Strain differentiation of Mycobacterium tuberculosis complex ...

Egyptian Journal of Medical Microbiology, January 2008 Vol. 17, No. 1 

Strain differentiation of Mycobacterium tuberculosis complex isolated 

from sputum of Pulmonary Tuberculosis Patients 

1 

Abbadi Said, 1 El Hadidy Gehan, 1 Gomaa Nahed, and 2 Robert Cooksey 

1 Microbiology & Immunology Department, Faculty of Medicine, Suez Canal University, and 2 The 

Division of AIDS, STD, and TB Laboratory Research, Centers for Disease Control, Atlanta, USA 

ABSTRACT 

We characterized 45 Mycobacterium tuberculosis complex (MTC) isolates from sputum samples of Egyptian 

patients with pulmonary tuberculosis. One M. bovis and 44 M. tuberculosis (MTB) isolates were identified by 

PCR RFLP analysis of OxyR gene. Twenty-five (56.8%) of the 44 MTB isolates were susceptible in vitro to all 

antituberculosis drugs tested; 5 (11.4%) were mono-resistant to INH and STR (4 were resistant to STR and 

only one was resistant to INH); 14 (31.8%) were resistant to more than one drug (MDR) .Among the 44 MTB 

isolates tested for RFLP analysis in this study, 40 different RFLP patterns were obtained. The number of 

IS6110 copies ranged from 5 to 16 (fig. 1). Studying the IS6110 RFLP patterns indicated that the 44 isolates 

did not cluster together but were generally scattered. None of the 15 multi-drug resistant (MDR) isolates were 

clustered. Twenty-two different spoligotypes were identified among the 44 MTB isolates, of which 13 were 

unique (Table 3). The remaining 31 isolates (%) were grouped into 9 clusters of strains sharing identical 

spoligotypes. We demonstrated evidence of diversity between the drug-susceptible and resistant MTB strains. 

Key words: pulmonary tuberculosis; IS6110 RFLP, spoligotyping. 

INTRODUCTION 

Key factors in the control of tuberculosis 

are rapid detection, adequate therapy, and contact 

tracing to arrest further transmission. Recent 

developments in DNA technology and molecular 

biology have led to methods for rapid detection of 

mycobacterial DNA by nucleic acid amplification 

(1). These methods include; DNA fingerprinting, 

based on the polymorphism of the insertion 

sequence IS6110 among MTB complex strains (2) , 

pTBN12 fingerprinting based on the polymorphic 

GC rich sequence (PGRS) (3), spoligotyping 

based on the analysis of polymorphisms in the DR 

locus (1) and variable-number tandem repeats 

(VNTR) typing (4). Among these methods, the 

IS6110 fingerprinting is the recommended 

standard primary genotyping method (5) and has 

been used routinely worldwide (6). Clinical 

isolates of MTB obtained from patients infected 

by the same strain of bacillus usually exhibit 

identical or very similar (with one band variation) 

IS6110 fingerprint patterns, and the patients are 

more often found to be epidemiologically linked 

(7). The major limitation of the IS6110 typing is 

its low discriminating power for isolates with 

fewer than six copies of IS6110. In the case where 

the IS6110 is not definitive, Mycobacterial 

interspersed repetitive unit- variable number 

tandem repeat analysis (MIRU/VNTR) or 

spoligotyping is usually needed as a secondary 

typing (4]. These secondary typing methods have 

the advantage of being less time consuming as 

they are PCR-based (8). 

The increased application of DNA 

fingerprinting has advanced the understanding of 

the dynamics of TB epidemiology (9). Molecular 

typing has provided insight into the impact of 

reinfection on recurrent tuberculosis in 

comparison to reactivation (10). Molecular typing 

of MTB isolates has also proven to be useful tool 

in confirming laboratory cross-contamination (11) 

and investigating nosocomial and institutional 

transmission (12). 

This study represents early attempts at 

tracking diversity particularly among drugresistant 

strains consistent with low-incidence 

countries. In this study we characterized 

Mycobacterium tuberculosis complex (MTC) 

isolates from sputum of patients infected with 

MTB from Egypt in order to establish a database 

of strain types and antimicrobial susceptibility 

patterns. We demonstrated evidence of diversity 

among MDR-MTB and drug-susceptible MTB 

strains. 

