Detection of group A Rota virus and characterization of G type ...

Egyptian Journal of Medical Microbiology, January 2007 Vol. 16, No. 1 

Detection of group A Rota virus and characterization of G type among 

Egyptian children with diarrhea 

Maysa A Amer 1 , Shwikar M Abdel Salam 2 , Hoda A H Ibrahim 2 , Mona A Farag 2 

Department of pediatrics 1 ,Department of Medical Microbiology and Immunology 2 , , Faculty of Medicine, 

Alexandria University 

Group A rotaviruses are the most important cause of acute diarrhea in children throughout the 

world. It is the cause of more than 450,000 deaths per year. There are few data available about 

rotavirus type circulating in Egypt. Serotyping by ELISA with anti-VP7 serotype-specific 

monoclonal antibodies and genotyping by reverse transcription-PCR (RT-PCR) have been widely 

used for typing . The materials of this study comprised 100 stool specimens collected from children 

less than 5 years old suffering from acute diarrhea, attending Alexandria University Children's 

Hospital at El-Shatby during the period from January to December 2006. These specimens were 

subjected to RT-PCR. Rotavirus was detected by RT PCR in 33 (33%) of patients. In the present 

study, a total of 30 (90.9%) of the 33 rotavirus positive samples were found to be G typable and the 

remaining 3 (9.1%) were untypable. Out of the 33 rotavirus positive cases, G4 was the main 

genotype detected being responsible for 12 cases (36.4%) of rotavirus infections. G1 was the second 

most common cause and was responsible for 9 cases (27.3%) of the infections. Our study identified 

G9 in 6 (18.1%) of the positive cases. Mixed G types reflecting dual infections G1+G9 were detected 

in 3 (3%) of the samples. G2, G3, and G8 were not detected among our cases. These results 

underline the importance of continued detailed epidemiological and virological studies to identify 

rotavirus serotypes responsible for severe diarrhea, including characterization of less common and 

or unusual strains. Knowledge of rotavirus prevalence and strains circulating in the Egyptian 

community will add in assessing the suitability of candidate vaccines, in order to protect against all 

currently circulating rotavirus strains. 

INTRODUCTION 

Group A rotaviruses are the most 

important cause of acute diarrhea in children 

throughout the world. It is the cause of more 

than 450,000 deaths per year (1). In Egypt, 

during the past decade, numerous studies 

evaluating diarrheal diseases among children 

living in the Nile River Delta, northern Egypt 

revealed that rotavirus is the most commonly 

identified cause of diarrhea among children 

seeking medical care for severe illness 

(2,3,4,5). Development of vaccines against 

rotavirus infection is considered a high 

priority in developing countries (6). However, 

the vaccine efficacy is being challenged by 

the extensive diversity of the rotaviruses (7- 

9). 

The genome of rotaviruses consists of 

11 segments of double stranded RNA (10,11). 

The rotaviruses are distinguished by the 

layered proteins forming the capsid, which 

can be used to differentiate and classify 

strains, and which are important to the 

antigenic response. Based on the antigenic 

properties of the VP6 protein in the inner 

layer of the capsid, the rotavirus genus is 

divided into different serogroups (labeled A 

through to E with two possible additional 

species F and G) (8,9). The clinically 

significant rotaviruses belong to group A 

(12). Further classification of rotaviruses is 

based on the genetic characteristics or 

seroreactivity of the VP4 and VP7 viral 

proteins in the outer layer of the capsid. Each 

of these proteins induces neutralizing 

antibodies independently (13). So far, 23 P 

genotypes and 15 G genotypes (7) have been 

identified. Ten of the G genotypes and 11 of 

the P genotypes have been detected in 

humans ( 14 ), but most rotavirus-induced 

diarrhea in children is caused by a small 

number of the G genotypes, primarily G1, G2, 

G3, G4, and the newly emerging strain G9 

(15,16,17). However, dominant strains vary 

between and within geographic regions. Since 

the rotavirus serotypes (genotypes) circulating 

in a given region have a direct influence on 

the predicted efficiency of a potential vaccine 

for the region, an examination of the G and P 

type distribution is necessary (18,19). 

123


There are few data available about 

rotavirus types circulating in Egypt. In spite 

of the variety of methods used, many 

untypable strains remained, raising the 

possibility that additional serotypes may be 

prevalent in Egypt. This demonstrate the need 

to incorporate a wider variety of reagents and 

detection methods in an attempt to identify 

the full variety of strains in circulation (3,6). 

Serotyping by ELISA with anti-VP7 

serotype-specific monoclonal antibodies and 

genotyping by reverse transcription-PCR 

(RT-PCR) have been widely used for typing ( 

20,21,22). 

MATERIAL AND METHODS 

The materials of this study comprised 

100 stool specimens collected from children 

less than 5 years old suffering from acute 

diarrhea, attending Alexandria University 

Children's Hospital at El-Shatby during the 

period from January to December 2006. This 

study was approved by ″Alexandria 

University Ethical Committee″, and an 

informed consent was obtained from all 

parents. 

