FGF-signalling in the differentiation of mouse ES cells towards ...

PhD thesisCand.scient. Janny Marie Landegent PeterslundFGF-signalling in thedifferentiation of mouse ES cellstowards definitive endodermAcademic advisors:Dr. Berthe M. Willumsen, Department of Biology, Faculty of Science, University ofCopenhagen – DenmarkDr. Palle Serup, Department of Stem Cell Biology, Hagedorn Research Institute – DenmarkSubmitted March 2010"It is not birth, marriage, or death, but gastrulation,which is truly the most important time in your life."Lewis Wolpert (1986)

PrefaceThis thesis is based on experimental work performed in the Department of Stem Cell Biology(formerly the Department of Developmental Biology) at the Hagedorn Research Institute inGentofte – Denmark, from August 2006 to March 2010 (including an 8 month leave). Theproject supervisors were Berthe M. Willumsen, Professor at the Institute of Biology, Faculty ofScience, University of Copenhagen – Denmark, and Palle Serup, Ph.D., Scientific Director atthe Hagedorn Research Institute, Gentofte – Denmark. The work was supported by grants fromthe Juvenile Diabetes Research Foundation and the Beta Cell Biology Consortium, NationalInstitutes of Health – USA.This thesis is submitted in order to meet the requirements for obtaining the degree ofphilosophiæ doctor (Ph.D.) at the Faculty of Science, University of Copenhagen – Denmark.The thesis is based on two papers:Paper I:‘A late requirement for Wnt and FGF signaling during Activin-induced formation of foregutendoderm from mouse embryonic stem cells’Published in Developmental Biology, 2009; 330, pp. 286-304.Mattias Hansson, Dorthe R- Olesen, Janny M.L. Peterslund, Nina Engberg, Morten Kahn,Maria Winzi, Tino Klein, Poul Maddox-Hyttel and Palle SerupPaper II:‘FGFR(IIIc)-activation induces mesendoderm but is dispensable for definitive endodermformation in mouse embryonic stem cells’Manuscript to be submitted.Janny Marie L. Peterslund and Palle SerupIn addition, this thesis contains a general introduction to early mouse embryonic developmentand pancreas formation, directed differentiation of mES cells towards DE and pancreatic β-likecells, and FGF-signalling in relation to both development and differentiation. The reader willalso find a short chapter expanding on the patterning of definitive endoderm described in paperI and a general discussion of my work in relation to the research field as a whole.Janny Marie Landegent PeterslundMarch 2010III

ResuméSukkersyge er en sygdom der på verdensplan påvirker mere end 200 mio. mennesker.Transplantation med insulinproducerende β-celler anses for en mulig fremtidig kur modsukkersyge, men da antallet af donorer er begrænset er der brug for andre kilder tilcellemateriale. Embryonale stamceller (ESC’er) er pluripotente celler, hvilket betyder at de harpotentiale til at kunne differentiere til alle celle- og vævstyper i den voksne krop. De vil somsådan kunne være en ubegrænset kilde til in vitro-differentierede β-lignende celler. Detnærværende arbejde beskriver hvordan muse-ESC’er, der bruges som model for humaneESC’er, bliver induceret til at differentiere i de tidlige stadier mod β-lignende celler. Arbejdetfokuserer på fibroblast vækstfaktor (FGF)-signalering i forhold til dannelsen af mesendoderm,definitiv endoderm (DE) og ’posterior foregut endoderm’. Mesendoderm er en bipotentcellepopulation som kan differentiere til enten DE eller mesoderm ved activinA eller bonemorphogenetic protein (BMP). DE og ’posterior foregut endoderm’ er mere modne celletyperder senere danner bugspytkirtlen og β-celler.Dette arbejde er baseret på et serum- og feederfrit cellekultursystem og viser hvordan induktionaf mesendoderme celletyper med BMP4 eller forskellige activinA-koncentrationer afhænger afFGF-signalering. Blokering af FGF-signalering med opløselige FGF receptorer (FGFR’er) ellersmåmolekylære hæmmere hindrer dannelsen af mesendoderm, hvorimod tilsætning af en rækkeFGF’er øger dens dannelse. Mere præcist er det aktivering af FGFR(III)c (FGFRc)-isoformerder giver effekten, mens aktivering af FGFRb-isoformer ikke har nogen effekt. Dette stemmeroverens med udtrykket af især FGFRc-isoformer i tidlig differentiering af ESC’er. På denanden side reducerer høje FGF-koncentrationer antallet af mere modne DE celler, men aktivFGFR-signalering generelt er dog nødvendig for DE-dannelse.En FGF4 knockout cellelinje, der tidligere har vist sig ikke at kunne differentiere til ektodermog mesoderm kimlagstyper, kunne meget overraskende sagtens differentiere til DE udentilsætning af FGF4-protein. Den heterozygote cellelinje FGF4 +/– viser endda højere udtryk afDE markørgener end både vildtype og knockout cellelinjerne, hvilket tyder på at etmellemliggende niveau af FGF-signalering er fremmende for DE dannelse. Alt i alt tyder disseresultater på at DE opnås bedst i muse-ESC’er ved tidlig aktivering af FGFRc-isoformer imesendodermdannelse efterfulgt af FGFRc-aktivering under endogene niveauer.Endeligt afhænger en videre differentiering af DE cellepopulationen af retinoic acid og FGFsignalering,helst ved FGF7 og FGF10, der aktiverer FGFRb-isoformer. Enmiddelkoncentration af FGF resulterer i mange celler der udtrykker en ’anterior foregut’-markør, få celler der udtrykker en ’posterior foregut’ markør og ingen celler der udtrykker en’hindgut’-markør. Høje koncentrationer af FGF får DE til at danne ’hindgut’.Disse resultater giver ny viden om FGF-signalerings forskelligartede effekt på mesendoderm-,DE- og ’posterior foregut endoderm’-dannelse over tid. Det vil sandsynligvis være værdifuldtfor slutmaterialet, nemlig β-lignende celler, at overføre denne viden til nuværendedifferentieringsprotokoller.V

VIII

Table of contents1

AbbreviationsAP1 activator protein 1AIPanterior intestinal portalAKTakt; protein kinase BALK4 activin receptor-like kinase 4A-Panterior-posteriorAVEanterior visceral endodermBMPbone morphogenetic proteinBSAbovine serum albuminCdx2 Homeobox transcription factor Cdx2CIPcaudal intestinal portalCxcr4 Chemokine (C-X-C motif) receptor 4DAPI 4′,6-diamidino-2-phenylindoleDEdefinitive endodermDkk1 Dickkopf 1DTTdithiotreitolEembryonic dayEBembroid bodyEdU5-ethynyl-2’-deoxyuridineEpCAM epithelial cell-adhesion moleculeEpiSC epiblast stem cellEPLearly primitive ectoderm-likeERK1/2 extracellular signal-regulated kinase1/2ESembryonic stemEvx1 Even-skipped homeobox homolog 1ExEextra-embryonic ectodermFACS fluorescence-activated cell scannerFGFfibroblast growth factorFGFR fibroblast growth factor receptorFGFRb/c fibroblast growth factor(IIIb)/(IIIc)Flk1 Fetal-like kinase 1Foxa2 Forkhead transcription box 2GAPDH glyceraldehyde 3-phosphate dehydrogenaseGATA6 GATA-binding protein 6GFPgreen fluorescent proteinGp130 glycoprotein 130GscGooseciodGSK3 glycogen synthase kinase 3hES cells human embryonic stem cellsHesx1 Homeobox expressed in ES cells 1HexHematopoietically expressed homeoboxHlxb9 Homeobox transcription factor HB9HSheparin sulfate3

ICMinner cell massIdInhibitor of differentiationiPSinduced pluripotent stemJAKJanus kinaseJDRF Juvenile diabetes research foundationLIFleukemia inhibitory factorMAPK Mitogen-activated protein kinasem-Cer1 mouse-Cerberus 1MEK a MAP kinasemES cell s mouse embryonic stem cellsMHC major histocompatability complexMixl1 Mix1 homeobox-likeNgn3 Neurogenin 3Nkx6.1 NK homeobox transcription factor 6.1Oct4Octamer-4Otx2 Orthodenticle homeobox 2PCRpolymerase chain reactionPDGFR platelet-derived growth factor receptorPdx1 Pancreatic and duodenal homeobox factor 1PEparietal endodermPLCγ phospholipase CγPPpancreatic polypeptide-producingPI3Kphosphoinosityl 3 kinasePtf1aPancreas-specific transcription factor 1aqPCR quantitative polymerase chain reactionRAretinoic acidRT-PCR reverse transcriptase- polymerase chain reactionS.D.standard deviationS.E.M. standard error of the meanShhSonic hedgehogSMAD proteins modulating the activity of TGFβ ligands; the name is a combination ofthe protein homologs ‘SMA’ (C. elegans) and ‘mosthers againtsdecapentaplegic’ (D. melanogaster)SoxSex determining region Y (SRY)-related HMG boxSPRED Sprouty-related EVH1 proteinSTAT3 signal transducer and activator of transcription 3TBrachyuryTBPTATA-binding proteinTdhThermostable direct hemolysin geneTEtrophectodermTGFβ Transforming growth factor βVEvisceral endodermWHO World Health OrganizationWNT3(a) wingless-type MMTV integration site 3(a)4

1. General introductionDiabetes mellitusDiabetes mellitus (diabetes hereafter) is caused by a lack of insulin-production or insulinresponsiveness,resulting in high blood glucose levels in the patient. There are two types ofdiabetes, type I and type II, resulting in an absolute or a relative lack of β cells, respectively(Donath and Halban 2004). Type II is the most common form of diabetes, accounting for 90 –95% of all cases. The World Health Organization (WHO) estimated a worldwide prevalence of171 million diabetics in 2000 and the prognosis is 336 million people by the year 2030, calling it apandemic. In Denmark alone, 226.000 people (or 5% of the total population) had diabetes in 2006and it is estimated that the Danish health care system spends DKK 22 billion (or app. US$ 4billion) per year on treatment of diabetes and diabetes-related illness (Juvenile Diabetes ResearchFoundation homage). Furthermore, it is estimated that the disease costs Denmark an extra DKK 9billion per year due to loss-of-production.In type I patients, the disease is a result of an auto-immune attack on the insulin-producing β cells,resulting in the loss of β cell mass, followed by dependence on insulin-treatment for the patient(see (Lernmark and Falorni 1998; Madsen 2005) for reviews). This dependency is life-long, as theβ cell mass does not regenerate to levels where it can sustain the body’s need for insulin. Theonset of type I diabetes is due to genetic and/ or environmental factors, but a comprehensiveknowledge of the aetiology of the disease is still lacking despite intense studies thereof. Alongwith the primary disease which is treated with insulin injections, patients develop severesecondary complications such as blindness, kidney failure, and amputations due to chronicvascular defects caused by their blood-glucose levels being irregular and difficult to stabilize.In type II patients, a gradual insulin resistance of the peripheral tissues leads to an increase in βcell mass as a compensation for this condition (Rhodes 2005). This condition is partly reversible,but will ultimately lead to type I diabetes and insulin-dependence if not treated. Type II diabetes ismainly caused by genetic predisposition and environmental factors such as obesity, physicalinactivity, excessive calorie intake and aging (Ling and Groop 2009).Cell replacement therapy in diabetesAlthough there is no cure for diabetes at present, research focusing on therapeutic treatment isenvisioned as a palliative treatment or maybe even a cure for the disease. This section will focuson therapies directed against type I diabetes.In 2000, Shapiro and co-workers published the Edmonton protocol, as it is now referred to,providing proof of principle for curing diabetes by transplanting donor islets of Langerhans andre-establishing eu-glycaemia in seven patients suffering from type I (Shapiro et al. 2000).However, 85% of islet recipients needed insulin treatment after a 5-year period (Ryan et al. 2005).The obstacles of auto-immunity along with the scarcity of islet donor material, has directed focustowards other sources of β cell material to put to use in a similar treatment.In type I diabetics, there is evidence of a continuous β cell regeneration taking place (Meier et al.2005). However, attempts to regenerate the β cell mass are most likely overruled by the autoimmuneattack, the gross result being no insulin-production from the islets of Langerhans. Thereis evidence that β-cells can be generated from existing cells, but it is unclear whether this isthrough replication of existing β cells or by re-differentiation of other pancreatic cells such as ductcells or even from hepatic cells (Bouwens and Pipeleers 1998; Yang et al. 2002a; Dor et al. 2004;Hardikar 2004; Xu et al. 2008; Borowiak and Melton 2009). It is debated whether the pancreashosts a pancreatic endocrine stem cell that can be stimulated to proliferate (Madsen 2005). Bypartial pancreatectomy or cellophane wrapping of the pancreas, it has been demonstrated that β5

cell mass regenerates probably through an ability to ‘sense’ the total mass of insulin-producingcells and self-regulate accordingly (Hardikar 2004). Still, the success of these studies is low andsuch treatments will probably not be sufficient for curing diabetes.Replacement therapy by external sources of β-like cells holds the potential of an infinite supply ofdonor material for transplantation. The initial cell material may come from either somatic (oradult) stem cells or embryonic stem (ES) cells, or may in time come from patient-specific inducedpluripotent (iPS) cells. These cell types are described in detail in a later section.The immune system represents a major obstacle when discussing cell replacement-therapies.Patients would either have to be put on a life-long treatment of immune-suppressive drugs, withmany complications to follow, or other methods will have to be developed to overcome the attackof cell material by the recipient immune system (Rossini et al. 1999). Encapsulation of therapeuticcells is one such method. Despite limitations in nutrient supply to and transport of effectermoleculesfrom the transplanted cells, studies in rat show that they can convey normo-glycaemiain steptozotocin-induced diabetic rats (Omer et al. 2005). Another possibility is induction ofimmunological tolerance (mixed chimaerism), which has been shown possible by bone-marrowtransplantation in mice (Rossini et al. 1999; Blaha et al. 2005).Embryonic developmentTo appreciate the challenges of directed in vitro differentiation of ES cells, one must acquire athorough understanding of embryonic development. In this thesis, focus will be on mousedevelopment from zygote to pancreatic β cells, especially concentrating on the early development,as the work presented here is on mouse ES cell differentiation in the early steps towards β-likecells.From zygote to blastocystThe fertilized egg, the zygote, is a totipotent cell from which all tissues of the embryo proper, thegerm line and extra-embryonic tissues arise. In mice, the zygote moves into the uterine tract of thefemale and matures along the way. By embryonic day 3.5 (E3.5), it has developed into an ovalstructure, the blastocyst, consisting of an inner cell mass (ICM) at one end and the blastocoel atthe other end. The ICM gives rise to i) the epiblast (also called the primitive ectoderm), which willlater form the embryo proper and ii) facing the blastocoel, the primitive endoderm, which willgive rise to the visceral and parietal endoderm (PE), forming parts of the yolk sac and uterine walllining, respectively (Gardner 1983; Rossant 2004). Surrounding these structures is thetrophectoderm (TE), which will develop into the foetal parts of the placenta, the chorion. At E4.5the blastocyst implants into the uterine wall, gaining access to maternal blood vessels and therebya supply of nutrients and oxygen.The ICM expresses Octamer-4 (Oct4; encoded by Pou5f1), which is down-regulated in the TE(Nichols et al. 1998) and Nanog, which is maintained in the epiblast but down-regulated in the PE(Mitsui et al. 2003). Oct4 –/– and Nanog –/– embryos die due to a failure to form the ICM or theepiblast, respectively. Also, Sex determining region Y (SRY)-box 2 (Sox2) is present in the ICM,possibly as remnants of maternally deposited protein (Avilion et al. 2003). It is expressed by theembryo in the later epiblast and TE, where it, together with OCT4 and nanog inducestranscription of pluripotency-associated genes. The TE expresses Cdx2, a homeobox transcriptionfactor, which is required to form the placenta and to suppress transcription of Oct4 and Nanog(Chawengsaksophak et al. 2004; Strumpf et al. 2005). The PE expresses GATA-binding protein 6(GATA6; (Morrisey et al. 1998)). Recent studies have shown that cells in the ICM express bothnanog and GATA6 proteins prior to segregation into either epiblast or PE cells in a mosaic pattern(Chazaud et al. 2006). It is the expression level of fibroblast growth factor (FGF) that regulateseach cell’s fate in such that low levels of FGF generate epiblast cell formation and high levels ofFGF generate PE formation (Yamanaka et al. 2010). At this early stage, FGF4 and FGF receptor 1(FGFR1) are expressed in the ICM and knockout mice of both genes die prior to or at gastrulation(Deng et al. 1994; Yamaguchi et al. 1994; Feldman et al. 1995). Fgf4 expression is activated by6

SOX2 and OCT4. Later, the PE and epiblast transiently express Fgf5 (Haub and Goldfarb 1991;Hebert et al. 1991).Gastrulation and germ-layer formationAt E5.5 the epiblast is formed as a cup-like structure surrounded by the visceral endoderm (VE)which patterns the epiblast and initiates gastrulation (Figure 1-1A; (Rossant 2004)). It is at theposterior, proximal part of this cup that the primitive streak (PS) forms around E6.5 from where itstarts to migrate distally (Figure 1-1A). There is an anterior-posterior (A-P) patterning of theepiblast prior to gastrulation. Onset of PS formation is initiated by a gradient of the transforminggrowth factor β (TGFβ)-family member nodal and wingless-type MMTV integration site 3(WNT3) signalling from the posterior epiblast. Nodal generates a proximal-to-distal gradient andWNT3a forms a posterior-to-anterior gradient (Liu et al. 1999; Ben-Haim et al. 2006; Arnold andRobertson 2009). The nodal gradient moves distally, forming the PS along the way and finallyends at the distal-most part of the embryo, the node (Gadue et al. 2005). At the late streak stage,nodal expression is only found in the node where it forms a distal-to-proximal signal gradient. TheWNT3 expression pattern is restricted to the posterior epiblast during PS-formation. At the sametime, the TGFβ family member bone morphogenetic protein 4 (BMP4) from the extra-embryonicectoderm (ExE) signals to the adjacent epiblast. Thereby a proximal-to-distal signal gradientopposing that of nodal is formed (Lawson et al. 1999). The shape of these morphogeneticgradients is modulated by the reciprocal expression of antagonists or inhibitors, these being leftyand cerberus-like inhibiting nodal-signalling, dickkopf-related protein 1 (DKK1) inhibitingWNT3-signalling, and chordin and noggin inhibiting BMP4-signalling (Gadue et al. 2005).Thereby, the extension of the PS is restricted to the posterior side of the embryo.The primitive streak expresses the T-box transcription factor Brachyury (T) in migrating cells ofthe PS and Mix1 homeobox-like (Mixl1), along with Even-skipped homeobox homolog 1 (Evx1)(Figure 1-1A; (Bastian and Gruss 1990; Dush and Martin 1992; Kispert and Herrmann 1994; Nget al. 2005)). Goosecoid (Gsc) is expressed in the progressing PS and localises to the anteriorstreak (Blum et al. 1992).7

Figure 1-1: Early embryo development from blastocyst stage to development through the primitive streak. A)Schematic representation of mouse embryonic development and signal gradients of BMP4, WNT, and nodal fromblastocyst to late-streak stages. The red line in the late streak-stage embryo marks a cross-section, which is shown inB). Names of marker genes expressed in a tissue-type are noted in brackets. B) Cross-section of embryo illustratinghow epiblast cells (in blue) move through the PS and form the definitive endoderm (DE) germ layer (in yellow)displacing the visceral endoderm (VE; in green). In between the DE and epiblast/ ectoderm, the mesoderm germ layer(in red) forms. Ant, anterior; AVE, anterior visceral endoderm; DE, definitive endoderm; Dist, distal; ExE, extraembryonicectoderm; ICM, inner cell mass; Post, posterior; Prox, proximal; PS, primitive streak; VE, visceralendoderm. Modified from (Gadue et al. 2005; Wolpert 2002).Cells start gastrulation by undergoing an epithelial-to-mesenchymal transition, enabling them tomove through the PS (Figure 1-1B, cross-section of the PS). FGF3, 4 and 8 are present in the PSand FGF4 and 8 are required for gastrulating cells to leave the PS (Sun et al. 1999). From chickenstudies it is suggested that FGF4 and 8 act as a chemo-attractant and a chemo-repellent,respectively on the migrating cells, driving cell movements after ingression through the PS(Wilkinson et al. 1988; Hebert et al. 1991; Niswander and Martin 1992; Sun et al. 1999; Yang etal. 2002b; Bottcher and Niehrs 2005). When cells have moved through the PS, they become eitherdefinitive endoderm (DE), displacing the visceral endoderm, or mesoderm forming anintermediate germ layer between the DE and the epiblast (Lawson et al. 1991; Tam et al. 1993;Carey et al. 1995). The remaining cells of the former epiblast become the ectoderm germ layer.Cells moving through the mid- and posterior PS early become different types of mesoderm,including some extra-embryonic mesoderm, influenced by BMP4 and low concentrations ofnodal (Parameswaran and Tam 1995; Kinder et al. 1999). The mesoderm expresses Fetal-likekinase 1 (Flk1) along with Noggin and Chordin. DE is formed from the anterior regions of the PS,influenced mainly by high concentrations of nodal. Here, Forkhead box A2 (Foxa2) is expressedduring gastrulation and is later found in the DE (Tam and Beddington 1992; Robb and Tam2004). A specific marker for the DE germ layer at this stage is the Sry-related HMG box gene 17(Sox17), which is not expressed in the other two germ layers, but is found also in the VE (Kanai-Azuma et al. 2002). The VE expresses the Sry-related HMG box gene 7 (Sox7), which is notfound in DE (Futaki et al. 2004; Seguin et al. 2008). DE cells migrating through the PS earlyduring gastrulation populate the anterior parts of the endoderm, the later foregut, and cells leavingthe PS late in gastrulation populate the posterior endoderm, the later hindgut (Tam andBeddington 1992).Gut tube patterning and regionalizationBy the end of gastrulation around E7.5 in the mouse, the embryo contains two major signallingcentres, the anterior VE (AVE) and the node. The AVE is found at the anterior side of the embryo(Figure 1-1A) and acts to restrict the PS structure and is involved in the head fold (Wells andMelton 2000). The node is found in the distal-most part of the embryo cylinder, the anterior limitof the PS, from where it directs DE patterning among other activities.The DE is patterned along the A-P axis through interactions with the anterior ectoderm, cardiacmesoderm, and notochord to form the anterior gut tube and with the node, lateral plate mesodermand PS to form the posterior gut tube (Wells and Melton 1999; Wells and Melton 2000). At E7.5anterior and posterior gut tube can be distinguished from one another not only by theirlocalization in the embryo, but also by their expression of marker genes. Mouse-Cerberus 1 (m-Cer1), Orthodenticle homeobox 2 (Otx2), Hematopoietically expressed homeobox (Hex) andHomeobox expressed in ES cells 1 (Hesx1) are expressed anteriorly and Cdx2 and certainmembers of the Hox family are expressed posteriorly. Dividing the forming gut tube into fourregions can illustrate how they re-localize to form the proper gut tube (Figure 1-2A&B; E8.5):Region I, the most anterior part, seems to fold over region II and form the ventral foregut, givingrise to the lungs, stomach, liver and ventral pancreas. Region II gives rise to the oesophagus,stomach, duodenum and dorsal pancreas. Similarly, region IV seems to fold over region III,giving rise to posterior trunk endoderm and hindgut, forming the large intestine. Region III givesrise to the midgut and trunk endoderm, forming the small intestine (Wells and Melton 1999).Closure of the gut tube happens as the anterior intestinal portal (AIP) and caudal intestinal portal8

(CIP) move rostrally (arrows in Figure 1-2A&B). Around E8.5 – E8.75 the embryo starts to turnso that the endoderm becomes situated on the inside, and the ectoderm on the outside of thedeveloping organism.Figure 1-2: Formation, folding and branching of the gut tube. A) The endoderm (yellow and light green) separatedfrom the mesoderm (red), ectoderm (blue) and PS (pink) in an E7.5 embryo. Roman numerals I–IV represent regionsof E7.5 endoderm that fate map to regions I–IV of the E8.5 gut in B). B) The forming gut tube (yellow) is seperatedfrom the remaining embryo. The foregut tube forms as region I folds over region II and migrates in a posteriordirection, whereas the hindgut tube forms when region IV folds over region III and migrates in an anterior direction(arrows in A). C) The formation of organ buds in a E10.5 embryo. D) Branching and maturation of the pancreas. A,anterior; AIP, anterior intestinal portal; CIP, caudal intestinal portal; D, dorsal; d. Panc, dorsal pancreatic bud; int,duodenum/intestine; Lu, lung; Li, liver; P, posterior; PS, primitive streak; St, stomach; V, ventral; v. Panc, ventralpancreatic bud. Modified from (Wells and Melton 1999).Instructive signals from the adjacent germ layers specify the A-P regions of the gut tube. Theanterior part of the gut tube has been shown to adopt a more posterior fate when exposed toposterior mesoderm or ectoderm in mouse embryos (Wells and Melton 2000). This has beensupported by studies in chicken, where anterior endoderm changes to a more posterior fate whentransplanted to a posterior site, but it cannot change to a more anterior fate when transplantedthere (Kumar and Melton 2003). These studies showed that increasing concentrations of FGF4and retinoic acid (RA) posteriorize the gut tube in mouse and chicken (Wells and Melton 2000;Dessimoz et al. 2006; Bayha et al. 2009). In the chick embryo BMP, activinA (a surrogate fornodal) and RA signalling could induce expression of the pancreatic foregut marker Pancreaticand duodenal homeobox 1 (Pdx1) in endoderm anterior to the pancreas (Kumar and Melton2003). Thus, signals originally implicated in the A-P specification of the neural tube were shownto have a similar function in the endoderm. The mouse gut tube can be specified by regionalmarkers, including Foxa2 expressed throughout the gut tube; Sox2 expressed in the thyroid,trachea and stomach regions; Pdx1 expressed in the duodenal and pancreatic regions; and Cdx2expressed in the posterior gut tube (as exemplified by the chicken cartoon in Figure 1-3; chickenCdxA = mouse Cdx2).9

Figure 1-3: Regional expression of transcription factors in the endoderm. Although their expression is here mappedin the chicken embryo, their homologs are expressed in a similar regional manner in the mouse. The transcriptionfactors shown on the left, mostly homeobox genes, are mapped to specific regions of the endoderm, as shown on theright.. These genes are not only regionally expressed in already shaped organs (as shown in the E4 chicken gut tube),but also in the endodermal sheet prior to organ formation, with stable expression domains that can be used as markersof presumptive regions. The top left pink triangle shows Hex expression in the thyroid. The bottom left triangle refersto pancreas bud and the bottom right triangle to liver bud. BA1–4, branchial arches 1–4; Chicken CdxA = mouseCdx2. Modified from (Grapin-Botton and Melton 2000).Pancreas and β cell formationPdx1 is expressed in the region of the gut tube where the pancreatic primordia start to bud aroundE8.75 (Figure 1-2C) and all pancreatic cell types derive from this PDX1-positive (PDX1 +hereafter) domain (Jonsson et al. 1994). The ventral and dorsal buds form from the midline andlateral areas of the PDX1 + gut, respectively, then grow and branch extensively before fusing tobecome one pancreas by E12.5 (Figure 1-2D; (Jorgensen et al. 2007)). The ventral bud precedesthe dorsal bud and expresses the Homeobox transcription factor HB9 (Hlxb9) and Pdx1concomitantly whereas the dorsal bud expresses these sequentially and exclude sonic hedgehog(SHH)-signalling (Hebrok et al. 1998). SHH repression allows pancreatic budding in this regionand is determined by the underlying notochord. Expression of the Pancreas-specific transcriptionfactor 1a subunit (Ptf1a; or p48) is limited to the dorsal and ventral epithelium and is coexpressedwith Pdx1. The ventral pancreas develops in close association with the adjacent hepaticand bile duct endoderm and restriction of the ventral pancreas is dependent on TGFβ (SMAD2/3),BMP (SMAD1/5/8) and FGF-signalling from the cardiac mesoderm (Deutsch et al. 2001; Rossi etal. 2001). TGFβ-signalling is stable whereas FGF and BMP-signalling are dynamic and canchange within a few somite stages (Wandzioch and Zaret 2009). The dorsal pancreas does notshow active BMP or FGF-signalling at this stage, but rather is specified by dynamic TGFβ-10

signalling. These dynamic signalling cascades possibly determine the boundaries of pancreaticendoderm, i.e. expression of Pdx1, and the closely related liver endoderm.As the pancreatic buds grow and branch, the surrounding mesenchyme secretes FGF10, whichstimulates pancreatic epithelial proliferation. This mesenchymal stimulation is absolutelynecessary for maintenance of Pdx1 expression and pancreatic development, as FGF10 –/– show noPdx1 expression at E10.5 (Bhushan et al. 2001). The epithelial expression of Pdx1 and NKhomeobox transcription factor 6.1 (Nkx6.1) starts to deviate into NKX6.1 + cells found only in thecentral part of the epithelium, whereas PDX1 + /NKX6.1 – cells are found at the periphery and atE13.5 mark the acini (Jorgensen et al. 2007). These acini become the exocrine part of the pancreasthat produces and secretes digestive enzymes into the connecting ducts, releasing them to theintestine (Slack 1995). Neurogenin 3 (NGN3) + endocrine precursors delaminate from theepithelium and develop into Paired box gene 6 (Pax6)-expressing endocrine cells which form theislets of Langerhans. The endocrine cells in these islets produce hormones, which they secrete tothe bloodstream. Islets consist of five cell types: α cells producing glucagon; β cells producinginsulin; δ cells producing somatostatin; ε cells producing ghrelin and PP cells producingpancreatic polypeptide. These islets have a distinct morphology, with the β cells in the centre andthe other cell types at the periphery.Mouse ES cells in directed differentiationThe initial cell population used to generate β-like cells for cell replacement therapy may comefrom either somatic (or adult) stem cells or from ES cells. Somatic stem cells are mono- ormultipotent cells residing in most tissues and organs of the post-natal human. They are used in thetreatment of leukaemia and other haematological malignancies through bone-marrowtransplantation. Additional areas under investigation include treatment of strokes, myocardialinfarctions, corneal regeneration and epidermal gene therapy (Pellegrini et al. 2009; McCall et al.2010). There is no definitive evidence of a somatic stem cell in the pancreas and thus the focus ofcell replacement-therapy for diabetes is currently on ES cells (Madsen 2005).ES cells are pluripotent cells, i.e. they can give rise to all tissues of the embryo proper (Ohtsukaand Dalton 2008). They are isolated from the inner cell mass of a blastocyst stage embryo andunder the right culture conditions they can multiply indefinitely, while keeping their pluripotentphenotype (Evans and Kaufman 1981; Martin 1981; Ying et al. 2003a). They hold great potentialdue to their pluripotent nature, but as yet, no protocol applicable to human treatment has beendeveloped.Modelling differentiation using mouse ES cellsMouse ES (mES) cells are used for the study of directed differentiation towards definitiveendoderm, pancreatic foregut and ultimately β-like cells because they have certain advantages.Working with mES cells holds fewer ethical concerns than working with human ES (hES) cellsand there are many available tools, such as transgenic mES cell lines which can be used to testhypotheses that cannot be otherwise experimentally tested. Also, mouse embryonic developmentclosely mimics human embryonic development, suggesting that conclusions may be extrapolatedand applied to the human system. But in using mES cells for scientific purposes, it is important tobear in mind that the end product will always be a cell therapy based on hES cells, and findingswill therefore always have to be confirmed in this system. The sections below will focus on mEScells with examples from hES cell work where relevant.Derivation of mESCsThe first mES cells were derived almost 30 years ago and the first hES cell line was derived 12years ago (Evans and Kaufman 1981; Martin 1981; Thomson et al. 1998). mES cells (ES cellshereafter) are used either for generation of transgenic mice or for culturing and differentiation of(transgenic) cell lines. Mouse ES cells are derived from the ICM of the E3.5 blastocyst. They aregrown on feeder cells in the presence of serum and leukemia inhibitory factor (LIF), whichmaintains them pluripotent.11

The pluripotent stateThe pluripotency of ES cells along with their capability to self-renew indefinitely are the mostimportant characteristics of ES cells. The pluripotent state is characterised morphologically bytightly associated cells growing in rounded clusters. Molecularly, they are characterised by theexpression of markers, some of which are found also in the ICM of the developing embryo. Themost commonly used are Oct4, Nanog, Stage specific embryonic antigen-1 (SSEA-1), Sox2 andAlkaline phosphatase (Solter and Knowles 1978; Pease et al. 1990; Nichols et al. 1998; Avilion etal. 2003; Chambers et al. 2003; Mitsui et al. 2003). To test if ES cells have maintained theirpluripotency over time when in culture, they are evaluated in several ways, each providing a morestringent test but at the same time taking more resources. They can be evaluated by i)morphology; ii) a positive stain with antibodies for the pluripotent markers; iii) subcutaneousinjection in mice and formation of teratomes with cells of all three germ layers; iv) injection intothe ICM of a developing embryo where they give rise to chimaeras with contributions to tissues ofall three germ layers and the germ line (Ohtsuka and Dalton 2008). The last test is considered the‘golden standard’ but is time-consuming and is therefore not routinely carried out except in theestablishment and analysis of newly generated transgenic cell lines or by investigating whether acertain (manipulated) ES cell line is entirely pluripotent.Maintaining the pluripotent state in an ES cell culture is done through prevention ofdifferentiation (or induction of self-renewal properties) and promotion of proliferation. LIF isadded to the culture medium of pluripotent ES cells and is the main factor involved in keepingcells pluripotent (Figure 1-4A). It activates the JAK/STAT3-signalling pathway, resulting intranscription of genes involved in self-renewal, one of these being C-myc (Niwa et al. 1998;Cartwright et al. 2005). LIF also activates the important Phosphoinositol 3 kinase (PI3K), leadingto activation of Ras/ mitogen-activated protein kinase (MAPK) and AKT pathways. The latter isinvolved in relief of C-myc repression by glycogen synthase kinase-3 (GSK-3), which seems to bevery important in maintaining self-renewal capability (Umehara et al. 2007). BMP is a secondimportant factor for maintaining self-renewal, its effect possibly depending on the cultureconditions in which it acts (Ohtsuka and Dalton 2008). BMP activates SMAD1/5/8-signallingleading to expression of Inhibitor of differentiation (Id)-genes which block at least neuraldifferentiation (Figure 1-4A; (Ying et al. 2003a)). BMPs also act by suppressing the p38 MAPK,which would otherwise promote differentiation (Qi et al. 2004; Kunath et al. 2007). FGF4 isexpressed in pluripotent ES cells in an autocrine fashion and the activation of the ERK1/2-signalling cascade by FGF must be suppressed in order to maintain cells in the plupipotent state(Ma et al. 1992; Kunath et al. 2007; Nichols et al. 2009). The LIF-gp130 receptor complex sees tothis.12

Figure 1-4: Key signalling pathways required for maintaining pluripotency and for directed differentiationinto the three germ layers. A) LIF signalling activates JAK–STAT3 and PI3K pathways to induce target genesessential for pluripotency. BMP signals activate SMAD1/5/8-Id gene and suppress p38 MAPK. Activin/ nodalhave been shown to contribute mESCs proliferation but not pluripotency. B) Illustration of signallingdemonstrated induce to ES cell self-renewal and germ layer specification, through the EPL-state. BMP, bonemorphogenetic protein; EPL, early-primitive ectoderm-like; ESCs, embryonic stem cells; FGF, fibroblast growthfactor; ICM, inner cell mass; LIF, leukemia inhibitory factor. Modified from (Ohtsuka and Dalton 2008; Gadueet al. 2005).Recent studies have suggested that epigenetic processes are required for repression ofdevelopmental pathways through the actions of e.g. polycomb-group complex proteins. Howimportant epigenetic control and regulation of the pluripotent state is compared to the addition ofgrowth factors and cytokines is yet to be determined (Niwa 2007).Growing ES cells as a pluripotent culture can be done on a feeder-layer of e.g. mouse embryonicfibroblasts in the presence of serum and LIF. Here, serum contains BMP and feeder cells may besubstituted entirely by LIF, which they contribute to the culture condition (Smith et al. 1988; Yingand Smith 2003). Alternatively, pluripotent ES cells can be maintained in feeder-free serumreplacement media containing LIF, where N2, B27 and BMP4 are added to replace serum ingeneral, and BMP in particular (Ying et al. 2003a).Directed differentiation of ES cellsRemoval of LIF (and BMP4) initiates differentiation of ES cells by increasing ERK activity.FGF5 is up-regulated and pluripotency markers are down-regulated along with PI3K and AKTsignallingpathways (Rathjen et al. 1999; Ohtsuka and Dalton 2008). Intact FGF4-signalling hasbeen shown to be necessary for initiation of differentiation for at least ectoderm and, lessconvincingly, mesoderm lineages (Kunath et al. 2007). As little as a 24-hour pulse of ectopic13