MATERIALS AND METHODS 

Bacterial isolates: 

Forty- five clinical isolates (one isolate per 

patient) were included in this study. All specimens 

were isolated from sputum samples from patients 

with pulmonary tuberculosis at Suez Canal 

Region, Egypt. 

Isolation and Preliminary identification of 

MTB strains: After concentration/ 

decontamination of sputum samples by NALC 

method, culture of sputum was done on 

Lowenstein-Jensen (LJ) media. Isolation and 

identification of MTC were performed as 

described previously (13). 

Antimicrobial susceptibility testing 

Isolates of Mycobacterium tuberculosis 

complex (MTC) were tested by the modified 

method of proportion as described by Kent and 

Kubica (13) using Middlebrook 7H10 agar plates 

containing rifampin (RIF), isoniazid (INH), 

streptomycin (STR), ethambutol (EMB) and 

143


pyrazinamide (PZA). The following critical 

concentrations were used: RIF(1.0 ug/ml), 

INH(0.2, 1.0 and 5.0 ug/ml), STR(2.0 and 10.0 

ug/ml), EMB(5.0 ug/ml), PZA(25.0 ug/ml). 

Molecular identification of MTB isolates: DNA 

of suspected MTB isolates was extracted by the 

mini-glass bead agitation procedure as previously 

described (15). PCR amplification of IS6110 

(MTB complex-specific) and IS1245 (M.aviumspecific) 

(14) was performed in a multiplex PCR 

assay. 

Multiplex PCR assay was performed on the 

purified DNA as follows: In a final volume of 25 

ul; 1 ul of DNA template, 0.6 ul (5 uM) of each of 

the four primers and 12.5 ul HotStar Taq Master 

Mix (Taq DNA polymerase, 10x Taq buffer, 3 

mM MgCl 2 , and 400 uM dNTPs; Quiagen, CA, 

USA) were added to 9.1 uL distilled water. The 

primers used to amplify 123 bp fragment of 

IS6110 were: KDE1 (5` -CCT GCG AGC GTA 

GGC GTC GG) and KDE2 (5` -CTC GTC CAG 

CGC CGC TTC GG). The primers used to amplify 

a 378 bp fragment of IS1245 were: MA1 (5` -CTT 

GCT GGA GGT GCT CGA CG) and primer MA2 

(5` -GGA GGT GCC GTG CAG GTA GG). 

MTB strain H37Rv and M. avium ATCC 871031 

were used as PCR controls. Thermocycling was 

done in Gene-Amp PCR system 9700 

Thermocycler (Perkin-Elmer Inc., CA). PCR 

conditions were as follows: initial denaturation at 

96 o C for 15 min, then 35 cycles composed of 

denaturation at 96 o C for 30 sec, annealing at 64 

o C for 30 sec, and extension at 72 o C for 30 sec. 

Final extension at 72 o C for 7 min was done at the 

end of cycles. PCR amplicons were 

electrophoresed through 2% agarose gel 

supplemented with 50 ug ethidium bromide, at 

100 V for 1 hr. DNA bands were visualized by 

UV transilluminator, and compared to control 

strains. 

PCR RFLP analysis of OxyR gene: Isolates 

were further characterized Using PCR RFLP 

analysis of OxyR gene to differentiate between M. 

bovis & M. tuberculosis within the MTB complex. 

A 548 bp segment of the OxyR gene was 

amplified as described previously (16 ) using the 

following oligonucleotide primers: forward 

primer, 5 ’GGT GAT ATA TCA CAC CATA-3 ’ ; 

reverse primer , 5 ’ – CTA TGC GAT CAG GCG 

TAC TTG-3’. The following cyclic conditions 

were used for amplification of the OxyR gene: 

denaturation at 96 o C for 5 min, 35 cycles of 30 

sec at 96 o C, 30 sec at 57 o C, 45 sec at 72 o C and 

finally extension for 6 min at 72 o C. DNA gel 

Electrophoresis was done to test the amplification 

using 2% agarose gel under 100 V for 1 hour. the 

PCR product (10 ul) was digested with 4 U of AluI 

( New England Biolabs, Beverly, Mass., USA), 

the reaction mix included 12 ul water, 2.5 ul 

enzyme buffer, and 10 ul PCR product. 100 bp 

marker was used as a ladder. 4-20% Novex precast 

acrylamide gel was used for doing the gel 

electrophoresis for 3 hours, at 100V, using TBE 

buffer cooled to 6 o C. 