All patients were subjected to 

thorough history taking and clinical 

examination at the time of specimen 

collection. An interview questionnaire was 

designed to obtain data regarding the age, sex, 

residence, duration of diarrhea and frequency 

of motions per day, the presence or absence 

of fever, vomiting and flu –like symptoms, 

the stool consistency, and the breast feeding. 

Sample collection.The stool specimens were 

obtained in a sterile container. About 30 mg 

of each stool sample were added to 175 ul 

lysis buffer containing RNase inhibitors 

supplied in the RNA extraction kit (Promega). 

The samples were transported the same day to 

the laboratory as they were stored at - 70 º C. 

RNA extraction: RNA was extracted from 

stool by the guanidinium isothiocyanate 

(GTC) and spin column extraction method 

using SV total RNA isolation system 

(Promega, Madison US), according to the 

manufacturer ' s instruction 

RT-PCR In the present study, we used the 

PCR assay and primers described by Gouvea 

et al (23) for the detection and typing of 

group A rotavirus. The primers specific for 

gene segment 9, (8, or 7), which encode for 

the VP7 glycoprotein, are used for the 

detection of rotavirus. [Beg 9 – End 9] and 

primers for G typing of rotavirus are 

displayed in figure 1, and table 1. 

Reverse transcription. Reverse transcription 

was performed using Omniscript Reverse 

Transcriptase kit (Qiagen). The 

complementary DNA copies (cDNA) from 

both rotavirus RNA strands were synthesized 

in 20 ul solutions containing; 2 ul of 10 X 

enzyme buffer, 0.5 mM of each 

deoxynucleotide triphosphate, 5 picomoles of 

each End 9 and Beg 9 primers, 10 ul of the 

RNA samples and 4 IU of omnireverse 

transcriptase enzyme. Before the addition of 

the reverse transcriptase enzyme, the ds RNA 

of rotaviruses were first denaturated by 

heating the mixture first at 97 º C for 5 minutes 

in the thermocycler (Techne). Then the tubes 

were transferred quickly to an ice-bath to 

prevent reannealing of the ds RNA, and the 

enzyme was added. The tubes were then 

transferred back to the thermocycler for 

incubation at 37 º C for one hour followed by 

94 º C for 5 minutes. 

PCR amplification. Initially, 1,062 bp (full 

length) gene segment 9, encoding the VP7 

glycoprotein in human group A rotavirus, was 

amplified using primers Beg 9 in the forward 

direction and primer End 9 in the reverse 

direction (figure 2). Amplification was 

performed in a final volume of 50 µl of PCR 

mixture containing 1µM Of each primer, 10 

mΜ of each deoxynucleotide triphosphate 

(dATP, dGTP, d TTP, dCTP), 10 mΜ Tris 

HCL, 50 mΜ KCL, 0.1% Triton x-100, 1.5 

mΜ MgCl2, 2.5 units of Taq DNA 

polymerase (Qiagen), and 10 µl of cDNA. 

The amplification reaction was applied as 

follow: denaturation at 94 º C for 1 minute, 

annealing at 42 

º C for 2 minutes and 

extension at 72 º C for 1 minute (for 25 

cycles), followed by a final 7 minutes 

extension at 72 º C. 

PCR typing. PCR typing was performed 

from dsDNA that was obtained from the first 

amplification of the entire gene 9. In this case, 

3ul of the dsDNA product served as the 

template for this second typing amplification. 

124


The same reaction buffer containing all six 

serotype specific primers [a AT8, a BT1, a 

CT2, a DT4, a ET3, a FT9] and RVG9 primer 

was used but with reduced concentrations of 

the primer mix 200 nM each primer. The 

same PCR program was used with only 15 

cycles followed by a final extension at 72 º C 

for seven minutes. The PCR products were 

resolved by 2% agarose gel electrophoresis 

and were visualized after ethidium bromide 

(0.5 ug / ml) staining, using an UV 

transilluminator and photographed by 

Polaroid camera.. 

RESULTS 

The present study was carried out in the 

period from January to December 2006, on 

100 stool specimens obtained from children 

less than 5 years old, who attended the 

Alexandria University Hospital at el Shatby, 

and were diagnosed clinically as acute 

gastroenteritis. The mean age distribution of 

the patients was 9 ± 7.53 months, ranging 

from 1 - 35 months. Fifty six percent of the 

patients were males and 44% were females. 

Rotavirus detection by PCR 

Rotavirus was detected by RT PCR in 33 

(33%) of cases. As shown in figure 2, primers 

Beg9 and End9 amplified gene segment 9 of 

rotavirus yielding a PCR product of expected 

size (1,062 bp) 

Rotavirus G-type distribution 

In the present study, a total of 30 (90.9%) of 

the 33 Egyptian rotavirus positive samples 

were found to be G typed and the remaining 3 

(9.1%) were untypable. As shown in table II, 

out of the 33 rotavirus positive cases, G4 was 

the main genotype detected being responsible 

for 12 cases (36.4%) of rotavirus infections. 

G1 was the second most common cause and 

was responsible for 9 cases (27.3%) of the 

infections. Our study identified G9 in 6 

(18.1%) of the positive cases. Mixed G types 

reflecting dual infections G1+G9 were 

detected in 3 (3%) of the samples. G2, G3, 

and G8 were not detected among our cases. 

