Immunity in the moss Physcomitrella patens

UNIVERSITY OF COPENHAGEN
FACULTY OF SCIENCE
DEPARTMENT OF BIOLOGY
PhD thesis
Simon Bressendorff
Immunity in the moss Physcomitrella patens
Academic advisor: John Mundy
Submitted: 01/11/2012

Abstract............................................................................................................................... 3
Resumé................................................................................................................................ 4
Abbreviations...................................................................................................................... 6
Introduction......................................................................................................................... 7
The plant innate immune system .................................................................................... 7
MTI ............................................................................................................................. 7
ROS............................................................................................................................. 9
MPK signaling pathways .......................................................................................... 10
WRKY transcription factors ..................................................................................... 12
ETI ............................................................................................................................ 12
RAR1, SGT1 and HSP90.......................................................................................... 13
HR............................................................................................................................. 13
Autophagy..................................................................................................................... 14
Physcomitrella patens ................................................................................................... 17
Evolution................................................................................................................... 17
The life cycle and morphology of Physcomitrella.................................................... 18
Homologous recombination...................................................................................... 19
The genome of Physcomitrella ................................................................................. 20
Innate immunity in Physcomitrella............................................................................... 21
Physcomitrella responses to pathogens .................................................................... 21
Physcomitrella responses to MAMPs....................................................................... 21
Results............................................................................................................................... 23
Identification of Physcomitrella homologs of defense related Arabidopsis genes....... 23
CERK1...................................................................................................................... 23
MEKK1..................................................................................................................... 25
MKK1 and MKK2 .................................................................................................... 27
MPK4........................................................................................................................ 29
R-genes ..................................................................................................................... 30
Creating targeted KOs................................................................................................... 32
Southern blot............................................................................................................. 35
Flow cytometry ......................................................................................................... 38
Pathogen infections....................................................................................................... 39
Symptoms of a Botrytis cinerea infection ................................................................ 40
Symptoms of P. irregulare infection........................................................................ 42
Evans blue staining ................................................................................................... 42
Alternaria spore counting assay................................................................................ 44
The MAP kinase KO ΔMPK4A ................................................................................... 45
P. irregulare infection of ΔMPK4A.......................................................................... 45
Genes not differentially expressed in the ΔMPK4A-1 line....................................... 46
Gene expression in ΔMPK4A lines upon B. cinerea infection ................................. 48
ROS production upon chitosan treatment................................................................. 49
MPK phosphorylation western blots......................................................................... 51
Sporophyte induction................................................................................................ 51
MAMP growth assay ................................................................................................ 52
ΔRAR-1 and R-gene KOs............................................................................................. 52
Evans blue staining upon B. cinerea infection of ΔPpRAR1.................................... 53
1

Infections with biotrophic pathogens........................................................................ 53
Yeast two-hybrid analysis of PpRAR1 and PpSGT1 ............................................... 54
Gene expression in ΔRAR1 upon chitosan treatment................................................ 55
MPK phosporylation in ΔRAR1................................................................................ 56
The autophagy deficient mutant ΔATG5...................................................................... 56
Phenotypic description of the ΔATG5 lines.............................................................. 56
ATG8 western blot.................................................................................................... 60
Pathogen treatments of the ΔATG5 lines .................................................................. 62
Infection with a Sordariomycetes fungus ................................................................. 63
MPK phosporylation in ΔATG5 lines ....................................................................... 65
The AtMEKK1 homologs ΔPpMEKK1A and ΔPpMEKK1B ..................................... 65
Discussion......................................................................................................................... 67
MPKs in Physcomitrella............................................................................................... 67
ROS........................................................................................................................... 67
Abiotic stress............................................................................................................. 68
Sporophyte formation ............................................................................................... 68
PpMPK4B................................................................................................................. 69
PpRAR1 and R-proteins ........................................................................................... 70
Autophagy..................................................................................................................... 71
Materials and methods ...................................................................................................... 72
Identifying Arabidopsis homologs/orthologs in Physcomitrella .............................. 72
Moss growth conditions............................................................................................ 72
Media ........................................................................................................................ 73
Cloning of PpMPK4B............................................................................................... 73
Constructing a USER compatible moss KO vector .................................................. 74
Preparation of pMBLU ............................................................................................. 75
USER cloning ........................................................................................................... 75
Protoplast isolation.................................................................................................... 76
Transformation.......................................................................................................... 77
Genotyping................................................................................................................ 78
Southern blot............................................................................................................. 81
RNA extraction and quantitative RT-PCR ............................................................... 83
Statistics .................................................................................................................... 84
Flow cytometry ......................................................................................................... 84
ROS accumulation .................................................................................................... 84
Histochemical staining.............................................................................................. 85
cDNA ........................................................................................................................ 85
Yeast two-hybrid....................................................................................................... 85
Western blots ............................................................................................................ 85
PCR conditions ......................................................................................................... 85
References......................................................................................................................... 87
Manuscript 1 ................................................................................................................... 102
Manuscript 2 ................................................................................................................... 136
2

Abstract
Studies in flowering plants have provided a wealth of information on pathogen
recognition, signal transduction and the activation of defense responses. However, very
little is known about the immune system of the phylogenetically ancient moss
Physcomitrella patens. Mosses represent some of the earliest land plants and are thus in
an ideal evolutionary position to provide information on the evolution of plant innate
immune systems. Furthermore, Physcomitrella has the unique ability to be genetically
manipulated using targeted gene replacements through homologous recombination.
Using this emerging model system, we identify and create targeted knock out of
nine Physcomitrella homologs of defense related Arabidopsis genes. The knock-out lines
are assessed for altered immune responses to a range of different pathogens.
We find that at least one Physcomitrella mitogen activated protein kinase (MPK),
PpMPK4A is required for proper innate immune responses. This is a primary example of
a single, non-redundant plant MPK essential for immunity without any other apparent
phenotypes associated with the corresponding null-mutant. We show that PpMPK4A is
phosphorylated in response to microbe associated molecular patterns (MAMPs) including
fungal chitin and bacterial MAMPs. The knock out of PpMPK4A renders the moss more
susceptible to the pathogenic fungi Botrytis cinerea and Alternaria brassicicola and fails
to accumulate several defense related transcripts and ROS production upon treatment
with fungal chitosan. While related MPKs in the higher plant model Arabidopsis thaliana
are activated both by pathogen inoculation and by abiotic stress, we did not detect
activation of PpMPK4A or any other Physcomitrella MPK by several abiotic stresses.
Signal transduction via PpMPK4A may therefore be specific to MAMP-triggered
immunity, and the moss may use other signaling components to respond to abiotic
stresses.
In addition, a Physcomitrella knock-out of a homolog of the autophagy related
gene ATG5 provides the first analysis of autophagy in non-vascular plants. PpATG5
knock-out mutants show clear signs of autophagy deficiency, such as early senescence
and sensitivity to nutrient deprivation. We also show that PpATG5 is required for the
defense against a Sordariomycetes fungus.
3

Resumé
Studier i blomstrende planter har givet et væld af informationer om pathogen genkendelse,
signal transduktion og aktiveringen af forsvars respons. Men, meget lidt vides om
immunsystemet i den fylogenetisk gamle mos Physcomitrella patens. Mos repræsentere
nogle af de ældste landplanter og er således i en ideel evolutionær position til at give
informationer om evolutionen af det medfødte plante immunforsvar. Yderligere har
Physcomitrell den unikke evne til at blive genetisk manipuleret med målrettet gen
udskiftning ved hjælp af homolog rekombination.
Ved hjælp af dette nye model system identificere og sletter vi ni Physcomitrella
homologer af forsvars relaterede Arabidopsis gener. Disse ”knock out” linjer bliver testet
for ændrede immun respons til en række forskellige pathogener.
Vi finder at mindst en Physcomitrella mitogen aktiveret protein kinase (MPK),
PpMPK4A er nødvendig for korrekt immun respons. Dette er det første eksempel på en
enkelt ikke-overflødig MPK der er afgørende, uden andre fænotyper knyttet til den
svarende mutant. Vi viser at PpMPK4A bliver fosforyleret som respons på mikrobe
aktiverede molekylære mønstre (MAMPs) som chitin fra svampe og bakterielle
MAMPs. ”knock outen” af PpMPK4A gør mossen mere modtagelig overfor de
pathogene svampe Botrytis cinerea og Alternaria brassicicola og forhindre ophobningen
af flere forsvars relaterede transkripter og ROS produktionen efter bahandling med chitin
fra svampe. Mens MPKer i den blomstrende plantemodel Arabidopsis thaliana bliver
aktiveret af både pathogen infektioner og af abiotisk stress, så vi ikke nogen aktivering af
PpMPK4A eller nogle andre MPKer i Physcomitrella efter mange former for abiotisk
stres. Signal transduktion via PpMPK4A kan derfor være specifik for MAMP-aktiveret
immun system, og mossen kan benytte andre signalerings komponenter som respons på
abiotisk stres.
En Physcomitrella ”knock out” a en homolog af det autofagi relateret gen ATG5
giver den første analyse af autofagi i en ikke-vaskulær plante. PpATG5 knock out
planterne viser klare tegn på autofagi mangel, så som tidlig aldring og følsomhed overfor
næringsstof mangel. Vi viser at PpATG5 er nødvendig for forsvaret mod en
Sordariomycetes svamp.
4

Preface and acknowledgements
This thesis concludes my PhD work at the Department of Biology,University of
Copenhagen. The project has resulted in the manuscript: “A MAP kinase regulates innate
immunity triggered by pathogen associated molecular patterns in the moss
Physcomitrella patens”, submitted to Pathogen (manuscript 1) and my contribution to the
review: “Role of autophagy in disease resistance and hypersensitive response-associated
cell death” (manuscript 2).
I started this PhD project as part of the newly started Center for Comparative
Genomics, but after about a year the center was closed as its Director Rasmus Nielsen
moved to U. Berkeley. I therefore had to refocus my project on the bryophyte plant
model Physcomitrella patens which had not been previously studied in our research
group. Introducing a new model organism meant that I had to devote much effort and
time to practical and technical problems to get the many new techniques to work with
little practical supervision.
Over the years I was also involved in many different side projects which are not
mentioned in the report. Together with Maria Christina Suarez I annotated MPK, MKK
and MP3K genes in the newly sequenced spike moss Selaginella Moellendorfii. Together
with Michael Krogh Jensen I did many experiments with the carnivorous plant Venus
flytrap (Dionaea muscipula). For example I optimized protocols for doing DNA and
RNA extraction from the flytrap and I successfully estimated the very large flytrap
genome size (~3GBp) based on a qPCR method. Together with Klaus Petersen I
furthermore cloned several R-genes in Arabidopsis and introduced dominant negative P-
loop mutations.
During the PhD program I supervised several people that I thank for their interest
in the moss project. Some of the figures in this report are done by these people under my
supervision: i. the yeast two hybrid assay in Figure 36 was done by lab technician student
Ali Fard, and ii. the western blot in Figure 34 and the qPCR in Figure 32 were done by
BSc. students Søren Iversen and Mira Wilkan.
I would like to thank John Mundy and Morten Petersen for supporting the project
even when nothing seemed to work. A very special thanks to everybody at IIBCE in
Uruguay for being very generous hosts, and especially Inés Ponce de León for teaching
me many moss techniques, and Alexandra Castro who helped me with the Southern blot
analysis. Also thanks to Anders Tolver Jensen for help with the statistics, Sarah Line
Skovbakke for helping with the FACS analysis, Henning Knudsen for helping with the
identification of the Sordariomycetes fungus, Christine Lunde for providing the
Physcomitrella patens (Gransden 2004) wild type strain, and Andrew Cuming for the
original pMBL6 and pMBLU10a KO vectors.
October 2012
Simon Bressendorff
5

Abbreviations
ACC = 1-Aminocyclopropane-1-carboxylic acid (Ethylene
Precursor) MKS1 = MPK4 Substrate 1
a-DOX = alfa dioxygenase
MP3K = Mitogen activated protein kinase kinase kinase
Amp = Ampicillin
MPK= Mitogen Activated Protein Kinase
Arabidopsis = Arabidopsis thaliana
MTI = MAMP Triggered Immunity
At = Arabidopsis thaliana
MYA = Million Years Ago
ATG = Autophagy related
Nb = Nicotiana benthamiana
BAK1 = BRI1-associated receptor kinase 1
NB = Nucleotide Binding
BCD = Basal growth medium NDR1 = Non-race specific Disease Resistance 1
BCD+AT = Basal growth medium supplemented with ammonium
tartrate (see Material and Methods)
NOX = NADPH oxidase
bla = amp-resistance gene
Os = Oryza sativa
bp = base pairs
PAD = Phytoalexin-Deficient
CC = Coiled-Coil
PAL = Phenyl Allanine Ammonialyase
CDPK = calcium-dependent protein kinases
PAMP = Pathogen Associated Molecular Pattern
Ce = Caenorhabditis elegans
PCD = Programmed Cell Death
CEBiP = Chitin Elicitor-Binding Protein
PEG = Polyethylene Glycol
CERK = Chitin Elicitor Receptor Kinase
PGN = Peptidoglycan
Physcomitrella = Physcomitrella patens (Gransden 2004
CHS = Chalcone Synthase
strain)
CYP71A13 = cytochrome P450, family 71, subfamily A,
polypeptide 13
Pp = Physcomitrella patens
DAMP = Danger Associated Molecular Pattern
PR = Pathogen Related
EDS1 = Enhanced Disease Susceptibility 1
PRR = Pathogen Recognition Receptor
EF-Tu = Elongation Factor Tu
PRX = Peroxidase
ERF = Ethylene Respone Factor
Pto = Pseudomonas syringae pv. tomato DC3000
qPCR = quantitative Reverse Transcriptase Poly Chain
ETI = Effector Triggered Immunity
Reaction
flg22 = Flagellin peptide
RAR1 = required for Mla12 resistance1
G418 = Geneticin
RB = Right Boarder
hpi = hours post infection
RbohB = respiratory burst oxidase homolog B
hpt = hours post treatment
R-gene = Resistance gene
HR = Hypersensitive Response
RLK = Receptor-like kinase
HSP = Heat Shock Protein
ROS = Reactive Oxygen Species
JA = Jasmonic Acid
SA = Salicylic Acid
KI = Knock In SAG101 = Senescence Associated Gene 101
KO = Knock Out
Sc = Saccharomyces cerevisiae
LB = Left Boarder OR bacteria media, read from context
SEM = Standard Error of the Mean
LOX = Lipooxygenase
SGT1 = suppressor of the G2 allele of skp1
LRR = Leucine Rich Repeat
SUMM = suppressor of mkk1 mkk2
LysM = Lysin Motif
T-DNA = Transfer DNA
MAMP = Microbe Associated Molecular Pattern
TIR = Toll/Interleukin-1 Receptor
TSPO = mitochondrial peripheral-type benzodiazepine
MAPK = Mitogen Activated Protein Kinase
receptor
Mb = Mega Base pairs
TUB6 = beta-Tubulin6
MC = Meta-Caspase
USER cloning = Urasil-Specific Excision Reagent cloning
MeJA= Methyl-Jasmonate
WT= wild type
MEKK = MP3K
Y2H = Yeast Two Hybrid
MKK = Mitogen activated protein Kinase Kinase
Δ = knockout mutant
6

Introduction
Ever since plants colonized land they have formed the basis of all other life on land as
they alone have the ability to convert solar radiation into the chemical energy we call
nutrients. As autotrophs they provide the nutrients upon which all other life feeds on.
Thus, viruses, bacteria, fungi and animals depend on plants to harvest the solar energy.
So even humans compete with microbes to get these nutrients. It is estimated that yearly
crop losses due to microbial pathogens is between 7 and 15%, depending on the crop
(Oerke, 2006).
The plant innate immune system
Plants, like animals, have been involved in an evolutionary arms race with the pathogens
that infect them. This race has evolved sophisticated strategies by which pathogens attack
their hosts, and equally sophisticated strategies by which hosts defend themselves.
Host immune system must i. recognize non-self, ii. judge if the recognized nonself
posses a danger, and iii. if dangerous, initiate an appropriate response. In order to do
so, plants have evolved a multilayered innate immune system to combat pathogen attacks
(Jones and Dangl, 2006). The first layer relies on recognizing the pathogen at the
boundaries of the cell to initiate defense responses to prevent the pathogen from entering
the cell. This is made possible by pathogen recognition receptors (PRRs) in the plasma
membrane. These receptors recognize microbe/pathogen associated molecular patterns
(MAMPs or PAMPs). Since the patterns recognized by the receptors are characteristics of
classes of microbes, whether they are pathogenic or not, the term MAMP is generally
more appropriate than PAMP. This first layer of defense is termed MAMP triggered
immunity (MTI) or basal defense. A typical outcome of a MTI is the production of
antimicrobial compounds and cell wall fortification.
Some pathogens have evolved mechanisms to overcome this first layer of defense
by delivering effector molecules into the host cell in an attempt to disrupt the MTI. In
order to avoid this immune suppression, plants have evolved a surveillance system that
either recognizes the delivered effector molecules directly or recognizes them indirectly
by sensing the damage they cause, i.e. by recognizing altered self. Such surveillance is
done by R-proteins (resistance proteins) that are said to guard the targets of the effector.
This second layer of defense is termed effector triggered immunity (ETI). A ETI response
is more drastic than the MTI response, since it often triggers a rapid, localized
programmed cell death (PCD) known as the hypersensitive response (HR) (DeYoung and
Innes, 2006). This scorched-earth tactic is very effective in stopping biotrophic pathogens
from spreading.
MTI
Most research in plant immunity has been done in the model plant Arabidopsis or in other
flowering plants like tobacco, rice and tomato. In these plants, several MAMPs and their
corresponding PRR have been identified. These MAMPs include the 22 amino acid
peptide flg22 from the flagellin protein which is an essential building block of bacterial
7

flagella (Felix et al., 2002). Flg22 is recognized by the leucine rich repeat receptor like
kinase (LRR-RLK) flagellin sensing 2 (FLS2) (Chinchilla et al., 2006). The extracellular
domain of FLS2 is similar to the innate immunity receptor TOLL in Drosophila (Gómez-
Gómez and Boller, 2000). The Arabidopsis Atfls2 mutant is more susceptible to the
bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Pto) (Zipfel et al., 2004)
Another bacterial MAMP is the 18 residue elf18 peptide from the N-terminus of
elongation factor Tu (EF-Tu) that is recognized by the LRR-RLK elongation factor
receptor (EFR) (Zipfel et al., 2006). Both FLS2 and EFR form complexes with another
transmembrane LRR-RLK receptor, the BRI1-associated receptor kinase 1 (BAK1)
which respectively perceive flg22 and elf18 and mediate immunity (Chinchilla et al.,
2007; Roux et al., 2011). Atefr mutants are more susceptible to colonization by weakly
virulent mutant strains of Pto (Nekrasov et al., 2009).
The fungal MAMP chitin, a b-(1,4)-linked oligosaccharide of N-acetylglucosamine,
is an essential component of the cell walls of fungi that is not found in
plants and vertebrates. Chitin fragments have long been known to act as elicitors of
defense responses in plants (Felix et al., 1993). It is recognized by two RLKs in rice
(Oryza sativa), the chitin elicitor-binding protein (OsCEBiP) and chitin elicitor receptor
kinase1 (OsCERK1), which cooperatively regulate chitin perception by forming a
receptor complex (Shimizu et al., 2010). In Arabidopsis the closest homolog of rice
OsCEBiP (AtLYM2) does not contribute to chitin perception (Shinya et al., 2012), while
the closest homolog of OsCERK1 is solely responsible for the detection of chitin (Miya
et al., 2007). It does so by forming homodimers in the presence of chitin (Liu et al., 2012).
The Arabidopsis Atcerk1 mutant exhibits enhanced susceptibility to the necrotrophic
fungus Alternaria brassicicola (Miya et al., 2007).
It has recently been found in Arabidopsis that two other RLKs, AtLYM1 and
AtLYM3 with sequence identity to rice OsCEBiP, interact with AtCERK1 to perceive the
presence of the bacterial derived MAMP peptidoglycan (PGN). This hetero-oligomer
perception system is similar to the OsCEBiP OsCERK1 complex that mediates chitin
perception and immunity to fungal infection in rice (Willmann et al., 2011). The ability
of PRRs to form complexes and engage in hetero-oligomerization in different
combinations greatly extends the abilities of relatively few PRRs to recognize many
different MAMPs.
Apart from MAMPs that originate from the pathogen, plant cells under attack can also
produce their own danger signals (damaged-associated molecular patterns, or DAMPs)
that are thought to amplify the same responses triggered by MAMPs (Krol et al., 2010;
Segonzac and Zipfel, 2011).
PRRs belongs to the very large RLK family with >600 members in Arabidopsis, >1100 in
rice and 157 in Physcomitrella (Shiu et al., 2004; Vij et al., 2008). The large number of
genes and the expansion of the gene family through evolution indicates that clear one to
one orthologous connection cannot be established. For example, in Physcomitrella there
are no clear homologs of the RLK receptors FLS2 and ERF2, but there is one of BAK1
(Boller and Felix, 2009) and possibly also of CERK1 (Lawton and Saidasan, 2009).
However, thus far no functional PRRs have been described in Physcomitrella.
8

ROS
Within seconds of PAMP perception by cognate PRRs, apoplastic reactive oxygen
species (ROS) rapidly accumulate in a reaction known as the ROS burst. The role of ROS
in disease resistance is not very well understood, but it is conserved throughout the plant
kingdom and also occurs in animal innate immunity (Kohchi et al., 2009; Pérez-Pérez et
al., 2012).
Molecular links between PRRs and ROS production have not been fully
documented, but it is known that activation of PRRs following MAMP perception
stimulates a rapid influx of Ca 2+ from the apoplast which increases the cytoplasmic Ca 2+
concentrations. This activates calcium-dependent protein kinases (CDPKs) that then
directly phosphorylate the NADPH oxidase RbohB (respiratory burst oxidase homolog B)
(Boudsocq and Sheen). The membrane localized Rboh enzymes are a key source of ROS
in plants (Torres and Dangl, 2005).
In plants, ROS can contribute to defense either directly as an antibiotic agent or
indirectly by promoting oxidative cross-linking in the cell wall (Apel and Hirt, 2004). It
can also act as a secondary messenger either directly in the form of H 2 O 2 , or indirectly by
oxidizing polyunsaturated fatty acids that may act as secondary messengers to trigger
defense responses (Forman et al., 2010; Vellosillo et al., 2010). In mammalian innate
immunity, ROS generation is used to kill bacteria within the phagosome (Diebold and
Bokoch, 2005), but it can also function as a secondary messenger of signal transduction
(Kohchi et al., 2009).
The ROS burst has long been used as a tool to identify MTI signaling components in
Arabidopsis, and recently the ROS burst has been described in mosses within seconds of
treatment with the fungal MAMP chitosan (Lehtonen et al., 2012). Lethonen et al. found
that a class III peroxidase (PpPRX34) is essential for the ROS burst in Physcomitrella,
and that the ΔPpPRX34 mutant is more susceptible to saprophytic and a necrotrophic
fungi than the wild type moss (Lehtonen et al., 2009, 2012). Similarly, Arabidopsis T-
DNA insertion lines of two apoplastic peroxidases, Atprx33 and Atprx34, exhibit reduced
ROS and callose deposition in response to the bacterial MAMPs flg22 and elf26 (Daudi
et al., 2012).
However, ROS production is not restricted to MTI but is a general stress response that
also occurs after abiotic stress and in ETI triggered HR (Zurbriggen et al., 2010; Suzuki
et al., 2012). As in flowering plants, ROS is also produced upon abiotic stress in
Physcomitrella (Frank et al., 2007). A Physcomitrella mutant unable to produce a
mitochondrial localized protein homologous to the mammalian mitochondrial peripheraltype
benzodiazepine receptor (ΔPpTSPO1) is unable to maintain redox homeostasis and
is hyper sensitive to salt stress and fungal pathogens (Frank et al., 2007; Lehtonen et al.,
2012).
Recently a connection between ROS and autophagy has emerged, since several studies in
different plants have shown activation of autophagy in response to stimuli that increase
ROS generation, regardless of the origin and location of ROS production in the cell
(reviewed in Pérez-Pérez et al., 2012).
9

MPK signaling pathways
Mitogen activated protein kinases (MPKs) are a class of enzymes present in all
Eukaryotes. They transduce extracellular stimuli from the cell surface to the nucleus via a
sequential phosphorylation cascade in which MPK kinase kinases (MP3Ks or MEKKs)
phosphorylate MPK kinases (MKKs) which phosphorylate MPKs (Ichimura et al., 2002).
They are involved in a wide range of cellular functions including stress-responses, cellcycle
checkpoint pathways, and cell differentiation and proliferation (Suarez-Rodriguez
et al., 2010). The Arabidopsis genome encodes 60 MAP3Ks, 10 MAP2Ks, and 20
MAPKs (Ichimura et al., 2002). This indicates that a MPK cascade does not necessarily
only consist of single MAP3K, a single MAP2K, and a single MAPK. It rather indicates
that some levels of redundancy must exist.
In Arabidopsis AtMPK3, 4, 6 and 11 have all been shown to be activated within
minutes of PRRs perception of the MAMPs flg22, elf18 and chitin (Wan et al., 2004;
Nekrasov et al., 2009; Petutschnig et al., 2010; Roux et al., 2011; Bethke et al., 2012;
Eschen-Lippold et al., 2012). AtMPK3, 4 and 6 are also activated by abiotic stresses like
salt, drought, cold, UV-light and wounding (Ichimura et al., 2000; Droillard et al., 2004;
Teige et al., 2004; González Besteiro et al., 2011). The activation of AtMPK11 upon
MAMP sensing has only been shown very recently, and there is no data on the MPK
cascade leading to the activation of AtMPK11 (Bethke et al., 2012; Eschen-Lippold et al.,
2012).
However, two MPK cascades have been shown to be activated downstream of
PRRs. The first to be described was the cascade downstream of AtFLS2 consisting of the
two MP3Ks AtMPKKKα and AtMEKK1, the two MKKs AtMKK4 and AtMKK5 and the
two MPKs AtMPK3 and AtMPK6 (Asai et al., 2002; Ren et al., 2008). The other MPK
cascade acting downstream of PRRs consists of AtMEKK1, AtMKK1/AtMKK2 and
AtMPK4 (Gao et al., 2008). All these components have been shown to interact, and might
thus act in a scaffolding complex (Suarez-Rodriguez et al., 2007). Usually the activity of
the components in such a signaling cascade is conferred through phosphorylation, but
surprisingly a kinase dead version of AtMEKK1 could rescue AtMPK4 activation in a
Atmekk1 mutant background. This suggests that AtMEKK1 merely acts as a scaffolding
protein, and that another MP3K may supply the kinase activity as long as AtMEKK1 is
present (Suarez-Rodriguez et al., 2007).
Exactly how PRR binding of MAMPs leads to the activation of a MPK cascade is
not known, but the influx of Ca 2+ and subsequent activation of CDPKs is thought to be
involved (Wurzinger et al., 2011).
AtMPK4 was originally reported as a negative regulator of plant immunity because the
Atmpk4 mutant displayed constitutive expression of defense related genes, elevated ROS
levels, high levels of salicylic acid (SA), spontaneous cell death and a dwarfed growth
phenotype (Petersen et al., 2000). The Atmekk1 mutant and the Atmkk1/Atmkk2 double
mutant display similar phenotypes to Atmpk4, underlining their functional connections
(Suarez-Rodriguez et al., 2007; Gao et al., 2008; Qiu et al., 2008b). It has recently been
shown that severe phenotypes of mutants in this MPK cascade are due to the activation of
10

ETI through the R-protein AtSUMM2 (suppressor of mkk1/mkk2 2) since the triple
mutant Atsumm2/Atmkk1/Atmkk2 displayed normal phenotype in respect to growth,
defense gene expression, ROS and hormone levels (Zhang et al., 2012). The double
mutant of Atsumm2/Atmekk1 also displayed a normal phenotype, while the double mutant
Atsumm2/Atmpk4 did not fully rescue the phenotype of Atmpk4 since it still had elevated
ROS levels, residual cell death and slightly stunted growth (Zhang et al., 2012). This
retained phenotype of the Atsumm2/Atmpk4 double mutant suggests that AtMPK4 could
be guarded by another R-protein besides AtSUMM2.
Inducible expression of the bacterial effector HopAI1 in wild-type plants gives rise to a
defense phenotype similar to that seen in Atmekk1, Atmkk1/Atmkk2 and Atmpk4 mutants
including elevated levels of ROS, defense gene expression and cell death (Zhang et al.,
2012). This is because the bacteria Pto injects the HopAI1 effector into the plant cell to
prevent immune responses by irreversibly inactivate AtMPK3, AtMPK4 and AtMPK6,
and this modified self is sensed by the guard R-protein AtSUMM2 which then activates a
ETI response (Zhang et al., 2007, 2012). Thus, the immune responses caused by HopAI1
were completely suppressed in the Atsumm2 background (Zhang et al., 2012). However,
which host component the R-protein AtSUMM2 is guarding has not yet been identified,
since AtSUMM2 does not interact directly with any of components of the AtMEKK1,
AtMKK1/AtMKK2 and AtMPK4 signaling cascade (Zhang et al., 2012). This indicates
that AtSUMM2 possibly guards a downstream target of the AtMPK4 activity.
Interestingly, the suppressor screen of the Atmkk1/Atmkk2 double mutant also
identified AtSUMM1 which turned out to be identical with the MP3K AtMEKK2 (Kong
et al., 2012). Mutations in AtMEKK2 were able to suppress the dwarfed phenotype and
the constitutive defense responses in Atmekk1, Atmkk1/Atmkk2, and Atmpk4 mutant plants
although the Atmekk2/Atmpk4 double mutant retained residual cell death and slightly
elevated ROS levels just like the Atsumm2/Atmpk4 mutant (Kong et al., 2012). They
found that disruption of the AtMEKK1, AtMKK1/AtMKK2 and AtMPK4 signaling
cascade leads to activation of AtMEKK2, which triggers AtSUMM2 mediated immune
responses. However, since AtMEKK2 and AtSUMM2 did not interact directly, the host
component guarded by AtSUMM2 still remains to be found (Kong et al., 2012).
Understanding the function of individual component of the MPK signaling cascade in
flowering plants have been complicated by functional redundancy, potential promiscuity,
and inappropriate auto-activation of immune responses in some mutants. Together these
observations indicate that studies of MPKs in different evolutionary models may help
elucidate their basal and subsequently acquired functions. A recent phylogenetic study
found that there are seven MKKs and eight MPKs in Physcomitrella (Dóczi et al., 2012).
However, there are no reports on how many MP3Ks there are in Physcomitrella, and no
reports on the functions of any single MPKs or MPK signaling cascades components.
Since Physcomitrella has fewer members of the MPK gene family, it could be imagined
that they exhibit less redundancy and it could thus be easier to assign a function for each
MPK.
11

WRKY transcription factors
WRKY transcription factors are members of a large family of plant specific proteins
defined by the presence of one or two WRKY domains, a ~60 amino acid region that
contains the conserved signature motif WRKYGQK followed by a zink finger structure.
There are no WRKYs in animals or yeast, but they have evolved rapidly within the plant
kingdom as there is just one WRKY in the green algae C. reinhardtii, 37 in
Physcomitrella and 74 in Arabidopsis (Rushton et al., 2010). WRKY transcription factors
are involved in both positive and negative gene regulation in a range of processes
including biotic and abiotic stress, senescence and different developmental processes
(Rushton et al., 2010).
In unchallenged Arabidopsis plants, AtMPK4 forms a nuclear localized
complex with AtMKS1 (MPK4 Substrate 1) and AtWRKY25 and AtWRKY33
(Andreasson et al., 2005; Qiu et al., 2008a). When treated with flg22, AtMPK4
phosphorylates AtMKS1 which leads to the dissociation of the complex, thereby releasing
the AtWRKY33 transcription factor to bind to the promoters of its target genes (Qiu et al.,
2008a). One target of AtWRKY33 is the gene encoding the P450 monooxygenase
AtPAD3 (Phytoalexin-Deficient 3). AtPAD3 catalyzes the final step in the biosynthesis of
the antimicrobial compound camalexin (Schuhegger et al., 2006). The production of
camalexin is important in defense against necrotrophic fungi since Atpad3 and Atwrky33
mutants are more susceptible to infection with B. cinerea and A. brassicicola (Ferrari et
al., 2003; Wees et al., 2003; Zheng et al., 2006). Besides AtPAD3, several other defense
related genes have been identified as direct targets of AtWRKY33 underlining its
important role in MTI (Birkenbihl et al., 2012)
Recently Mao et al. (2011) described how WRKY33 also functions downstream
of AtMPK3/AtMPK6 by being phosphorylated in vivo by these MPKs in response to B.
cinerea infection. AtWRKY22 and AtWRKY29 have also been reported to function
downstream of the AtMEKK1, AtMKK4/AtMKK5 and AtMPK3/AtMPK6 pathway (Asai
et al., 2002)
To our knowledge there are no reports on the function of any of the 37 reported WRKY
transcription factors in Physcomitrella.
ETI
As noted above, R-proteins can trigger ETI by direct interaction with pathogen effectors
delivered into the cells, or by detecting altered self by guarding host components or
pathways targeted by the effectors (Jones and Dangl, 2006; Shen and Schulze-Lefert,
2007). There are some 200 Arabidopsis genes encoding proteins containing domains
characteristic of plant resistance proteins (Meyers et al., 2003). These characteristics are
the presence of a N-terminal region consisting of either a coiled-coil structure (CC) or a
TOLL/Interleukin 1 Receptor (TIR) domain, followed by a nucleotide binding (NB)
domain, and a C-terminal with leucin rich repeats (LRR). These two major types are
referred to as either CC-NB-LRR or TIR-NB-LRR (Meyers et al., 2003). While the CC
domain is a common structural domain found in many proteins, the TIR domain has
homology to the innate immunity TOLL receptor in Drosophila and to the human innate
12

immunity receptor interleukin 1 (Shirasu, 2009). The central NB domain is part of a
larger domain, called NB-ARC, due to its occurrence in plant R-proteins, the apoptotic
regulator human Apoptotic Protease-Activating Factor 1 (APAF-1), and its
Caenorhabditis elegans homolog CED-4 (van der Biezen and Jones, 1998). The LRR
domain is also found in mammalian immune receptors with striking similarities to the
plant R-proteins (Shirasu, 2009). Some of the 200 R-proteins in Arabidopsis lack one of
these three core domains, and some have additional domains at their N or C-termini
(Meyers et al., 2003).
Much work has been put into deciphering the genetic requirements of the R-
proteins. Its has been found that the function of most CC-NB-LRR R-proteins depends on
non-race specific disease resistance 1 (NDR1) (Knepper et al., 2011b). There are,
however, exceptions to this rule; several CC-NB-LRR R proteins that specify resistance
to the oomycete pathogen Hyaloperonospora arabidopsidis (Hpa) function independently
of NDR1 (Knepper et al., 2011a). TIR-NB-LRR R-proteins require the two lipase-like
proteins enhanced disease susceptibility 1 (EDS1) and phytoalexin deficient 4 (PAD4)
and an acyl hydrolase, senescence associated gene 101 (SAG101) (Feys et al., 2005).
RAR1, SGT1 and HSP90
Genetic screens for loss of resistance have further provided strong evidence for the
requirement of another complex to confer resistance mediated by both CC and TIR-NB-
LRRs. This complex consists of Required for mlA12 Resistance 1 (RAR1), suppressor of
the G2 allele of SKP1 (SGT1), and heat shock protein 90 (HSP90) (Shirasu, 2009). Yeast
two-hybrid analysis and co-immunoprecipitation experiments on plant extracts have
shown that R-proteins interact with RAR1, SGT1 and HSP90 and that these three
components also mutually interact (Takahashi et al., 2003; Azevedo et al., 2006). RAR1
is a single copy gene in plants and the Atrar1 mutant does not exhibit other phenotypes
than loss of R-protein mediated resistance, indicating that RAR1 functions exclusively in
immunity in plants (Shirasu, 2009). Arabidopsis contains two isoforms of SGT, AtSGT1a
and AtSGT1b. The double mutant Atsgt1a/Atsgt1b is embryonic lethal, indicating that
SGT is essential and has functions other than in immunity (Azevedo et al., 2006). HSP90
is a molecular chaperone and is one of the most abundant cellular proteins. HSP90
homologs are found across all kingdoms of organisms, except for Archaea (Chen et al.,
2006). RAR1 and SGT1 are thought to act as co-chaperones with HSP90 to ensure R-
protein stability (Shirasu, 2009). However, not all R-proteins depend on the presence of a
functional RAR1/SGT1/HSP90 co-chaperone (Shirasu, 2009).
HR
R-protein recognition of a pathogen induces a conformational change which is thought to
start the signaling which lead to the HR (DeYoung and Innes, 2006). However, the chain
of events leading to the HR after effector recognition via R-proteins is not fully
elucidated (Coll et al., 2011). The molecular events that lead to the HR during ETI
overlap partly with those associated with MTI, including the accumulation of SA, ROS,
activation of MAPK cascades, changes in intracellular calcium levels, transcriptional
reprogramming and synthesis of antimicrobial compounds (Mur et al., 2008). Although
CC and TIR-NB-LRRs in general require different downstream components, their signals
13

converge in the activation of SA and ROS production, which act synergistically to drive
the HR (Mur et al., 2008).
In mammals, a common form of PCD is apoptosis which requires the caspase
proteases. However, plants do not possess caspases, rather they have caspase-like
proteins called metacaspases which cleave proteins after arginine or lysine residues as
opposed to cystein and aspartate for caspases (Enoksson and Salvesen, 2010). In
Arabidopsis metacaspase 1 mutants (Atmc1) suppress cell death induced by bacterial and
oomycete triggered HR (Coll et al., 2011). HR mediated by both CC and TIR-NB-LRR
intracellular immune receptors is severely attenuated in the Atmc1 plants, indicating
convergence of the two pathways into a single cell death output. However, at least one
other cell death pathway exists since HR induced cell death by some TIR-NB-LRRs has
been shown to require autophagy genes (Hofius et al., 2009, and manuscript 2).
Apparently R-genes evolved when plants made the transition from sea to land
since they are not found in an extant species representing the last common ancestor of all
land plants, the green algae Chlamydomonas (Shirasu, 2009). Physcomitrella was
recently reported to encode 18 intact R-proteins compared to 122 intact R-proteins in
Arabidopsis (Meyers et al., 2003; Xue et al., 2012). An interesting observation on the
evolution of R-proteins is that monocots apparently completely lack the TIR-type R-
proteins, but still have EDS1 on which the activities of most dicot TIR R-proteins depend
(Tarr and Alexander, 2009). Thus rice (Oryza sativa) encodes >400 R-proteins, but none
of these are of the TIR type (Wang et al., 2004).
Autophagy
The role of autophagy in plant defense is described in detail in manuscript 2, but I will
provide a brief overview of autophagy here. Several subtypes of autophagy are described,
but macroautophagy (hereafter termed autophagy) is the most extensively studied (Yang
and Klionsky, 2010) and will be the only form described here. Autophagy is a conserved
eukaryotic mechanism, which is classically defined as the degradation of cytoplasmic
constituents in the lytic organelle (vacuoles in yeast and plants and lysosomes in
mammals) (Xie and Klionsky, 2007).
It was originally discovered over 40 years ago in yeast (Saccharomyces cerevisiae) as a
mechanism to survive during starvation (Yang and Klionsky, 2010). It has since been
found that the core machinery of autophagy is conserved throughout the eukaryote
kingdoms, and that its functions are much more versatile than just survival during
starvation (Liu and Bassham, 2012). Thus, autophagy has been shown to be involved
several other pro-survival mechanisms like clearance of misfolded proteins, aggregated
proteins and damaged, potentially deleterious organelles. These functions play an
important role in human diseases like cancer and neurodegenerative diseases (Yang and
Klionsky, 2010). In plants, autophagy is also induced by the presence of ROS which is
generated when the plant is subjected to biotic or abiotic stresses (Pérez-Pérez et al.,
2012). The elevated ROS levels result in damaged, oxidized proteins which are then
degraded by autophagy (Xiong et al., 2007). It is also now known that autophagy not only
functions under stress conditions but also functions at a basal level under optimal
14

conditions as a house keeping function to maintain cell homeostasis (Liu and Bassham,
2012).
Morphologically, autophagy begins with the formation of cup-shaped double membranes,
which expand to form autophagosomes engulfing malfunctioning or un-needed
macromolecules and organelles and transport them for degradation inside the vacuole
(Figure 1). In plants, the origin of the double membrane is unknown (Liu and Bassham,
2012). Upon arrival of the autophagosomes to the vacuoles, their outer membrane fuses
with the tonoplast, creating single membrane vesicles inside the vacuole, termed
'autophagic bodies'. Autophagic bodies and their contents are then degraded inside the
vacuole, providing recycled materials to build new macromolecules (Xie and Klionsky,
2007).
Figure 1. Schematic of the formation of an autophagic body. Cytosolic material is sequestered by an
expanding membrane, the phagophore, resulting in the formation of a double-membrane vesicle, an
autophagosome. The outer membrane of the autophagosome subsequently fuses with the vacuole,
exposing the inner single membrane of the autophagosome to lysosomal hydrolases. The cargocontaining
membrane compartment is then lysed, and the contents are degraded. Adapted from
(Klionsky et al., 2008).
In plants, autophagy is involved in leaf senescence. When leaves senesce, the plant
recovers and recycles valuable nutrient components that have been incorporated during
growth that would otherwise be lost when the leaf dies or is shed (Figure 2). Chloroplasts
contain approximately 80% of total leaf nitrogen and represent a major source of recycled
nitrogen during leaf senescence (Makino and Osmond, 1991). Chloroplasts are thus taken
up by the vacuole and degraded in an autophagy dependent manner during leaf
senescence, since the Arabidopsis autophagy deficient mutant Atatg4a4b-1 was unable to
degrade chloroplasts during senescence (Wada et al., 2009). In an assay of gene
expression during senescence it was found that 15 Arabidopsis genes involved in
autophagy are up regulated, showing the key role of autophagy in the controlled
degradation of cellular components (Breeze et al., 2011).
Not only in plants, but also in yeast and animals, autophagy mutants often display
early senescence under nutrient deficient conditions. Arabidopsis atg2, atg5, atg4s, atg6,
atg7, atg8s, atg9, atg10, atg12s and atg18a mutants all show early senescence in carbon
or nitrogen deficient conditions, and some even under nutrient-rich conditions (Liu and
Bassham, 2012).
15