There are four membrane-bound FGFRs consisting of three Ig domains (domains I – III) on theextracellular side and of two tyrosine kinase domains on the intracellular side of the cell surface.The Ig-domains convey FGF-binding, determine FGF ligand selectivity (domain III) and interactwith HS (Bottcher and Niehrs 2005). The C-terminal half of Ig-domain III in FGFR1-3demonstrates alternative splicing of exon 7 to either exons 8 or 9, generating FGFR(III)b orFGFR(III)c isoforms, respectively (FGFRb or FGFRc hereafter; Figure 1-6C; (Johnson andWilliams 1993; Groth and Lardelli 2002; Eswarakumar et al. 2005)). The expression of specificFGFR-isoforms is tissue-specific, meaning ligand-receptor interactions can be regulated acrosstissues, giving a high range of interaction-potential to modulate downstream signalling pathwaysand gene expression. The intracellular kinase domains are responsible for tyrosine kinase activityleading to auto-phosphorylation and recruitment of downstream signalling components elicitingthe cellular response to ligand binding. FGFR4, which has no splice variants, resembles FGFRcisoformsboth structurally and in FGF binding-affinities (Vainikka et al. 1992).A secreted third isoform, FGFR1-3(III)a lacks the trans-membrane and intracellular kinasedomains, and although they are present in blood, their function is somewhat unclear (Johnson etal. 1990; Johnson et al. 1991; Johnson and Williams 1993; Hanneken 2001).Figure 1-6: The evolution of the FGF family, binding of FGF to FGFR and alternative splicing of the FGFR. A)The evolutionary relationships within the fibroblast growth factor (FGF) gene family. The twenty-two FGF encodinggenes are arranged into seven subfamilies. Branch lengths are proportional to the evolutionary distance between eachgene. FGF19 is the human ortholog of mouse FGF15. The FGF11 subfamily is also referred to as the intracellularFGFs (iFGFs), and the FGF15 (FGF19) family as the hormone-like FGFs (hFGFs). B) Ribbon diagram of the ternaryFGF2/heparin/FGFR1 complex showing FGF2 in yellow, D2 and D3 domains of the ligand-binding portion ofFGFR1 in green and blue, respectively, and heparin in red. C) The two isoforms of FGFR1-3 are generated by17

alternative splicing of exons 8 and 9. The C-terminal half of the DIII domain is encoded by exon 8 to generate theFGFR(III)b isoforms while the C-terminal half of DIII is encoded by exon 9 to generate the FGFR(III)c isoforms.Modified from (Itoh and Ornitz 2004; Eswarakumar et al. 2005).HS, downstream signalling pathways and regulationHeparan sulfates (HSs) are proteoglycans consisting of repeated subunits of D-glucosamine anddisaccharides and are embedded in the extracellular matrix on the cell surface. Mutations in genesinvolved in the synthesis or modulation of HS results in developmental defects in mice, mostlikely due to impaired FGF-signalling (Bullock et al. 1998; Ornitz 2000; Kraushaar et al. 2010)).HS stabilizes FGFs to thermal denaturation, proteolysis and limit their diffusion and release tointerstitial spaces (Moscatelli 1987; Flaumenhaft et al. 1990). This leads to increased 1:1FGF:FGFR complex formation which then results in a transient receptor dimerization andsignalling from this 2:2 FGF:FGFR complex (Figure 1-6B; (Hsu et al. 1999; Plotnikov et al.1999; Pye and Gallagher 1999)).Intracellular phosphorylation of the kinase-domains leads to activation of intracellular signaltransduction pathways. Most commonly, the Ras/MAPK pathway is activated upon FGFsignalling,but also the PLCγ/Ca 2+ and PI3K/AKT pathways are activated (Bottcher and Niehrs2005). For activation of the Ras/MAPK pathway, FRS2 is recruited and forms a complexactivating Ras. Pathway activity ultimately leads to nuclear translocation of MAPK and activationof target genes, such as AP1, c-myc and ETS transcription factors (Wasylyk et al. 1998).Activation of PLCγ leads to intracellular release of Ca 2+ and activation of phosphokinase C (PKC;(Pawson 1995)). Finally, activation of PI3K through either direct interaction with the FGFR or bycomponents of the Ras/ MAPK pathway leads to activation of AKT (Carballada et al. 2001).FGF-signalling is regulated by members of the sprouty and sprouty-related EVH1 protein(SPRED) families by a feedback mechanism that regulates MAPK-signalling through receptortyrosine kinase binding (Hacohen et al. 1998; Lim et al. 2002). Furthermore, FGF-activity ismodified through a tight regulation of HS-synthesis and certain transmembrane regulators (SEFand FLRT), which interrupt FGF-FGFR complex formation or downstream signalling (Bottcherand Niehrs 2005). Synthetic small molecules such as SU5402 and PD173074 inhibit most FGFRsignallingwith some or little secondary effects, respectively (Mohammadi et al. 1997;Mohammadi et al. 1998).To date, the role of FGF-FGFR signalling in directed differentiation towards cell types of theendoderm germ layer has been investigated as a general activation or inhibition of FGF-FGFRsignals. The role of individual FGF- and FGFR family members in differentiation towards DEremains to be elucidated.18

2. AimsThe aim of this study was to investigate the role of FGF-signalling in directed differentiation ofmouse ES cells towards i) mesendoderm formation, and ii) definitive endoderm formation andpatterning.We applied a mono-layer, serum-free culture system in which differentiation of mouse ES cellstowards mesendoderm was achieved by addition of BMP4 and a range of activin-concentrationsto the culture medium. Formation of definitive endoderm was reached using high concentrationsof activin and further patterning hereof was done using various growth factors and inhibitors. Weinvestigated the influence of FGFs on this system by addition of a range of FGFs, small moleculeFGF-inhibitors and soluble FGFRs. We analysed the resulting cell populations by using greenfluorescent protein (GFP)-linked reporter cell lines and knockout cell lines, immunecytochemistry,RT-PCR and qPCR.19

3. Paper IA late requirement for Wnt and FGF signaling during activin-induced formationof foregut endoderm from mouse embryonic stem cellsPublished in Developmental Biology, 2009, 330, p. 286 – 304.Mattias Hansson a,1 , Dorthe R- Olesen a,b,1 , Janny M.L. Peterslund a , Nina Engberg a , MortenKahn a,b , Maria Winzi a , Tino Klein a , Poul Maddox-Hyttel b and Palle Serup a, *a Department of Developmental Biology, Hagedorn Research Institute, Niels Steensens Vej 6,DK-2820 Gentofte, Denmark. b Department of Animal and Veterinary Basic Sciences, Faculty ofLife Sciences, University of Copenhagen, DK-1870 Frederiksberg C, Denmark. 1 These authorscontributed equally to this work. * Corresponding author.Author contributionsThe majority of the experiments were performed in collaboration between Mattias Hansson andDorthe R. Olesen with equal contributions. I worked on the effect of FGF-signalling upon foregutendoderm formation, and in collaboration with Nina Engberg looked at the further patterning ofactivin-induced definitive endoderm towards Pdx1-expressing pancreatic endoderm. The paperwas published in Developmental Biology, issue 330, 2009. Stated below is each individual’scontribution to the paper (numbers indicate figures).Mattias Hansson 1; 2; 3; 4A; 7; 10; 11; S1; S2; S3B,C; S4; Wrote paper draftDorthe R. Olesen 1; 2; 3; 4A,C,F; 5; 8B; S1; S2Janny M. L. Peterslund 8A; 9; 10; 12; S4Nina Engberg 4B,D,E; 12Morten KahnS3A; S5B,CMaria Winzi6; S6Tino KleinS5APoul Maddox-Hyttel SupervisorPalle SerupPrincipal investigator and supervisor; paper revisionFor co-authorship declaration, see Appendix A.21

Developmental Biology 330 (2009) 286–304Contents lists available at ScienceDirectDevelopmental Biologyjournal homepage: www.elsevier.com/developmentalbiologyA late requirement for Wnt and FGF signaling during activin-induced formation offoregut endoderm from mouse embryonic stem cellsMattias Hansson a,1 , Dorthe R. Olesen a,b,1 , Janny M.L. Peterslund a , Nina Engberg a , Morten Kahn a,b ,Maria Winzi a , Tino Klein a , Poul Maddox-Hyttel b , Palle Serup a, ⁎a Department of Developmental Biology, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmarkb Department of Animal and Veterinary Basic Sciences, Faculty of Life Sciences, University of Copenhagen, DK-1870, Frederiksberg C, DenmarkarticleinfoabstractArticle history:Received for publication 16 July 2008Revised 18 March 2009Accepted 30 March 2009Available online 7 April 2009Keywords:Embryonic stem cellGastrulationEndodermMesendodermAnterior–posterior patterningTGF-βWntFGFHere we examine how BMP, Wnt, and FGF signaling modulate activin-induced mesendodermal differentiationof mouse ES cells grown under defined conditions in adherent monoculture. We monitor ES cells containingreporter genes for markers of primitive streak (PS) and its progeny and extend previous findings on the abilityof increasing concentrations of activin to progressively induce more ES cell progeny to anterior PS andendodermal fates. We find that the number of Sox17- and Gsc-expressing cells increases with increasingactivin concentration while the highest number of T-expressing cells is found at the lowest activinconcentration. The expression of Gsc and other anterior markers induced by activin is prevented by treatmentwith BMP4, which induces T expression and subsequent mesodermal development. We show that canonicalWnt signaling is required only during late stages of activin-induced development of Sox17-expressingendodermal cells. Furthermore, Dkk1 treatment is less effective in reducing development of Sox17 +endodermal cells in adherent culture than in aggregate culture and appears to inhibit nodal-mediatedinduction of Sox17 + cells more effectively than activin-mediated induction. Notably, activin induction of Gsc-GFP + cells appears refractory to inhibition of canonical Wnt signaling but shows a dependence on early as wellas late FGF signaling. Additionally, we find a late dependence on FGF signaling during induction of Sox17 + cellsby activin while BMP4-induced T expression requires FGF signaling in adherent but not aggregate culture.Lastly, we demonstrate that activin-induced definitive endoderm derived from mouse ES cells can incorporateinto the developing foregut endoderm in vivo and adopt a mostly anterior foregut character after furtherculture in vitro.© 2009 Elsevier Inc. All rights reserved.IntroductionDirected differentiation of embryonic stem (ES) cells into mesoandendodermal derivatives is intensely studied due to their potentialclinical applications. Meso- and endoderm is formed by epiblast cellsthat ingress through the primitive streak (PS) during gastrulation(reviewed in Tam and Loebel, 2007). Fate mapping studies haveshown that cells that migrate through different anterior–posteriorregions of the streak give rise to different mesodermal andendodermal components (Carey et al., 1995; Lawson, 1999; Lawsonand Pedersen, 1992). At early stages, mesodermally fated cells ingressalongside endodermally fated cells but it is unclear when and howingressing cells acquire their ultimate fate. The definitive endoderm(DE) is derived from progenitors migrating through the anterior PS atearly and mid-streak stages (Carey et al., 1995; Lawson, 1999; Lawson⁎ Corresponding author. Fax: +45 44438000.E-mail address: pas@hagedorn.dk (P. Serup).1 These authors have contributed equally to this work.and Pedersen, 1987; Lawson and Pedersen, 1992). Moreover, recentevidence suggests that a common progenitor population, themesendoderm, exists in the PS (Kinder et al., 2001; Lawson et al.,1991; Tada et al., 2005) and that the cumulative exposure to nodalsignaling determines mesendodermal fates such that increasingexposure to nodal shifts the fate from posterior mesoderm throughanterior mesoderm and posterior endoderm to anterior DE at thelargest dose (Ben-Haim et al., 2006).The use of mouse ES (mES) cell lines with the green fluorescentprotein (GFP) targeted to the PS- and early mesodermal-specific genesBrachyury (T), Mix1 homeobox-like 1 (Mixl1), and Goosecoid (Gsc) hasmade it possible to quantify mesendoderm induction and isolate andcharacterize different mesodermal and endodermal populations(Fehling et al., 2003; Gadue et al., 2006; Kubo et al., 2004; Ng et al.,2005; Tada et al., 2005; Yasunaga et al., 2005). Anterior PS fates andendoderm was induced with high concentrations of activin A (activinhereafter) that activates Smad2/3 signaling through binding to thesame receptor as nodal. Recent studies have extended the endoderminducingproperties of activin to human ES cell differentiation cultures(D'Amour et al., 2005, 2006). However, as nodal signaling in the early0012-1606/$ – see front matter © 2009 Elsevier Inc. All rights reserved.doi:10.1016/j.ydbio.2009.03.026

M. Hansson et al. / Developmental Biology 330 (2009) 286–304287embryo interacts with other signaling pathways such as the BMP, Wnt,and FGF pathways (reviewed in Tam and Loebel, 2007), we addresshere the role of these signals and their potential to modulate activininducedmesendodermal differentiation of mES cells grown understandard conditions in feeder- and serum-free adherent monoculture(Ying et al., 2003a,b). We use ES cells containing reporter genes (lacZor GFP) targeted to the T (Fehling et al., 2003), Mixl1 (Hart et al.,2002), Gsc (Tada et al., 2005), Flk1 (Shalaby et al., 1995), Sox17 (Kim etal., 2007), and Sox2 (Li et al., 1998) loci to monitor, over time, theeffects of different growth factors on the expression of markersspecific to different anterior and posterior regions of the PS andderivatives thereof. We confirm and extend previous findings on theability of increasing concentrations of activin to progressively inducemore ES cell progeny to an anterior PS fate. Remarkably, while thenumber of Gsc- and Sox17-expressing cells increases with increasingactivin concentration, the highest number of T-expressing cells isfound at the lowest activin concentration, similar to the activinresponse seen in Xenopus animal cap cells. Furthermore, expression ofGsc and other anterior markers induced at high activin doses isprevented by simultaneous treatment with BMP4 which redirectsdevelopment towards mesodermal fates, also similar to results fromXenopus. Extending previous work, we find that inhibition ofcanonical Wnt signaling by treatment with Dkk1 is able to preventactivin-induced development of endodermal cells but only at latestages of differentiation. Dkk1 also inhibits activin-induced Mixl1-expression and consistent with this finding Wnt3a and activin actadditively on Mixl1 expression but not on Gsc expression. Wnt3a byitself appears to induce only posterior PS fates depending, however, onendogenous Smad2/3 signaling. Additionally, we demonstrate thatinduction of anterior and posterior PS fates by activin or BMP4,respectively, is dependent on FGF signaling. Lastly, we demonstrate forthe first time that activin-induced DE derived from mES cells canincorporate into the developing foregut endoderm when implantedinto chicken embryos but respond only to a limited degree toposteriorizing cues in vitro by initiating expression of regional foregutmarkers.Materials and methodsCell culture and differentiation of ESCsMouse ES cells (40,000 cells/cm 2 ) were kept undifferentiated ongelatin-coated cell culture plastic (Nunc) in serum-free medium; KO-DMEM supplemented with N2, B27, 0.1 mM nonessential amino acids,2 mM L-glutamine, Penicillin/Streptomycin (all from Invitrogen),0.1 mM 2-mercaptoethanol (Sigma-Aldrich), 1500 U/ml leukemiainhibitory factor (LIF, Chemicon) and 10 ng/ml BMP4 (R&D Systems),essentially as described by Ying et al. (2003a). ES cells were passagedevery second day with daily media changes for at least three passages(6 days) prior to initiation of differentiation studies.For differentiation experiments cells grown as described abovewere dissociated to single cells and differentiation was induced byseeding 2000 cells/cm 2 on gelatin-coated cell culture plastic in KO-DMEM supplemented with N2, B27, 0.1 mM nonessential amino acids,2 mM L-glutamine, Penicillin/Streptomycin (all from Invitrogen),0.1 mM 2-mercaptoethanol (Sigma-Aldrich) without LIF and BMP4.The medium was supplemented with one or more of the followinggrowth factors, soluble receptors, and small molecule compounds:activin (3, 10, 30 or 100 ng/ml), Wnt3a (5 or 100 ng/ml), Nodal(1 µg/ml), BMP4 (10 ng/ml), Dkk1 (320 ng/ml; all from R&DSystems), and FGF2 (100 ng/ml; Invitrogen). Soluble FGF receptors(all from R&D Systems) were first used to achieve inhibition of ligandsspecific for both b and c splice forms by mixing sFGFR1IIIc, sFGFR2IIIb,and l sFGFR4 (12, 8 and 24 ng/ml, respectively). To achieve selectiveinhibition of the b or c splice form specific FGFs we mixed sFGFR1IIIband sFGFR2IIIb (both at 250 ng/ml) or sFGFR1IIIc and sFGFR4 (both at250 ng/ml), respectively. The medium containing FGF2 or sFGFRs wassupplemented with 10 μg/ml heparan sulfate (Sigma-Aldrich), 1 μMSB431542 (Inman et al., 2002), 10 μM SU5402 or 100 nM PD173074(Calbiochem). The cells were cultured for up to 7 days and themedium was changed daily, beginning at the second day ofdifferentiation. It should be noted that our B27 supplement containretinyl acetate which is a precursor during RA synthesis. However,experiments using B27 supplement without retinyl acetate (Invitrogen)did not affect the number of activin-induced Sox17-GFP Hiendodermal cells. Further differentiation of day 5 activin-inducedcultures was done by 3 days of additional culture in serum-freemedium (KO-DMEM, N2, B27, 0.1 mM nonessential amino acids, 2 mML-glutamine, Penicillin/Streptomycin, 0.1 mM 2-mercaptoethanol)supplemented with Wnt3a (5 ng/ml), FGF4 (10 ng/ml) and/or0.1 μM all-trans retinoic acid (Sigma).Differentiation in embryoid bodies (EBs) was carried out using thehanging drop method. Cells were dissociated to single cells using nonenzymaticCell Dissociation Solution (Sigma-Aldrich) and diluted inN2B27 medium containing the relevant growth factors to yield100 cells per 20 μl drop. Approximately 150 drops were applied tothe lid of a 14 cm cell culture dish (Nunc), and placed upside downover autoclaved Millipore water. Drops were left overnight and EBswere washed down with HBSS w/o Ca 2+ and Mg 2+ and left tosediment for 3–4 min before removing the supernatant andtransferring EBs to 50 mm Petri dishes (Sterilin) containing N2B27medium with the relevant growth factors. The medium was changeddaily. We frequently observed that 3–5 individual aggregates wouldform in the hanging drop yielding aggregates composed of 20–30cells.Flow cytometryThe cells were dissociated in 0.05% Trypsin-EDTA (Invitrogen) anda percentage of GFP + cells was analyzed on a FACSCalibur flowcytometer (BD Biosciences) at days 2–6 in at least three independentexperiments. Mean % GFP + cells±standard deviation (S.D.) wascalculated and statistical analyses were performed using a two-tailedStudent's t-test for paired samples, unless we had a clear expectationof the outcome in which case a one-tailed test was used. Sorting ofGFP + cells for RNA extraction was performed on a FACSAria (BDBiosciences). CXCR4 expression was analyzed on a FACSCalibur flowcytometer using a human anti-CXCR4 monoclonal antibody (MAB172;R&D Systems). Cells were dissociated using Collagenase (Sigma-Aldrich) for 5 min. The cell suspension was fixed and stained asdescribed below without permeabilization. Visual inspection of thestained cells by confocal microscopy confirmed surface localization ofthe antigen.Immunofluorescence and X-gal stainingThe cells were cultured on gelatin-coated chamber slides for 3, 5 or8 days and fixed at room temperature for 30 min in 4% formaldehydesolution (Mallinckrodt Baker) for immunofluorescence or 5 min in0.2% glutaraldehyde for X-gal staining. For immunofluorescence, thecells were permeabilized in graded ethanol followed by blocking in10% donkey serum for 1 h and incubation with primary antibody for1 h at room temperature or overnight at 4 °C. The following antibodieswere used: goat anti-Foxa2 (Santa Cruz Biotechnology), goat anti-T(R&D Systems), rat anti-E-cadherin (E-cad; Zymed/Invitrogen), goatanti-Sox17 (R&D Systems), Alexa 448 conjugated rabbit anti-GFP(Molecular Probes/Invitrogen), rabbit anti-β-galactosidase (MPBiomedicals), rabbit anti-Lhx1 (Chemicon), goat and rabbit anti-Pdx1 (a kind gift from C. Wright), mouse and rabbit anti-Nkx6-1(Jensen et al., 1996; Pedersen et al., 2006), rabbit anti-Sox2(Chemicon) and mouse anti-Cdx2 (BioGenex). The cells wereincubated with Cy2-, Cy3-, Texas Red- or Cy5-conjugated species-

288 M. Hansson et al. / Developmental Biology 330 (2009) 286–304

M. Hansson et al. / Developmental Biology 330 (2009) 286–304289specific secondary antibodies (Jackson ImmunoResearch Laboratories)and 4′,6-diamidino-2-phenylindole (DAPI, MP Biomedicals).The Lhx1 staining used tyramide signal amplification (PerkinElmer)according to the manufacturer's recommendations. Negative controls,where the primary antibodies were omitted, were included for allstainings. These controls showed no unspecific staining of thesecondary antibodies (data not shown). β-galactosidase activity wasvisualized by adding X-gal stain solution for 4 h at 37 °C. The slideswere analyzed using an LSM 510 META laser scanning microscope(Carl Zeiss) or a BX60 epifluorescence microscope equipped with aDP71 camera (both from Olympus).RT-PCR and qPCRCells were dissociated using 0.05% Trypsin-EDTA and collected bycentrifugation. Total RNA was isolated using the RNeasy kit withDNAse treatment (Qiagen) following the manufacturer's protocol.cDNA was prepared from 5 or 100 ng RNA using MMLV ReverseTranscriptase (Invitrogen). PCR reactions were performed using 1 μlcDNA, 1 μl 20μM primer mix and 23 μl Reddy Mix PCR master mix(Abgene). The PCR was carried out with an initial denaturation step at96 °C for 2 min, followed by 32–38 cycles of 96 °C for 30 s, 55 °C for30 s and 72 °C for 1 min. The PCR was finished with a final extensionstep at 72 °C for 5 min. QPCR was performed using the standard SYBR ®Green program with dissociation curve of the Mx3005P (Stratagene).PCR reaction was run in duplicates using 5 μl Brilliant ® SYBR ® GreenQPCR Master Mix (Stratagene), 1 μl cDNA, 1 μl 10μM primer mix and3 μl DEPC-treated water. Quantified values for each gene of interestwere normalized against the input determined by the housekeepinggenes G6pdh and Tbp. The results are expressed as the relativeexpression level compared with the vehicle control condition or thescrambled control siRNA in the vehicle condition. Primer sequencesare available on request.siRNA transfectionThe sequence effective for mouse β-catenin knock-down wasdesigned using software available at the web site of Invitrogen(http://rnaidesigner.invitrogen.com/rnaiexpress/). The β-catenin(accession number NM_0079614.2) target sequences of the STEALTHsiRNAs were 5′-GCCTTCATTATGGACTGCCTGTTGT-3′ (siRNA1) and 5′-GAGCAAGGCTTTTCCCAGTCCTTCA-3′ (siRNA2). The STEALTH negativecontrol siRNA (scrambled; Invitrogen) has been used as negativecontrol and is labeled “scrambled”.The cells were cultured on gelatin-treated 24-well plates aspreviously described with a starting density of 4000 cells/cm 2 .After1 day of differentiation the cells were transfected with 100 nMSTEALTH siRNAs using Lipofectamine2000 according to the manufacturer'sinstructions. The transfected cells were grown further andanalyzed for β-catenin expression by western blot at days 3 and 5 ofdifferentiation. QPCR and flow cytometry analysis was performed atday 5.Western blotTotal cell lysates were obtained on days 3 and 5 of differentiationculture using RIPA lysis buffer. 20 μg of each protein sample wereloaded and analyzed by western blot using a rabbit anti-β-cateninmonoclonal antibody (Lab Vision) and a mouse anti-β-Actinmonoclonal antibody (Sigma-Aldrich) as primary antibodies aswell as secondary HRP-conjugated antibodies (Santa CruzBiotechnology).Generation of stable Wnt-reporter ES cell lines and chimera formationThe SuTOP-CFP construct was generated by cutting the luciferasegene from the Super8XTOPFLASH Wnt reporter (generously providedby Dr. R. Moon, University of Seattle, WA) with Fse and Nco1 andreplacing it with Cerulean PCR product from the pmCerulean-C1vector (Rizzo et al., 2004). To generate stably transfected cell lines, E14cells (Hooper et al., 1987) of low passage number were co-transfectedwith SuTOP-CFP and a ploxP-Neo vector, conferring resistance toNeomycin. The relationship between plasmids was 10:1 (reporter:ploxP-Neo). Transfection was carried out using Lipofectamine2000(Invitrogen) and 24 h after transfection, selection was added (200 μg/ml G418, Invitrogen). Medium was changed daily for 9 days and0.5 μM BIO (GSK3β inhibitor, Calbiochem), which activates canonicalWnt signaling, was added to the medium for the last 2 days ofselection to identify Wnt-responsive colonies. Fluorescent colonieswere then picked and expanded and one clone was selected forchimera formation via blastocyst injection.E3.5 blastocysts were harvested by flushing the uteri of mature,time mated NMRI mice (Taconic). Chimeric embryos were generatedby injection of approximately 10 SuTOP-CFP ES cells into theblastocoel using a paraffin-oil driven manual injector (Cell TramVario, Eppendorf) and a Narishige micromanipulator. Following 3 h ofculture in M16 medium, embryos were transferred to the uterus ofE2.5 pseudo-pregnant, 7 week old NMRI foster mothers. Care of theanimals was done according to institutional guidelines. Embryos wereharvested at E10.5 and fixed in Lilly's fixative (4% phosphate bufferedformaldehyde) for 30 min before being analyzed for native Ceruleanfluorescence. All animal experiments were performed in accordancewith institutional and national regulations.Chick embryo graftingFertilized eggs from white leghorn chicken were purchased fromTriova and incubated at 38 °C to Hamburger and Hamilton (HH) stages8–10 (Hamburger and Hamilton, 1951). The embryos were explantedas previously described (Chapman et al., 2001). E14 ES cell progenywas prepared for grafting by labeling with fluorescent CMTMRCellTracker dye (Molecular Probes/Invitrogen). Clumps of cells werescraped off, washed in PBS and inserted between endoderm andmesoderm of chicken embryos via a small incision in the endoderm.Grafted embryos were incubated for 48 h in a humidified incubator at38 °C. The embryos were isolated, washed in PBS, fixed in 4% PFA atroom temperature for 2 h and stored in methanol at −20 °C until thetime of analysis. Whole-mount immunofluorescent analyses ofgrafted chicken embryos were performed as previously described(Ahnfelt-Ronne et al., 2007).ResultsDose-dependent effects of activin on the expression of PS genes aremodulated by BMP and Wnt signalingPrevious studies have demonstrated induction of Brachyury (T) andGoosecoid (Gsc) by activin in mES cells (Gadue et al., 2006; Kubo et al.,2004; Tada et al., 2005; Yasunaga et al., 2005). However, differences inmedia compositions and the culture methods used make a directcomparison of the response of these two genes to varying doses ofactivin difficult. Prior to the induction of differentiation by addition ofgrowth factors, we culture the undifferentiated ES cells under definedconditions (Ying et al., 2003a). As activin is known to dosedependentlyregulate T and Gsc expression in Xenopus animal capFig. 1. Activin, BMP and Wnt signaling control the dynamic expression of primitive streak genes in differentiating ES cells. Flow cytometric analysis of T Gfp/+ (A), Gsc Gfp/+ (B), orMixl1 Gfp/+ (C) cells grown in adherent culture for up to 6 days in serum-free media containing 0, 3, 10, 30 or 100 ng/ml activin in the presence or absence of 10 ng/ml BMP4 or100 ng/ml Wnt3a. The mean % GFP + cells ±standard deviation of three independent experiments is presented.

290 M. Hansson et al. / Developmental Biology 330 (2009) 286–304Fig. 2. BMP4 but not Wnt3a inhibits the expression of Foxa2 and E-cadherin, and promotes expression of Flk1 in the presence of activin. The expression of Foxa2, E-cad (Cdh1), and Flk1(β-gal) was analyzed by immunofluorescence in Flk1 LacZ/+ ES cells cultured for 5 days in media containing 0, 3 or 100 ng/ml activin, 100 ng/ml Wnt3a, 10 ng/ml BMP4, 100 ng/mlactivin+100 ng/ml Wnt3a, or 100 ng/ml activin+ 10 ng/ml BMP4.cells such that low doses will activate T and high doses will activate Gsc(Dyson and Gurdon, 1998; Green et al., 1992; Gurdon et al., 1994, 1999;Latinkic et al., 1997), we initially tested if exposure of mES cells toincreasing doses of activin would lead to a shift from T to Gscexpression. ES cell lines carrying T-Gfp (T Gfp/+ ) and Gsc-Gfp (Gsc Gfp/+ )knock-in alleles (Fehling et al., 2003; Tada et al., 2005) were culturedwith increasing amounts of activin (from 3 to 100 ng/ml) and thenumber of GFP + cells was analyzed by flow cytometry. Examples ofprimary flow cytometry diagrams are shown in Fig. S1. When GFP +cells were quantitated we found that 3 ng/ml activin transientlyinduced 21±15% T-GFP + cells (mean %±S.D., n=3) peaking at day 4(Fig. 1A). However, this induction was not statistically significant. Athigher activin concentrations the number of T-GFP + cells declinedgradually such that the highest dose (100 ng/ml) resulted in only5±4% T-GFP + cells at day 4, comparable to the control samplescultured in the absence of activin (6±5% T-GFP + cells, Fig. 1A). Incontrast, flow cytometric analyses of Gsc Gfp/+ cells showed that theexpression of this anterior PS marker (Blum et al., 1992) was inducedby activin in a dose-dependent manner with expression peaking atdays 5–6 (Fig. 1B). 3 ng/ml activin induced 25±4% Gsc-GFP + cells atday 5, and this number increased with increasing concentration ofactivin reaching 43±11% Gsc-GFP + cells in cultures treated with100 ng/ml activin (Fig. 1B). Control samples grown in the absence ofactivin contained 3 ±4% Gsc-GFP + cells at this time point. Theinduction of Gsc expression at day 5 was statistically significant forall activin concentrations tested (pb0.05). Thus, similar to the case inXenopus animal cap cells, low doses of activin support T expressionwhile high doses stimulate Gsc expression. Intriguingly, while

M. Hansson et al. / Developmental Biology 330 (2009) 286–304291expression of the PS marker Mixl1 (Pearce and Evans, 1999) wasinduced by activin, the number of Mixl1-GFP + cells was independentof the activin concentration (Fig. 1C).In vivo, BMP4 is a ventralizing agent, acting during gastrulation toinduce T and repress Gsc expression (Fainsod et al., 1994; Jones et al.,1996; Steinbeisser et al., 1995). We found a strong but transientinduction of T expression in response to BMP4 (Fig. 1A). Peaking at day3, we observed 48±15% T-GFP + cells, which was significantly higherthan detected in vehicle-treated cells (pb0.05). The induction of Texpression by BMP4 was observed regardless of the presence orabsence of activin. However, the activin-mediated induction of Gsc-GFP + cells at day 5 was strongly inhibited by BMP4 (pb0.05),irrespective of the activin concentration (Fig. 1B). Cultures containingBMP4 never contained more than 10±6% Gsc-GFP + cells, which iscomparable to vehicle-treated cells. BMP4 also stimulated Mixl1expression peaking at day 3 with 26±12% Mixl1-GFP + cells butfurther addition of activin did not affect the number of Mixl1-GFP +cells (Fig. 1C).In Xenopus, Wnt molecules have both organizer-inducing andposteriorizing activities (Niehrs, 2004) and in mice Wnt3 is requiredfor proper axis formation and induction of the primitive streak(Barrow et al., 2007; Liu et al., 1999). We therefore tested the abilityof Wnt3a by itself or in combination with different doses of activin toinduce PS markers. 5 ng/ml Wnt3a induced 23±4% T-GFP + cells (datanot shown), whereas 100 ng/ml induced 30±9% T-GFP + cells at day 3,significantly higher than the control cells (Fig. 1A; pb0.05). Activin didnot have a significant effect on Wnt3a-induced T expression althoughwe observed a tendency to reduced numbers of T-GFP + cells with thehighest doses of activin. The prominent induction of T expression seenwith both BMP4 and Wnt3a was confirmed by immunofluorescence atday 3 (Fig. S2A). Wnt3a also induced Mixl1 expression. Culturescontaining 100 ng/ml Wnt3a contained 11±4% Mixl1-GFP + cells atday 4. Notably, the combination of 100 ng/ml activin and 100 ng/mlWnt3a induced 22±3% Mixl1-GFP + cells at day 4, approximatelytwice that achieved by either factor alone (Fig. 1C; pb0.05). Whenexamining co-expression of Tand GFP at day 3 by immunofluorescencewe found that most, if not all, Mixl1 expressing cells also expressed T,while the converse was not the case (Fig. S2B). While Wnt3astimulated T and Mixl1 expression, it did not affect the number ofGsc-GFP + cells (Figs. 1B and S2). The induction of Gsc expression byactivin in the presence or absence of Wnt3a and its inhibition by BMP4was confirmed by immunofluorescence at day 5 (Fig. S2C). Notably, thefew T-expressing cells present in activin-treated Gsc Gfp/+ cells after5 days did not express GFP. Considering that T is found not only in thePS, but also in the emerging mesoderm at the late gastrula stage(Inman and Downs, 2006), this may indicate that mesoderm is alsoformed in activin-treated cultures. Collectively, the different ES lines allresponded similarly to growth factor treatment (Fig. S2). Overall, ourresults indicate an anteriorizing role of activin during ES celldifferentiation that can be modulated by the posteriorizing factorsBMP4 and Wnt3a, consistent with the roles of these factors before andduring gastrulation (reviewed in Tam and Loebel, 2007).BMP4 induces mesoderm and blocks activin-mediated induction ofdefinitive endodermTo establish if our cultures contained embryonic or extraembryoniccell types we first examined expression of CXCR4 (chemokine (C-X-Cmotif) receptor-4), which is expressed in embryonic but not inextraembryonic tissues (McGrath et al., 1999; Sherwood et al., 2007).Using FACS analysis we compared surface expression of CXCR4 on cellsisolated from dissociated E11 mouse embryo heads with that ofdifferentiated ES cell progeny. Two distinct CXCR4-expression populationscould be detected among cells from mouse embryos, a CXCR4 lo andaCXCR4 hi population (Fig. S3A). When ES cell progeny from eithervehicle or activin-treated cultures was analyzed it was clear that the vastFig. 3. Activin-induced expression of the anterior primitive streak marker Gsc is inhibited by BMP4 but not by Dkk1. Gsc Gfp/+ ES cells were grown in serum-free mediumsupplemented with one or more of the following growth factors or inhibitor; 10 ng/ml BMP4, 100 ng/ml Wnt3a, 320 ng/ml Dkk1, 3 or 100 ng/ml activin as indicated. (A)Triple-label immunofluorescence was performed to analyze the co-expression of E-cad (Cdh1), Gsc (GFP), and Sox17 in cells grown for 5 days under the indicated conditions.Note Cdh1 + GFP − Sox17 − cells (white arrows), Cdh1 − GFP + Sox17 − cells (red arrows), Cdh1 + GFP − Sox17 + cells (white arrowheads), and Cdh1 + GFP + Sox17 + cells (with yellownuclei, red arrowheads) (B) Triple-label immunofluorescence was also performed to analyze co-expression of Cdh1, Gsc (GFP), and Oct4 on day 5. Note Cdh1 + GFP − Oct4 + cells(white arrows), Cdh1 − GFP + Oct4 − cells (red arrows), and Cdh1 + GFP + Oct4 − cells (red arrowheads).

292 M. Hansson et al. / Developmental Biology 330 (2009) 286–304majority of the cells were CXCR4 hi (Fig. S3A), indicating that most cells, inboth vehicles and activin-treated cultures, are embryonic rather thanextraembryonic in nature. Furthermore, significant levels of Sox7 (SRYboxcontaining gene 7) transcripts, which is exclusively expressed in theextraembryonic part of the endoderm in the gastrula stage embryo(Kanai-Azuma et al., 2002), could only be detected in Wnt3a-treatedcultures but not in vehicle, BMP4-, or activin-treated cultures (Fig. S3B).Having established the embryonic nature of the ES cell progeny inour cultures we next examined the expression of a number of germlayer specific markers. We initially analyzed expression of thetranscription factor gene Foxa2 and the epithelial marker E-cadherin(E-cad; Cdh1), both of which are expressed in developing endoderm(Ang et al., 1993; Sasaki and Hogan, 1993). Immunofluorescentstaining of cells grown in 3 or 100 ng/ml activin showed that thesecultures contained many Foxa2 + Cdh1 + cells compared to vehicletreatedsamples (Fig. 2). Notably, addition of BMP4 (10 ng/ml) but notWnt3a (100 ng/ml) was able to drastically reduce the number ofFoxa2 + Cdh1 + cells induced by activin (Fig. 2). Analysis of VEGFreceptor-2 (Kdr or Flk1) expression using Flk1-LacZ ES cells revealedthat both BMP4 (with or without 100 ng/ml activin) and Wnt3a werecapable of inducing Flk1-expressing cells (Fig. 2), indicative ofmesoderm formation (Ema et al., 2006).Wnt signaling augments the development of Sox17-expressing definitiveendoderm induced by activinBased on the analysis of Foxa2 and Cdh1 expression it was not clearif the concentration of activin used influenced subsequent differentiationtowards DE. Furthermore, analyses of Foxa2 and Cdh1 expressioncannot distinguish between DE from different A–P positions. Wetherefore examined the number of Gsc Gfp/+ cells that co-expressedGFP, Cdh1, and Sox17 by ICC as an indicator of anterior DE (ADE), inresponse to varying doses of activin with or without additional BMP4,Wnt3a, or Dkk1 treatment. Notably, we found that 100 ng/ml activinresulted in higher numbers of Cdh1 + GFP + Sox17 + triple positive cellsthan seen with 3 ng/ml activin (Fig. 3A, compare panels b and c),supporting that efficient formation of ADE depends on the activinconcentration (Yasunaga et al., 2005). Treatment with 3 ng/ml activinresulted in many Cdh1 + cells but the majority of these were not coexpressingGFP or Sox17 and most likely represent undifferentiated EScells (see below). Most of the GFP + cells generated in response to 3 ng/ml activin were Cdh1 − Sox17 − , suggesting that they may representmesoderm (Fig. 3A, panel b). Similarly, after treatment with Wnt3aalone (100 ng/ml) most GFP + cells were Cdh1 − Sox17 − (Fig. 3A, paneld). We tested if Wnt signaling was required for the development ofFig. 4. The requirement for canonical Wnt signaling during activin-induced Sox17 expression is more pronounced in aggregate culture than in adherent culture, and Dkk1 inhibitsnodal-induced Sox17 expression more than activin-induced Sox17 expression. (A) Nodal/activin and Wnt signaling interactions were analyzed in Mixl1 Gfp/+ and Gsc Gfp/+ cells atdays 2–6 of differentiation using flow cytometry. (B) Gsc Gfp/+ cells cultured in the presence of Dkk1 prior to and during activin induction were analyzed by flow cytometry. (C) Gsc Gfp/+cells were induced to form embryoid bodies in the presence of the indicated growth factors and analyzed for GFP expression by flow cytometry after 5 days of culture. (D) Sox17 Gfp/+cells cultured for 5 days were analyzed for GFP expression by flow cytometry. The mean % GFP + cells ±S.E.M. of three independent experiments is presented. (E) Sox17 Gfp/+ cellscultured for 2–7 days in the presence of activin (30 or 100 ng/ml) were analyzed for GFP expression by flow cytometry at the indicated time points. (F) Sox17 Gfp/+ cells were induced toform embryoid bodies in the presence of the indicated growth factors and analyzed for GFP expression by flow cytometry after 5 days of culture. The mean % GFP + cells ±standarddeviation of three independent experiments is presented for all flow cytometric analyses unless otherwise noted.