Strain typing (IS6110 RFLP) 

Isolates of MTB were typed by the 

standard IS6110-RFLP method as described by 

van Embden et al (5). In brief, a 2-3 week old 

subculture isolates in 7H9 broth was incubated 

overnight with cycloserine (1 mg/ml) at 37 o C. The 

sedimented cells were harvested to 1.5 ml 

microcentrifuge tube and incubated for 20 min at 

80 o C. Chromosomal DNA was isolated by 

disruption of cells with siliconized glass beads as 

described previously (14). About 0.75 to 1.25 ug 

of genomic DNA was digested for 2 h with 10 U 

of pvuII (BRL Life technologies Inc., Gaitherburg, 

MD) and electrophoresed on 1.0% agarose gel 

electrophoresis overnight. The restriction 

fragments were transferred by vacuum blotting to 

a Hybond-N+ nylon membrane (Amersham Corp., 

Arlington heights, IL). Hybridization was carried 

out under stringent conditions with 247-bp IS6110 

PCR fragment, using the Amersham ECL direct 

labeling and detection kit. Banding patterns on 

resulting autoradiographs were scanned and 

analyzed using molecular analysis software (Bio 

Image, Ann Arbor, MI) (14). 

Spoligotyping 

Spoligotyping was performed as previously 

described by Kamerbeek et al., (17). The direct 

repeat (DR) region was amplified by PCR using 

primers derived from the DR sequence. The 

primers used were DRa 

(GGTTTTGGGTCTGACGAC) and DRb 

(CCGAGAGGGGACGGAAAC). Fifty 

microliters of the following reaction mixture were 

used for the PCR: 10 ng of DNA, 20 pmol each of 

primers DRa and DRb, each deoxynucleoside 

triphosphate at 200 mM, PCR buffer, and 0.5 U of 

taq polymerase. The mixture was heated for 3 min 

at 96C and subjected to 20 cycles of 1 min at 96C, 

1 min at 55C, and 30 s at 72C. The amplified 

DNA was hybridized to a set of 43 immobilized 

oligonucleotides, each corresponding to one of the 

unique spacer DNA sequences within the D R 

locus. The sequences of the oligonucleotides used 

are given in table 1. These oligonucleotides were 

covalently bound to a Hybridization membrane. 

The membrane (Biodyne C) was obtained from 

Pall Biosupport, Portsmouth, UK, and was 

activated as previously described (17). For 

hybridization, 20 ul of the amplified PCR product 

was diluted in 150ul of 2X SSPE supplemented 

with 0.1% sodium dodecyl sulfate and heat 

denatured. The diluted samples (130ul) were 

pipetted into the parallel channels in such a way 

that the channels of the miniblotter apparatus were 

perpendicular to the rows of oligonucleotides 

deposited previously. Hybridization was done for 

60 min at 60C. After hybridization, the membrane 

was washed as previously described (17). 

144


Detection of hybridizing DNa was done by using 

chemiluminescent ECL (Amersham) detection kit. 

The 43-digit binary result is converted to a 15- 

digit octal designation as previously described 

(18). 

Table 1 Sequences of the oligonucleotides used in the study. 

Space Oligonucleotide sequence 

Space Oligonucleotide sequence 

No. 

No. 