Figure 2. Senescence leaves of Quercus dentata, the Daimyo Oak. In a controlled process that involves
autophagy, cellular content is degraded and nutrients transported via the vascular system into the
stem before the leaves are shed. Senescence proceeds from leaf margins toward the center. Note that
cells surrounding the vascular tissues senesce relatively late to facilitate nutrient mobilization from
adjacent, senescing cells.
Besides its pro-survival functions autophagy has also been found have a pro-death
function in an autophagy dependent PCD pathway conserved across the Eukaryotic
kingdoms (Yang and Klionsky, 2010). Autophagic PCD has been shown to be essential
to specific developmental processes in Drosophila, C. elegans and Arabidopsis (See text
and Figure 2, manuscript 2).
Hofius et al. (2009) showed that TIR-NB-LRR mediated cell death was autophagy
dependent since the TIR-NB-LRR RPS4-mediated HR response in Atatg7 and Atatg9
was compromised in response to Pto DC3000 carrying the effector avrRps4. This result
contradicted previously published results showing that autophagy was required for
restricting the spread of cell death induced by pathogen effector recognition (Patel and
Dinesh-Kumar, 2008; Yoshimoto et al., 2009). The apparent discrepancy between these
results is discussed in more detail in manuscript 2. In brief, the discrepancy may be due to
the age of the plants used. In older, autophagy deficient plants, toxic compounds
accumulate that would have been cleared in wild type plants. This accumulation of toxic
compounds make the cells vulnerable to pathogen attack and thus the apparent increased
cell death in older autophagy deficient plants could be due to accumulative effects of not
having a functional autophagy house-keeping system.
Lenz et al. (2011) recently showed that Arabidopsis autophagy deficient plants are less
susceptible to the biotrophic Pto DC3000 bacteria while they are more susceptible to the
necrotrophic fungus A. brassicicola. They suggested that this difference could be due to
slightly elevated levels of the phytohormone SA which promotes HR. Lai et al. (2011)
also found that autophagy deficient Arabidopsis plants were more susceptible to the
necrotrophic fungus B. cinerea and that the uninfected autophagy mutant had elevated
SA levels. Furthermore Lai et al. (2011) showed that the transcription factor WRKY33,
which is important for MTI against necrotrophic pathogens (Zheng et al., 2006),
interacted with ATG18a, thus pointing to a possible regulatory link between autophagy
and defense against necrotrophic pathogens.
16

Autophagy has been demonstrated in the green algae model Chlamydomonas reinhardtii
(Pérez-Pérez et al., 2010), but to our knowledge there have been no studies published on
any aspect of autophagy in Physcomitrella or any other nonvascular land plant. Thus the
autophagy deficient Physcomitrella mutant described in this report represents the first
autophagic analysis in a non-vascular plant. However, since the core machinery of
autophagy is conserved throughout the Eukaryote kingdoms, Physcomitrella should be a
very good model organism in which to study this phenomenon due to its unique ability to
be manipulated through reverse genetics.
Physcomitrella patens
Evolution
Bryophytes pioneered and modified the terrestrial environment 475 MYA (Wellman et al.,
2003), and thus paved the way for all other terrestrial life forms. Bryophytes developed
from an ancestor most closely related to modern green algae (Lewis and McCourt, 2004)
and after making the transition onto land the early land plants diverged into lineages
adapting to the different habitats of the terrestrial environment. Mosses and seed plants
shared their last common ancestor at least 420 MYA (Clarke et al., 2011), making the
evolutionary distance between Physcomitrella and Arabidopsis similar to that of fishes
and humans (Hedges, 2002). Fossil records show that the macro morphology of extant
mosses appears unchanged since the earliest preserved fossil records from 320 MYA
(Hübers and Kerp, 2012).
Moving from the aquatic environment to the terrestrial led to many fundamental
changes. Drought, UV-light exposure and changing temperatures are among the major
environmental differences that required adaptations.
Figure 3. Land plant evolution. A schematic overview of the adaptations in the different lineages of
landplants. From (Rensing et al., 2008)
Since mosses are amongst the earliest land plants they present an evolutionary link
between green algae and flowering plants. This makes them ideal for studying the
evolutionary changes required to conquer land. These chances included adaptations to the
new abiotic stresses including enhanced osmoregulation and osmoprotection, desiccation
and freezing tolerance, heat resistance, synthesis and accumulation of protective
17

“sunscreens”, and enhanced DNA repair mechanisms (Rensing et al., 2008). However, it
can be assumed that plants moving from water to land were accompanied by pathogens
many of which evolved airborne spores. This started the evolutionary arms race that
resulted in advanced pathogen weapons and attack strategies and coevolved defense
systems in the plants. Physcomitrella is thus in an ideal evolutionary position to provide
useful insights to the evolution of plant innate immunity.
The life cycle and morphology of Physcomitrella
Like other bryophytes, Physcomitrella exhibits a reverse alternation of generations
compared to vascular plants. Thus, the gametophyte (haploid) generation comprises most
of the plant while the sporophyte (diploid) generation is very small and dependent upon
the haploid shoot (gametophore) (Figure 4). Following meiosis, haploid spores (Figure
4A) germinate into filamentous networks of cells with apical growth comprising the
protonema stage. The protonemal filaments consist of two cell types: chloronemata with
many fully developed chloroplasts (Figure 4B) and caulonemata with faster, invasive
growth and fewer, smaller chloroplasts (Figure 4C). When moss is grown on medium
overlaid with cellophane the protonema stage is prolonged and formation of
gametophores is delayed compared to growth on medium without cellophane. At some
point a branch of chloronemal cells will differentiate and form a gametophore (Figure
4D). The gametophore is a leafy shoot composed of a nonvascular stem with leafs and
rhizoids. On top of a gametophore both male (antheridia) and female (archegonia) sexual
organs form (Figure 4E). If water is present, motile spermatozoids can swim from the
antheridia to the archegonium and fertilize the eggs. The resulting zygote develops into
the diploid sporophore (Figure 4F). The sporophyte needs to divert water and nutrients
from the parental gametophyte. While the gametophyte does not have stomata, there are
fully functional stomata on the diploid sporangium (Chater et al., 2011). Meioses in the
spore capsule within the sporangium produces approximately 4000 haploid spores.
When grown in the lab, the life cycle of Physcomitrella can be completed within
approximately 12 weeks. Cold conditions with short days of low light mimic autumnal
seasonal change and induce sporophyte formation (Hohe et al., 2002). However, for most
experimental procedures there is no need to complete the life cycle of Physcomitrella as
it is easily propagated vegetatively. This is because any part of the plant will differentiate
into chloronemal cells and produce a new colony when mechanically disrupted.
18

Figure 4. (A) A haploid spore germinates into (B) chloronemal cells, which continue to grow and
differentiate into (C) caulonemal cells. (D) Gametophores, or shoots, emerge off protonemal
filaments and are ultimately anchored by rhizoids that grow by tip growth from the base of the
gametophore. (E) At the apex of the gametophore, both female, archegonia (arrows) and male,
antheridia (arrowheads) form. A motile flagellate sperm fertilizes the egg and the (F) sporophyte
(marked with a bracket) develops at the apex of the gametophore. From (Prigge and Bezanilla, 2010).
Like other mosses, Physcomitrella has a relatively simply morphology compared to
flowering plants. The lack of roots and vascular tissue restricts their size. Both the leaves,
rhizoids and protonemal filaments consist of only one layer of cells without a fully
developed cuticle to protect from water loss. Thus they are poikilohydric such that the
water content of the plant is in equilibrium with the water content of the environment.
Though most mosses can tolerate some dehydration, they are dependent on a rather moist
environment. Since the leaves of Physcomitrella consist of just one layer of cells there is
no need for stomata. However, the sporophyte which develops the multilayered
sporangium has stomata (Chater et al., 2011).
Homologous recombination
Much of the knowledge of modern genetics has been gained from the discovery of gene
targeting through homologous recombination in the yeast Saccharomyces cerevisiae back
in the late 1970s (Struhl et al., 1979). In 1991, a protocol was published for genetic
transformation of Physcomitrella protoplasts (Schaefer et al., 1991). This protocol is
based on the same techniques as for yeast transformation: Direct uptake of DNA in the
presence of polyethylene glycol (PEG) followed by heat chock. To achieve efficient gene
targeting through homologous recombination, the homologous sequences flanking the
selection cassette have to be 500-1000 bp in Physcomitrella compared to just 30-60 bp in
S. cerevisiae (Schaefer and Zrÿd, 1997). However, with such longer flanking regions the
19

homologous recombination rate in Physcomitrella is the highest reported for any
multicellular organism making it a very useful model organism for doing reverse genetic
studies (Schaefer and Zrÿd, 1997). This technique has successfully enabled targeted
knock out (KO) or targeted insert (KI) or targeted mutation down to one nucleotide,
making Physcomitrella a model to provide useful information in a wide range of research
fields. A schematic drawing of the principle in targeted KO through homolog
recombination can be seen in Figure 16 in the result section.
The genome of Physcomitrella
The genome of Physcomitrella patens was published in 2008 (Rensing et al., 2008). It
consists of 27 chromosomes with a total size of 480 Mb, which is almost four times the
size of the small genome of Arabidopsis thaliana (125 Mb, 5 chromosomes) (The
Arabidopsis Genome Initiative, 2000). According to the latest gene annotation version
(V1.6 at www.cosmoss.org ) Physcomitrella patens has 38.357 protein coding genes
compared to the 27.416 of Arabidopsis thaliana (TAIR 10 at www.Arabidopsis.org ).
Whole genome duplications have occurred in both the Arabidopsis and
Physcomitrella lineages. This makes it difficult to establish orthologous relationships
between genes in these two evolutionary distant species, especially for members of
multigene families. It is hypothesized that the 27 chromosomes of Physcomitrella have
arisen from an original chromosome number of 7 that duplicated twice to 28 and a single
chromosome was subsequently lost. The last whole genome duplication event has been
estimated to have occurred ~45 MYA i.e. after the diversification from the last common
shared ancestor of Arabidopsis (Rensing et al., 2007). Arabidopsis has also undergone
two or more rounds of whole genome duplication since the diversification from the last
common ancestor of mosses, the most recent duplication being ~112 MYA (Ku et al.,
2000), as well as numerous local gene duplications and gene losses (The Arabidopsis
Genome Initiative, 2000).
Despite these major genomic rearrangements and more than 400 million years of
evolution, only about 130 genes are retained in Physcomitrella that do not have clear
homologs in flowering plants (Rensing et al., 2005). Thus, much of “what it takes to be a
plant” is present in Physcomitrella. In fact, many basic cellular processes are conserved
throughout the Eukaryote kingdoms and thus the knowledge gained from comparative
and evolutionary studies of Physcomitrella can provide insights into related processes in
a wide range of other organisms from crop plants to humans.
Summary of the strengths of Physcomitrella as a model organism
• It is easily grown in simple sterile medium in Petri dishes and propagated
vegetatively
• The genome has been sequenced and resources are accessible at
www.cosmoss.org , www.phytozome.net or www.ncbi.nlm.nih.gov
20

• The occurrence, at a very high frequency, of homologous recombination between
sequences in transforming DNA and the corresponding genomic sequences,
allows for targeted gene inactivation and for allele modification
• The haploidy of the dominant phase of the moss life cycle allows the direct
recognition of mutants having a recessive phenotype
• The simple morphology with monolayered leaves make it very suitable for
microscopy and subcellular localization studies.
Innate immunity in Physcomitrella
The study of Physcomitrella pathology is in its infancy. To date, only a few studies on
pathogenesis in Physcomitrella have been done, and they all involve broad host range
necrotrophic pathogens (Andersson et al., 2005; Ponce de León et al., 2007; Lehtonen et
al., 2009; Oliver et al., 2009; Akita et al., 2011). However, many of the molecular and
cellular responses of Physcomitrella after pathogen infection are similar to those
observed in flowering plants including production of ROS, altered gene expression,
production of secondary metabolites, and hallmarks of PCD.
Physcomitrella responses to pathogens
Physcomitrella infection with the necrotrophic fungus B. cinerea and the necrotrophic
oomycete Pythium causes an increase in ROS and SA production (Ponce de León et al.,
2007; Oliver et al., 2009; Ponce De León et al., 2012). Along with ROS and SA
production, other hallmarks of PCD include cytoplasmic shrinkage, accumulation of
autofluorescent compounds and chloroplast breakdown (Ponce De León et al., 2012). The
apparent activation of HR-like PCD after infection with necrotrophic pathogens could be
a result of the invasion strategy of the pathogen by which it manipulates the host defense
system to induce localized host cell death to facilitate its own growth (Govrin and Levine,
2000; Govrin et al., 2006; Frías et al., 2011).
While HR seems like an inappropriate defense response against necrotrophic
intruders, infection of Physcomitrella with B. cinerea and Pythium also induces more
appropriate defense responses like cell wall modifications in the form of callose
deposition and accumulation of phenolic compounds (Ponce de León et al., 2007; Oliver
et al., 2009). Infection with B. cinerea and Pythium also results in up-regulation of
several defense related genes, including PpPAL, PpCHS, PpLOX and PpPR-1 (Ponce de
León et al., 2007; Oliver et al., 2009).
Physcomitrella responses to MAMPs
Treatment of Physcomitrella with cell free pathogen culture filtrates and purified
MAMPs induces defense responses, indicating a functional MTI system (Ponce de León
et al., 2007; Lehtonen et al., 2009, 2012). Ponce de León et al. (2007) observed these
responses when treating Physcomitrella protonemal tissue with cell free culture filtrates
of two different strains of Pectobacterium carotovorum ssp. carotovorum (P.c.
21

carotovorum, formerly named Erwinia carotovora ssp. carotovora), the P.c. carotovorum
SCC1 strain which produces the elicitor HrpN, and the P.c. carotovorum SCC3193 strain
which is a harpin (HrpN)-negative strain. The culture filtrates of both strains induced
defense responses in Physcomitrella, but filtrates of the harpin-secreting strain induced
much stronger responses than filtrates of the HrpN-negative strain. These responses
included up regulation of defense related genes and signs of PCD including cytoplasmic
shrinkage, and the accumulation of ROS and auto fluorescent compounds (Ponce de León
et al., 2007).
Lehtonen et al. (2009, 2012) observed that treating Physcomitrella with the fungal
MAMP chitosan caused a rapid increase in peroxidase activity and a ROS burst. They
discovered that the peroxidase activity caused by a single peroxidase, PpPRX34. The KO
of PpPRX34 was unable to produce a ROS burst upon chitosan treatment and rendered
plants more susceptible to two different pathogenic fungi (Lehtonen et al., 2009, 2012).
These experiments indicate that MTI is conserved between Physcomitrella and flowering
plants. However, until now nothing is known about how MAMPs are perceived, how the
signal is transduced to the nucleus, and how the MAMP induced defense responses are
regulated in Physcomitrella.
Whether Physcomitrella posses a functional ETI with R-proteins is also not known, but
the clear signs of HR-like PCD and the discovery of R-protein homologs of functional R-
proteins in flowering plants indicates that the moss has a functional ETI system (Xue et
al., 2012).
22

Results
Identification of Physcomitrella homologs of defense related
Arabidopsis genes
13 genes of interest from Arabidopsis were chosen as candidates for creating targeted
KOs of their closest Physcomitrella homologs. The 13 genes are the nine listed in Table 1
plus two R-genes of the CC-NB-LRR type and two of the TIR-NB-LRR type.
AtCERK1 AT3G21630
AtMEKK1 AT4G08500
AtMKK2 AT4G29810
AtMKK1 AT4G26070
AtMPK4 AT4G01370
AtSGT1 AT4G11260
AtRAR1 AT5G51700
AtACD11 AT2G34690
AtATG5 AT5G17290
Table 1. Arabidopsis genes of interest and their TAIR IDs. Bold means a Physcomitrella ortholog
could be identified by the reciprocal best hit method.
For four of the 13 Arabidopsis genes, an ortholog in Physcomitrella could be identified
by the reciprocal best hit method (Table 1) (Moreno-Hagelsieb and Latimer, 2008). This
means that if, when performing a reverse BLASTp search against the Arabidopsis genes
with the best Physcomitrella hit as query, the best hit in Arabidopsis is the same as the
original query, then the two genes are considered orthologous. Analyses of the KO of
such in silico orthologs may clarify if they are indeed functional orthologs.
For the remaining nine genes of interest, more than one homologous gene with
similar identity could be the functional orthologs. Therefore, more than one candidate
was chosen for KOs. This selection was done by constructing the phylogenetic
relationship between the gene of interest and its closest homologs in both Arabidopsis
and Physcomitrella, and sometimes also by including homologs from other species.
CERK1
AtCERK1 belongs to the very large family of receptor like kinases with >600 members in
Arabidopsis, >1100 in rice and 157 in Physcomitrella (Shiu et al., 2004; Vij et al., 2008).
With the large number of genes and the great expansion of the gene family through
evolution, it is expected that a clear one to one orthologous connection can not be
established. Figure 5 shows the phylogenetic relationship between the CERK1 and
CEBiP homologs with human IRAK1 as outgroup. There are no closely related homologs
to the rice chitin elicitor-binding protein (OsCEBiP) and its three homologs in
Arabidopsis (AtLYM1-3). However, there are four Physcomitrella RLKs with extensive
similarity to AtCERK1. They were termed PpCERK1A-D (bolded in Figure 5). From this
23

phylogenetic relationship it is not possible to establish a single candidate as the functional
ortholog of AtCERK1. Therefore, the phylogenetic relationship was also created using
DNA and truncated amino acid sequences containing only conserved domains. However,
these phylogenetic trees also did not reveal if any of the four candidates should be
omitted as a putative functional ortholog (data not shown).
Figure 5. Phylogenetic relationship of CERK1 and CeBiP homologs in Pp=Physcomitrella patens,
Sm=Selaginella moellendorffii, Os=Oryza sativa, At=Arabidopsis thaliana, Hs=Homo sapiens. Human
IRAK1 included as outgroup.
The mRNAs of MAMP receptors such as FLS2, EFR and CERK1 are know to be upregulated
at the level of gene expression upon perception of their respective MAMPs
(Hruz et al., 2008). We therefore wanted to see if any of the four candidates responded by
increased expression upon chitosan treatment. As seen in Figure 6, PpCERK1A and
PpCERK1B mRNA levels were induced 8-11 fold within one hour of chitosan treatment
relative to the untreated control (0h). PpCERK1C was slightly induced ~2 fold, while
PpCERK1D did not show any induction. Note that the graphs represent a single q-PCR
run and some technical variation between runs must be expected. Nevertheless,
PpCERK1A and PpCERK1B seem to respond much more to the treatment compared to
the other two and were therefore chosen as candidates for creating targeted KOs.
24

Relative expression
12
10
8
6
4
2
0
CERK1A
CERK1B
CERK1C
CERK1D
0h 15m 30m 1h 2h 4h 8h
Figure 6. Expression of the four CERK1 homologs in Physcomitrella upon chitosan treatment in wild
type moss relative to untreated (0h). The figure is based on a single technical replicate.
MEKK1
In Arabidopsis, there are 10 MP3K members of the MEKK type kinase family and two
MEKK-like genes (Suarez-Rodriguez et al., 2010). There are no publications on how
many MEKKs exists in Physcomitrella. Thus, to find a homolog of AtMEKK1 in
Physcomitrella we first identified all sequences containing the conserved signature
catalytic motif of MEKK type kinases (Figure 7).
Figure 7. WebLogo of the conserved consensus motif in the catalytic domain of MEKK type plant
kinases. (from Suarez-Rodriguez et al., 2010; I created this figure for that publication, as mentioned
in its acknowledgments).
Performing BLAST queries against Physcomitrella protein databases at
www.cosmoss.org, with both full length and the conserved domain of Arabidopsis
MEKKs, MEKK-like and RAF type MP3Ks, revealed 17 proteins with the signature
motif of plant MP3Ks. In order to identify the homologs with the highest similarity to
AtMEKK1, phylogenetic relationships were established. Due to high variation in the N-
terminal regions of the proteins, the full length sequences did not align well. Thus,
truncated versions containing the conserved catalytic domain were used to perform a
multiple alignment using ClustalW2, from which a phylogenetic tree was created using
Treeview (Figure 8). This phylogenetic relationship reveals that Physcomitrella has some
10 MP3Ks with similarity to the MEKK type, at least four with similarity to the RAF
type, and three that show higher similarity to the MEKK-like. Only members of the
MEKK1 type constitute canonical MP3Ks that activate a MAP kinase cascade (Suarez-
Rodriguez et al., 2010). Since we were searching for an AtMEKK1 ortholog, this search
25

should not be considered thorough regarding the number RAF like MP3Ks in
Physcomitrella: there are probably more members of this family than shown in Figure 8.
Figure 8. Phylogenetic relationship of 17 MP3K homologs in Physcomitrella and the 10 Arabidopsis
MEKK type MP3Ks, two members of the RAF type MP3Ks (AtEDR1 and AtCTR1) and members of
the MEKK-like family (AtMP3Ke1 and AtMP3Ke2). Human RAF1 and MEKK3 are included as
outgroups. Pp=Physcomitrella patens, At=Arabidopsis thaliana, Hs=Homo sapiens.
From the phylogenetic tree (Figure 8) it can be seen that there are two Physcomitrella
MP3K homologs with similar identity to Arabidopsis AtMEKK1, here termed
PpMEKK1A and PpMEKK1B (bolded in Figure 8). Performing multiple alignments
with full length sequences of these two with AtMEKK1 did not favor either one.
Therefore, I assayed if either of the two responded to chitosan at the level of gene
expression.
26

Relative expression
6
4
2
PpMEKK1A
PpMEKK1B
0
0h 15m 30m 1h 2h 4h 8h
Figure 9. Expression of the two MEKK1 homologs in Physcomitrella upon chitosan treatment in wild
type moss relative to untreated (0h). The figure is based on a single technical replicate.
As seen in Figure 9, PpMEKK1A mRNA levels respond more strongly than does
PpMEKK1B mRNA upon chitosan treatment. However, it cannot be excluded that
PpMEKK1B is also differentially expressed upon chitosan perception. Thus, both
homologs were chosen as candidates for creating KOs.
MKK1 and MKK2
At the time when we wanted to identify a homolog of AtMKK1 and AtMKK2 in
Physcomitrella there did not exist any publications on how many MKKs Physcomitrella
may have. Thus, we first identified all sequences containing the conserved signature
catalytic motif of MKK type kinases (Figure 10).
Figure 10. WebLogo of the conserved consensus motifs in the catalytic domain of MKK type kinases
of plants (Suarez-Rodriguez et al., 2010; I created this figure for that publication as mentioned in its
acknowledgments).
Performing BLAST queries against Physcomitrella protein databases at
www.cosmoss.org with both full length and the conserved domain of the 10 Arabidopsis
MKKs revealed 7 MKKs in Physcomitrella. The phylogenetic relationship of these and
the 10 Arabidopsis homologs are shown in Figure 11.
27

Figure 11. Phylogenetic relationship of 7 MKK homologs in Physcomitrella and the 10 Arabidopsis
MKKs. Human MEK1 is included as an outgroup. Pp=Physcomitrella patens, At=Arabidopsis
thaliana, Hs=Homo sapiens.
Recently, Dóczi et al. (2012) published a study on the phylogeny of plant MKKs and
MPKs. They found the same 7 MKKs in Physcomitrella. A minor difference was that
they used slightly different annotated models of three of the homologs: Pp1s106_83V6.1,
Pp1s16_334V6.1 and Pp1s114_89V6.1. After the sequencing of the Physcomitrella
genome, the putative genes have been automatically annotated by several different
annotation algorithms. Thus, at each putative gene locus several different gene models
are annotated and they might differ in their coding regions (CDS). For example, one gene
model has included an exon which another model excluded. Until the gene models are
experimentally confirmed, they are all hypothetical. In our study, most homologs were
chosen from the latest annotation version (V1.6) at www.cosmoss.org.
As seen in Figure 11, there are three PpMKKs with similar levels of identity to
AtMKK1 and AtMKK2, here termed PpMKK1A-C. It can also be seen that they all share
higher similarity to AtMKK6 than they do to AtMKK1 and AtMKK2. Arabidopsis
AtMKK6 has been shown to function in a different signaling pathway than AtMKK1 and
AtMKK2, since AtMKK6 activates AtMPK13 (Melikant et al., 2004). Again, we tested
how the regulation of the putative orthologs responded to chitosan treatment (Figure 12).
28

Relative expression
3
2
1
PpMKK1A
PpMKK1B
PpMKK1C
0
0h 15m 30m 1h 2h 4h 8h
Figure 12. mRNA levels of the three MKK1 and MKK2 homologs in Physcomitrella upon chitosan
treatment in wild typerelative to untreated (0h). Only three time points were tested for PpMKK1A.
The figure is based on a single technical replicate.
As seen in Figure 12, PpMKK1B and PpMKK1C responded slightly with a 2.5 fold
increase in mRNA two hours after chitosan treatment. This response was not considered
robust enough to omit any of the three as putative functional orthologs. Thus, all three
were chosen as candidates for creating KOs.
MPK4
At the time when we wanted to identify a homolog of AtMPK4 in Physcomitrella there
did not exist any publications on how many MPKs there are in Physcomitrella. Thus, we
first identified all sequences containing the conserved signature catalytic motif of MPK
type kinases (Figure 13).
Figure 13. WebLogo of the conserved consensus motifs in the catalytic domain of MPK type kinases
of plants. (Suarez-Rodriguez et al., 2010; I created this figure for that publication as mentioned in its
acknowledgments).
Performing BLAST queries against Physcomitrella protein databases at
www.cosmoss.org with both full length and the conserved domain of the 20 Arabidopsis
MPKs revealed 8 MPKs in Physcomitrella. The phylogenetic relationship of these and
the 20 of Arabidopsis are shown in Figure 14.
29

Figure 14. Phylogenetic relationship of 8 MPK homologs in Physcomitrella and the 20 Arabidopsis
MPKs. Human ERK1 is included as an outgroup. Pp=Physcomitrella patens, At=Arabidopsis thaliana,
Hs=Homo sapiens.
Dóczi et al. (2012) later found the same 8 MPKs but used different annotated versions of
Pp1s80_71V6.1 and Pp87_157V6.1. As seen from the phylogenetic tree, two MPK
homologs share similar sequence identity to AtMPK4 (bolded in Figure 14), and both
were chosen for further studies that are described in detail in manuscript 1 and in the
ΔPpMPK4A section.
R-genes
At the time this study was undertaken there only existed one report on the presence of R-
genes in Physcomitrella (Akita and Valkonen, 2002). That study was done before the
genome was sequenced and was therefore probably not exhaustive. Thus, we wanted to
establish how many R-genes of the CC-NB-LRR type and how many of the TIR-NB-
LRR type exist in Physcomitrella. This was done by running BLASTp queries with the
amino acid sequence of the ~83 TIR-NB-LRR genes and 51 CC-NB-LRR genes in
Arabidopsis (Meyers et al., 2003) against the Physcomitrella protein sequence databases
at www.cosmoss.org. Many of the identified sequences contained only parts of a fully
intact R-gene, for example proteins with CC-NB and no LRR domain or just the NB-
LRR domains. For this study we were interested in establishing whether the R-gene
homologs functioned in innate immunity in Physcomitrella as they do in flowering plants.
We therefore performed a conservative search and were mostly interested in R-genes
30

with all three domains intact. The Physcomitrella sequences from the first BLAST search
were thus used as queries in additional BLAST searches against the Physcomitrella
genome to identify paralogs with high identity that were missed in the first search. The
presence of a TIR domain was verified using Pfam http://pfam.sanger.ac.uk/ (Finn et al.,
2007), while presumptive coiled-coil domains were verified using Coils
http://embnet.vital-it.ch/software/COILS_form.html (Lupas et al, 1991). This search
identified six CC-NB-LRR R-genes, nine unusual R-genes containing a Protein Kinase
domain (Pfam: PF00069) as well as a CC domain in the N-terminal region (CC-PK-NB-
LRR) and three TIR-NB-LRRs. Figure 15 depicts the phylogenetic relationship of these
18 R genes with Arabidopsis ADR1-L2, a CC-NB-LRR, and with Arabidopsis RPS4, a
TIR-NB-LRR. Also included in the phylogenetic tree is an unusual Physcomitrella R-like
protein containing both TIR and CC in the N-terminal region but no LRR
(Pp1s32_318V6.1). The human Toll Like Receptor 8 (TLR8) is included as an outgroup.
Figure 15. Phylogenetic relationship of 18 R-protein homologs and one R-protein like protein
(Pp1s32_318V6.1 R2) in Physcomitrella and two Arabidopsis R-proteins. Human TLR8 is included as
outgroup. Pp=Physcomitrella patens, At=Arabidopsis thaliana, Hs=Homo sapiens.
.
Four different kinds of R-genes were chosen for further functional studies by creating
KOs. These were termed R1-4 (bolded in Figure 15): R1 is CC-NB-LRR, R2 is a R-like
31

protein consisting of CC-TIR-NB, R3 is a TIR-NB-LRR and R4 is a member of the novel
protein kinase containing group CC-PK-NB-LRR.
Recently Xue et al. (2012) described the phylogeny of R-genes in Physcomitrella.
Besides 47 shortened NBS-encoding genes, they found, like us, a total of 18 intact R-
genes with N-terminal, NB, and LRR domains all present. Like us, three of these are of
the TIR-NB-LRR kind. But unlike us they found six of the novel protein kinase domain
N-terminal containing kind, and nine of the ‘classic’ CC-NB-LRR kind while we found 9
of the novel class and just six belonging to the CC-NB-LRR class. In addition, they do
not mention if they, like us, found a CC domain in addition to the protein kinase domain
in the novel class. Unfortunately, they did not include full ID numbers on the genes they
find. It is therefore impossible for us to investigate this discrepancy, and also impossible
to say whether the four R-genes we chose to create KOs of are among the R-genes
included in their phylogenetic tree.
Creating targeted KOs
From the bioinformatics searches with the13 Arabidopsis genes of interest in Table 1, 17
homologs in Physcomitrella were chosen for creating targeted KOs using
Physcomitrella’s ability to do homologous recombination at a high rate. This procedure is
achieved by cloning approximately 1 kbp of the genomic flanking regions of a target
gene into each side of a selection marker in a transformation vector. The plasmid DNA is
then transformed into moss protoplasts using a PEG and heat chock based protocol
(Schaefer et al., 1991). In some protoplasts, homologues recombination will occur on
both of the flanking regions resulting in a swap of the target gene with the selection
marker (Figure 16).
Figure 16. Overview of a wild type (WT) locus of a target gene and the ideal KO locus after
homologous recombinant integration of a single selection marker (nptII). The principle primers used
for genotyping are depicted P1-P8. LB – Left Boarder and RB – Right Boarder.
The cloning of the first two target genes (PpMPK4A and PpMPK4B) was done by regular
restriction enzyme digestion and ligation one side at the time. The cloning of PpMPK4B
is described in Materials & Methods, and the cloning of PpMPK4A is described in
manuscript 1. This was very tedious work and therefore a transformation plasmid
containing two USER cloning cassettes was created (Nour-Eldin et al., 2006; Jacobsen et
al., 2011). This enabled four fragment cloning, thereby cloning of both LB and RB onto
the selection marker and the backbone in one step. The remaining KO vectors were
cloned this way. The resulting 16 plasmids are listed in Table 8 with their name and ID#
of the corresponding target gene. One of the 16 plasmids is a knock in (KI) vector with a
GFP tagged version of PpMPK4A. This KI construct was cloned into the pMBLU-GFP
32

vector which was made by PhD student Magnus Rasmussen in our group. KO contructs
for PpMKK1B and PpMKK1C remain to be cloned.
Upon transformation, protoplasts are subjected to two rounds of selection. Colonies
surviving these selection rounds are considered stable transformants and must have a
selection gene integrated in the genome. Although the homologous recombination rate in
Physcomitrella is the highest reported for any multicellular organism (Schaefer and Zrÿd,
1997), in practice targeted KO with the integration of a single selection cassette at the
locus of the target gene only occurs at a low frequency. Random integration or
concatemeric insertions occur at higher frequencies than single gene replacements. Thus,
the surviving colonies are first subjected to a screen for WT KO in which a wild type
PCR band fails to be amplified while a control PCR works. As an example of such a
screen, part of the screen for ΔPpMEKK1A KOs is shown in Figure 17.
Figure 17. Screening of potential ΔPpMEKK1A KOs with the WT primer set (P3-P4, Figure 16) and a
control primer set (P3-P4 for PpMEKK1B). Specific primer sequences can be found in Table 9. The
asterisk marks an example of a false KO since the control PCR also failed to amplify a product.
Next, the KOs found in these screens were propagated on new plates. New DNA was
then extracted and subjected to further genotyping to verify the WT KO and to check for
correct integration at LB and RB. As an example of such the genotyping, PCRs of two
independent KO lines of the R-gene R3 are shown in Figure 18.
Figure 18. Genotyping of two KO lines of the R-gene R3 (ΔR3-1 = KO1 and ΔR3-2 = KO2). The
numbers above each lane refer to the primers depicted in Figure 16.
The production and selection of the 17 KOs were in practice done in two rounds.
Included in the first round of KOs were ATG5, MPK4A, MPK4B, SGT1, RAR1, R1, R2,
R3, R4. The second, ongoing round of KO transformations included CERK1A, CERK1B,
MEKK1A, MEKK1B, MKK1A, MPK4B#2, and ACD11 as well as a repeat of MPK4A
to produce more KO lines. Also a targeted insert, knock in (KI), of a GFP tag on
PpMPK4A is now being transformed and selected.
33

From the first transformation round, no KOs were found of the PpSGT1 and
PpMPK4B despite at least six independent transformation attempts done in parallel when
creating other successful KO lines. This could indicate that the two genes are essential. In
Arabidopsis there are two copies of SGT1, and their double KO is embryo lethal
(Azevedo et al., 2006). Since Physcomitrella only has one SGT1 homolog and is haploid
it is likely that this gene can not be permanently knocked out. In Arabidopsis, some MPK
loss-of-function mutants also exhibit seedling lethality, inappropriate defense activation
and dwarfism (Petersen et al., 2000; Ren et al., 2008; Zhang et al., 2012). Since
Physcomitrella has only eight MPKs compared to the 20 in Arabidopsis, it is possible
that missing one MPK in this more basal set of MPKs could be lethal.
From the other target genes from the first round of transformation, two KOs of
each line that showed correct LB and RB integrations were kept for further experiments.
However, it has previously been shown that between 40 and 85% of targeted gene
replacements loci contain multiple copies of the targeting cassette and on average 11
copies are integrated (Kamisugi et al., 2006). Therefore, to examine if only one copy of
the selection cassette was inserted at the target locus a PCR flanking the whole targeted
gene was conducted. The results from these PCRs are shown in Figure 19.
Figure 19. Whole locus PCR amplification on WT and two KOs from each line using the P1-P6
principle primers depicted in Figure 16. Primer sequences are in Table 9.
The great advantage of genotyping with the whole locus spanning primers is that the
same primer set will amplify a product in both WT and KO but with different lengths in
case of single integration of the selection cassette at the locus. Also, the PCR product
from the KOs can be sent for sequencing to verify correct integration. The disadvantage
is that the PCR products are very long, 4.5 – 9.5 Kbp, and can therefore be hard to
amplify. In addition, if concatemeric integration has occurred the product will be too long
to amplify.
As seen in Figure 19, it was possible to amplify a whole gene product for KO1 of
each line except for R1 for which both KO1 and KO2 could be amplified. These PCR
products were all sequenced and correct insertions were verified. The fact that correct LB
and RB was confirmed in all lines, but whole gene amplification only was possible in
some, could indicate that concatemeric integration had occurred at the loci. If the whole
selection cassette is inserted several times in a “head to tail” manner at the same locus it
should be possible to amplify a PCR product with the P7-P8 primers pointing “outwards”
in the selection cassette while this primer set should not yield any product if only one
selection cassette have been inserted (Kamisugi et al., 2006). This type of PCR was
conducted on all lines and the result is shown in Figure 20.
34