As shown in figure 2, the six sets of primers 

used for typing yielded bands of distinct 

lengths; 749, 583 and 306 bp corresponding to 

serotype G1, G4 and G9 respectively. 

By RT PCR assay rotavirus was detected in 

children ranging in age from 1 – 23 months, 

with the mean age value 9 ± 5.12 months. 

There was no statistical significant association 

between sex and rotavirus infection, and no 

statistically significant association with 

residence (P = 0.322). In the present study, 27 

(81.1%) of the rotavirus positive cases did not 

receive any breast milk during there life, 

while only 6 (18.2%) were breast fed, which 

was found to be statistically significant, P= 

0.000. As shown in table III, although 

rotavirus was detected in every season all over 

the 12 months of the year, a strong significant 

association between the seasonal trend and the 

incidence rate of rotavirus infection (P = 

0.000) was found as shown in table III. The 

highest ratio of rotavirus infections was 

represented in winter (60%), followed by 

autumn where 50% of the diarrheal cases were 

due to rotavirus infection. Rotavirus infections 

in summer represented 33%, and the lowest 

incidence of rotavirus diarrhea was in spring 

(10.9%). 

Table I: Primers for detection and typing of Rotavirus. 

Primer Sequence (5′-3′) Position Region 

Beg 9 b GGTTTTAAAAGAGAGAATCGTTTCCTGG 1-28 

End 9 b GGTCACATCATACAATTCTAATCTAAG 1062-1036 

RVG9 GGTCACATCATACAATTCT 1062_1044 

aAT8 GTCACACCATTTGTAAATTCG 178_198 A 

aBT1 CAAGTACTCAAATCAATGATGG 314_335 B 

aCT2 CAATGATATTAACACATTTTCTGTG 411_435 C 

aDT4 CGTTTCTGGTGAGGAGTTG 480_498 D 

aET3 CGTTTGAAGAAGTTGCAACAG 689_709 E 

aFT9 CTAGATGTAACTACAACTAC 757_776 F 

125


Fig. 1. Rotavirus gene 9 ( or gene 8) which encode the VP7 glycoprotein. Shown are locations of 

the variable regions and PCR primers and excepted length of the amplified segment (23.) . 

Table II: Distribution of Rotavirus genotypes within the Rotavirus positive samples. 

Positive cases 

Genotype No. % 

G4 

G1 

G9 

Mixed 

Untypable 

12 

9 

6 

3 

3 

36.4 

27.3 

18.1 

9.1 

9.1 

Total 33 100 

Table III: Relation between season and Rotavirus infection. 

Rotavirus Winter 

(Dec., Jan., 

Feb.,) 

Spring 

(Mar., Apr., 

May) 

Summer 

(Jun., Jul., 

Aug.) 

Autumn 

(Sep., Oct., 

Nov.) 

No. % No. % No. % No. % 

Total 

Positive 18 60 5 10.9 4 33.3 6 50 33 

cases 

Negative 12 40 41 89.1 8 66.7 6 50 67 

cases 

Total 30 46 12 12 100 

P 0.001 

126


Fig. 2: Agarose gel electrophoresis of PCR products. Lane 1;100 bp marker, Lane 2,4,6 

showing rotavirus positive cases, Lane 8 rotavirus negative cases, Lane 3, 5 and 7 

showing G4, G1 and G9 respectively. 

DISCUSSION 

Diarrhoeal disease remains one of the most 

important public health challenges 

worldwide, mainly in developing countries 

where mortality is still high. Rotaviruses are 

the leading cause of gastroenteritis in young 

children. They are responsible for a so-called 

¨ universal infection ¨ in young children, as 

virtually every child will be infected by the 

age of 5 years (24). Therefore, the huge 

burden of rotavirus diarrhea has made 

rotavirus a prime target for global estimation 

of the prevalence and type distribution of the 

virus strains all over the world (7,24,25). 

In a study done in Egypt by Wierzba et al in 

2006 to identify enteropathogens for vaccine 

development, rotavirus was of principle 

concern, followed by ETEC, Shigella, and 

Campylobacter (5). Therefore, the HRV 

serotypes circulating in the Egyptian 

community should be determined. The 

present study was an attempt to participate in 

the research efforts made in Egypt for the 

estimation of the frequency and type 

distribution of rotaviruses, using the 

molecular technique RT-PCR. 

Typically large amounts of virus particles are 

present in faeces during the peak of infection, 

thus facilitating the diagnosis of the viral 

infection. However as few as 10 virus 

particles are sufficient for the infection of 

small children. To minimize the risk of 

Rotavirus infection, an increase in sensitivity 

of the rotavirus detection assay is therefore 

desirable. Conventional ELISA detection of 

rotavirus antigen VP6, a well-proven specific 

antigen, for all known human Rotavirus goes 

along with typical limits of detection of ≈ 1x 

10 5 particles/ml. Several approaches to the 

establishment of RT-PCR assay of the viral 

RNA have been described, and the limit of 

detection was found to be ≈ 100 particles/ml 

(22). 