M. Hansson et al. / Developmental Biology 330 (2009) 286–304293Cdh1 + GFP + Sox17 + triple positive cells in response to activin andfound that such cells were still generated efficiently in response to100 ng/ml activin if Dkk1 was included (Fig. 3A, panel f). In contrast,addition of BMP4 completely prevented the development of such cells(Fig. 3A, panel g). We often found clusters of Cdh1 + GFP − Sox17 − cellsin cultures treated with different combinations of activin and Wnt3a(Fig. 3A, panels b–e). Immunocytochemistry revealed that manyCdh1 + Gsc − cells were Oct4 + and thus likely represent undifferentiatedES cells (Fig. 3B). Attempts to quantify the relative number ofGsc-GFP + Cdh1 + and Gsc-GFP − Cdh1 + cells by FACS under the variousconditions failed due to problems with achieving reliable FACS datausing the Chd1 monoclonal antibodies available.Although it was not evident from the above experiments with theGsc Gfp/+ cells that canonical Wnt signaling influenced the expressionof PS markers or the formation of DE in response to activin we wantedto examine closer if Wnt activity was required for expression of otherPS markers and DE formation in our ES cell cultures since gastrulationand thereby also endoderm formation requires Wnt3 activity in vivo(Barrow et al., 2007; Liu et al., 1999) and because we detectedexpression of Wnt3 and Wnt3a in our differentiating ES cell cultures(Fig. S4). To test this notion, we first cultured Mixl1 Gfp/+ cells withactivin or Wnt3a in the presence or absence of 320 ng/ml Dkk1 or1 μM of the ALK4/5/7-specific inhibitor SB431542, respectively. Theconcentration of the inhibitors was titrated by using a Wnt- or activinresponsiveluciferase assay (data not shown), choosing the concentrationthat blocked the response to exogenous Wnt3a or activin,respectively, without causing non-specific toxicity in ES cells. Whenanalyzing the number of Mixl1-GFP + cells after 4 days of activintreatment (30 ng/ml) we found that these were significantly reducedwhen Dkk1 was included (26±3% vs. 4±3%; pb0.05; Fig. 4A).Similarly, the number of Mixl1-GFP + cells induced by 100 ng/mlWnt3a was reduced from 11±4% on day 4 to 3±4% by simultaneousSB431542 treatment (Fig. 4A). Thus, activin and Wnt3a act cooperativelyto induce Mixl1 expression and both signaling pathways arerequired for Mixl1 expression in ES cell progeny. Although Wnt3a onlyinduced low numbers of Gsc-expressing cells, these were dependenton endogenous nodal/activin signaling as SB431542 significantlyinhibited the development of Gsc-GFP + cells in response to Wnt3a(Fig. 4A). In contrast, FACS analyses confirmed that activin-inducedGsc expression was not inhibited by Dkk1 treatment. Cultures ofGsc Gfp/+ cells contained 17±4% Gsc-GFP + cells at day 5 when grownin 30 ng/ml activin and 23±12% when cultured in the presence ofactivin and Dkk1 (Fig. 4A) consistent with the above mentionedimmunofluorescent analysis that demonstrated that Gsc-GFP + Sox17 +Cdh1 + triple positive cells were efficiently generated in response toactivin treatment, regardless of the presence of Dkk1. UndifferentiatedES cells have a low level of active canonical Wnt signaling despite thelack of exogenously added Wnt factors (Sato et al., 2004). To test if thislow level of Wnt signaling has any influence on the later activation ofGsc expression we cultured undifferentiated Gsc Gfp/+ cells for threepassages in media containing Dkk1 before differentiation was inducedby removing LIF and BMP4 and adding activin and Dkk1 for 5 days. Wefound that inclusion of Dkk1 prior to differentiation did not preventactivin from efficiently inducing Gsc expression (Fig. 4B). Furthermore,Dkk1 failed to prevent activin from inducing Gsc-GFP + cells inaggregate culture (Fig. 4C).To obtain quantitative data on the number of DE cells after growthfactor treatment we subjected a Sox17 Gfp/+ reporter line (Kim et al.,2007) to our differentiation protocol. At mid-streak stage Sox17expression marks the definitive endoderm forming adjacent to theanterior end of the PS. Simultaneous with the movement of DE to theanterior region of the gastrula, the Sox17 expression domain expandsto include the endoderm underlying the neural plate of the early tailbud-stageembryo (Kanai-Azuma et al., 2002). Thus, Sox17 is an earlymarker that similar to genes such as Hex, Foxa2, and Cer1, areexpressed simultaneously in the anterior visceral endoderm and theDE in the embryonic part of the gastrulating embryo. Sox17 Gfp/+ cellsexpress a low level of GFP (Sox17-GFP Lo ) when kept undifferentiatedin the presence of LIF and BMP4 (not shown). Differentiation underneural promoting conditions (Ying et al., 2003a) results in thedevelopment of a Sox17-GFP − population and some remainingSox17-GFP Lo cells while treatment with activin for 5 days inducesSox17-GFP Hi and Sox17-GFP − populations in addition to a remainingSox17 Lo population (Fig. S1). Increasing concentrations of activinresulted in development of progressively more Sox17-GFP Hi cells withthe highest numbers reached with 30 and 100 ng/ml of activin (Fig.4D). We observed an increase in Sox17-GFP Hi cells over time, peakingat day 5, followed by a modest decrease at days 6 and 7 (Fig. 4E). Theinduction of Sox17-GFP Hi cells was at least partly dependent on Wntsignaling as treatment with Dkk1 reduced the number of GFP Hi cellsby ∼50% at the highest activin concentration (Fig. 4D). Notably, thenumber of Sox17-GFP Hi cells induced by 1 μg/ml nodal appeared morestrongly reduced in response to Dkk1 treatment than did a similarnumber of Sox17-GFP Hi cells induced by 30 and 100 ng/ml of activin(Fig. 4D). Furthermore, when differentiation was performed inaggregate culture, which may rely more on endogenous signaling(Sachlos and Auguste, 2008; ten Berge et al., 2008), the number ofactivin-induced Sox17-GFP Hi cells were strongly reduced by Dkk1treatment (Fig. 4F). As expected, the addition of BMP4 preventedactivin-induced formation of Sox17-GFP Hi cells (pb0.001), whileaddition of Wnt3a resulted in a marginal, but significant (pb0.05)increase in the development of Sox17-GFP Hi cells (Fig. 4D).To further define the time at which canonical Wnt signaling wasrequired for the formation of T-, Gsc- and Sox17-GFP Hi cells, wecultured the cells with activin for three (T Gfp/+ )orfive (Gsc Gfp/+ andSox17 Gfp/+ ) days and added either Wnt3a or Dkk1 for shorter periodsFig. 5. Wnt signaling is required during late stages of activin-induced definitiveendoderm formation. ES cells were cultured in serum-free medium with 100 ng/mlactivin and supplemented with 100 ng/ml Wnt3a or 320 ng/ml Dkk1 for a variablenumber of days. T Gfp/+ cells (A) were cultured for 3 days and Gsc Gfp/+ (B) and Sox17 Gfp/+(C) cells were cultured for 5 days before being analyzed for GFP expression by flowcytometry. The mean % GFP + cells ±standard deviation of three independentexperiments is presented.

294 M. Hansson et al. / Developmental Biology 330 (2009) 286–304during the 5 day activin treatment. To monitor the effectiveness ofDkk1 treatment in reducing canonical Wnt signaling we firstgenerated an ES cell line stably transfected with a SuperTOP-Ceruleanreporter (SuTOP-CFP) and established its ability to report Wntsignaling in E10.5 chimeric embryos after injection into E3.5blastocysts and implantation into pseudo-pregnant females. Asshown in Fig. S5A, native Cerulean fluorescence can be observed inseveral sites known to harbor active Wnt signaling at this stage,including the peripheral aspects of the otic vesicles (Maretto et al.,2003). When SuTOP-CFP cells were cultured in activin we found thatCFP + colonies developed at day 3 even in the absence of exogenousWnt addition and that additional treatment with Dkk1 reduced orabolished reporter activity depending on the duration of treatment(Fig. S5B). Similarly, when SuTOP-CFP cells were assayed at day 5, wefound that Dkk1 treatment at days 3–4 or4–5 inhibited reporteractivity (Fig. S5C). Thus, treatment with Dkk1 for as little as 1 to 2 daysat the concentration used appeared quite effective in suppressingSuTOP reporter activity.We then analyzed the number of T-GFP + cells developing inresponse to activin when Wnt signaling was experimentally perturbed.T-GFP + cell numbers were augmented by Wnt3a with thelargest effect reached when Wnt3a was added only at day 3.Treatment with Dkk1 on the other hand reduced the number of T-GFP + cells most effectively when included in that last part of thethree day period (Fig. 5A). Neither stimulating nor inhibiting Wntsignaling in Gsc Gfp/+ cells, by treatment with Wnt3a and Dkk1,respectively, resulted in a significant change in the number of activininducedGFP + cells irrespective of the treatment period (Fig. 5B).However, treatment of Sox17 Gfp/+ cells with Wnt3a prior toappearance of GFP + cells reduced the number of Sox17-GFP Hi cells,while later Wnt3a treatment had no effect. Conversely, treatment withDkk1 reduced the number of Sox17-GFP Hi cells only if present after thefirst appearance of these (Fig. 5C).We next used siRNA mediated knock-down of β-catenin (encodedby Ctnnb1) to confirm that inhibition of canonical Wnt signaling at thelatter part of the 5 day activin stimulation period could suppress theappearance of Sox17-GFP Hi cells and to further test the Gsc Gfp/+ cellline which appeared refractory to Wnt inhibition in previousexperiments. We transfected Gsc Gfp/+ and Sox17 Gfp/+ cells withcontrol and two different Ctnnb1 siRNAs at day 2 of differentiationand assayed β-catenin expression by western blotting at days 3 and 5.In Gsc Gfp/+ cells we found a reduction of β-catenin expression at day 3which was normalized at day 5. siRNA treatment appeared moreeffective in Sox17 Gfp/+ cells with strong inhibition of β-cateninexpression at day 3 which was only partly recovered by day 5(Fig. 6A). FACS analysis at day 5 showed a reduction in the number ofGsc-GFP + cells after β-catenin knock-down, although this onlyreached significance in Ctnnb1 siRNA2 treated samples (pb0.05,Fig. 6B). Furthermore, Q-RT-PCR analysis of Gsc Gfp/+ cells after β-catenin knock-down did not reveal significant changes in expressionof Lhx1 and Chrd (Fig. S6).However, in agreement with the results obtained with Dkk1treatment, we found a prominent reduction in the number of Sox17-GFP Hi cells at day 5, in both siRNA1 and siRNA2 treated samples(pb0.05, Fig. 6B).Activin dose-dependently induces an anterior gene expression patternTo determine whether the DE formed in the presence of highconcentrations of activin was anterior or posterior in character weanalyzed the expression of a number of markers displaying differentialexpression depending on the anterior–posterior position of the cells.RT-PCR analyses at day 5 showed that activin, regardless ofconcentration, could induce expression of genes associated withanterior cell fates, including Lefty1, Hex, (Martinez-Barbera et al.,2000) and Otx2, (Rhinn et al., 1998). However, robust expression ofFig. 6. Inhibition of canonical Wnt signaling inhibits activin-induced Sox17-GFP Hi definitive endoderm formation, but has little effect on Gsc expression. (A) Western blot analysis ofβ-catenin expression after siRNA mediated knock-down. Two different siRNAs targeting β-catenin (siRNA1 and siRNA2) or a scrambled control siRNA were introduced to Gsc Gfp/+and Sox17 Gfp/+ cell lines on day 2 and β-catenin levels assayed at day 3 and 5. An anti-β-actin western blot served as loading control. (B) siRNA treated Gsc Gfp/+ and Sox17 Gfp/+ cellswere analyzed for GFP expression by flow cytometry after 5 days of serum-free culture supplemented with 0, 3 or 100 ng/ml activin. The mean % GFP + cells ±standard deviation ofthree independent experiments is presented. Untransfected and mock transfected controls are also shown.

M. Hansson et al. / Developmental Biology 330 (2009) 286–304295Cer1 as well as repression of the posterior marker Cdx2 was only seenin the presence of the high activin concentration (Fig. 7A). In contrast,Cdx2 (Beck et al., 1995) was expressed in samples treated with 10 ng/ml BMP4 or 100 ng/ml Wnt3a, as well as cells treated with the lowdose of activin (Fig. 7A). We next isolated Gsc-GFP + and Gsc-GFP −cells as well as Sox17-GFP Hi , Sox17-GFP Lo and Sox17-GFP − cells fromactivin-stimulated cultures at day 5 by FACS and prepared RNA forgene expression analysis. Message for Otx2 and Cer1 was detected inboth Gsc-GFP + and Gsc-GFP − fractions, but with an enrichment in theGFP + fraction (Fig. 7B). Cer1 was also enriched in Sox17-GFP Hi cellscompared to Sox17-GFP − and Sox17-GFP Lo cells (Fig. 7B). Furthermore,when analyzing the expression of the respective DE and VEmarkers, Pyy and Tdh (Hou et al., 2007; Sherwood et al., 2007) weonly found Pyy in the Sox17-GFP Hi cells while Tdh was found in theSox17-GFP − and, to a lesser degree, Sox17-GFP Lo populations (Fig. 7B).However, it should be noted that FACS sorted populations are probablynot completely pure. For example, the Sox17 Hi and Sox17 Lo populationsare likely displaying “cross-contamination” to some extent.Finally, as Lhx1 is expressed in the anterior part of the PS in the latestreakembryo and expected to co-localize with Gsc (Shawlot andBehringer, 1995; Tada et al., 2005) we performed GFP-Lhx1 doubleimmunofluorescent stainings on Gsc Gfp/+ cells after 5 days ofdifferentiation. As expected, we found Gsc-GFP + Lhx1 + doublepositive cells in activin-treated cultures and the formation of thesecells was inhibited by the addition of BMP4 but not Wnt3a (Fig. 7C).FGF receptor signaling is required for mesendoderm and endodermdifferentiationIf FGF signaling is compromised during early development as inFGF8, FGFR1, or UDP-glucose dehydrogenase mutants, the embryos'arrest at gastrulation and no embryonic mesoderm- or endodermderivedtissues develop (Ciruna et al., 1997; Deng et al., 1994; Garcia-Garcia and Anderson, 2003; Sun et al., 1999; Yamaguchi et al., 1994).The phenotype is associated with a failure of migration and it isunclear to what degree FGF signaling regulates allocation ofmesodermal and endodermal fates. However, studies in zebrafishindicate that FGF signaling promotes mesodermal development at theexpense of endodermal development (Mathieu et al., 2004; Mizoguchiet al., 2006; Poulain et al., 2006). We first examined theFig. 7. Activin, BMP and Wnt signaling influence anterior–posterior patterning during differentiation of ES cells. ES cells were grown for 5 days in serum-free medium supplementedwith indicated growth factors. (A) The expression of Lefty1, Hex, Otx2, Cer1 and Cdx2 was analyzed in T Gfp/+ cells by RT-PCR. The expression of TATA binding protein (Tbp) was usedas internal standard. (B) ES cells were cultured with 100 ng/ml activin and FACS sorted based on native GFP fluorescence after 5 days of culture. The expression of Otx2 and Cer1 wasanalyzed in the GFP + and GFP − fraction of Gsc Gfp/+ cells, and Otx2, Cer1, Pyy and Tdh expression was analyzedin the GFP Hi , GFP Lo and GFP − fraction in Sox17 Gfp/+ cells. Glucose-6-phosphate dehydrogenase (G6pd) was used as internal standard. (C) The expression of Lhx1 and GFP was examined in Gsc Gfp/+ cells by immunofluorescence after 5 days in thepresence of the indicated factors.

296 M. Hansson et al. / Developmental Biology 330 (2009) 286–304expression of members of the FGF family in differentiating ES cellcultures treated with activin and BMP4 (alone or in combination). Wefound that FGF4 and FGF8 were expressed in ES cell cultures treatedwith activin or BMP4 (Fig. S4). We therefore addressed the role of FGFsignaling by culturing the cells in activin (100 ng/ml) or BMP4(10 ng/ml) with or without the FGF receptor inhibitor SU5402(Mohammadi et al., 1997) or in the absence or presence ofexogenously added FGF2. Consistent with a recent report (Kunath etal., 2007), flow cytometric analyses of undifferentiated cells (day 0)and at days 3 and 5 of differentiation revealed that both BMP4-induced T and Mixl1 expression were strongly inhibited by 10 μMSU5402 (Fig. 8A), a concentration of SU5402 that did not compromisecell viability (data not shown). As BMP4-induced T expression hasbeen shown to be insensitive to SU5402 in EB culture (Willems andLeyns, 2008), we repeated this experiment to determine if choice ofculture system could explain this difference. Indeed we also find thatBMP4-induced T expression is unaffected by addition of SU5402, andeven by itself SU5402 is able to induce T expression (Fig. 8B).Nevertheless, addition of soluble FGF receptors (sFGFRs, b and c spliceforms) failed to inhibit BMP4-induced T or Mixl1 expression at day 3of adherent culture (Fig. 8A). Conversely, addition of FGF2 augmentedthe number of T-GFP + and Mixl1-GFP + cells formed in response toBMP4 treatment (from 39±23% to 68 ±6% and from 41±8% to 53±8%, respectively). However, this induction was only significant forMixl1-GFP (pb0.01).From studies in zebrafish we would expect that FGF signalingwould inhibit endoderm development and redirect cells towardsmesoderm (Mizoguchi et al., 2006; Poulain et al., 2006).When Gsc Gfp/+ cells were cultured in the presence of activin withaddition of FGF2, SU5402, PD173074, or soluble FGF receptors weobserved a strong dependence on FGF signaling for the development ofGsc-GFP + cells (Figs. 9A and B). The number of Gsc-GFP + cellsappearing at day 5 in the presence of activin was significantly inhibitedby the addition of SU5402 (pb0.05), PD173074 (pb0.001) or sFGFRs(pb0.05). Furthermore, both the b and c splice forms of solubleFGF receptors reduced the number of Gsc-GFP + cells (p b0.05using Student's one-tailed t-test). Moreover, the addition of FGF2significantly enhanced the amount of Gsc-GFP + cells seen at day 5 inactivin-treated cultures (pb0.01). These results demonstrate thatactivin-induced Gsc expression depends on FGF signaling and suggestthat anterior PS fate is augmented by FGF signaling. However, as Gscexpressingcells develop further into both meso- and endoderm wenext asked whether development of definitive endoderm is also FGFdependent. Hence we examined if activin-induced formation of Sox17-GFP Hi cells was influenced by FGF signaling. Culture of Sox17 Gfp/+ cellsin activin together with SU5402 or PD173074 resulted in a ∼50% and∼90% reduction in the number of Sox17-GFP Hi cells compared toactivin alone (pb0.001; Fig. 9B), demonstrating that FGFR signaling isrequired for normal formation of definitive endoderm. However, incontrast to results obtained with the Gsc reporter, addition of sFGFRdid not affect Sox17 expression. Moreover, where the addition of FGF2boosted the formation of Gsc-GFP + cells it resulted in an almost 50%reduction in the number of Sox17-GFP Hi cells (pb0.005; Fig. 9B),suggesting that precise control of FGF levels is important for regulationof Sox17 promoter activity.To better define the time where FGF signaling acted duringinduction of Gsc- and Sox17 expression we cultured Gsc- and Sox17-GFP cells with activin for 5 days and added either FGF2, SU5402, orPD173074 for shorter periods. The (modest) stimulatory effect of FGF2upon Gsc-GFP expression required that FGF2 was present early in the5 day culture period, prior to the initial appearance of GFP + cells(Fig. 9C). In contrast, SU5402 and PD173074 reduced the number ofGsc-GFP + cells both when added early and late in the culture period(Fig. 9C). In contrast, the number of Sox17-GFP Hi cells was reducedwhen FGF2 and FGFR inhibitors were present after the initialappearance of GFP Hi cells (Fig. 9C).We used RT-PCR to analyze whether the expression of additionalmarkers, informative in relation to anterior–posterior positionalFig. 8. FGF receptor signaling is required for BMP4-induced mesendoderm formation in adherent, but not in aggregate culture. (A) T Gfp/+ and Mixl1 Gfp/+ cells were cultured inmedium containing 10 ng/ml BMP4, with or without 100 ng/ml FGF2, 10 μM SU5402, or different concentrations of soluble forms of FGF receptors (b or c splice forms, or acombination of both). Cells were analyzed for GFP expression by flow cytometry on days 0, 3 and 5. (B) T Gfp/+ were induced to form embryoid bodies with the indicated growthfactors and analyzed for GFP expression by flow cytometry on day 3. The mean % GFP + cells ±standard deviation of three independent experiments is presented.

M. Hansson et al. / Developmental Biology 330 (2009) 286–304297Fig. 9. FGF receptor signaling is required throughout the five day period for activin-induced Gsc expression but only required late for activin induction of Sox17-expressing definitiveendoderm. Gsc Gfp/+ and Sox17 Gfp/+ cells were cultured in medium containing 100 ng/ml activin, in combination with 100 ng/ml FGF2, 10 μM SU5402, 100 nM PD173074, or solubleforms of FGF receptors as indicated. (A) Time course analysis of appearance of Gsc-GFP + cells by flow cytometry at time 0 and after 3 and 5 days in culture. (B) Gsc Gfp/+ and Sox17 Gfp/+cells were analyzed for GFP expression at day 5 after culture with the indicated factors. (C) Gsc Gfp/+ and Sox17 Gfp/+ cells were analyzed for GFP expression at day 5 after culture withactivin and either FGF2, SU5402, or PD173074 for shorted periods as indicated. The mean % GFP + cells ±standard deviation of three independent experiments is presented.identity, were affected by blocking FGF receptor signaling in activintreatedcells. Expression of Otx2, Chrd, and Cer1, genes that arerepressed by BMP4, is not affected by the addition of SU5402 after3days(Fig. 10). Among the markers analyzed only Bmp2, which is firstexpressed in the embryo proper at E7.5 just lateral to the anteriorneural folds and in precardiac mesoderm and slightly later in foregutendoderm (Winnier et al., 1995), is repressed both by BMP4 andSU5402 at day 3. Chrd expression appears at day 3 in vehicle-treatedcultures and at day 5 in BMP4-treated cultures but in both cases it issensitive to SU5402. Also BMP4-induced expression of mesodermmarkers Chrd, and Nog at day 5, as well as the posterior markers Bmp4and Cdx2, is sensitive to SU5402 (Fig. 10 and Fig. S4).Foregut and pancreatic competence of ES cell-derived endodermTo test if the DE-like cells had potential to functionally integrateinto developing embryonic endoderm, we implanted approximately50 cells labeled with a fluorescent dye into 6 to 10 somite stage chickenembryos at the level of the prospective pancreatic endoderm andincubated for 48 h. When ES cell progeny from activin-treated cultureswere grafted, 15 out of 21 transplanted embryos contained dyelabeled,Foxa2 + cells incorporated into the endoderm. In contrast, only3 out of 20 embryos receiving cells cultured without activin and 0 ofthe 8 embryos receiving activin- and BMP4-treated cells containeddye-labeled cell in the endoderm (Figs. 11A, D, G). Frequently, theactivin-treated cells incorporated in the Nkx6-1 + Pdx1 + pancreaticendoderm (Figs. 11E, F) (Pedersen et al., 2005). In a second series ofgrafting experiments we tested if the Sox17-GFP Hi cells obtained afteractivin treatment for 5 days with or without additional Dkk1 treatmentwere capable of incorporating into chick foregut endoderm. Such cellswere equally capable of contributing to the foregut endoderm (Figs.11H, I, K–M), although the number of Sox17-GFP Hi cells were reducedin cultures containing Dkk1. Orthogonal projections of the confocalstacks obtained from grafted embryos suggested expression of Nkx6-1in some of the grafted cells (Fig. 11J). Considering the anterior markersexpressed by activin-treated cells, and the absence of pancreatic or

298 M. Hansson et al. / Developmental Biology 330 (2009) 286–304Fig. 10. TGF-β, Wnt and FGF signaling control the dynamic gene expression in differentiating ES cells. T Gfp/+ cells cultured for 3 or 5 days in serum-free medium supplemented with100 ng/ml activin, 10 ng/ml BMP4 and/or 10 μM SU5402, as indicated, were analyzed by RT-PCR. The expression of Otx2, Chrd, Cer1, Bmp2, Bmp4 and Cdx2 was analyzed. Tbp wasused as internal standard.other regional foregut markers at day 5 (Fig. 12), the graftingexperiments suggest that DE formed in our cultures can respond toposteriorizing cues from the embryonic environment and progressfurther in differentiation. We therefore tested if the cells were able torespond to suspected posteriorizing cues in vitro. After 5 days ofculture in activin, the cells were shifted to conditions where activinwas replaced by candidate posteriorizing factors Wnt3a, FGF4, andretinoic acid (RA) (Grapin-Botton and Constam, 2007) and analyzedfor expression of Sox2, Pdx1, and Cdx2, markers of fore-, mid-, andhindgut, respectively (Grapin-Botton and Melton, 2000). Remarkably,we found large numbers of Sox2 + Foxa2 + cells in cultures treated withposteriorizing factors (Fig. 12). We confirmed Sox2 expression usingthe OS25 cell line which carries a β-geo reporter gene in the Sox2 locus(Li et al., 1998). β-galactosidase activity was visualized with X-galstaining (Fig. 12). The appearance of Sox2 + cells was depending onneither FGF4 nor RA. Scattered Pdx1 + cells also appeared but incontrast to Sox2 + cells these only appeared in the presence of RA. Cdx2positive cells were not detected under any of the conditions tested.Together, our data demonstrate that DE formed from mES cells inadherent monoculture is capable of differentiation toward foregutendoderm in vivo and in vitro but that only a limited number of thesecells appear to respond to posteriorizing cues in vitro.DiscussionA recent work from Smith et al. has demonstrated that mES cells canbe kept pluripotent under defined serum- and feeder-free conditions(Ying et al., 2003a), and be efficiently converted to Sox1 + neuroectodermalprogenitors when kept in adherent monoculture in the absenceof LIF and BMP4 (Ying et al., 2003a,b). In the present work, we extendthis defined system to demonstrate that mES cells kept in serum- andfeeder-free adherent monoculture respond dose-dependently to inducersof primitive streak formation by developing mesendoderm withcapacity to differentiate further into cells resembling foregut endoderm,in vivo and in vitro. Although several recent studies have establishedthat the TGF-β family members BMP4 and activin induce mesodermaland endodermal gene expression in differentiating mES cells (Gadue etal., 2006; Kubo et al., 2004; Mossman et al., 2005; Ng et al., 2005; Tada etal., 2005; Yasunaga et al., 2005), the varied conditions under whichdifferentiation was induced; e.g. adherent vs. suspension culture,differences in basal cell culture media and supplements, cell density,absence or presence of serum; as well as the different reporter linesutilized make a direct comparison of these studies difficult. Here we usea series of GFP-based reporters to study the dynamic expression of T,Mixl1, Gsc,andSox17 after manipulating one or more of the FGF, TGF-β,and Wnt signaling pathways. Remarkably, we find that the lowestconcentration of activin used (3 ng/ml) induced the highest number ofT-GFP + cells, whereas higher concentrations (10–100 ng/ml) resulted inprogressively fewer T-GFP + cells. These data apparently conflict withresults obtained by Keller et al. who observed increasing numbers of T-GFP + cells with increasing activin concentration until a plateau of about50–60% T-GFP + cells was reached at 30 ng/ml of activin (Kubo et al.,2004). It is not entirely clear why a direct correlation between activinconcentration and the number of T-GFP + cells is observed by Kubo et al.while we observe an inverse correlation. One possible explanationrelates to the embryoid body formation used by Kubo et al. in which onlycells located at the periphery, directly exposed to the cell culturemedium, may experience the full concentration of added growth factoras recently demonstrated (Sachlos and Auguste, 2008). Cells located inthe interior of the embryoid body are most likely experiencing a lowerconcentration and the overall dose–response curve may thereforeappear shifted towards higher concentrations. It is also possible that theenvironment of the embryoid body is more conducive to secondarysignaling events that may influence the number of T-GFP + cells. A recentstudy did however report that T mRNA levels in differentiating EBs wereinversely correlated with activin concentration within the 5–50 ng/mlrange (Willems and Leyns, 2008). Moreover, our results are strikinglysimilar to data from Xenopus animal cap explants, where activin dosedependentlycontrols cell fate specification. The expression of the XenopusT homolog Xbra is induced by low concentrations of activin whilehigher concentrations induce the expression of the Gsc homolog Xgsc(Green et al., 1992; Gurdon et al., 1994; Latinkic et al., 1997). However,even Xgsc-expressing cells induced by high doses of activin haveundergone a transient Xbra-expressing phase, but direct repression ofXbra transcription by binding of Xgsc to the Xbra promoter limits theduration of Xbra expression (Latinkic et al.,1997). In this regard, analysesof the duration of T expression by time-lapse microscopy under differentconditions would be highly informative. The notion of activin as a dosedependentinducer of anterior fate in ES cell progeny is indicated byseveral observations: the differential effect of 3 and 100 ng/ml activin ongene expression such that only the high dose induces the anteriormarker Cer1 and represses the posterior marker Cdx2. Also, extensiveco-localization of E-cadherin, Gsc-GFP and Sox17 was only observedafter treatment with 100 ng/ml of activin. Additional marker analyses

M. Hansson et al. / Developmental Biology 330 (2009) 286–304299Fig. 11. mES cell-derived endoderm grafts contribute to the developing chicken endoderm. (A–F) ES cells were cultured for 5 days in serum-free medium containing vehicle,100 ng/mlactivin or 100 ng/ml activin and 10 ng/ml BMP4 as indicated. Small clusters of cells were labeled with the red fluorescent cell tracker dye CMTMR and grafted between the endodermand mesoderm of explanted chicken embryos and allowed to develop for 2 days before being processed for confocal immunohistochemistry. (H–M) Sox17 Gfp/+ cells were cultured for5 days in serum-free medium containing either 100 ng/ml activin or 100 ng/ml activin plus 320 ng/ml Dkk1. Small clumps of GFP + cells were labeled with the red fluorescent celltracker dye CMTMR and grafted between the endoderm and mesoderm of explanted chicken embryos and allowed to develop in ovo for 2 days before being processed for confocalimmunohistochemistry. (A–F, H, I, K, L) Optical sections of chicken embryos whole-mount stained with the indicated antibodies and transplanted with ES cell progeny developing after5 days with the indicated growth factors. (J) Orthogonal view of a Z-stack revealing an Nkx6-1-expressing CMTMR-labeled cell. (G, M) Tabulated results of the grafting experiments.Arrowheads in A–F and H–L indicate implanted cells. dp: dorsal pancreas, e: endoderm, fp: floor plate, n: notochord, nt: neural tube, vp: ventral pancreas.revealed that such cells were also Pyy + ,Foxa2 + and CXCR4 + but Sox7 −and Tdh − , suggesting embryonic rather than extraembryonic endodermhad formed (Kanai-Azuma et al., 2002; Tada et al., 2005; Yasunaga et al.,2005). Conversely, BMP4- and Wnt3a-treated cells expressed low levelsof anterior markers and instead expressed the posterior markers Bmp4and Cdx2. Furthermore, BMP4 prevented activin-induced gene expressionand stimulated the expression of T and Mixl1. These observationsare consistent with previous in vivo data showing that BMP4 isnecessary for T expression (Winnier et al., 1995) and that activininducedGsc expression can be counteracted by BMP4 in vivo (Imai et al.,2001; Jones et al., 1996; Sander et al., 2007; Shapira et al., 1999;Steinbeisser et al., 1995). Additionally, Keller et al. also noted aposteriorizing effect of BMP4 upon mouse ES cells derived, activininducedPS populations (Nostro et al., 2008) and Suemori et al. foundthat inhibition of BMP signaling redirected human ES cell-derivedmesodermal cells (induced by forced expression of stabilized β-catenin)towards an anterior PS/DE lineage, in a process dependent on activin/nodal signaling (Sumi et al., 2008).