Figure 20. PCR amplification to check for concatemeric selection marker integration on WT and two
KOs from each line using the P7-P8 primer set depicted in Figure 16.
The presence of PCR product with the primer set P7-P8 (Figure 19) corresponds with the
lack of a PCR product with the primer set P1-P6 (Figure 20) except for the ΔPpMPK4A-2
line in which neither primer set produced any product. This could be explained by a
concatemeric integration with only parts of the selection marker, thus lacking a primer
binding site.
From the new and ongoing round of transformations, eight KOs of MEKK1A (Figure 17),
four KOs of MEKK1B, and one new MPK4A KO have been confirmed by lack of WT
band in two independent DNA extractions. But further genotyping is still lacking. A
complete summary of the genotypic evidence for the different transformants is included
in Table 3.
Southern blot
Since a single integration event at a target locus does not rule out ectopic integration
events elsewhere in the genome, Southern blots were made with the selection gene nptII
as probe. This assay has so far only been done on KOs from the first round.
Genotype Restriction enzymes
Pst1 BamH1 EcoRV
ΔATG5 4107+17759 18860 19205
ΔMPK4A 436+9510 11312 5065
ΔRAR1 1397+3545 22k+ 7129
ΔR1 545+10k+ 20k+ 20k+
ΔR2 2151+4959 22k+ 7263
ΔR3 2279+2429 16842 7648
ΔR4 2946+5183 11300 8251
Table 2. Expected band sizes (bp) for the different KO lines when their gDNA is digested with the
indicated restriction enzymes and hybridized to the nptII probe.
Genomic DNA from WT and the different KO lines was digested with the three
restriction enzymes listed in Table 2. The restriction enzyme Pst1 cuts once inside the
nptII selection cassette and gDNA cut with this enzyme should thus yield two bands
when annealed to nptII if only one integration event has occurred. BamH1 and EcoRV do
not cut within the selection cassette and should therefore only yield one band.
35

Figure 21. Southern blot analysis. Detection of nptII integration in genomic DNA of the indicated
genotypes digested with Pst1 which cuts once within nptII and with BamH1 which does not cut in
nptII. Control (C) is 15 ng of nptII cut from pMBLU with the restriction enzymes Sac1 and AsiSI
(1940 bp). The expected sizes in case of a single integration event are shown in Table 2. The numbers
to the left are sizes in kb of selected bands of the ladder, λ-phage cut with Pst1. A picture of the
corresponding ethidium bromide stained DNA gel can be found in material and methods (Figure
53A).
It proved difficult to extract enough clean DNA of the ΔATG5 lines. Perhaps due to its
autophagy deficiency it had a high content of some materials that could not be separated
from the DNA with the phenol/chloroform DNA extraction protocol used. Thus these
bands are a bit weak. A picture of the ethidium bromide stained agarose gel with the
DNA before it was blotted onto the membrane can be seen in Figure 53A in Materials
and Method.
From this first blot the very faint bands of ΔATG5-1 indicate that it could be a
single integration targeted KO, while ΔATG5-2 may have more than one copy of nptII.
Both of the ΔMPK4A lines have unexpected bands and are therefore likely to have more
than one copy. ΔRAR1-1 only has the two expected bands when digested with Pst1 while
there is not really any clear band when digested with BamH1. Nonetheless, ΔRAR1-1 is
most likely a single integration targeted KO.
Since digestions with BamH1 did not produce very clear bands, the experiment
was repeated with EcoRV and the remaining genotypes were included (Figure 22 and
Figure 23)
36

Figure 22. Southern blot analysis. Detection of nptII integration in genomic DNA of the indicated
genotypes digested with Pst1 which cuts once within nptII and with EcoRV which does not cut in
nptII. Control (C) is, to the left 50 ng and to the right 5 ng of pMBLU cut with Sma1 (4254 bp). The
expected sizes in case of a single integration event are shown in Table 2. Numbers to the left are sizes
in kbp of selected bands of the ladder, λ-phage cut with Pst1. (A) and (B) are two different exposures
of the same blot. A picture of the corresponding ethidium bromide stained DNA gel can be found in
material and methods (Figure 53B).
In the blot shown in Figure 22 there is a band in the WT most likely due to run over from
the very dark control band since no bands were detected in the two WT digestions
included in the first blot (Figure 21). The ΔATG5-1 line is still faint, but the expected
bands can just be detected whereas no other bands are detected. ΔATG5-1 is thus
concluded to be a single integration targeted KO. ΔATG5-2 has more than one insertion.
Again, both of the ΔMPK4A lines have unexpected bands and are therefore likely to have
more than one copy. In Figure 22B ΔRAR1-1, is clearly a single integration targeted KO
while ΔRAR1-2 has multiple insertions.
Figure 23. Southern blot analysis. Detection of nptII integration in genomic DNA of the indicated
genotypes digested with Pst1 which cuts once within nptII and with EcoRV which does not cut in
37

nptII. Control (C) is to the left 50 ng and to the right 5 ng of pMBLU cut with Sma1 (4254 bp). The
expected sizes in case of a single integration event are shown in Table 2. Numbers to the left are sizes
in kbp of selected bands of the ladder, λ-phage cut with Pst1. (A) and (B) are two different exposures
of the same blot. A picture of the corresponding ethidium bromide stained DNA gel can be found in
material and methods (Figure 53C)
The DNA gel used to create the blots in Figure 22 and Figure 23 ran a little bit too far ,
and thus DNA fragments below some 600 bp ran out. Also, in Figure 23 the DNA gel did
not seem to have transferred equally onto to the membrane since the bands on the left
side are weaker than expected, including the control DNA which to the right is loaded
with 10 times the amount of control DNA compared to the left side but which shows as
equal intensity on the film. Even so, in Figure 23B very faint bands at the expected sizes
for ΔR1-1 and ΔR1-2 can be detected and thus these are considered single integration
targeted KOs. For the remaining R-genes, ΔR2-1, ΔR3-1 and ΔR4-1 are single integration
targeted KOs, while ΔR2-2, ΔR3-2 and ΔR4-2 contain more than one selection cassette
integrated in the genome. A summary of the Southern blot evidence is included in Table
3.
When a southern blot with the selection cassette as probe shows a single
integration event, it still does not rule out the possibility of random integration of the
vector backbone or the flanking regions. Thus, the best evidence that the observed
phenotype of a transformed moss line is due to integration in the target locus and not
ectopic insertion is that more than one independent transformant shows the same
phenotype. This is because it is very unlikely that a random integration event will occur
at the same locus and thus cause the same molecular phenotype. Thus, at least two
individual transformant were kept for each target locus no matter the Southern blot result.
Flow cytometry
PEG transformation is known to cause protoplast fusion which can result in polyploidy.
In a large mutant screen of PEG transformed protoplasts it was found that up to 17% of
the transformants were polyploid (Schween et al., 2005). Therefore, a screen of ploidy
was conducted. Protoplasts of the different genotypes were stained with the DNA stain
propidium iodine and the DNA content of the protoplasts was compared to WT
protoplasts in a FACS analysis using a flow cytometer. No difference was found between
any of the genotypes examined, and thus they were all concluded to be haploid as the WT.
Only the KOs from first round was subjected to this analysis (see Table 3). KOs from the
second round of transformation still needs to be assessed for ploidy level.
PCR genotyping
Southern
blot FACS
WT LB RB Whole Concatemer SIKO Haploid
Name P3-P4 P1-P2 P5-P6 P1-P6 P7-P8
R1-1 V V V V - V V
R1-2 V V V V - V V
R2-1 V V V V - V V
R2-2 V V V - V M V
R3-1 V V V V - V V
R3-2 V V V - V M V
38

R4-1 V V V V - V V
R4-2 V V V - V M V
RAR1-1 V V V V - V V
RAR1-2 V V V - V M V
ATG5-1 V V V V - V V
ATG5-2 V V V - V M V
MPK4A-1 V V V V - M V
MPK4A-2 V V V - - M V
MPK4A-4 V V
MEKK1A-1
MEKK1A-2
MEKK1A-3
MEKK1A-4
MEKK1B-1
MEKK1B-2
MEKK1B-3
MEKK1B-4
MEKK1B-5
MEKK1B-6
MEKK1B-7
MEKK1B-8
V
V
V
V
V
V
V
V
V
V
V
V
Table 3. Overview of KO transformants and their genotypic evidence. Transformant names in bold
are from the first round of transformation, while the rest is from the new and recently undertaken
round of transformation. Primers in Figure 16 and listed in Table 9 are yellow. “V” in the “PCR
genotyping” columns means PCR product denominated in the top of the column could be amplified.
“-“ means the PCR was performed but did not produce any product. “V” in the Southern blot
means it showed evidence of a Single Integration KO event (SIKO) while “M” means evidence of
multiple integration events. “V” below “FACS” means the line is haploid. Nothing in any box means
that the test has not been done yet.
Pathogen infections
With the KO lines obtained in the first round of transformation (Table 3) I went to
Instituto de Investigaciones Biológicas Clemente Estable (IIBCE) in Montevideo,
Uruguay, where, under the supervision of Dr. Inés Ponce de León, I screened for altered
immune responses of the mutants upon infection with different pathogens. The pathogens
tested in Uruguay are all necrotrophic and known to infect Physcomitrella (Table 4)
(Andersson et al., 2005; Ponce de León et al., 2007; Oliver et al., 2009; Ponce De León et
al., 2012).
Necrotrophic pathogens
Botrytis cinerea
Alternaria brassicicola
Pectobacterium carotovorum subsp. carotovorum SCC3193
Pectobacterium carotovorum subsp. carotovorum SCC1
Pythium irregulare
Table 4. Necrotrophic pathogens tested on Physcomitrella
39

The different KO lines were all infected with these pathogens and screened for altered
disease symptoms. After infection, symptoms were visualized with different stainings and
inspected by microscopy.
Symptoms of a Botrytis cinerea infection
As previously reported, B. cinerea infection causes macroscopic disease symptoms like
browning of the stem and protonemal tissue as well as visible maceration and cell death
of the infected tissue (Ponce de León et al., 2007; Ponce De León et al., 2012) (see also
Figure 26B). Cellular changes occurring during this infection can be examined with
histochemical staining techniques.
In Figure 24A-C the initial steps of a B. cinerea colonization are detected with
Evans blue staining which stains both dead cells and fungal cell walls. Spores with
elongated germ tubes attempt to penetrate the cell wall of the moss which responds by
producing a visible browning at the point of entrance. In Figure 24A the hyphae have
penetrated one cell and continued to grow inside the dead cell. The browning of the cell
wall is suspected to be caused by the accumulation of antimicrobial phenolic compounds.
This suspicion is confirmed by staining with toluidine blue which stains phenolic
compounds (Figure 24D-F). Corresponding to the brown areas of Figure 24A-C, in
Figure 24D-F a clear blue staining is visible.
Two days after B. cinerea infection larger areas of dead cells in leaves can also be
visualized with Evans blue (Figure 24G). The infected areas also respond with cell wall
fortification by callose deposition (Figure 24H, I). Hyphal proliferation inside the
infected cells one day after infection is clearly visible after staining with solophenyl
flavine which stains fungal cell walls (Hoch et al., 2005) (Figure 24J). ROS production
inside infected cells is visualized by staining with H 2 DCFDA which becomes fluorescent
in the presence of reactive oxygen (Eruslanov and Kusmartsev, 2010) (Figure 24K, L).
Note that the B. cinerea spore and hyphae are also stained by H 2 DCFDA and thus also
produce ROS (Figure 24L).
These stainings are very good for a qualitative description of disease symptoms and
defense mechanisms of a pathogen infection. However, it is very difficult to use to
quantitatively compare genotype responses to pathogen attack.
We did all of these histochemical stainings and subsequent microscopy screenings
of the different transformants. However, we did not detect obvious differences between
the transformants and the wild type and therefore these data are omitted.
40

Figure 24. Symptoms of B. cinerea infection of three week old gametophores grown on BCD+AT. (A-
C) Shows germ tube elongation from spores one day post infection, stained with Evans blue. In (A) a
hyphal tip has penetrated the cell wall and hyphae are growing inside the cell. In (B and C) the
hyphal tip is about to penetrate the cell wall and browning is visible at the point of penetration. (D-F)
Phenolic compounds incorporated in the cell walls in contact with hyphae and especially around the
point of hyphal tip penetration. One day post infection stained with toluidine blue. (G) A leaf tip two
days post infection showing dead cells stained with Evans blue. (H, I) Methyl blue staining of leaves
two days post infection. (H) Bright field image of the same cells as (I) showing cell wall fortification
by callose deposition seen as green fluorescent (marked by an arrow). (J) Hyphal growth inside
infected cells one day after infection, stained with solophenyl flavine. (K, L) ROS production in
infected cells one day post infection, stained with H 2 DCFDA. Scale bars (A-F and H-L) 20 µm and (G)
200 µm.
41

Symptoms of P. irregulare infection
Infection with P. irregulare results in callose deposition visualized by staining with
methyl blue as seen in Figure 25B compared to Figure 25A which is also stained with
methyl blue but not infected. Hyphal tissue growing on and inside cells is clearly visible
after staining with the fluorescent dye solophenyl flavine (Figure 25C, E). In Figure 25D,
an oospore inside an infected cell can be seen with solophenyl flavine staining.
As with B. cinerea infection, symptoms upon P. irregulare infection were
assessed for the different genotypes. However, no obvious differences between these and
the wild type were found and these data are omitted.
Figure 25. Symptoms at two days upon P. irregulare infection of three week old wild type
gametophores grown on BCD+AT. (A) Uninfected leaf stained with methyl blue. (B) Callose
deposition and hyphal growth inside leaf two days post infection, methyl blue staining. (C) Hyphal
tissue stained with the fluorescent dye solophenyl flavine. (D) Oospore inside an infected cell stained
with solophenyl flavine. (E) A single infected cell with hyphal growth stained with solophenyl flavine.
Scale bars represent 20 µm.
Evans blue staining
In order to compare the susceptibility of the different genotypes to the pathogens, we
used Evans blue staining of protonemal tissue which can be quantified and thus compared
42

in an objective manner. In Figure 26B it can be seen how two days of B. cinerea infection
causes a visible browning of the colony and maceration of the cells compared to control
treated plants (Figure 26A). The resulting cell death can be visualized by staining with
Evans blue which only stains a few cells in control treated plants Figure 26C-F. This
staining can be quantified and used as a measure of cell death by destaining the colonies
in 50% methanol, 1% SDS and measuring the OD (600nm) of this liquid (Oliver et al.,
2009; Ponce De León et al., 2012). However, as seen in Figure 26F and Figure 24A-C,
Evans blue stains both dead cells and the fungal hyphae and thus the quantification of
Evans blue staining is more likely a mix of cell death and fungal growth. Nonetheless,
when comparing genotypes higher OD values still mean higher susceptibility.
Figure 26. Two week old moss colonies two days after spraying with either H 2 O or 2x10 5 B. cinerea
spores per ml. (A) and (B) are unstained while (C-F) are stained with Evans blue. Bars represent in
(A-D) 0.5 cm and in (E, F) 100 µm.
The quantitative Evans blue staining assay was done upon B. cinerea infection in a
preliminary experiment (Figure 27). This experiment showed that this method could be
used to compare the susceptibility to B. cinerea between different transformants and the
wild type moss.
43

Evans blue staining two days post B. cinerea infection
OD (600nM)/mg DW
0.25
0.2
0.15
0.1
0.05
H2O
Botrytis
0
WT MPK4A-1 MPK4A-2 RAR1-1 RAR1-2
Figure 27. Evans blue staining two days post B. cinerea infection. Error bars represent SEM of four
samples, each of four colonies grown on the same plate.
This experiment led to the discovery that ΔMPK4A lines are more susceptible to B.
cinerea infection compared to wild type. This discovery is described in detail in
manuscript 1. It also indicated that the ΔRAR1 lines are less susceptible to B. cinerea
infection compared to wild type. This observation will be further discussed in the ΔRAR1
section. What could also be observed from this preliminary experiment was that there is
considerable biological variance between the different plates with infected moss, as seen
from the difference between ΔMPK4A-1 and ΔMPK4A-2. This experiment was
performed with just one plate with 16 colonies for each line. These 16 colonies were
thereafter divided into 4x4 colonies and then stained and destained. Thus, each data point
consists of four samples but from 16 colonies that grew on the same plate. In order to
take into account the variation between different plates of the same genotype, we decided
to perform the assay with four plates of 16 colonies for each line.
Alternaria spore counting assay
For some reason the quantification of cell death using Evans blue staining did not work
after A. brassicicola infection despite several attempts. This had also been their
experience in Uruguay (Inés Ponce de León, personal communication). In order to
compare A. brassicicola infections, we therefore decided to adapt a quantitative spore
counting assay that had previously been published for A. brassicicola infections on
Arabidopsis (Wees et al., 2003).
Figure 28. Alternaria brassicicola infection. (A) Leaf of three week old wild type three days post
spraying with 2x10 5 spores/ml. (B) Wild type colony four days post drop inoculation with 5 µl of
44

2x10 5 spores/ml. (C) Spores in hemocytometer. The darker spore is one of the old spores from the
infection and the lighter is a newly formed spore. Bars: (A) 500 µm, (B), 5 mm and (C) 100 µm.
Three days post A. brassicicola infection the fungus starts to produce new spores (Figure
28) which, unlike the B. cinerea spores, can easily be shaken off. The assay is performed
by inoculating with a drop (5 µl) containing ~2500 spores on each colony. Four days post
inoculation the colonies are carefully harvested, placed in a falcon tube and shaken
vigorously in a 0.01% TWEEN20 solution. The detached spores in this liquid are then
counted using a hemocytometer. The newly formed spores are light in color and thus
easily distinguished from the older ones use in the drop inoculation which are dark brown
(Figure 29C).
A preliminary experiment using just one plate of 16 colonies per genotype
showed that this assay could be used to compare the susceptibility to A. brassicicola of
different genotypes (Figure 29).
400
Alternaria spore count 4 days post infection
1000 spores/colony
350
300
250
200
150
100
50
0
WT ATG5‐1 ATG5‐2 MPK4A‐1 MPK4A2 RAR1‐1 RAR1‐2
Figure 29. Alternaria spore count 4 days post drop inoculation with ~2500 spores/colony. This
experiment served as a screen with only one biological replicate per genotype. For this reason no
statistics were applied. The error bars represent SEM of the six counts made per line in this
experiment.
From the preliminary spore counting experiment it seemed that the ΔATG5 lines
supported more fungal growth than the wild type. This result will be further discussed in
the ΔATG5 section. The ΔMPK4A lines also had higher spore counts and thus are more
susceptible to A. brassicicola infection compared to the wild type.
The MAP kinase KO ΔMPK4A
The increased susceptibility of this KO mutant to the necrotrophic fungi B. cinerea and A.
brassicicola seen in the preliminary screens (Figure 27 and Figure 29) was repeated and
is described thoroughly in manuscript 1. This section describes some experiments made
with the ΔMPK4A lines and that are not included in manuscript 1.
P. irregulare infection of ΔMPK4A
The susceptibility of the two independent ΔMPK4A lines upon P. irregulare infection
was assessed with the quantitative Evans blue staining assay (Figure 30). It was not
45

possible to conclude anything due to the high variation. This is probably due to the way
the infection is done: a small peace of PDA plate with the oomycete mycelium is
harvested by pressing a filter tip into the agar and it is then placed on top of each colony.
The infection is done this way to infect the colonies with an equal amount of mycelium.
But it does visually gives rise to variation in the rate at which the individual colonies
become infected and, even with 4 times 16 colonies for each data point, this probably
reflects the high variation in the final graph. This experiment was repeated with similar
results.
Evans blue staining 24 hours post P. irregulare infection
OD (600nm)/mg DW
0.16
0.12
0.08
0.04
Pythium
H2O
0
WT MPK4A-1 MPK4A-2
Figure 30. Evans blue staining 24 hours post P. irregulare infection. The error bars represent SEM of
four individual biological replicates consisting of 16 moss colonies each.
Genes not differentially expressed in the ΔMPK4A-1 line
When screening for genes that are differentially expressed upon chitosan treatment (Fig.
4, manuscript 1) we also found genes that were not differentially expressed in the
ΔMPK4A-1 line compared to the wild type. Some of these are shown in Figure 31.
46

CYP71A13
WRKY70
Relative expression
3
2
1
0
WT
MPK4A-1 KO
0h 15m 30m 1h 2h 4h 8h
Relative expression
7
6
5
4
3
2
1
0
0h 15m 30m 1h 2h 4h 8h
PRX34
WRKY40
Relative expression
8
6
4
2
0
0h 15m 30m 1h 2h 4h 8h
Relative expression
7
6
5
4
3
2
1
0
0h 15m 30m 1h 2h 4h 8h
ERFb3
WRKY53
Relative expression
50
40
30
20
10
0
0h 15m 30m 1h 2h 4h 8h
Relative expression
30
20
10
0
0h 15m 30m 1h 2h 4h 8h
Relative expression
80
60
40
20
0
ERF5
0h 15m 30m 1h 2h 4h 8h
Relative expression
40
30
20
10
0
PAL4-2
0h 15m 30m 1h 2h 4h 8h
Figure 31. Quantitative reverse transcriptase PCR (qPCR) analysis of transcript levels in WT (blue
diamonds) and ΔPpMPK4A-1 (red squares) relative to untreated WT (time 0h) following treatment
with 100 μg/ml chitosan. In cases where there are no error bars, the experiment was based on a single
technical replicate, otherwise error bars represent SEM of three independent technical replicates.
Gene identifiers and primers used are in Table 10.
Since AtWRKY25 and AtWRKY33 have been shown to be regulated downstream of
AtMPK4 (Andreasson et al., 2005) we tried to identify WRKY genes that were
47

differentially regulated after chitosan treatment in the ΔPpMPK4A-1 line compared to
wild type. If a WRKY gene fails to be upregulated in the ΔPpMPK4A-1 background it
implies that it is a downstream target of this signaling cascade. However WRKY genes
are part of a large family of closely related proteins with 37 members in Physcomitrella
and 74 in Arabidopsis (Ülker and Somssich, 2004; Rensing et al., 2008). Thus, a clear
orthologous relationship can not be established and therefore the expression of several
WRKY homologs was assessed. The closest homologs of AtWRKY25 and 33 were not
differentially expressed in a preliminary screen of ΔPpMPK4A-1 and wild type 30 min, 1
h and 2 h after chitosan treatment (data not shown). In Figure 31, PpWRKY40 is clearly
also not differentially expressed, while PpWRKY53 and PpWRKY70 could be
differentially expressed. However, the result should be replicated to be convincing.
Another downstream target of AtMPK4 in Arabidopsis is AtCYP71A13, which
encode a cytochrome P450 monoxygenase required for synthesis of the antimicrobial
phytoalexin camalexin (Petersen et al., 2008). The closest AtCYP71A13 homolog in
Physcomitrella was not regulated by chitosan (Figure 31). But the cytochrome P450
super family has 245 members in Arabidopsis (Schuler et al., 2006) and it is likely that
the homolog we identified is not a functional ortholog.
We looked at the expression of PpPRX34 since this peroxidase was shown to be
involved in defense against pathogenic fungi in Physcomitrella (Lehtonen et al., 2009).
However PpPRX34 did not seem to be regulated by PpMPK4A (Figure 31).
The ethylene response factor (ERF) family in Arabidopsis includes 122 members.
The biological functions of the majority remain unknown, although several ERF genes
are upregulated in Arabidopsis upon chitin treatment (Libault et al., 2007), and the
Aterf5/Aterf6 double mutant showed a significant increase in susceptibility to B. cinerea
(Moffat et al., 2012). Furthermore, AtERF5 interacts with AtMPK3 and AtMPK6 which
are involved in defense against A. brassicicola (Son et al., 2012). PpERF2 was
differentially regulated in the ΔPpMPK4A-1 line compared to wild type after chitosan
treatment (Figure 4, manuscript 1). However, the PpERFb3 and PpERF5 homologs only
seem to be differentially regulated in the very early response (at 15 min for PpERF5 and
from 15 min to 1 h for PpERF3b) (Figure 31).
PAL production is important for the defense against B. cinerea in Arabidopsis
(Ferrari et al., 2003). We found that PpPAL4 was differentially regulated in the
ΔPpMPK4A-1 line compared to wild type after chitosan treatment (Figure 4, manuscript
1). Another PAL4 homolog PpPAL4-2 may be less upregulated in the ΔPpMPK4A-1
background after chitosan treatment, but the result should be repeated to be convincing
(Figure 31).
Gene expression in ΔMPK4A lines upon B. cinerea infection
We wanted to test if changes in gene expression upon treatment with the fungal MAMP
chitosan were also reflected in gene expression upon B. cinerea infection. Thus, we
sprayed moss colonies with a spore suspension of 2x10 6 spores/ml, the same
concentration used for the successful MAPK phosphorylation shown in Figure 5,
manuscript 1, but it is ten times higher than the concentration used in the quantitative
Evans blue staining assay upon B. cinerea infection (Figure 3B, manuscript 1). Even with
this high spore concentration we did not see much induction of the genes assessed until
48

after 4 hours (Figure 32). The reason for this is that sporulation starts after approximately
5 hours, and the changes in moss gene expression are probably not only controlled via a
MAMP induced signaling cascade activated by the chitin receptor. Instead, the changes
in gene regulation are probably caused by the an array of signals from the sporulating
fungi because, upon sporulation, the fungus starts invading the moss cells and it is no
longer a situation of immunity triggered by MAMPs alone. HR is probably also triggered,
cells are killed and DAMP molecules are released, which all are factors that could alter
gene expression in the moss colony.
MPK4B
CHS
Relative expression
10
8
6
4
2
0
0h 15m 30m 1h 2h 4h 8h 16h
Relative expression
100
80
60
40
20
0
WT
MPK4A-1 KO
MPK4A-2 KO
0h 15m 30m 1h 2h 4h 8h 16h
a-DOX
PAL
120
120
Relative expression
80
40
0
0h 15m 30m 1h 2h 4h 8h 16h
Relative expression
90
60
30
0
0h 15m 30m 1h 2h 4h 8h 16h
Figure 32. Quantitative reverse transcriptase PCR (qPCR) analysis of transcript levels in WT (blue
diamonds), ΔPpMPK4A-1 (magenta squares), and ΔPpMPK4A-2 (red triangles) relative to untreated
WT (time 0h) following infection with 2x10 6 B. cinerea spores/ml. Error bars represent SEM of three
independent technical replicates. Gene identifiers and primers used are in Table 10. These qPCR
experiments where carried out by bachelor students Søren Iversen and Mira Wilkans under my
supervision.
ROS production upon chitosan treatment
Production of reactive oxygen species (ROS) is a key feature of an activated immune
system, and MAP kinases have been implicated in the production of ROS (Nakagami et
al., 2006). Indeed, the genes shown to be differentially regulated upon chitosan treatment
described in manuscript 1 are all oxidative stress associated genes. They are either
directly involved in ROS production (NOX) (Miller et al., 2009), or in ROS detoxification
(a-DOX, CHS and PAL) (Ponce de León et al., 2002; Apel and Hirt, 2004), or are known
to be regulated by redox level (LOX7 and ERF2) (Dietz et al., 2010; Ponce De León et al.,
2012). Therefore, we wanted to investigate whether ROS accumulation upon chitosan
treatment was altered in the ΔPpMPK4A lines.
49

The production of ROS was visualized by staining with DAB 24 hours after
treating the wild type and the two ΔPpMPK4A mutants with chitosan (Figure 33). The
wild type colonies stained darker with DAB, indicating that more ROS had accumulated
in these plants than in the KO lines. Some background staining occurred equally in all
lines stained with DAB but treated with control, and also some darkening occurred in all
lines only treated with chitosan and not stained with DAB.
Figure 33. ROS accumulation. DAB staining of wild type and two independent ΔPpMPK4A (KO1 and
KO2) lines 24 hours after treatment with 100 µg/ml chitosan (Chi, in 0.01% Acetic acid, adjusted to
pH 5.5 with NaOH) or control treatment (C, 0.01% Acetic acid, adjusted to pH 5.5 with NaOH). The
experiment was repeated with similar results.
The failure to accumulate ROS upon chitosan treatment in the ΔPpMPK4A lines
implicates this MPK in transducing signals from the MAMP receptor to activate defense
responses. To substantiate this result, we attempted to quantify ROS accumulation in the
lines using a fluorimetric technique with the dye Amplex Red. However, we have not
succeeded with this yet.
50

MPK phosphorylation western blots
Since AtMPK4 has been implicated in regulating some responses to the phytohormones
ethylene (ET) and jasmonic acid (JA) (Brodersen et al., 2006), we tested if treatment with
precursors of these hormones could induce phosphorylation of MPKs in the moss.
Arabidopsis MPKs are also phosphorylated in response to the ethylene precursor 1-
aminocyclopropane-1-carboxylic acid (ACC) (Yoo et al., 2008). And while JA has not
been found in Physcomitrella (Stumpe et al., 2010), Ponce de león et al. (2012) recently
showed that Physcomitrella is capable of responding to methyl jasmonate (MeJA).
Therefore, we tested if this response involved MPK phosphorylation. However, we did
not detect phosphorylation of any moss MPKs in response to these hormone treatments
(Figure 34).
Figure 34. Immunoblot analysis with anti-phospho-p44/42 MAPK antibodies at indicated minutes
after spraying with either 1 mg/ml chitin, 100 µM MeJA and 1 mM 1-aminocyclopropane-1-
carboxylic acid (ACC). Loading controls show amido black stained total protein.
Sporophyte induction
We recently discovered that the ΔPpMPK4A lines appear to be inhibited in their ability to
form sporophytes (Figure 35). On several independent plates of both ΔPpMPK4A lines,
there were almost no sporophytes while the wild type of the same age had sporophytes
formed on top of virtually all gametophores. On a whole plate of both ΔPpMPK4A-1 and
ΔPpMPK4A-2, only one or two sporophytes could be discerned. This is a very
preliminary result and it is currently being repeated with all KO lines included.
51

Figure 35. Sporophyte induction. 10 week old gametophores of wild type and ΔPpMPK4A-1 grown
for four weeks in standard conditions, then transferred to 17°C and short day with low light
conditions to induce sporophyte formation. Scale bars (A, B) 3 mm and (C, D) 1 mm.
Arabidopsis AtMPK4 has been shown to function in both somatic and meiotic cytokinesis
resulting in retarded root tip growth and abnormal pollen formation in the Atmpk4 mutant
(Kosetsu et al., 2010; Zeng et al., 2011). Thus, it is not unlikely that PpMPK4A is
involved in a developmental process like sporophyte formation.
MAMP growth assay
Growing Arabidopsis seedlings on plates supplemented with the MAMPs flg22 or elf18
results in growth retardation which is a useful tool to identify mutants of genes involved
in sensing these two MAMPs. However, the chitin MAMP does not stunt growth in
Arabidopsis and this assay can therefore not be used to identify components in chitin
signaling. Physcomitrella was grown on medium supplemented with 1 mg/ml chitosan
but this also did not produce any visible difference from control plants (data not shown)
ΔRAR-1 and R-gene KOs
Most R-proteins in flowering plants need the RAR1-SGT1-HSP90 chaperone complex to
be correctly folded and maintained in a recognition competent stage in the correct cellular
location. Genetic screens for loss of resistance have shown that RAR1 is required for the
function of multiple and distinct R-proteins in both monocots and dicots (Shirasu, 2009).
Activating the R-proteins results in HR which will induce localized PCD. The
hypersensitive response is an effective defense against biotrophic plant pathogens,
52

estricting access to water and nutrients, but can be exploited by necrotrophic pathogens
such as B. cinerea to generate dead tissue around the infected area and thus facilitating its
growth (Govrin and Levine, 2000). Specifically, B. cinerea has been shown to secrete an
elicitor that induces HR in Arabidopsis (Govrin et al., 2006) and such a secreted toxin has
recently been identified as the cerato-platanin protein BcSpl1 (Frías et al., 2011). Frías et
al. (2011), showed that BcSpl1 is required for full B. cinerea virulence and that the
protein induced cell death with symptoms of HR in Arabidopsis, tobacco and tomato. It
has previously been shown in tobacco (Nicotiana benthamiana) that virus-induced gene
silencing of NbSGT1 and NbEDS1 enhanced plant resistance to B. cinerea (El Oirdi and
Bouarab, 2007). Together these data indicate that B. cinerea is able to hijack the host
immune system by secreting an elicitor that activates the R-protein system to induce HR,
thereby causing cell death which releases nutrients and facilitates necrotrophic growth.
Evans blue staining upon B. cinerea infection of ΔPpRAR1
In the initial screen of quantitative Evans blue staining upon B. cinerea infection, the two
independent ΔRAR1 lines had less staining than the wild type and thus seemed less
susceptible to B. cinerea (Figure 27). This result was very exciting since RAR1 is part of
the co-chaperone RAR1/SGT1/HSP90 that stabilizes R-genes, and SGT1 has been shown
to be required for full B. cinerea virulence (El Oirdi and Bouarab, 2007). Thus, the less
susceptible ΔPpRAR1 lines indicate that Physcomitrella has a functional R-gene system
capable of inducing programmed cell death. To our knowledge, there have been no
descriptions of functional R-genes in any non-vascular plants. Therefore we expended
efforts to replicate this initial result. However, in subsequent assays unexplainable
variation made the results inconclusive (data not shown). Therefore, the role of PpRAR1
in B. cinerea infection remains unknown.
Since B. cinerea apparently manipulates the R-gene system to facilitate its own
growth, we also tested whether the four R-gene KOs had altered susceptibility to the
fungus. But none of the R-gene KOs showed any significant difference in a quantitative
Evans blue staining upon B. cinerea infection (data not shown).
Infections with biotrophic pathogens
No obligate biotrophic pathogen has been described that infects Physcomitrella. This
makes it difficult to investigate the role of PpRAR1 and R-proteins in Physcomitrella
since R-proteins are primarily involved in defense against biotrophic pathogens. We
therefore hoped that either the ΔRAR-1 lines or the four R-gene KOs could render the
moss susceptible to a biotrophic pathogen. However, infection with the biotrophic
pathogens listed in Table 5 did not yield disease symptoms on any of the mutants from
the first round of transformations (data not shown). The infections were performed on
both protonemal tissues and gametophores, both by spraying high concentrations of
bacteria and by placing a small colony of bacteria directly on top of a colony. Prewounding
the moss was also attempted, since this has previously been shown to facilitate
a pathogen infection on moss (Andersson et al., 2005; Ponce de León et al., 2007).
53