RT-PCR has shown greater sensitivity than 

ELISA for determination of human rotavirus 

G-types 1 to 4 and 9 in previous studies 

(26,27,28). It appears that degradation of VP7 

antigen by proteolytic enzymes during 

freezing and thawing was a major factor in 

the loss of typing ability by ELISA. 

In the present study, Rotaviruses were 

identified by RT-PCR assays in 33 (33%) of 

the 100 stool specimens collected from 

children with acute gastroenteritis, who 

attended the outpatient clinic in EL-Shatby 

Hospital in Alexandria, over a 12 months 

period from January to December 2006. Our 

127


results were similar to findings from an active 

surveillance studies conducted in Egypt over 

the past decade. A five years study on the 

bacterial and viral etiology of infantile 

diarrhea in Alexandria revealed that rotavirus 

was responsible for 15.8% of diarrheal 

illnesses in infants and children attended the 

outpatient clinic in EL-Shatby Children 

Hospital, during the period of 1982-1987 

(29). Shukry et al (1989) (30), Radwan et al 

(1997)(6) and El-Mougi et al (1998)(31), 

detected the antigen of rotavirus in 33%, 

35.6% and 40%, of stool samples obtained 

from children with acute diarrhea 

respectively, using the ELISA technique. 

More recently , Rotavirus was detected in 

17% of diarrheal cases within 356 children 

aged ≤ 6 months, in children living in the 

Tamiya District of the Fayoum governorate 

located in Southern Egypt, between August 

and September 2003(32). Our results show 

remarkable agreement with the results of 

other investigators in Venezuela, Spain and 

Dhaka (33,34,35). However,in other settings 

(36,37), rotavirus was detected with a higher 

percentage rates than found in our study 

which confirm the huge disease burden over 

the world, and the variability of its prevalence 

from a region to another. 

As mention before, Rotavirus diarrhea is 

widely distributed allover the world. The 

disease usually presents with similar 

epidemiological and clinical pattern within 

developed and developing countries. The age 

of the children with rotavirus diarrhea 

detected in this study ranged between one and 

twenty three months. The age group that 

experienced the highest incidence of rotavirus 

diarrhea ranged from six to twelve months, 

with the median age 9 months. These findings 

were in agreement with the previous studies 

done in Egypt (3, 7, 38). In addition, other 

investigators in different countries (39, 40) 

recorded that the highest rate of rotavirus 

isolation was found among children in their 

first year of life. These findings confirm the 

role of the immune system in prevention of 

the disease, which helps decline of rotavirus 

diarrhea with age. 

In the present study, rotavirus presented with 

a marked seasonal peak during the cold 

months of the year (December – February), 

similar to those observed in England (41), 

Finland (42), Spain (34) and Tunisia (39). 

Our results were similar to a previous cohort 

study conducted in Bilbeis (Egypt), in which 

the rate of rotavirus isolation was 

predominant in the colder months (November 

– April). However, the seasonal peak of 

rotavirus infection in Egypt tends to shift over 

consecutive years (43). 

Rotavirus strain surveillance has proven to 

continue as a world wide effort, in order to 

determine the prevalent strains in each 

country and to apply a rotavirus vaccination 

program that provide a serotype specific 

immunity to every child. Previous 

epidemiological studies conducted in many 

countries from different continents such as 

Tunisia (36), Nigeria (44) and Spain (34) 

reported that G1 rotaviruses predominated as 

a cause of severe rotavirus diarrhea, with G2, 

G3, and G4 strains responsible for the 

majority of the residual diarrhea. However, 

the results presented here reveal 

predominance of G4 (36.4%) as the most 

common cause of diarrhea followed by G1 

(27.3%) genotype. 

Reports of the distribution and epidemiology 

of human rotavirus G types in Egypt are 

limited in number. In a study done by 

Radwan et al (7), enzyme immunoassay 

(EIA) has been used to detect, for the first 

time in Egypt, the relative frequency and 

temporal distribution of HRV G serotypes 1 

to 4 among the community of neonates and 

infants with and without acute diarrhea. 

Serotypes G1 and G4 predominated in all age 

groups. Mixed (G1 plus G4) and nontypeable 

specimens represented 16.1 and 38.7% of the 

total number serotyped, respectively. 

Recently, a study in Cairo, Egypt was done on 

raw sewage samples taken from three sewage 

treatment plants based on G typing. The 

predominated type for rotavirus identified in 

that study was found to be G1 (69.9%), 

followed by G3 (13.0%), G4 (8.7%), and G9 

(8.7%). The results presented in this study 

revealed the occurrence of G9 strains in 

clinical specimens in Egypt for the first time, 

although this does not necessarily imply 

emergence of new strains, since this serotype 

was not investigated in previous studies (45). 

The absence of G2 and G3 genotypes in our 

study might reflect the absence of these 

strains in Egypt as have been published by 

128


Villena et al 2003 (45), where no G2 

rotavirus genotypes were detected within the 

sewage samples. A more reasonable 

explanation is the low level circulation of 

such strains in our community, which has 

been reported by Radwan et al 1997 (7), 

where G2 was represented with 3.2% and G3 

6.5% of rotavirus positive samples. These 

findings confirm the great diversity within 

rotavirus strains circulating in humans which 

make the prevalence of rotavirus genotypes 

varies according to location and time. 