1 ATAGAGGGTCGCCGGTTCTGGATCA 23 AGCATCGCTGATGCGTCCAGCTCG 

2 CCTCATAATTGGGCGACAGCTTTTG 24 CCGCCTGCTGGGTGAGACGTGCTCG 

3 CCGTGCTTCCAGTGATCGCCTTCTA 25 GATCAGCGACCACCGCACCCTGTCA 

4 ACGTCATACGCCGACCAATCATCAG 26 CTTCAGCACCACCATCATCCGGCGC 

5 TTTTCTGACCACTTGTGCGGGATTA 27 GGATTCGTGATCTCTTCCCGCGGAT 

6 CGTCGTCATTTCCGGCTTCAATTTC 28 TGCCCCGGCGTTTAGCGATCACAAC 

7 GAGGAGAGCGAGTACTCGGGGCTGC 29 AAATACAGCTCCACGACACGACCA 

8 CGTGAAACCGCCCCCAGCCTCGCCG 30 GGTTGCCCCGCGCCCTTTTCCAGCC 

9 ACTCGGAATCCCATGTGCTGACAGC 31 TCAGACAGGTTCGCGTCGATCAAGT 

10 TCGACACCCGCTCTAGTTGACTTCC 32 GACCAAATAGGTATCGGCGTGTTCA 

11 GTGAGCAACGGCGGCGGCAACCTGG 33 GACATGACGGCGGTGCCGCACTTGA 

12 ATATCTGCTGCCCGCCCGGGGAGAT 34 AAGTCACCTCGCCCACACCGTCGAA 

13 GACCATCATTGCCATTCCCTCTCCC 35 TCCGTACGCTCGAAACGCTTCCAAC 

14 GGTGTGATGCGGATGGTCGGCTCGG 36 CGAAATCCAGCACCACATCCGCAGC 

15 CTTGAATAACGCGCAGTGAATTTCG 37 CGCGAACTCGTCCACAGTCCCCCTT 

16 CGAGTTCCCGTCAGCGTCGTAAATC 38 CGTGGATGGCGGATGCGTTGTGCGC 

17 GCGCCGGCCCGCGCGGATGACTCCG 39 GACGATGGCCAGTAAATCGGCGTGG 

18 CATGGACCCGGGCGAGCTGCAGATG 40 CGCCATCTGTGCCTCATACAGGTCC 

19 TAACTGGCTTGGCGCTGATCCTGGT 41 GGAGCTTTCCGGCTTCTATCAGGTA 

20 TTGACCTCGCCAGGAGAGAAGATCA 42 ATGGTGGGACATGGACGAGCGCGAC 

21 TCGATGTCGATGTCCCAATCGTCGA 43 CGCAGAATCGCACCGGGTGCGGGAG 

22 ACCGCAGACGGCACGATTGAGACAA 

RESULTS 

MTC was cultured from sputum samples 

from 45 patients with a presumptive diagnosis of 

pulmonary tuberculosis from Suez Canal region. 

All isolates contained IS6110 based upon PCR 

amplification of a 123-bp region of the insertion 

element. Among the 45 human isolates, one 

human isolate was determined to be M. bovis and 

44 were M. tuberculosis based upon amplification 

of 270- bp region of oxyR. 

Antimicrobial Susceptibility testing 

Twenty-5ive (56.8%) of the 44 MTB isolates 

were susceptible in vitro to all antituberculosis 

drugs tested; 5 (11.4%) were mono-resistant to 

INH and STR (4 were resistant to STR and only 

one was resistant to INH); 14 (31.8%) were 

resistant to more than one drug (MDR). The 14 

MDR strains included 6 strains resistant to 4 

drugs, 3 resistant to INH, RIF, 3 resistant to INH 

and STR, one resistant to INH, RIF and EMB, 

and one resistant to INH, RIF and STR (Table 2). 

Strain types (IS6110 RFLP) 

Among the 44 MTB isolates tested for 

RFLP analysis in this study, 40 different RFLP 

patterns were obtained (table 3). The number of 

IS6110 copies ranged from 5 to 16 (fig. 1). 

Studying the IS6110 RFLP patterns indicated that 

the 44 isolates did not cluster together but were 

generally scattered. Eight isolates were clustered 

together in 4 patterns, 2 isolates each. These two 

pairs of isolates had more than 90 % similarity but 

still had one difference in IS6110-hybridization 

band within each pair. The MDR-TB isolates did 

not cluster together. 