Pseudomonas syringae pv. Tomato (Pto) DC3000
Hyaloperonospora parasitica (Hpa) isolate Noco2
Hyaloperonospora parasitica (Hpa) isolate Emwa1
Hyaloperonospora parasitica (Hpa) isolate Cala2
Table 5. Biotrophic pathogens used to challenge Physcomitrella.
Yeast two-hybrid analysis of PpRAR1 and PpSGT1
The functions of the Physcomitrella PpRAR1, PpSGT1 and the R-proteins homologs are
unknown. Since the interaction of RAR1 and SGT1 in flowering plants is required for
their function in stabilizing R-proteins (Shirasu, 2009), a functionally orthologous
relationship would be strengthened if the Physcomitrella PpRAR1 and PpSGT1
homologs interact. We therefore tested if PpRAR1 and PpSGT1 interact using a GAL4
based, yeast two hybrid system (Matchmaker tm from Clonetech).
Full length CDS of PpRAR1 and PpSGT1 were amplified from cDNA with
USER extended primers (Table 9) and cloned into both the binding domain vector
(pGADT7) and the activation domain vector (pGBKT7). Both vectors were modified to
contain a USER cloning cassette (Elizabeth Peanuts, B.Sc. thesis) and correct insertions
of PpRAR1 and PpSGT1 were verified by sequencing. The vectors were transformed in
pairs into yeast. The four vectors were also co-transformed with an empty vector as
counterpart to check for auto-activation. Finally, a vector pair encoding two proteins that
have previously been shown to interact (AtGF6 and AtLAZ1) were included as a positive
control. In total nine different cotransformations were performed (Table 6).
# pGADT7 pGBKT7
1 RAR1 SGT1
2 SGT1 RAR1
3 RAR1 RAR1
4 SGT1 SGT1
5 RAR1 Empty
6 SGT1 Empty
7 Empty RAR1
8 Empty SGT1
9 GF6 LAZ1
Table 6. Vector combinations co-transformed into yeast for two-hybrid analysis
Upon transformation into yeast the presence of the expected vectors was verified by PCR
(data not shown). One to four colonies from each co-transformation that had the expected
vector present were restreaked onto SD-2 medium (double dropout medium lacking Leu
and Trp) (Figure 36). All colonies were able to grow on SD-2 confirming the presence of
both the activating domain and the binding domain vectors. All colonies were then
restreaked onto SD-4 (quadruple dropout medium lacking Leu, Trp, His and Ade). Yeast
colonies containing PpSGT1 in the activating domain vector and PpRAR1 in the binding
domain vector were able to grow on the SD-4 medium indicating interaction between the
two proteins in the yeast (Fig. 33, 2,2 on SD-4). No colonies grew when the two proteins
were co-transformed with themselves as interacting partners (#3 and #4), showing that
the two proteins do not form homodimers in yeast. Also no auto-activation was observed
54

when the vectors were transformed with an empty vector as counterpart. Finally there
was growth in the positive control, although weak (Fig. 33, 9,4 on SD-4).
Figure 36. Yeast two –hybrid analysis of PpRAR1 and PpSGT1. Co-transformed yeast colonies
(Table 6 ) grown for four days on SD-2 and SD-4. This experiment was performed by lab technician
student Ali Fard for his final thesis under my supervision.
Gene expression in ΔRAR1 upon chitosan treatment
When treating the wild type with the fungal MAMP chitosan we found that PpRAR1 and
PpSGT1 expression was induced (Figure 37). We therefore looked at marker gene
expression in the ΔPpRAR1-1 line to see if we could find differentially expressed genes
that could lead us to find a phenotype of the mutant. Despite screening the expression of
most of the genes shown in Figure 31 and Figure 4 of manuscript 1, we did not find any
genes that were significantly differentially expressed in ΔPpRAR1-1 compared to the
wild type. These data are therefore omitted and only an example, the expression of
PpSGT1 in the KO and in wild type, is shown in Figure 37.
RAR1
SGT1
Relative expression
5
4
3
2
1
0
WT
rar1-1
0h 15m 30m 1h 2h 4h 8h
Relative expression
3
2
1
0
WT
rar1-1
0h 15m 30m 1h 2h 4h 8h
Figure 37. Quantitative reverse transcriptase PCR (qPCR) analysis of transcript levels in WT (blue
diamonds) and ΔPpRAR1-1 (purple triangles) relative to untreated WT (time 0h) following treatment
with 100 μg/ml chitosan. In cases where there are no error bars the time point is based on a single
55

technical replicate, otherwise error bars represent SEM of three independent technical replicates.
Gene identifiers and primers used are in Table 10.
MPK phosporylation in ΔRAR1
We also checked if the phosphorylation of MPKs upon MAMP treatment with chitin was
altered in the ΔPpRAR1 lines, but it was not different from the wild type (data not shown)
The autophagy deficient mutant ΔATG5
Autophagy is involved in many cellular processes including nutrient recycling of old and
damaged cellular compartments (Liu and Bassham, 2012). Many autophagy deficient
mutants including Atatg5 in Arabidopsis display early senescence and cell death upon
starvation (Thompson et al., 2005; Liu and Bassham, 2012).
To our knowledge there are no publications on autophagy in Physcomitrella or
any other non-vascular plant. Thus, since there have been no prior description of an
autophagy deficient mutant in Physcomitrella, the first experiments with the ΔATG5 lines
were to carefully describe any detectable phenotype when grown under different
conditions.
Phenotypic description of the ΔATG5 lines
Figure 38. Wild type and ΔATG5-1 grown on BCD+AT medium overlaid with cellophane for 12 days.
Bar corresponds to 1 cm.
The two independent ΔATG5 lines display clear signs of autophagy defects. When grown
on BCD+AT medium overlaid with cellophane they start growing like wild type but after
approximately 8 days the middle and oldest parts of the colony turn yellow and die within
in a few days (Figure 38). In order to get a better description of the ΔATG5 phenotype,
the two KO lines were grown on media containing different nutritional supplements and
also subjected to a week of low light to attempt to induce carbon starvation (Figure 39).
BCD medium is the minimal medium established by Ashton and Cove (1977).
The ΔATG5 lines grow a bit slower than wild type on this medium and after three weeks
the oldest parts of the plant start to die. An additional week of growth in low light kills
the ΔATG5 lines whereas the wild type stop proliferating but otherwise appears
unaffected (Figure 39).
BCD+AT medium is BCD supplemented with 5 mM of ammonium tartrate as a
nitrogen source. This medium makes both the wild type and the KO lines grow faster, but
still the ΔATG5 lines grown a bit slower. After one week of low light the ΔATG5 lines
are dying but the leaf tips and the edge of the colony with protonemal tissue are still
56

green and viable such that it can still be propagated by moving green parts to a new plate.
The wild type was fully viable but had only grown slightly in the low light (Figure 39).
Complete medium is designed to facilitate the growth of metabolic mutants
(Egener et al., 2002). It contains a range of vitamins and nutrient supplements including
peptides but no carbon source. Complete medium clearly altered the growth of both the
wild type and ΔATG5 lines to a dense growth with less gametophore formation, but the
KO lines and the wild type grew at the same rate. After three weeks of growth on this
medium the center of the ΔATG5 colonies started to die and an additional week of low
light killed most of the colony, but not the leaf tips and the edges of the colony, whereas
the wild type was completely viable but did not grow further in low light (Figure 39).
Complete + 5 g/L glucose medium induced a more dense protonemal growth with
less protonemal tissue differentiating into gametophores in both the wild type and the
ΔATG5 lines. Still, some older parts of the KO colonies started to die by three weeks of
growth, but less than in the media without glucose supplement. Also, the added sugar
made the KO lines better at withstanding a week of low light, although most of the older
center parts of the colonies were still dying. Glucose enriched media is known to induce
the formation of caulonemal filaments (Thelander et al., 2005) and it seemed that the
added sugar induced a strong radial growth of what appeared to be caulonemal filaments
in the wild type which was inhibited in the KO lines (Figure 39)
Complete + 50g/L glucose medium completely stops the formation of
gametophores. The colonies grow very slow and very dense, probably due to the osmotic
stress caused by the high sugar content of the medium. But, when grown on this medium,
it is not possible to distinguish the ΔATG5 lines from the wild type after three weeks of
growth under standard light conditions. When grown for an additional week of low light
the wild type had clearly visible radial growth of brown caulonemal filaments. But the
ΔATG5 lines had less radial growth and the tissue appeared greener as if it had a higher
content of chloroplasts and thus resembled chloronemal tissue more than caulonemal
tissue (Figure 39 and close up in Figure 40). Further microscopy analysis is required to
establish if the radial growing filaments are indeed caulonemata in the wild type and
chloronemata in the ΔATG5 lines.
In Arabidopsis it has been shown that autophagy is required for chloroplast
degradation during dark induced senescence (Wada et al., 2009). There are many
examples of autophagy required for cell differentiation during development in both plants
and animals (Liu and Bassham, 2012). As no examples have yet been published in
Physcomitrella, it would be interesting to investigate if autophagy is involved in the
differentiation of chloronemata into caulonemata.
57

Figure 39. Wild type and two independent ΔATG5 lines on the indicated media. Left, growth after
three weeks of standard light conditions (55 µE·m -2·s -1 ), and right the same colonies subjected to an
additional week of low light (3 µE·m -2·s -1 ). The bar in the right bottom corner represents 8 mm. The
experiment was repeated with similar results.
Figure 40. Wild type and ΔATG5-1 grown for three weeks in standard light conditions and an
additional week of low light on full +50 g glucose medium. Bar represent 5 mm.
The main conclusions from this experiment are:
1. There is no phenotypic difference between the two individual ΔATG5 lines, although
ΔATG5-2 had concatemeric insertions of the selection cassette.
2. The ΔATG5 lines are very sensitive to both nitrogen and carbon starvation, as the KOs
showed visible cell death if the medium was not supplemented with additional nutrients,
especially nitrogen and carbon sources. Growth in low light/dark is known to induce
autophagic recycling to save energy/resources. The ΔATG5 lines are apparently not
capable of doing so and thus quickly die in the dark if the medium is not supplemented
with an exogenous carbon source in the form of sugar.
58

Since many Physcomitrella assays are carried out on protonemal tissue rather than
differentiated gametophores, the experiment was repeated by growing the moss on solid
media overlaid with cellophane favoring protonemal growth (Figure 41).
Figure 41. Wild type and two independent ΔATG5 lines on the indicated media overlaid with
cellophane. Left, growth after two weeks of standard light conditions (55 µE·m -2·s -1 ) and right, the
same colonies subjected to an additional week of low light (3 µE·m -2·s -1 ). The bar in the right bottom
corner represents 8 mm. The experiment was repeated with similar results.
The conclusion from this experiment is much the same: the more nutrients the medium is
supplemented with, the less the difference is between growth of the ΔATG5 lines and the
wild type.
In an effort to investigate whether nitrogen or carbon was the most important
factor for ΔATG5 survival, they were also grown on BCD plates supplemented with
different amounts of glucose. But glucose alone could not rescue the KO lines (data not
shown). It was also tested if high continuous light to promote carbon fixation could
rescue the ΔATG5 lines when grown on different media. However, the conclusion from
this experiment was that high continuous light (180 µE·m -2·s -1 ) did not rescue the ΔATG5
phenotype (data not shown). Thus, it seems that a sufficient supply of both nitrogen,
carbon and other nutrients is necessary to keep the autophagy deficient ΔATG5 lines
viable. These results are in accordance with findings in Arabidopsis that AtATG5 is
important not only for survival under nitrogen limiting conditions, but also during carbon
starvation (Thompson et al., 2005).
The ΔATG5 lines are also hypersensitive to drought (data not shown) but surprisingly
they appear to tolerate salt stress very well (Figure 42). When grown on BCD+AT
medium supplemented with either 100 or 200 mM of NaCl, it is difficult to visibly
distinguish the ΔATG5 lines from wild type (Figure 42A). And when spraying 10 day old
59

ΔATG5 lines with 500 mM NaCl, they survive much longer than control colonies sprayed
with H 2 O (Figure 42B). This is surprising since it has been reported that autophagy is
required for tolerance to salt and osmotic stress (Liu et al., 2009). Further experiments
need to clarify if this result is due to the NaCl in itself, or if it is the osmotic stress that
keeps the ΔATG5 lines from dying. This could be achieved by inducing osmotic stress
with osmolytes such as mannitol or sorbitol.
Figure 42. Salt tolerance of the wild type and two independent ΔATG5 lines. (A) Grown for three
weeks on BCD+AT medium with either no NaCl, 100 mM NaCl or 200 mM NaCl supplemented. (B)
Grown for 10 days on BCD+AT medium and then sprayed with either H 2 O or 500 mM NaCl and left
for an additional week. Scale bars represent 5 mm. The experiment was repeated with similar results.
Another phenotypic feature of the ΔATG5 lines is that their rhizoids are much shorter
than the wild type (Figure 43).
Figure 43. Gametophores of wild type and ΔATG5-1 grown on BCD+AT medium for three weeks and
stained with toluidine blue to visualize the rhizoids. There were no phenotypic differences between
the two PpATG5 KO lines (data not shown). The bar is 3 mm.
ATG8 western blot
Tunicamycin is widely used to study autophagy. It induces the unfolded protein response
which activates autophagy and the formation of autophagosomes. In Arabidopsis the
formation of autophagosomes is studied in western blots using an antibody against
AtATG8A. During the formation of autophagosomes, ATG8 is C-terminally cleaved and
lipidated which causes it to travel faster in acrylamide gels during electrophoresis,
thereby causing a detectable band shift in a western blot with ATG8 primary antibody. In
60

order to see if this tool could be used to investigate autophagy in Physcomitrella, we
treated wild type and ΔATG5-1 with tunicamycin and did a western blot with the
Arabidopsis ATG8 antibody (Figure 44A). The treatment was done by transferring one
week old protonema tissue grown on cellophane on BCD+AT plates onto BCD+AT
plates supplemented with 3 µg/ml tunicamycin. This concentration was established in a
preliminary experiment in which it was seen that this concentration killed the ΔATG5
lines but not the wild type, while a concentration of 15 µg/ml tunicamycin also killed the
wild type (data not shown). As seen from the western blot in Figure 44, there is a distinct
difference in the pattern of proteins binding the antibody in the ΔATG5 lines compared to
wild type. However, there does not seem to be induction of any bands or band shifts in
the wild type during the four days it was growing on tunicamycin plates. Thus, either
tunicamycin treatment did not induce autophagy, or the Arabidopsis antibody cannot be
used to detect lipidation of Physcomitrella PpATG8.
There are nine Arabidopsis isoforms of AtATG8 and a BLASTp search with their
sequences detected five homologs in Physcomitrella. The polyclonal antibody used had
been raised against almost full length AtATG8A (AA 1-117 of 122 ) (Yoshimoto et al.,
2004). The sequence identity for these 117 amino acids of AtATG8A versus the
corresponding regions of the five Physcomitrella homologs ranges from 79-82%. With
such high sequence identities, it is likely that the antibody recognizes all or most of the
Physcomitrella PpATG8 homologs. In Arabidopsis the antibody binds to all homologs
except AtATG8H, but it is not known how many and which ATG8 isoforms are actually
lipidated during autophagosome formation. Thus, it is also not known which of the five
ATG8 homologs in Physcomitrella might be bound by the antibody. However, since the
pattern is clearly different in the ΔATG5 lines and there is an accumulation of proteins
binding the antibody, this indicates that the AtATG8A antibody does bind PpATG8. In an
Arabidopsis Atatg5 background AtATG8 accumulates because AtATG5 is required for
AtATG8 degradation (Thompson et al., 2005).
Therefore the reason that no induction of a PpATG8 binding protein is seen in the
tunicamycin treated wild type plants could be that the tunicamycin concentration was too
low or that it does not diffuse freely through the cellophane. The experiment should be
repeated with another autophagy inducing treatment such as growth in the dark on
BCD+AT media plates which has been shown to kill the ΔATG5 lines but not affect the
wild type (Figure 39 and Figure 41) or by treatments with exogenous H 2 O 2 which has
been shown to induce autophagy (Xiong et al., 2007).
61

Figure 44. (A) Immunoblot analysis with anti-AtATG8 antibodies at indicated days post treatment.
KO1=ΔATG5-1 and KO2= ΔATG5-2. (B) Phylogenetic relationships between the nine Arabidopsis
(At), the five Physcomitrella (Pp), and the Saccharomyces cerevisiae (Sc) ATG8 homologs.
Pathogen treatments of the ΔATG5 lines
In Arabidopsis autophagy has been shown to play a role in defense against necrotrophic
fungi (Lai et al., 2011; Lenz et al., 2011). The ΔATG5 lines were therefore also infected
with the pathogens listed in Table 4, and a visual screen showed that they were more
susceptible to all these necrotrophic pathogens compared to wild type. The ΔATG5 lines
showed visible disease symptoms such as browning and cell maceration much earlier
than the wild type (data not shown).
An Alternaria spore count assay showed many more spores being produced in the
ΔATG5 lines compared to wild type (Figure 29). However, it may well be that the
enhanced fungal growth on ΔATG5 is due to indirect effects of autophagy deficiency
rather than a direct involvement of autophagy in combating fungal invasion. In principle,
autophagy deficient cells have accumulated toxic compounds and lack energy and
nutrients due to lack of the autophagic recycling system. It is therefore possible that a
necrotrophic fungus would find better growth conditions in ΔATG5 than in wild type cell.
Evans blue staining upon treatment with cell free culture filtrates of the HrpN secreting P.
carotovorum SCC1 and the HrpN negative strain P. carotovorum SCC3193 showed that
both strains induced more cell death in ΔATG5 than in the wild type Figure 45.
62

O.D. 600 nm/mg DW
0.6
0.4
0.2
Evans blue staining upon P. carotovorum culture
filtrate treatment
H2O
P.c. 3193
P.C. SCC1
0
WT ATG5‐1 ATG5‐2
Figure 45. Evans blue staining of wild type and two independent ΔATG5 lines 24 hours after spraying
with cell free culture filtrates of the HrpN negative strain P. carotovorum 3193, the HrpN producing
strain P. carotovorum SCC1 or H 2 O. Error bars represent SEM of three independent biological
replicates.
Again, it is difficult to say if this increased cell death is due to a direct or indirect effect
of autophagy deficiency. An interesting observation from this experiment is that the
water treated ΔATG5 lines do not have an elevated level of Evans blue staining even
though they have visibly dead cells after two weeks of growth when the experiment was
performed. Apparently Evans blue only stains recently dead cells.
Pathogen infections were also tried on wild type and ΔATG5 lines that had grown on full
+ 50g glucose medium which rescues the phenotype of the ΔATG5 lines (Figure 39). But
the pathogen grew very differently due to the added sugar in the medium and apparently
it also affected the Evans blue staining. Thus, these experiments were inconclusive and
the data omitted.
Infection with a Sordariomycetes fungus
A contamination of an unknown pathogen on a plate with all the KO lines from the first
round of transformation apparently only grew on the ΔATG5 lines (Figure 46). The
unknown pathogen was subsequently propagated on PDA medium and spores were
isolated and reinfections performed several times by both spraying a suspension of
isolated spores and with small parts PDA with the organism growing on it. The same
result was repeatedly found: the ΔATG5 lines became infected and the other lines did
apparently not.
With the help of Henning Knudsen, a small part of the unknown pathogen’s DNA
was sequenced and BLASTed against a fungal DNA database. The best hit was to a
unknown Ascomycetes, the second best hit was to Chaetosphaeria lateriphiala with 1140
bp and 96% identity, and the third best hit was to Ophiocordyceps sinensis with 93%
identity for 650 bp. Both C. lateriphiala and O. sinensis belong to the Sordariomycetes
class which includes more than 600 genera with over 3000 species (Zhang et al., 2006).
Thus, the unknown pathogen is most likely the anamorphic stage of a fungus belonging
to this class, which seems plausible since the class exhibits a wide range of ecologies
including pathogens and endophytes of plants, animal pathogens and mycoparasites
(Zhang et al., 2006).
63

Figure 46. KO lines from the first round of transformations. (A) Grown for three weeks on BCD+AT
and (B) infected by spraying a suspension of spores from the Sordariomycetes class fungus and grown
for an additional two weeks. Note that the two pictures are not of the same plate. The experiment was
repeated with similar result. Bars represent 1 cm.
The growth of the Sordariomycetes fungus on the ΔATG5 lines was not only due to these
lines dying at this stage, since control plants were still green and alive after six weeks
(Figure 47A+B). A closer inspection under the microscope revealed that the
Sordariomycetes fungus actually did infect the wild type (Figure 47C) (and all the other
KO lines from the first round of transformations, data not shown). But apparently the
infection was suppressed so that the fungus did not produce conidia that were clearly
visible on the ΔATG5 lines (Figure 47B, D, E). It would be interesting to investigate
whether autophagy plays an active role in combating this fungal pathogen, or if its
susceptibility is more indirectly due to the accumulation of toxic compounds and lack of
nutrient recycling in the autophagy deficient mutants. One way to assess this could be to
investigate if the pathogen infection activates autophagy in the wild type, thereby
indicating a direct role of autophagy in combating this pathogen intruder.
64

Figure 47. Infection with the Sordariomycetes fungus. (A) Wild type and ΔATG5-1 grown for five
weeks on BCD+AT with no treatment. (B-D) Wild type and ΔATG5-1 grown for three weeks on
BCD+AT and then infected with the Sordariomycetes fungus and grown for an additional two weeks.
(E) Close up of the Sordariomycetes fungus hyphae with conidia. Scale bars: (A+B) 1 cm, (C+D) 0.5
mm and (E) 100 µm.
MPK phosporylation in ΔATG5 lines
We also checked if the phosphorylation of MPKs upon MAMP treatment with chitin was
altered in the ΔATG5 lines, but it was not distinguishable from the wild type (data not
shown). This finding is in accordance with the findings that Arabidopsis Atatg5 shows
normal MPK phosphorylation when treated with the bacterial MAMP flg22 (Lenz et al.,
2011).
The AtMEKK1 homologs ΔPpMEKK1A and ΔPpMEKK1B
When treating moss colonies with the fungal MAMP chitin and subsequently performing
a western blot with antibody against the phosphorylated TxY motif of MPKs, we have
found that two MPKs are phosphorylated upon chitin treatment. One of them is
PpMPK4A, as seen from a lacking band in the ΔPpMPK4A lines, and the other is most
probably PpMPK4B judged from the size (see Figure 5, manuscript 1). This observation
can be used to identify upstream components involved in the signaling cascade from the
perception of chitin to the activation of defense mechanisms. In Arabidopsis, AtMEKK1
is required for the activation of AtMPK4 after treatment with the bacterial MAMP flg22
(Suarez-Rodriguez et al., 2007). It is not known if AtMEKK1 functions upstream of
AtMPK4 signaling after chitin treatment in Arabidopsis, but since treating Arabidopsis
with chitin induces the same AtMPK phosphorylation pattern as treating with flg22 or
65

elf18 (Wan et al., 2004; Petutschnig et al., 2010; Roux et al., 2011; Bethke et al., 2012;
Eschen-Lippold et al., 2012) it is thought that MEKK1 is also the upstream MP3K in
chitin induced MPK signaling. We identified two putative Physcomitrella orthologs of
Arabidopsis AtMEKK1, PpMEKK1A and PpMEKK1B (Figure 8). In order to test if
these are the MP3K in the MAP kinase signaling cascade that phosphorylates PpMPK4A
and probably PpMPK4B upon chitin treatment, we performed a western blot with the
antibody against phosphorylated MPKs in the ΔPpMEKK1B and ΔPpMEKK1A lines
(Figure 48).
Figure 48 Immunoblot analysis with anti-phospho-p44/42 MAPK antibodies three minutes after
spraying with 1 mg/ml chitin. The numbers below each of the two KO lines denote the number of the
transformant. Thus all four ΔMEKK1A lines we identified are included in this blot while ΔMEKK1B-
3,7,8 have yet to be tested. Loading controls show amido black stained total protein.
As seen in the western blot, two bands are visible in all lines tested. Although some of the
lines (ΔPpMEKK1B-6 and ΔPpMEKK1A-3 and 4) appear to have a weaker band, all
lines still have two visible bands presumably corresponding to phosphorylated
PpMPK4A and B. That said, it may also be that the two MAP3Ks are partially redundant
such that their single knockouts will not fully abolish MPK phosphorylation in response
to chitin treatment, or that neither PpMEKK1A nor PpMEKK1B are the upstream MP3K
in the signaling cascade leading to the phosphorylation of the two MPKs in the western
blot (or at least not any of the two PpMEKK1 homologs alone). There are several
examples of redundancy in MPK signaling cascades (Rasmussen et al., 2012). Creating a
double KO of the two PpMEKK1 homologs could be used in a similar assay to asses this
question.
66

Discussion
This discussion highlights current and potential, future work on Physcomitrella.
Despite the striking similarities between plant and animal innate immune systems, they
are probably a consequence of convergent evolution since multicellularity evolved
independently in plants and animals (Meyerowitz, 2002). The use of many of the same
building blocks and similarities in the overall design probably reflect inherent constraints
on how an innate immune system can be constructed (Ausubel, 2005). A better
understanding of the evolution of plant innate immunity will help elucidate the origin of
its different components. Physcomitrella has proven to be a good model for this due to its
evolutionary position and ability to be genetically manipulated.
MPKs in Physcomitrella
The work presented in this thesis provides comprehensive evidence that the MAMP
triggered immune system, with activation of a MPK signaling cascade(s) upon MAMP
recognition, is conserved between mosses and flowering plants. In manuscript 1 it is
described how at least one Physcomitrella MPK (PpMPK4A) is required for proper
innate immune responses. This is a primary example of a single, non-redundant plant
MPK essential for immunity without any other apparent phenotypes associated with the
corresponding null-mutant. This finding is important because researchers continue to
debate the immunity-related functions of numerous MPKs in vascular plants. For
example, the contribution of single MPK in immune responses of the higher plant
Arabidopsis is unclear due to pleiotropic effects of specific knockout mutants including
seedling lethality, inappropriate defense activation and dwarfism.
ROS
My findings (Figure 33) show that ΔPpMPK4A does not accumulate as much ROS as the
WT after chitosan treatment. This is interesting since the MPK cascade AtMEKK1,
AtMKK1/AtMKK2 and AtMPK4 has been reported to negatively regulate ROS
production (Petersen et al., 2000; Nakagami et al., 2006; Gao et al., 2008). Although, it
was recently discovered that the constitutive production of ROS in the mutants of this
Arabidopsis MPK cascade is due to the activation of ETI through the AtSUMM2 R-
protein, the Atmpk4/Atsumm2 double mutant still havs constitutive ROS production
(Zhang et al., 2012). Thus, caution is needed in interpreting the function of AtMPK4 from
results obtained with the Atmpk4/Atsumm2 double mutant. In Physcomitrella the lack of
constitutive ROS production in the ΔPpMPK4A shows that there is no auto-activation of
defense responses in this mutant (Figure 33). Thus, the results obtained with this KO
probably reflect the direct effect of the missing the MPK. That ΔPpMPK4A does not
accumulate as much ROS as WT after chitosan treatment points to PpMPK4A as a
positive regulator of defense. Thus, the signaling cascade from the PRR is interrupted in
the ΔPpMPK4A mutant and no defense responses are initiated.
67

As in Arabidopsis, we found that the same MPKs are activated by the application
of exogenous H 2 O 2 as by MAMP treatment (Gao et al., 2008, Figure 5E manuscript 1).
How H 2 O 2 activates MPKs is not known (Gao et al., 2008). It is possible that the ROS
burst that occurs seconds after MAMP binding to its cognate PRR is part of the link
between PRR and MPK cascade activation. Physcomitrella should be a good model to
study this since the ROS burst has been shown to occur within seconds after chitosan
treatment (Lehtonen et al., 2012). Measurements of the ROS burst can be used to identify
a Physcomitrella chitin receptor (PpCERK), since a ΔPpCERK knockout should not be
able to induce ROS burst after chitosan treatment (Segonzac et al., 2011). In this
connection, it seems likely that the ΔPpMPK4A mutant is fully capable of producing the
early ROS burst although it is inhibited in ROS accumulation as a result of defense
responses downstream of PpMPK4A. The DAB staining shown in Figure 33 was
performed 24 hours after chitosan treatment, and thus reflects long term ROS
accumulation rather than the early ROS burst.
Abiotic stress
The lack of phosphorylated MPKs in Physcomitrella after abiotic stress is very surprising
and should be further tested. MPK activation in abiotic stresses like osmotic stress have
been reported to be ubiquitous amongst eukaryotes (Kültz, 2001). A strong argument for
the conservation of this function is that a MAP kinase from pea Pisum sativum could
rescue a knock out of the yeast MPK ScHOG1 involved in the osmoregulatory pathway
(Pöpping et al., 1996). Similarly, the mammalian MPK HsSAPK2a rescues ScHOG1-
deficient yeast in hyper osmotic medium and restores the osmotolerance of mutant yeast
to that of the wild-type (Han et al., 1994). However, to our knowledge there are no
reports of MPK activation under any abiotic stresses in non-flowering plants (Sinha et al.,
2011). Therefore, it could be interesting to test MPK activation under abiotic stress in
other mosses and in the spike moss Selaginella moellendorffii, a nonseed vascular plant
that is considered an extant evolutionary intermediate between bryophytes and flowering
plants (Banks et al., 2011). This would help elucidate if MPK involvement in abiotic
stress adaptation has been lost in Physcomitrella or has evolved later in plant evolution. If
it evolved later, it would be a fascinating example of convergent evolution, although not
unique since MPK signaling in biotic stress also seems to have evolved independently in
the plant and animal lineages (Ausubel, 2005).
Sporophyte formation
We have recently observed that the ΔPpMPK4A mutant might be inhibited in sporophyte
formation (Figure 35). We are currently repeating this experiment and if the ΔPpMPK4A
mutants keep producing far fewer sporophytes than the WT it will be interesting to study
if the sporophytes that do form contain stomata and if they are fully functional. In
Arabidopsis the MPK cascade consisting of the MP3K YODA, AtMKK4/AtMKK5 and
AtMPK3/AtMPK6 has been shown to regulate stomatal development (Wang et al., 2007).
AtMPK3 and AtMPK6 share high similarity to PpMPK4A as seen in Figure 14, and
AtMPK4 is strongly expressed in stomata (Petersen et al., 2000; Rodriguez et al., 2010).
68

PpMPK4B
Despite several transformation attempts with two different KO constructs we have not yet
obtained a KO of PpMPK4B. Our failure to obtain a PpMPK4B KO may well be because
PpMPK4B is essential. In principle, such potential loss-of-function lethality may be
circumvented using inducible gene silencing systems used in Physcomitrella (Bezanilla et
al., 2005; Nakaoka et al., 2012). However, there is a more powerful way to do this for
most protein kinases using an approach that has been pioneered in plants in our lab with
AtMPK4 (Brodersen et al., 2006). In this approach, conditional loss-of-function alleles
are made according to a chemical–genetic system for protein kinases (Bishop et al., 2000).
In this system, a point mutation is introduced that enlarges the kinase ATP-binding
pocket to allow it to accommodate bulky ATP analogs such as N6-(benzyl)–ATP. Pocket
enlargement has three consequences. 1 st , it does not impair the ability of the kinase to
phosphorylate its substrates with endogenous ATP. In Physcomitrella then, a mutant
pocket kinase allele can be ‘knocked in’ to replace the wild type allele without loss-offunction.
2 nd , pocket enlargement sensitizes the kinase to inhibition by derivatives, such
as C3–1’-naphtyl (NaPP1), of the Src tyrosine kinase family inhibitor PP1. Due to the
simple morphology of Physcomitrella and its poikilohydric physiology these cellpermeable
molecules should easily penetrate all moss cells at any stage of development.
Since NaPP1 is not an efficient inhibitor of wild type kinases, treatments with it
specifically inhibit the enlarged pocket kinase. Transcript profiling over a time course of
inhibitor treatment can therefore identify target genes regulated by the specific kinase
pathway. 3rd, [γ-32P]-N6-(benzyl)–ATP can be used to specifically label the substrates
of the enlarged pocket kinase. Proteomics (2-D gel autoradiography and peptide
identification by mass spectrometry) can then be used to identify the specific substrates
of the enlarged pocket kinase (Specht and Shokat, 2002).
This inducible loss of function technique should be deployed to assess if PpMPK4B is
involved in defense, like its closest homolog PpMPK4A. This technique could also be
used if any of future targeted PpMPKK or PpMP3K can not be knocked out using
targeted gene replacement.
As shown for Arabidopsis kinases, functional fusions of green fluorescent protein (GFP)
to the kinase can also be used to follow its spatial and temporal patterns of expression
(Petersen et al., 2000; Anthony et al., 2004; Robatzek et al., 2006). The great advantage
of using this technique in Physcomitrella is that the GFP-tag can be added to the native
protein under its own promoter at its native gene locus using the knock in technique.
Potential pleiotropic effects of over expression or ectopic integration can thereby be
avoided.
We are currently selecting a knock in transformation of PpMPK4A:GFP.
However, when we identify upstream MPKK and MP3K components in the signaling
cascade of PpMPK4B, these should also be transformed with a GFP tag.
69

PpRAR1 and R-proteins
Although we initially saw that the ΔPpRAR1 mutants were less susceptible to B. cinerea
(Figure 27), we consistently saw very high variation in the Evans blue staining for cell
death in repeated experiments. In addition, Evans blue staining after B. cinerea infection
of the four R-protein KOs was not different than WT. Thus we have not yet shown a
phenotype of the ΔPpRAR1 and R-protein mutants.
Nonetheless, there are several approaches to establish if Physcomitrella has a functional
R-protein system. 1 st , we could use the already created ΔPpRAR1 and R-protein mutants
to screen for susceptibility to biotrophic pathogens. Wild type moss is resistant to those
biotrophic pathogens that have been tested and that are recognized by R-gene systems in
higher plants. Thus, there is a chance that the ΔPpRAR1 and R-protein mutants do not
recognize specific biotrophic pathogens such that these mutants will be more susceptible
to them. We have only tested a few biotrophic pathogens and did not find any that were
able to grow on any of the mutants. The problem with identifying a biotrophic pathogen
is that they often are host specific and are often difficult to cultivate since they require a
living host if they are obligate biotrophs).
2 nd , some R-proteins are auto-activated when over expressed in plant cells
(Bendahmane et al., 2002; DeYoung and Innes, 2006). Since constitutive over expression
of auto-activated R-proteins could be lethal, they could be stably transformed under a
DEX inducible promoter. However, instead of over expressing native R-protein, there are
several examples of so called gain of function mutations resulting in auto-activating R-
proteins (DeYoung and Innes, 2006). Such a gain of function mutation could be
introduced to one of the R-proteins already knocked out and re-transformed into its
cognate KO moss line under an inducible promoter. If the induced expression of the autoactivated
R-protein results in HR, it would indicate a functional ETI.
A Physcomitrella auto-activated R-protein could also be transiently expressed in
tobacco via Agrobacterium infiltration. If the Physcomitrella R-protein causes HR in
tobacco it would be a good indicator of conserved functions of ETI. There are several
examples of such auto-activating R-proteins from Arabidopsis, potato and tomato that
induce HR in tobacco when transiently expressed after Agrobacterium infiltration
(Bendahmane et al., 2002; Tameling et al., 2006; Gabriëls et al., 2007; Swiderski et al.,
2009).
Another approach could be to transiently over express auto-activating GFP tagged
R-genes in moss delivered on gold particles using a gene gun (Šmídková et al., 2010).
This could be done in WT and ΔPpRAR1 mutants to see if the R-protein required
PpRAR1 to function. We have successfully tested transient expression of 35S:GFP in
Physcomitrella transformed using a gene gun.
3 rd One could transform a functional R-protein from another species into
Physcomitrella. For example, one could introduce the tomato CC-NB-LRR SlNCR1 that
does not require EDS1 or NDR1 (which are not present in Physcomitrella) (Gabriëls et
al., 2007). In the Physcomitrella lines expressing SlNCR1 one could then transiently
express an effector recognized by SlNCR1, for example Avr4 from Cladosporium fulvum.
If the expression of Avr4 causes HR in Physcomitrella, it would indicate a functional ETI.
70

Autophagy
Although the finding that the ΔPpATG5 mutant is more susceptible to the necrotroph A.
brassicicola (Figure 29) is concordant with similar findings in Arabidopsis (Lai et al.,
2011; Lenz et al., 2011), the fragility of these mutants makes it likely that the enhanced
fungal growth is caused by pleiotropic effects of autophagy deficiency rather than the
direct involvement of autophagy in the immune system.
One way to study autophagy in Physcomitrella during pathogen infection could
be to create a line expressing a PpATG8:GFP fusion protein. AtATG8:GFP fusions have
been very useful in studying the formation of autophagosomes in Arabidopsis
(Yoshimoto et al., 2004; Thompson et al., 2005; Xie and Klionsky, 2007; Slavikova et al.,
2008). Such a construct could for example be used to characterize whether autophagy is
involved in defense against the Sordariomycetes fungus by showing if autophagosomes
are formed in the wild type moss.
A PpATG8:GFP expressing line would also be useful in determining if autophagy
is involved in the differentiation of chloronemata to caulonemata, as our findings in
Figure 38 and Figure 39 indicates. It would also be a useful tool in trying to understand
the apparent salt stress tolerance of the ΔPpATG5 lines (Figure 42) by showing if salt
stress induces autophagy in the wild type.
Figure 43 show that ΔPpATG5 lines have shorter rhizoids than wild type. In Arabidopsis,
autophagy has been shown to be constitutively active in root cells, and several autophagy
mutants exhibitaltered root architecture and root hair formation (Yoshimoto et al., 2004;
Yano et al., 2007; Slavikova et al., 2008). Although roots develop on the sporophytes in
vascular plants and rhizoids develop on the gametophyte of bryophytes, there could be a
connection. A recent study shows that a similar regulatory network controls the
development of rhizoids in moss gametophytes and root hairs on the roots of vascular
plant sporophytes (Jones and Dolan, 2012).
71

Materials and methods
Identifying Arabidopsis homologs/orthologs in Physcomitrella
Arabidopsis protein and cDNA sequences were obtained from www.Arabidopsis.org
from version TAIR10 containing 27,416 protein coding genes. Physcomitrella protein,
genomic and cDNA sequences were obtained from www.cosmoss.org, mostly from
version 1.6 but some homologs with higher identity to Arabidopsis were chosen from
older versions.
Homologs were identified by BLASTp searches, with Arabidopsis protein
sequences as queries against all annotated gene models in Physcomitrella
www.cosmoss.org using the BLOSUM62 matrix. Putative orthologs were identified by
means of the reciprocal best hit method (Moreno-Hagelsieb and Latimer, 2008).
When no such orthologous relationship could be established, a phylogenetic tree
was constructed such that all the protein sequences were aligned using ClustalW2 at
http://www.ebi.ac.uk/Tools/msa/clustalw2/ with default settings (Larkin et al., 2007). In
an effort to narrow down the candidates, most phylogenetic trees were constructed using
both full length protein sequences, truncated versions with sequences of conserved core
domains, as well as cDNA sequences. The phylogeny of the aligned sequences was
calculated using the neighbor joining method with default settings in ClustalW2. With
such alignment information, a phylogenetic tree was then drawn using TreeView V1.6.6.
Scale bars in the phylogenetic trees represent 0.1 amino acid substitutions per site.
Moss growth conditions
Standard conditions: 22ºC, 16 hours light and 8 hours dark with 55 µE·m -2·s -1 on
BCD+AT media. Lines were routinely propagated by setting small pieces of protonema
on a new plate every week to maintain fresh tissue. For most assays, 16 small pieces of
protonema were placed on a BCD+AT plate overlaid with cellophane and grown for 14
days under standard conditions (Figure 49).
Figure 49. Different Physcomitrella lines grown on BCD+AT plates overlaid with cellophane for 14
days.
Sporophyte induction: 17°C (optimal condition would be 15°C; Hohe et al., 2002) in 8
hours light and 16 hours dark, and app. 20 µE·m -2·s -1 on BCD+AT media supplemented
with 200 mg/l (v/w) D-Glucose.
72

Media
BCD: MgSO 4 . 7H 2 O 250 mg/l, KH 2 PO 4 250 mg/l, KNO 3 1010 mg/l, FeSO 4 . 7H 2 O 12.5
mg/l, CaCl 2 . H 2 O 147 mg/l, trace elements*, pH 6.5 adjusted with KOH, agar 8g/l. After
autoclaving app. 30 ml poured in sterile Petri dishes (90 mm) and left to solidify. The
plates were stored cold until use.
*Trace elements: Made as a 1000x stock and kept at 4°C. Working solution in all
medias are: 614 µg/l H 3 BO 3 , 389 µg MnCl 2·4H 2 O, 110 µg/l AlK(SO 4 ) 2·12H 2 O, 55 µg/l
CoCl 2·6H 2 O, 55 µg/l CuSO 4·5H 2 O, 55 µg/l ZnSO 4·7H 2 O, 28 µg/l KBr, 28 µg/l KI, 28
µg/l LiCl, 28 µg/l SnCl 2·2H 2 O, 25 µg/l Na 2 MoO 4·2H 2 O, 59 µg/µl NiCl 2·6H 2 O
BCD+AT: As BCD but with ammonium tartrate 920 mg/l added before autoclaving.
PRMT: MgSO 4 . 7H 2 O 250 mg/l, KH 2 PO 4 250 mg/l, KNO 3 1010 mg/l, ammonium tartrate
920 mg/l, FeSO 4 . 7H 2 O 12.5 mg/l, CaCl 2 . H 2 O 1470 mg/l, D-mannitol 80 mg/l, trace
elements, pH 6.5, agar 6g/l was autoclaved.
PRMB: MgSO 4 . 7H 2 O 250 mg/l, KH 2 PO 4 250 mg/l, KNO 3 1010 mg/l, ammonium
tartrate 920 mg/l, FeSO 4 . 7H 2 O 12.5 mg/l, CaCl 2 . H 2 O 1470 mg/l, D-mannitol 60mg/l,
trace elements, pH 6.5, agar 10g/l. Autoclaved and poured in sterile Petri dishes and left
to solidify. The plates were stored cold until use.
+G418:, 40 mg/l G418 (Sigma) was added to the liquid media when it had cooled below
70°C after the autoclaving when the media was used for selection.
Full: The supplements are as described in Egener et al., (2002): MgSO 4 . 7H 2 O 250 mg/l,
KH 2 PO 4 250 mg/l, KNO 3 1010 mg/l, ammonium tartrate 920 mg/l, FeSO 4 . 7H 2 O 12.5
mg/l, CaCl 2 . H 2 O 1470 mg/l. Supplemented with: Myo-inositol 4 mg/l, Choline chloride
2.8 mg/l, Nicotine acid 2.8 mg/l, Thiamine-HCl 500 µg/l, Pyridoxine 250 µg/l, Biotin 10
µg/l, P-aminobenzoic acid 250 µg/l, Ca-D-pantothenate 1.9 mg/l, Riboflavine 15 µg/l,
Adenine 6.76 mg/l, Na-palmetinic acid 3.84 mg/l and Peptone 250 mg/l
+ 5g sug: As BCD+AT with 5 g/l D-Glucose
+ 50g sug: As BCD+AT with 50 g/l D-Glucose
Sporophyte induction media: As BCD+AT with 200 mg/l D-Glucose added (Hohe et
al., 2002)
Cloning of PpMPK4B
The Physcomitrella transformation vector pMBL10a was kindly provided by Dr. Andrew
Cuming. Flanking regions of the Pp1s59_325V6.1 gene were PCR amplified and the
resulting fragments cloned into pCR®-Blunt II-TOPO® (Invitrogen) and transformed
into competent E. coli cells. The primers used to amplify the LB and RB are listed in
Table 9. The LB fragment was cut from the TOPO vector using the restriction enzymes
73