In the present study, rotavirus genotype G9 

was responsible for 18.1% of the rotavirus 

infections. This percentage confirm the need 

for continued surveillance to identify the 

persistence of G9 strain in our community, as 

the emergence of such pathogen necessitates 

the urgent consideration of G9 moiety in 

rotavirus vaccines considered for use in 

Egypt. Since the introduction of RT–PCR for 

rotavirus genotyping, many epidemiological 

surveillance studies have been conducted, and 

new data has been collected to understand this 

complex epidemiology(3,37,44). However, 

there is considerable number of strains all 

over the world that remain untypable by PCR 

using the current primers. In the present 

study, 9.1% of the rotavirus positive samples 

could not be G genotyped. However, the 

percentage of the untypable rotavirus stains 

detected in sewage in Cairo (30%) was higher 

than that found in the current study. In 

addition, 38.7% of rotavirus positive 

specimens collected from infants in Cairo by 

Radwan et al (6), were untypable. In other 

settings all over the world, the proportion of 

rotavirus strains that remain untypable exists 

with different ratios (37,46,47). It was 

suggested that failure of the currently used 

RT-PCR assay to characterize all rotavirus 

genotypes may be due to either failure of the 

laboratory to use the full range of primers 

required to detect uncommon strains, or the 

strains are novel enough that they must be 

sequenced so that new and special primers 

can be applied (47). 

In recent years, it was reported that 

accumulation of point mutation in VP7 genes 

was the main cause of failure of rotavirus G 

typing. It was suggested that the use of 

modified or degenerated primers or changing 

the primer binding site allow strains that were 

previously untypable to be completely typed 

through avoiding the mismatch between the 

primers used and VP7 genes (48-49). 

Moreover, following new typing 

methodologies like microarray procedures 

could be successful in characterization of all 

the existing rotavirus strains (50). 

Finally, our results underline the importance 

of continued detailed epidemiological and 

virological studies to identify rotavirus 

serotypes responsible for sever gastroenteritis, 

including characterization of less common 

and or unusual strains. Knowledge of 

rotavirus prevalence and strains circulating in 

our community will help in assessing the 

suitability of candidate vaccines, in order to 

protect against all currently circulating 

rotavirus strains. 

REFERENCES 

1-Parashar UD, Gibson CJ, Bresse JS, Glass 

RI. Rotavirus and severe childhood 

diarrhea. Emerg Infect Dis. 2006;12:304-6 

2- Abu-Elyazeed R,Wierzba TF, Mourad AS, 

Peruski Jr LF, Kay BA, Rao MR,Churilla 

AM, Bourgeois AL, Mortagy AK, Kamal 

SM, Savarino SJ, Campbell JR, Murphy 

JR, Naficy AB, Clemens JD 

Epidemiology of enterotoxigenic 

Escherichia coli diarrhea in a pediatric 

cohort in a periurban area of lower Egypt. 

J Infect Dis 1999;179:382– 89. 

3-Naficy AB, Abu-Elyazeed R, Holmes JL, 

Rao MR, Savarino SJ, Kim Y, Wierzba 

TF, Peruski L, Lee YJ, Gentsch JR, Glass 

RI, Clemens JD. Epidemiology of 

rotavirus diarrhea in Egyptian children and 

implications for disease control. Am J Clin 

Pathol 1999; 150:770–77. 

4-Rao MR, Abu-Elyazeed R, Savarino SJ, 

Naficy AB, Wierzba TF, Abdel- Messih I, 

Shaheen HI, Frenck RW, Svennerholm 

AM, Clemens JD. High disease burden of 

diarrhea due to enterotoxigenic 

Escherichia coli among rural Egyptian 

infants and young children. J Clin 

Microbiol 2003;41:4862– 4. 

5-Wierzba TF, Abdel-Messih IA, Abu- 

Elyazeed R, Putnam SD, Kamal KA, 

Rozmajzl P, Ahmed SF, Fatah A, Zabedy 

K, Shaheen HI, Sanders J, Frenck R 

Clinic-based surveillance for bacterialand 

rotavirus-associated diarrhea in 

129


Egyptian children. Am J Trop Med Hyg 

2006;74:148–53. 

6- Radwan SF, Gabr MK, EL-Maraghi S, EL- 

Saifi AF. Serotyping of Group A 

Rotaviruses in Egyptian Neonates and 

Infants Less than 1 Year Old with Acute 

Diarrhea. J Clin Microbiol 1997;35:2996– 

8 

7-Kapikian AZ, Hoshino Y, Chanock RM. 

Rotaviruses. In: Fields Howley. ed. Fields 

Virology 4 th ed. Philadelphia: Lippincot / 

The Williams and Wilkins Co, 2001: 

1787-833. 

8-Estes MK. Rotaviruses and their 

replication. In: Fields Knipe DM, Howley 

PM, Chanock RM, eds. Fields Virology 

3 rd ed. New York: Raven Press, 

1996:1625-55. 

9-Desselberger U. Reoviruses. In: Collier L, 

Balows A, Sussman M, eds. Toply & 

Wilson ' s Microbiology and Microbial 

infections. 9 th ed. London. Sydney. 