Spoligotyping 

Twenty-two different spoligotypes were 

identified among the 44 MTB isolates, of which 

13 were unique (Table 3). The remaining 31 

isolates (%) were grouped into 9 clusters of strains 

sharing identical spoligotypes. One of these 

clusters contained 12 isolates (%) and represented 

the most frequently observed type, which was 

designated as spoligotype A. The other major 

spoligotypes H & G, were observed for 4 (%) and 

3 (%) isolates respectively. While Spoligotypes C, 

E, I, K, M, and S were observed for 2 isolates 

(3.50%) (Fig. 2). 

145


Table 2. RFLP types according to the antimicrobial susceptibility patterns of the 44 tested M. tuberculosis 

isolates from sputum samples of pulmonary tuberculosis patients in Egypt 

Resistance pattern Number of isolates RFLP patterns 

INH 1 32 

STR 4 22, 30, 5, 16 

RIF + INH 3 6, 15, 38 

INH + STR 3 2,5,17 

INH+RIF+STR 1 3 

INH+RIF+EMB 1 39 

INH+RIF+ STR +EMB 6 7,9,10,20,21,40 

None 25 Multiple * 

Total 44 

* 21 RFLP patterns. 

Table 3. Spoligotypes of 44 MTB isolates from sputum of patients with pulmonary tuberculosis in Egypt. 

Spoligotype 

Number of 

Isolates 

Spoligotype a 

RFLP type (s) 

A b 12 777777777760771 1, 21 c , 25, 26 c , 27, 28 c ,38,39,40 

B 1 777777367720771 2 

C 2 777777377760771 9, 3 

D 1 777777777740171 4 

E 2 477677577760771 6, 19 

F b 1 377777607760771 5 

G 3 437777777760771 20, 7, 10 

H b 4 777777607760771 8, 12, 32, 33 

I b 2 703777740003171 31, 11 

J b 1 776377777760771 13 

K 2 777777607760751 14 

L 1 037637767760771 15 

M 2 770000777760771 16, 17 

N 1 703777740003771 22 

O 1 703777600003171 29 

P 1 776367777760771 30 

Q 1 777777601760771 24 

R 1 777777347760471 35 

S 2 777777777620771 23, 34 

T 1 677777777413731 37 

U 1 776377740000031 36 

V 1 777737607760771 18 

Total 44 40 

a, 15-digital octal code (REF). 

b, Types were found among Egyptian isolates isolates in previous studies. 

c, each FRLP pattern contain 2 isolates. 

146


RFLP Patterns 

S 1 2 5 6 7 8 9 11 1 4 14 17 18 22 23 25 28 28 40 S 

FIG. 1: IS6110 RFLP Patterns of 18 M. tuberculosis 

Isolates. S, size standard. 

H37Rv 

BCG 

Water 

Clinical samples 

a 

Figure 2. Spoligotypes from amplified mycobacterial DNA of purified M. tuberculosis DNA from strain 

H37Rv (lanes 1), purified M. bovis from strain BCG (lanes 2) and M. tuberculosis DNA strains 

cultured from clinical specimens lanes (4-40). 

147


DISCUSSION 

Epidemiologic studies of tuberculosis can 

be greatly facilitated by the application of strainspecific 

markers. The discoveries of transposable 

elements in Mycobacterium tuberculosis have 

been shown to be of great potential for use in 

strain identification. 

This study represents early attempts at 

tracking diversity particularly among drugresistant 

strains consistent with low-incidence 

countries. In this study we characterized 

Mycobacterium tuberculosis complex (MTC) 

isolates from sputum of patients infected with 

MTB from Egypt in order to establish a database 

of strain types and antimicrobial susceptibility 

patterns. 

Among the 45 MTC isolates from sputum 

samples obtained from Suez Canal Hospitals in 

Egypt, 44 were identified as MTB and one as M. 

bovis by PCR-RFLP analysis of oxyR. This 

finding suggests that M. bovis plays a minor role, 

compared to MTB, in the etiology of pulmonary 

tuberculosis in Egypt. We found 40 IS6110 RFLP 

patterns among the 44 MTB isolates tested. None 

of these patterns may be considered low-copy 

number (


Greenland and Denmark. J. Clin. Microbiol. 32:3018- 

3025. 