Not1 (Fermentas) and BamH1 (Fermentas), and the resulting 621 bp fragment was
ligated using T4 fast ligase (Promega) into pMBL10a which was also cut with Not1 and
BamH1. This plasmid was transformed into competent E. coli cells. The plasmid was
extracted and correct insertion of the LB verified. Subsequently, the RB fragment was
cloned into pMBL10a containing the LB. The RB fragment was cut from TOPO vector
using the restriction enzymes Sph1 (Fermentas) and EcoRV (Fermentas) and the resulting
580 bp fragment was ligated into pMBL10a containing the first LB fragment also
digested with Sph1 and EcoRV. This plasmid was transformed into competent E. coli
cells. The plasmid was extracted and correct insertion of the LB and RB verified by
sequencing with the primers listed in Table 7. The resulting vector was termed
pMBL10a_MPK4B.
Constructing a USER compatible moss KO vector
The moss transformation vector pMBL6 was modified for USER cloning (Nour-Eldin
et al., 2010) by adding a USER cassette on both sides of the selection gene. Thus, at the
left side of the nptII gene a USER cassette containing a Pac1 restriction site and two
Nt.BbvCI (NEB) nicking sites was inserted in pMBL6 cut with Sac1 and Kpn1.
Subsequently, at the right side of the NptII selection cassette a USER cassette containing
an AsiSi restriction site and two Nt.BbvCI nicking sites was inserted by cutting the vector
with Sal1 and EcoR1 restriction enzymes.
Left side User cassette:
5’-CGCTGAGGCTTAATTAAGGATCCTTAATTAAACCTCAGCGGTAC-3’
3’-TCGAGCGACTCCGAATTAATTCCTAGGAATTAATTTGGAGTCGC-5’
Right side User cassette:
5’-TCGACGCTGAGGCGCGATCGCGGATCCGCGATCGCACCTCAGCG-3’
3’GCGACTCCGCGCTAGCGCCTAGGCGCTAGCGTGGAGTCGCTTAA-5’
The resulting vector was termed pMBLU and is depicted in Figure 50.
74

Figure 50. A graphic representation of pMBLU with the two USER cassettes.
Preparation of pMBLU
For four fragment cloning, 50 µg of pMBLU was digested with 10 µl Pac1 (NEB) and 10
µl AsiSI (Invitrogen) in buffer 1xTango (Invitrogen) over night at 37°C. Then, 5 µl of
Pac1 (NEB) and 5µl AsiSI (Invitrogen) were added along with 10 µl Nt.BbvCI (NEB) for
an additional two hours of digestion at 37°C. (If only LB or RB is to be inserted in a
regular two fragment cloning, either Pac1 or AsiSI are omitted). The digested plasmid
was cleaned using a kit (High Pure PCR Product Purification Kit, Roche) according to
the manufacturer's specifications and diluted in H 2 O to100 ng/µl.
USER cloning
1 µl digested pMBLU (100 ng) was mixed with 5 µl of LB PCR product, 5 µl of RB PCR
product (both between 10-40 ng/µl), and 1 µl of USER enzyme mix (NEB). The mix was
then incubated for 20 min at 37°C and 20 min at 25°C. The mix was added to competent
E. coli cells and transformed by heat chock (42°C for 50 sec), and then plated on LB
plates containing ampicillin. Plasmid DNA was extracted from a selection of surviving
colonies and digested with appropriate restriction enzymes to screen for correctly
transformed plasmids. Correct insertions of LB and RB were verified by sequencing the
plasmid DNA (see Table 7 for primers used).
75

Sequencing inserts in pMBLU-GFP and pMBLU-mCherry
sb410 GGTTATTGTCTCATGAGCGGA LB forward
GFP CTCCTCGCCCTTGCTCACCAT LB reverse
sb024 GGTATCAGAGCCATGAATAGGTC RB forward
sb417 GACCATGATTACGCCAAGCTA RB reverse
Sequencing inserts in pMBLU
sb410 GGTTATTGTCTCATGAGCGGA LB forward
sb027 GGCAATGGAATCCGAGGAGGT LB reverse
sb024 GGTATCAGAGCCATGAATAGGTC RB forward
sb059 TGTGAGCGGATAACAATTTCAC RB reverse
Table 7. Primers used to sequence insertion in pMBLU, pMBLU-GFP and pMBLU-mCherry. The
table contains: Primer name, sequence and description
Protoplast isolation
This protocol is modified from (Schaefer et al., 1991). One week old protonemal moss
tissue grown on BCD+AT media over laid with cellophane was harvested (Figure 51) and
digested in 10 ml 8% (v/w) D-mannitol with 0.5% (w/v) Driselase (Sigma), for 30 min
with slow agitation on a rocking table. The mixture was filtered through a mesh with 100
μm × 100 μm pores. The protoplasts were sedimented by a 150 g, 3 minute centrifugation
with low breaks (Standard centrifugation in this protocol), and the supernatant removed.
The pellet was washed twice by resupending in 8% (v/w) D-mannitol and sedimented by
centrifugation. The final pellet was resuspended in 10 ml CaPW (D-mannitol 80 g/l,
CaCl 2 (2H 2 O) 7.35 g/l, distilled water), and protoplast concentration assessed using a
hemocytometer (Figure 52).
Figure 51. Harvesting of one week old protonemal tissue grown on BCD+AT plate overlaid with
cellophane.
76

Figure 52. Protoplasts in a hemocytometer. One square is 250 µm X 250 µm.
Transformation
5x10 5 protoplasts were resuspended in 300 µl freshly made MMM solution (Filter
sterilized mixture of D-mannitol 920mg, 150 µl MgCl 2 1M, 1 ml MES 1% (v/w) pH 5.6
and distilled water 8.85ml) then 30 µl (1 µg/µl) linearized plasmid was added (See Table
8 for restriction enzymes used to digest the different KO vectors). 300 µl freshly made
PEGT solution (PEG 2 g (4000 MW, Sigma), 4.5 ml 8% (v/w) D-mannitol, 500 µl 1 M
Ca(NO 3 ) 2 ) was added, and 5 minutes later the tube was heat shocked in a 45ºC water
bath for 5 minutes. Samples were left at room temperature for 10 minutes, then 600 µl
CaPW was gently mixed into the solution followed after 5 minutes by another 1 ml, 2ml,
3ml, and 4ml added each after an additional 5 minutes. Protoplasts were then centrifuged,
the supernatant removed, and the pellet resuspended in 1 ml sterile filtered 8% (v/w) D-
mannitol. 7 ml molten PRMT (45°C) was added and the mixture was spread on four
PRMB plates with cellophane, 2 ml per Petri dish. The protoplasts were left to recover
for one week under standard conditions. Then, they were transferred onto PRMB with
G418 (Sigma) (40 µg/l) for two weeks of selection, then two weeks without selection,
then followed by another two weeks on selection. Colonies surviving these two rounds of
selection were considered stable transformants.
Gene Plasmid name Enzymes Fragments
Plasmid
size
Phypa_457568 pMBLU-R1 Sac1 Sma1 4093-2246 6339
Phypa_430134 pMBLU-R2 Sac1 Sma1 4020-2246 6266
Phypa_452798 pMBLU-R3 Nde1 4369-2552 6921
Phypa_426777 pMBLU-R4 Stu1 Snab1 4215-2467 6682
Phypa_452597 pMBLU-ATG5 Sac1 4420-2335 6755
Phypa_461267 pMBLU-RAR1 Sac1 Sma1 4736-2246 6982
Phypa_446407 pMBL10a-MPK4A Not1 Xba1 3280-2383 5663
Phypa_445237 pMBLU-MEKK1A Sac1 3731-2423 6154
Phypa_429991 pMBLU-MEKK1B Sma1 4168-2376 6544
Phypa_430122 pMBLU-MKK1A EcorV Xba1 4105-2258 6363
Phypa_451420 pMBLU-ACD11 Sac1 Sma1 3920-2246 6166
Phypa_435424 pMBLU-MPK4B2 EcoR1 6431 6431
77

Phypa_432218 pMBLU-CERK1A Sac1 Sma1 4390-2246 6636
Phypa_458799 pMBLU-CERK1B Sma1 6424 6424
Phypa_446407 pMBLU-GFP-MPK4A Sma1 7511 7511
Phypa_453593 pMBLU-SGT1 Nhe1 Sma1 4442-2311 6753
Phypa_435424 pMBL10a-Mpk4B1 Not1 Nde1 3191-2331 5522
Phypa_435424 pMBLU-MPK4B2 EcoR1 6431 6431
Table 8. Physcomitrella transformation plasmids. The table contains the Cosmoss ID for the targeted
gene, the plasmid name, the enzymes used to linearize it, the fragment sizes in bp obtained by the
digestion, and the uncut plasmid size. The plasmids used to create confirmed KOs are in black. The
blue color plasmids have not yet been confirmed as KOs or KI, and the red plasmids have failed to
produce KOs despite several attempts.
Genotyping
Initial screening of KO colonies was done with the Extract-N-Amp Plant PCR Kit
(Sigma-Aldrich). DNA extraction and PCR amplification was according to the
manufacturer's specifications. If WT PCR failed but a control PCR worked, the colony
was propagated and new DNA extracted using a modified Edwards extraction protocol
with an additional Phenol:Chloroform:Isoamyl Alcohol 25:24:1 purification step
(Edwards et al., 1991). This DNA was then used as template for PCRs to confirm correct
left boarder and right boarder integration as well as whole gene amplification. Primers
used for genotyping are in Table 9.
MPK4A Phypa_446407 Pp1s149_39V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb269 TGAAAACGTCGTTGCCATTA P4 sb270 GGTCCGTATCCATCAACTCG 290 WT gDNA
P1 sb94 TTCGAATCCTAAATTTGAAAACAA P2 sb103 TTTTCTCTCCTTCGTTCGTCA 1223 WT LB
P5 sb200 TGATTCGTTTCCTTGCAACA P6 sb54 ATAAAAGAGGGGTGTCTGCCTGGTAGTTC 1859 WT RB
P1 sb94 TTCGAATCCTAAATTTGAAAACAA P7 sb27 GGCAATGGAATCCGAGGAGGT 880 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb54 ATAAAAGAGGGGTGTCTGCCTGGTAGTTC 1419 KO RB
P1 sb94 TTCGAATCCTAAATTTGAAAACAA P6 sb54 ATAAAAGAGGGGTGTCTGCCTGGTAGTTC 5646/4169 All WT/KO
cDNAF sb228 GGTACAAGCCACCACTTCGT cDNAR sb270 GGTCCGTATCCATCAACTCG 270 WT cDNA
LBFF sb47,2 GCGGCCGCGGGTCTTTAGATTTGCCATGT LBFR sb64 GGATCCGTGTATTCCCGCGATTCTAGGT 663 Cloning LB
RBFF sb48 GATATCAAGGCCTACTCTCAATTCTTTAG RBFR sb66 TAGTACAGTAGGCAATGGTAGAATTGTT 888 Cloning RB
RAR1 Phypa_461267 Pp1s505_15V5.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb252 AGGCAGCTCCTAGTCCTAACG P4 sb253 CTGCAAAACGAAAACAACCAT 263 WT gDNA
P1 sb255 GTCTACACATGTAATGTTGAAGGATAA P2 sb245 CATACCCAGGCAGGCTTAAA 1530 WT LB
P5 sb215 CTCAACAACCAACAGCTGGA P6 sb254 TCTTGATTCAACCGCTGACA 2533 WT RB
P1 sb255 GTCTACACATGTAATGTTGAAGGATAA P7 sb92 GGTACCGCTGAGGTTTAAT 1555 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb254 TCTTGATTCAACCGCTGACA 1602 KO RB
P1 sb255 GTCTACACATGTAATGTTGAAGGATAA P6 sb254 TCTTGATTCAACCGCTGACA 4528/4772 All WT/KO
cDNAF sb252 AGGCAGCTCCTAGTCCTAACG cDNAR sb216 GGATGGCACAGCCTTCTTTA 222 WT cDNA
LBFF sb195 GGCTTAAUGGTTTGAACGGAGAACGAAA LBFR sb196 GGTTTAAUGGAACAAACCGAAGCAATGT 1250 Cloning LB
RBFF sb164 GGCGCGAUCGTTGGTGCGAGTATTAATGTAAG RBFR sb165 GGTGCGAUCCATTTAGACTACGACACACTTGG 1499 Cloning RB
Y2H AFRAR1F GGCTTAAUATGACGACGACGACAGGAAGAC Y2H AFRAR1R GGTTTAAUTCACGCCGCATCCTGTGGATTG 779 Cloning CDS
ATG5 Phypa_452597 Pp1s227_54V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb223 TTTTCGTGCTCAGACATTGC P4 sb224 GTGCAGCATCAAAGAGGTCA 285 WT gDNA
P1 sb221 ATTTACCACCTTCATGGTGAGG P2 sb115 TCTCGGGCTCCAACAACGGT 3326 WT LB
P5 sb223 TTTTCGTGCTCAGACATTGC P6 sb230 GTCCTCTCCCTTGTGCTGAG 2627 WT RB
P1 sb221 ATTTACCACCTTCATGGTGAGG P7 sb92 GGTACCGCTGAGGTTTAAT 1647 KO LB
78

P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb230 GTCCTCTCCCTTGTGCTGAG 1693 KO RB
P1 sb233 TCGGAGAGTGGGAAAGAAGA P6 sb230 GTCCTCTCCCTTGTGCTGAG 7448/4954 All WT/KO
cDNAF sb114 TGGTCGGGAGCCGTGCCAAT cDNAR sb115 TCTCGGGCTCCAACAACGGT 124 WT cDNA
LBFF sb116 GGCTTAAUTCATAACAAATTGCCAGGAGTG LBFR sb117 GGTTTAAUATGCGCACAATTGAATTAACAG 1264 Cloning LB
RBFF sb118 GGCGCGAUTCCCTTTCGTCATCTGTGTATG RBFR sb119 GGTGCGAUTACGCACTTTGTGAGATTTGCT 1262 Cloning RB
R1 Phypa_457568 Pp1s327_15V5.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb240 TCGACAAACCTCAAGGAGCTA P4 sb241 TGATAGAAGTGCGCCTCAGAT 154 WT gDNA
P1 sb246 CCATTACAGGTCTTATGTCCCATT P2 sb175 AACCCTAACTTGTTCGTATTCTCG 1462 WT LB
P5 sb150 TGAGAATGAGGTCGTGTAATGC P6 sb256 CTAGAAGGCGGGATAATGTCAC 2086 WT RB
P1 sb246 CCATTACAGGTCTTATGTCCCATT P7 sb27 GGCAATGGAATCCGAGGAGGT 1244 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb256 CTAGAAGGCGGGATAATGTCAC 1910 KO RB
P1 sb246 CCATTACAGGTCTTATGTCCCATT P6 sb256 CTAGAAGGCGGGATAATGTCAC 5747/5039 All WT/KO
LBFF sb193 GGCTTAAUGGGTTCGAAGGCACTGTTTA LBFR sb194 GGTTTAAUTGCCAGTCTGGTGATCTGAG 945 Cloning LB
RBFF sb124 GGCGCGAUTTCAAAAAGTGAGCCAACAAGA RBFR sb125 GGTGCGAUGTAACCTCCATCAAATGTGTGC 1168 Cloning RB
R2 Phypa_430134 Pp1s32_318V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb126 TGATGCAGCCGATCTCAA P4 sb127 CACCCGGTCGATGATTTT 907 WT gDNA
P1 sb219 TCGGGACCTCAATAACTGCTAT P2 sb236 TTCTCCATCACCTCCGAATC 1570 WT LB
P5 sb226 CTGAGCCGTTTCCTCTTGTC P6 sb220 AGGCATTTGCAATGAACCTCAA 2199 WT RB
P1 sb219 TCGGGACCTCAATAACTGCTAT P7 sb27 GGCAATGGAATCCGAGGAGGT 1020 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb220 AGGCATTTGCAATGAACCTCAA 1860 KO RB
P1 sb219 TCGGGACCTCAATAACTGCTAT P6 sb220 AGGCATTTGCAATGAACCTCAA 8906/4624 All WT/KO
LBFF sb128 GGCTTAAUTACGTCGTCATTGGAAGTTTTG LBFR sb147 GGTTTAAUATATTTCGGTCGTCCATAGATTGT 724 Cloning LB
RBFF sb130 GGCGCGAUAGTTATTGTTGTTGTGCCATCG RBFR sb131 GGTGCGAUAACCCTCCATAGCTGCAAATTA 1314 Cloning RB
R3 Phypa_452798 Pp1s231_60V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb132 CCTTGGTAGCGTCGCAAT P4 sb133 TTCACGCATGCTCCTCTG 313 WT gDNA
P1 sb152 GCAACTGGATGTTCAGTCAGAG P2 sb153 GAGCTCTCGGTGGAATAGATTG 1552 WT LB
P5 sb237 TGGAATCCTTACCCTGTTGC P6 sb238 ATGACCAAGTTTGCGGTTTC 1744 WT RB
P1 sb152 GCAACTGGATGTTCAGTCAGAG P7 sb92 GGTACCGCTGAGGTTTAAT 1368 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb238 ATGACCAAGTTTGCGGTTTC 1568 KO RB
P1 sb152 GCAACTGGATGTTCAGTCAGAG P6 sb238 ATGACCAAGTTTGCGGTTTC 6696/4536 All WT/KO
LBFF sb134 GGCTTAAUAAAACATCGGTGCGAGTAGATT LBFR sb135 GGTTTAAUGAGATTGCGACATGAAAGTGAG 1256 Cloning LB
RBFF sb198 GGCGCGAUTGCTGGCTGAATTGAACTTG RBFR sb199 GGTGCGAUTCCTTCCGGACATCATCTTC 1435 Cloning RB
R4 Phypa_426777 Pp1s17_234V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb138 GGTTCAAAGAGGAAATATGA P4 sb139 TCACACCATTTTTGCATAGC 312 WT gDNA
P1 sb156 ACAATCTGGGCTTATTCTGCAT P2 sb157 AACAATCATCTTGGCTTCCATC 2025 WT LB
P5 sb158 CATTGACATCATTGGAAGTAGCA P6 sb225 GTCAACAAGTTGGTCACGTGTTAT 1372 WT RB
P1 sb156 ACAATCTGGGCTTATTCTGCAT P7 sb92 GGTACCGCTGAGGTTTAAT 1608 KO LB
P8 sb24 GGTATCAGAGCCATGAATAGGTC P6 sb225 GTCAACAAGTTGGTCACGTGTTAT 1383 KO RB
P1 sb156 ACAATCTGGGCTTATTCTGCAT P6 sb225 GTCAACAAGTTGGTCACGTGTTAT 9537/4999 All WT/KO
LBFF sb140 GGCTTAAUGCCAAGATTTGCTCTTCTGAGT LBFR sb141 GGTTTAAUTTTCATCAAGGTTTCACATTGC 1238 Cloning LB
RBFF sb142 GGCGCGAUGCACCTGCCAACAAGAATTTAT RBFR sb143 GGTGCGAUTATGTGTTCCGCAAGTTAGACG 1208 Cloning RB
Cloned but not transformed
MPK4B(1) Phypa_435424 Pp1s59_325V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb368 AATGTCGCCACTTCTGCTCT P4 sb369 GGCTGCTCAAAATCGAACTC 134 WT gDNA
cDNAF sb267 GGCGAGTACACGCAGTACAA cDNAR sb268 ATTCACAGCGGAACACACAA 117 WT cDNA
LBFF sb043 CCTCACTCTTTTCCCTCTACATAACACGAG LBFR sb044 GCGGCCGCTGGCTGCTAAACAGAATTGAAA 845 Cloning LB
RBFF sb045 GTAAAGAGAGCAGTACAAGGAGTCGTG RBFR sb046 GATATCCGACAGTAAATGACCAGGATCTC 876 Cloning RB
MPK4B(2) Phypa_435424 Pp1s59_325V6.1
LBFF sb364 GGCTTAAUTGGCATCAAGGATTGATAGAAGT LBFR sb365 GGTTTAAUAATCCAGATATGTTCACCACCAC 1064 Cloning LB
79

RBFF sb366 GGCGCGAUGAGAGCAGTACAAGGAGTCGTGT RBFR sb367 GGTGCGAUTCCAAAACCTCTATCCACGTAAA 1137 Cloning RB
MPK4A
-GFP Phypa_446407 Pp1s149_39V6.1
LBFF sb412 GGCTTAAUATCGAGTGATATTTGACGATGCTA LBFR sb413 GGTTTAAUTTACTGCACCATATCATCAGGAC 1179 Cloning LB
RBFF sb414 GGCGCGAUAGCTTCACACTTCATCTCAAGTTGTA RBFR sb415 GGTGCGAUCAGTAGGCAATGGTAGAATTGTTG 904 Cloning RB
SGT1 Phypa_453593 Pp1s244_58V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb213 TGCAACCTCTAGACCTGCTG P4 sb214 CAACGATGGCACAACTTCAG 106 WT gDNA
LBFF sb166 GGCTTAAUAAAGAAGGCTAGCACTCAAAGGTA LBFR sb197 GGTTTAAUGCCAAAGCTTCCGTGTAAAG 1463 Cloning LB
RBFF sb206 GGCGCGAUTCAAGCTCATGAACCACTGC RBFR sb207 GGTGCGAUCCGACAGCCATAATCCTCAT 1017 Cloning RB
GGTTTAAUCTAAATTTCCCACTTTTTCATATCC
Y2H AFSGT1F GGCTTAAUATGGCAGAGGATATTGAGAAGCG Y2H AFSGT1R ATTCCTG 1143 Cloning CDS
CERK1A Phypa_432218 Pp1s41_280V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb376 CAAGCATAGGTTGCTCGTCA P4 sb377 AGTCATAAGGGCCACCACTG 340 WT gDNA
cDNAF sb336 ATCCGCCAACATACTCCTTG cDNAR sb337 AACGACTCCGAAAGCGTAGA 202 WT cDNA
LBFF sb372 GGCTTAAUGGTGGTTTTGAAATTACGCATTA LBFR sb373 GGTTTAAUATCGTTCAGGGAAGTTTTATGGT 1290 Cloning LB
RBFF MW01 GGCGCGAUCATGTGCAGTAAATCTGTTTGTGA RBFR MW02 GGTGCGAUCTCATCCTCAAGTAAATGTGCAAC 1116 Cloning RB
CERK1B Phypa_458799 Pp1s364_10V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb338 CATGAGCACACCAAACCAAC P4 sb339 CAAACCAAAATCTGCCACCT 213 WT gDNA
cDNAF sb338 CATGAGCACACCAAACCAAC cDNAR sb339 CAAACCAAAATCTGCCACCT 99 WT cDNA
LBFF sb378 GGCTTAAUAGTCTGCATCTTTTGTTCTCCAG LBFR sb379 GGTTTAAUTCCAGGAATGAAGGAACTTAACA 806 Cloning LB
RBFF sb380 GGCGCGAUTTCGAGATTTGGAACACTTCATT RBFR sb381 GGTGCGAUTCTCCAAATCCAAACTCCTACAA 1388 Cloning RB
MEKK1A Phypa_445237 Pp1s136_5V6.3
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb348 GCAGATGAAGGAAAGCTTGG P4 sb349 GCCGGTAAGAATCTGCTCTG 234 WT gDNA
cDNAF sb348 GCAGATGAAGGAAAGCTTGG cDNAR sb349 GCCGGTAAGAATCTGCTCTG 234 WT cDNA
LBFF sb384 GGCTTAAUTTTTTGTTTGGAGTGCAAGATTT LBFR sb385 GGTTTAAUCCAACGTAGTATGCCTATTCTGC 996 Cloning LB
RBFF sb386 GGCGCGAUTGGGATGCAGAAGACGTATAGTT RBFR sb387 GGTGCGAUTATTCCTGAAACCTGGCTTAACA 914 Cloning RB
MEKK1B Phypa_429991 Pp1s31_252V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb370 GGATGGCTCCAGAAGTGGTA P4 sb371 CCGGAATAAGAGGACCTTCC 171 WT gDNA
cDNAF sb370 GGATGGCTCCAGAAGTGGTA cDNAR sb371 CCGGAATAAGAGGACCTTCC 171 WT cDNA
LBFF sb392 GGCTTAAUCAGTACATTAATAACCCCACCACA LBFR sb393 GGTTTAAUTTCAAGATCTCCAAGAACCACATA 1111 Cloning LB
RBFF sb394 GGCGCGAUTGCATTGGTGTTTATTTGGTAATC RBFR sb395 GGTGCGAUTTCTTTTTAAAACCGTCCACTCTC 1203 Cloning RB
MKK1A Phypa_430122 Pp1s32_219V6.1
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb388 GCAAGCAAGTTTTGCTAGGG P4 sb389 ATCGCTGTCGAATCCATAGG 233 WT gDNA
cDNAF sb346 GCTTAGGGTTGACGCTCTTG cDNAR sb389 ATCGCTGTCGAATCCATAGG 196 WT cDNA
LBFF si01 GGCTTAAUTCCTCCTACTCGATATCCTTGTTC LBFR si02 GGTTTAAUACAACAAGCCTTTACAAACACAAA 912 Cloning LB
RBFF si03 GGCGCGAUTTATGAAGGGCTTGTGTCTTGATA RBFR si04 GGTGCGAUATTGGTGGTAATTCTTGTGGAAGT 1221 Cloning RB
ACD11 Phypa_451420 Pp1s211_32V6.2
Type Name Forward primer 5' - 3' Type Name Reverse primer 5' - 3'
Product
size
Description
P3 sb340 CTCATCTCGCCTCTCTTTGG P4 sb341 TCGGTGACAAGAATGTGCTC 429 WT gDNA
cDNAF sb340 CTCATCTCGCCTCTCTTTGG cDNAR sb361 GGTTTAAUTTCCAAGGCAAACGAAATAGTTA 242 WT cDNA
LBFF sb360 GGCTTAAUGTCTTGCAAAGTTGACACGTTTT LBFR sb361 GGTTTAAUTTCCAAGGCAAACGAAATAGTTA 1119 Cloning LB
RBFF sb362 GGCGCGAUGGATAGCGACACTGAACTCACTT RBFR sb363 GGTGCGAUTGAGTGGTATGACCCCAGATATT 817 Cloning RB
Table 9. Primers used to clone flanking regions of target genes and to genotype KOs of these genes.
Abbreviations: P1-P8 refers to the primer type illustrated in Figure 16. cDNAF – cDNA Forward,
cDNAR – cDNA Reverse, LBFF – Left Boarder Flanking Forward, LBFR – Left Boarder Flanking
Reverse, RBFF – Right Boarder Flanking Forward, RBFR – Right Boarder Flanking Reverse and
Y2H – Yeast two Hybrid.
80

Southern blot
DNA was extracted from four plates of approximately one week old protonema from
each genotype. 8 µg were digested over night with the restriction enzymes Pst1 (NEB)
and BamH1 (Fermentas) and/or EcoRV (Fermentas). The digested DNA was run on an
ethidium bromide stained 1% agarose gel (Figure 53).
81

Figure 53. Ethidium bromide stained agarose gels with genomic DNA from the indicated genotypes
digested with the indicated restriction enzymes used for Southern blot analysis. (A) the
corresponding blot is shown in Figure 21, (B) the corresponding blot is shown in Figure 22 and (C)
the corresponding blot is shown in Figure 23.
82

The gel with the digested DNA was denatured for 30 min in denaturing solution (NaOH
0.5M, NaCl 1.5 M), then neutralized in NaCl 1.5 M, Tris-HCL (pH 7.4) 0.5M) followed
by washing for15 min in 20x SCC (NaCl 3M, Na 3 -citrate 0.3 M). DNA was then
transferred to nylon membranes (Amarsham, Hybond XL) over night using capillary
effect in 10XSCC. After transfer the lanes were marked and the membrane dried in an
oven at 120°C for 30 min.
Probe labeling for Southern blot was performed using the DIG High prime DNA
Labeling and detection starter kit II (Manheim boehringer, cat. No. 1585614). App 500
ng of the whole selection cassette 35S:ntpII:ter (1942 bp fragment in water (16 µl total),
obtained by running pMBLU digested with the restriction enzymes Pac1 and AsiSI on a
gel and excising the band corresponding to the selection cassette, was denatured by
boiling for 10 min and then cooled on ice. The sample was then labeled over night with 4
µl DIG mix. The reaction was stopped by adding 2 µl 0.2 M EDTA (pH 8.0). To quantify
the probe, a dot blot was performed with dilutions of the probe and a dilution of a DIGlabeled
control DNA (data not shown). Based on this, 3 µl of the probe solution was used
in 50 ml standard hybridization buffer (described in the kit manual). Development of the
membrane was done according to the manufacturer's specifications.
RNA extraction and quantitative RT-PCR
RNA extraction and quantitative RT-PCR was performed as described in manuscript 1.
Primers used for qPCR are listed below in Table 10.
Name Phypa ID Gene ID name Forward sequence name Reverse sequence cDNA gDNA
a-DOX Phypa_447346 Pp1s159_20V6.1 sb296 CCGCGAAGTTGCTATCTAGG sb297 AGAGGGTGGAGCCGTAATCT 149
ATG5 Phypa_452597 Pp1s227_54V6.1 sb114 TGGTCGGGAGCCGTGCCAAT sb115 TCTCGGGCTCCAACAACGGT 124 998
CERK1A Phypa_432218 Pp1s41_280V6.1 sb336 ATCCGCCAACATACTCCTTG sb337 AACGACTCCGAAAGCGTAGA 202
CERK1B Phypa_458799 Pp1s364_10V6.1 sb338 CATGAGCACACCAAACCAAC sb339 CAAACCAAAATCTGCCACCT 99 213
CERK1C Phypa_441050 Pp1s97_105V6.1 sb400 CATATGTGGTGCAAGCCAAC sb401 CTTGGAGTTGCCAAAAGGAG 173
CERK1D Phypa_434612 Pp1s54_159V6.1 sb328 CCGAAAGACGAACAAAGAGC sb329 CTAATTGCGCCATCTTCCAT 145
CHS Phypa_427901 Pp1s22_4V6.1 sb263 GGCATGGAACGAGATGTTCT sb264 CCTTGCATCTTGTCCTTGGT 99
CYP71A13 Phypa_450673 Pp1s200_17V6.1 sb273 GCAGAAATATTTGCCCCGTA sb274 TAATCGCCATGTTGACTCCA 125
ERF2 Phypa_422542 Pp1s2_404V6.1 sb275 GAGAGGCGTCCAAACTCTTG sb276 AGGGACTTACGGGCTTGTTT 118
ERF5 Phypa_422320 Pp1s2_410V6.1 sb383 GCTCCGCTGTATCGAAAGTC sb382 TCGAAGTTGCTGACAAGGTG 204
ERFB3 Phypa_431734 Pp1s38_262V6.1 sb316 CTGTCTCCCTACTCCGAACG sb317 AGTCGAACTGCGAGTCCAAT 83
LOX7 Phypa_184078 Pp1s70_182V6.1 sb356 GTGGCGGTTTGATCAGGA sb357 CGTTCAGCCATCCCTCTTC 156 N/A
MEKK1A Phypa_445237 Pp1s136_5V6.3 sb348 GCAGATGAAGGAAAGCTTGG sb349 GCCGGTAAGAATCTGCTCTG 234
MEKK1B Phypa_429991 Pp1s31_252V6.1 sb370 GGATGGCTCCAGAAGTGGTA sb371 CCGGAATAAGAGGACCTTCC 171
MKK1A Phypa_430122 Pp1s32_219V6.1 sb346 GCTTAGGGTTGACGCTCTTG sb347 ACTTTGGATCCTTCTGCAAG 195 318
MKK1B Phypa_442149 Pp1s106_83V6.1 sb344 TTACGCATTGAAGGGGATTC sb345 CTGATGCAGTGTCAGCTGGT 94 210
MKK1C Phypa_433829 Pp1s50_83V6.1 sb342 TTCGTTGGGACTTGCACATA sb343 CGCACACTCCAAAAGAGTCA 105 297
MPK4A Phypa_446407 Pp1s149_39V6.1 sb228 GGTACAAGCCACCACTTCGT sb270 GGTCCGTATCCATCAACTCG 270 890
MPK4B Phypa_435424 Pp1s59_325V6.1 sb267 GGCGAGTACACGCAGTACAA sb268 ATTCACAGCGGAACACACAA 117 N/A
NOX Phypa_204103 Pp1s18_194V6.1 sb354 CACGATGTTGCAGTCGTTG sb355 TACGTGCCCTAGTGCCTGA 68 N/A
PAL4 Phypa_461241 Pp1s500_4V6.1 sb284 TGGCCTACTCGGTAATGGAG sb285 GTCAACCATCCGCTTGATTT 109
83

PAL4-2 Phypa_180561 Pp1s43_67V6.1 sb396 CGTTCGAGGAGGAACTCAAG sb397 TGCAGTTCTCGATCCTGTTG 108
PRX34A Phypa_144797 Pp1s219_8V2.1 sb104 CAATACGCTACTCGCGACTCTGT sb105 CGTCTCTTCGACCGCCATA 73 235
RAR1 Phypa_461267 Pp1s505_15V5.1 sb252 AGGCAGCTCCTAGTCCTAACG sb216 GGATGGCACAGCCTTCTTTA 222 402
SGT1 Phypa_453593 Pp1s244_58V6.1 sb332 CTCGCCTGTATGGCAAGATT sb333 GGTCGAACTCCAACTGCTTC 117
TUB6 Phypa_440500 Pp1s93_158V6.1 sb041 GAGTTCACGGAAGCGGAGAG sb042 ATATCTTTCAGGCTCCACCG 224
Wkry 33 Phypa_431011 Pp1s35_336V6.1 sb277 GATACGGAAGGACGACGAAA sb278 CCTGGACATCATCTGTGGTG 130
Wrky18 Phypa_447355 Pp1s159_105V6.1 sb322 CCAGAAATGTCGAACCACCT sb323 TTCTCAAACGCCGTCTTCTT 127
Wrky25 Phypa_445119 Pp1s135_80V6.1 sb290 ATTTGTTGGCAGGAGCAATC sb291 GGAGCCTCTGCCATCAGTAG 140
Wrky40 Phypa_433427 Pp1s47_251V6.1 sb318 GAAAAGCAGTGGGAGAGTCG sb319 TGTGATGGTCCGACCTTGTA 137
Wrky53 Phypa_447750 Pp1s163_112V6.2 sb320 CTCATCAAAACCTCCGCAAT sb321 GCAGAAGGTGGTGAGCTTTC 152
Wrky70 Phypa_447996 Pp1s166_34V6.1 sb310 GAAAGACTTGGGGCATTTGA sb311 ACAATGTCCTCCAGCAATCC 150
Table 10. Primers used for qPCR. Listed are the gene name and identifiers, the primer names and
sequences, and the product length when amplified on cDNA and gDNA. If no product length is listed
for a cDNA, it is the same as for gDNA, and N/A means that one of the primers spans an exon/intron
junction and thus can only amplify cDNA.
Statistics
The statistical analysis of quantitative Evans blue staining and Alternaria spore counting
assays were done by first performing a one way analysis of variance (ANOVA) followed
by a Tukey's HSD (Honestly Significant Difference) test. For the Alternaria spore
counting assay the test was performed on mean values of the counting for each sample
(Anders Tolver Jensen, personal communication). The tests were performed in “R” using
following codes:
#ANOVA and Tukey HSD test
rm(list=ls()) # Removes all objects
your = read.csv(file.choose()) # Opens windos explorer, then enter file
attach(your) # attaches variables
summary(aov(count ~ gt)) # Gives summery of anova test
mod

control treatment (C) (0.01% Acetic acid, adjusted to pH 5.5 with NaOH). Moss colonies
were then incubated for 2 h in 1 mg/ml DAB, HCl (pH 3.8). The colonies were rinsed
twice in H 2 O and chlorophyll removed by incubating overnight in 96% (v/v) ethanol.
Histochemical staining
The histochemical stainings and microscopic pictures in Figure 24 and Figure 25 were
performed at IIBCE in Uruguay with the help of Inés Ponce de León as previously
described (Oliver et al., 2009; Ponce de León et al., 2007; Ponce De León et al., 2012).
Bright field microscopy and fluorescence microscopy were performed with an Olympus
BX61 microscope (Shinjuku-ku, Tokyo, Japan). All images shown in Figure 24 and
Figure 25 were captured with the Microsuite software package (Olympus).
Cell death was visualized by staining for 2 h with 0.1% Evans blue (Sigma) in 0.5
x PBS and washing four times in H 2 O to remove excess unbound dye. The intracellular
production of ROS was analyzed by incubating moss tissues with 10 mM 2 ′ ,7 ′ -
dichlorodihydrofluorescein diacetate (H 2 DCFDA) for 15 min in 0.1 M phosphate buffer
(pH 7.5) in the dark. Leaves were visualized with epifluorescence. Botrytis cinerea and
Pythium irregulare inoculated tissues were stained with 0.1% solophenyl flavine 7GFE
500 in water for 10 min, rinsed in water and visualized with epifluorescence. Callose
detection was performed by fixing the tissue in ethanol over night, rinsing in water and
staining with 0.01% methyl blue in phosphate buffer pH 7.0 for 30 min and observed
with epifluorescence. Phenolic compounds were detected by staining tissues with 0.05%
toluidine blue in citrate–citric acid buffer (50 mM, pH 3.5).
cDNA
cDNA was prepared from a total RNA extraction from wild type moss using the
Superscript III kit (Clonetech) according to the manufacturer's specifications.
Yeast two-hybrid
The yeast two-hybrid analyses were done using the Matchmaker TM kit from Clonetech
according to the manufacturer's specifications.
Western blots
The MPK phosphorylation western blots were done as described in manuscript 1
The ATG8 western blot was done as described in (Yoshimoto et al., 2004)
PCR conditions
All PCRs for USER cloning were performed with the PfuCx polymerase, a mutant of Pfu
DNA polymerase that overcomes uracil stalling completely, allowing the polymerase to
read through uracil located in the template strand or incorporated into the extending
85

strand. For PCR amplification of long fragments, a mix of homemade Pfu and Phusion
hot start polymerase (Finnzymes) was used.
PCR for USER cloning: Total volume of 50 μl, 39 μl H2O, 2 μl WT DNA (10
ng/μl), 1 μl PFUCx, 1 μl forward primer (10mM), 1 μl reverse primer, DNTP 10 mM 1μl,
5 μl 10x Pfu buffer. PCR program: 98ºC for 30 sec., 35 times (98ºC for 10 sec., 57ºC for
25 sec., 72ºC for 45 sec.), 72ºC for 5 min.
86