Auckland: Oxford University Press, Inc., 

New York 1998: 537-51. 

10-Ramig RF. Genetics of the rotaviruses. 

Annu Rev Microbiol 1997; 51: 225-55. 

11-Mertens PPC, Arrella M, Attoui H. Family 

Reoviridae. In:.Van Regenmortel MHV, 

Fauquet CM, Bishop DHL, Carstens EB, 

Estes MK, Lemon SM, Maniloff J, Mayo 

MA, Mc Geoch DJ, Pringle CR, Wickner 

RB, ed. Virus Taxonomy: classification 

and nomenclature of viruses. Seven 

reports of the International Committee on 

Taxonomy of Viruses. Academic press, 

San Diego, California:Academic press 

2000: 395-480. 

12-Bishop RF, Davidson GP, Holmes IH, 

Ruck BJ. Virus particles in epithelial cells 

of duodenal mucosa from children with 

acute-non bacterial gastroenteritis. Lancet 

1973; 1: 1281-3. 

13-Midthun K, Kapikian AZ. Rotavirus 

vaccines: an overview. Clin Microbiol 

Rev. 1996; 9:423-34. 

14-Laird AR, Ibarra V, Ruiz-Palacios G, Guerrero 

ML, Glass RI, Gentsch JR. Unexpected 

detection of animal VP7 genes among 

common rotavirus strains isolated from 

children in Mexico. J Clin Microbiol 

2003;41:4400-3 

15-Gentsch JR, Woods PA, Ramachandran M, 

Das BK, Leite JP, Alfieri A, Kumar R, Bhan 

MK, Glass RI. Review of G and P typing 

results from a global collection of 

rotavirus strains: implications for vaccine 

development. J Infect Dis 

1996;174(S):30-6. 

16-Steyer A, Poljsak-Prijatelj M, Barlic-Maganja 

D, Bufon T, Marin J. The emergence of 

rotavirus genotype G9 in hospitalized 

children in Slovenia. J Clin Virol 

2005;33:7-11. 

17-Cunliffe NA, Bresee JS, Gentsch JR, Glass RI, 

Hart CA. The expanding diversity of 

rotaviruses. Lancet 2002;359:640-2. 

18-Mustafizure R, Leener KD, Goegebuer T, 

Wallants E, Donck IVD, Hoovels LV, 

Ranst MV. Genetic characterization of a 

novel, naturally occurring recombinant 

G6P[6] rotavirus. J Clin Microbiol 2003; 

41:2088-95. 

19- Coulson BS. VP4 and VP7 typing using 

monoclonal antibodies. Arch Virol Suppl 

1996;12:113-8 

20-Gentsch, JR, Glass RI, Woods P, Gouvea 

V, Gorziglia M, Flores J, Das BK, Bhan 

MK. Identification of group A rotavirus 

gene 4 types by polymerase chain reaction. 

J Clin Microbiol 1992;30:1365-73. 

21-Masendycz PJ., Palombo EA, Gorrell RJ, 

Bishop RF. Comparison of enzyme 

immunoassay, PCR, and type-specific 

cDNA probe techniques for identification 

of group A rotavirus gene 4 types (P 

types). J Clin Microbiol 1997;35:3104-31 

22-Adler M, Schulz S, Fischer R, Niemeyer CM. 

Detection of Rotavirus from stool samples 

using a standardized immuno-PCR 

("Imperacer") method with end-point and 

real-time detection. Biochem Biophys Res 

Commun 2005;333:1289-94. 

23- Gouvea V, Glass RI. Woods P, Taniguchi 

K, Clark HF, Forrester B, Fang Z. 

Polymerase chain reaction amplification 

and typing of rotavirus nucleic acid from 

stool specimens. J Clin Microbiol 1992; 

28: 276-82. 

24-Parashar UD, Bresee JS, Gentsch JR. 

Rotavirus and severe childhood diarrhea. 

Emerg Infect Dis 1998; 4: 561-70. 

25-Parashar UD, Hummelman EG, Bresee JS, 

Miller MA, Glass RI. Global illness and 

deaths caused by rotavirus disease in 

children. Emerg Infect Dis 2003; 9: 565- 

72. 

26-Ushijima H, Koike H, Mukoyama A, 

Hasegawa A, Nishimura S, Gentsch J. 

Detection and serotyping of rotaviruses in 

130


stool specimens by using reverse 

transcription and polymerase chain 

reaction amplification. J Med Virol. 

1992;38:292–297 

27-Taniguchi K, Wakasugi F, Pongsuwanna 

Y, Urasawa T, Ukae S, Chiba S, Urasawa 

S. Identification of human and bovine 

rotavirus serotypes by polymerase chain 

reaction. Epidemiol Infect 1992;109:303– 

12. 

28-Coulson BS, Gentsch JR, Das BK, Bhan 

MK, Glass RI. Comparison of enzyme 

immunoassay and reverse transcriptase 

PCR for identification of serotype G9 

rotaviruses. J Clin Microbiol 

1999;37:3187-93 

29-Massoud BZ, Kassem AS, Omar NY, 

Madkour AA. A five year study of the 

bacterial and viral etiology of infantile 

diarrhea in Alexandria and the sensitivity 

of the bacterial pathogens to several 

antibiotics. Alex J Pediatr 1989; 3: 9-15. 