300 M. Hansson et al. / Developmental Biology 330 (2009) 286–304Fig. 12. ES cell-derived endoderm acquire foregut cell fates. (A–J′ and P–Z′) OS25 (Sox2β geo/+ )or(K–O) Pdx1 LacZ/+ cells were cultured for 5 days in 100 ng/ml activin andsubsequently treated with 5 ng/ml Wnt3a, 10 ng/ml FGF4 and/or 0,1 μM RA for 3 days as indicated. The co-expression of Foxa2 and Sox2 (foregut), Pdx1 (midgut) or Cdx2 (hindgut)was analyzed by immunofluorescence. The expression of Sox2 (A–E) and Pdx1 (K–O) was confirmed by analyzing β-galactosidase activity using X-gal staining.Further analysis of BMP4- (and Wnt3a-) treated cells revealed thepresence of Flk1 + cells demonstrating that mesodermal differentiationhad occurred. Interestingly, Smith et al. recently reported thatBMP4 treatment of mES cells, under conditions nearly identical toours, resulted in cells of unknown identity that were unlikely to bemesodermal based on presence of E-cad immunoreactivity (Kunath etal., 2007). While we occasionally detect a faint plasma membranestaining in BMP4-treated cells (see for example Fig. 3), the intensity ofthe staining is strongly reduced compared to the signal seen in activintreatedcells, and most cells appear E-cad − in our experiments.Furthermore, the presence of Flk1 expressing cells would appear toconclusively demonstrate mesodermal differentiation. This is alsoconsistent with a number of studies where embryoid bodies arestimulated with BMP4 (Czyz and Wobus, 2001; Finley et al., 1999;Johansson and Wiles, 1995; Lengerke et al., 2008; Ng et al., 2005;Willems and Leyns, 2008).Our examination of the role of Wnt signaling during mesendodermdifferentiation seems to indicate a major difference between differentiationin embryoid bodies and in adherent monoculture. Apparently,the extent to which Wnt signaling is required to induce anteriorPS formation is different in the two systems. Gadue et al. found that100 ng/ml Wnt could induce formation of Foxa2-CD4 + T-GFP +anterior PS-like cells, and that this was dependent on endogenousALK4/5/7 signaling. Moreover, the ability of activin to induce thesame fate was dependent on Wnt signaling since Dkk1 could preventthe effect of activin (Gadue et al., 2006). At first glance these findingsmay appear to contrast with our results, namely that the sameconcentration of Wnt3a could not induce significant numbers of Gsc-GFP + in adherent culture and that Dkk1 could not prevent inductionof Gsc-GFP + cells by activin. However, the Gsc-GFP + cells in this workdo not express Brachyury and very likely represent a mixed populationand are thus difficult to compare to the Foxa2/T double positive cells

M. Hansson et al. / Developmental Biology 330 (2009) 286–304301studied by Gadue et al. Furthermore, although siRNA mediated knockdownof β-catenin significantly reduced the number of Gsc-GFP + cellsdeveloping in response to activin the effect never exceeded 50%. Incontrast, the formation of Sox17-GFP Hi DE cells was more sensitive toinhibition of canonical Wnt signaling, but only when signaling wasinhibited at a relatively late stage of development, suggesting that therequirement for Wnt signaling is not during the formation of PS cellsbut may rather represent a Wnt-mediated lineage choice by acommon mesendodermal precursor or alternatively, a requirementfor Wnt signaling in the maintenance of Sox17-expressing DE cells.Indeed, our observation that Dkk1 only reduces the number of Sox17 Hicells if present at day 4, i.e. after Sox17 expression is initiated, isconsistent with a requirement for Wnt signaling in the maintenance ofDE. Also, our observations are consistent with the requirement for β-catenin function in DE to acquire or maintain DE fate (Lickert et al.,2002) as well as the observation of synergy between Sox17 and β-catenin in the activation of DE gene expression (Sinner et al., 2004).We also speculate that the proposed action of Wnt3 duringgastrulation might offer at least a partial explanation for the differencein sensitivity towards Dkk1 treatment observed between activin andnodal as well as between adherent and aggregate culture. Wnt3 isrequired in vivo for nodal to initiate its auto-stimulatory cascade. Inthe absence of Wnt3, nodal expression is initiated but then regressesrather than expands (Barrow et al., 2007; Liu et al., 1999). Wnt3 isthought to induce expression of Cfc1 which encodes the obligatenodal co-receptor Cripto (Morkel et al., 2003). It was recently reportedthat the three dimensional environment in embryoid bodies preventexogenously added growth factors from diffusing more than a limiteddistance into the embryoid body (Sachlos and Auguste, 2008) possiblymaking these more reliant on endogenous relay signaling via nodalwhich subsequently would require Wnt activity to induce Criptoexpression. This notion is supported by our observation that nodalinducedSox17-GFP Hi cells appear more sensitive to Dkk1-mediatedsuppression than activin induced Sox17-GFP Hi cells, and by ourobservation that activin-induced Sox17-GFP Hi cells are more sensitiveto Dkk1 treatment in aggregate culture compared to adherent culture.The apparent absence of such an autocrine nodal/Wnt signaling loopin adherent culture is not surprising given the remarkable instabilityof nodal when secreted by cultured cells (Le Good et al., 2005). Nodalmay simply be degraded before it can reach other cells in the dishwhereas in the confined environment of an embryoid body it may wellsignal to nearby cells and such signaling might propagate in a relayfashion. Thus, Wnt3a treatment would not be sufficient to induce thisloop in adherent culture. Conversely, since all the cells in adherentculture are exposed evenly to exogenous activin there may be norequirement for Wnt signaling to facilitate ALK4 signaling. Nevertheless,Gsc-GFP + cells appear largely refractory to the inhibitoryeffects of Dkk1 treatment. Since Wnt induced expression of Xgsc ismediated by two homeodomain proteins (Siamois and Twin whichhave no apparent homologs in the mouse) binding to the PE-element,this finding raises the question of whether the conserved Wntresponsiveelement in the mouse Gsc promoter (Watabe et al., 1995)isfunctional in all contexts. It is possible that Gsc is not always inducedby Wnt as Gsc expression is reduced rather than increased in E8.5Dkk1 mutant embryos (Lewis et al., 2008). Lastly, we cannot ruleout a more trivial explanation related to the particular Gsc-GFP cellline, which may potentially harbor a defect in its responsiveness toDkk1-mediated Wnt inhibition. It is possible that more efficientknock-down of β-catenin than we achieved might further reduce oreven prevent the formation of Gsc-GFP + cells.In contrast, we do observe a requirement for Wnt signaling forinduction of Mixl1 expression. Our experiments revealed the simultaneousrequirement of nodal/activin and Wnt signaling to induceexpression of Mixl1 in ES cell progeny. Stimulation of one pathwaywhile inhibiting the other reduced Mixl1 induction, which corroboratesprevious findings (Gadue et al., 2006). The Mixl1 promoter haspreviously been shown to be nodal/activin-responsive via thepresence of Foxh1 and Smad binding sites in the promoter (Hart etal., 2005) and inspection of the published sequence reveals thepresence of consensus TCF/LEF binding sites in the promoter as well.In vivo, Wnt/β-catenin signaling is upstream of two distinct geneexpression programs acting during anteroposterior axis and mesodermformation, respectively (Morkel et al., 2003). We suspect thatwe observe a requirement for Wnt signaling in mesoderm formationbut did not pursue this aspect further.The two differentiation systems, adherent and aggregate culture,also differ strikingly in the requirement for FGF signaling. In agreementwith our results a recent study using embryoid body formation foundthat FGF signaling was not required for BMP4-induced T expression(Willems and Leyns, 2008), which is unlike the situation in adherentculture where BMP4-induced T expression is completely prevented bySU5402. Moreover, consistent with our results Kunath et al., also usingadherent culture, recently reported that FGF4 deficiency or treatmentwith PD173074 prevented the switch from BMP4-mediated support ofpluripotency to BMP4-induced differentiation (Kunath et al., 2007).The requirement for FGF signaling in induction of mesodermal geneexpression is also consistent with the in vivo requirement for FGFsignaling in Xenopus and zebrafish mesodermal induction (Cornell etal., 1995; Mathieu et al., 2004). In zebrafish, FGF signaling is requireddownstream of Nodal for induction of One-eyed-pinhead, the zebrafishhomolog of Cripto (Mathieu et al., 2004). However, as discussedabove activin does not require Cripto to activate its receptors, thusactivin induced Sox17 expression should not necessarily be inhibitedby FGFR inhibitors. This is indeed what we find when inhibiting FGFsignaling prior to appearance of Sox17-GFP Hi cells, the time where onewould expect to find a requirement for Cripto function if Nodal was theinducer. It might be illuminating to determine if Nodal induced Sox17expression would be sensitive to these inhibitors. Nevertheless, we doobserve that Sox17 expression depends on FGF signaling after theinitial appearance of Sox17-GFP Hi cells at the same time where weobserve a dependency for Wnt signaling. It thus appears thatmaintenance of Sox17 expression and/or propagation of Sox17expressing cells depend on both FGF and Wnt signaling. Consistentwith our results, Brickman et al. also observed an absolute requirementfor FGF signaling at days 3–7 for the formation of Hex + CXCR4 + ADEcells when differentiating ES cells in monolayer culture under definedconditions (Morrison et al., 2008).In some cases we noticed what appeared to be conflicting resultswhen inhibiting FGF and FGFR signaling by soluble FGF receptors andSU5402, respectively. It is possible that this is a reflection of FGFindependent FGFR activation. FGF receptors are known to formcomplexes with N-cadherin and N CAM in neurons and in pancreaticβ-cells, resulting in ligand independent receptor activation (Cavallaroet al., 2001; Saffell et al., 1997; Williams et al., 1994), and this wouldnot be expected to be sensitive to the addition of soluble FGFreceptors. More trivial explanations are also possible. We cannot ruleout that SU5402 may have unknown non-FGFR-mediated effects or becertain that our soluble FGFR preparations are capable of inhibiting allFGF family members. Additional experiments with dominant negativereceptors and cell lines mutated in genes coding for FGF signalingcomponents will likely shed more light on these questions.The expression of anterior markers such as Otx2 and Cer1 in Sox17-GFP Hi cells suggest that these could be anterior definitive endoderm.This notion is supported by the selective presence of Pyy transcripts inthis population, but the lack of good ADE specific markers prevents usfrom categorically making this conclusion. However, in vivo ADEforms under conditions of high nodal signaling (Ben-Haim et al.,2006; Lu and Robertson, 2004; Vincent et al., 2003) which we believewe mimic with culture conditions containing 30–100 ng/ml activin or1 μg/ml nodal. Thus, it is likely that the Sox17-GFP Hi cells formed inour cultures represent ADE. However, it is also likely that mesoderm isformed to some extent in cultures treated with high doses of activin or

302 M. Hansson et al. / Developmental Biology 330 (2009) 286–304nodal. The presence of Otx2 transcripts in Sox17-GFP Lo and -GFP −populations suggest that these also contain anterior cell typesincluding perhaps small numbers of AVE cells. The latter is indicatedby the presence of the VE marker Tdh and the presence of Otx2 andCer1 is consistent with this idea. Lastly, we cannot exclude thatSox17-negative endoderm is present in our cultures.Chick embryo xenografting has previously been used to investigatethe developmental potential of embryonic mouse cells (Fontaine-Perus, 2000; Fontaine-Perus et al., 1996, 1997, 1995) as well as mouseand human ES cell derivatives (Lee et al., 2007; Wichterle et al., 2002)but to our knowledge we report the first functional assay for mES cellderivedendoderm. Previous studies have relied almost exclusively onexpression of cell-specific markers for the characterization of in vitrogenerated endoderm. Although the ES cell-derived endoderm did notexpress transcription factors associated with the regionalization of theprimitive gut tube after 5 days of activin treatment, the cells werecapable of turning on these genes when integrating into endodermalepithelium in vivo. Moreover, some embryos contained grafted cells inthe Nkx6-1 + and Pdx1 + pancreatic endoderm. Overall, our datasuggest that ES cell-derived DE, formed under defined conditions, cancontribute to the developing gut tube and further suggests that suchcells are, at least partly, capable of responding to patterning cues fromthe in vivo environment. The latter notion is corroborated by theinduction of pancreas markers in a limited number of cells when suchcells are cultured further in the presence of known and suspectedposteriorizing factors.It is remarkable how the requirement for certain signaling eventsare strikingly different when comparing aggregate culture (i.e.embryoid body formation) and adherent culture. However, we donot think that one system is superior to the other but rather thatcomparison of directed differentiation under adherent and aggregateculture conditions will prove valuable when attempting to decipherthe extent of secondary signaling events and their role in lineageselection. In this regard it is also noteworthy that endogenous signalinglikely plays a prominent role also in adherent culture. This notion isbased on several of our observations, including that many SuTOP-CFP +cells formed in cultures that received activin as the only exogenousfactor, the interdependence between activin and Wnt signaling forgeneration of Mixl1-GFP + cells, and on the dependence on Wnt andFGF signaling for efficient activin-induced formation of Sox17-GFP +cells.AcknowledgmentsWe are indebted to Drs. G. Keller, A.G. Elefanty, S. Nishikawa, A.Smith, S.J. Morrison, J. Rossant, and C. Wright for the T-GFP, Mixl1-GFP,Gsc-GFP, Sox2-LacZ, Sox17-GFP, Flk1-LacZ and Pdx1-LacZ reporter EScell lines and anti-Pdx1 antibody. We thank Ragna Jørgensen, SørenRefsgaard Lindskog, Gurmeet Kaur Singh, Heidi Ingemann Jensen, andRodrigo Garcia for excellent technical assistance. This work was madepossible by funding from the Juvenile Diabetes Research Foundation,EU Integrated Project No. 512145, PS; NIDDK U19-DK04-017, PS; andthe Danish Stem Cell Research Doctoral School (PS and PM-H).Appendix A. Supplementary dataSupplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ydbio.2009.03.026.ReferencesAhnfelt-Ronne, J., Jorgensen, M.C., Hald, J., Madsen, O.D., Serup, P., Hecksher-Sorensen, J.,2007. An improved method for 3D reconstruction of protein expression patterns inintact mouse and chicken embryos and organs. J. Histochem. Cytochem. 55, 925–930.Ang, S.L., Wierda, A., Wong, D., Stevens, K.A., Cascio, S., Rossant, J., Zaret, K.S., 1993. Theformation and maintenance of the definitive endoderm lineage in the mouse:involvement of HNF3/forkhead proteins. Development 119, 1301–1315.Barrow, J.R., Howell, W.D., Rule, M., Hayashi, S., Thomas, K.R., Capecchi, M.R., McMahon,A.P., 2007. Wnt3 signaling in the epiblast is required for proper orientation of theanteroposterior axis. Dev. Biol. 312, 312–320.Beck, F., Erler, T., Russell, A., James, R., 1995. Expression of Cdx-2 in the mouse embryoand placenta: possible role in patterning of the extra-embryonic membranes. Dev.Dyn. 204, 219–227.Ben-Haim, N., Lu, C., Guzman-Ayala, M., Pescatore, L., Mesnard, D., Bischofberger, M.,Naef, F., Robertson, E.J., Constam, D.B., 2006. The nodal precursor acting via activinreceptors induces mesoderm by maintaining a source of its convertases and BMP4.Dev. Cell 11, 313–323.Blum, M., Gaunt, S.J., Cho, K.W., Steinbeisser, H., Blumberg, B., Bittner, D., De Robertis, E.M., 1992. Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell69, 1097–1106.Carey, F.J., Linney, E.A., Pedersen, R.A., 1995. Allocation of epiblast cells to germ layerderivatives during mouse gastrulation as studied with a retroviral vector. Dev.Genet. 17, 29–37.Cavallaro, U., Niedermeyer, J., Fuxa, M., Christofori, G., 2001. N-CAM modulates tumourcelladhesion to matrix by inducing FGF-receptor signalling. Nat. Cell Biol. 3, 650–657.Chapman, S.C., Collignon, J., Schoenwolf, G.C., Lumsden, A., 2001. Improved methodfor chick whole-embryo culture using a filter paper carrier. Dev. Dyn. 220,284–289.Ciruna, B.G., Schwartz, L., Harpal, K., Yamaguchi, T.P., Rossant, J., 1997. Chimeric analysis offibroblast growth factor receptor-1 (Fgfr1) function: a role for FGFR1 in morphogeneticmovement through the primitive streak. Development 124, 2829–2841.Cornell, R.A., Musci, T.J., Kimelman, D., 1995. FGF is a prospective competence factor forearly activin-type signals in Xenopus mesoderm induction. Development 121,2429–2437.Czyz, J., Wobus, A., 2001. Embryonic stem cell differentiation: the role of extracellularfactors. Differentiation 68, 167–174.D′ Amour, K.A., Agulnick, A.D., Eliazer, S., Kelly, O.G., Kroon, E., Baetge, E.E., 2005.Efficient differentiation of human embryonic stem cells to definitive endoderm.Nat. Biotechnol. 23, 1534–1541.D′ Amour, K.A., Bang, A.G., Eliazer, S., Kelly, O.G., Agulnick, A.D., Smart, N.G., Moorman,M.A., Kroon, E., Carpenter, M.K., Baetge, E.E., 2006. Production of pancreatichormone-expressing endocrine cells from human embryonic stem cells. Nat.Biotechnol. 24, 1392–1401.Deng, C.X., Wynshaw-Boris, A., Shen, M.M., Daugherty, C., Ornitz, D.M., Leder, P., 1994.Murine FGFR-1 is required for early postimplantation growth and axial organization.Genes Dev. 8, 3045–3057.Dyson, S., Gurdon, J.B., 1998. The interpretation of position in a morphogen gradient asrevealed by occupancy of activin receptors. Cell 93, 557–568.Ema, M., Takahashi, S., Rossant, J., 2006. Deletion of the selection cassette, but not cisactingelements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotentmesodermal progenitors. Blood 107, 111–117.Fainsod, A., Steinbeisser, H., De Robertis, E.M., 1994. On the function of BMP-4 inpatterning the marginal zone of the Xenopus embryo. EMBO J. 13, 5015–5025.Fehling, H.J., Lacaud, G., Kubo, A., Kennedy, M., Robertson, S., Keller, G., Kouskoff, V.,2003. Tracking mesoderm induction and its specification to the hemangioblastduring embryonic stem cell differentiation. Development 130, 4217–4227.Finley, M.F., Devata, S., Huettner, J.E., 1999. BMP-4 inhibits neural differentiation ofmurine embryonic stem cells. J. Neurobiol. 40, 271–287.Fontaine-Perus, J., 2000. Interspecific mouse-chick chimeras. Methods Mol. Biol. 135,443–446.Fontaine-Perus, J., Jarno, V., Fournier le Ray, C., Li, Z., Paulin, D., 1995. Mouse chickchimera: a new model to study the in ovo developmental potentialities ofmammalian somites. Development 121, 1705–1718.Fontaine-Perus, J., Cheraud, Y., Halgand, P., 1996. Developmental potentialities of themouse neural tube grafted in chick embryo. Int. J. Dev. Biol. (Suppl 1), 135S.Fontaine-Perus, J., Halgand, P., Cheraud, Y., Rouaud, T., Velasco, M.E., Cifuentes Diaz, C.,Rieger, F., 1997. Mouse-chick chimera: a developmental model of murineneurogenic cells. Development 124, 3025–3036.Gadue, P., Huber, T.L., Paddison, P.J., Keller, G.M., 2006. Wnt and TGF-beta signaling arerequired for the induction of an in vitro model of primitive streak formation usingembryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 103, 16806–16811.Garcia-Garcia, M.J., Anderson, K.V., 2003. Essential role of glycosaminoglycans in Fgfsignaling during mouse gastrulation. Cell 114, 727–737.Grapin-Botton, A., Constam, D., 2007. Evolution of the mechanisms and molecularcontrol of endoderm formation. Mech. Dev. 124, 253–278.Grapin-Botton, A., Melton, D.A., 2000. Endoderm development: from patterning toorganogenesis. Trends Genet. 16, 124–130.Green, J.B., New, H.V., Smith, J.C., 1992. Responses of embryonic Xenopus cells to activinand FGF are separated by multiple dose thresholds and correspond to distinct axesof the mesoderm. Cell 71, 731–739.Gurdon, J.B., Harger, P., Mitchell, A., Lemaire, P., 1994. Activin signalling and response toa morphogen gradient. Nature 371, 487–492.Gurdon, J.B., Standley, H., Dyson, S., Butler, K., Langon, T., Ryan, K., Stennard, F., Shimizu,K., Zorn, A., 1999. Single cells can sense their position in a morphogen gradient.Development 126, 5309–5317.Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of thechick embryo. J. Exp. Morphol. 88, 49–92.Hart, A.H., Hartley, L., Sourris, K., Stadler, E.S., Li, R., Stanley, E.G., Tam, P.P., Elefanty, A.G.,Robb, L., 2002. Mixl1 is required for axial mesendoderm morphogenesis andpatterning in the murine embryo. Development 129, 3597–3608.Hart, A.H., Willson, T.A., Wong, M., Parker, K., Robb, L., 2005. Transcriptional regulationof the homeobox gene Mixl1 by TGF-beta and FoxH1. Biochem. Biophys. Res.Commun. 333, 1361–1369.

M. Hansson et al. / Developmental Biology 330 (2009) 286–304303Hooper, M., Hardy, K., Handyside, A., Hunter, S., Monk, M., 1987. HPRT-deficient (Lesch–Nyhan) mouse embryos derived from germline colonization by cultured cells.Nature 326, 292–295.Hou, J., Charters, A.M., Lee, S.C., Zhao, Y., Wu, M.K., Jones, S.J., Marra, M.A., Hoodless, P.A.,2007. A systematic screen for genes expressed in definitive endoderm by serialanalysis of gene expression (SAGE). BMC Dev. Biol. 7, 92.Imai, Y., Gates, M.A., Melby, A.E., Kimelman, D., Schier, A.F., Talbot, W.S., 2001. Thehomeobox genes vox and vent are redundant repressors of dorsal fates in zebrafish.Development 128, 2407–2420.Inman, G.J., Nicolas, F.J., Callahan, J.F., Harling, J.D., Gaster, L.M., Reith, A.D., Laping, N.J.,Hill, C.S., 2002. SB-431542 is a potent and specific inhibitor of transforming growthfactor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4,ALK5, and ALK7. Mol. Pharmacol. 62, 65–74.Inman, K.E., Downs, K.M., 2006. Localization of brachyury (T) in embryonic andextraembryonic tissues during mouse gastrulation. Gene Expr. Patterns 6,783–793.Jensen, J., Serup, P., Karlsen, C., Nielsen, T.F., Madsen, O.D., 1996. mRNA profiling of ratislet tumors reveals Nkx6.1 as a beta-cell-specific homeodomain transcriptionfactor. J. Biol. Chem. 271, 18749–18758.Johansson, B.M., Wiles, M.V., 1995. Evidence for involvement of activin A and bonemorphogenetic protein 4 in mammalian mesoderm and hematopoietic development.Mol. Cell. Biol. 15, 141–151.Jones, C.M., Dale, L., Hogan, B.L., Wright, C.V., Smith, J.C., 1996. Bone morphogeneticprotein-4 (BMP-4) acts during gastrula stages to cause ventralization of Xenopusembryos. Development 122, 1545–1554.Kanai-Azuma, M., Kanai, Y., Gad, J.M., Tajima, Y., Taya, C., Kurohmaru, M., Sanai, Y.,Yonekawa, H., Yazaki, K., Tam, P.P., Hayashi, Y., 2002. Depletion of definitive gutendoderm in Sox17-null mutant mice. Development 129, 2367–2379.Kim, I., Saunders, T.L., Morrison, S.J., 2007. Sox17 dependence distinguishes thetranscriptional regulation of fetal from adult hematopoietic stem cells. Cell 130,470–483.Kinder, S.J., Tsang, T.E., Wakamiya, M., Sasaki, H., Behringer, R.R., Nagy, A., Tam, P.P., 2001.The organizer of the mouse gastrula is composed of a dynamic population ofprogenitor cells for the axial mesoderm. Development 128, 3623–3634.Kubo, A., Shinozaki, K., Shannon, J.M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H.J.,Keller, G., 2004. Development of definitive endoderm from embryonic stem cells inculture. Development 131, 1651–1662.Kunath, T., Saba-El-Leil, M.K., Almousailleakh, M., Wray, J., Meloche, S., Smith, A., 2007.FGF stimulation of the Erk1/2 signalling cascade triggers transition of pluripotentembryonic stem cells from self-renewal to lineage commitment. Development 134,2895–2902.Latinkic, B.V., Umbhauer, M., Neal, K.A., Lerchner, W., Smith, J.C., Cunliffe, V., 1997. TheXenopus brachyury promoter is activated by FGF and low concentrations of activinand suppressed by high concentrations of activin and by paired-type homeodomainproteins. Genes Dev. 11, 3265–3276.Lawson, K.A., 1999. Fate mapping the mouse embryo. Int. J. Dev. Biol. 43, 773–775.Lawson, K.A., Pedersen, R.A., 1987. Cell fate, morphogenetic movement and populationkinetics of embryonic endoderm at the time of germ layer formation in the mouse.Development 101, 627–652.Lawson, K.A., Pedersen, R.A., 1992. Clonal analysis of cell fate during gastrulation andearly neurulation in the mouse. Ciba Found. Symp. 165, 3–21.Lawson, K.A., Meneses, J.J., Pedersen, R.A., 1991. Clonal analysis of epiblast fate duringgerm layer formation in the mouse embryo. Development 113, 891–911.Lee, H., Shamy, G.A., Elkabetz, Y., Schofield, C.M., Harrsion, N.L., Panagiotakos, G.,Socci, N.D., Tabar, V., Studer, L., 2007. Directed differentiation and transplantationof human embryonic stem cell-derived motoneurons. Stem. Cells 25,1931–1939.Le Good, J.A., Joubin, K., Giraldez, A.J., Ben-Haim, N., Beck, S., Chen, Y., Schier, A.F.,Constam, D.B., 2005. Nodal stability determines signaling range. Curr. Biol. 15,31–36.Lengerke, C., Schmitt, S., Bowman, T.V., Jang, I.H., Maouche-Chretien, L., McKinney-Freeman, S., Davidson, A.J., Hammerschmidt, M., Rentzsch, F., Green, J.B., Zon, L.I.,Daley, G.Q., 2008. BMP and Wnt specify hematopoietic fate by activation of the Cdx-Hox pathway. Cell. Stem. Cell. 2, 72–82.Lewis, S.L., Khoo, P.L., De Young, R.A., Steiner, K., Wilcock, C., Mukhopadhyay, M.,Westphal, H., Jamieson, R.V., Robb, L., Tam, P.P., 2008. Dkk1 and Wnt3 interact tocontrol head morphogenesis in the mouse. Development 135, 1791–1801.Lickert, H., Kutsch, S., Kanzler, B., Tamai, Y., Taketo, M.M., Kemler, R., 2002. Formation ofmultiple hearts in mice following deletion of beta-catenin in the embryonicendoderm. Dev. Cell. 3, 171–181.Li, M., Pevny, L., Lovell-Badge, R., Smith, A., 1998. Generation of purified neuralprecursors from embryonic stem cells by lineage selection. Curr. Biol. 8, 971–974.Liu, P., Wakamiya, M., Shea, M.J., Albrecht, U., Behringer, R.R., Bradley, A., 1999.Requirement for Wnt3 in vertebrate axis formation. Nat. Genet. 22, 361–365.Lu, C.C., Robertson, E.J., 2004. Multiple roles for Nodal in the epiblast of the mouseembryo in the establishment of anterior–posterior patterning. Dev. Biol. 273,149–159.Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P., Broccoli, V., Hassan, A.B., Volpin, D.,Bressan, G.M., Piccolo, S., 2003. Mapping Wnt/beta-catenin signaling during mousedevelopment and in colorectal tumors. Proc. Natl. Acad. Sci. U. S. A. 100, 3299–3304.Martinez-Barbera, J.P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D., Kioussis, D.,Beddington, R.S., 2000. The homeobox gene Hex is required in definitiveendodermal tissues for normal forebrain, liver and thyroid formation. Development127, 2433–2445.Mathieu, J., Griffin, K., Herbomel, P., Dickmeis, T., Strahle, U., Kimelman, D., Rosa, F.M.,Peyrieras, N., 2004. Nodal and Fgf pathways interact through a positive regulatoryloop and synergize to maintain mesodermal cell populations. Development 131,629–641.McGrath, K.E., Koniski, A.D., Maltby, K.M., McGann, J.K., Palis, J., 1999. Embryonicexpression and function of the chemokine SDF-1 and its receptor, CXCR4. Dev. Biol.213, 442–456.Mizoguchi, T., Izawa, T., Kuroiwa, A., Kikuchi, Y., 2006. Fgf signaling negativelyregulates Nodal-dependent endoderm induction in zebrafish. Dev. Biol. 300,612–622.Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh, B.K., Hubbard, S.R.,Schlessinger, J., 1997. Structures of the tyrosine kinase domain of fibroblast growthfactor receptor in complex with inhibitors. Science 276, 955–960.Morkel, M., Huelsken, J., Wakamiya, M., Ding, J., van de Wetering, M., Clevers, H., Taketo,M.M., Behringer, R.R., Shen, M.M., Birchmeier, W., 2003. Beta-catenin regulatesCripto- and Wnt3-dependent gene expression programs in mouse axis andmesoderm formation. Development 130, 6283–6294.Morrison, G.M., Oikonomopoulou, I., Migueles, R.P., Soneji, S., Livigni, A., Enver, T.,Brickman, J.M., 2008. Anterior definitive endoderm from ESCs reveals a role for FGFsignaling. Cell. Stem. Cell. 3, 402–415.Mossman, A.K., Sourris, K., Ng, E., Stanley, E.G., Elefanty, A.G., 2005. Mixl1 and oct4proteins are transiently co-expressed in differentiating mouse and humanembryonic stem cells. Stem. Cells Dev. 14, 656–663.Ng, E.S., Azzola, L., Sourris, K., Robb, L., Stanley, E.G., Elefanty, A.G., 2005. The primitivestreak gene Mixl1 is required for efficient haematopoiesis and BMP4-inducedventral mesoderm patterning in differentiating ES cells. Development 132,873–884.Niehrs, C., 2004. Regionally specific induction by the Spemann–Mangold organizer. Nat.Rev. Genet. 5, 425–434.Nostro, M.C., Cheng, X., Keller, G.M., Gadue, P., 2008. Wnt, activin, and BMP signalingregulate distinct stages in the developmental pathway from embryonic stem cellsto blood. Cell. Stem. Cell. 2, 60–71.Pearce, J.J., Evans, M.J., 1999. Mml, a mouse Mix-like gene expressed in the primitivestreak. Mech. Dev. 87, 189–192.Pedersen, I.L., Klinck, R., Hecksher-Sorensen, J., Zahn, S., Madsen, O.D., Serup, P.,Jorgensen, M.C., 2006. Generation and characterization of monoclonal antibodiesagainst the transcription factor Nkx6.1. J. Histochem. Cytochem. 54,567–574.Pedersen, J.K., Nelson, S.B., Jorgensen, M.C., Henseleit, K.D., Fujitani, Y., Wright, C.V.,Sander, M., Serup, P., 2005. Endodermal expression of Nkx6 genes dependsdifferentially on Pdx1. Dev. Biol. 288, 487–501.Poulain, M., Furthauer, M., Thisse, B., Thisse, C., Lepage, T., 2006. Zebrafish endodermformation is regulated by combinatorial Nodal, FGF and BMP signalling. Development133, 2189–2200.Rhinn, M., Dierich, A., Shawlot, W., Behringer, R.R., Le Meur, M., Ang, S.L., 1998.Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrainand midbrain induction and specification. Development 125, 845–856.Rizzo, M.A., Springer, G.H., Granada, B., Piston, D.W., 2004. An improved cyanfluorescent protein variant useful for FRET. Nat. Biotechnol. 22, 445–449.Sachlos, E., Auguste, D.T., 2008. Embryoid body morphology influences diffusivetransport of inductive biochemicals: a strategy for stem cell differentiation.Biomaterials 29, 4471–4480.Saffell, J.L., Williams, E.J., Mason, I.J., Walsh, F.S., Doherty, P., 1997. Expression of adominant negative FGF receptor inhibits axonal growth and FGF receptorphosphorylation stimulated by CAMs. Neuron 18, 231–242.Sander, V., Reversade, B., De Robertis, E.M., 2007. The opposing homeobox genesgoosecoid and Vent1/2 self-regulate Xenopus patterning. EMBO J. 26, 2955–2965.Sasaki, H., Hogan, B.L., 1993. Differential expression of multiple fork head related genesduring gastrulation and axial pattern formation in the mouse embryo. Development118, 47–59.Sato, N., Meijer, L., Skaltsounis, L., Greengard, P., Brivanlou, A.H., 2004. Maintenanceof pluripotency in human and mouse embryonic stem cells through activationof Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med. 10,55–63.Shalaby, F., Rossant, J., Yamaguchi, T.P., Gertsenstein, M., Wu, X.F., Breitman, M.L., Schuh,A.C., 1995. Failure of blood-island formation and vasculogenesis in Flk-1-deficientmice. Nature 376, 62–66.Shapira, E., Marom, K., Yelin, R., Levy, A., Fainsod, A., 1999. A role for the homeobox geneXvex-1 as part of the BMP-4 ventral signaling pathway. Mech. Dev. 86, 99–111.Shawlot, W., Behringer, R.R., 1995. Requirement for Lim1 in head-organizer function.Nature 374, 425–430.Sherwood, R.I., Jitianu, C., Cleaver, O., Shaywitz, D.A., Lamenzo, J.O., Chen, A.E., Golub, T.R., Melton, D.A., 2007. Prospective isolation and global gene expression analysis ofdefinitive and visceral endoderm. Dev. Biol. 304, 541–555.Sinner, D., Rankin, S., Lee, M., Zorn, A.M., 2004. Sox17 and beta-catenin cooperate toregulate the transcription of endodermal genes. Development 131, 3069–3080.Steinbeisser, H., Fainsod, A., Niehrs, C., Sasai, Y., De Robertis, E.M., 1995. The role of gscand BMP-4 in dorsal–ventral patterning of the marginal zone in Xenopus: a loss-offunctionstudy using antisense RNA. Embo J. 14, 5230–5243.Sumi, T., Tsuneyoshi, N., Nakatsuji, N., Suemori, H., 2008. Defining early lineagespecification of human embryonic stem cells by the orchestrated balance ofcanonical Wnt/beta-catenin, Activin/Nodal and BMP signaling. Development 135,2969–2979.Sun, X., Meyers, E.N., Lewandoski, M., Martin, G.R., 1999. Targeted disruption of Fgf8causes failure of cell migration in the gastrulating mouse embryo. Genes Dev. 13,1834–1846.Tada, S., Era, T., Furusawa, C., Sakurai, H., Nishikawa, S., Kinoshita, M., Nakao, K., Chiba, T.,2005. Characterization of mesendoderm: a diverging point of the definitive

304 M. Hansson et al. / Developmental Biology 330 (2009) 286–304endoderm and mesoderm in embryonic stem cell differentiation culture. Development132, 4363–4374.Tam, P.P., Loebel, D.A., 2007. Gene function in mouse embryogenesis: get set forgastrulation. Nat. Rev. Genet. 8, 368–381.ten Berge, D., Koole, W., Fuerer, C., Fish, M., Eroglu, E., Nusse, R., 2008. Wnt signalingmediates self-organization and axis formation in embryoid bodies. Cell. Stem. Cell.3, 508–518.Vincent, S.D., Dunn, N.R., Hayashi, S., Norris, D.P., Robertson, E.J., 2003. Cell fate decisionswithin the mouse organizer are governed by graded nodal signals. Genes Dev. 17,1646–1662.Watabe, T., Kim, S., Candia, A., Rothbacher, U., Hashimoto, C., Inoue, K., Cho, K.W., 1995.Molecular mechanisms of Spemann's organizer formation: conserved growthfactor synergy between Xenopus and mouse. Genes Dev. 9, 3038–3050.Wichterle, H., Lieberam, I., Porter, J.A., Jessell, T.M., 2002. Directed differentiation ofembryonic stem cells into motor neurons. Cell 110, 385–397.Willems, E., Leyns, L., 2008. Patterning of mouse embryonic stem cell-derived panmesodermby activin A/nodal and Bmp4 signaling requires fibroblast growth factoractivity. Differentiation 2, 2.Williams, E.J., Furness, J., Walsh, F.S., Doherty, P., 1994. Activation of the FGF receptorunderlies neurite outgrowth stimulated by L1, N-CAM, and N-cadherin. Neuron 13,583–594.Winnier, G., Blessing, M., Labosky, P.A., Hogan, B.L., 1995. Bone morphogenetic protein-4is required for mesoderm formation and patterning in the mouse. Genes Dev. 9,2105–2116.Yamaguchi, T.P., Harpal, K., Henkemeyer, M., Rossant, J., 1994. fgfr-1 is required forembryonic growth and mesodermal patterning during mouse gastrulation. GenesDev. 8, 3032–3044.Yasunaga, M., Tada, S., Torikai-Nishikawa, S., Nakano, Y., Okada, M., Jakt, L.M., Nishikawa,S., Chiba, T., Era, T., 2005. Induction and monitoring of definitive and visceralendoderm differentiation of mouse ES cells. Nat. Biotechnol. 23, 1542–1550.Ying, Q.L., Nichols, J., Chambers, I., Smith, A., 2003a. BMP induction of Id proteinssuppresses differentiation and sustains embryonic stem cell self-renewal incollaboration with STAT3. Cell 115, 281–292.Ying, Q.L., Stavridis, M., Griffiths, D., Li, M., Smith, A., 2003b. Conversion of embryonicstem cells into neuroectodermal precursors in adherent monoculture. Nat.Biotechnol. 21, 183–186.