8. Jasmer R M, Hahn J A, Small P M, et al. 1999. A 

molecular epidemiologic analysis of tuberculosis trends 

in San Francisco, 1991-1997. Annals of Int Med. 130: 

971-978. 

9. Bifani, P. J., B. B. Plikaytis, Vkapur, K. Stockbauer, 

X. Pan, M. L. Lutfey, S. L. Moghazeh, W. Eisner, T. 

M. Daniel, M.H. Kaplan, J. T. Crawford, J. M. 

Musser, and B. N. Krreiswirth. 1996. Origin and 

interstate spread of a New York City multidrugresistant 

Mycobacterium tuberculosis clone family. 

JAMA 275: 452-457. 

10. van Rie, A., R. Warren, M. Richardson, T. C. 

Victor, R. P. Gie, D. A. Enarson, N. Beyers, and P. 

D. van Helden. 1999. Exogenous reinfection as a 

cause of recurrent tuberculosis after curative treatment. 

N. Engl. J. Med. 341:1174-1179.World Health 

Organization. 1998. Global tuberculosis control: WHO 

report 1998. 

11. Small, P. M., N. B. McClenny, S. P. Singh, G. K. 

Schoolnik, L. S. Tomkins, P. A. Mickelsen. 1993. 

Molecular strain typing of Mycobacterium tuberculosis 

to confirm cross-contamination in the 

mycobacteriology laboratory and modification of 

procedures to minimize occurrence of false-positive 

cultures. J. Clin. Microbiol. 31:1677-1682. 

12. Dooley, S. W., M. E. Villarino, M. Lawrence, L. 

Salinas, S. Amil, J. V. Rullan, W. R. Jarvis, A. B. 

Block, and G. M. Cauthen. 1992. Nosocomial 

transmission of tuberculosis in a hospital unit for HIVinfected 

patients. JAMA. 267:2632-2635. 

13. Kent P. T. and J. P. Kubica 1985. Public Health 

Mycobacteriology: A guide for the level III laboratory. 

U.S. Department of Health and human services 

publication no. 86-8230. U.S. Department of Health 

and human services, Washington D.C, p. 159-184. 

14. Kremer, K., D. van Soolingen, R. Frothingham, W. 

H. Haas, P. W. M. Hermans, C. Martin, P. 

Palitapongarnpim, B. B. Plikaytis, L. W. Riley, M. 

A. Yakrus, J. M. Musser, and J. D. A. van Embden. 

1999. Comparison of methods based on different 

molecular epidemiological markers for typing of 

Mycobacterium tuberculosis complex strains: 

interlaboratory study of discriminatory power and 

reproducibility. J. Clin. Microbiol. 37:2607-2618. 

15. McAdam, R.A., P.W.M. Hermans, D. van 

Soolingen, Z.F. Zainuddin, D.Catty, J.D.A. van 

Embden and J.W.Dale. 1990. Characterization of a 

M. tuberculosis insertion seqence belonging to the IS3 

family. Mol. Microbiol. 4:1607-1613. 

16. Abbadi S.H. 2001. Use of PCR –RFLP analysis of 

oxyR gene to differentiate between Mycobacterium 

tuberculosis and Mycobacterium bovis. Egy. J. Med. 

Microbiol. 10 (4): 809-813. 

17. Kamerbeek, J., L. Schouls, A. Kolk, M. van 

Agtervveld, D. van Soolingen, S. Kuijper, A. 

Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and 

J. D. A. van Embden. 1997. Simultaneous detection 

and strain differentiation of Mycobacterium 

tuberculosis for diagnosis and epidemiology. J. Clin. 

Microbiol. 35:907-914. 

18. Dale, J.W. , D. Brittain, A. A. Cataldi, D. Cousins, J. 

T. Crawford, J. Driscoll, H. Heersma, T. Lillebaek, 

T. Quitugua, N. Rastogi, R. A. Skuce, C. Sola, D. 

van Soolingen, and V. Vincent. 2oo1. Spacer 

oligonucleotide typing of bacteria of the 

mycobacterium tuberculosis complex: 

recommendations for standard nomenclature. Int. J. 