30-Shukry S, Zaki AM, Duo Pont L, Shukry 

I, EL-Tagi AM, Hamed Z. Detection of 

enteropathogens in fatal and potentially 

fatal diarrhea in Cairo, Egypt. J Clin 

Microbiol 1986; 24: 959-62. 

31-El- Mougi M, Amer A, EL-Abhar A, 

Hughes J, El-Shafie A. Epidemiological 

and clinical features of rotavirus 

associated acute infantile diarrhea in 

Cairo, Egypt. J Trop Pediatr 1989; 35: 

230-3. 

32-EL-Mohamady H, Abdel–Messih IA, 

Youssef FG, Said M, Shaheen HI Farag H, 

Rockabrand DM, Luby SB, Hajjeh R, 

Sanders JW, Monteville MR, Klena JD, 

Frenk RW. Enteric pathogens associated 

with diarrhea in children in Fayoum, 

Egypt. Diagnostic Microbiology and 

Infectious Disease 2006; 56: 1-5. 

33-Salinas B, Gonzàlez G, Gonzàlez R, 

Escalona M, Materàn M, Schael IP. 

Epidemiologic and clinical characteristics 

of rotavirus disease during five years of 

surveillance in Venezuela. Pediatr Infect 

Dis J 2004; 23: 161-7. 

34-Sanchez-Fauquier A, Wilhelmi I, 

Colomina J, Cubero E, Roman E. 

Diversity of group A human rotavirus 

serotypes circulating over a 4-year period 

in Madrid, Spain. J Clin Microbiol 2004; 

42: 1609-13. 

35-Rahman M, Sultana R, Podder G, Faruque 

ASG, Matthijnssens J, Zaman K, Breiman 

RF, Sack DA, Van Ranst M, Azim T. 

Typing of human rotavirus serotypes: 

Nucleotide mismatches between the VP7 

gene and primer are associated with 

genotyping failure. Virology Journal 2005; 

2: 24-9. 

36-Armero Guardado JA, Clarà AW, Turcios 

RM, Chacón Fuentes RA, Valencia D, 

Sandoval R, Barahona de Figueroa J, 

Bresee JS, Glass RI. Rotavirus in El 

Salvador an outbreak surveillance and 

estimates of disease burden 2000 – 2002. 

Pediatr Infect Dis J 2004; 23: 156-60. 

37-Sanchez-Fauquier A, Montero V, Moreno 

S, Sole M, Colomina J, Iturriza-Gomara 

M, Revilla A, Wilhelmi I, Gray J. Human 

rotavirus G9 and G3 as major cause of 

diarrhea in hospitalized children, Spain. 

Emerg Infect Dis 2006;12:1536-41. 

38-Reves RR, Hossain MM, Mithdum K, 

Kapikian AZ, Naguib T, Zaki AM, 

DuPont HL. An observational study of 

naturally acquired immunity to rotavirus 

diarrhea in a cohort of 363 Egyptian 

Children. Am J Epidemiol 1989; 130: 981- 

8. 

39-Trabelsi A, Peenze I, Pager C, Jeddi M, 

Steele D. Distribution of rotavirus VP7 

serotypes and VP4 genotypes circulating 

in Sousse, Tunisia, from 1995 to 1999: 

Emergence of natural human reassortants. 

J Clin Microbiol 2000; 38: 3415-9. 

40-Veeravigrom M, Theamboonlers A, 

Poovorawan Y. Epidemiology and clinical 

manifestations of rotavirus and Norwalklike 

viruses in Thai children. J Med Assoc 

Thai 2004;2:50-4 

41-Ryan MJ, Ramsay M, Brown D, Gay NJ, 

Farington CP, Wall PG. Hospital 

admissions attributable to rotavirus 

infection in England and Wales. J Infect 

Dis 1996; 174: 5-11. 

42-Vesikari T, Rautanen T, Von Bonsdorff 

CH. Rotavirus gastroenteritis in Finland: 

burden of disease and epidemiologic 

features. Act Pediatr 1999; 426: 24-30. 

43- Zaki AM, DuPont HL, El-Alamy MA, 

Arafat RR, Amin K, Awad MM, Bassiouni 

L, Imam IZ, El-Malih GS, El-Marsafie A, 

Mohieldin MS, Naguib T, Rakha MA, 

Sidaros M, Wasef N, Wright CE, Wyatt 

RG. The detection of enteropathogens in 

acute diarrhea in a family cohort 

population in rural Egypt. Am J Trop Med 

Hyg 1986; 35: 1013-22. 

131


44-Adah MI, Wade A, Taniguchi K. 

Molecular epidemiology of rotaviruses in 

Nigeria: Detection of unusual strains with 

G2P[6] and G8P[1] specificities. J Clin 

Microbiol 2001; 39: 3969-75. 

45-Villena C, El-Senousy WM, Abad FX, 

Pintó RM, Bosch A. Group A rotavirus in 

sewage samples from Barcelona and 

Cairo: emergence of unusual genotypes. 