Supplementary data, Paper I‘A late requirement for Wnt and FGF signaling ’during activin-inducde formation offoregut endoderm from mouse embryonic stem cells’Developmental Biology, 2009, 330, p. 286 – 304.Mattias Hansson, Dorthe R- Olesen, Janny M.L. Peterslund, Nina Engberg, Morten Kahn,Maria Winzi, Tino Klein, Poul Maddox-Hyttel and Palle SerupFigure S1Figure S1: BMP4 and Activin induction of GFP expression in T Gfp/+ , Mixl1-Gsc Gfp/+ , Gsc Gfp/+ and Sox17 Gfp/+cells. Primary flow cytometry histograms of GFP expression in T Gfp/+ and Mixl1Gfp/+ cells cultured for 3 days withor without 10 ng/ml BMP4 and Gsc Gfp/+ and Sox17 Gfp/+ cells cultured for 5 days in the presence or absence of100 ng/ml activin43

Figure S2Figure S2: A subpopulation of T + cells expresses Mixl1, whereas Gsc + cells express no or low levels of T.Immunofluorescent analyses of T expression in T Gfp/+ (A), Mixl1 Gfp/+ (B) or Gsc Gfp/+ cells (C) grown in adherentculture for 3 or 5 days in the presence of the indicated growth factors. The arrows in (C) indicate areas with high Texpression and low/no Gsc (GFP) expression. (D) Immunofluorescent analyses of Foxa2 and E-cad expression inT Gfp/+ (a–d), Mixl1 Gfp/+ (e–h), or Gsc Gfp/+ cells (i–l) after activin treatment.44

Figure S3Figure S3: ES cell progeny treated with activin express markers of definitive endoderm and not visceralendoderm. (A) Flow cytometric analysis of CXCR4 expression in Mixl1 Gfp/+ cells grown for 5 days with or without100 ng/ml activin. Mouse embryonic day (E)11 head tissue was used as control. (B, C) RT-PCR analysis for Sox7expression in T Gfp/+ cells (B) and Sox17, Pyy, Sox7 and Tdh expression in Flk1 LacZ/+ cells (C). Cells were cultured in0, 3 or 100 ng/ml activin, 10 ng/ml BMP4, 100 ng/ml Wnt3a or 100 ng/ml activin + 100 ng/ml Wnt3a for 5 days asindicated. E7 mouse embryo cDNA was used as positive control and expression of Tbp and G6pd was analyzed asreference genes.45

Figure S4Figure S4: Expression of TGF-β, Wnt and FGF signaling components during directed differentiation of EScells. RT-PCR analysis of T Gfp/+ cells cultured for 3 or 5 days in medium containing growth factors and/or inhibitor,as indicated. The expression of components of the nodal/activin, BMP, Wnt and FGF signaling pathway wasanalyzed. The expression of Tbp was analyzed as reference gene.Opposite, Figure S5: Wnt signaling is inhibited by addition of Dkk1 to activin-stimulated SuTOP-CFP cellscultured for 3 and 5 days. (A) Chimeric E10.5 embryo recovered after blastocyst injection of SuTOP-CFP EScells. Note CFP expression at sites known to harbor active Wnt signaling at this stage including the otic vesicle(white arrow), optic vesicle (white arrowhead), tail bud (red arrow), and somites and dorsal neural tube (redarrowhead). (B) SuTOP-CFP cells were cultured in the presence of 100 ng/ml activin for 3 days and supplementedwith 100 ng/ml Wnt3a or 320 ng/ml Dkk1 for a variable number of days as indicated. Scale bar is 80 µm. (C)SuTOP-CFP cells were cultured in the presence of 100 ng/ml activin for 5 days and supplemented with 100 ng/mlWnt3a or 320 ng/ml Dkk1 for a variable number of days as indicated in the figure. “–” indicates treatment withactivin alone. Scale bar is 200 µm.46

Figure S547

Figure S6Figure S6: qRT-PCR analyses of activin-stimulated ES cells after inhibition of Wnt signaling. Gsc Gfp/+ cells werecultured in 100 ng/ml activin for 5 days and (A) transfected with β-catenin siRNA as indicated or (B) treated withDkk1 as indicated. At the end of day 5 of the culture period RNA was prepared and qRT-PCR was performed tomeasure the relative abundance of Lhx1 and Chrd message.48

4. Pxd1 inductionBackgroundThe work shown in Figure 12 of paper I was performed by Nina Engberg and me incollaboration. We worked together with other members of the lab on patterning the naïve DEinduced by high concentrations of activin. In this chapter, I will show additional data on thispatterning performed by myself, and refer to data performed by other members of the lab.The motivation behind this project departs from work by Mattias Hansson and Dorthe R.Olesen showing that they could differentiate mES cells to DE after 5 days of culture in 100ng/ml activin, referred to as ‘Step 1’ of the differentiation protocol. This DE was believed to beof a naïve type, as it did not stain positive for regional markers of the gut tube, such as SOX2,PDX1, NKX6.1 or CDX2 (Figure 4-1). We proposed that the DE could be patterned into cellsresembling posterior foregut endoderm, the region from which the pancreatic outgrowth occurs,when presented to the correct inducing signal.Figure 4-1: A high concentration of activin in Step 1 induces naïve DE. Flk1-LacZ cells were differentiated for 5days in 100 ng/ml activin and both differentiated cells mouse and tissue was stained for whole endoderm andregional markers: FOXA2, SOX2, PDX1, NKX6.1, CDX2 and the nuclear stain DAPI. Mattias Hansson,unpublished data.To pattern this naïve DE into posterior foregut endoderm, referred to as ‘Step 2’ of thedifferentiation protocol, we relied on data from mouse and chicken development. We chosespecific genes regionally expressed along the anterior-posterior (A-P) axis of the gut tube asmarkers of cell fate. These were Sox2, expressed anterior to the pancreatic region; Pdx1,expressed in the duodenum and pancreatic regions; Nkx6.1, expressed in the pancreatic49

epithelium; Cdx2, expressed posterior to the pancreatic region. Foxa2, expressed throughout thegut tube, was used as a marker for DE-derived cell types (see also Figure 1-3; (Grapin-Bottonand Melton 2000; Jorgensen et al. 2007)).In the embryo, endoderm cells are patterned by signalling events within the endoderm or fromthe mesoderm. Activin has an anteriorising effect on both endoderm formation and patterningwhereas WNT3a has a posteriorising effect on PS-formation and cell specification duringgastrulation (Grapin-Botton and Melton 2000). Dessimoz and co-workers showed that inchicken embryos, FGF4 also has a posteriorising effect starting during gastrulation andpersisting through the early somite stages (Dessimoz et al. 2006). FGF-signalling is necessaryfor restricting anterior expressed genes and for establishing midgut gene expression. Retinoicacid (RA) is implicated in the development of tissues in all three germ layers. In mES celldifferentiation, it is often used to induce cells of a neural type (Okada et al. 2004). In ES cellaggregates, RA has been shown to induce Pdx1-expressing cells (Micallef et al. 2005), and inendoderm patterning towards pancreatic cell types it is used in both mouse and human ES cellprotocols (D'Amour et al. 2006; Micallef et al. 2007; Borowiak and Melton 2009).Materials and MethodsWe cultured and analysed cells as described in Hansson et al., 2009. Below are additions to themethods and materials described.Cell culture and differentiationWe used the following mES cell lines: Sox2-LacZ (Li et al. 1998) and Pdx1-GFP (Holland etal. 2006). We added KAAD-cyclopamine (Toronto Research Chemicals) and FGF10 (R&DSystems) to the differentiation medium.RT-PCRRT-PCR was performed using the primer sequences: Pdx1F_AAATTGAAACAAGTGCAGGT, R_GACAGTTCTCCACTGCTCTC; GAPDH F_CGGTGCTGAGTATGTCGTGGA, R_ GGCAGAA GGGGCGGAGATGA.ResultsWe applied a 2-step protocol for the patterning of our DE:‘Step 1’ – DE induction: 5 days in 30 – 100 ng/ ml activin, seeding density of 2.000 cells/ cm 2‘Step 2’ – Pdx1 induction: 3 – 5 days in a combination of growth factors and inhibitors50

Figure 4-2: WNT3a and FGF4 in Step 2 induce anterior gut tube cells. Sox2-LacZ cells differentiated for 5 daysin 100 ng/ml activin (Step 1) and 3 days in 5 ng/ml WNT3a + 10 ng/ml FGF4 (Step 2) were stained for β–Galactosidase and imaged under 10× objective.Figure 4-3: Increasing the FGF4-concentration does not result in posterior foregut-type cells. Flk1-LacZ cellsdifferentiated for 5 days in 100 ng/ml activin (Step 1) and 3 days in 25 ng/ml WNT3a ± 10 or 100 ng/ml FGF4(Step 2) were stained for FOXA2, SOX2, and PDX1. 20× objective.FGF4 and WNT3a alone induce cells resembling anterior or posterior gut tubeThe first attempts to pattern our DE into cells of a pancreatic type was done by addition of 0, 10or 100 ng/ml FGF4 and/ or 0, 5 or 25 ng/ml WNT3a to the basic medium for 3 days.51

Figure 4-4: A high FGF4-concentration induces CDX2 + posterior gut tube. Flk1-LacZ cells differentiated for 5days in 100 ng/ml activin (Step 1) and 3 days in 25 ng/ml Wnt3a + 0, 10 or 100 ng/ml FGF4 (Step 2) were stainedfor FOXA2 and CDX2. 20× objective, scale bar indicates 50 µm.This resulted in numerous Sox2-LacZ + and SOX2 + cells as seen by β-Galactosidase stain andimmune-cytochemistry, respectively (Figures 4-2 and 4-3). Variation in the concentrations ofFGF4 and WNT3a did not seem to influence the numbers of Sox2-LacZ + or SOX2 + cells, aslong as both factors were present. We saw vast numbers of FOXA2 + cells throughout theconditions applied (Figure 4-3). FGF4 and WNT3a did not induce PDX1 + cells under anyconditions (Figure 4-3), but high concentrations of FGF4 in combination with WNT3a (5 or 25ng/ml) induced CDX2 + clusters in the culture (Figure 4-4). To be sure that we did not miss aweak expression of Pdx1 in the samples, we performed RT-PCR and saw only the housekeepinggene Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) expressed (Figure 4-5).Thus, we concluded that FGF4 and WNT3a either alone or in combination were not enough todrive patterning of the DE into Pdx1-expressing posterior foregut cell types. We saw vastnumbers of Sox2-LacZ + and SOX2 + cells, indicative of an anterior DE-type. CDX2 wasinduced by 100 ng/ml FGF4, suggesting that this concentration is too high when aiming atPDX1-induction.52

Figure 4-5: Pdx1 cannot be detected by RT-PCR. RT-PCR for Pdx1 on E18,5 mouse pancreas and β-TC3, i.e.positive controls and Flk1-LacZ cells differentiated for 5 days in 100 ng/ml activin (Step 1) and 3 days in 25 ng/mlWNT3a ± 10 or 100 ng/ml FGF4 (Step 2). Gapdh is used as a house-keeping gene control. Loading in theindividual wells is described next to the agarose gel images.RA in combination with WNT3a and FGF4 induces posterior foregut cellsAs shown in paper I, figure 12, we could induce PDX1-expression by addition of 0.1 µM RAand intermediate levels of WNT3a (5 ng/ ml) and FGF4 (10 ng/ml) to Step 2 of thedifferentiation protocol. Under these conditions, we saw a vast number of FOXA2 + /SOX2 +cells and no CDX2-expressing cells. This indicates that RA, in combination with WNT3a andFGF4, induces cells of an anterior-intermediate gut fate expressing FOXA2 and SOX2 orPDX1, but no CDX2.Prolonged differentiation does not increase Pdx1-inductionTo be able to quantify the numbers of PDX1 + cells, we used a Pdx1-GFP cell line (Holland etal. 2006) and applied our 2-step protocol to this. We included KAAD-cyclopamine(cyclopamine; an inhibitor of SHH-signalling) in this protocol, as inhibition of SHH has provencrucial for Pdx1-induction in the developing gut tube (Hebrok et al. 1998).We generally saw induction of 2-4% Pdx1-GFP + cells when applying our standard protocol of0.1 µM RA, 5 ng/ml WNT3a and 10 ng/ml FGF4 (data not shown). This was not satisfactoryfor continued differentiation towards posterior foregut endoderm, and we speculated whetherour DE was still to immature to be patterned after 5 days of DE-induction. Thus, we introducedan extra step between endoderm induction and patterning: two days of culture with or withoutpatterning factors FGF10 and cyclopamine followed by combinations of RA, FGF10 andcyclopamine. In general, we saw a very low induction of Pdx1-GFP + cells in all conditions,ranging from 0,5-4% (Figure 4-6). There was a tendency for more Pdx1-GFP + cells with anincrease in factors applied, the combination of all three being the most potent. Also, the cellsgrown in FGF10 and cyclopamine in step 2 showed higher numbers of Pdx1-GFP + cells ingeneral. There seems to be little endogenous SHH-signalling in the DE cell population, asinhibition thereof did not improve our protocol. However, with a total amount of 2-4% Pdx1-GFP + cells, this protocol needs further optimization.53

Figure 4-6: A 3-step protocol does not enhance the numbers of Pdx1-GFP + cells. Pdx1-GFP cells differentiatedfor 5 days in 30 ng/ml activin (Step 1), 2 days in Step 2A-media and 3 days in Step 2B-media (see schematic fordetails). Concentrations used: 0,1 µM RA; 25 ng/ml FGF10; 0,25 µM KAAD-Cyclopamine (Cyc). n = 3 ± S.E.M.is shown.Figure 4-7: Addition of the posteriorizing factor BMP4 in Step 1 does not increase Pdx1-GFP induction. Pdx1-GFP cells differentiated for 5 days in 30 ng/ml activin (Step 1) and 3 days in Step 2-media (see schematic fordetails). Concentrations used: 0,1 or 1 ng/ml BMP4; 0,1 µM RA; 25 ng/ml FGF7; 1 µM SB431542; 50 mg/mlNoggin. n = 3 ± S.E.M. is shown.Posteriorising DE-induction does not increase the posterior foregut cell populationWe decided to look into whether the DE we generated by a high concentration of activin couldbe posteriorized already in Step 1, thus leading to higher numbers of posterior foregutendoderm in Step 2. Based on DE-induction protocols used for mES or hES cells, we addedBMP4 at different concentrations in Step 1 and inhibited this signalling-pathway in Step 2(Candy H.-H. Cho, personal communication; (Morrison et al. 2008; Touboul et al. 2009)). InStep 1, we found that BMP4-concentrations of 0,1 ng/ml on days 1-2 or 1-5, or 1 ng/ml on days1-2 had no inhibitory effect on the percentage of Sox17-GFP + cells formed, whereas higherBMP4-concentrations did (Maria Winzi, unpublished data). Next, we used these concentrationsin Step 1 and added FGF7 and RA ± the BMP4-inhibitor noggin and the ALK4/5/7 inhibitorSB431542. We saw a tendency for increased numbers of Pdx1-GFP + cells when adding the lowconcentration of BMP4 for all 5 days or the high concentration for 2 days (Figure 4-7).However, the percentage of Pdx1-GFP + cells was not significantly higher than when inducing54

DE in medium containing activin only. We therefore conclude that addition of BMP4 has noposteriorising effect on our DE in this system.DiscussionOur protocol for the generation of posterior foregut from an activin-induced DE cell populationis successful as a ‘proof of principle’. We show that addition of posteriorising factors such asRA and FGF induce PDX1-expression in further differentiation of apparently naïve DE cells.The protocol is reproducible between E14, Pdx1-LacZ and Pdx1-GFP cell lines, in which weobtain 2-4% PDX1 + cells on average. However, attempts to increase the efficiency of Pdx1-induction proved difficult and the protocol is therefore not satisfactory for further differentiationinto pancreatic endoderm.It seems that there is a fundamental problem in our protocol setup, as we have had little successin improving the number of PDX1 + cells. One source of problems could be connected to ourculture conditions. We use B27 which contains glucocorticoids that have been shown to inhibitPdx1-expression (Tanimizu et al. 2004). Another issue is timing; we see the highest inductionof Pdx1-GFP + cells after 3 days of culture in Step 2 media, and introducing an extra 2 days ofdifferentiation does not increase the numbers of Pdx1-GFP + cells. However, 3 days seem to bea rather short induction period compared to other protocols. D’Amour and co-workers grewhES cell-derived DE for 4-8 days to differentiate them to posterior foregut (D'Amour et al.2006).The rationales on which we have built our inducing factor-combinations seem reasonable, asstudies performed in hES cells using FGF4 and RA showed an induction of 32% PDX1 + cellsfrom DE-cultures (Johannesson et al. 2009). Also, intermediate concentrations of FGF2 wereshown to induce pancreatic foregut specification, whereas higher concentrations induced amore posterior gut type (Ameri et al. 2010).In conclusion, we show that by addition of RA and FGF we can successfully induce PDX1 +cells, albeit in low numbers. This protocol lays the ground for further optimization, althoughthis may prove difficult in the current culture conditions.55

5. Paper IIFGFR(IIIc)-activation induces mesendoderm but is dispensable for definitiveendoderm formation in mouse embryonic stem cellsManuscript to be submitted.Janny Marie L. Peterslund and Palle Serup*Department of Stem Cell Biology, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark. * Corresponding author.Author contributionsJanny Marie L. Peterslund performed the experiments, analyzed and interpreted the data, madethe figures and wrote the paper draft. Palle Serup conceived ideas, commented on the paper andwas the principal investigator and supervisor on the research. Both authors designed theresearch and discussed the results.For co-authorship declaration, see Appendix B.57

FGFR(IIIc)-activation induces mesendoderm but isdispensable for definitive endoderm formation in mouseembryonic stem cellsJanny Marie L. Peterslund and Palle Serup*Department of Stem Cell Biology, Hagedorn Research Institute, Niels Steensens Vej 6, DK-2820 Gentofte, Denmark.Running title: FGF(R)s and mesendoderm differentiation in mESCsKeywords: mouse embryonic stem cell, fibroblast growth factor (FGF), FGF receptors,mesendoderm, definitive endoderm, FGF4 –/– cell line*Corresponding author:Dr. Palle SerupHagedorn Research InstituteNiels Steensens Vej 6DK-2820 GentofteDenmarkE-mail: pas@hagedorn.dkPhone: +45 44439822Fax: +45 4443800058

AbstractProgress in embryonic stem (ES) cell research over the last decade has outlined a possible cellbased intervention strategy in diabetes based on the hierarchical differentiation of embryonicstem cells into insulin producing beta cells. The definitive endoderm (DE) cell type constitutesan essential milestone in this differentiation pathway and fibroblast growth factor (FGF)-signaling drives the formation of DE in the mouse ES cell model system. More specifically, ithas been shown that FGF4 is crucial for cells to leave the pluripotent state and differentiate toectoderm and mesoderm cell lineages. The FGF system counts several receptor isoforms with apossible functional redundant role in conducting the differentiation signal. Here, we investigatethe spatio-temporal dynamics of FGF receptor (FGFR) distribution in the forming DE and findthat FGFR(III)c-isoforms are highly represented in the whole culture, whereas FGFR2(III)band FGFR4 are found in the DE fraction, specifically. The FGFR(III)c isoform-activating FGFsinduce mesendoderm markers T and Gsc, but reduce the DE marker Sox17 whereas FGFsactivating FGF(III)b-isoforms have no effect on either cell type. Notably, FGFR(III)c isoformactivatingFGFs exhibit strong mitogenic effects on ES cells early in the differentiation periodwhere FGFs activating FGFR(III)b-isoforms have only a moderate mitogenic potentialconfined to the late differentiation period. Interestingly, when applying our DE inductionprotocol onto an FGF4 –/– cell line, we find that cells readily differentiate into endoderm cellswithout ectopic administration of FGF4. By antibody staining and qPCR analyses for definitiveand visceral endoderm markers, we show that this endoderm is definitive rather than visceral.We conclude that FGFR(III)c-isoform activation selectively drives the differentiation of mEScells towards mesendoderm and that FGF4 is dispensable for the final differentiation step intoDE.59

IntroductionBased on knowledge obtained in developmental biology, mouse embryonic stem (mES) cellscan be directed towards differentiation into specific germ layers and more mature tissues. Sucha differentiation into glucose-responsive β cell-like insulin-secreting cells, serves in theory as acure for type I diabetes mellitus (McCall et al. 2010). For this purpose, the first step is togenerate definitive endoderm (DE) with the potential to further differentiate into cellsresembling the primitive gut tube (reviewed by (Van Hoof et al. 2009)). Understanding the roleof each component used in this directed differentiation is crucial for obtaining the optimalprogenitor cell population in each step.In the late blastocyst stage of the developing mouse embryo (E4.5), the inner cell mass (ICM) isdivided into the epiblast and the primitive, later visceral endoderm. The visceral endoderm(VE) is involved in the asymmetric anterior-posterior patterning of the epiblast, resulting in theonset of gastrulation (reviewed by (Rossant 2004)). In the gastrulating mouse embryo, epiblastcells migrate through the primitive streak (PS), and in this process become determined towardseither mesoderm or DE germ layers (Lawson et al. 1991; Tam et al. 1993; Carey et al. 1995).The transforming growth factor-β family member nodal, an activator of SMAD2/3 signalling, isthe main initiator of epiblast patterning and PS formation (Conlon et al. 1994; Waldrip et al.1998). At high levels, nodal induces anterior PS structures and DE and at low doses it inducesmore posterior streak fates (Ben-Haim et al. 2006). At the posterior-most end of the PS, bonemorphogenetic protein 4 (BMP4) is produced by the extra-embryonic ectoderm and establishesa signal gradient. BMP4 is critical for formation of the PS and induces mesoderm formation(reviewed by (Gadue et al. 2005)). It is currently accepted that cells in the mesoderm andendoderm tissues arise from a common progenitor cell population, the mesendoderm (Lawsonet al. 1991; Kinder et al. 2001). The PS marker Brachyury (T) is expressed in the nascent andmigrating mesoderm of the primitive streak during gastrulation in the mouse embryo (Kispertand Herrmann 1994). Goosecoid (Gsc) is located in the progressing primitive streak at E6.5,and later localizes to the anterior streak, from which the DE arises (Blum et al. 1992). It isinduced by high concentrations of activin in animal cap explants from Xenopus and in mEScells, it is used as a marker for the mesendoderm cell population (Kubo et al. 2004; Gadue et al.2006). Sry-related HMG box gene 17 (Sox17) is an early marker specifically expressed in thedefinitive endoderm of the gastrula, and later expands to the endoderm underlying the neuralplate of the early-bud-stage embryo (Kanai-Azuma et al. 2002). Sox17 is also expressed in theextra-embryonic, but not in the embryonic visceral endoderm.In mES cell cultures, cells take on a mesendoderm-type fate before being committed to eitherthe mesoderm or DE lineages (Tada et al. 2005). ActivinA (activin hereafter) is used as asurrogate for nodal as they both activate SMAD2/3 signalling by binding to the ALK4 receptor,thus functioning in the same manner (Schier 2003). In the mesendoderm population, highconcentrations of nodal/ activin-signalling induce anterior streak and DE cells while BMP4 orlow concentrations of nodal/ activin induce posterior streak or mesoderm (Kubo et al. 2004;Willems and Leyns 2008; Hansson et al. 2009). The PS genes T, Mix-like 1 (Mixl1) and Gsc areexpressed in this population in response to increasing concentrations of activin. High activinlevelsfurther induce the DE markers Sox17, E-cadherin and Forkhead box A2 (Foxa2). BMP4induces T, Mixl1 and the mesodermal marker Fetal like kinase 1 (Flk1; VEGFR2/ Kdr; (Gadueet al. 2005)). During mES cell differentiation, T-expressing cells give rise to endoderm andmesoderm derivatives (Kubo et al. 2004) and we have previously shown that a T-GFP reportercell line (T Gfp/ + ; (Fehling et al. 2003)) can be activated by BMP4 and a low concentration ofactivin (Hansson et al. 2009).For the differentiation of mesendoderm and DE to occur properly in mES cells, fibroblastgrowth factor (FGF)-signalling is required (Funa et al. 2008; Morrison et al. 2008; Willems andLeyns 2008; Hansson et al. 2009). The FGF family of proteins consists of 22 members namedFGF1-23 (FGF15 is the mouse ortholog of human FGF19). They activate one or more of fourreceptor tyrosine kinases, the FGF receptors (FGFRs)1-4. FGFRs1-3 have two secreted splice60

variants in their Ig-like domain III, the FGFR(III)b or FGFR(III)c isoforms (hereafter FGFRbor FGFRc, respectively; (Ornitz and Itoh 2001; Itoh and Ornitz 2004)). FGFs are involved inmany functions such as germ layer formation, limb development, cell proliferation and cellmigration in the developing embryo (Ornitz and Itoh 2001). In early mouse development, FGFsignallingis necessary for the migration of epiblast cells through the PS (Ciruna et al. 1997;Guo and Li 2007). The loss of FGF4 is lethal at E4-5, due to the inability of epiblast cells toundergo epithelial-to-mesenchymal transition and migrate through the PS (Feldman et al.1995). FGFR1 –/– mice also die at gastrulation and both FGF4 and FGFR1 are expressed in theICM and PS (Deng et al. 1994; Yamaguchi et al. 1994). FGF4 is expressed in pluripotent mEScells and has been shown to be necessary for differentiation into ectoderm and mesodermlineages, suggesting a crucial role of FGF4 in the initiation of differentiation (Kunath et al.2007). However, Wilder et al. showed that FGF4 –/– cells could differentiate in vitro, albeit at alow frequency, and gave rise to tumours consisting of a wide range of differentiated cell typesin vivo (Wilder et al. 1997).In this study, we expand on our previous finding that active FGF-signalling is necessary for DEformation (Hansson et al. 2009), and investigate the effects of different FGFR-isoforms onmesendoderm and DE differentiation. We first analyse the expression patterns of FGFRisoformsin the forming DE and find that FGFRc-isoforms are up-regulated in the bulk culturewhereas FGFR2b and 4 are up-regulated specifically in the DE-fraction. By means of reportercell lines and antibody staining, we find that FGFs activating primarily FGFRc-isoforms inducePS and mesendoderm markers T and Gsc but reduce the DE marker Sox17. FGFs activatingFGFRb-isoforms have no effect on either cell type. The FGFRc isoform-activating FGFs showthe highest mitogenic effects early in the differentiation period, and suggestively speeds updifferentiation, as proliferation rates in the presence of these FGFs are reduced later in theculture period. Remarkably, an ES cell line carrying a knockout for one such FGFRc isoformactivatingFGF, FGF4 –/– was able to differentiate to endoderm cells at levels comparable to wtand FGF4 +/– situations. The absence of FGF4 gave rise to DE differentiation, and although afew cells stained positive for the VE marker Sry-related HMG box 7 (SOX7), qPCR analysesconfirmed the DE fate of the culture. Thus, we conclude that FGFRc-isoforms specify themesendoderm but not DE cell population and that FGF4-signalling is dispensable for inductionof DE cells.Materials and MethodsCell culture and differentiation of mESCsWe used the following mouse ES cell lines: E14 (Hooper et al. 1987), T-GFP (Fehling et al.2003), Gsc-GFP (Tada et al. 2005), Sox17-GFP (Kim et al. 2007), FGF4 +/– and FGF4 –/–(Wilder et al. 1997). Cells were grown as previously described (Ying et al. 2003a; Hansson etal. 2009) on cell culture plastic ware (Nunc) coated with 0,1% gelatine (Sigma), using 0,05%Trypsin-EDTA (Invitrogen) for dissociation of cells during passage. Trypsin was inactivated byN2B27 medium: KO-DMEM supplemented with N2, B27, 0.1 mM non-essential amino acids,2 mM L-glutamine, Penicillin/Streptomycin (all from Invitrogen), 0.1 mM 2-mercaptoethanol(Sigma-Aldrich). Cells were grown for at least 3 passages before onset of differentiation.For differentiation purposes, cells were dissociated into single cells and seeded at 2.000 cells/cm 2 in N2B27 medium containing one or more of the following growth factors: BMP4 (10ng/ml), activinA (1 or 30 ng/ml; both from R&D Systems), FGF1 (100 ng/ml; ChemiconInternational), FGF2 (100 ng/ml; Invitrogen), FGF4, FGF5, FGF6, FGF7, FGF8b, FGF8c,FGF8e, FGF9, FGF10, FGF16 (5 or 100 ng/ml; all from R&D Systems). Media containingFGFs were supplemented with 10 µg/ml heparan sulfate (Sigma-Aldrich).Flow cytometryFor GFP-analysis of reporter cell lines, live cells were dissociated into single cells by 0,05%Trypsin-EDTA (Invitrogen) and analysed by FACS Calibur flow cytometer (BD Biosciences).61

For analysis of cells stained with antibodies, cells were fixed in LILLY’s fixative (Bie &Berntsen), and resuspended in 0,1% BSA in PBS. Cells were stained in 0,1% BSA in PBS for 2hrs at 4°C with Flk1-PE (BD Pharmigen, # 555308) and EpCAM-PE-Cy7 (eBioscience, # 25-5791-80). Or cells were permeabilised in dilution buffer (0,3% Triton X-100 + 0,1% BSA inPBS), unspecific binding sites were blocked by 10% Normal Donkey Serum (JacksonImmunoresearch Laboratories) for 30 minutes at RT and stained for Brachyury (R&D Systems,# AF2085) for 2 hours at RT in dilution buffer, followed by a Cy3-conjugated secondaryantibody (Jackson Immunoresearch Laboratories, # 705-165-147) for 1 hour at RT. Cells wereanalysed by FACS Aria flow cytometer (BD Biosciences).Cell sortingCells were dissociated by 0,05% Trypsin-EDTA (Invitrogen), washed and resuspended inN2B27 medium before sorting by FACS Aria flow cytometer (BD Biosciences).Immunofluorescent stainingCells were grown in 9 cm 2 slide flasks (Nunc) coated with 0,1% gelatine (Sigma) and fixed inLILLY’s fixative (Bie & Berntsen), permeabilised in dilution buffer (see above) and blockedfor 30 minutes at RT in 10% Normal Donkey Serum (Jackson Immunoresearch Laboratories)in dilution buffer. They were stained ON at 4°C with primary antibodies: mouse anti-Oct3/4(C-10), goat anti-Foxa2 (both Santa Cruz Biotechnology), goat anti-Brachyury (R&DSystems), rat anti-E-cadherin (Zymed/Invitrogen), goat anti-Sox17 (R&D Systems), and 1 hrwith Cy2-, Cy3- or Cy5-conjugated species-specific secondary antibodies (JacksonImmunoResearch Laboratories) and 4′,6-diamidino-2-phenylindole (DAPI, MP Biomedicals).Slides were mounted in Fluorescent mounting medium (KPL). Negative controls, where theprimary antibodies were omitted, were included for all stainings and showed no unspecificstaining of the secondary antibodies (data not shown). The slides were analyzed using an LSM510 META laser scanning microscope (Carl Zeiss).qPCRCells were harvested in Lysis solution (Invitek), supplemented with 10 mM dithiothreitol(DTT). Total RNA was isolated using the Invisorb Spin RNA kit (Invitek) with DNAsetreatment (Promega) following the manufacturer’s protocol. cDNA was prepared from 250 ngRNA using MMLV Reverse Transcriptase (Invitrogen) with random oligos or oligo(dT) 12-18primers (both Invitrogen).qPCR was performed using the standard SYBR ® Green program with dissociation curve on theMx3005P (Stratagene). PCR reactions were run in duplicates using 10 µl Brilliant ® SYBR ®Green qPCR Master Mix (Stratagene), 1 µl cDNA, 1 µl 20 µM primer-mix and 8 µl dH 2 O.Quantified values for each gene were normalized against the housekeeping gene TATAbindingprotein (TBP). Statistical analyses were performed using Student’s two-tailed, paired t-test. Primer sequences are: FGFR1c F_CCGTATGTCCAGATCCTGAAGA,R_GATAGAGTTACCCGCCAAGCA; FGFR2c F_GCCCTACCTCAAGGTTCTGAAAGR_GATAGAATTACCCGCCAAGCA; FGFR3c F_CCCTACGTCACTGTACTCAAGACTGR_GTGACATTGTGCAAGGACAGAAC; FGFR4 F_CGACGGTTTCCCCTACGTACAR_TGCCCGCCAGACAGGTATAC (all from (Woei Ng et al. 2007); FGFR1bF_CTTGACGTCGTGGAACGATCT, R_CACGCAGACTGGTTAGCTTCAC (Nakayama etal. 2007); FGFR2b F_AACGGGAAGGAGTTTAAGCAG,R_GGAGCTATTTATCCCCGAGTG (Yamanaka et al. 2000); Sox17F_GGAGGGTCACCACTGCTTTA, R_TCAGATGTCTGGAGGTGCTG; Cxcr4F_AGGTACATCTGTGACCGCCTTT, R_ AGACCCACCATTATATGCTGGAA (Kim etal. 2008); Sox7 F_GGCAGTGCAGAACCCGGACC, R_TGCAGAGGCGCTTGCCTTGT;Tdh F_ CCTGGAGGAGGAACAACTGACTA, R_ ACTCGAATGTGCCGTTCTTTG(Wang et al. 2009); TBP F_TCTGAGAGCTCTGGAATTGT,R_GAAGTGCAATGGTCTTTAGG.62

Cell count and proliferation assayCells were fixed in LILLY’s fixative (Bie & Berntsen) and counted in a NucleoCassette read bythe NucleoCounter (ChemoMetec A/S) according to the manufacturer’s protocol for countingnon-living cells.As a proliferation assay, EdU-incorporation by the Click-iT® EdU HCS Assay (Invitrogen)was used (Salic and Mitchison 2008). Cells were incubated for 15 min in their respective mediacontaining 10 µM EdU. Cells were washed, fixed and stained by the Click-iT reaction cocktailaccording to the manufacturer’s protocol, using the Alexa Fluor 488-conjugated antibody todetect incorporation. Stained cells were quantified using the FACS Aria flow cytometer (BDBiosciences).StatisticsMean % of the cells of interest ± standard deviation or standard error of the mean (S.D. orS.E.M.) was calculated and statistical analyses by Student’s paired, two-tailed t-test or Ratio t-test were performed.ResultsExpression of FGF receptor-isotypes during definitive endoderm formationRecently, we and others have shown that fibroblast growth factor (FGF)-signalling in mouseembryonic stem (mES) cell cultures is necessary for the differentiation of definitive endoderm(DE; (Funa et al. 2008; Morrison et al. 2008; Willems and Leyns 2008; Hansson et al. 2009)).These studies are based on a general requirement for active FGF-signalling during early mousedevelopment where FGF3, 4, 5, 8b and FGFR1 are expressed in the epiblast to post-gastrulationembryo (Wilkinson et al. 1988; Haub and Goldfarb 1991; Hebert et al. 1991; Niswander andMartin 1992; Ciruna et al. 1997; Guo and Li 2007). To elaborate on the observed dependenceon FGF-signalling during DE formation, we made a thorough investigation of the expression ofisoforms of FGFRs during the 5-day differentiation period by quantitative RT-PCR (qPCR).We used a Sox17 Gfp/ + reporter cell line (Kim et al. 2007) and sorted cells into Sox17-GFP Hi andSox17-GFP Lo fractions, in order to isolate RNA from the forming DE and the non-DEpopulations of cells, respectively (Figure 1A). In general, FGFR1c was expressed at high levels,FGFR2b and 2c at intermediate levels and FGFR1b, 3c and 4 at low levels. During the 5-daydifferentiation period, FGFR2b and 4 were up-regulated in the unsorted and Sox17-GFP Hifractions while their expression was either unchanged or down-regulated in the Sox17-GFP Lofractions (Figure 1B). FGFR1b was down-regulated in both the unsorted and Sox17-GFP Lofractions upon initiation of differentiation, although not significantly different from theundifferentiated culture. These data confirm findings by other groups, showing that FGFR2band 4 are expressed in endodermal epithelia such as the definitive endoderm (Stark et al. 1991;Orr-Urtreger et al. 1993; Elghazi et al. 2002). FGFR1c was upregulated in the Sox17-GFP Lofraction alone, peaking on day 5, whereas FGFR2c and 3c were up-regulated in both Sox17-GFP Lo and Sox17-GFP Hi fractions, upon differentiation by activin (Figure 1B). In summary,FGFRc-isoforms are highly up-regulated throughout the cell culture or in the Sox17-GFP Lofraction alone, whereas FGFR2b and 4 are up-regulated in the Sox17-GFP Hi fractionspecifically, suggesting a role for especially FGFRc isoform-activation during DE formation inmES cells.FGFs activating specific sub-populations of FGFRs differentially activate PS and DEmarkersSince FGFs activate specific FGFR-isofoms, we speculated that certain FGFs were likely tohave a more potent effect on expression of PS and DE markers in a culture system aimed atinducing such cell types. We chose to focus on FGFs that are described to have a functionduring gastrulation and in the development of the DE and based on which FGFRs they activate63

they were divided into three categories (Figure 2A; (Ornitz et al. 1996; Bottcher and Niehrs2005; Zhang et al. 2006)). FGF1, 2 and 9 activate a mixed population of both FGFRb- andFGFRc-isoforms, with a preference for the latter; FGF7 and 10 activate FGFRb-isoforms only;and FGF4, 5, 6, 8b, 8c, 8e and 16 activate one or more FGFRc-isoforms and/ or FGFR4(MacArthur et al. 1995; Ornitz et al. 1996; Olsen et al. 2006; Zhang et al. 2006; Mason 2007).FGFR4 is grouped with the FGFRc-type of receptors, based on the fact that it structurallyresembles this group of FGFRs (Vainikka et al. 1992). Importantly, most FGFs activatingFGFRc-isoforms also activate the FGFR4 (Mason 2007), making it also functionally anFGFRc-type. To evaluate the effect of the different FGFs in mesendodermal differentiation, wemonitored at the expression of PS and DE markers by means of reporter cell lines on days 3and 5.Accordingly, we induced mesoderm by 10 ng/ml BMP4 and added different FGFs to evaluatetheir effect on the PS marker T Gfp/ + cell line expression. FGF1, 2, 4, 6 and 9, binding a mixedpopulation of FGFRs or FGFRc-isoforms only, increased the number of T-GFP + cells on day 3by up to 20% compared to BMP4-treatment alone, i.e. 79 – 83 ± 6 – 10% and 69 ± 6%,respectively (mean % ± S.D., n=3; Figure 2B). FGF7 and 10 had no significant effect on T-GFP induction, nor did FGF8b, 8c, 8e or 16, but FGF5 slightly repressed T-induction (Figure2B). Looking at the same marker in a posterior streak/ mesoderm-inducing protocol, using 1ng/ml activin, we saw that FGF4 and 6 show a 31 – 42% increase in T-GFP induction on day 3(Figure 2C), while FGF5 and 10 show a smaller increase. FGF1, 2, 4, 6 and 9 induced numbersof T-GFP + cells by up to 34% on day 5. FGF7, 8b, 8c, 8e and 16 showed no effect on thenumbers of T-GFP + cells on either day 3 or 5. Thus, the largest effect was seen when addingFGFs binding FGFRc-isoforms or a mixed population of FGFRs, mediating an increase in T-GFP + cells in general and on day 5 in particular. The reason for this pronounced effect can bethrough either a delay in the response by some cells (in media containing BMP4 or activin only,it peaks on day 3), or maintaining the T-expression for a time period extending beyond day 3.Next, we looked at the effect of FGFs on anterior streak/ DE-induction by 30 ng/ml activin in amES cell line containing a GFP knock-in allele of the anterior streak marker Gsc, Gsc Gfp/ +(Tada et al. 2005). Addition of FGF1, 2, 4, 6, 8b and 9 increased the number of Gsc-GFP + cellsby 22 – 40% (Figure 2D). Activation of FGFRb-isoforms only, by FGF7 and 10, had no effectand nor did FGF5, 8c, 8e and 16. This finding was not due to the lack of receptors, as they werepresent in the cell population (Figure 1B). Looking at the DE marker Sox17, we saw up to a50% decrease of the Sox17-GFP Hi fraction, from 34 ± 4% to 17 ± 3% when adding FGFsactivating FGFRc-isoforms (Figure 2E). FGFs activating FGFRb-isoforms only, slightlyincreased the number of Sox17-GFP Hi cells or had no effect (FGF7 and FGF10, respectively).In summary, FGFs binding predominantly FGFR4/FGFRc-isoforms, i.e. FGF1, 2, 4, 6, 8b and9, promote differentiation towards a mesendoderm cell population expressing primitive andanterior streak markers.The mesendoderm population responds to FGFRc-isoform activation onlyNext we investigated whether the FGFs inhibiting DE formation would instead promote PS andmesoderm marker expression by analysing Sox17-GFP cells stained with antibodies against T,FLK1 and EpCAM. For analytical purposes, cell populations were divided into Sox17-GFP –/Loand Sox17-GFP Hi fractions. We limited the number of FGFs introduced in these experiments,focusing only on those showing the largest effect on PS and DE marker induction/ repression,namely FGF1, 2 and 9 (mixed FGFR-activation); FGF7 and 10 (FGFRb-activation only); andFGF4, 6 and 8b (FGFRc-activation only). As a control, we included differentiation by BMP4and saw that these cells expressed the most T in Sox17-GFP –/Lo cells as expected (Figures 3Aand B).In the Sox17-GFP Hi fraction, 12% of cells were T + on day 3 when treated with activin alone(Figure 3A). This number was increased by addition of FGF2, 4, 7 and 10, and decreased in thepresence of FGF6, 8b, 9 and especially FGF1. On day 5, numbers of T + cells were rather lowand an increase in the Sox17-GFP Hi /T + cell population was seen only when adding FGF2(Figure 3A). We also investigated the Sox17-GFP –/Lo fraction and saw that FGF7 and 10 had no64