Tuber. Lung Dis. 5: 216-219 

19. Cooksey RC, Abbadi SH, Woodley CL, Sikes D, 

Wasfy M, Crawford JT, Mahoney F. 2002. 

Characterization of Mycobacterium tuberculosis 

complex isolates from the cerebrospinal fluid of 

meningitis patients at six fever hospitals in Egypt. J 

Clin Microbiol. 40(5):1651-5. 

20. Abbadi, S., H. G. Rashed, G. P. Morlock, C. L. 

Woodley, O. El Shannawy, and R. C. Cooksey. 

2001. Characterization of IS6110 Restriction fragment 

length polymorphisms patterns and mechanisms of 

antimicrobial resistance for Multidrug-resistant isolates 

of Mycobacterium tuberculosis from a major reference 

hospital in Assuit, Egypt. J. Clin. Microbiol. 39: 2330- 

2334. 

21. Girgis, N., Y. Sultan, Z. Farid, M. Mansour, M. 

Erian, L. Hanna, and A. Mateczun. 1998. 

Tuberculous meningitis, Abbassia Fever Hospital- 

Naval Medical Research Unit No. 3-Cairo, Egypt, from 

1976 to 1996. Am. J. Trop. Med. Hyg. 58:28-34. 

22. El Moghazy, E. 1997. National tuberculosis program 

report, Epidemiological review and action plan. 

Egyptian Ministry of Health, Cairo, Egypt. 

149


التفريق بين سلالات ميكروب الدرن الرئوى المختلفة و المعزولة 

من بصاق مرضى الدرن الرئوى 

سعيد حامد عبادى،‏ جيهان الحديدى،‏ ناهد جمعة،‏ ، روبرت آوآسى 

قسم الميكروبيولوجى والمناعة-‏ آلية طب قناة السويس،‏ 

مرآز التحكم فى الامراض-‏ اتلانتا-امريكا 

من اهم وسائل مقاومة مرض الدرن الرئوى هو وجود وسيلة سريعة للتشخيص،‏ العلاج المناسب وآذلك معرفة نوع 

السلالات المعزولة لتحديد مصدر العدوى.‏ وبعد التطور الهائل فى استخدام تقننيات الحامض انووى ظهرت وسائل 

عديدة يمكن استخدامها فى معرفة نوع السلالت المعزولة.‏ 

وفى هذه الدراسة تم الاعتماد على وسيلتى التحليل الجينى لجين اى اس ٦١١٠، والتحليل الجينى لتعددية الشكلية 

الموجودة فى جين يى ار للتفريق بين ٤٥ سلالة من سلالات ميكروب الدرن 

وقد اظهرت الدراسة وجود ٤٤ سلالة من ميكروب الدرن الرئوى وسلالة واحدة من ميكروب الميكوبكتيريم بوفس 

وذلك بافحص نواتج تقطيع جين اوآى ار بعد تكبيره بتفاعل البلمرة المتسلسل.‏ آما اظهرت الدراسة وجود 

سلالة متعددة المقاومة لادوية الدرن 

١٤ 

. 

وباستخدام التحليل الجينى لجين اى اس ٦١١٠ تبين وجود‎٤٠‎ نوع مختلف من بين ال‎٤٤‎ سلالة لميكروب الدرن 

الرئوى ‏(منهم 

٣٦ نوع فريد ، 

٤ انواع يشمل آل نوع سلالتين).‏ آما تم تقسيم نفس ال‎٤٤‎ سلالة الى 

٢٢ نوع 

مختلف باستخدام طريقة التحليل الجينى لتعددية الشكلية الموجودة فى جين يى ار منهم ١٣ نوع فريد وتم تقسيم 

الباقى وعددهم ٣١ نوع الى ٩ مجوعات مختلفة.‏ آما لوحظ عدم وجود اى تجمع للسلالات المتعددة المقاومة 

لادوية الدرن فى مجموعة معينة فى الطريقتين المستخدمتين فى الدراسة.‏ 

150

Strain differentiation of Mycobacterium tuberculosis complex ...

Create successful ePaper yourself

Delete template?

Save as template?