References
Akita, M., Lehtonen, M.T., Koponen, H., Marttinen, E.M., and Valkonen, J.P.T. (2011).
Infection of the Sunagoke moss panels with fungal pathogens hampers sustainable
greening in urban environments. Science of The Total Environment 409, 3166–3173.
Akita, M., and Valkonen, J.P.T. (2002). A Novel Gene Family in Moss (Physcomitrella
patens) Shows Sequence Homology and a Phylogenetic Relationship with the TIR-NBS
Class of Plant Disease Resistance Genes. Journal of Molecular Evolution 55, 595–605.
Andersson, R.A., Akita, M., Pirhonen, M., Gammelgård, E., and Valkonen, J.P.T. (2005).
Moss-Erwinia pathosystem reveals possible similarities in pathogenesis and pathogen
defense in vascular and nonvascular plants. Journal of General Plant Pathology 71, 23–28.
Andreasson, E., Jenkins, T., Brodersen, P., Thorgrimsen, S., Petersen, N.H.T., Zhu, S.,
Qiu, J.-L., Micheelsen, P., Rocher, A., Petersen, M., et al. (2005). The MAP kinase
substrate MKS1 is a regulator of plant defense responses. EMBO J 24, 2579–2589.
Anthony, R.G., Henriques, R., Helfer, A., Mészáros, T., Rios, G., Testerink, C., Munnik,
T., Deák, M., Koncz, C., and Bögre, L. (2004). A protein kinase target of a PDK1
signalling pathway is involved in root hair growth in Arabidopsis. EMBO J 23, 572–581.
Apel, K., and Hirt, H. (2004a). REACTIVE OXYGEN SPECIES: Metabolism, Oxidative
Stress, and Signal Transduction. Annual Review of Plant Biology 55, 373–399.
Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.-L., Gomez-Gomez, L.,
Boller, T., Ausubel, F.M., and Sheen, J. (2002). MAP kinase signalling cascade in
Arabidopsis innate immunity. Nature 415, 977–983.
Ashton, N.W., and Cove, D.J. (1977). The isolation and preliminary characterisation of
auxotrophic and analogue resistant mutants of the moss Physcomitrella patens. Molecular
and General Genetics MGG 154, 87–95.
Ausubel, F.M. (2005). Are innate immune signaling pathways in plants and animals
conserved Nature Immunology 6, 973–979.
Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., Noël, L., Sadanandom, A., Casais,
C., Parker, J., and Shirasu, K. (2006). Role of SGT1 in resistance protein accumulation in
plant immunity. The EMBO Journal 25, 2007–2016.
Banks, J.A., Nishiyama, T., Hasebe, M., Bowman, J.L., Gribskov, M., dePamphilis, C.,
Albert, V.A., Aono, N., Aoyama, T., Ambrose, B.A., et al. (2011). The Selaginella
Genome Identifies Genetic Changes Associated with the Evolution of Vascular Plants.
Science 332, 960–963.
87

Bendahmane, A., Farnham, G., Moffett, P., and Baulcombe, D.C. (2002). Constitutive
gain-of-function mutants in a nucleotide binding site–leucine rich repeat protein encoded
at the Rx locus of potato. The Plant Journal 32, 195–204.
Bethke, G., Pecher, P., Eschen-Lippold, L., Tsuda, K., Katagiri, F., Glazebrook, J.,
Scheel, D., and Lee, J. (2012). Activation of the Arabidopsis thaliana mitogen-activated
protein kinase MPK11 by the flagellin-derived elicitor peptide, flg22. Mol. Plant Microbe
Interact. 25, 471–480.
Bezanilla, M., Perroud, P.-F., Pan, A., Klueh, P., and Quatrano, R.S. (2005). An RNAi
System in Physcomitrella patens with an Internal Marker for Silencing Allows for Rapid
Identification of Loss of Function Phenotypes. Plant Biology 7, 251–257.
van der Biezen, E.A., and Jones, J.D.G. (1998). The NB-ARC domain: a novel signalling
motif shared by plant resistance gene products and regulators of cell death in animals.
Current Biology 8, R226–R228.
Birkenbihl, R.P., Diezel, C., and Somssich, I.E. (2012). Arabidopsis WRKY33 Is a Key
Transcriptional Regulator of Hormonal and Metabolic Responses toward Botrytis cinerea
Infection. Plant Physiol. 159, 266–285.
Bishop, A.C., Ubersax, J.A., Petsch, D.T., Matheos, D.P., Gray, N.S., Blethrow, J.,
Shimizu, E., Tsien, J.Z., Schultz, P.G., Rose, M.D., et al. (2000). A chemical switch for
inhibitor-sensitive alleles of any protein kinase. Nature 407, 395–401.
Boller, T., and Felix, G. (2009). A Renaissance of Elicitors: Perception of Microbe-
Associated Molecular Patterns and Danger Signals by Pattern-Recognition Receptors.
Annual Review of Plant Biology 60, 379–406.
Boudsocq, M., and Sheen, J. CDPKs in immune and stress signaling. Trends in Plant
Science.
Breeze, E., Harrison, E., McHattie, S., Hughes, L., Hickman, R., Hill, C., Kiddle, S., Kim,
Y., Penfold, C.A., Jenkins, D., et al. (2011). High-Resolution Temporal Profiling of
Transcripts during Arabidopsis Leaf Senescence Reveals a Distinct Chronology of
Processes and Regulation. Plant Cell 23, 873–894.
Brodersen, P., Petersen, M., Bjørn Nielsen, H., Zhu, S., Newman, M.-A., Shokat, K.M.,
Rietz, S., Parker, J., and Mundy, J. (2006). Arabidopsis MAP kinase 4 regulates salicylic
acid- and jasmonic acid/ethylene-dependent responses via EDS1 and PAD4. The Plant
Journal 47, 532–546.
Chater, C., Kamisugi, Y., Movahedi, M., Fleming, A., Cuming, A.C., Gray, J.E., and
Beerling, D.J. (2011). Regulatory Mechanism Controlling Stomatal Behavior Conserved
across 400 Million Years of Land Plant Evolution. Current Biology 21, 1025–1029.
Chen, B., Zhong, D., and Monteiro, A. (2006). Comparative genomics and evolution of
the HSP90 family of genes across all kingdoms of organisms. BMC Genomics 7, 156.
88

Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsis
Receptor Kinase FLS2 Binds flg22 and Determines the Specificity of Flagellin
Perception. Plant Cell 18, 465–476.
Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., N|[uuml]|rnberger, T., Jones,
J.D.G., Felix, G., and Boller, T. (2007). A flagellin-induced complex of the receptor
FLS2 and BAK1 initiates plant defence. Nature 448, 497–500.
Clarke, J.T., Warnock, R.C.M., and Donoghue, P.C.J. (2011). Establishing a time-scale
for plant evolution. New Phytologist 192, 266–301.
Coll, N.S., Epple, P., and Dangl, J.L. (2011). Programmed cell death in the plant immune
system. Cell Death & Differentiation 18, 1247–1256.
Daudi, A., Cheng, Z., O’Brien, J.A., Mammarella, N., Khan, S., Ausubel, F.M., and
Bolwell, G.P. (2012). The Apoplastic Oxidative Burst Peroxidase in Arabidopsis Is a
Major Component of Pattern-Triggered Immunity[W][OA]. Plant Cell 24, 275–287.
DeYoung, B.J., and Innes, R.W. (2006). Plant NBS-LRR proteins in pathogen sensing
and host defense. Nature Immunology 7, 1243–1249.
Diebold, B.A., and Bokoch, G.M. (2005). Rho GTPases and the control of the oxidative
burst in polymorphonuclear leukocytes. Curr. Top. Microbiol. Immunol. 291, 91–111.
Dietz, K.-J., Vogel, M., and Viehhauser, A. (2010). AP2/EREBP transcription factors are
part of gene regulatory networks and integrate metabolic, hormonal and environmental
signals in stress acclimation and retrograde signalling. Protoplasma 245, 3–14.
Dóczi, R., Ökrész, L., Romero, A.E., Paccanaro, A., and Bögre, L. (2012). Exploring the
evolutionary path of plant MAPK networks. Trends in Plant Science 17, 503–562.
Droillard, M.-J., Boudsocq, M., Barbier-Brygoo, H., and Laurière, C. (2004).
Involvement of MPK4 in osmotic stress response pathways in cell suspensions and
plantlets of Arabidopsis thaliana: activation by hypoosmolarity and negative role in
hyperosmolarity tolerance. FEBS Letters 574, 42–48.
Edwards, K., Johnstone, C., and Thompson, C. (1991). A simple and rapid method for the
preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19, 1349.
Egener, T., Granado, J., Guitton, M.-C., Hohe, A., Holtorf, H., Lucht, J.M., Rensing, S.A.,
Schlink, K., Schulte, J., Schween, G., et al. (2002). High frequency of phenotypic
deviations in Physcomitrella patens plants transformed with a gene-disruption library.
BMC Plant Biology 2, 6.
El Oirdi, M., and Bouarab, K. (2007). Plant signalling components EDS1 and SGT1
enhance disease caused by the necrotrophic pathogen Botrytis cinerea. New Phytologist
175, 131–139.
89

Enoksson, M., and Salvesen, G.S. (2010). Metacaspases are not caspases – always doubt.
Cell Death & Differentiation 17, 1221–1221.
Eruslanov, E., and Kusmartsev, S. (2010). Identification of ROS Using Oxidized DCFDA
and Flow-Cytometry. In Advanced Protocols in Oxidative Stress II, D. Armstrong, ed.
(Humana Press), pp. 57–72.
Eschen-Lippold, L., Bethke, G., Palm-Forster, M., Pecher, P., Bauer, N., Glazebrook, J.,
Scheel, D., and Lee, J. (2012). MPK11—a fourth elicitor-responsive mitogen-activated
protein kinase in Arabidopsis thaliana. Plant Signaling & Behavior 7, 1203–1205.
Felix, G., Duran, J.D., Volko, S., and Boller, T. (2002). Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. The Plant Journal 18, 265–
276.
Felix, G., Regenass, M., and Boller, T. (1993). Specific perception of subnanomolar
concentrations of chitin fragments by tomato cells: induction of extracellular
alkalinization, changes in protein phosphorylation, and establishment of a refractory state.
The Plant Journal 4, 307–316.
Ferrari, S., Plotnikova, J.M., De Lorenzo, G., and Ausubel, F.M. (2003). Arabidopsis
local resistance to Botrytis cinerea involves salicylic acid and camalexin and requires
EDS4 and PAD2, but not SID2, EDS5 or PAD4. The Plant Journal 35, 193–205.
Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral,
A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101
Stabilizes and Signals within an ENHANCED DISEASE SUSCEPTIBILITY1 Complex
in Plant Innate Immunity. Plant Cell 17, 2601–2613.
Finn, R.D., Tate, J., Mistry, J., Coggill, P.C., Sammut, S.J., Hotz, H.-R., Ceric, G.,
Forslund, K., Eddy, S.R., Sonnhammer, E.L.L., et al. (2007). The Pfam protein families
database. Nucleic Acids Research 36, D281–D288.
Forman, H.J., Maiorino, M., and Ursini, F. (2010). Signaling Functions of Reactive
Oxygen Species. Biochemistry 49, 835–842.
Frank, W., Baar, K.-M., Qudeimat, E., Woriedh, M., Alawady, A., Ratnadewi, D.,
Gremillon, L., Grimm, B., and Reski, R. (2007). A mitochondrial protein homologous to
the mammalian peripheral-type benzodiazepine receptor is essential for stress adaptation
in plants. The Plant Journal 51, 1004–1018.
Frías, M., González, C., and Brito, N. (2011). BcSpl1, a cerato-platanin family protein,
contributes to Botrytis cinerea virulence and elicits the hypersensitive response in the
host. New Phytologist 192, 483–495.
Gabriëls, S.H.E.J., Vossen, J.H., Ekengren, S.K., Ooijen, G. van, Abd-El-Haliem, A.M.,
Berg, G.C.M. van den, Rainey, D.Y., Martin, G.B., Takken, F.L.W., Wit, P.J.G.M. de, et
90

al. (2007). An NB-LRR protein required for HR signalling mediated by both extra- and
intracellular resistance proteins. The Plant Journal 50, 14–28.
Gao, M., Liu, J., Bi, D., Zhang, Z., Cheng, F., Chen, S., and Zhang, Y. (2008). MEKK1,
MKK1/MKK2 and MPK4 function together in a mitogen-activated protein kinase
cascade to regulate innate immunity in plants. Cell Research 18, 1190–1198.
Gómez-Gómez, L., and Boller, T. (2000). FLS2: An LRR Receptor–like Kinase Involved
in the Perception of the Bacterial Elicitor Flagellin in Arabidopsis. Molecular Cell 5,
1003–1011.
González Besteiro, M.A., Bartels, S., Albert, A., and Ulm, R. (2011). Arabidopsis MAP
kinase phosphatase 1 and its target MAP kinases 3 and 6 antagonistically determine UV-
B stress tolerance, independent of the UVR8 photoreceptor pathway. The Plant Journal
68, 727–737.
Govrin, E.M., and Levine, A. (2000). The hypersensitive response facilitates plant
infection by the necrotrophic pathogen Botrytis cinerea. Current Biology 10, 751–757.
Govrin, E.M., Rachmilevitch, S., Tiwari, B.S., Solomon, M., and Levine, A. (2006). An
Elicitor from Botrytis cinerea Induces the Hypersensitive Response in Arabidopsis
thaliana and Other Plants and Promotes the Gray Mold Disease. Phytopathology
96, 299–307.
Han, J., Lee, J.D., Bibbs, L., and Ulevitch, R.J. (1994). A MAP kinase targeted by
endotoxin and hyperosmolarity in mammalian cells. Science 265, 808–811.
Hedges, S.B. (2002). The origin and evolution of model organisms. Nature Reviews
Genetics 3, 838–849.
Hoch, H.C., Galvani, C.D., Szarowski, D.H., and Turner, J.N. (2005). Two new
fluorescent dyes applicable for visualization of fungal cell walls. Mycologia 97, 580–588.
Hofius, D., Schultz-Larsen, T., Joensen, J., Tsitsigiannis, D.I., Petersen, N.H.T., Mattsson,
O., Jørgensen, L.B., Jones, J.D.G., Mundy, J., and Petersen, M. (2009). Autophagic
Components Contribute to Hypersensitive Cell Death in Arabidopsis. Cell 137, 773–783.
Hohe, A., Rensing, S.A., Mildner, M., Lang, D., and Reski, R. (2002). Day Length and
Temperature Strongly Influence Sexual Reproduction and Expression of a Novel MADS-
Box Gene in the Moss Physcomitrella patens. Plant Biology 4, 595–602.
Hruz, T., Laule, O., Szabo, G., Wessendorp, F., Bleuler, S., Oertle, L., Widmayer, P.,
Gruissem, W., and Zimmermann, P. (2008). Genevestigator V3: A Reference Expression
Database for the Meta-Analysis of Transcriptomes. Advances in Bioinformatics 2008, 1–
5.
Hübers, M., and Kerp, H. (2012). Oldest known mosses discovered in Mississippian (late
Visean) strata of Germany. Geology 40, 755–758.
91

Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T., and Shinozaki, K. (2000). Various
abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. The
Plant Journal 24, 655–665.
Ichimura, K., Shinozaki, K., Tena, G., Sheen, J., Henry, Y., Champion, A., Kreis, M.,
Zhang, S., Hirt, H., Wilson, C., et al. (2002). Mitogen-activated protein kinase cascades
in plants: a new nomenclature. Trends in Plant Science 7, 301–308.
Jacobsen, J., Rosgaard, L., Sakuragi, Y., and Frigaard, N.-U. (2011). One-step plasmid
construction for generation of knock-out mutants in cyanobacteria: studies of glycogen
metabolism in Synechococcus sp. PCC 7002. Photosynthesis Research 107, 215–221.
Jones, J.D.G., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323–329.
Jones, V.A.S., and Dolan, L. (2012). The evolution of root hairs and rhizoids. Ann Bot.
Kamisugi, Y., Schlink, K., Rensing, S.A., Schween, G., Stackelberg, M. von, Cuming,
A.C., Reski, R., and Cove, D.J. (2006). The mechanism of gene targeting in
Physcomitrella patens: homologous recombination, concatenation and multiple
integration. Nucl. Acids Res. 34, 6205–6214.
Klionsky, D.J., Abeliovich, H., Agostinis, P., Agrawal, D.K., Aliev, G., Askew, D.S.,
Baba, M., Baehrecke, E.H., Bahr, B.A., Ballabio, A., et al. (2008). Guidelines for the use
and interpretation of assays for monitoring autophagy in higher eukaryotes. Autophagy 4,
151–175.
Knepper, C., Savory, E.A., and Day, B. (2011a). Arabidopsis NDR1 Is an Integrin-Like
Protein with a Role in Fluid Loss and Plasma Membrane-Cell Wall Adhesion1[W][OA].
Plant Physiol 156, 286–300.
Knepper, C., Savory, E.A., and Day, B. (2011b). The role of NDR1 in pathogen
perception and plant defense signaling. Plant Signaling & Behavior 6, 1114–1116.
Kohchi, C., Inagawa, H., Nishizawa, T., and Soma, G.-I. (2009). ROS and Innate
Immunity. Anticancer Res 29, 817–821.
Kong, Q., Qu, N., Gao, M., Zhang, Z., Ding, X., Yang, F., Li, Y., Dong, O.X., Chen, S.,
Li, X., et al. (2012). The MEKK1-MKK1/MKK2-MPK4 Kinase Cascade Negatively
Regulates Immunity Mediated by a Mitogen-Activated Protein Kinase Kinase Kinase in
Arabidopsis. Plant Cell.
Kosetsu, K., Matsunaga, S., Nakagami, H., Colcombet, J., Sasabe, M., Soyano, T.,
Takahashi, Y., Hirt, H., and Machida, Y. (2010). The MAP Kinase MPK4 Is Required for
Cytokinesis in Arabidopsis thaliana. Plant Cell 22, 3778–3790.
Krol, E., Mentzel, T., Chinchilla, D., Boller, T., Felix, G., Kemmerling, B., Postel, S.,
Arents, M., Jeworutzki, E., Al-Rasheid, K.A.S., et al. (2010). Perception of the
92

Arabidopsis Danger Signal Peptide 1 Involves the Pattern Recognition Receptor
AtPEPR1 and Its Close Homologue AtPEPR2. J Biol Chem 285, 13471–13479.
Ku, H.-M., Vision, T., Liu, J., and Tanksley, S.D. (2000). Comparing sequenced
segments of the tomato and Arabidopsis genomes: Large-scale duplication followed by
selective gene loss creates a network of synteny. PNAS 97, 9121–9126.
Kültz, D. (2001). Evolution of Osmosensory MAP Kinase Signaling Pathways. Amer.
Zool. 41, 743–757.
Lai, Z., Wang, F., Zheng, Z., Fan, B., and Chen, Z. (2011). A critical role of autophagy in
plant resistance to necrotrophic fungal pathogens. The Plant Journal 66, 953–968.
Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam,
H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., et al. (2007). Clustal W and Clustal
X Version 2.0. Bioinformatics 23, 2947–2948.
Lawton, M., and Saidasan, H. (2009). Pathogenesis in Mosses. In Annual Plant Reviews
Volume 36: The Moss Physcomitrella Patens, C.D. Knight, P.-F. Perroud, and D.J. Cove,
eds. (Wiley-Blackwell), pp. 298–338.
Lehtonen, M.T., Akita, M., Frank, W., Reski, R., and Valkonen, J.P.T. (2012).
Involvement of a Class III Peroxidase and the Mitochondrial Protein TSPO in Oxidative
Burst Upon Treatment of Moss Plants with a Fungal Elicitor. Molecular Plant-Microbe
Interactions 25, 363–371.
Lehtonen, M.T., Akita, M., Kalkkinen, N., Ahola-Iivarinen, E., Rönnholm, G., Somervuo,
P., Thelander, M., and Valkonen, J.P.T. (2009). Quickly-released peroxidase of moss in
defense against fungal invaders. New Phytologist 183, 432–443.
Lenz, H.D., Haller, E., Melzer, E., Kober, K., Wurster, K., Stahl, M., Bassham, D.C.,
Vierstra, R.D., Parker, J.E., Bautor, J., et al. (2011). Autophagy differentially controls
plant basal immunity to biotrophic and necrotrophic pathogens. The Plant Journal 66,
818–830.
Lewis, L.A., and McCourt, R.M. (2004). Green algae and the origin of land plants. Am. J.
Bot. 91, 1535–1556.
Libault, M., Wan, J., Czechowski, T., Udvardi, M., and Stacey, G. (2007). Identification
of 118 Arabidopsis Transcription Factor and 30 Ubiquitin-Ligase Genes
Responding to Chitin, a Plant-Defense Elicitor. Molecular Plant-Microbe Interactions 20,
900–911.
Liu, T., Liu, Z., Song, C., Hu, Y., Han, Z., She, J., Fan, F., Wang, J., Jin, C., Chang, J., et
al. (2012). Chitin-Induced Dimerization Activates a Plant Immune Receptor. Science 336,
1160–1164.
93

Liu, Y., and Bassham, D.C. (2012). Autophagy: Pathways for Self-Eating in Plant Cells.
Annual Review of Plant Biology 63, 215–237.
Liu, Y., Xiong, Y., and Bassham, D.C. (2009). Autophagy is required for tolerance of
drought and salt stress in plants. Autophagy 5, 954–964.
Lupas et al, V.D., M., and Stock, J. (1991). Predicting coiled coils from protein
sequences. Science 252, 1162–1164.
Makino, A., and Osmond, B. (1991). Effects of Nitrogen Nutrition on Nitrogen
Partitioning between Chloroplasts and Mitochondria in Pea and Wheat. Plant Physiol. 96,
355–362.
Mao, G., Meng, X., Liu, Y., Zheng, Z., Chen, Z., and Zhang, S. (2011). Phosphorylation
of a WRKY Transcription Factor by Two Pathogen-Responsive MAPKs Drives
Phytoalexin Biosynthesis in Arabidopsis. Plant Cell 23, 1639–1653.
Melikant, B., Giuliani, C., Halbmayer-Watzina, S., Limmongkon, A., Heberle-Bors, E.,
and Wilson, C. (2004). The Arabidopsis thaliana MEK AtMKK6 activates the MAP
kinase AtMPK13. FEBS Letters 576, 5–8.
Meyerowitz, E.M. (2002). Plants Compared to Animals: The Broadest Comparative
Study of Development. Science 295, 1482–1485.
Meyers, B.C., Kozik, A., Griego, A., Kuang, H., and Michelmore, R.W. (2003). Genome-
Wide Analysis of NBS-LRR–Encoding Genes in Arabidopsis. Plant Cell 15, 809–834.
Miller, G., Schlauch, K., Tam, R., Cortes, D., Torres, M.A., Shulaev, V., Dangl, J.L., and
Mittler, R. (2009). The Plant NADPH Oxidase RBOHD Mediates Rapid Systemic
Signaling in Response to Diverse Stimuli. Sci. Signal. 2, ra45.
Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y.,
Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM Receptor Kinase, Is
Essential for Chitin Elicitor Signaling in Arabidopsis. PNAS 104, 19613–19618.
Moffat, C.S., Ingle, R.A., Wathugala, D.L., Saunders, N.J., Knight, H., and Knight, M.R.
(2012). ERF5 and ERF6 Play Redundant Roles as Positive Regulators of JA/Et-Mediated
Defense against Botrytis cinerea in Arabidopsis. PLoS ONE 7, e35995.
Moreno-Hagelsieb, G., and Latimer, K. (2008). Choosing BLAST options for better
detection of orthologs as reciprocal best hits. Bioinformatics 24, 319–324.
Mur, L.A.J., Kenton, P., Lloyd, A.J., Ougham, H., and Prats, E. (2008). The
hypersensitive response; the centenary is upon us but how much do we know J. Exp. Bot.
59, 501–520.
94

Nakagami, H., Soukupová, H., Schikora, A., Zárský, V., and Hirt, H. (2006). A Mitogenactivated
Protein Kinase Kinase Kinase Mediates Reactive Oxygen Species Homeostasis
in Arabidopsis. J. Biol. Chem. 281, 38697–38704.
Nakaoka, Y., Miki, T., Fujioka, R., Uehara, R., Tomioka, A., Obuse, C., Kubo, M.,
Hiwatashi, Y., and Goshima, G. (2012). An Inducible RNA Interference System in
Physcomitrella patens Reveals a Dominant Role of Augmin in Phragmoplast Microtubule
Generation. Plant Cell 24, 1478–1493.
Nekrasov, V., Li, J., Batoux, M., Roux, M., Chu, Z.-H., Lacombe, S., Rougon, A., Bittel,
P., Kiss-Papp, M., Chinchilla, D., et al. (2009). Control of the pattern-recognition
receptor EFR by an ER protein complex in plant immunity. The EMBO Journal 28,
3428–3438.
Nour-Eldin, H.H., Hansen, B.G., Nørholm, M.H.H., Jensen, J.K., and Halkier, B.A.
(2006). Advancing uracil-excision based cloning towards an ideal technique for cloning
PCR fragments. Nucl. Acids Res. 34, e122–e122.
Oerke, E.-C. (2006). Crop losses to pests. The Journal of Agricultural Science 144, 31–43.
Oliver, J., Castro, A., Gaggero, C., Cascón, T., Schmelz, E., Castresana, C., and Ponce de
León, I. (2009). Pythium infection activates conserved plant defense responses in mosses.
Planta 230, 569–579.
Patel, S., and Dinesh-Kumar, S.P. (2008). Arabidopsis ATG6 is required to limit the
pathogen-associated cell death response. Autophagy 4, 20–27.
Pérez-Pérez, M.E., Florencio, F.J., and Crespo, J.L. (2010). Inhibition of Target of
Rapamycin Signaling and Stress Activate Autophagy in Chlamydomonas reinhardtii.
Plant Physiol. 152, 1874–1888.
Pérez-Pérez, M.E., Lemaire, S.D., and Crespo, J.L. (2012). Reactive Oxygen Species and
Autophagy in Plants and Algae. Plant Physiol. 160, 156–164.
Petersen, K., Fiil, B.K., Mundy, J., and Petersen, M. (2008). Downstream targets of
WRKY33. Plant Signal Behav 3, 1033–1034.
Petersen, M., Brodersen, P., Naested, H., Andreasson, E., Lindhart, U., Johansen, B.,
Nielsen, H.B., Lacy, M., Austin, M.J., Parker, J.E., et al. (2000). Arabidopsis MAP
Kinase 4 Negatively Regulates Systemic Acquired Resistance. Cell 103, 1111–1120.
Petutschnig, E.K., Jones, A.M.E., Serazetdinova, L., Lipka, U., and Lipka, V. (2010). The
Lysin Motif Receptor-like Kinase (LysM-RLK) CERK1 Is a Major Chitin-binding
Protein in Arabidopsis thaliana and Subject to Chitin-induced Phosphorylation♦. J Biol
Chem 285, 28902–28911.
95

Ponce de León, I.P., Sanz, A., Hamberg, M., and Castresana, C. (2002). Involvement of
the Arabidopsisα-DOX1 fatty acid dioxygenase in protection against oxidative stress and
cell death. The Plant Journal 29, 61–72.
Ponce de León, I., Oliver, J., Castro, A., Gaggero, C., Bentancor, M., and Vidal, S.
(2007). Erwinia carotovora elicitors and Botrytis cinerea activate defense responses in
Physcomitrella patens. BMC Plant Biology 7, 52.
Ponce De León, I., Schmelz, E.A., Gaggero, C., Castro, A., Álvarez, A., and Montesano,
M. (2012). Physcomitrella patens activates reinforcement of the cell wall, programmed
cell death and accumulation of evolutionary conserved defence signals, such as salicylic
acid and 12‐oxo‐phytodienoic acid, but not jasmonic acid, upon Botrytis cinerea
infection. Molecular Plant Pathology 13, 960–974.
Prigge, M.J., and Bezanilla, M. (2010). Evolutionary crossroads in developmental
biology: Physcomitrella patens. Development 137, 3535–3543.
Pöpping, B., Gibbons, T., and Watson, M.D. (1996). The Pisum sativum MAP kinase
homologue (PsMAPK) rescues the Saccharomyces cerevisiae hog1 deletion mutant under
conditions of high osmotic stress. Plant Mol. Biol. 31, 355–363.
Qiu, J.-L., Fiil, B.K., Petersen, K., Nielsen, H.B., Botanga, C.J., Thorgrimsen, S., Palma,
K., Suarez-Rodriguez, M.C., Sandbech-Clausen, S., Lichota, J., et al. (2008a).
Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release
in the nucleus. The EMBO Journal 27, 2214–2221.
Qiu, J.-L., Zhou, L., Yun, B.-W., Nielsen, H.B., Fiil, B.K., Petersen, K., MacKinlay, J.,
Loake, G.J., Mundy, J., and Morris, P.C. (2008b). Arabidopsis Mitogen-Activated
Protein Kinase Kinases MKK1 and MKK2 Have Overlapping Functions in Defense
Signaling Mediated by MEKK1, MPK4, and MKS1. Plant Physiol. 148, 212–222.
Rasmussen, M.W., Roux, M., Petersen, M., and Mundy, J. (2012). MAP Kinase Cascades
in Arabidopsis Innate Immunity. Front Plant Sci 3, 169.
Ren, D., Liu, Y., Yang, K.-Y., Han, L., Mao, G., Glazebrook, J., and Zhang, S. (2008). A
fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis.
Rensing, S., Fritzowsky, D., Lang, D., and Reski, R. (2005). Protein encoding genes in an
ancient plant: analysis of codon usage, retained genes and splice sites in a moss,
Physcomitrella patens. BMC Genomics 6, 43.
Rensing, S., Ick, J., Fawcett, J., Lang, D., Zimmer, A., Peer, Y.V. de, and Reski, R.
(2007). An ancient genome duplication contributed to the abundance of metabolic genes
in the moss Physcomitrella patens. BMC Evolutionary Biology 7, 130.
Rensing, S.A., Lang, D., Zimmer, A.D., Terry, A., Salamov, A., Shapiro, H., Nishiyama,
T., Perroud, P.-F., Lindquist, E.A., Kamisugi, Y., et al. (2008). The Physcomitrella
96

Genome Reveals Evolutionary Insights into the Conquest of Land by Plants. Science 319,
64–69.
Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced endocytosis of the
pattern recognition receptor FLS2 in Arabidopsis. Genes Dev. 20, 537–542.
Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N.,
Malinovsky, F.G., Tör, M., De Vries, S., and Zipfel, C. (2011). The Arabidopsis Leucine-
Rich Repeat Receptor–Like Kinases BAK1/SERK3 and BKK1/SERK4 Are Required for
Innate Immunity to Hemibiotrophic and Biotrophic Pathogens. Plant Cell 23, 2440–2455.
Rushton, P.J., Somssich, I.E., Ringler, P., and Shen, Q.J. (2010). WRKY transcription
factors. Trends in Plant Science 15, 247–258.
Schaefer, D., Zryd, J.-P., Knight, C.D., and Cove, D.J. (1991). Stable transformation of
the moss Physcomitrella patens. Molecular and General Genetics MGG 226, 418–424.
Schaefer, D.G., and Zrÿd, J.-P. (1997). Efficient gene targeting in the moss
Physcomitrella patens. The Plant Journal 11, 1195–1206.
Schuhegger, R., Nafisi, M., Mansourova, M., Petersen, B.L., Olsen, C.E., Svatoš, A.,
Halkier, B.A., and Glawischnig, E. (2006). CYP71B15 (PAD3) Catalyzes the Final Step
in Camalexin Biosynthesis. Plant Physiol. 141, 1248–1254.
Schuler, M.A., Duan, H., Bilgin, M., and Ali, S. (2006). Arabidopsis cytochrome P450s
through the looking glass: a window on plant biochemistry. Phytochemistry Reviews 5,
205–237.
Schween, G., Egener, T., Fritzowsky, D., Granado, J., Guitton, M.-C., Hartmann, N.,
Hohe, A., Holtorf, H., Lang, D., Lucht, J.M., et al. (2005). Large-Scale Analysis of 73
329 Physcomitrella Plants Transformed with Different Gene Disruption Libraries:
Production Parameters and Mutant Phenotypes. Plant Biology 7, 228–237.
Segonzac, C., Feike, D., Gimenez-Ibanez, S., Hann, D.R., Zipfel, C., and Rathjen, J.P.
(2011). Hierarchy and Roles of Pathogen-Associated Molecular Pattern-Induced
Responses in Nicotiana benthamiana. Plant Physiol. 156, 687–699.
Segonzac, C., and Zipfel, C. (2011). Activation of plant pattern-recognition receptors by
bacteria. Current Opinion in Microbiology 14, 54–61.
Shen, Q.-H., and Schulze-Lefert, P. (2007). Rumble in the nuclear jungle:
compartmentalization, trafficking, and nuclear action of plant immune receptors. The
EMBO Journal 26, 4293–4301.
Shimizu, T., Nakano, T., Takamizawa, D., Desaki, Y., Ishii-Minami, N., Nishizawa, Y.,
Minami, E., Okada, K., Yamane, H., Kaku, H., et al. (2010). Two LysM receptor
molecules, CEBiP and OsCERK1, cooperatively regulate chitin elicitor signaling in rice.
Plant J 64, 204–214.
97

Shinya, T., Motoyama, N., Ikeda, A., Wada, M., Kamiya, K., Hayafune, M., Kaku, H.,
and Shibuya, N. (2012). Functional Characterization of CEBiP and CERK1 Homologs in
Arabidopsis and Rice Reveals the Presence of Different Chitin Receptor Systems in
Plants. Plant Cell Physiol 53, 1696–1706.
Shirasu, K. (2009). The HSP90-SGT1 Chaperone Complex for NLR Immune Sensors.
Annual Review of Plant Biology 60, 139–164.
Shiu, S.-H., Karlowski, W.M., Pan, R., Tzeng, Y.-H., Mayer, K.F.X., and Li, W.-H.
(2004). Comparative Analysis of the Receptor-Like Kinase Family in Arabidopsis and
Rice. Plant Cell 16, 1220–1234.
Sinha, A.K., Jaggi, M., Raghuram, B., and Tuteja, N. (2011). Mitogen-activated protein
kinase signaling in plants under abiotic stress. Plant Signal Behav 6, 196–203.
Slavikova, S., Ufaz, S., Avin-Wittenberg, T., Levanony, H., and Galili, G. (2008). An
autophagy-associated Atg8 protein is involved in the responses of Arabidopsis seedlings
to hormonal controls and abiotic stresses. J. Exp. Bot. 59, 4029–4043.
Šmídková, M., Holá, M., and Angelis, K.J. (2010). Efficient biolistic transformation of
the moss Physcomitrella patens. Biologia Plantarum 54, 777–780.
Son, G.H., Wan, J., Kim, H.J., Nguyen, X.C., Chung, W.S., Hong, J.C., and Stacey, G.
(2012). Ethylene-responsive element-binding factor 5, ERF5, is involved in chitininduced
innate immunity response. Mol. Plant Microbe Interact. 25, 48–60.
Specht, K.M., and Shokat, K.M. (2002). The emerging power of chemical genetics.
Current Opinion in Cell Biology 14, 155–159.
Struhl, K., Stinchcomb, D.T., Scherer, S., and Davis, R.W. (1979). High-frequency
transformation of yeast: autonomous replication of hybrid DNA molecules. PNAS 76,
1035–1039.
Stumpe, M., Göbel, C., Faltin, B., Beike, A.K., Hause, B., Himmelsbach, K., Bode, J.,
Kramell, R., Wasternack, C., Frank, W., et al. (2010). The moss Physcomitrella patens
contains cyclopentenones but no jasmonates: mutations in allene oxide cyclase lead to
reduced fertility and altered sporophyte morphology. New Phytologist 188, 740–749.
Suarez-Rodriguez, C.M., Petersen, M., and Mundy, J. (2010). Mitogen-Activated Protein
Kinase Signaling in Plants. Annual Review of Plant Biology 61, 621–649.
Suarez-Rodriguez, M.C., Adams-Phillips, L., Liu, Y., Wang, H., Su, S.-H., Jester, P.J.,
Zhang, S., Bent, A.F., and Krysan, P.J. (2007). MEKK1 Is Required for Flg22-Induced
MPK4 Activation in Arabidopsis Plants. Plant Physiol. 143, 661–669.
Suzuki, N., Koussevitzky, S., Mittler, R., and Miller, G. (2012). ROS and redox
signalling in the response of plants to abiotic stress. Plant, Cell & Environment 35, 259–
270.
98