influence on the numbers of Sox17-GFP –/Lo / T + cells on day 3 (Figure 3B), but the other FGFsall reduced cell numbers. On day 5, cell numbers were in general very low, showing a slightinduction of Sox17-GFP –/Lo / T + cells when adding FGF2, 4 or 6 (Figure 3B). These datademonstrate that the FGFs activating either a mixed population of FGFRs or FGFRc-isoformscan reduce the number of T + cells in the emerging DE and in the rest of the cell culture, whichhas been suggested to consist of cells of an anterior streak type, not yet determined to expressDE markers (Hansson et al. 2009).Tada and co-workers showed that the mesendoderm population can be distinguished by the PSmarker Gsc, and later the DE can be separated from the mesoderm by means of the DE markersSOX17, E-cadherin and FOXA2 and mesoderm markers FLK1 and platelet-derived growthfactor receptors (PDGFRs) α and β (Tada et al. 2005). Trying to define whether individualFGFs would switch the mesoderm vs. endoderm balance in the differentiating culture, weinvestigated markers able to distinguish between these cultures namely Epithelial cell adhesionmolecule (EpCAM) and FLK1. EpCAM is expressed in pluripotent mES cells and in the DEepithelium during embryonic development (Balzar et al. 1999; Sherwood et al. 2007) whereasFLK1 is expressed in all mesoderm cells leaving the embryonic posterior streak. Subsequently,FLK1 is observed in developing mesodermal cardiac crescent cells and in most extraembryonicmesoderm and at E8.5 it is expressed in splanchnic mesoderm and endothelial cellsof the dorsal aorta only (Ema et al. 2006). Focusing on day 5, we stained differentiated Sox17-GFP cells with antibodies for Flk1 and EpCAM. Looking at the three markers separately, wesaw a decrease in Sox17-GFP Hi cells in the presence of FGF1, 2, 4 and 6 in concordance withprevious data (Figures 3C and 2E). There were very few FLK1 + cells when treating withactivin, regardless of FGFs added, but a high induction in the BMP4-treated positive controland BSA control samples (Figure 3D). The induction of EpCAM is 87 ± 2% in the presence ofactivin (Figure 3E) and FGF6, 7, 8b and 9 modestly but significantly increase EpCAMexpression in the range of 88 ± 3% to 92 ± 3%. We see a high amount of cells that are FLK1 +or EpCAM + in the N2B27+BSA negative control medium. This condition gives rise to 50-75%Sox1-expressing neural progenitors at day 5 of culture ((Ying et al. 2003b); Peterslund et al.,unpublished data). The high amount of FLK1 + and EpCAM + cells in this condition is mostlikely due to random and/ or neural differentiation.In the Sox17-GFP Hi fraction, cells turned primarily into Sox17-GFP Hi / FLK1 – / EpCAM + cellsin the presence of activin, representative of definitive endoderm (Figure 3F; numbers shown are% of Sox17-GFP Hi cells). The addition of FGFs did not alter this picture, and also did notchange fates of the remaining cells, these being small fractions of Sox17 Hi / FLK1 + / EpCAM +and Sox17 Hi / FLK1 – / EpCAM – . The former are likely to represent cells in a transition phaseexpressing both EpCAM and FLK1 and were present mainly in the BSA control sample. Weonly found Sox17 Hi / FLK1 + / EpCAM – cells in the BMP4-condition, thus inducing what appearsto be a Sox17-expressing mesodermal cell type.We also looked at cell fates in the Sox17-GFP –/Lo fraction. Here, the vast majority of cells werestill Sox17 –/Lo / FLK1 – / EpCAM + (Figure 3G), and FGF1, 2, 8b and 9 had a positive effect onthis population, elevating numbers of this population by up to 10%.In summary, FGFs activating FGFRc-isoforms slightly decrease the number of Sox17-GFP + /T +and Sox17 –/Lo /T + cells, indicating random and/ or neural differentiation rather than PSformation at the expense of DE. In the Sox17-GFP + population, FGFs activating FGFRcisoformsincrease the number of FLK1 – /EpCAM + and decrease the number of FLK1 – /EpCAM –cells possibly indicating a pool of non-mesodermal cells at intermediary steps of differentiation.FGFRc-isotype activation induces cell growth during the first 3 days of cultureFGFs were originally discovered as having a mitogenic effect in fibroblast cells, and were laterfound to have adverse effects in embryonic development, including endoderm formation(Gospodarowicz and Moran 1975; Ornitz et al. 1996; Bottcher and Niehrs 2005). We analysedthe mitogenic effect of the FGFs in wt mES cells on days 3 and 5, and found that activintreatmentalone gave a 3,3 times increase in cell numbers by day 3 (from 2.000 cells/ cm 2 to6.600 cells/ cm 2 ; Figure 4A). All FGFs improved cell growth to varying degrees, FGF1, 2, 465

and 9 being the most effective ones (up to 20.400 cells/ cm 2 or a 3 times increase compared tothe activin-treated cells). By means of 5-ethynyl-2’-deoxyuridine (EdU)-incorporation (Salicand Mitchison 2008) we could quantify the proliferation of cells (see Figure S1 for gating andcontrols). We found that the absolute number of proliferating cells was higher at day 3 than day5, by an approximate 4 time increase for the activin-treated cells and a 4-7 times increase forthe conditions supplemented with FGFs. At day 3, the relative number of proliferating cells didnot differ much from the activin-treated sample (Figure 4A) except for a small reduction whenadding FGF1 or not adding any growth factors at all, i.e. the BSA control.On day 5, there was app. 80.000 cells/cm 2 in samples treated with activin alone. This numberincreased 1,6 times to app. 130.000 cells/ cm 2 when adding FGF2 (Figure 4B). This indicatesthat the effect of FGFs on cell growth is decreasing over time probably because more cells aredifferentiated at day 5. At this stage, especially FGF1 and 2 positively affect cell numbers.These have been shown also in other cell systems to have the largest mitogenic effect (Ornitz etal. 1996; Zhang et al. 2006). By EdU-incorporation, we saw a 50% higher proliferation rate inthe BSA control than with cells treated with activin, showing 25% and 15% total proliferation,respectively (Figure 4B). The FGFs most frequently reduced proliferation; FGF1, 2, 4 and 6 by40 – 50% and FGF8b, 9 and 10 showing moderate reductions. These data indicate that the maineffect seen by FGF1, 2, 4, 6 and 9 on proliferation occurs prior to day 3, and that most of thecells in these cultures have left the proliferative state by day 5.FGF4 is dispensable for the formation of endodermOf the FGFs tested, FGF4 and 6 binding FGFRc-isotypes only, increase BMP4 and activininducedexpression of T and Gsc the most. FGF4 is important during gastrulation where it isresponsible for the cell movements through the PS (Bottcher and Niehrs 2005). We wanted toinvestigate whether an FGF4 –/– cell line (Wilder et al. 1997) would be able to i) differentiateinto the endoderm lineage; and ii) promote differentiation of DE cell types, in that the latterwould not be inhibited by the FGFRc isoform-activating FGF4. When cells were maintained aspluripotent cells, the FGF4 –/– cell line showed a different cell morphology than the E14 andFGF4 +/– cell lines. Cells grew in small, very dense clusters indicative of pluripotent cells(Figure 5A) and growth rates were slower, confirming the mitogenic effect of FGF4. Cellsstained positive for the pluripotency marker OCT4 and negative for the endoderm markerSox17, similar to the wt and heterozygote cell lines.We subjected the wt E14, FGF4 +/– and FGF4 –/– cell lines to our DE induction-protocol.Through antibody staining of SOX17, E-cadherin (Ecad) and FOXA2 we identified cells of anendoderm origin. Foxa2 is expressed during embryonic development in the anterior primitivestreak, the newly formed definitive endoderm and is maintained throughout most matureendoderm-derived tissues (Kaestner et al. 1994; Weinstein et al. 1994). FGF4 +/– cells behavedmuch like E14 wt cells, showing vast numbers of OCT4 – /SOX17 + and SOX17 + /FOXA2 + /Ecadherin+ cells by day 5 (Figure 5B). In each cell line, differentiation was not 100% and smallclusters of tightly connected, undifferentiated OCT4 + cells persisted in the culture. Remarkably,FGF4 –/– cells readily differentiated along the endoderm lineage, showing mainly OCT4 –/SOX17 + cells and only a few more OCT4 + cells than the wt and heterozygote cell lines (Figure5A). When administrating FGF4 protein ectopically, the number of OCT4 + cells was reduced towt levels. There were comparable numbers of SOX17 + /FOXA2 + /E-cadherin + in the knock-outcell line and wt or heterozygote cell lines, and these did not change by the addition of FGF4 tothe medium (Figure 5B).Thus, we conclude that FGF4 is dispensable for differentiation of mES cells along theendoderm lineage and for cells to leave the pluripotent state when the differentiation protocolapplied includes activin.Definitive endoderm is formed in the absence of FGF4Looking for expression of Sox7 and Thermostable direct hemolysin gene (Tdh), markers ofvisceral endoderm (VE; (Sherwood et al. 2007)), we wanted to see whether the endodermformed was definitive or visceral. Staining for endoderm and VE markers in the66

undifferentiated cells, we found that E-cadherin was abundantly expressed but not SOX17 orSOX7 expression (Figure 6A). When cells had undergone differentiation for five days, E14 andFGF4 +/– cell lines were SOX17 + /E-cadherin + /SOX7 – indicative of a DE identity (Figure 6B).FGF4 –/– cells mainly showed the same expression pattern but also showed small clusters ofSOX17 + /E-cadherin + /SOX7 + cells indicating formation of VE in these areas (Figures 6B andS2). When adding ectopic FGF4 to the growth medium, hardly any SOX7 + cells were seen inthe culture (Figure 6B).By qPCR analyses, we confirmed the DE phenotype of all three cell lines but did not seeevidence of a VE sub-population in the FGF4 –/– cell culture. We saw a large induction of Sox17and especially Cxcr4 transcription upon DE-induction (Figure 6C) indicative of the formationof DE rather than VE. The VE marker Sox7 showed similar levels of expression in thepluripotent and differentiated states for all three cell lines and the absolute amount oftranscription was very low, i.e. similar to Sox17-expression levels in mES cells. Tdh wasexpressed at intermediary levels in mES cells but was down-regulated upon DE-induction.Interestingly, the FGF4 +/– cell line showed a somewhat elevated expression of Sox17 and Cxcr4both in the pluripotent and differentiated states whereas the FGF4 –/– cell line expressed thesegenes at levels comparable to wt cells. This suggests that FGF4 acts as a morphogen and that anintermediary expression level most efficiently induces DE-formation whereas high or lowlevels in the wt and FGF4 –/– cell lines, respectively, fail to do so. In summary, we conclude thatFGF4-signalling is dispensable for induction of DE in FGF4 –/– mES cells and that anintermediary FGF4-koncentration may be beneficial to DE formation.DiscussionDuring embryonic development, epithelial tissues express FGFRb-isoforms whilemesenchymal tissues express mainly FGFRc-isoforms (Ornitz and Itoh 2001). FGFsspecifically activating FGFRb-isoforms (i.e. FGF7 and 10) are mainly expressed in themesenchyme and FGFs activating FGFRc-isoforms (i.e. FGF4, 8 and 9) are mainly expressedin the epithelium, resulting in specificity during reciprocal epithelial-mesenchymal signalling indeveloping organs such as the lung, cecum, salivary glands and pancreas (Stark et al. 1991;Orr-Urtreger et al. 1993; Colvin et al. 2001; Ornitz and Itoh 2001; Elghazi et al. 2002; Manfroidet al. 2007). Data from mouse embryos obtained in our group confirm findings by others that inthe developing pancreas FGFR2b and 4 are expressed in the epithelium, whereas FGFR1c and2c are expressed in the mesenchyme (Kathrine Beck Sylvestersen, personal communication;(Stark et al. 1991; Orr-Urtreger et al. 1993; Elghazi et al. 2002)). In the present report we showhow FGFR2b and 4 are up-regulated in the Sox17-GFP Hi or DE-fraction during DE formationin mES cells. FGFR1c, 2c and 3c were up-regulated in the Sox17-GFP Lo fraction alone or inboth fractions. The reason for this unexpected high expression of FGFRc-isoforms in both theSox17-GFP Lo and Sox17-GFP Hi fractions may be that the Sox17-GFP Lo fraction contains alarge pool of cells not yet committed to an epithelial fate or cells that are undifferentiated. Thefraction is characterised by high numbers of non-mesodermal Sox17-GFP –/Lo / FLK1 – /EpCAM + expressing cells. These cells may still undergo differentiation and maturation andthus have the potential to later become epithelial endoderm or they may contain mesenchymalcells to some degree. The Sox17-GFP Lo expressing cells may have a function in the culturesimilar to that of the mesenchyme in pancreatic development, i.e. signalling to direct cell fate ofDE or foregut progenitors. Accordingly, preliminary data in our lab show that if Sox17-GFPcells are sorted after 5 days of DE formation, then re-plated and cultured under conditionsinducing pancreatic progenitors (Hansson et al. 2009), the Sox17-GFP Hi fraction will looseGFP expression and fail to turn on foregut markers such as SOX2 and PDX1 (Maria Winzi,personal communication). On the contrary, cells of the Sox17-GFP Lo fraction will turn on GFPexpression and differentiate into SOX2 + , NKX6.1 + and PDX1 + positive cells similar to theunsorted culture. This suggests that signals from the Sox17-GFP Lo to the Sox17-GFP Hi cellsinclude FGFs and is crucial for their propagation and ability to differentiate further.67

Most of the remaining cells are Sox17 –/Lo / FLK1 – / EpCAM – and these may represent amesoderm population which is no longer expressing FLK1, i.e. is not haematopoietic. Flk1 isnecessary for hematopoietic and endothelial development, but not for other mesodermallineages expressing the marker at an early stage (Ema et al. 2006).We have previously shown that FGF-signalling has a positive effect on differentiation towardsPS-type cells peaking on day 3 (T-GFP + and Gsc-GFP + ), but inhibitory effect on DE cells(Sox17-GFP + ; (Hansson et al. 2009)). In the present study we show that FGF activating severalFGFRc-isotypes elicit this effect and that FGFs activating only FGFRb-isotypes have no effect.This suggests that activation of FGFRc-isoforms is beneficial for early differentiation towardsan intermediary PS-type cell, primarily through increased proliferation of cells induced todifferentiate by activin or BMP4. Later, FGFRc-activation must be removed in order tooptimize differentiation into a DE cell, probably because FGFRc-activation drivesmesendodermal cells towards the mesodermal lineage. The FGFR-expression seen duringmesendoderm/ DE-induction supports this, as mainly FGFRc-isoforms are expressed in theculture. FGFR2b is expressed late during DE-induction suggesting that the forming epitheliumcan respond to FGFs activating this receptor. However, we failed to substantiate this hypothesisas the number of Sox17-GFP Hi cells were unaffected by FGF7 and 10. Possibly, this FGFR2bexpression renders the cells competent to respond to later signals during organogenesis.Prior to gastrulation, FGF4 and 5, activating FGFRc-isoforms only, are expressed in theembryonic ectoderm in the area of the later PS, and in the PS during gastrulation (Haub andGoldfarb 1991; Hebert et al. 1991; Niswander and Martin 1992). During gastrulation, FGF3,activating FGFRb-isoforms only, is expressed in the PS (Wilkinson et al. 1988). This supportsour suggestion that FGFRc-activation is important early in differentiation, although we do notsee a requirement for FGFRb-activation during either mesoderm or endoderm induction. Acombination of factors, activating FGFRc-isoforms early during differentiation and FGFRbisoformslater may be beneficial for future DE-induction.The FGFs having the largest effect on PS-marker induction were FGF4 and 6. FGF4 is animportant growth factor during gastrulation where it is responsible for the cell movementsthrough the PS (Bottcher and Niehrs 2005) and FGF4 knock-out mice die during gastrulation atE4-5 (Feldman et al. 1995). It has also been shown to be necessary for mESCs when leavingthe pluripotent state and differentiating into either ectoderm or mesoderm lineages (Kunath etal. 2007; Stavridis et al. 2007). Kunath and co-workers found that this knock-out cell line couldnot differentiate into either lineage, except when supplementing the growth medium with FGF4protein.Remarkably, using culture conditions similar to Kunath and co-workers, we found that ectopicFGF4 was dispensable when differentiating the FGF4 –/– cell line into SOX17 + /Ecadherin+ /FOXA2 + /SOX7 – DE cells expressing Sox17 and Cxcr4, but not Sox7 and Tdh. Thissupports our previous finding that induction of DE-formation is not dependent on early FGFsignalling,as cells readily become Sox17-GFP + in the presence of the FGFR-inhibitorPD173074 at early stages (Hansson et al. 2009). In the FGF4 –/– cell line, slightly more cells stayin a pluripotent state, i.e. more cells stain OCT4 + , than what is seen for wt and heterozygote celllines. Some of these cells can be induced to differentiate when FGF4 is added to thedifferentiation medium, but FGF4 supplement does not seem to alter the fate of thedifferentiated cells. We propose that ectopic administration of FGF4 is only necessary fordifferentiation into ectoderm and mesoderm lineages but not for leaving the pluripotent state(Kunath et al. 2007; Stavridis et al. 2007). Although FGF4 knockout mice have been shown tobe embryonic lethal at the stage of gastrulation (Feldman et al. 1995; Wilder et al.), theirdependence on FGF4 signalling may lie at an earlier time-point, namely in the area ofembryonic ectoderm where later the PS forms. This would render FGF4 necessary forformation of the PS rather than it’s function (Niswander and Martin 1992; Tam et al. 1993).This also shows that FGF4 is not necessary for cells to leave the pluripotent state when thedifferentiation protocol applied includes activin.68

FGF4, 5, FGF8b and FGFR1, are expressed during PS-formation and gastrulation (Haub andGoldfarb 1991; Hebert et al. 1991; Deng et al. 1994; Yamaguchi et al. 1994; Sun et al. 1999).FGFR1 –/– or FGF8 –/– embryos are embryonic lethal at this time point, the latter failing toexpress Fgf4 in the streak. In mES cell cultures, Fgf5 is upregulated at the onset ofdifferentiation (Kunath et al. 2007). Interestingly, Kunath and co-workers could not rescueneural differentiation in the FGF4 –/– cell line when adding FGF5 (Kunath et al. 2007).However, we suggest a redundancy in FGF-signalling at the point of initiation of endodermdifferentiation taking place, in such that FGF5 or 8b, binding FGFRc-isoforms as does FGF4,facilitate the activation of key differentiation genes.Most studies on endoderm formation from mES cells rely on culturing conditions using eitherembryoid bodies as starting material or high cell densities (Funa et al. 2008; Morrison et al.2008; Willems and Leyns 2008). Compared to Kunath and co-workers, we seed cells at a lowerdensity. Possibly, an excess of cells to some degree inhibits differentiation, a commonphenomenon seen in many ES cell differentiation systems. Indeed, when applying the ectodermdifferentiation protocol as described by Kunath and co-workers to cells at low density, we sawa significant increase in differentiation (data not shown). It has been shown that only mES cellsgrown at high density loose their renewal properties after ROCK-inhibition (Chang et al. 2010).Cells grown at high densities have more cell-cell interactions and their β-catenin pool is partlylocated at the plasma membrane, activating the Wnt signalling pathway implicated inmaintaining the pluripotent state in both human and mouse ES cells. Thus, we speculate thathigh cell densities preferentially retain mES cells in the pluripotent state to a higher degree thancells at low density and that FGF4-signalling may be necessary for leaving the pluripotent stateat high cell densities only.AcknowledgementsWe are thankful to Drs. G. Keller, S. Nishikawa, S. J. Morrison and A. Rizzino/ T. Kunath forthe T-GFP, Gsc-GFP, Sox17-GFP, FGF4 +/– and FGF4 –/– cell lines, respectively. We thankSøren Refsgaard Lindskog for excellent technical assistance and Mads Daugaard for criticallyreading of the manuscript.Figure legendsFigure 1: Screen for FGFR-isotypes during DE differentiation in sorted fractions of Sox17-GFP cellsThe expression of each FGFR-isoform was analysed by qPCR in both sorted and unsortedfractions of Sox17-GFP cells, differentiated by our DE protocol (30 ng/ml activin for 5 days).A) A histogram showing sorting gates in GFP – , GFP Lo and GFP Hi fractions. B) The absoluteexpression of each FGFR-isoform was standardised to the house-keeping gene TATA-bindingprotein (Tbp). Sox17 Hi fractions are shown only at day 4 and 5, when they appeared in theculture. The fraction of Sox17-GFP – cells was to low for RNA-extraction. We did not obtainfunctional primers for FGFR3b. The relative mean expression ± S.E.M. of 3 independentexperiments is shown, using a Student’s paired, two-tailed t-test for the statistical analysis: * =P < 0,05; ** = P < 0,01 compared to the ESC condition for each fraction (Sox17-GFP +fractions were compared to the unsorted ESC sample).Figure 2: Activation of FGFRc-isoforms boosts mesendoderm but inhibits DE markerexpressionUsing GFP-reporter cell lines T-GFP, Gsc-GFP and Sox17-GFP, we differentiated cells for 3(T-GFP cell line only) and 5 days in BMP4- or activin-containing media, adding differentFGFs. Cells were analysed by a FACS. A) Table of FGF – FGFR binding of selected FGFs69

used in this paper. Modified from (Ornitz et al. 1996; Olsen et al. 2006; Zhang et al. 2006;Mason 2007). B-C) Cells were differentiated in 10 ng/ml BMP4 (= mesoderm-induction) or 1ng/ml activin (= posterior streak/ mesoderm-induction) w/wo FGFs, and expression of T-GFPwas measured at days 3 and 5. D) Gsc-GFP cells were differentiated in 30 ng/ml activin w/woFGFs, and expression of GFP was measured at day 5. E) Sox17-GFP cells were differentiatedin 30 ng/ml activin w/wo FGFs, and expression of GFP was measured at day 5. The meanexpression ± S.E.M. of 3 independent experiments is shown, using a Student’s t-test for thestatistical analysis: * = P < 0,05; ** = P < 0,01 compared to the BMP4 or activin conditions.Figure 3: Activation of FGFRb or FGFRc-isoforms differentially affects the expression ofPS, DE and mesoderm markersSox17-GFP cells were differentiated in media containing BMP4 or activin w/wo FGFs for 3-5days before harvest. Cells were stained for markers of PS, DE or mesoderm and analysed usinga FACS. A & B) Cells were stained for T and analysed on days 3 and 5. Shown here are therelative number of T + cells in the Sox17-GFP Hi fraction A), or the Sox17-GFP –/Lo fraction B).The mean expression ± S.E.M. of 2 independent experiments are shown, no statistical analysisperformed. C-G) Cells were stained for FLK1 and EpCAM and analysed in either singlechannel for C) Sox17-GFP, D) FLK1, E) EpCAM; or in multichannel for the Sox17-GFP Hifraction F), or Sox17-GFP –/Lo fraction G) dividing data into four fractions: FLK1 – /EpCAM + ;FLK1 + /EpCAM + ; FLK1 – /EpCAM – ; FLK1 + /EpCAM – . The mean expression ± S.E.M. of 3independent experiments is shown, using a Student’s paired, two-tailed t-test for the statisticalanalysis: * = P < 0,05; ** = P < 0,01 compared to the activin conditions.Figure 4: FGFs activating FGFRc-isoforms affect early cell growth and proliferationA wt mES cell line (E14) was grown in media containing activin w/wo FGFs and harvested foranalysis of total cell number and proliferation on days 3 &5. A count of total number of cellsand relative proliferation of cells is shown for day 3 A) and day 5 B). The mean expression ±S.E.M. of 3 independent experiments is shown, using a Student’s t-test for the statisticalanalysis: * = P < 0,05; ** = P < 0,01 compared to the activin conditions.Figure 5: FGF4-signalling is dispensable for endoderm differentiationE14, FGF4 +/– and FGF4 –/– cells were stained for markers of pluripotency and endoderm. A)Undifferentiated cells were stained for OCT4 and SOX17 and the nuclear stain DAPI. B) Cellswere differentiated for 5 days in 30 ng/ml activin w/wo 5 ng/ml FGF4 and stained for OCT4and endoderm markers SOX17, FOXA2, E-cadherin (Ecad) and DAPI. Representative imagesare shown for each condition. Scale bar: 100 µm.Figure 6: In the absence of FGF4, DE rather than VE is formedAntibody stain and qPCR-analyses of DE and VE markers in E14, FGF4 +/– and FGF4 –/– cells.A) Undifferentiated cells were stained for SOX17, E-cadherin, SOX7 and the nuclear stainDAPI. B) Cells were differentiated for 5 days in 30 ng/ml activin w/wo 5 ng/ml FGF4 andstained for the same markers. Representative images are shown for each condition. Scale bar:100 µm. C) qPCR data showing the relative expression levels of Sox17, Cxcr4, Sox7 and TdhmRNA present in undifferentiated and differentiated cells of each cell line compared to E14ESCs, all standardized to the house-keeping gene Tbp. The mean expression ± S.E.M. of 3independent experiments is shown (n=2 for FGF4 –/– cells treated w/ activin + FGF4), using aRatio t-test for the statistical analysis: # = P < 0,05; ## = P < 0,01 compared to the E14 mES cellcondition.SUPPLEMENTARY DATAFigure S1: Negative controls of EdU-incorporation and sort gateA histogram showing the distribution of pluripotent E14 mES cells with/without EdUincorporationand without EdU-stain (red and black samples); without EdU-incorporation and70

with EdU-stain (blue sample); and w/ EdU-incorporation and with EdU-stain (stained withAlexa-488, i.e. positive control; green sample).Figure S2: A few areas of SOX7 + cells in the FGF4 –/– cell line after DE-inductionCells were differentiated for 5 days in 30 ng/ml activin w/wo 5 ng/ml FGF4 and stained forSOX17, E-cadherin, SOX7 and the nuclear stain DAPI. The yellow frame indicates area blownup and shown to the right (red signal boosted). Representative images are shown for eachcondition, except for FGF4 –/– cells in activin alone which shows a SOX7 + area in the culture.White scale bar: 100 µm; yellow scale bar: 50 µm.ReferencesBalzar, M., M.J. Winter, C.J. de Boer, and S.V. Litvinov. 1999. The biology of the 17-1A antigen (Ep-CAM). J Mol Med 77: 699-712.Ben-Haim, N., C. Lu, M. Guzman-Ayala, L. Pescatore, D. Mesnard, M. Bischofberger, F. Naef, E.J.Robertson, and D.B. Constam. 2006. The nodal precursor acting via activin receptors inducesmesoderm by maintaining a source of its convertases and BMP4. Dev Cell 11: 313-23.Blum, M., S.J. Gaunt, K.W. Cho, H. Steinbeisser, B. Blumberg, D. Bittner, and E.M. De Robertis. 1992.Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell 69: 1097-106.Bottcher, R.T. and C. Niehrs. 2005. Fibroblast growth factor signaling during early vertebratedevelopment. Endocr Rev 26: 63-77.Carey, F.J., E.A. Linney, and R.A. Pedersen. 1995. Allocation of epiblast cells to germ layer derivativesduring mouse gastrulation as studied with a retroviral vector. Dev Genet 17: 29-37.Chang, T.C., Y.C. Chen, M.H. Yang, C.H. Chen, E.W. Hsing, B.S. Ko, J.Y. Liou, and K.K. Wu. 2010.Rho kinases regulate the renewal and neural differentiation of embryonic stem cells in a cellplating density-dependent manner. PLoS One 5: e9187.Ciruna, B.G., L. Schwartz, K. Harpal, T.P. Yamaguchi, and J. Rossant. 1997. Chimeric analysis offibroblast growth factor receptor-1 (Fgfr1) function: a role for FGFR1 in morphogeneticmovement through the primitive streak. Development 124: 2829-41.Colvin, J.S., A.C. White, S.J. Pratt, and D.M. Ornitz. 2001. Lung hypoplasia and neonatal death in Fgf9-null mice identify this gene as an essential regulator of lung mesenchyme. Development 128:2095-106.Conlon, F.L., K.M. Lyons, N. Takaesu, K.S. Barth, A. Kispert, B. Herrmann, and E.J. Robertson. 1994.A primary requirement for nodal in the formation and maintenance of the primitive streak in themouse. Development 120: 1919-28.Deng, C.X., A. Wynshaw-Boris, M.M. Shen, C. Daugherty, D.M. Ornitz, and P. Leder. 1994. MurineFGFR-1 is required for early postimplantation growth and axial organization. Genes Dev 8:3045-57.Elghazi, L., C. Cras-Meneur, P. Czernichow, and R. Scharfmann. 2002. Role for FGFR2IIIb-mediatedsignals in controlling pancreatic endocrine progenitor cell proliferation. Proc Natl Acad Sci U SA 99: 3884-9.Ema, M., S. Takahashi, and J. Rossant. 2006. Deletion of the selection cassette, but not cis-actingelements, in targeted Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermalprogenitors. Blood 107: 111-7.Fehling, H.J., G. Lacaud, A. Kubo, M. Kennedy, S. Robertson, G. Keller, and V. Kouskoff. 2003.Tracking mesoderm induction and its specification to the hemangioblast during embryonic stemcell differentiation. Development 130: 4217-27.Feldman, B., W. Poueymirou, V.E. Papaioannou, T.M. DeChiara, and M. Goldfarb. 1995. Requirementof FGF-4 for postimplantation mouse development. Science 267: 246-9.Funa, N.S., J. Saldeen, B. Akerblom, and M. Welsh. 2008. Interdependent fibroblast growth factor andactivin A signaling promotes the expression of endodermal genes in differentiating mouseembryonic stem cells expressing Src Homology 2-domain inactive Shb. Differentiation 76: 443-53.Gadue, P., T.L. Huber, M.C. Nostro, S. Kattman, and G.M. Keller. 2005. Germ layer induction fromembryonic stem cells. Exp Hematol 33: 955-64.71

Gadue, P., T.L. Huber, P.J. Paddison, and G.M. Keller. 2006. Wnt and TGF-beta signaling are requiredfor the induction of an in vitro model of primitive streak formation using embryonic stem cells.Proc Natl Acad Sci U S A 103: 16806-11.Gospodarowicz, D. and J.S. Moran. 1975. Mitogenic effect of fibroblast growth factor on early passagecultures of human and murine fibroblasts. J Cell Biol 66: 451-7.Guo, Q. and J.Y. Li. 2007. Distinct functions of the major Fgf8 spliceform, Fgf8b, before and duringmouse gastrulation. Development 134: 2251-60.Hansson, M., D.R. Olesen, J.M. Peterslund, N. Engberg, M. Kahn, M. Winzi, T. Klein, P. Maddox-Hyttel, and P. Serup. 2009. A late requirement for Wnt and FGF signaling during activininducedformation of foregut endoderm from mouse embryonic stem cells. Dev Biol 330: 286-304.Haub, O. and M. Goldfarb. 1991. Expression of the fibroblast growth factor-5 gene in the mouseembryo. Development 112: 397-406.Hebert, J.M., M. Boyle, and G.R. Martin. 1991. mRNA localization studies suggest that murine FGF-5plays a role in gastrulation. Development 112: 407-15.Hooper, M., K. Hardy, A. Handyside, S. Hunter, and M. Monk. 1987. HPRT-deficient (Lesch-Nyhan)mouse embryos derived from germline colonization by cultured cells. Nature 326: 292-5.Itoh, N. and D.M. Ornitz. 2004. Evolution of the Fgf and Fgfr gene families. Trends Genet 20: 563-9.Kaestner, K.H., H. Hiemisch, B. Luckow, and G. Schutz. 1994. The HNF-3 gene family of transcriptionfactors in mice: gene structure, cDNA sequence, and mRNA distribution. Genomics 20: 377-85.Kanai-Azuma, M., Y. Kanai, J.M. Gad, Y. Tajima, C. Taya, M. Kurohmaru, Y. Sanai, H. Yonekawa, K.Yazaki, P.P. Tam, and Y. Hayashi. 2002. Depletion of definitive gut endoderm in Sox17-nullmutant mice. Development 129: 2367-79.Kim, I., T.L. Saunders, and S.J. Morrison. 2007. Sox17 dependence distinguishes the transcriptionalregulation of fetal from adult hematopoietic stem cells. Cell 130: 470-83.Kim, S.Y., C.H. Lee, B.V. Midura, C. Yeung, A. Mendoza, S.H. Hong, L. Ren, D. Wong, W. Korz, A.Merzouk, H. Salari, H. Zhang, S.T. Hwang, C. Khanna, and L.J. Helman. 2008. Inhibition of theCXCR4/CXCL12 chemokine pathway reduces the development of murine pulmonarymetastases. Clin Exp Metastasis 25: 201-11.Kinder, S.J., T.E. Tsang, M. Wakamiya, H. Sasaki, R.R. Behringer, A. Nagy, and P.P. Tam. 2001. Theorganizer of the mouse gastrula is composed of a dynamic population of progenitor cells for theaxial mesoderm. Development 128: 3623-34.Kispert, A. and B.G. Herrmann. 1994. Immunohistochemical analysis of the Brachyury protein in wildtypeand mutant mouse embryos. Dev Biol 161: 179-93.Kubo, A., K. Shinozaki, J.M. Shannon, V. Kouskoff, M. Kennedy, S. Woo, H.J. Fehling, and G. Keller.2004. Development of definitive endoderm from embryonic stem cells in culture. Development131: 1651-62.Kunath, T., M.K. Saba-El-Leil, M. Almousailleakh, J. Wray, S. Meloche, and A. Smith. 2007. FGFstimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stemcells from self-renewal to lineage commitment. Development 134: 2895-902.Lawson, K.A., J.J. Meneses, and R.A. Pedersen. 1991. Clonal analysis of epiblast fate during germ layerformation in the mouse embryo. Development 113: 891-911.MacArthur, C.A., A. Lawshe, J. Xu, S. Santos-Ocampo, M. Heikinheimo, A.T. Chellaiah, and D.M.Ornitz. 1995. FGF-8 isoforms activate receptor splice forms that are expressed in mesenchymalregions of mouse development. Development 121: 3603-13.Manfroid, I., F. Delporte, A. Baudhuin, P. Motte, C.J. Neumann, M.L. Voz, J.A. Martial, and B. Peers.2007. Reciprocal endoderm-mesoderm interactions mediated by fgf24 and fgf10 governpancreas development. Development 134: 4011-21.Mason, I. 2007. Initiation to end point: the multiple roles of fibroblast growth factors in neuraldevelopment. Nat Rev Neurosci 8: 583-96.McCall, M.D., C. Toso, E.E. Baetge, and A.M. Shapiro. 2010. Are stem cells a cure for diabetes? ClinSci (Lond) 118: 87-97.Morrison, G.M., I. Oikonomopoulou, R.P. Migueles, S. Soneji, A. Livigni, T. Enver, and J.M.Brickman. 2008. Anterior definitive endoderm from ESCs reveals a role for FGF signaling. CellStem Cell 3: 402-15.Nakayama, T., N. Mutsuga, and G. Tosato. 2007. FGF2 posttranscriptionally down-regulates expressionof SDF1 in bone marrow stromal cells through FGFR1 IIIc. Blood 109: 1363-72.Niswander, L. and G.R. Martin. 1992. Fgf-4 expression during gastrulation, myogenesis, limb and toothdevelopment in the mouse. Development 114: 755-68.72