Applied and Environmental Microbiology 

2003; 69: 3919-23. 

46-Kirkood C, Bogdanovic-Sakran N, 

Palombo E, Masendyez P, Bugg H, 

Graeme B, Bishop R. Genetic and 

antigenic characterization or rotavirus 

serotype G9 strains isolated in Australia 

between 1997 and 2001. J Clin Microbiol 

2003; 41:3649-54. 

47-Castello AA, Arvay ML, Glass RI, 

Gentsch J. Rotavirus strain surveillance in 

Latin America. A review of the last nine 

years. Pediatr Infect Dis 2004; 23: 168-72. 

48-Martella V, Terio V, Arista S, Elia G, 

Correnta M, Madio M, Partelli A. 

Nucleotide variation in the VP7 gene 

affects PCR genotyping of G9 rotaviruses 

identified in Italy. J Med Virol 2004; 72: 

143-8. 

49-Arista S, Giammanco GM, De Grazia S, 

Colomba C, Martella V. Genetic 

variability among serotype G4 Italian 

human rotaviruses. J Clin Microbiol 2005; 

43: 1420-5. 

50-Chizhikov U, Wagner M, Ivshina A, 

Hoshino Y, Kapikian AZ, Chumakov K. 

Detection and genotyping of human group 

A rotaviruses by oligonucleotide 

microarrray hybridization. J Clin. 

Microbiol 2002; 40: 2398-407. 

132

لإبا 


الكشف عن فيروس الروتا المجموعه الاولي وتوصيف نوع G 

في حالات الاطفال المصريين المصابين بالاسهال 

ُ 

يعد فيروس روتا من أهم المسببا ت للنزلا ت أ لمعوية أ لحا دة فى ألأطفا ل على مستوى العالم.‏ 

ويعتبر أ لتطعيم ضد هذا ا لفيروس أ لطريقة الفعالة للسيطرة عليه والحد من إنتشاره الواسع.‏ لهذا 

السبب آان المسح الشا مل لأنواع فيروس روتا من أهم الجهود المبذولة عالميًا لتحديد مدى إمكانية 

تطبيق النظام الخاص بالتطعيم ضد هذا ا لفيروس فى آل بلد 

بالمناعة الخاصة لكل نوع من أنواع ا لفيروس على حدى 

، حيث 

أن هذا أ لتطعيم يمد الطفل 

ُ 

‏.وقد أجريَ‏ هذا البحث على ١٠٠ من 

ألأطفا ل المصابين بالإسهال الحاد ، و المترددين على مستشفى الشاطبى الجامعى 

للأ طفال بمدينة 

الإسكندرية خلا ل مدة قدرها ١٢ شهرًا إعتبا ‏ًرا من يناير إلى ديسمبر . ٢٠٠٦ حيث قد تم فحص 

عينات البراز المأخوذة من هؤلاء أ لأطفا ل عن طريق التفاعل البوليميريزى المتسلسل بإستخدام 

إنزيم الإنتساخ الإنعكاسى للكشف عن الحمض النووي الخاص بفيروس روتا.‏ وقد وجد 

من العينات آانت إيجابية لهذا الفيروس ‏.وقد تم الكشف عن الجين الخاص بإظهار بروتين 

أن ٪ ٣٣ 

VP7 

لتحديد أنواع فيروس روتا ضمن العينات ألإجابية ، وذلك عن طريق إستخدام التفاعل البوليميريزى 

. المتسلسل 

ووجد أن G4 هو النوع السائد للفيروس ضمن هذا البحث حيث يمثل نسبة تصل إلى 

. ٪ ٣٦٫٤ 

يليه G1 الذي تصل نسبته 

إلى ٪ ٢٧٫٣ . 

و لم يتم الكشف عن 

أو G3 ٫ G2 من أي 

. G8 

وقد تم الكشف عن 

مستوى العالم 

G9 بنسبة ٪ ١٨٫١ 

. 

، وهو من أنواع فيروس روتا المنتشرة حديثا على 

هذا بالإصافة إلى توصيف ٪ ٩٫١ من العينات ألإجابية بالإصابة المختلطة والتي 

تشمل نوعين من فيروس روتا هما 

G1+G9 معا.‏ أما النسبة المتبقية من العينات ألإجابية وهي 

٪ ٩٫١ فلم يمكن تحديد نوع الفيروس بها.‏ وقد وجد في هذا البحث أن أآثر الإصابات بفيروس 

روتا آانت في الشهور الباردة من العام ‏(ديسمبر إلى فبراير)،‏ 

وأن معظم ألأطفا ل المصابين بلغ 

عمرهم من ٦ 

إلى 

١٢ شهرًا . ضافة إلى ذلك ، فقد وجد أن حالات الإسهال الناتجة عن الإصابة 

بفيروس روتا مصطحبة بالقئ وإلرتفاع درجة الحرارة و البراز السائل.‏ هذ ه النتائج توضح أهمية 

استمرارية الدراسة المستفيضة من الناحية الوبائية و الفيرولوجية للتعرف على الأنواع 

السيرولوجية لفيروس روتا 

133

Detection of group A Rota virus and characterization of G type ...

Create successful ePaper yourself

Delete template?

Save as template?