Swiderski, M.R., Birker, D., and Jones, J.D.G. (2009). The TIR Domain of TIR-NB-LRR
Resistance Proteins Is a Signaling Domain Involved in Cell Death Induction. Molecular
Plant-Microbe Interactions 22, 157–165.
Takahashi, A., Casais, C., Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with
RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis.
PNAS 100, 11777–11782.
Tameling, W.I.L., Vossen, J.H., Albrecht, M., Lengauer, T., Berden, J.A., Haring, M.A.,
Cornelissen, B.J.C., and Takken, F.L.W. (2006). Mutations in the NB-ARC Domain of I-
2 That Impair ATP Hydrolysis Cause Autoactivation. Plant Physiol. 140, 1233–1245.
Tarr, D.E., and Alexander, H. (2009). TIR-NBS-LRR genes are rare in monocots:
evidence from diverse monocot orders. BMC Research Notes 2, 197.
Teige, M., Scheikl, E., Eulgem, T., Dóczi, R., Ichimura, K., Shinozaki, K., Dangl, J.L.,
and Hirt, H. (2004). The MKK2 pathway mediates cold and salt stress signaling in
Arabidopsis. Mol. Cell 15, 141–152.
The Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the
flowering plant Arabidopsis thaliana. Nature 408, 796–815.
Thelander, M., Olsson, T., and Ronne, H. (2005). Effect of the energy supply on
filamentous growth and development in Physcomitrella patens. J. Exp. Bot. 56, 653–662.
Thompson, A.R., Doelling, J.H., Suttangkakul, A., and Vierstra, R.D. (2005). Autophagic
Nutrient Recycling in Arabidopsis Directed by the ATG8 and ATG12 Conjugation
Pathways. Plant Physiol. 138, 2097–2110.
Thordal-Christensen, H., Zhang, Z., Wei, Y., and Collinge, D.B. (1997). Subcellular
localization of H2O2 in plants. H2O2 accumulation in papillae and hypersensitive
response during the barley—powdery mildew interaction. The Plant Journal 11, 1187–
1194.
Torres, M.A., and Dangl, J.L. (2005). Functions of the respiratory burst oxidase in biotic
interactions, abiotic stress and development. Current Opinion in Plant Biology 8, 397–
403.
Vellosillo, T., Vicente, J., Kulasekaran, S., Hamberg, M., and Castresana, C. (2010).
Emerging Complexity in Reactive Oxygen Species Production and Signaling during the
Response of Plants to Pathogens. Plant Physiol. 154, 444–448.
Vij, S., Giri, J., Dansana, P.K., Kapoor, S., and Tyagi, A.K. (2008). The Receptor-Like
Cytoplasmic Kinase (OsRLCK) Gene Family in Rice: Organization, Phylogenetic
Relationship, and Expression during Development and Stress. Mol. Plant 1, 732–750.
99

Wada, S., Ishida, H., Izumi, M., Yoshimoto, K., Ohsumi, Y., Mae, T., and Makino, A.
(2009). Autophagy Plays a Role in Chloroplast Degradation during Senescence in
Individually Darkened Leaves. Plant Physiol. 149, 885–893.
Wan, J., Zhang, S., and Stacey, G. (2004). Activation of a mitogen-activated protein
kinase pathway in Arabidopsis by chitin. Molecular Plant Pathology 5, 125–135.
Wang, H., Ngwenyama, N., Liu, Y., Walker, J.C., and Zhang, S. (2007). Stomatal
Development and Patterning Are Regulated by Environmentally Responsive Mitogen-
Activated Protein Kinases in Arabidopsis. PLANT CELL 19, 63–73.
Wang, Y., Chen, J.-Q., Araki, H., Jing, Z., Jiang, K., Shen, J., Tian, D., and Zhou, T.
(2004). Genome-wide identification of NBS genes in japonica rice reveals significant
expansion of divergent non-TIR NBS-LRR genes. Molecular Genetics and Genomics 271,
402–415.
Wees, V., C.m, S., Chang, H.-S., Zhu, T., and Glazebrook, J. (2003). Characterization of
the Early Response of Arabidopsis to Alternaria Brassicicola Infection Using Expression
Profiling. Plant Physiol. 132, 606–617.
Wellman, C.H., Osterloff, P.L., and Mohiuddin, U. (2003). Fragments of the earliest land
plants. Nature 425, 282–285.
Willmann, R., Lajunen, H.M., Erbs, G., Newman, M.-A., Kolb, D., Tsuda, K., Katagiri,
F., Fliegmann, J., Bono, J.-J., Cullimore, J.V., et al. (2011). Arabidopsis lysin-motif
proteins LYM1 LYM3 CERK1 mediate bacterial peptidoglycan sensing and immunity to
bacterial infection. PNAS 108, 19824–19829.
Wurzinger, B., Mair, A., Pfister, B., and Teige, M. (2011). Cross-talk of calciumdependent
protein kinase and MAP kinase signaling. Plant Signal Behav 6, 8–12.
Xie, Z., and Klionsky, D.J. (2007). Autophagosome formation: core machinery and
adaptations. Nature Cell Biology 9, 1102–1109.
Xiong, Y., Contento, A.L., Nguyen, P.Q., and Bassham, D.C. (2007). Degradation of
Oxidized Proteins by Autophagy during Oxidative Stress in Arabidopsis. Plant Physiol
143, 291–299.
Xue, J.-Y., Wang, Y., Wu, P., Wang, Q., Yang, L.-T., Pan, X.-H., Wang, B., and Chen,
J.-Q. (2012). A Primary Survey on Bryophyte Species Reveals Two Novel Classes of
Nucleotide-Binding Site (NBS) Genes. PLoS ONE 7, e36700.
Yang, Z., and Klionsky, D.J. (2010). Eaten alive: a history of macroautophagy. Nature
Cell Biology 12, 814–822.
Yano, K., Suzuki, T., and Moriyasu, Y. (2007). Constitutive Autophagy in Plant Root
Cells. Autophagy 3, 360–362.
100

Ülker, B., and Somssich, I.E. (2004). WRKY transcription factors: from DNA binding
towards biological function. Current Opinion in Plant Biology 7, 491–498.
Yoo, S.-D., Cho, Y.-H., Tena, G., Xiong, Y., and Sheen, J. (2008). Dual control of
nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature 451, 789–795.
Yoshimoto, K., Hanaoka, H., Sato, S., Kato, T., Tabata, S., Noda, T., and Ohsumi, Y.
(2004). Processing of ATG8s, Ubiquitin-Like Proteins, and Their Deconjugation by
ATG4s Are Essential for Plant Autophagy. Plant Cell 16, 2967–2983.
Yoshimoto, K., Jikumaru, Y., Kamiya, Y., Kusano, M., Consonni, C., Panstruga, R.,
Ohsumi, Y., and Shirasu, K. (2009). Autophagy Negatively Regulates Cell Death by
Controlling NPR1-Dependent Salicylic Acid Signaling during Senescence and the Innate
Immune Response in Arabidopsis. Plant Cell 21, 2914–2927.
Zeng, Q., Chen, J.-G., and Ellis, B.E. (2011). AtMPK4 is required for male-specific
meiotic cytokinesis in Arabidopsis. The Plant Journal 67, 895–906.
Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L., Chai, J.,
et al. (2007). A Pseudomonas syringae Effector Inactivates MAPKs to Suppress PAMP-
Induced Immunity in Plants. Cell Host & Microbe 1, 175–185.
Zhang, N., Castlebury, L.A., Miller, A.N., Huhndorf, S.M., Schoch, C.L., Seifert, K.A.,
Rossman, A.Y., Rogers, J.D., Kohlmeyer, J., Volkmann-Kohlmeyer, B., et al. (2006). An
overview of the systematics of the Sordariomycetes based on a four-gene phylogeny.
Mycologia 98, 1076–1087.
Zhang, Z., Wu, Y., Gao, M., Zhang, J., Kong, Q., Liu, Y., Ba, H., Zhou, J., and Zhang, Y.
(2012). Disruption of PAMP-Induced MAP Kinase Cascade by a Pseudomonas syringae
Effector Activates Plant Immunity Mediated by the NB-LRR Protein SUMM2. Cell Host
& Microbe 11, 253–263.
Zheng, Z., Qamar, S.A., Chen, Z., and Mengiste, T. (2006). Arabidopsis WRKY33
transcription factor is required for resistance to necrotrophic fungal pathogens. The Plant
Journal 48, 592–605.
Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D.G., Boller, T., and Felix, G.
(2006). Perception of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts
Agrobacterium-Mediated Transformation. Cell 125, 749–760.
Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G., and Boller,
T. (2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature
428, 764–767.
Zurbriggen, M.D., Carrillo, N., and Hajirezaei, M.-R. (2010). ROS signaling in the
hypersensitive response. Plant Signal Behav 5, 393–396.
101

Manuscript 1
Submitted to PLOS Pathogen
102

A MAP kinase regulates innate immunity triggered by pathogen
associated molecular patterns in the moss Physcomitrella patens
Simon Bressendorff 1 , Inés Ponce de León 2 , Raquel Azevedo 1 and Morten Petersen 1*
1 Department of Molecular Biology, University of Copenhagen, Copenhagen, Denmark
2 Departamento de Biología Molecular, Instituto de Investigaciones Biológicas Clemente
Estable, Montevideo, Uruguay
* E-mail: shutko@bio.ku.dk
Abstract
In eukaryotes, the activation of pattern recognition receptors by pathogen-associated
molecular patterns (PAMPs), such as fungal chitin or bacterial flagellin, elicit PAMPtriggered
immunity via MAP kinase cascades. Given the agronomic importance of
disease resistance, much is known about such immune pathways in higher plants and
crops. In contrast, very little is known about how early land plants evolved immune
responses. Here we provide a primary example of a MAP kinase that is required for
pathogen resistance in the phylogenetically ancient moss Physcomitrella patens. We
show that P. patens MAP kinase 4A is phosphorylated in response to fungal chitin or a
complement of bacterial PAMPs, but not in response to a PAMP derived from bacterial
flagellin (flg22 peptide). We also show that knock-out of MAP kinase 4A renders the
moss more susceptible to the pathogenic fungi Botrytis cinerea and Alternaria
brassisicola, and that defense-related moss transcripts fail to accumulate in the knock-out
103

mutant upon treatment with fungal chitosan. While related MAP kinases in the higher
plant model Arabidopsis thaliana are activated both by pathogen inoculation and by
abiotic stress, we did not detect activation of MAP kinase 4A or any other P. patens MAP
kinase by several abiotic stresses. Signal transduction via MAP kinase 4A may therefore
be specific to PAMP-triggered immunity, and the moss may use other signaling
components to respond to abiotic stresses.
Introduction
In eukaryotes, innate immune systems play predominant roles in pathogen detection and
elimination. Plants and animals have evolved surface-localized surveillance systems
consisting of pattern-recognition receptors (PRRs) that recognize evolutionarily
conserved pathogen-associated molecular patterns (PAMPs) [1]. Examples of PAMP
recognition in plants include the perception of bacterial flagellin by the receptor-like
kinase (RLK) FLS2, perception of bacterial elongation factor Tu by the closely related
EFR, and fungal chitin by the LysM RLK CERK1 [2,3,4].
In higher eukaryotes, MAP kinase cascades transmit and amplify signals from
PRRs to the nucleus. MAP kinase cascades consist of a MAP kinase kinase kinase
(MPKKK), a MAP kinase kinase (MPKK) and a MAP kinase (MPK) and signals from
upstream components [5]. In A. thaliana, four MPKs (MPK3/4/6 and 11) are involved in
signalling upon PRR activation [6,7]. In addition to their roles in immunity, these MPKs
have also been implicated in responses to abiotic stresses and in developmental processes
[5]. However, the contribution and importance of the single MPKs in A. thaliana
104

immunity is unclear, and some of their loss-of-function mutants exhibit seedling lethality,
inappropriate defense activation and dwarfism which complicates their analysis [8,9,10].
The moss P. patens is a nonvascular bryophyte and represents an early branch of land
plants. Although P. patens shares basic processes with flowering plants, the two lineages
shared a common ancestor at least 450 million years ago [11]. Recent studies have shown
that P. patens may be a good model for studying plant pathogen interactions. It is
susceptible to a range of pathogens including fungi, oomycetes and bacteria which
activate several defense mechanisms including production of apoplastic reactive oxygen
species (ROS), cell wall fortifications and expression of defense related genes [12,13,14].
However, little is known about how P. patens perceives pathogens and activates
responses, and the functions of PRRs and MPKs in moss signaling cascades has not been
studied.
The A. thaliana genome encodes 20 MPKs whereas a recent study on the
phylogeny of MPKs showed that there are some 8 MPKs in P. patens [15]. This limited
set of moss MPKs may represent a “basal” set of MAP kinase pathways, and targeted
deletion of single moss MPKs via homologous recombination may help to elucidate the
complexity of MPK activation in higher plants. Studying the repertoire of PAMPs that
can activate MPKs and induce innate immune responses in organisms that diverged in the
lineage to vascular plants will also help us understand how plant surveillance systems
adapted to different types of microbes.
A. thaliana MPK4 (AtMPK4) has been proposed to function in a cascade(s) that
includes the MAP kinase kinases MKK1 and MKK2 and the MPKKK MEKK1[16,17].
105

Different abiotic stresses can activate AtMPK4, and PAMPs activate this kinase and
release the WRKY33 transcription factor from AtMPK4 complexes [17,18,19]. In
addition, A. thaliana mpk4 loss-of-function mutants exhibit extreme dwarfism and
ectopically express defense responses, suggesting that AtMPK4 functions as a negative
regulator of defense [9]. Whereas a recent report implicated AtMPK4 as a negative
regulator of the SUMM1 MPKKK [20], another report partially explained how AtMPK4
could function as a positive regulator of immunity [10]. These differing observations
indicate that studies of MPKs in different evolutionary models may elucidate their basal
and subsequently acquired functions.
To initiate studies on the innate immune responses of P. patens, and to address
questions about MPKs in basal land plants, we identified moss homologs of A. thaliana
MPK4. Interestingly, the targeted knock out mutant of one P. patens MPK4 homolog
(ΔPpMPK4A) had no obvious phenotypic differences compared to wild type plants and
did not exhibit constitutive defense activation. However, we found that the PpMPK4A
kinase is phosphorylated, and presumably activated, following exposure to bacterial and
fungal PAMPs. Activation of PpMPK4A contributes to immunity since ΔPpMPK4A
mutant is more susceptible to the necrotrophic fungi. Furthermore, we could not detect
activation of PpMPK4A or other MPKs in P. patens in response to various abiotic
stresses. These results indicate that PpMPK4A specifically functions in pathways below
PAMP reception, and that MPK functions in abiotic stress responses may have appeared
at later stages of plant evolution, or these traits were lost in the moss lineage.
Results
106

Two MPKs in P. patens are homologs of AtMPK4
Dóczi et al. (2012) recently published the phylogenetic relationship of MPKs from ten
plant genomes including P. patens [15]. In P. patens there are eight putative MPKs, two
with homology to group B MPKs in A. thaliana which include AtMPK4/5/11/12 and13
[21]. Dóczi et al. (2012) could not establish a clear orthologous relationships between
MPKs from A. thaliana and basal land plants including P. patens. Nonetheless, the two
P. patens MPKs in group B had the highest sequence similarity to AtMPK4, and we
therefore named them PpMPK4A (Phypa 446407) and PpMPK4B (Phypa 435424). A
pairwise sequence alignment using the BLOSSUM30 matrix showed 83.6% similarity
between AtMPK4 and PpMPK4A and 86.1% similarity between AtMPK4 and PpMPK4B,
while the similarity between the two P. patens homologs is 84.8% (Figure 1S).
PpMPK4A accumulates in the presence of chitosan
Treatments that affect the biochemical activity of regulatory proteins, including MAP
kinases, can also alter the expression of their corresponding mRNAs [22]. P. patens
responds to fungal-derived elicitors or PAMPs like chitosan [23], but lacks obvious
homologs of the well-studied PAMP receptors FLS2 and EFR that bind the bacterial
PAMPs flagellin and EF-Tu [24]. We therefore examined the expression of PpMPK4A
and PpMPK4B upon treatment of P. patens with chitosan. To this end, 14 day-old wildtype
moss colonies where sprayed with 100 µg/ml chitosan and mRNA was isolated at
different time points. Interestingly, PpMPK4A mRNA was highly induced by chitosan
treatment already after 15 minutes, peaking at an eight-fold induction after two hours and
107

eturning to normal level by eight hours (Figure 1). In contrast, PpMPK4B mRNA was
only marginally affected by this treatment.
Generation of targeted PpMPK4B knock-out mutants
The correlation between chitosan treatment and the expression of PpMPK4A mRNA
indicated that this MPK could play a role in P. patens innate immune responses. For lossof-function
analysis of PpMPK4A, the gene was replaced with a selection marker cassette
by homologous recombination [25]. After two rounds of selection, surviving colonies
were examined by PCR and two lines in which PpMPK4A specific primers failed to
amplify DNA were selected (Figure 2A and Table S1). First, we examined for correct 3’
and 5’ integration as well as full-length amplification (Figure 2B). Full length
amplification with an external primer set was only possible in the ΔPpMPK4A-1 line,
indicating that the disruption in ΔPpMPK4A-2 was caused by concatemeric integration at
the locus since the 3’ primer and 5’ primer sets showed correct integration (Figure 2B).
The full length PCR product from line ΔPpMPK4A-1 was sequenced to verify correct
integration. Gene disruption was further verified since RT-PCR amplification of the
corresponding PpMPK4A mRNAs was only possible in wild type (WT) and not in the
two independent KO lines (Figure 2C).
As noted above, loss of function mutants of A. thaliana MPK4 exhibit derepression
of innate immune responses and stunted growth [9]. Interestingly, the
ΔPpMPK4A KO lines did not exhibit such characteristics and appeared similar to the WT
under different growth regimes. This indicates that AtMPK4 and/or the pathways in
which it acts may have evolved additional functions compared to that of PpMPK4A.
108

We also repeatedly attempted to make PpMPK4B KO lines with two different KO
vectors, but could not obtain any viable PpMPK4B KO lines. A. thaliana AtMPK4 and
AtMPK6 have recently been shown to be involved in important developmental features of
cytoskeletal regulation [26,27]. It is therefore possible that PpMPK4B performs essential
functions in P. patens whose fewer MPK genes may provide less functional redundancy
than the larger MPK gene families of higher plants.
ΔPpMPK4A is highly susceptible to necrotrophic pathogens
The four A. thaliana MAP kinases AtMPK3/4/6 and 11 have been shown to function in
PTI signaling, but some controversy exists about their individual functions in innate
immunity [7,8,10,17,28]. In contrast, nothing is known about the functions of MPKs in P.
patens innate immunity. Since PpMPK4A mRNA responds to fungal chitosan, and
necrotrophic fungi have previously been shown to induce defense responses in moss
[29,30], we examined the susceptibility of the two ΔPpMPK4A lines to the necrotrophic
fungus Alternaria brassicicola compared to wild type using a previously described spore
count assay [31]. 14-day-old colonies of wild type and the ΔPpMPK4A lines were dropinoculated
with a fungal spore suspension and colonies were carefully harvested after
four days for spore counting. As seen in Figure 3A, the fungus produced significantly
more spores in the two independent KO lines of ΔPpMPK4A compared to wild type.
We then extended this analysis and inoculated the ΔPpMPK4A mutants and wild
type colonies with Botrytis cinerea. A hallmark of B. cinerea infection is host cell death
detectable by Evans blue staining [12], and both ΔPpMPK4A mutant lines exhibited
massive cell death compared to wild type (Figure 3B). Taken together, these results
109

indicate that PpMPK4A is required for defense responses aimed at combating the
necrotrophic fungal pathogens Alternaria brassicicola and Botrytis cinerea.
Defense-related gene transcripts fail to accumulate in ΔPpMPK4A
To analyze whether the expression of defense related genes was altered in ΔPpMPK4A,
we characterized the expression of several genes upon chitosan treatment. The genes
chosen are known to be involved in defense against pathogens and/or are induced by
chitosan in both A. thaliana and P. patens: PAL4, CHS, ERF2, a-DOX, LOX7 and NOX
[14,32]. In wild type plants these genes were induced after chitosan treatment compared
to controls (Figure 4) and treatment without chitosan did not induce any of the genes
(CHS is shown as an example, FigureS2A). Notably, all of these genes were upregulated
to a lesser extent in the ΔPpMPK4B-1 line compared to wild type upon chitosan
treatment (Figure 4). In wild type, PAL, CHS, ERF2 and LOX7 transcript levels after
chitosan treatment were already elevated after 15 min and peaked 2h after treatment,
while NOX peaked after 4h. a-DOX started accumulating after 1h and peaked at 4h after
treatment. In ΔPpMPK4A-1, accumulation of the transcripts occurred later and to a lesser
extent than in wild type (Figure 4). This failure to accumulate a group of defense related
genes in the ΔPpMPK4A-1 line points to a role of PpMPK4A in signal transduction from
chitin perception at the cell wall to the activation of defense genes.
Since the expression of the defense-related genes is not fully inhibited in
ΔPpMPK4A, it is possible that PpMPK4B and PpMPK4A are partially redundant. As
there was no significant difference in the expression pattern of PpMPK4B in wild type
110

versus ΔPpMPK4A-1 (Figure S2B), the expression of PpMPK4B was not altered in
ΔPpMPK4A to compensate for the absence of PpMPK4A.
PAMP-induced phosphorylation of PpMPK4A
A. thaliana MPK3/4/6/11 are all thought to function below PRRs and to be
phosphorylated upon PAMP treatment [2,7]. Since our data suggested that PpMPK4A
functions as a signaling component below PRRs in P. patens, we examined if PpMPK4A
and other MAP kinases were phosphorylated and thereby activated upon different PAMP
treatments.
To this end we first performed immunoblot analysis of proteins extracted from
wild-type and the two PpMPK4A KO lines after spraying with 1 mg/ml chitin with antiphospho-p44/42
antibodies. In wild-type controls, two MPKs became rapidly
phosphorylated upon chitin treatment. Significantly, phosphorylation of only one MPK
form was detected in the PpMPK4A KO lines (Figure 5A). Given the predicted molecular
weights of PpMPK4A (42.84 kD) and PpMPK4B (43.49 kD), the upper band present in
the wild type and KO lines is probably phosphorylated PpMPK4B, while the lower band
only seen in wild type is phosphorylated PpMPK4A. A similar phosphorylation pattern
was seen upon treatment with 100 µg/ml chitosan, a deacetylated
β-1,4-linked
glucosamine derivative of chitin (Figure S3A).
To assess if activation of the MPKs by chitin and chitosan was similar to that
upon pathogen infection, moss colonies were sprayed with spores of B. cinerea. As seen
in Figure 5A and S3A, several bands were detected in the immunoblot upon infection
with B. cinerea spores, indicating phosphorylation of several MPKs including PpMPK4A
111

(Figure 5B). The phosphorylation signals detected after infection with fungal spores were
weaker than the signals detected after chitin treatment. The film was therefore exposed
for a longer time, resulting in some background signals seen as weak bands in the
untreated samples of both WT and ΔPpMPK4A (0 min samples, Figure5B) Interestingly,
the band corresponding to PpMPK4A was again absent in the ΔPpMPK4A-1 mutant.
Significantly, the strong phosphorylation of wild type PpMPK4A at 16 minutes and 60
minutes after infection, combined with the increased susceptibility of ΔPpMPK4A to B.
cinerea infection, points to the importance of PpMPK4A activation in signal transduction
from a receptor to activate defense responses.
A. thaliana MPK3/4/6/11 are all phosphorylated when the FLS2 receptor is
activated by the flg22 PAMP [2,7], a small, conserved peptide of bacterial flagellin [33].
Another PAMP that triggers MPK phosphorylation is elf18 [34], a conserved peptide of
bacterial elongation factor EF-Tu [4]. To assess the specificity of the chitin-induced
activation of PpMPK4A & B, we also treated wild-type moss colonies with flg22 and
with elf18. No MPK phosphorylation was detected in response to flg22 or elf18, in
keeping with the apparent absence of close homologues of the respective cognate
immune receptors FLS2 and EFR in the P. patens genome (Figure 5C).
We extended our analysis by attempting to detect whether P. patens MPKs are
phosphorylated upon treatment with other bacterial PAMPs. To this end we treated the
moss with cell-free culture filtrates from two strains of Pectobacterium carotovorum ssp.
carotovorum (P.c. carotovorum, formerly named Erwinia carotovora ssp. carotovora). .
The P.c. carotovorum SCC1 strain produces the PAMP HrpN, while P.c. carotovorum
SCC3193 is a harpin (HrpN)-negative strain. While culture filtrates of both strains induce
112

defense responses in P. patens, filtrates of the harpin-secreting strain induce much
stronger responses than filtrates of the HrpN-negative strain [30]. In keeping with these
findings, culture filtrates from both strains induced the activation of PpMPK4A and other
MPK(s) (Figure 5D), indicating that different MPKs are phosphorylated whether or not
harpin has been secreted into the culture. However, in the ΔPpMPK4A-1 mutant, the
lower band corresponding to PpMPK4A was again absent (Figure 5D). This indicates
that the moss possesses PRRs that also recognize bacterial PAMPs, and that PpMPK4A
most likely functions to transduce signals from a number of them.
We next assessed whether PpMPK4A could act downstream of ROS production
in PAMP signaling. We found that PpMPK4A&B were phosphorylated in wild type
treated with exogenous hydrogen peroxide [35] and, again, the lower band was absent in
ΔPpMPK4A (Figure 5E). This indicates that PpMPK4A functions downstream of ROS in
PAMP signaling.
A. thaliana MPK3/4/6 are all phosphorylated by various abiotic stresses including
osmotic and cold stress, UV light and wounding [19,36,37,38], and P. patens have
previously been shown to respond at the level of gene expression upon exposure to UVlight,
salt stress and cold [39,40,41]. Surprisingly, we did not detect phosphorylation of
any MPKs after stress treatments including salt (Figure S3B), cold, UV light, or
wounding (Figure S3C).
Discussion
Map kinases are key transducers of extracellular stimuli in eukaryotes [5]. In vascular
plants, numerous MAP kinases have been shown to regulate signaling cascades
113

downstream of immune receptors [42]. However, the specific requirement for individual
MAP kinases in these processes remains poorly understood. The results presented here
show that immunity in the moss P. patens involves PAMP recognition that activates
defense responses via MAP kinases including PpMPK4A. In addition, PpMPK4A
represents a primary example in early land plants of a MAP kinase that does not respond
to various stress treatments. Instead, our results indicate that this MAP kinase primarily
functions in innate immunity and thus differs from its closest homologues in higher
plants such as A. thaliana. That we were unable to detect phosphorylation of MAP
kinases upon exposure to different abiotic stresses is surprising. Although we cannot
exclude the possibility that our stress conditions may be suboptimal, rapid responses to
similar treatments have been documented in vascular plants [19,36,37,38]. An
explanation for this apparent difference may be that the limited set of MAP kinases in
moss does not function in abiotic stress responses. If so, other types of kinases or
regulators may be involved in abiotic stress signal transduction in moss, and MPK
functions in abiotic stress signaling evolved subsequently in higher plant lineages.
The apparent phosphorylation of PpMPK4B indicates that it also play roles in
PAMP signaling. However, our inability to produce a ΔPpMPK4B KO lines makes it
difficult to clarify such a function at this stage. However, the strong immunity
phenotypes of ΔPpMPK4A indicates that these two MPKs have different roles in PAMP
signaling. Future studies using kinase chemical-genetic approaches in P. patens may help
to clarify PpMPK4B functions [43].
PpMPK4A is phylogenetically related to AtMPK4 but, in apparent contrast to the
Atmpk4 mutant, the ΔPpMPK4A mutant appears phenotypically normal under all growth
114

conditions tested. While this suggests that PpMPK4A and AtMPK4 have different
functions, both kinases are responsive to PAMPs and many studies have shown that
AtMPK4 positively regulates PAMP triggered immunity [17]. One explanation for their
apparently different functions is that AtMPK4 and its orthologues in higher plants have
evolved additional functions. A second explanation relates to the evolution of host plant
systems for monitoring pathogen infections. Successful pathogens deliver into host cells
various effectors which modify host proteins and manipulate the host cell machinery to
suppress immune responses [44]. Plants have developed mechanisms to detect these
microbial effectors via cytoplasmic immune receptors (termed resistance R-proteins) that
typically trigger a rapid, localized programmed cell death (PCD) reaction known as the
hypersensitive response (HR) [45]. R proteins may thus guard effector targets or guardees
[46]. Zhang et al. (2012) recently reported that the absence of AtMPK4 in the A. thaliana
mpk4 mutant triggers immunity via a resistance protein [10]. Since AtMPK4 is a key
signaling component in PAMP surveillance, AtMPK4 (or a complex or pathway
containing it) may be targeted by pathogen effectors to block its activation by PAMPs
and thereby prevent defense gene activation. It is therefore possible that, in the
evolutionarily older moss, PpMPK4A is not guarded. This may have enabled us to assess
the phenotype and function of the ΔPpMPK4A mutant more readily than has been the
case for the Atmpk4 mutant. In addition, it would be interesting to examine whether our
failure to isolate PpMPK4B mutants is because this kinase performs essential functions or
is in fact guarded. Although some 18 R genes are found in P. patens [47] it still needs to
be demonstrated that they function like the well studied R genes in vascular plants.
115

Material and methods
Growth conditions
Physcomitrella patens (Gransden 2004 strain) was grown on BCDAT media (250 mg/l
MgSO 4·7H 2 O, 250 mg/l KH 2 PO 4 , 1010 mg/l KNO 3 , 920 mg/l Ammonium tartrate, 12.5
mg/l FeSO 4·7H 2 O, 147 mg/l CaCl 2·2H 2 O, trace elements (614 μg/l H 3 BO 3 , 389 μg/l
MnCl 2·4H 2 0, 110 μg/l AlK(S0 4 ) 2·12H 2 O, 55 μg/l CoCl 2·6H 2 0, 55 μg/l CuSO 4·5H 2 0, 55
μg/l ZnS0 4·7H 2 0, 28 μg/l KBr, 28 μg/l KI, 28 μg/l LiCl, 28 μg/l SnCl 2·2H 2 0, 25 μg/l
Na 2 MoO 4·2H 2 O, 59 μg/μl NiCl 2·6H 2 0)) [48], pH 6.5 adjusted with KOH, solidified with
agar 8 g/l and overlaid with cellophane discs (AA Packaging Ltd.). Colonies were grown
at 22°C for two weeks in 55 µE m -2 s -1 in a long day regime of 16h light/8h dark. Botrytis
cinerea and Alternaria brassicicola were cultivated on 24 g/l potato dextrose agar (PDA)
(Difco, Detroit, MI, USA) at 22°C for app. two weeks until sporulation was dense.
Spores were collected in H 2 O, filtered through Miracloth and concentration was
determined using a hemocytometer. Pectobacterium carotovorum subsp. carotovorum
SCC3193 and Pectobacterium carotovorum subsp. carotovorum SCC1 were grown over
night in LB media at 28°C. Cell densities were adjusted to equal O.D. with LB media.
The cells were removed by centrifugation and the supernatant were sterile filtered using a
0.20 µm filter (Thermo Scientific).
Generation of knock out mutants
The P. patens transformation vector pMBL10a was kindly provided by David Cove.
For PpMPK4A transformation, vector flanking regions of gene Phypa 446407
(Pp1s14939V6.1) was amplified using primer LBF+LBR and RBF+RBR (Table S1). The
116

esulting PCR fragments were cloned into pCR®-Blunt II-TOPO® (Invitrogen) and
transformed into E. coli. The LB fragment was cut from the TOPO vector using
restriction enzymes Not1 and BamH1, and the resulting 651 bp fragment ligated using T4
fast ligase (Promega) into pMBL10a linearized with Not1 and BamH1. Subsequently, the
RB fragment was cloned into pMBL10a containing the LB. The RB fragment was cut
from Topo vector with EcoRV, and the resulting 737 bp fragment ligated into pMBL10a
containing LB linearized with EcoRV and desphosphorylated using shrimp alkaline
phosphatase (Affymetrix). The transformation cassette was excised from the resulting
vector, with Not1 and Xba1. P. patens protoplasts were transformed with 30 μg of vector
DNA using PEG as previously described [25]. Stable transformants were identified by
two rounds of selection: initial selection on media supplemented with 40 μg/ml G418
(Sigma) for two weeks, then a non-selective release step of two weeks, and finally two
weeks of G418 selection.
Plant treatments for MAPK phosphorylation assay
Unless otherwise stated, all treatments were applied by spraying 3 ml of the solution used
for the treatment onto a Petri dish (9 cm) with 16 colonies of 14 day- old moss grown on
BCDAT media overlaid with cellophane. Chitin oligosaccharide (Yaizu Suisankagaku
Industry) was diluted to 1 mg/ml in H 2 O. The chitosan (Sigma Aldrich, 448869) used in
this study contains 75-85% deacetylated, low molecular weight chitin (50,000 - 190,000
daltons). It was made water-soluble by dissolving 100 µg/ml in 0.010% acetic acid and
then adjusting the pH to 5.5 with NaOH. 0.010% acetic acid adjusted to pH 5.5 with
117

NaOH was used as a control. For MPK phosphorylation Western blot with B. cinerea,
2x10 6 spores per ml were sprayed onto the colonies. Cold stress was applied by moving
the cellophane disc with 14 day-old colonies onto prechilled BCDAT plated on ice. The
surface temperature was measured during the experiment at 1-2°C. UV light stress was
applied in two ways. For UV(1), colonies were subjected to UV light from a Geldoc 2000
containing six UV-B tubes (G8T5E, Ushio) and flash-frozen at the indicated times. For
UV(2), colonies were subjected to 120 mJ cm -2 UV-B (Stratalinker 1800, Stratagene) and
flash-frozen after 15 min. Wounding was conducted by squeezing two colonies in an
Eppendorf tube using a pestle which was then flash-frozen at the indicated time.
Alternaria spore counting assay
The Alternaria spore counting assay was adapted from Wees et al. [31]. A. brassicicola
spores were harvested in H 2 O from 14-day-old plates and counted in a hemocytometer.
Moss colonies were infected by placing 5 µl of 2x10 5 A. brassicicola spores/ml on top of
each colony. Four plates of each line, each with 16 colonies, were drop inoculated. Four
days later the 16 colonies from each plate were carefully transferred to a tube containing
8 ml of 0.01% (v/v) Tween 20 (Sigma-Aldrich) and shaken vigorously. The numbers of
spores in the liquid were counted in a hemocytometer. Each data point is an average of
four pools of 16 colonies per genotype. An analysis of variance followed by a Tukey's
test was used to assess the statistical difference between the WT and the two KOs. The
experiment was repeated twice with similar results.
Evans blue staining for detection of cell death
118

Measurement of cell death with Evans blue staining was done similarly to the assay
described by Oliver et al. [32]. Four plates of each line, each with 16 colonies, were
sprayed with 3 ml of 2x10 5 B. cinerea spores per ml and one plate sprayed with water.
Two days later, the colonies were incubated in 0.1% Evans blue (Bie & Berntsen) in 0.5x
PBS for 2 hours followed by washing four times in H 2 O. They were then destained in
50% (v/v) methanol, 1% SDS at 60°C for 30 min. and the O.D. at 600 nm measured.
Colonies were dried over night at 70°C and weighed. Each data point is presented as O.D.
(600nm)/mg dry weight as an average of four samples of 16 colonies each. An analysis of
variance followed by a Tukey's test was applied to assess the significance of the
difference. The experiment was repeated twice with similar results.
RNA extraction and quantitative RT-PCR
Two 14 day-old colonies were sampled at each time point after spraying with 100 µg/ml
chitosan or control and flash frozen in liquid nitrogen. RNA was extracted with
NucleoSpin RNA plant (Macherey-Nagel) according to the manufacturer’s protocol.
RNA concentrations were measured using a Nano Drop 1000 (Thermo Scientific) and
adjusted to 5 ng/μl. Quantitative PCR was done using Brilliant II SYBR green one step
kit (Agilent Technologies) with 10 pmol of each primer and 12.5 ng total RNA in 10 µl.
Reactions were run on a CFX 96 Thermocycler (BioRad) three times, and means of
normalized expression were calculated according to Pfaffl [49]. Primers used for qPCR
are in supplementary Table S2.
MAP Kinase Assay
119

Three 14-day-old colonies were flash-frozen at the given time point after treatment.
Protein was extracted by grinding in Lacus buffer (50 mM Tris-HCl pH 7.5, 10 mM
MgCl2, 15 mM EGTA, 100 mM NaCl, 2 mM DTT, 30 mM β-glycero-phosphate, 0.1%
NP-40) plus Phosphatase inhibitor cocktail (PhosSTOP, Roche) and Protease inhibitor
cocktail (Complete, Roche). Samples were cleared by centrifugation, boiled for 5 min in
loading buffer and subjected to SDS-PAGE and electroblotting. Immunoblots were
blocked by incubating for 1h in TBS-Tween (0.1%, (v/v)) and 5% (w/v) milk powder.
Phosphorylated MAP kinases where detected by incubation overnight with primary
antibody anti-p42/p44-erk (1/2000, CST) in 5% (w/v) BSA, followed by incubation for
1h with anti-rabbit-HRP secondary antibody (1/10000, Sigma-Aldrich) in TBS-Tween
(0.1%, (v/v)) and 5% (w/v) milk powder. Antibodies were visualized with Pierce ECL
Plus Western Blotting Substrate (Thermo Scientific) and exposed to X-ray film (Ultra
UV-G, AGFA).
Acknowledgement
Thank you to: Dr. Andrew Cuming for providing the pMBL10a transformation vector,
Christine Lunde for providing the wild type Physcomitrella patens (Gransden 2004 strain)
and E.Tapio Palva for the P.c. carotovorum strains.
120