Olsen, S.K., J.Y. Li, C. Bromleigh, A.V. Eliseenkova, O.A. Ibrahimi, Z. Lao, F. Zhang, R.J. Linhardt,A.L. Joyner, and M. Mohammadi. 2006. Structural basis by which alternative splicingmodulates the organizer activity of FGF8 in the brain. Genes Dev 20: 185-98.Ornitz, D.M. and N. Itoh. 2001. Fibroblast growth factors. Genome Biol 2: REVIEWS3005.Ornitz, D.M., J. Xu, J.S. Colvin, D.G. McEwen, C.A. MacArthur, F. Coulier, G. Gao, and M. Goldfarb.1996. Receptor specificity of the fibroblast growth factor family. J Biol Chem 271: 15292-7.Orr-Urtreger, A., M.T. Bedford, T. Burakova, E. Arman, Y. Zimmer, A. Yayon, D. Givol, and P. Lonai.1993. Developmental localization of the splicing alternatives of fibroblast growth factorreceptor-2 (FGFR2). Dev Biol 158: 475-86.Rossant, J. 2004. Lineage development and polar asymmetries in the peri-implantation mouse blastocyst.Semin Cell Dev Biol 15: 573-81.Salic, A. and T.J. Mitchison. 2008. A chemical method for fast and sensitive detection of DNA synthesisin vivo. Proc Natl Acad Sci U S A 105: 2415-20.Schier, A.F. 2003. Nodal signaling in vertebrate development. Annu Rev Cell Dev Biol 19: 589-621.Sherwood, R.I., C. Jitianu, O. Cleaver, D.A. Shaywitz, J.O. Lamenzo, A.E. Chen, T.R. Golub, and D.A.Melton. 2007. Prospective isolation and global gene expression analysis of definitive andvisceral endoderm. Dev Biol 304: 541-55.Stark, K.L., J.A. McMahon, and A.P. McMahon. 1991. FGFR-4, a new member of the fibroblast growthfactor receptor family, expressed in the definitive endoderm and skeletal muscle lineages of themouse. Development 113: 641-51.Stavridis, M.P., J.S. Lunn, B.J. Collins, and K.G. Storey. 2007. A discrete period of FGF-induced Erk1/2signalling is required for vertebrate neural specification. Development 134: 2889-94.Sun, X., E.N. Meyers, M. Lewandoski, and G.R. Martin. 1999. Targeted disruption of Fgf8 causesfailure of cell migration in the gastrulating mouse embryo. Genes Dev 13: 1834-46.Tada, S., T. Era, C. Furusawa, H. Sakurai, S. Nishikawa, M. Kinoshita, K. Nakao, and T. Chiba. 2005.Characterization of mesendoderm: a diverging point of the definitive endoderm and mesodermin embryonic stem cell differentiation culture. Development 132: 4363-74.Tam, P.P., E.A. Williams, and W.Y. Chan. 1993. Gastrulation in the mouse embryo: ultrastructural andmolecular aspects of germ layer morphogenesis. Microsc Res Tech 26: 301-28.Vainikka, S., J. Partanen, P. Bellosta, F. Coulier, D. Birnbaum, C. Basilico, M. Jaye, and K. Alitalo.1992. Fibroblast growth factor receptor-4 shows novel features in genomic structure, ligandbinding and signal transduction. Embo J 11: 4273-80.Van Hoof, D., K.A. D'Amour, and M.S. German. 2009. Derivation of insulin-producing cells fromhuman embryonic stem cells. Stem Cell Res 3: 73-87.Waldrip, W.R., E.K. Bikoff, P.A. Hoodless, J.L. Wrana, and E.J. Robertson. 1998. Smad2 signaling inextraembryonic tissues determines anterior-posterior polarity of the early mouse embryo. Cell92: 797-808.Wang, J., P. Alexander, L. Wu, R. Hammer, O. Cleaver, and S.L. McKnight. 2009. Dependence ofmouse embryonic stem cells on threonine catabolism. Science 325: 435-9.Weinstein, D.C., A. Ruiz i Altaba, W.S. Chen, P. Hoodless, V.R. Prezioso, T.M. Jessell, and J.E.Darnell, Jr. 1994. The winged-helix transcription factor HNF-3 beta is required for notochorddevelopment in the mouse embryo. Cell 78: 575-88.Wilder, P.J., D. Kelly, K. Brigman, C.L. Peterson, T. Nowling, Q.S. Gao, R.D. McComb, M.R.Capecchi, and A. Rizzino. 1997. Inactivation of the FGF-4 gene in embryonic stem cells altersthe growth and/or the survival of their early differentiated progeny. Dev Biol 192: 614-29.Wilkinson, D.G., G. Peters, C. Dickson, and A.P. McMahon. 1988. Expression of the FGF-related protooncogeneint-2 during gastrulation and neurulation in the mouse. Embo J 7: 691-5.Willems, E. and L. Leyns. 2008. Patterning of mouse embryonic stem cell-derived pan-mesoderm byActivin A/Nodal and Bmp4 signaling requires Fibroblast Growth Factor activity. Differentiation76: 745-59.Woei Ng, K., T. Speicher, C. Dombrowski, T. Helledie, L.M. Haupt, V. Nurcombe, and S.M. Cool.2007. Osteogenic differentiation of murine embryonic stem cells is mediated by fibroblastgrowth factor receptors. Stem Cells Dev 16: 305-18.Yamaguchi, T.P., K. Harpal, M. Henkemeyer, and J. Rossant. 1994. fgfr-1 is required for embryonicgrowth and mesodermal patterning during mouse gastrulation. Genes Dev 8: 3032-44.Yamanaka, T., A. Sakamoto, Y. Tanaka, Y. Zhang, Y. Hayashido, S. Toratani, Y. Akagawa, and T.Okamoto. 2000. Isolation and serum-free culture of epithelial cells derived from epithelial restsof Malassez in human periodontal ligament. In Vitro Cell Dev Biol Anim 36: 548-53.73

Ying, Q.L., J. Nichols, I. Chambers, and A. Smith. 2003a. BMP induction of Id proteins suppressesdifferentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell115: 281-92.Ying, Q.L., M. Stavridis, D. Griffiths, M. Li, and A. Smith. 2003b. Conversion of embryonic stem cellsinto neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21: 183-6.Zhang, X., O.A. Ibrahimi, S.K. Olsen, H. Umemori, M. Mohammadi, and D.M. Ornitz. 2006. Receptorspecificity of the fibroblast growth factor family. The complete mammalian FGF family. J BiolChem 281: 15694-700.74

FiguresFigure 1: Screen for FGFR-isotypes during DE differentiation in sorted fractions of Sox17-GFP cells. Theexpression of each FGFR-isoform was analysed by qPCR in both sorted and unsorted fractions of Sox17-GFP cells,differentiated by our DE protocol (30 ng/ml activin for 5 days). A) A histogram showing sorting gates in GFP – ,GFP Lo and GFP Hi fractions. B) The absolute expression of each FGFR-isoform was standardised to the housekeepinggene TATA-binding protein (Tbp). Sox17 Hi fractions are shown only at day 4 and 5, when they appeared inthe culture. The fraction of Sox17-GFP – cells was to low for RNA-extraction. We did not obtain functional primersfor FGFR3b. The relative mean expression ± S.E.M. of 3 independent experiments is shown, using a Student’spaired, two-tailed t-test for the statistical analysis: * = P < 0,05; ** = P < 0,01 compared to the ESC condition foreach fraction (Sox17-GFP + fractions were compared to the unsorted ESC sample).75

Figure 2: Activation of FGFRc-isoforms boosts mesendoderm but inhibits DE marker expression. Using GFPreportercell lines T-GFP, Gsc-GFP and Sox17-GFP, we differentiated cells for 3 (T-GFP cell line only) and 5 daysin BMP4- or activin-containing media, adding different FGFs. Cells were analysed by a FACS. A) Table of FGF –FGFR binding of selected FGFs used in this paper. Modified from {Olsen, 2006 #25;Mason, 2007 #21;Ornitz, 1996#20;Zhang, 2006 #19}. B-C) Cells were differentiated in 10 ng/ml BMP4 (= mesoderm-induction) or 1 ng/mlactivin (= posterior streak/ mesoderm-induction) w/wo FGFs, and expression of T-GFP was measured at days 3 and5. D) Gsc-GFP cells were differentiated in 30 ng/ml activin w/wo FGFs, and expression of GFP was measured atday 5. E) Sox17-GFP cells were differentiated in 30 ng/ml activin w/wo FGFs, and expression of GFP wasmeasured at day 5. The mean expression ± S.E.M. of 3 independent experiments is shown, using a Student’s t-testfor the statistical analysis: * = P < 0,05; ** = P < 0,01 compared to the BMP4 or activin conditions.76

Figure 3: Activation of FGFRb or FGFRc-isoforms differentially affects the expression of PS, DE andmesoderm markers. Sox17-GFP cells were differentiated in media containing BMP4 or activin w/wo FGFs for 3-5days before harvest. Cells were stained for markers of PS, DE or mesoderm and analysed using a FACS. A & B)Cells were stained for T and analysed on days 3 and 5. Shown here are the relative number of T + cells in the Sox17-GFP Hi fraction A), or the Sox17-GFP –/Lo fraction B). The mean expression ± S.E.M. of 2 independent experimentsare shown, no statistical analysis performed. C-G) Cells were stained for FLK1 and EpCAM and analysed in eithersingle channel for C) Sox17-GFP, D) FLK1, E) EpCAM; or in multichannel for the Sox17-GFP Hi fraction F), orSox17-GFP –/Lo fraction G) dividing data into four fractions: FLK1 – /EpCAM + ; FLK1 + /EpCAM + ; FLK1 – /EpCAM – ;FLK1 + /EpCAM – . The mean expression ± S.E.M. of 3 independent experiments is shown, using a Student’s paired,two-tailed t-test for the statistical analysis: * = P < 0,05; ** = P < 0,01 compared to the activin conditions.77

Figure 4: FGFs activating FGFRc-isoforms affect early cell growth and proliferation. A wt mES cell line (E14)was grown in media containing activin w/wo FGFs and harvested for analysis of total cell number and proliferationon days 3 &5. A count of total number of cells and relative proliferation of cells is shown for day 3 A) and day 5 B).The mean expression ± S.E.M. of 3 independent experiments is shown, using a Student’s t-test for the statisticalanalysis: * = P < 0,05; ** = P < 0,01 compared to the activin conditions.Opposite, Figure 5: FGF4-signalling is dispensable for endoderm differentiation. E14, FGF4 +/– and FGF4 –/– cellswere stained for markers of pluripotency and endoderm. A) Undifferentiated cells were stained for OCT4 andSOX17 and the nuclear stain DAPI. B) Cells were differentiated for 5 days in 30 ng/ml activin w/wo 5 ng/ml FGF4and stained for OCT4 and endoderm markers SOX17, FOXA2, E-cadherin (Ecad) and DAPI. Representativeimages are shown for each condition. Scale bar: 100 µm.78

Opposite, Figure 6: In the absence of FGF4, DE rather than VE is formed. Antibody stain and qPCR-analyses ofDE and VE markers in E14, FGF4 +/– and FGF4 –/– cells. A) Undifferentiated cells were stained for SOX17, E-cadherin, SOX7 and the nuclear stain DAPI. B) Cells were differentiated for 5 days in 30 ng/ml activin w/wo 5ng/ml FGF4 and stained for the same markers. Representative images are shown for each condition. Scale bar: 100µm. C) qPCR data showing the relative expression levels of Sox17, Cxcr4, Sox7 and Tdh mRNA present inundifferentiated and differentiated cells of each cell line compared to E14 ESCs, all standardized to the housekeepinggene Tbp. The mean expression ± S.E.M. of 3 independent experiments is shown (n=2 for FGF4 –/– cellstreated w/ activin + FGF4), using a Ratio t-test for the statistical analysis: # = P < 0,05; ## = P < 0,01 compared to theE14 mES cell condition.SUPPLEMENTARY DATAFigure S1: Negative controls of EdU-incorporation and sort gate. A histogram showing the distribution ofpluripotent E14 mES cells with/without EdU-incorporation and without EdU-stain (red and black samples); withoutEdU-incorporation and with EdU-stain (blue sample); and w/ EdU-incorporation and with EdU-stain (stained withAlexa-488, i.e. positive control; green sample).81

Figure S2: A few areas of SOX7 + cells in the FGF4 –/– cell line after DE-induction. Cells were differentiated for 5days in 30 ng/ml activin w/wo 5 ng/ml FGF4 and stained for SOX17, E-cadherin, SOX7 and the nuclear stainDAPI. The yellow frame indicates area blown up and shown to the right (red signal boosted). Representativeimages are shown for each condition, except for FGF4 –/– cells in activin alone which shows a SOX7 + area in theculture. White scale bar: 100 µm; yellow scale bar: 50 µm.82

6. General discussionEndoderm differentiationBasic culture conditionsOur culture system is based on serum and feeder-free conditions by means of gelatine-coatedculture flasks and the N2, B27, BMP4 and LIF supplements. Remnants of serum and feedershave been removed by growing cells for 3 passages, i.e. 6 days, under these conditions prior toexperimental setup. In the presence of LIF and BMP4 cells do not differentiate, but it is hard todetermine the effect of trace amounts of BMP4 on the very early differentiation in the culture.However, such differentiation would most likely be opposed by trace amounts of LIF andtherefore not have any practical effect especially when cells are differentiated using highconcentrations of growth factors.A recent study showed that inhibition of FGFRs, MEK and GSK3 through addition of the smallmolecule inhibitors SU5402, PD184352 and Chir99021 respectively, could maintain cellspluripotent over time (Ying et al. 2008). This protocol was refined by using the stronger MEKinhibitorPD0325901 in combination with Chir99021 (Nichols et al. 2009). Thus, LIF andBMP4 are not necessary for maintenance of pluripotency, as inhibition of the MAPK-pathwayand GSK3 is sufficient. This protocol may be preferred in the future to avoid maintenance ofthe pluripotent state through addition of e.g. BMP4, a potent inducer of mesodermdifferentiation.‘Mesendoderm’: Does it exist?Nodal and BMP4, both members of the TGFβ superfamily are expressed in the PS and ExE,respectively, and act in opposite directions to induce DE and mesoderm. These two germ layersderive from the same population of epiblast cells migrating through the PS during gastrulation.Cells moving through the PS are bipotent and are collectively termed the mesendoderm beforethey are further differentiated into mesoderm and endoderm (Lawson et al. 1991; Kinder et al.2001; Rodaway and Patient 2001). This mesendoderm population seems much conserved, as itis found from Caenorhabditis elegans (C. elegans) through Xenopus laevis (Xenopus) tozebrafish (Rodaway et al. 1999; Rodaway and Patient 2001). A bipotent mesendoderm cellpopulation has also been shown in mES cell work where a pool of cells expressing T orGSC/FOXA2/PDGFRα, i.e. a mesendoderm population, had the potential to form bothmesoderm and endoderm dependent on the growth factors presented (Kubo et al. 2004; Tada etal. 2005). Indeed, we found that by using GFP-reporter cell lines for the PS markers T, Gsc andMixl1, we could analyse the effect of anteriorising and posteriorising TGFβ- and WNTsignallingin the early differentiation steps.Although the mesendoderm cell population is well-established from C. elegans to mousedevelopment, it is challenged by a recent study. By use of single-cell lineage tracing, theauthors claim that endoderm and surface ectoderm segregate during gastrulation, whereas apool of bipotent neuromesoderm persists through all stages of axis elongation (Tzouanacou etal. 2009). If these observations hold true, it has implication for ES cell differentiation towardscells of the DE lineage, as it will then be better to obtain a pool of cells expressing DE markersonly, and not a combination of DE and mesoderm markers at early stages.Other groups and we have shown derivation of DE cells from a population of cells expressingapp. 40 – 70% mesendoderm markers (Tada et al. 2005). Whether these DE cells derive from amesendoderm population or rather from an endoderm population directly, is difficult toestablish without the use of lineage tracing during differentiation. Also, any contribution ofsignals from randomly differentiated cells to the forming DE may prove important, but are asyet not studied in depth. All in all this mesendoderm population may prove not to have apractical limitation to ES cell differentiation in vitro as long as the DE is properly established.83

The definitive problem of endodermWhen initiating differentiation into endoderm there is a great concern as to whether it hasbecome visceral or definitive endoderm. These cell types share many markers (Sox17, Foxa2,E-cadherin), and it is therefore necessary to test the obtained cell population for the divergingmarkers to make a solid conclusion. In pratice this has proven less important, as induction ofDE is based on addition of activin, in which visceral endoderm (VE) does not form (Yasunagaet al. 2005). However, it is still necessary to show more than the shared markers to drawconvincing conclusions.In the developing embryo, the forming DE cells have traditionally been believed to replace theouter layer of VE, thus forming a homogeneous cell layer. A recent study performing lineagetracingof VE cells in the mouse embryo suggests that DE cells insert into the VE cellpopulation (Kwon et al. 2008). The VE cells are diluted by the faster proliferating DE cells, butVE cells are found in the gut tube lining as late as the 16-18 somite stages. This indicates thatthe VE does indeed contribute to the embryo proper and suggests that it may not be detrimentalto have a small population of VE cells in the differentiating culture after all.FGFR isoform-specific activation in differentiationFGFs in evolution: why are there so many in Mammalia?The temporal and spatial expression of FGFs and FGFRs determine signalling at any giventime. The large number of FGFs and FGFRs may seem excessive since a simpler system wouldbe more ‘cost-efficient’ to the cell. FGFs are found only in multicellular organisms (metazoa),ranging from the nematode C. elegans to mouse and human (Itoh and Ornitz 2004). In C.elegans there are two FGFs and one FGFR and in Drosophila melanogaster there are threeFGFs (Ornitz and Itoh 2001; Itoh and Ornitz 2004). The reason behind the large family of FGFsfound in mouse and human lies in two phases of expansion during evolution. The firstexpansion occurred by genome duplication before chordate evolution. The second expansionoccurred during early vertebrate evolution by two large-scale gene-duplications, possibly of thewhole genome each time (Itoh and Ornitz 2004). This resulted in the 22 FGFs found in miceand humans today. FGFRs co-evolved with the FGFs and they have since evolved splicevariants,which add to the complexity of ligand-receptor specificity and downstream signalling(Itoh and Ornitz 2004). The temporal and spatial expression of FGFs and FGFRs determinesignalling at any given time, and an additional layer of complexity is added by the evolution ofHSs, which are also differentially expressed (Allen and Rapraeger 2003).The many different functions of FGFs during development and adult homeostasis is probablythe basis for the abundance of FGFs and FGFRs found in mammals, as specific regulation oftheir function is important. Most null mutants show different phenotypes, arguing for distinctfunctions of each FGF during development. These specific functions are tissue- and time pointdependent:some FGFs are expressed at the same time in certain tissues, but have distinctfunctions in other tissues, as is the case for the FGF8 family, comprising FGF8, 17 and 18.These are co-expressed in the midbrain-hindbrain junction, but FGF8 and FGF18 showdifferential expression and effects in limb and bone development, respectively (Xu et al. 2000;Liu et al. 2002). This overlapping expression of FGFs belonging to the same sub-family, andtheir shared FGFR-binding properties, argue for a functional redundancy among FGFs (Itohand Ornitz 2004). Redundancy between sub-families is also seen, for example by FGF3 and 8in the induction of otic placode and forebrain development in zebrafish (Liu et al. 2003; Walsheand Mason 2003). In embryonic development, the specific activation of FGFRs is not onlydependent on the concentration of FGFs secreted, but also on their diffusion through theextracellular matrix where HS retains them. The effective dose may therefore be differentamong cells, and could explain e.g. the differential expression of epiblast and primitiveendoderm markers in the ICM, which was recently shown to be FGF concentration-dependent(Yamanaka et al. 2010).84

Overall, the multitude of FGF-signalling is huge and has to be interpreted in the spatio-temporalcontext in which it is investigated. In in vitro ES cell differentiation, however, one can makeuse of redundant functions of the different FGFs as the effect upon differentiation is onlydependent on the expression of FGFRs and not necessarily on the endogenous range of FGFsexpressed. Still, the endogenously expressed FGFs must be taken into account when aiming forthe optimal protocol to ensure no conflicting signalling is taking place in the cells.FGFR-isoforms in DE formation and patterningWe have shown that FGFs activating FGFRc-isoforms increase the numbers of cells expressingmesendoderm markers but reduce the numbers of Sox17-GFP + DE cells. On the other hand,FGFs activating only FGFRb-isoforms have no effect on these cells, most likely due to theirlack of expression. This argues for a beneficial effect of FGFRc-activation during early stageDE-induction, namely in the generation of a mesendodermal population of cells, but aninhibitory effect of these same FGFs during the later DE-specification. Also, the concentrationsof FGFs used in this study may prove to be important. DE-formation is dependent on FGFRsignalling,as inhibition by small molecules inhibits Sox17-GFP + cells. Likewise, highconcentrations of FGFs have an inhibitory effect on this same population, arguing for anoptimal intermediate concentration. Such an intermediate concentration is possibly even belowthe endogenous FGF concentration, as the FGF4 +/– cell line seems to differentiate into DE at ahigher success that the wt or the FGF4 –/– cell line, even when the latter is supplemented with alow concentration of FGF4.Meanwhile, experiments in ‘Step 2’ of the Pdx1-inducing protocol (Chapter 4) show thataddition of FGFs increases the number of Pdx1-GFP + cells, possibly through their mitogeniceffect. Furthermore, FGF7 and 10 function even better than FGF4 in induction of Pdx1-GFP +cells (Nina Engberg and Claude Rescan, unpublished data), arguing that FGFRb-isoforms arepresent and have an additional role to the mitogenic alone. These DE cells are epithelial and assuch probably require activation of FGFRb-isoforms during DE patterning and/ ororganogenesis. This would make sense from a developmental point of view as the developmentof epithelial components in many organs depends on FGF10 for epithelio-mesenchymalinteractions (Min et al. 1998; Ohuchi et al. 2000). Also, FGFRb-isoforms are expressed inepithelial tissues during development (Kathrine Beck Sylvestersen, unpublished data; (Ornitzand Itoh 2001)).Overall, addition of FGFs activating FGFRc-isoforms during mesendoderm formation followedby absence of FGFs during DE-formation and finally FGFRb isoform-activation duringinduction of posterior foregut, i.e. Pdx1-expressing cells, could prove the most beneficial.Successful DE formation in an FGF4 null cell lineAt a low cell density, we see that the FGF4 –/– cell line readily differentiates into DE, showingindependence of FGF4-signalling in induction of differentiation. This was surprising, as aprevious study showed dependence for FGF4 in the induction of ectoderm and mesodermdifferentiation, thus suggesting that FGF4-signalling is needed for cells to leave the pluripotentstate altogether (Kunath et al. 2007). This inhibition of differentiation could be reverted byaddition of FGF4, but not by FGF5, which is expressed early during differentiation andactivates FGFR1c as does FGF4 (Haub and Goldfarb 1991). However, FGF4 additionallyactivates FGFR2c, 3c and 4 and a redundancy by FGF6 or 8(b) may prove significant as thesebind FGFR1c, 2c, 4 and FGFR2c, 3c, 4, respectively, similar to FGF4 (Ornitz et al. 1996;Zhang et al. 2006; Mason 2007).From in vitro studies of mammalian cell cultures, it is known that there is a positive correlationbetween cell density and cellular response, measured by receptor phosphorylation or geneexpression (Polk et al. 1995; Bedrin et al. 1997; Batt and Roberts 1998; Mukhopadhyay et al.1998). On the other hand, an inverse correlation between cell density and gene expression hasbeen shown in other systems (Li and Goldstein 1996; Singh et al. 1996; Posern et al. 1998). InES cell cultures little is known about cell density and gene expression responses. It was shownthat cells grown at high densities have a pool of β-catenin located at the cell surface, where it is85

involved in WNT-signalling and maintenance of the pluripotent state (Chang et al. 2010). Thus,here it seems that a high cell density may inhibit differentiation, which has also been suggestedby Smith and co-workers (Smith et al. 1992). Similarly, we propose inhibition by high celldensities in the FGF4 –/– ES cell culture, and suggest low seeding densities for optimaldifferentiation.DE patterningIt seems rather symptomatic that we successfully reach 40-60% SOX17 + DE cells, but havelimited success in further patterning this DE to PDX1-expressing posterior foregut. We saw aninduction of PDX1-expressing cells when adding RA and FGF (and Cyclopamine), but nevermore than 2-4% on average. Competing groups have successfully obtained 32% PDX1 + cells inhES cell cultures by using some of the same posterior foregut-inducing factors, basing theirscientific approach on the same hypotheses as we do (Johannesson et al. 2009; Ameri et al.2010). Therefore the reason for our inefficient Pdx1-GFP induction shall possibly be soughtelsewhere.The Pdx1-GFP cell line we use has shown a nice expression pattern within the posterior foregutregion when injected into mouse blastocysts to form chimaeras (Tino Klein, unpublished data).The cell line works in vivo and is pluripotent, and we therefore expect it to also work in vitro.One point could be that we have optimized the DE-induction step in the Sox17-GFP and not thePdx1-GFP cell line. Data from hES cells indicate that the outcome of a differentiation protocolvaries much between cell lines (D'Amour et al. 2006; Mfopou et al. 2010). If this is also thecase for mES cells, we will have to redo optimization of DE-induction in our Pdx1-GFP cellline to have the best starting material. However, our protocol induces 2-4% Pdx1 + cells in E14,Pdx1-LacZ and Pdx1-GFP cell lines, showing robustness of the protocol.A developmental-based explanation is that the DE we have is simply not the ‘correct’ one.Using our protocol, we get many SOX2 + cells, suggesting that the DE we have after 5 days inhigh concentrations of activin may be somehow pre-patterned to respond to patterning factorspredominantly by induction of anterior foregut, marked by SOX2.Finally, there could be one or more components in our basic medium or medium supplementsthat inhibit differentiation. This problem could be overcome by changing the basic medium,medium supplements and the culture dish coating individually to decipher which may beinhibitory.Cell replacement therapy as a future cure for TIDMES cells are not the only source of β cells or β-like cells envisioned as material for futuretransplantation in the treatment or even cure for diabetes. Some perspectives of the variousalternatives are discussed below.Xeno-transplantationXeno-transplantation of islets of Langerhans from pig to primate is being investigated as atreatment for type I diabetes. The use of pigs is promising, as their vascular physiology issimilar to that of humans and they are relatively cheap to breed. Furthermore, the so-calledmini-pigs weighing app. 120 kg are similar to humans in organ and body sizes and can beinbred to homozygosity at e.g. the porcine major histocompatibility complex (MCH). The latterholds a great potential for manipulation to create customized donor organs/ cells and overcomesome of the problems of immune-responses normally seen in transplantation. This could bedone by introducing porcine MHC genes into the bone marrow of the recipient human inducingmixed chimaerism thereby introducing immunological tolerance to the xenograft (Hoerbelt andMadsen 2004). Alternatively, pigs could be genetically manipulated not to express geneproducts to which the recipient immune system reacts. Of major concern in xeno-86

transplantation is the spread of animal diseases to humans. Some of the risk factors may beeliminated by breeding homozygous mini-pigs in controlled environments.EpiSCs, hESCs and iPSCsIt has recently been shown that epiblast stem cells (epiSCs) derived from post-implantationmouse blastocysts show characteristics of hES cells in their need for pluripotency-maintainingfactors activin and FGF2 (Brons et al. 2007; Tesar et al. 2007; Vallier et al. 2009). Also, theirresponse to differentiation-inducing factors is more similar to hES cells than what is seen formES cells (Vallier et al. 2009). This close resemblance to hES cells may make epiSCs a bettermodel for studying differentiation, as extrapolation of knowledge to the hES cell field mayprove easier and more valuable. One major advantage is that existing ES cell lines can beconverted into epiSCs without new derivation from mouse embryos (Guo et al. 2009), makingalready established transgenic cell lines readily transferable by a low work load. This may holdgreat potential for better inter-species protocol transfer between epiSCs and hES cells.In 2006, the Yamanaka-group showed that mature somatic cells, i.e. skin fibroblasts, can beinduced to achieve an ES cell-like phenotype, i.e. become pluripotent and are reported tobehave in the same way as mES or hES cells upon differentiation. These induced pluripotentstem (iPS) cells were generated by introduction of four transcription factors Oct4, Sox2, Klf4,and C-myc (Takahashi and Yamanaka 2006). This was done in mice, and the protocol has sincebeen modified in several ways and has been transferred to human cells (Takahashi et al. 2007;Yamanaka 2009). iPS cells hold the potential for development of patient-specific pluripotentstem cell lines, which can be differentiated into any cell type of choice. They thereforerepresent a source of transplantable cells, which eliminates the need for immune-suppressingagents to a large degree. Although this is a very positive future application, in reality it mayprove much too expensive for actual treatment. iPS cells will likely be important tools formodelling of and investigating the aetiology of (inherited) human diseases, which are notdiscovered until the disease state is complete. For instance, type I diabetes is normally notdiscovered until patients suffer from high blood glucose levels at which time point their β cellmass is practically obsolete (Maehr et al. 2009). Whether iPS cells will serve as material for cellreplacement-therapies is still to be seen. Of major concern is to ensure that the genomicreprogramming of the cells is complete, a trait believed necessary for the cells to adopt thecorrect fate upon exposure to differentiation-inducing conditions (Yamanaka 2009). Also,teratoma formation from fully reprogrammed iPS cells cannot be avoided so far, making themunsuited for treatment in humans at this point. In general, avoiding teratoma-formation fromdifferentiated cell populations is a major concern in transplantation. It is not acceptable to curefor instance diabetes but at the same time induce a cancerous condition, and as long as this riskexists with cell therapy-protocols, they will not be approved for treatment.Generation of β cells from existing cell sources in the pancreasThe presence of a pancreatic stem cell, which has clonogenic potential, is multipotent and canbe induced to generate insulin-producing cells in vitro has been suggested in both mice andhumans (Ramiya et al. 2000; Seaberg et al. 2004; Zhao et al. 2007). However, it is speculatedthat these cells only show such stem cell-like properties due to the in vitro culture conditions(Baeyens and Bouwens 2008). A more convincing in vivo study showed the presence of isletprecursors that could be activated upon serious tissue injury by the so-called partial ductligation,in which facultative multipotent progenitor cells in the ductal lining differentiate andproliferate into functional β cells (Xu et al. 2008).An alternative approach is to generate β cells by reprogramming of existing endocrine orexocrine cells in the pancreas. Following pancreatectomy to a mild or severe degree (70% and95% respectively), regeneration of β cell mass is achieved through either replication of existingβ cells or through neogenesis of precursor cells in addition to replication (Dor et al. 2004;Bouwens and Rooman 2005). Exocrine ductal cells show convincing potential as they seemable to contribute to glucose-responsive β cells through reprogramming (Baeyens and Bouwens87

2008). Lineage tracing of these cells has not yet been performed but will elucidate whether theincreases in β cell mass are truly by neogenesis of ductal cells. Acinar cells cultured in vitroshow dedifferentiation, possibly to the stage of the common acinar and endocrine cell which isfound during pancreas development. They can subsequently be re-specified into hepatocytes inhuman cultures and β cells in mouse cultures, showing a large amount of plasticity of thesecells (Lardon et al. 2004; Okuno et al. 2007).Whether it is possible to circumvent the patient’s auto-immune response towards these β cells isstill to be seen. For the moment, life-long treatment with immune-suppressors represents theonly alternative and is not desirable due to inherent side effects.Concluding remarksThe reason for putting a large effort into differentiation in a 2-dimensional, serum and feederfreeprotocol is first of all to be able to better control the signalling events going on in the dishand thereby better direct differentiation into the cell types of desire. A second and not lessimportant point is that cell culture with animal products is not desirable due to fear of spread ofdisease. The latter especially has major implications in xeno-transplantations. Recently, apublication showing derivation and culture of a xeno-free hES cell line was published(Ellerstrom et al. 2006). In the future, this could very well be the only material we arecomfortable with using for transplantation and it will as such have major impact on theapplication of the various differentiation protocols applicable to clinical work.88

AcknowledgementsThe work presented here has been made possible first and foremost by Palle Serup and Helle V.Petersen offering me a position as a Ph.D.-student in their department and through thesupervision by Palle Serup. The former Department of Developmental Biology (now ‘Dept.s ofStem Cell Biology’ and ‘β-Cell Regeneration’) is an inspiring and pleasant workplace, bothduring and outside work-hours. I thank all of you for 5 really good years at Hagedorn and thestem cell group in particular for primarily supplying the scientific input. Thanks to Søren R.Lindskog and Gurmeet K. Singh for help on practical lab work. A special thanks to NinaEngberg, my significant other in the lab, office, cell room and in achieving the Master’s degreeand working through the Ph.D. I am grateful to Jan N. Jensen, Tino Klein and Mattias Hansson,whose constructive natures helped me at critical time points. Thanks to Anette Bjerregaard forbeing the social backbone of our department.Outside work, I have been lucky to have a very supportive family and friends bringing muchfun, seriousness and good times into my life. I’m always amazed at how many people can bepersuaded to come and party on Mors! I could not have done this without you, Mads: youbelieve in me like no one else! A special thanks to Hjalte, my dancing tiger for demandingfocus on what’s important and always making me happy.90

7. ReferencesAllen, B.L. and A.C. Rapraeger. 2003. Spatial and temporal expression of heparan sulfate in mousedevelopment regulates FGF and FGF receptor assembly. J Cell Biol 163: 637-48.Ameri, J., A. Stahlberg, J. Pedersen, J.K. Johansson, M.M. Johannesson, I. Artner, and H. Semb. 2010.FGF2 specifies hESC-derived definitive endoderm into foregut/midgut cell lineages in aconcentration-dependent manner. Stem Cells 28: 45-56.Armelin, H.A. 1973. Pituitary extracts and steroid hormones in the control of 3T3 cell growth. Proc NatlAcad Sci U S A 70: 2702-6.Arnold, S.J. and E.J. Robertson. 2009. Making a commitment: cell lineage allocation and axis patterningin the early mouse embryo. Nat Rev Mol Cell Biol 10: 91-103.Avilion, A.A., S.K. Nicolis, L.H. Pevny, L. Perez, N. Vivian, and R. Lovell-Badge. 2003. Multipotentcell lineages in early mouse development depend on SOX2 function. Genes Dev 17: 126-40.Baeyens, L. and L. Bouwens. 2008. Can beta-cells be derived from exocrine pancreas? Diabetes ObesMetab 10 Suppl 4: 170-8.Bastian, H. and P. Gruss. 1990. A murine even-skipped homologue, Evx 1, is expressed during earlyembryogenesis and neurogenesis in a biphasic manner. Embo J 9: 1839-52.Batt, D.B. and T.M. Roberts. 1998. Cell density modulates protein-tyrosine phosphorylation. J BiolChem 273: 3408-14.Bayha, E., M.C. Jorgensen, P. Serup, and A. Grapin-Botton. 2009. Retinoic acid signaling organizesendodermal organ specification along the entire antero-posterior axis. PLoS One 4: e5845.Bedrin, M.S., C.M. Abolafia, and J.F. Thompson. 1997. Cytoskeletal association of epidermal growthfactor receptor and associated signaling proteins is regulated by cell density in IEC-6 intestinalcells. J Cell Physiol 172: 126-36.Ben-Haim, N., C. Lu, M. Guzman-Ayala, L. Pescatore, D. Mesnard, M. Bischofberger, F. Naef, E.J.Robertson, and D.B. Constam. 2006. The nodal precursor acting via activin receptors inducesmesoderm by maintaining a source of its convertases and BMP4. Dev Cell 11: 313-23.Bhushan, A., N. Itoh, S. Kato, J.P. Thiery, P. Czernichow, S. Bellusci, and R. Scharfmann. 2001. Fgf10is essential for maintaining the proliferative capacity of epithelial progenitor cells during earlypancreatic organogenesis. Development 128: 5109-17.Blaha, P., S. Bigenzahn, Z. Koporc, M. Sykes, F. Muehlbacher, and T. Wekerle. 2005. Short-termimmunosuppression facilitates induction of mixed chimerism and tolerance after bone marrowtransplantation without cytoreductive conditioning. Transplantation 80: 237-43.Blum, M., S.J. Gaunt, K.W. Cho, H. Steinbeisser, B. Blumberg, D. Bittner, and E.M. De Robertis. 1992.Gastrulation in the mouse: the role of the homeobox gene goosecoid. Cell 69: 1097-106.Borowiak, M. and D.A. Melton. 2009. How to make beta cells? Curr Opin Cell Biol 21: 727-32.Bottcher, R.T. and C. Niehrs. 2005. Fibroblast growth factor signaling during early vertebratedevelopment. Endocr Rev 26: 63-77.Bouwens, L. and D.G. Pipeleers. 1998. Extra-insular beta cells associated with ductules are frequent inadult human pancreas. Diabetologia 41: 629-33.Bouwens, L. and I. Rooman. 2005. Regulation of pancreatic beta-cell mass. Physiol Rev 85: 1255-70.Brons, I.G., L.E. Smithers, M.W. Trotter, P. Rugg-Gunn, B. Sun, S.M. Chuva de Sousa Lopes, S.K.Howlett, A. Clarkson, L. Ahrlund-Richter, R.A. Pedersen, and L. Vallier. 2007. Derivation ofpluripotent epiblast stem cells from mammalian embryos. Nature 448: 191-5.Bullock, S.L., J.M. Fletcher, R.S. Beddington, and V.A. Wilson. 1998. Renal agenesis in micehomozygous for a gene trap mutation in the gene encoding heparan sulfate 2-sulfotransferase.Genes Dev 12: 1894-906.Carballada, R., H. Yasuo, and P. Lemaire. 2001. Phosphatidylinositol-3 kinase acts in parallel to theERK MAP kinase in the FGF pathway during Xenopus mesoderm induction. Development 128:35-44.Carey, F.J., E.A. Linney, and R.A. Pedersen. 1995. Allocation of epiblast cells to germ layer derivativesduring mouse gastrulation as studied with a retroviral vector. Dev Genet 17: 29-37.Cartwright, P., C. McLean, A. Sheppard, D. Rivett, K. Jones, and S. Dalton. 2005. LIF/STAT3 controlsES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132: 885-96.92

Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A. Smith. 2003. Functionalexpression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643-55.Chang, T.C., Y.C. Chen, M.H. Yang, C.H. Chen, E.W. Hsing, B.S. Ko, J.Y. Liou, and K.K. Wu. 2010.Rho kinases regulate the renewal and neural differentiation of embryonic stem cells in a cellplating density-dependent manner. PLoS One 5: e9187.Chawengsaksophak, K., W. de Graaff, J. Rossant, J. Deschamps, and F. Beck. 2004. Cdx2 is essentialfor axial elongation in mouse development. Proc Natl Acad Sci U S A 101: 7641-5.Chazaud, C., Y. Yamanaka, T. Pawson, and J. Rossant. 2006. Early lineage segregation between epiblastand primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Dev Cell 10:615-24.Cho, Y.M., J.M. Lim, D.H. Yoo, J.H. Kim, S.S. Chung, S.G. Park, T.H. Kim, S.K. Oh, Y.M. Choi, S.Y.Moon, K.S. Park, and H.K. Lee. 2008. Betacellulin and nicotinamide sustain PDX1 expressionand induce pancreatic beta-cell differentiation in human embryonic stem cells. Biochem BiophysRes Commun 366: 129-34.D'Amour, K.A., A.D. Agulnick, S. Eliazer, O.G. Kelly, E. Kroon, and E.E. Baetge. 2005. Efficientdifferentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol 23: 1534-41.D'Amour, K.A., A.G. Bang, S. Eliazer, O.G. Kelly, A.D. Agulnick, N.G. Smart, M.A. Moorman, E.Kroon, M.K. Carpenter, and E.E. Baetge. 2006. Production of pancreatic hormone-expressingendocrine cells from human embryonic stem cells. Nat Biotechnol.Deng, C.X., A. Wynshaw-Boris, M.M. Shen, C. Daugherty, D.M. Ornitz, and P. Leder. 1994. MurineFGFR-1 is required for early postimplantation growth and axial organization. Genes Dev 8:3045-57.Dessimoz, J., R. Opoka, J.J. Kordich, A. Grapin-Botton, and J.M. Wells. 2006. FGF signaling isnecessary for establishing gut tube domains along the anterior-posterior axis in vivo. Mech Dev123: 42-55.Deutsch, G., J. Jung, M. Zheng, J. Lora, and K.S. Zaret. 2001. A bipotential precursor population forpancreas and liver within the embryonic endoderm. Development 128: 871-81.Donath, M.Y. and P.A. Halban. 2004. Decreased beta-cell mass in diabetes: significance, mechanismsand therapeutic implications. Diabetologia 47: 581-9.Dor, Y., J. Brown, O.I. Martinez, and D.A. Melton. 2004. Adult pancreatic beta-cells are formed by selfduplicationrather than stem-cell differentiation. Nature 429: 41-6.Dush, M.K. and G.R. Martin. 1992. Analysis of mouse Evx genes: Evx-1 displays graded expression inthe primitive streak. Dev Biol 151: 273-87.Ellerstrom, C., R. Strehl, K. Moya, K. Andersson, C. Bergh, K. Lundin, J. Hyllner, and H. Semb. 2006.Derivation of a xeno-free human embryonic stem cell line. Stem Cells 24: 2170-6.Eswarakumar, V.P., I. Lax, and J. Schlessinger. 2005. Cellular signaling by fibroblast growth factorreceptors. Cytokine Growth Factor Rev 16: 139-49.Evans, M.J. and M.H. Kaufman. 1981. Establishment in culture of pluripotential cells from mouseembryos. Nature 292: 154-6.Feldman, B., W. Poueymirou, V.E. Papaioannou, T.M. DeChiara, and M. Goldfarb. 1995. Requirementof FGF-4 for postimplantation mouse development. Science 267: 246-9.Finley, M.F., S. Devata, and J.E. Huettner. 1999. BMP-4 inhibits neural differentiation of murineembryonic stem cells. J Neurobiol 40: 271-87.Flaumenhaft, R., D. Moscatelli, and D.B. Rifkin. 1990. Heparin and heparan sulfate increase the radiusof diffusion and action of basic fibroblast growth factor. J Cell Biol 111: 1651-9.Fukumoto, S. and T. Yamashita. 2007. FGF23 is a hormone-regulating phosphate metabolism--uniquebiological characteristics of FGF23. Bone 40: 1190-5.Funa, N.S., J. Saldeen, B. Akerblom, and M. Welsh. 2008. Interdependent fibroblast growth factor andactivin A signaling promotes the expression of endodermal genes in differentiating mouseembryonic stem cells expressing Src Homology 2-domain inactive Shb. Differentiation 76: 443-53.Futaki, S., Y. Hayashi, T. Emoto, C.N. Weber, and K. Sekiguchi. 2004. Sox7 plays crucial roles inparietal endoderm differentiation in F9 embryonal carcinoma cells through regulating Gata-4and Gata-6 expression. Mol Cell Biol 24: 10492-503.Gadue, P., T.L. Huber, M.C. Nostro, S. Kattman, and G.M. Keller. 2005. Germ layer induction fromembryonic stem cells. Exp Hematol 33: 955-64.93

Gadue, P., T.L. Huber, P.J. Paddison, and G.M. Keller. 2006. Wnt and TGF-beta signaling are requiredfor the induction of an in vitro model of primitive streak formation using embryonic stem cells.Proc Natl Acad Sci U S A 103: 16806-11.Gardner, R.L. 1983. Origin and differentiation of extraembryonic tissues in the mouse. Int Rev ExpPathol 24: 63-133.Goldfarb, M. 2005. Fibroblast growth factor homologous factors: evolution, structure, and function.Cytokine Growth Factor Rev 16: 215-20.Gospodarowicz, D. 1974. Localisation of a fibroblast growth factor and its effect alone and withhydrocortisone on 3T3 cell growth. Nature 249: 123-7.Grapin-Botton, A. and D.A. Melton. 2000. Endoderm development: from patterning to organogenesis.Trends Genet 16: 124-30.Groth, C. and M. Lardelli. 2002. The structure and function of vertebrate fibroblast growth factorreceptor 1. Int J Dev Biol 46: 393-400.Guo, G., J. Yang, J. Nichols, J.S. Hall, I. Eyres, W. Mansfield, and A. Smith. 2009. Klf4 revertsdevelopmentally programmed restriction of ground state pluripotency. Development 136: 1063-9.Hacohen, N., S. Kramer, D. Sutherland, Y. Hiromi, and M.A. Krasnow. 1998. sprouty encodes a novelantagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell 92:253-63.Hanneken, A. 2001. Structural characterization of the circulating soluble FGF receptors reveals multipleisoforms generated by secretion and ectodomain shedding. FEBS Lett 489: 176-81.Hardikar, A.A. 2004. Generating new pancreas from old. Trends Endocrinol Metab 15: 198-203.Haub, O. and M. Goldfarb. 1991. Expression of the fibroblast growth factor-5 gene in the mouseembryo. Development 112: 397-406.Hebert, J.M., M. Boyle, and G.R. Martin. 1991. mRNA localization studies suggest that murine FGF-5plays a role in gastrulation. Development 112: 407-15.Hebrok, M., S.K. Kim, and D.A. Melton. 1998. Notochord repression of endodermal Sonic hedgehogpermits pancreas development. Genes Dev 12: 1705-13.Hoerbelt, R. and J.C. Madsen. 2004. Feasibility of xeno-transplantation. Surg Clin North Am 84: 289-307.Holland, A.M., S.J. Micallef, X. Li, A.G. Elefanty, and E.G. Stanley. 2006. A mouse carrying the greenfluorescent protein gene targeted to the Pdx1 locus facilitates the study of pancreas developmentand function. Genesis 44: 304-7.Hsu, Y.R., R. Nybo, J.K. Sullivan, V. Costigan, C.S. Spahr, C. Wong, M. Jones, A.G. Pentzer, J.A.Crouse, R.E. Pacifici, H.S. Lu, C.F. Morris, and J.S. Philo. 1999. Heparin is essential for asingle keratinocyte growth factor molecule to bind and form a complex with two molecules ofthe extracellular domain of its receptor. Biochemistry 38: 2523-34.Itoh, N. and D.M. Ornitz. 2004. Evolution of the Fgf and Fgfr gene families. Trends Genet 20: 563-9.-. 2008. Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 237: 18-27.Johannesson, M., A. Stahlberg, J. Ameri, F.W. Sand, K. Norrman, and H. Semb. 2009. FGF4 andretinoic acid direct differentiation of hESCs into PDX1-expressing foregut endoderm in a timeandconcentration-dependent manner. PLoS One 4: e4794.Johnson, D.E., P.L. Lee, J. Lu, and L.T. Williams. 1990. Diverse forms of a receptor for acidic and basicfibroblast growth factors. Mol Cell Biol 10: 4728-36.Johnson, D.E., J. Lu, H. Chen, S. Werner, and L.T. Williams. 1991. The human fibroblast growth factorreceptor genes: a common structural arrangement underlies the mechanisms for generatingreceptor forms that differ in their third immunoglobulin domain. Mol Cell Biol 11: 4627-34.Johnson, D.E. and L.T. Williams. 1993. Structural and functional diversity in the FGF receptormultigene family. Adv Cancer Res 60: 1-41.Jonsson, J., L. Carlsson, T. Edlund, and H. Edlund. 1994. Insulin-promoter-factor 1 is required forpancreas development in mice. Nature 371: 606-9.Jorgensen, M.C., J. Ahnfelt-Ronne, J. Hald, O.D. Madsen, P. Serup, and J. Hecksher-Sorensen. 2007.An illustrated review of early pancreas development in the mouse. Endocr Rev 28: 685-705.Kanai-Azuma, M., Y. Kanai, J.M. Gad, Y. Tajima, C. Taya, M. Kurohmaru, Y. Sanai, H. Yonekawa, K.Yazaki, P.P. Tam, and Y. Hayashi. 2002. Depletion of definitive gut endoderm in Sox17-nullmutant mice. Development 129: 2367-79.Kharitonenkov, A., T.L. Shiyanova, A. Koester, A.M. Ford, R. Micanovic, E.J. Galbreath, G.E.Sandusky, L.J. Hammond, J.S. Moyers, R.A. Owens, J. Gromada, J.T. Brozinick, E.D.94

Hawkins, V.J. Wroblewski, D.S. Li, F. Mehrbod, S.R. Jaskunas, and A.B. Shanafelt. 2005.FGF-21 as a novel metabolic regulator. J Clin Invest 115: 1627-35.Kinder, S.J., T.E. Tsang, G.A. Quinlan, A.K. Hadjantonakis, A. Nagy, and P.P. Tam. 1999. The orderlyallocation of mesodermal cells to the extraembryonic structures and the anteroposterior axisduring gastrulation of the mouse embryo. Development 126: 4691-701.Kinder, S.J., T.E. Tsang, M. Wakamiya, H. Sasaki, R.R. Behringer, A. Nagy, and P.P. Tam. 2001. Theorganizer of the mouse gastrula is composed of a dynamic population of progenitor cells for theaxial mesoderm. Development 128: 3623-34.Kispert, A. and B.G. Herrmann. 1994. Immunohistochemical analysis of the Brachyury protein in wildtypeand mutant mouse embryos. Dev Biol 161: 179-93.Kraushaar, D.C., Y. Yamaguchi, and L. Wang. 2010. Heparan sulfate is required for embryonic stemcells to exit from self-renewal. J Biol Chem 285: 5907-16.Kroon, E., L.A. Martinson, K. Kadoya, A.G. Bang, O.G. Kelly, S. Eliazer, H. Young, M. Richardson,N.G. Smart, J. Cunningham, A.D. Agulnick, K.A. D'Amour, M.K. Carpenter, and E.E. Baetge.2008. Pancreatic endoderm derived from human embryonic stem cells generates glucoseresponsiveinsulin-secreting cells in vivo. Nat Biotechnol 26: 443-52.Kubo, A., K. Shinozaki, J.M. Shannon, V. Kouskoff, M. Kennedy, S. Woo, H.J. Fehling, and G. Keller.2004. Development of definitive endoderm from embryonic stem cells in culture. Development131: 1651-62.Kumar, M. and D. Melton. 2003. Pancreas specification: a budding question. Curr Opin Genet Dev 13:401-7.Kunath, T., M.K. Saba-El-Leil, M. Almousailleakh, J. Wray, S. Meloche, and A. Smith. 2007. FGFstimulation of the Erk1/2 signalling cascade triggers transition of pluripotent embryonic stemcells from self-renewal to lineage commitment. Development 134: 2895-902.Kwon, G.S., M. Viotti, and A.K. Hadjantonakis. 2008. The endoderm of the mouse embryo arises bydynamic widespread intercalation of embryonic and extraembryonic lineages. Dev Cell 15: 509-20.Lardon, J., S. De Breuck, I. Rooman, L. Van Lommel, M. Kruhoffer, T. Orntoft, F. Schuit, and L.Bouwens. 2004. Plasticity in the adult rat pancreas: transdifferentiation of exocrine tohepatocyte-like cells in primary culture. Hepatology 39: 1499-507.Lawson, K.A., N.R. Dunn, B.A. Roelen, L.M. Zeinstra, A.M. Davis, C.V. Wright, J.P. Korving, andB.L. Hogan. 1999. Bmp4 is required for the generation of primordial germ cells in the mouseembryo. Genes Dev 13: 424-36.Lawson, K.A., J.J. Meneses, and R.A. Pedersen. 1991. Clonal analysis of epiblast fate during germ layerformation in the mouse embryo. Development 113: 891-911.Lernmark, A. and A. Falorni. 1998. Immune phenomena and events in the islets in insulin-dependentdiabetes mellitus. In Textbook of Diabetes (ed. J.C. Pickup and G. Williams). BlackwellAcience Ltd., Oxford.Li, M., L. Pevny, R. Lovell-Badge, and A. Smith. 1998. Generation of purified neural precursors fromembryonic stem cells by lineage selection. Curr Biol 8: 971-4.Li, P.M. and B.J. Goldstein. 1996. Cell density-dependent changes in the insulin action pathway:evidence for involvement of protein-tyrosine phosphatases. J Cell Biochem 61: 31-8.Lim, J., P. Yusoff, E.S. Wong, S. Chandramouli, D.H. Lao, C.W. Fong, and G.R. Guy. 2002. Thecysteine-rich sprouty translocation domain targets mitogen-activated protein kinase inhibitoryproteins to phosphatidylinositol 4,5-bisphosphate in plasma membranes. Mol Cell Biol 22:7953-66.Ling, C. and L. Groop. 2009. Epigenetics: a molecular link between environmental factors and type 2diabetes. Diabetes 58: 2718-25.Liu, D., H. Chu, L. Maves, Y.L. Yan, P.A. Morcos, J.H. Postlethwait, and M. Westerfield. 2003. Fgf3and Fgf8 dependent and independent transcription factors are required for otic placodespecification. Development 130: 2213-24.Liu, P., M. Wakamiya, M.J. Shea, U. Albrecht, R.R. Behringer, and A. Bradley. 1999. Requirement forWnt3 in vertebrate axis formation. Nat Genet 22: 361-5.Liu, Z., J. Xu, J.S. Colvin, and D.M. Ornitz. 2002. Coordination of chondrogenesis and osteogenesis byfibroblast growth factor 18. Genes Dev 16: 859-69.Ma, Y.G., E. Rosfjord, C. Huebert, P. Wilder, J. Tiesman, D. Kelly, and A. Rizzino. 1992.Transcriptional regulation of the murine k-FGF gene in embryonic cell lines. Dev Biol 154: 45-54.Madsen, O.D. 2005. Stem cells and diabetes treatment. Apmis 113: 858-75.95

Madsen, O.D. and P. Serup. 2006. Towards cell therapy for diabetes. Nat Biotechnol 24: 1481-3.Maehr, R., S. Chen, M. Snitow, T. Ludwig, L. Yagasaki, R. Goland, R.L. Leibel, and D.A. Melton.2009. Generation of pluripotent stem cells from patients with type 1 diabetes. Proc Natl AcadSci U S A 106: 15768-73.Martin, G.R. 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in mediumconditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78: 7634-8.Mason, I. 2007. Initiation to end point: the multiple roles of fibroblast growth factors in neuraldevelopment. Nat Rev Neurosci 8: 583-96.McCall, M.D., C. Toso, E.E. Baetge, and A.M. Shapiro. 2010. Are stem cells a cure for diabetes? ClinSci (Lond) 118: 87-97.Meier, J.J., A. Bhushan, A.E. Butler, R.A. Rizza, and P.C. Butler. 2005. Sustained beta cell apoptosis inpatients with long-standing type 1 diabetes: indirect evidence for islet regeneration?Diabetologia 48: 2221-8.Mfopou, J.K., B. Chen, I. Mateizel, K. Sermon, and L. Bouwens. 2010. Noggin, retinoids, and fibroblastgrowth factor regulate hepatic or pancreatic fate of human embryonic stem cells.Gastroenterology.Mfopou, J.K., V. De Groote, X. Xu, H. Heimberg, and L. Bouwens. 2007. Sonic hedgehog and othersoluble factors from differentiating embryoid bodies inhibit pancreas development. Stem Cells25: 1156-65.Micallef, S.J., M.E. Janes, K. Knezevic, R.P. Davis, A.G. Elefanty, and E.G. Stanley. 2005. Retinoicacid induces Pdx1-positive endoderm in differentiating mouse embryonic stem cells. Diabetes54: 301-5.Micallef, S.J., X. Li, M.E. Janes, S.A. Jackson, R.M. Sutherland, A.M. Lew, L.C. Harrison, A.G.Elefanty, and E.G. Stanley. 2007. Endocrine cells develop within pancreatic bud-like structuresderived from mouse ES cells differentiated in response to BMP4 and retinoic acid. Stem CellRes 1: 25-36.Min, H., D.M. Danilenko, S.A. Scully, B. Bolon, B.D. Ring, J.E. Tarpley, M. DeRose, and W.S.Simonet. 1998. Fgf-10 is required for both limb and lung development and exhibits strikingfunctional similarity to Drosophila branchless. Genes Dev 12: 3156-61.Mitsui, K., Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda,and S. Yamanaka. 2003. The homeoprotein Nanog is required for maintenance of pluripotencyin mouse epiblast and ES cells. Cell 113: 631-42.Mohammadi, M., S. Froum, J.M. Hamby, M.C. Schroeder, R.L. Panek, G.H. Lu, A.V. Eliseenkova, D.Green, J. Schlessinger, and S.R. Hubbard. 1998. Crystal structure of an angiogenesis inhibitorbound to the FGF receptor tyrosine kinase domain. Embo J 17: 5896-904.Mohammadi, M., G. McMahon, L. Sun, C. Tang, P. Hirth, B.K. Yeh, S.R. Hubbard, and J. Schlessinger.1997. Structures of the tyrosine kinase domain of fibroblast growth factor receptor in complexwith inhibitors. Science 276: 955-60.Morrisey, E.E., Z. Tang, K. Sigrist, M.M. Lu, F. Jiang, H.S. Ip, and M.S. Parmacek. 1998. GATA6regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo.Genes Dev 12: 3579-90.Morrison, G.M., I. Oikonomopoulou, R.P. Migueles, S. Soneji, A. Livigni, T. Enver, and J.M.Brickman. 2008. Anterior definitive endoderm from ESCs reveals a role for FGF signaling. CellStem Cell 3: 402-15.Moscatelli, D. 1987. High and low affinity binding sites for basic fibroblast growth factor on culturedcells: absence of a role for low affinity binding in the stimulation of plasminogen activatorproduction by bovine capillary endothelial cells. J Cell Physiol 131: 123-30.Mukhopadhyay, D., L. Tsiokas, and V.P. Sukhatme. 1998. High cell density induces vascularendothelial growth factor expression via protein tyrosine phosphorylation. Gene Expr 7: 53-60.Ng, E.S., L. Azzola, K. Sourris, L. Robb, E.G. Stanley, and A.G. Elefanty. 2005. The primitive streakgene Mixl1 is required for efficient haematopoiesis and BMP4-induced ventral mesodermpatterning in differentiating ES cells. Development 132: 873-84.Nichols, J., J. Silva, M. Roode, and A. Smith. 2009. Suppression of Erk signalling promotes ground statepluripotency in the mouse embryo. Development 136: 3215-22.Nichols, J. and A. Smith. 2009. Naive and primed pluripotent states. Cell Stem Cell 4: 487-92.Nichols, J., B. Zevnik, K. Anastassiadis, H. Niwa, D. Klewe-Nebenius, I. Chambers, H. Scholer, and A.Smith. 1998. Formation of pluripotent stem cells in the mammalian embryo depends on thePOU transcription factor Oct4. Cell 95: 379-91.96

Nishikawa, S.I., S. Nishikawa, M. Hirashima, N. Matsuyoshi, and H. Kodama. 1998. Progressivelineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a divergingpoint of endothelial and hemopoietic lineages. Development 125: 1747-57.Niswander, L. and G.R. Martin. 1992. Fgf-4 expression during gastrulation, myogenesis, limb and toothdevelopment in the mouse. Development 114: 755-68.Niwa, H. 2007. How is pluripotency determined and maintained? Development 134: 635-46.Niwa, H., T. Burdon, I. Chambers, and A. Smith. 1998. Self-renewal of pluripotent embryonic stem cellsis mediated via activation of STAT3. Genes Dev 12: 2048-60.Ohtsuka, S. and S. Dalton. 2008. Molecular and biological properties of pluripotent embryonic stemcells. Gene Ther 15: 74-81.Ohuchi, H., Y. Hori, M. Yamasaki, H. Harada, K. Sekine, S. Kato, and N. Itoh. 2000. FGF10 acts as amajor ligand for FGF receptor 2 IIIb in mouse multi-organ development. Biochem Biophys ResCommun 277: 643-9.Okada, Y., T. Shimazaki, G. Sobue, and H. Okano. 2004. Retinoic-acid-concentration-dependentacquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells.Dev Biol 275: 124-42.Okuno, M., K. Minami, A. Okumachi, K. Miyawaki, N. Yokoi, S. Toyokuni, and S. Seino. 2007.Generation of insulin-secreting cells from pancreatic acinar cells of animal models of type 1diabetes. Am J Physiol Endocrinol Metab 292: E158-65.Omer, A., V. Duvivier-Kali, J. Fernandes, V. Tchipashvili, C.K. Colton, and G.C. Weir. 2005. Longtermnormoglycemia in rats receiving transplants with encapsulated islets. Transplantation 79:52-8.Ornitz, D.M. 2000. FGFs, heparan sulfate and FGFRs: complex interactions essential for development.Bioessays 22: 108-12.Ornitz, D.M. and N. Itoh. 2001. Fibroblast growth factors. Genome Biol 2: REVIEWS3005.Ornitz, D.M., J. Xu, J.S. Colvin, D.G. McEwen, C.A. MacArthur, F. Coulier, G. Gao, and M. Goldfarb.1996. Receptor specificity of the fibroblast growth factor family. J Biol Chem 271: 15292-7.Parameswaran, M. and P.P. Tam. 1995. Regionalisation of cell fate and morphogenetic movement of themesoderm during mouse gastrulation. Dev Genet 17: 16-28.Pawson, T. 1995. Protein-tyrosine kinases. Getting down to specifics. Nature 373: 477-8.Pease, S., P. Braghetta, D. Gearing, D. Grail, and R.L. Williams. 1990. Isolation of embryonic stem (ES)cells in media supplemented with recombinant leukemia inhibitory factor (LIF). Dev Biol 141:344-52.Pellegrini, G., P. Rama, F. Mavilio, and M. De Luca. 2009. Epithelial stem cells in corneal regenerationand epidermal gene therapy. J Pathol 217: 217-28.Plotnikov, A.N., J. Schlessinger, S.R. Hubbard, and M. Mohammadi. 1999. Structural basis for FGFreceptor dimerization and activation. Cell 98: 641-50.Polk, D.B., G.W. McCollum, and G. Carpenter. 1995. Cell density-dependent regulation of PLC gamma1 tyrosine phosphorylation and catalytic activity in an intestinal cell line (IEC-6). J Cell Physiol162: 427-33.Posern, G., C.K. Weber, U.R. Rapp, and S.M. Feller. 1998. Activity of Rap1 is regulated by bombesin,cell adhesion, and cell density in NIH3T3 fibroblasts. J Biol Chem 273: 24297-300.Pye, D.A. and J.T. Gallagher. 1999. Monomer complexes of basic fibroblast growth factor and heparansulfate oligosaccharides are the minimal functional unit for cell activation. J Biol Chem 274:13456-61.Qi, X., T.G. Li, J. Hao, J. Hu, J. Wang, H. Simmons, S. Miura, Y. Mishina, and G.Q. Zhao. 2004. BMP4supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinasepathways. Proc Natl Acad Sci U S A 101: 6027-32.Ramiya, V.K., M. Maraist, K.E. Arfors, D.A. Schatz, A.B. Peck, and J.G. Cornelius. 2000. Reversal ofinsulin-dependent diabetes using islets generated in vitro from pancreatic stem cells. Nat Med 6:278-82.Rathjen, J., J.A. Lake, M.D. Bettess, J.M. Washington, G. Chapman, and P.D. Rathjen. 1999. Formationof a primitive ectoderm like cell population, EPL cells, from ES cells in response to biologicallyderived factors. J Cell Sci 112 ( Pt 5): 601-12.Rhodes, C.J. 2005. Type 2 diabetes-a matter of beta-cell life and death? Science 307: 380-4.Ricordi, C. and H. Edlund. 2008. Toward a renewable source of pancreatic beta-cells. Nat Biotechnol 26:397-8.Robb, L. and P.P. Tam. 2004. Gastrula organiser and embryonic patterning in the mouse. Semin CellDev Biol 15: 543-54.97

Rodaway, A. and R. Patient. 2001. Mesendoderm. an ancient germ layer? Cell 105: 169-72.Rodaway, A., H. Takeda, S. Koshida, J. Broadbent, B. Price, J.C. Smith, R. Patient, and N. Holder.1999. Induction of the mesendoderm in the zebrafish germ ring by yolk cell-derived TGF-betafamily signals and discrimination of mesoderm and endoderm by FGF. Development 126: 3067-78.Rossant, J. 2004. Lineage development and polar asymmetries in the peri-implantation mouse blastocyst.Semin Cell Dev Biol 15: 573-81.Rossi, J.M., N.R. Dunn, B.L. Hogan, and K.S. Zaret. 2001. Distinct mesodermal signals, includingBMPs from the septum transversum mesenchyme, are required in combination forhepatogenesis from the endoderm. Genes Dev 15: 1998-2009.Rossini, A.A., D.L. Greiner, and J.P. Mordes. 1999. Induction of immunologic tolerance fortransplantation. Physiol Rev 79: 99-141.Ryan, E.A., B.W. Paty, P.A. Senior, D. Bigam, E. Alfadhli, N.M. Kneteman, J.R. Lakey, and A.M.Shapiro. 2005. Five-year follow-up after clinical islet transplantation. Diabetes 54: 2060-9.Schroeder, I.S., A. Rolletschek, P. Blyszczuk, G. Kania, and A.M. Wobus. 2006. Differentiation ofmouse embryonic stem cells to insulin-producing cells. Nat Protoc 1: 495-507.Seaberg, R.M., S.R. Smukler, T.J. Kieffer, G. Enikolopov, Z. Asghar, M.B. Wheeler, G. Korbutt, and D.van der Kooy. 2004. Clonal identification of multipotent precursors from adult mouse pancreasthat generate neural and pancreatic lineages. Nat Biotechnol 22: 1115-24.Seguin, C.A., J.S. Draper, A. Nagy, and J. Rossant. 2008. Establishment of endoderm progenitors bySOX transcription factor expression in human embryonic stem cells. Cell Stem Cell 3: 182-95.Semb, H. 2008. Definitive endoderm: a key step in coaxing human embryonic stem cells intotransplantable beta-cells. Biochem Soc Trans 36: 272-5.Shapiro, A.M., J.R. Lakey, E.A. Ryan, G.S. Korbutt, E. Toth, G.L. Warnock, N.M. Kneteman, and R.V.Rajotte. 2000. Islet transplantation in seven patients with type 1 diabetes mellitus using aglucocorticoid-free immunosuppressive regimen. N Engl J Med 343: 230-8.Sherwood, R.I., C. Jitianu, O. Cleaver, D.A. Shaywitz, J.O. Lamenzo, A.E. Chen, T.R. Golub, and D.A.Melton. 2007. Prospective isolation and global gene expression analysis of definitive andvisceral endoderm. Dev Biol 304: 541-55.Singh, R.K., N. Llansa, C.D. Bucana, R. Sanchez, A. Koura, and I.J. Fidler. 1996. Cell densitydependentregulation of basic fibroblast growth factor expression in human renal cell carcinomacells. Cell Growth Differ 7: 397-404.Slack, J.M. 1995. Developmental biology of the pancreas. Development 121: 1569-80.Smith, A.G., J.K. Heath, D.D. Donaldson, G.G. Wong, J. Moreau, M. Stahl, and D. Rogers. 1988.Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature336: 688-90.Smith, A.G., J. Nichols, M. Robertson, and P.D. Rathjen. 1992. Differentiation inhibiting activity(DIA/LIF) and mouse development. Dev Biol 151: 339-51.Solter, D. and B.B. Knowles. 1978. Monoclonal antibody defining a stage-specific mouse embryonicantigen (SSEA-1). Proc Natl Acad Sci U S A 75: 5565-9.Stavridis, M.P., J.S. Lunn, B.J. Collins, and K.G. Storey. 2007. A discrete period of FGF-induced Erk1/2signalling is required for vertebrate neural specification. Development 134: 2889-94.Strumpf, D., C.A. Mao, Y. Yamanaka, A. Ralston, K. Chawengsaksophak, F. Beck, and J. Rossant.2005. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm inthe mouse blastocyst. Development 132: 2093-102.Sun, X., E.N. Meyers, M. Lewandoski, and G.R. Martin. 1999. Targeted disruption of Fgf8 causesfailure of cell migration in the gastrulating mouse embryo. Genes Dev 13: 1834-46.Tada, S., T. Era, C. Furusawa, H. Sakurai, S. Nishikawa, M. Kinoshita, K. Nakao, and T. Chiba. 2005.Characterization of mesendoderm: a diverging point of the definitive endoderm and mesodermin embryonic stem cell differentiation culture. Development 132: 4363-74.Takahashi, K., K. Tanabe, M. Ohnuki, M. Narita, T. Ichisaka, K. Tomoda, and S. Yamanaka. 2007.Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861-72.Takahashi, K. and S. Yamanaka. 2006. Induction of pluripotent stem cells from mouse embryonic andadult fibroblast cultures by defined factors. Cell 126: 663-76.Tam, P.P. and R.S. Beddington. 1992. Establishment and organization of germ layers in the gastrulatingmouse embryo. Ciba Found Symp 165: 27-41; discussion 42-9.Tam, P.P., E.A. Williams, and W.Y. Chan. 1993. Gastrulation in the mouse embryo: ultrastructural andmolecular aspects of germ layer morphogenesis. Microsc Res Tech 26: 301-28.98

Tanimizu, N., H. Saito, K. Mostov, and A. Miyajima. 2004. Long-term culture of hepatic progenitorsderived from mouse Dlk+ hepatoblasts. J Cell Sci 117: 6425-34.Tesar, P.J., J.G. Chenoweth, F.A. Brook, T.J. Davies, E.P. Evans, D.L. Mack, R.L. Gardner, and R.D.McKay. 2007. New cell lines from mouse epiblast share defining features with humanembryonic stem cells. Nature 448: 196-9.Thomson, J.A., J. Itskovitz-Eldor, S.S. Shapiro, M.A. Waknitz, J.J. Swiergiel, V.S. Marshall, and J.M.Jones. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282: 1145-7.Tomlinson, E., L. Fu, L. John, B. Hultgren, X. Huang, M. Renz, J.P. Stephan, S.P. Tsai, L. Powell-Braxton, D. French, and T.A. Stewart. 2002. Transgenic mice expressing human fibroblastgrowth factor-19 display increased metabolic rate and decreased adiposity. Endocrinology 143:1741-7.Touboul, T., N.R. Hannan, S. Corbineau, A. Martinez, C. Martinet, S. Branchereau, S. Mainot, H.Strick-Marchand, R. Pedersen, J. Di Santo, A. Weber, and L. Vallier. 2009. Generation offunctional hepatocytes from human embryonic stem cells under chemically defined conditionsthat recapitulate liver development. Hepatology.Tzouanacou, E., A. Wegener, F.J. Wymeersch, V. Wilson, and J.F. Nicolas. 2009. Redefining theprogression of lineage segregations during mammalian embryogenesis by clonal analysis. DevCell 17: 365-76.Umehara, H., T. Kimura, S. Ohtsuka, T. Nakamura, K. Kitajima, M. Ikawa, M. Okabe, H. Niwa, and T.Nakano. 2007. Efficient derivation of embryonic stem cells by inhibition of glycogen synthasekinase-3. Stem Cells 25: 2705-11.Vainikka, S., J. Partanen, P. Bellosta, F. Coulier, D. Birnbaum, C. Basilico, M. Jaye, and K. Alitalo.1992. Fibroblast growth factor receptor-4 shows novel features in genomic structure, ligandbinding and signal transduction. Embo J 11: 4273-80.Vallier, L., D. Reynolds, and R.A. Pedersen. 2004. Nodal inhibits differentiation of human embryonicstem cells along the neuroectodermal default pathway. Dev Biol 275: 403-21.Vallier, L., T. Touboul, Z. Chng, M. Brimpari, N. Hannan, E. Millan, L.E. Smithers, M. Trotter, P.Rugg-Gunn, A. Weber, and R.A. Pedersen. 2009. Early cell fate decisions of human embryonicstem cells and mouse epiblast stem cells are controlled by the same signalling pathways. PLoSOne 4: e6082.Van Hoof, D., K.A. D'Amour, and M.S. German. 2009. Derivation of insulin-producing cells fromhuman embryonic stem cells. Stem Cell Res 3: 73-87.Walshe, J. and I. Mason. 2003. Unique and combinatorial functions of Fgf3 and Fgf8 during zebrafishforebrain development. Development 130: 4337-49.Wandzioch, E. and K.S. Zaret. 2009. Dynamic signaling network for the specification of embryonicpancreas and liver progenitors. Science 324: 1707-10.Wang, X. and K. Ye. 2009. Three-dimensional differentiation of embryonic stem cells into islet-likeinsulin-producing clusters. Tissue Eng Part A 15: 1941-52.Wasylyk, B., J. Hagman, and A. Gutierrez-Hartmann. 1998. Ets transcription factors: nuclear effectorsof the Ras-MAP-kinase signaling pathway. Trends Biochem Sci 23: 213-6.Watanabe, K., D. Kamiya, A. Nishiyama, T. Katayama, S. Nozaki, H. Kawasaki, Y. Watanabe, K.Mizuseki, and Y. Sasai. 2005. Directed differentiation of telencephalic precursors fromembryonic stem cells. Nat Neurosci 8: 288-96.Wells, J.M. and D.A. Melton. 1999. Vertebrate endoderm development. Annu Rev Cell Dev Biol 15:393-410.-. 2000. Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Development127: 1563-72.Wilkinson, D.G., G. Peters, C. Dickson, and A.P. McMahon. 1988. Expression of the FGF-related protooncogeneint-2 during gastrulation and neurulation in the mouse. Embo J 7: 691-5.Willems, E. and L. Leyns. 2008. Patterning of mouse embryonic stem cell-derived pan-mesoderm byActivin A/Nodal and Bmp4 signaling requires Fibroblast Growth Factor activity. Differentiation76: 745-59.Xu, J., Z. Liu, and D.M. Ornitz. 2000. Temporal and spatial gradients of Fgf8 and Fgf17 regulateproliferation and differentiation of midline cerebellar structures. Development 127: 1833-43.Xu, X., J. D'Hoker, G. Stange, S. Bonne, N. De Leu, X. Xiao, M. Van de Casteele, G. Mellitzer, Z. Ling,D. Pipeleers, L. Bouwens, R. Scharfmann, G. Gradwohl, and H. Heimberg. 2008. Beta cells canbe generated from endogenous progenitors in injured adult mouse pancreas. Cell 132: 197-207.Yamaguchi, T.P., K. Harpal, M. Henkemeyer, and J. Rossant. 1994. fgfr-1 is required for embryonicgrowth and mesodermal patterning during mouse gastrulation. Genes Dev 8: 3032-44.99

Yamanaka, S. 2009. A fresh look at iPS cells. Cell 137: 13-7.Yamanaka, Y., F. Lanner, and J. Rossant. 2010. FGF signal-dependent segregation of primitiveendoderm and epiblast in the mouse blastocyst. Development 137: 715-24.Yang, L., S. Li, H. Hatch, K. Ahrens, J.G. Cornelius, B.E. Petersen, and A.B. Peck. 2002a. In vitro transdifferentiationof adult hepatic stem cells into pancreatic endocrine hormone-producing cells.Proc Natl Acad Sci U S A 99: 8078-83.Yang, X., D. Dormann, A.E. Munsterberg, and C.J. Weijer. 2002b. Cell movement patterns duringgastrulation in the chick are controlled by positive and negative chemotaxis mediated by FGF4and FGF8. Dev Cell 3: 425-37.Yasunaga, M., S. Tada, S. Torikai-Nishikawa, Y. Nakano, M. Okada, L.M. Jakt, S. Nishikawa, T. Chiba,and T. Era. 2005. Induction and monitoring of definitive and visceral endoderm differentiationof mouse ES cells. Nat Biotechnol 23: 1542-50.Ying, Q.L., J. Nichols, I. Chambers, and A. Smith. 2003a. BMP induction of Id proteins suppressesdifferentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell115: 281-92.Ying, Q.L. and A.G. Smith. 2003. Defined conditions for neural commitment and differentiation.Methods Enzymol 365: 327-41.Ying, Q.L., M. Stavridis, D. Griffiths, M. Li, and A. Smith. 2003b. Conversion of embryonic stem cellsinto neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21: 183-6.Ying, Q.L., J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen, and A. Smith. 2008.The ground state of embryonic stem cell self-renewal. Nature 453: 519-23.Zhang, X., O.A. Ibrahimi, S.K. Olsen, H. Umemori, M. Mohammadi, and D.M. Ornitz. 2006. Receptorspecificity of the fibroblast growth factor family. The complete mammalian FGF family. J BiolChem 281: 15694-700.Zhao, M., S.A. Amiel, M.R. Christie, P. Muiesan, P. Srinivasan, W. Littlejohn, M. Rela, M. Arno, N.Heaton, and G.C. Huang. 2007. Evidence for the presence of stem cell-like progenitor cells inhuman adult pancreas. J Endocrinol 195: 407-14.100