Refferences
1. Zipfel C (2009) Early molecular events in PAMP-triggered immunity. Current
Opinion in Plant Biology 12: 414–420. doi:10.1016/j.pbi.2009.06.003.
2. Gómez-Gómez L, Boller T (2000) FLS2: an LRR receptor-like kinase involved in
the perception of the bacterial elicitor flagellin in Arabidopsis. Mol Cell 5: 1003–1011.
3. Miya A, Albert P, Shinya T, Desaki Y, Ichimura K, et al. (2007) CERK1, a LysM
Receptor Kinase, Is Essential for Chitin Elicitor Signaling in Arabidopsis. PNAS 104:
19613–19618. doi:10.1073/pnas.0705147104.
4. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JDG, et al. (2006) Perception
of the Bacterial PAMP EF-Tu by the Receptor EFR Restricts Agrobacterium-Mediated
Transformation. Cell 125: 749–760. doi:10.1016/j.cell.2006.03.037.
5. Suarez-Rodriguez CM, Petersen M, Mundy J (2010) Mitogen-Activated Protein
Kinase Signaling in Plants. Annual Review of Plant Biology 61: 621–649.
doi:10.1146/annurev-arplant-042809-112252.
6. Fiil BK, Petersen K, Petersen M, Mundy J (2009) Gene regulation by MAP kinase
cascades. Current Opinion in Plant Biology 12: 615–621. doi:10.1016/j.pbi.2009.07.017.
7. Bethke G, Pecher P, Eschen-Lippold L, Tsuda K, Katagiri F, et al. (2012)
Activation of the Arabidopsis thaliana mitogen-activated protein kinase MPK11 by the
flagellin-derived elicitor peptide, flg22. Mol Plant Microbe Interact 25: 471–480.
doi:10.1094/MPMI-11-11-0281.
8. Ren D, Liu Y, Yang K-Y, Han L, Mao G, et al. (2008) A Fungal-Responsive
MAPK Cascade Regulates Phytoalexin Biosynthesis in Arabidopsis. PNAS 105: 5638–
5643. doi:10.1073/pnas.0711301105.
9. Petersen M, Brodersen P, Naested H, Andreasson E, Lindhart U, et al. (2000)
Arabidopsis MAP Kinase 4 Negatively Regulates Systemic Acquired Resistance. Cell
103: 1111–1120. doi:10.1016/S0092-8674(00)00213-0.
10. Zhang Z, Wu Y, Gao M, Zhang J, Kong Q, et al. (2012) Disruption of PAMP-
Induced MAP Kinase Cascade by a Pseudomonas syringae Effector Activates Plant
Immunity Mediated by the NB-LRR Protein SUMM2. Cell Host & Microbe 11: 253–263.
doi:10.1016/j.chom.2012.01.015.
11. Zimmer A, Lang D, Richardt S, Frank W, Reski R, et al. (2007) Dating the early
evolution of plants: detection and molecular clock analyses of orthologs. Molecular
Genetics and Genomics 278: 393–402. doi:10.1007/s00438-007-0257-6.
12. Ponce De León I, Schmelz EA, Gaggero C, Castro A, Álvarez A, et al. (2012)
Physcomitrella patens activates reinforcement of the cell wall, programmed cell death
and accumulation of evolutionary conserved defence signals, such as salicylic acid and
121

12‐oxo‐phytodienoic acid, but not jasmonic acid, upon Botrytis cinerea infection.
Molecular Plant Pathology 13: 960–974. doi:10.1111/j.1364-3703.2012.00806.x.
13. Andersson RA, Akita M, Pirhonen M, Gammelgård E, Valkonen JPT (2005)
Moss-Erwinia pathosystem reveals possible similarities in pathogenesis and pathogen
defense in vascular and nonvascular plants. Journal of General Plant Pathology 71: 23–28.
doi:10.1007/s10327-004-0154-3.
14. Lehtonen MT, Akita M, Frank W, Reski R, Valkonen JPT (2012) Involvement of
a Class III Peroxidase and the Mitochondrial Protein TSPO in Oxidative Burst Upon
Treatment of Moss Plants with a Fungal Elicitor. Molecular Plant-Microbe Interactions
25: 363–371. doi:10.1094/MPMI-10-11-0265.
15. Dóczi R, Ökrész L, Romero AE, Paccanaro A, Bögre L (n.d.) Exploring the
evolutionary path of plant MAPK networks. Trends in Plant Science 17: 503–562.
doi:10.1016/j.tplants.2012.05.009.
16. Ichimura K, Mizoguchi T, Irie K, Morris P, Giraudat J, et al. (1998) Isolation of
ATMEKK1 (a MAP Kinase Kinase Kinase)-Interacting Proteins and Analysis of a MAP
Kinase Cascade inArabidopsis. Biochemical and Biophysical Research Communications
253: 532–543. doi:10.1006/bbrc.1998.9796.
17. Qiu J-L, Fiil BK, Petersen K, Nielsen HB, Botanga CJ, et al. (2008) Arabidopsis
MAP kinase 4 regulates gene expression through transcription factor release in the
nucleus. The EMBO Journal 27: 2214–2221. doi:10.1038/emboj.2008.147.
18. Suarez-Rodriguez MC, Adams-Phillips L, Liu Y, Wang H, Su S-H, et al. (2007)
MEKK1 Is Required for Flg22-Induced MPK4 Activation in Arabidopsis Plants. Plant
Physiol 143: 661–669. doi:10.1104/pp.106.091389.
19. Teige M, Scheikl E, Eulgem T, Dóczi R, Ichimura K, et al. (2004) The MKK2
pathway mediates cold and salt stress signaling in Arabidopsis. Mol Cell 15: 141–152.
doi:10.1016/j.molcel.2004.06.023.
20. Kong Q, Qu N, Gao M, Zhang Z, Ding X, et al. (2012) The MEKK1-
MKK1/MKK2-MPK4 Kinase Cascade Negatively Regulates Immunity Mediated by a
Mitogen-Activated Protein Kinase Kinase Kinase in Arabidopsis. Plant Cell.
doi:10.1105/tpc.112.097253.
21. Ichimura K, Shinozaki K, Tena G, Sheen J, Henry Y, et al. (2002) Mitogenactivated
protein kinase cascades in plants: a new nomenclature. Trends in Plant Science
7: 301–308. doi:10.1016/S1360-1385(02)02302-6.
22. Hruz T, Laule O, Szabo G, Wessendorp F, Bleuler S, et al. (2008) Genevestigator
V3: A Reference Expression Database for the Meta-Analysis of Transcriptomes.
Advances in Bioinformatics 2008: 1–5. doi:10.1155/2008/420747.
122

23. Lehtonen MT, Akita M, Kalkkinen N, Ahola-Iivarinen E, Rönnholm G, et al.
(2009) Quickly-released peroxidase of moss in defense against fungal invaders. New
Phytologist 183: 432–443. doi:10.1111/j.1469-8137.2009.02864.x.
24. Albert M, K. Jehle A, Lipschis M, Mueller K, Zeng Y, et al. (2010) Regulation of
cell behaviour by plant receptor kinases: Pattern recognition receptors as prototypical
models. European Journal of Cell Biology 89: 200–207. doi:10.1016/j.ejcb.2009.11.015.
25. Schaefer D, Zryd J-P, Knight CD, Cove DJ (1991) Stable transformation of the
moss Physcomitrella patens. Molecular and General Genetics MGG 226: 418–424.
doi:10.1007/BF00260654.
26. Kosetsu K, Matsunaga S, Nakagami H, Colcombet J, Sasabe M, et al. (2010) The
MAP Kinase MPK4 Is Required for Cytokinesis in Arabidopsis thaliana. Plant Cell 22:
3778–3790. doi:10.1105/tpc.110.077164.
27. Müller J, Beck M, Mettbach U, Komis G, Hause G, et al. (2010) Arabidopsis
MPK6 is involved in cell division plane control during early root development, and
localizes to the pre-prophase band, phragmoplast, trans-Golgi network and plasma
membrane. The Plant Journal 61: 234–248. doi:10.1111/j.1365-313X.2009.04046.x.
28. Mao G, Meng X, Liu Y, Zheng Z, Chen Z, et al. (2011) Phosphorylation of a
WRKY Transcription Factor by Two Pathogen-Responsive MAPKs Drives Phytoalexin
Biosynthesis in Arabidopsis. Plant Cell 23: 1639–1653. doi:10.1105/tpc.111.084996.
29. Akita M, Lehtonen MT, Koponen H, Marttinen EM, Valkonen JPT (2011)
Infection of the Sunagoke moss panels with fungal pathogens hampers sustainable
greening in urban environments. Science of The Total Environment 409: 3166–3173.
doi:10.1016/j.scitotenv.2011.05.009.
30. Ponce de León I, Oliver J, Castro A, Gaggero C, Bentancor M, et al. (2007)
Erwinia carotovora elicitors and Botrytis cinerea activate defense responses in
Physcomitrella patens. BMC Plant Biology 7: 52. doi:10.1186/1471-2229-7-52.
31. Wees V, C.m S, Chang H-S, Zhu T, Glazebrook J (2003) Characterization of the
Early Response of Arabidopsis to Alternaria Brassicicola Infection Using Expression
Profiling. Plant Physiol 132: 606–617. doi:10.1104/pp.103.022186.
32. Oliver J, Castro A, Gaggero C, Cascón T, Schmelz E, et al. (2009) Pythium
infection activates conserved plant defense responses in mosses. Planta 230: 569–579.
doi:10.1007/s00425-009-0969-4.
33. Felix G, Duran JD, Volko S, Boller T (2002) Plants have a sensitive perception
system for the most conserved domain of bacterial flagellin. The Plant Journal 18: 265–
276. doi:10.1046/j.1365-313X.1999.00265.x.
34. Roux M, Schwessinger B, Albrecht C, Chinchilla D, Jones A, et al. (2011) The
Arabidopsis Leucine-Rich Repeat Receptor–Like Kinases BAK1/SERK3 and
123

BKK1/SERK4 Are Required for Innate Immunity to Hemibiotrophic and Biotrophic
Pathogens. Plant Cell 23: 2440–2455. doi:10.1105/tpc.111.084301.
35. Nakagami H, Soukupová H, Schikora A, Zárský V, Hirt H (2006) A Mitogenactivated
Protein Kinase Kinase Kinase Mediates Reactive Oxygen Species Homeostasis
in Arabidopsis. J Biol Chem 281: 38697–38704. doi:10.1074/jbc.M605293200.
36. Droillard M-J, Boudsocq M, Barbier-Brygoo H, Laurière C (2004) Involvement
of MPK4 in osmotic stress response pathways in cell suspensions and plantlets of
Arabidopsis thaliana: activation by hypoosmolarity and negative role in hyperosmolarity
tolerance. FEBS Letters 574: 42–48. doi:10.1016/j.febslet.2004.08.001.
37. Ichimura K, Mizoguchi T, Yoshida R, Yuasa T, Shinozaki K (2000) Various
abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. The
Plant Journal 24: 655–665. doi:10.1046/j.1365-313x.2000.00913.x.
38. González Besteiro MA, Bartels S, Albert A, Ulm R (2011) Arabidopsis MAP
kinase phosphatase 1 and its target MAP kinases 3 and 6 antagonistically determine UV-
B stress tolerance, independent of the UVR8 photoreceptor pathway. The Plant Journal
68: 727–737. doi:10.1111/j.1365-313X.2011.04725.x.
39. Lunde C, Drew DP, Jacobs AK, Tester M (2007) Exclusion of Na+ via Sodium
ATPase (PpENA1) Ensures Normal Growth of Physcomitrella patens under Moderate
Salt Stress. Plant Physiol 144: 1786–1796. doi:10.1104/pp.106.094946.
40. Richardt S, Timmerhaus G, Lang D, Qudeimat E, Corrêa LGG, et al. (2009)
Microarray analysis of the moss Physcomitrella patens reveals evolutionarily conserved
transcriptional regulation of salt stress and abscisic acid signalling. Plant Molecular
Biology 72: 27–45. doi:10.1007/s11103-009-9550-6.
41. Wolf L, Rizzini L, Stracke R, Ulm R, Rensing SA (2010) The Molecular and
Physiological Responses of Physcomitrella Patens to Ultraviolet-B Radiation. Plant
Physiol 153: 1123–1134. doi:10.1104/pp.110.154658.
42. Rasmussen MW, Roux M, Petersen M, Mundy J (2012) MAP Kinase Cascades in
Arabidopsis Innate Immunity. Front Plant Sci 3: 169. doi:10.3389/fpls.2012.00169.
43. Brodersen P, Petersen M, Bjørn Nielsen H, Zhu S, Newman M-A, et al. (2006)
Arabidopsis MAP kinase 4 regulates salicylic acid- and jasmonic acid/ethylenedependent
responses via EDS1 and PAD4. The Plant Journal 47: 532–546.
doi:10.1111/j.1365-313X.2006.02806.x.
44. Bent AF, Mackey D (2007) Elicitors, Effectors, and R Genes: The New Paradigm
and a Lifetime Supply of Questions. Annual Review of Phytopathology 45: 399–436.
doi:10.1146/annurev.phyto.45.062806.094427.
45. DeYoung BJ, Innes RW (2006) Plant NBS-LRR proteins in pathogen sensing and
host defense. Nature Immunology 7: 1243–1249. doi:10.1038/ni1410.
124

46. Jones JDG, Dangl JL (2006) The plant immune system. Nature 444: 323–329.
doi:10.1038/nature05286.
47. Xue J-Y, Wang Y, Wu P, Wang Q, Yang L-T, et al. (2012) A Primary Survey on
Bryophyte Species Reveals Two Novel Classes of Nucleotide-Binding Site (NBS) Genes.
PLoS ONE 7: e36700. doi:10.1371/journal.pone.0036700.
48. Ashton NW, Cove DJ (1977) The isolation and preliminary characterisation of
auxotrophic and analogue resistant mutants of the moss Physcomitrella patens. Molecular
and General Genetics MGG 154: 87–95. doi:10.1007/BF00265581.
49. Pfaffl MW (2001) A new mathematical model for relative quantification in realtime
RT–PCR. Nucleic Acids Res 29: e45.
125

Figures
Figure 1. PpMPK4A is responsive to fungal chitin. Quantitative reverse transcriptase
PCR (qPCR) analysis of PpMPK4B (blue diamonds) and PpMPK4A (red squares)
expression relative to untreated (time 0h) following treatment with 100 μg/ml chitosan.
Expression level relative to wild type (WT) untreated was calculated as previously
described by Pfaffl [49], with β-TUBULIN (Phypa_440500) as an internal control for
normalization. Error bars represent S.E.M. of three independent technical replicates. The
experiment was repeated with similar results.
126

Figure 2. Identification of ΔPpMPK4A lines by PCR. See table S1 for primer
sequences. (A) Overview of the PpMPK4A wild type and KO locus. Primers used to
identify KO lines are indicated as p1-p8. (B) Verification of DNA insertion in the
genome by PCR amplification with the indicated primer combinations on DNA from WT
and two independent ΔPpMPK4A KO lines. (C) Evaluation of PpMPK4A expression
assessed by RT-PCR in WT and two independent ΔPpMPK4A KO lines.
127

Figure 3. ΔPpMPK4A plants are more susceptible to necrotrophic pathogens. (A) A.
brassicicola spore counts four days post-drop-inoculation with ~2500
spores per P. patens colony. Each data point is an average of four pools of 16 colonies
per genotype. Analysis of variance followed by Tukey's test showed a statistical
difference between the WT and the two independent ΔPpMPK4A (KO1 and KO2) lines,
indicated by two asterisks (p

Figure 4. PpMPK4A is required for PAMP induced gene expression. Quantitative
reverse transcriptase PCR (qPCR) analysis of transcript levels in WT (blue diamonds)
and ΔPpMPK4A-1 (red squares) relative to untreated WT (time 0h) following treatment
with 100 μg/ml chitosan. Expression level relative to untreated WT was calculated as
previously [49], with β-TUBULIN (Phypa_440500) as an internal control for
normalization. Error bars represent S.E.M. of three independent technical replicates. (A)
PAL4 (Phypa_461241), (B) CHS (Phypa_427901), (C) ERF2 (Phypa_422542), (D) α-
DOX (Phypa_447346), (E) LOX7 (Phypa_184078) and (F) NOX (Phypa_204103).
129

Figure 5. PpMPK4A is phosphorylated upon PAMP treatment. Immunoblot analysis
with anti-phospho-p44/42 MAPK antibodies at indicated minutes after different
treatments. Loading controls show amido black stained total protein.
(A) WT and two independent ΔPpMPK4A (KO1 and KO2) lines sprayed with 1 mg/ml
chitin. The arrow points to PpMPK4A. (B) WT sprayed with either 100 nM flg22, 100
nM elf18 or 100 μg/ml chitosan. (C) WT and ΔPpMPK4A-1 (KO1) sprayed with 2x10 6 B.
cinerea spores/ml. (D) WT and ΔPpMPK4A-1 (KO1) sprayed with either LB medium, 1
mg/ml chitin, cell free culture filtrate of the HrpN negative strain P.c. carotovorum
130

SCC3193, or cell free culture filtrate of the HrpN positive strain P.c. carotovorum SCC1.
PpMPK4A is marked with an arrow. (E) WT and ΔPpMPK4A-1 (KO1) sprayed with 10
mM H 2 O 2 .
Supplementary inventory
Figure S1. Provides an alignment of AtMPK4, PpMPK4A and PpMPK4B (Figure 1).
Figure S2. Provides a control that CHS gene expression is not induced by the control
treatment and that the expression of PpMPK4B is not affected by the knock out of
PpMPK4A (Figure 4).
Figure S3. Provides immunoblot analysis with anti-phospho-p44/42 MAPK with
additional treatments not shown in Figure 5.
Table S1. Primers used for cloning and genotyping PCR of ΔPpMPK4A KO lines
(Figure 2)
Table S2. Primers used for quantitative RT-PCR shown in Figure 4.
131

Figure S1. Alignment of AtMPK4, PpMPK4A and PpMPK4B. Related to Figure 1.
Sequence alignment of the Arabidopsis MPK4 with its two homologs in Physcomitrella,
PpMPK4A and PpMPK4B, constructed using CLUSTALW (available at
http://www.ebi.ac.uk/Tools/clustalw). Color codes for amino acids: red = small
hydrophobic (including aromatics), blue = acidic, magenta = basic, green = hydroxyl
+ amine + basic, others grey. Consensus symbols denoting degree of conservation
observed in each column: "*", identical in all sequences in the alignment; ":", conserved
substitutions, ".", semi-conserved substitutions.
132

Figure S2. Expression of CHS upon control treatment and expression of PpMPK4B
in ΔPpMPK4A. Related to Figure 4.
(A) Expression of CHS in the wild type upon spraying with 100µg/ml chitosan (blue
diamonds) or with control treatment (0.01% Acetic acid, adjusted to pH 5.5 with NaOH)
(red triangle). (B) Expression of PpMPK4B in WT (blue diamonds) and ΔPpMPK4A (red
squares) upon spraying with 100 µg/ml chitosan.
133

Figure S3. Immunoblot analysis with anti-phospho-p44/42 MAPK. Related to
Figure 5.
(A) WT and ΔPpMPK4A-1 (KO1) upon spraying with 100ug/ml chitosan or control
treatment (C) (0.01% Acetic acid, adjusted with NaOH to pH 5.5). Ponceau staining used as
total protein loading control. (B) WT and ΔPpMPK4A-2 (KO2) upon spraying with 500
mM NaCl or 100 µg/ml chitosan. Loading controls show amido black stained total
protein. (C) Wild type subjected to 100 µg/ml chitosan, UV light, cold or wounding (see
material and methods for details). Loading controls show amido black stained total
protein.
134

Table S1. Cloning and genotyping primers
Name Forward primer Name Reverse primer
Product
size
Description
LBF GCGGCCGCGGGTCTTTAGATTTGCCATGT LBR GGATCCGTGTATTCCCGCGATTCTAGGT 663 Flanking LB
RBF GATATCAAGGCCTACTCTCAATTCTTTAG RBR TAGTACAGTAGGCAATGGTAGAATTGTT 888 Flanking RB
P3 TGAAAACGTCGTTGCCATTA P4 GGTCCGTATCCATCAACTCG 290 WT gDNA
P1 TTCGAATCCTAAATTTGAAAACAA P2 TTTTCTCTCCTTCGTTCGTCA 1223 WT LB
P5 TGATTCGTTTCCTTGCAACA P6 ATAAAAGAGGGGTGTCTGCCTGGTAGTTC 1859 WT RB
P1 TTCGAATCCTAAATTTGAAAACAA P7 GGCAATGGAATCCGAGGAGGT 880 KO LB
P8 GGTATCAGAGCCATGAATAGGTC P6 ATAAAAGAGGGGTGTCTGCCTGGTAGTTC 1419 KO RB
P3 GGTACAAGCCACCACTTCGT P4 GGTCCGTATCCATCAACTCG 270 WT cDNA
Primers used for cloning and genotyping PCR of ΔPpMPK4A KO lines, shown in Figure
2. WT- wild type, LB – left boarder, RB – right boarder.
Table S2. qPCR primers
Name Gene accession Forward primer Reverse primer
β-tubulin1 (TUB) Phypa_440500 GAGTTCACGGAAGCGGAGAG ATATCTTTCAGGCTCCACCG
MPK4A Phypa_446407 GGTACAAGCCACCACTTCGT GGTCCGTATCCATCAACTCG
MPK4B Phypa_435424 GGCGAGTACACGCAGTACAA ATTCACAGCGGAACACACAA
Phenylalanine Ammonia-Lyase
family (PAL4) Phypa_461241 TGGCCTACTCGGTAATGGAG GTCAACCATCCGCTTGATTT
Chalcone Synthases (CHS) Phypa_427901 GGCATGGAACGAGATGTTCT CCTTGCATCTTGTCCTTGGT
Ethylene Response Factor 2
(ERF2) Phypa_422542 GAGAGGCGTCCAAACTCTTG AGGGACTTACGGGCTTGTTT
alfa dioxygenase (α-DOX) Phypa_447346 CCGCGAAGTTGCTATCTAGG AGAGGGTGGAGCCGTAATCT
Lipooxygenase LOX7 Phypa_184078 GTGGCGGTTTGATCAGGA CGTTCAGCCATCCCTCTTC
NADPH-oxidase (NOX) Phypa_204103 CACGATGTTGCAGTCGTTG TACGTGCCCTAGTGCCTGA
Primers used for quantitative RT-PCR shown in Figure 4.
135

Manuscript 2
136

Review
Cell Death and Differentiation (2011) 18, 1257–1262
& 2011 Macmillan Publishers Limited All rights reserved 1350-9047/11
www.nature.com/cdd
Role of autophagy in disease resistance and
hypersensitive response-associated cell death
D Hofius 1,3 , D Munch 1 , S Bressendorff 1 , J Mundy 1,2 and M Petersen* ,1
Ancient autophagy pathways are emerging as key defense modules in host eukaryotic cells against microbial pathogens. Apart
from actively eliminating intracellular intruders, autophagy is also responsible for cell survival, for example by reducing the
deleterious effects of endoplasmic reticulum stress. At the same time, autophagy can contribute to cellular suicide. The
concurrent engagement of autophagy in these processes during infection may sometimes mask its contribution to differing
pro-survival and pro-death decisions. The importance of autophagy in innate immunity in mammals is well documented, but how
autophagy contributes to plant innate immunity and cell death is not that clear. A few research reports have appeared recently to
shed light on the roles of autophagy in plant–pathogen interactions and in disease-associated host cell death. We present a first
attempt to reconcile the results of this research.
Cell Death and Differentiation (2011) 18, 1257–1262; doi:10.1038/cdd.2011.43; published online 29 April 2011
Autophagy mediates the degradation of bulk proteins and is
also involved in the clearance of damaged organelles,
insoluble protein aggregates and lipids. 1–3 Autophagic digestion
and recycling can occur as a survival mechanism to
maintain cellular homeostasis and to respond to environmental
stresses, such as nutrient depletion or pathogen
attack, but may also function as a mediator and/or mechanism
of programmed cell death. 4–8 Several subtypes of autophagy
are described, but macroautophagy (hereafter termed autophagy)
is the most extensively studied 9 and will be the only form
described here. The process is characterized by the formation
of large, double-membrane vesicles called autophagosomes.
These structures arise from expanding single membranes
(termed phagophores), which enclose cytoplasmic material
and organelles for degradation. Completed autophagosomes
fuse with the vacuole/lysosome to release the inner singlemembrane
vesicle, called the autophagic body, into the lumen
for hydrolytic degradation and recycling. 2,10
The mechanism of autophagy is conserved in yeast, plants
and metazoans, and involves the action of canonical
autophagy related genes (ATG) that synthesize and coordinate
membrane rearrangements to allow cellular catabolism.
1,2 The core sets of ATG genes seem to be present in all
eukaryotes and to be essential for the autophagy pathway
(Figure 1). For instance, induction of autophagy requires the
negative regulator target of rapamycin (TOR) kinase and the
ATG1 kinase complex, which control the activity of
the phosphatidylinositol 3-kinase complex containing, for
example, ATG6/Beclin1. 11 Initiation and completion of
autophagosome formation involves two ubiquitin-like conjugation
systems to produce ATG12-ATG5 and ATG8-phosphatidylethanolamine
(ATG8-PE) conjugates. ATG8-PE
conjugation involves the cysteine proteinase ATG4 and the
E1-like protein ATG7, and lipidated ATG8 is linked to and
translocated with autophagosomes to the vacuole. 12 Therefore,
conversion from soluble to lipid bound ATG8, as well as
subcellular localization of green fluorescent protein (GFP)-
fused protein, have been used to monitor temporal dynamics
and spatial regulation of autophagy. 13 Finally, recycling and
retrieval of autophagy proteins require the ATG9 complex,
containing ATG2, ATG9 and ATG18. 2,10
A number of excellent reviews provide more details about
the molecular mechanisms of autophagy and the individual
components required for autophagic complexes and processes
7,14–17 (see also Figure 1). In this review, we focus on
the role of autophagy in programmed cell death and innate
immune responses, with special emphasis on the plant
hypersensitive response associated with disease resistance.
Autophagy in Plants
Much has been learned about the requirement for specific
ATG genes in the model plant Arabidopsis. Loss-of-function
mutations in ATG genes such as ATG7 and ATG5 implicate
1 Department of Biology, Copenhagen University, Ole Maaloes Vej 5, Copenhagen 2200, Denmark; 2 King Saud University, College of Science, Riyadh 11451, Saudi Arabia
*Corresponding author: M Petersen, Department of Biology, Copenhagen University, Ole Maaloees Vej 5, Copenhagen 2200, Denmark. Tel: þ 45 3532 2137;
E-mail: shutko@bio.ku.dk
3 Present address: Uppsala BioCenter, Department of Plant Biology and Forest Genetics, The Swedish University of Agricultural Sciences (SLU), Box, 750 07 Uppsala,
Sweden.
Keywords: autophagy; ATG genes; innate immunity; plants
Abbreviations: ATG, autophagy related genes; ATG8-PE, ATG8-phosphatidylethanolamine; DAMPs, danger-associated molecular patterns; EDS1, enhanced
disease susceptibility1; GFP, green fluorescent protein; HR, hypersensitive response; MAMP, microbial associated molecular patterns; npr1, non expressor of PR
genes; PR, pathogenesis-related; R proteins, resistance proteins; SA, salicylic acid; TLRs, toll-like receptors; TMV, tobacco mosaic virus; TOR kinase, target of
rapamycin; UDP, uninfected dying tissue
Received 01.2.11; revised 09.3.11; accepted 21.3.11; Edited by J Dangl; published online 29.4.11

1258
Autophagy in disease resistance and HR-associated cell death
D Hofius et al
Figure 1 The autophagy pathway in plants. Upon induction by environmental and developmental stimuli, macroautophagy starts by nucleation and expansion of a preautophagosomal
membrane, the phagophore, which engulfs cytoplasmic material destined for degradation. Autophagosomes are then transported to and dock with the
vacuole, which leads to release of the inner single-membrane vesicle, the autophagic body, into the vacuolar lumen and hydrolytic breakdown of the enclosed cargo.
Autophagy induction and vesicle nucleation require the action of the TOR kinase and ATG1-complex, which activates the class III PI3K complex containing ATG6/Beclin1 and
possibly other yet unknown interactors. Additionally, as known from other eukaryotes, the ATG9 complex is required for recycling and retrieval of autophagy proteins, but this
function awaits verification in plants. Membrane elongation and autophagosome formation require the action of two-ubiquitin-like conjugation systems, which modify two
ubiquitin-like molecules, ATG5 and ATG8, to mediate association with the phagophore and its subsequent folding and expansion. *ATG proteins not identified in plants yet
autophagy as a central player in cellular homeostasis. 18,19
Processing and delivery of ATG8 to the vacuole under
nitrogen-starved condition requires the cysteine protease
ATG4 and the ATG12-ATG5 conjugate, 20,21 and atg5, atg7,
atg10, as well as atg12a/b double mutants are hypersensitive
to both nitrogen and carbon starvation. 21–23 Thus, both
autophagic-related conjugation pathways seem to be required
for autophagy in plants and, as in yeast and other models, the
process is required to recycle nutrients during starvation.
Several reports have documented the roles of autophagy in
plant development and under stress conditions. During
senescence of Arabidopsis leaves kept in darkness (a form
of carbon starvation for photosynthetic autotrophs), autophagy
seems to be responsible for degradation of the
chloroplasts, 24 and root development also becomes impaired
in different atg mutants during nitrogen starvation. 18,20
Perhaps not surprisingly, autophagy functions in the removal
of oxidized proteins during oxidative stress in Arabidopsis, 25
and downregulation of ATG18a using interference RNA
(RNAi) renders plants more sensitive to salt and drought
stress. 26 Collectively, these reports demonstrate that autophagy
affects plants in many aspects of their life cycle.
In contrast to autophagy mechanisms in yeast and
mammals, information about the signaling pathways triggering
the induction of plant autophagy in response to developmental,
nutritional and environmental cues is largely lacking.
Only recently, direct genetic evidence has been provided that
the TOR kinase is a negative regulator of autophagy in higher
plants. 27 Although knockout of the single TOR gene in
Arabidopsis proved to be embryo-lethal, 28,29 knockdown by
RNAi resulted in constitutive autophagy under non-stressed
conditions in an ATG18-dependent fashion. 27 In addition,
Tap46, the regulatory subunit of protein phosphatase 2A, was
recently identified as a downstream effector of the TOR
signaling pathway. Depletion of Tap46 reproduced the
signature phenotypes of TOR inactivation, including autophagy
induction. 30
Autophagy in Immunity
As autophagy has the ability to eliminate unwanted cellular
structures, it is not surprising that this complex and
evolutionary ancient pathway also evolved to combat unwanted
intracellular microbes. That autophagy could contribute
to cellular clearance of microbes was evident already in
the 1980s, 31 but it was first a decade later that the molecular
tools to study autophagy in immune responses became
available. More recently, autophagy has been shown in a
number of cases to contribute to defenses against microbial
invasion. For example, autophagy defends mammalian cells
against invading Streptococcus. 32 In contrast to wild type
cells, Streptococcus survives and multiplies in ATG5 deficient
cells, suggesting that the autophagic machinery is engaged to
actively kill the bacteria. These data were supported by
micrographs of Streptococci trapped inside autophagosomal
structures and these are absent in ATG5 deficient cells. 32
Likewise, induction of autophagy suppressed intracellular
survival of Mycobacterium tuberculosis in macrophages. In
this case, the bacteria are also trapped inside autophagosomal-like
structures positive for Beclin1. 33 Since these reports,
a number of excellent reviews have discussed other studies
documenting autophagy as an innate defense mechanism for
controlling intracellular pathogens in mammals. 34–36
In the evolutionary arms race between pathogens and their
hosts, some pathogens have also developed mechanisms to
avoid or even exploit this defense mechanism to survive and
establish infection. Shigella bacteria can escape autophagy
Cell Death and Differentiation

Autophagy in disease resistance and HR-associated cell death
D Hofius et al
1259
by secreting effectors by means of the type III secretion
system. However, mutant bacteria lacking specific effectors
become trapped by autophagy during multiplication within
host cells and fail to establish infection. 37 Interestingly,
autophagosomal-like structures in human cells provide
membranous supports for poliovirus RNA replication and, in
cells in which autophagy is inhibited via drugs or RNAi against
a collection of ATG genes, poliovirus yield is diminished. 38
More recently, increased autophagic activity has been
linked directly to pathogen surveillance systems in different
organisms. For example, mammalian Toll-like receptors
(TLRs) detect microbial-associated molecular patterns
(MAMP) and induce defense responses upon ligand detection.
39 Accordingly, stimulation of TLR7 in macrophages leads
to increased autophagic activity and elimination of
M. tuberculosis in an ATG5-dependent manner. 40 Another
example includes the pathogen receptor CD46 that binds
Streptococci and triggers autophagy. 41 Thus, these two
examples provide evidence that pathogen recognition in
different animal systems is directly linked to higher levels of
autophagic activity.
Autophagy and Cell Death
Apart from being required to tolerate nutrient deprivation and
other stresses, autophagy also represents a cell death
pathway conserved across the eukaryotic kingdom. In 2004,
Yu et al. 42 reported the requirement for ATG7 and Beclin1 in
certain types of cell death in mammalian cell cultures and
provided a primary example of autophagic cell death. Since
then, numerous reports have argued for or against autophagy
as a cell death mechanism, but evidence in favor of
autophagic cell death has recently emerged in various genetic
models. For example, the conidium of the rice blast fungus
Magnaporthe grisea undergoes autophagic cell death to
establish an infection and, accordingly, M. oryzae atg8
null-mutants are unable to infect plants. 43 In Drosophila,
physiological cell death of the salivary gland requires the action
of ATG genes 44 and autophagy is essential for midgut cell
death as well. 45 In C. elegans, necrotic breakdown of neurons
is autophagy-dependent and necrotic cell death is accompanied
by elevated autophagic activity. 46 A recent report
documented that cell death in the formation of tracheary
elements in Arabidopsis is inhibited in atg5 null-mutants and
stimulated by increased levels of autophagy. 47 Such examples
indicate that autophagy effectuates cell death pathways critical
for many aspects of eukaryotic development (Figure 2).
Beclin1 provides a primary example of a molecular
connection between autophagy and apoptosis, an important
pathway to cellular destruction in metazoans. Beclin1 is a
haplo-insufficient tumor suppressor in mice 48 involved in the
initial formation of autophagosomes. Beclin1 also forms
complexes with the anti-apoptotic protein Bcl-2 in mammalian
cells 49 and loss of Beclin1 in C. elegans triggers apoptotic cell
death. 50 In Arabidopsis, Beclin1 is essential for pollen
germination, a feature not associated with other ATG-null
mutants, 51 but knockdown of Beclin1 through antisense
or viral-induced gene silencing leads to premature chlorosis and
cell death in both Arabidopsis and Nicotiana benthamiana. 52,53
It is therefore tempting to speculate that, like Beclin1 in
Figure 2 Examples of cell death that depend on autophagy components in
different eukaryotic models. In the rice blast fungus Magnaporthe oryzae,
autophagic cell death is required for degradation of conidia and thus fungal
pathogenicity, which can be inhibited by knockout of ATG8. 43 In Drosophila
melanogaster, knockouts of ATG1, ATG2 and ATG18 demonstrated the
requirement of autophagy for mid gut cell death. 45 In Caenorhabiditis elegans,
autophagosome formation is required for necrotic cell death of neurons, which has
been shown to be inhibited by knockout of ATG1 or RNAi knockdown of ATG6,
ATG8 and ATG18. 46 Finally, in Arabidopsis thaliana, development of tracheary
elements depends on autophagic cell death, which is inhibited in atg5 knockout
mutants 47
metazoans, plant Beclin1 could also represent a molecular
link between autophagy and another cell death route. ATG5
represents an additional molecular link between autophagy
and apoptosis, because calpain-mediated cleavage of ATG5
promotes apoptosis through mitochondrial cytochrome C
release and caspase activation. 54 Recently, a conjugate
between ATG12 and ATG3 was shown to affect mitochondrial
homeostasis and sensitize cells to apoptosis in a context
completely separated from the established roles of the ATG
proteins in the autophagic pathway. 55 Collectively, these
findings imply that specific ATG genes can act as molecular
switches and have autophagy-independent functions in
homeostatic processes and cell death.
Autophagy in Plant Immunity and Hypersensitive Cell
Death
Plants rely on a multilayered innate immune system to prevent
pathogen invasion and proliferation. Pathogen recognition
can occur on the cell surface by pattern recognition receptors
that detect MAMPs and induce immune responses such as
cell wall thickening and production of antimicrobial proteins. 56
However, diverse pathogens deliver a variety of virulence
determinants, commonly referred to as effectors, into plant
cells to evade or suppress MAMP-triggered immunity and to
manipulate the host machinery for their own benefit. 57 In turn,
plants have evolved another layer of defense to recognize
effector modifications of host target proteins via host
surveillance proteins (resistance (R) proteins). These
R-mediated defenses often include a localized programmed
cell death reaction known as the hypersensitive response
(HR) to limit pathogen spread. 58
Several examples of the involvement of autophagy in plant
immunity and hypersensitive-related cell death have emerged
Cell Death and Differentiation

1260
Autophagy in disease resistance and HR-associated cell death
D Hofius et al
in the past few years. However, there remains some doubt
and apparent contradictions concerning the function(s) of
autophagy as a pro-survival or pro-death pathway. In 2005,
Liu et al., 52 linked the activation of autophagy to infection in
plants and nicely demonstrated that autophagy contributes to
resistance. In addition, they also presented evidence that
autophagy was required to restrict the spread of plant
hypersensitive cell death, thus functioning as a pro-survival
pathway. Activation of the N-resistance gene in N. benthamiana
by the p50 helicase protein of tobacco mosaic virus (TMV)
during infection or upon transient expression triggered
hypersensitive cell death, and a few days after local infection,
dead cell patches became visible in non-infected tissues on
plants silenced for Beclin1. 52 A similar approach in Arabidopsis
supported the observations in N. benthamiana, because
activation of hypersensitive cell death via the R gene RPM1
upon infection with bacteria also led to macroscopic cell death
beyond the infection site in plants silenced for Beclin1, starting
roughly 5 days post-infection. 53 In this context, it should be
noted that cell death triggered by RPM1 is executed rapidly
and ends after roughly 6–8 h. 59 This raises the question of
whether cell death emerging several days later is directly
connected to uncontrolled HR cell death. Nevertheless, the
data led to the hypothesis that autophagy prevents unrestricted
HR cell death by yet unknown mechanisms and thus
functions as a pro-survival pathway in plant–pathogen
interactions. 60,61
More recently, a pro-death function of autophagy during
hypersensitive cell death was reported. 62 Here, autophagic
activity in the infected tissue accompanied the onset of cell
death execution triggered by some, but not all types of R
proteins. In addition, in cases in which autophagy was
induced, cell death was suppressed in local infected tissues
in different atg mutants. Strongest suppression was found for
cell death conditioned by the R proteins RPS4 and RPP1
that signal through the signaling component Enhanced
Disease Susceptibility1 (EDS1). 62 HR cell death triggered
by RPM1 was also significantly suppressed in atg
mutants, but in this case suppression was most prominent in
combination with cathepsin inhibitors. 62 Cathepsins contribute
to HR triggered by Phytophthora infestans in
N. benthamiana HR, 63 suggesting that both autophagy and
cathepsins are engaged in RPM1-triggered hypersensitive
cell death. 62 In this context, Hatsugai et al. 64 recently reported
that the 20S proteasome subunit PBA1 has caspase-3-like
activity and contributes to cell death triggered by RPM1. This
further supported the view that RPM1 recruits autophagic
mechanisms for suicidal cell death, in parallel with various
other execution pathways. 65
How can these apparent discrepancies about the role of
autophagy in HR cell death be explained First, it is important
to emphasize differences in the experimental systems. Liu
et al. 52 primarily investigated plants visually and concluded
that collapse of tissues next to infection sites a few days after
local infections is caused by uncontrolled HR. Patel and
Dinesh-Kumar 53 performed similar assays with similar
observations in Arabidopsis. In contrast, Hofius et al. 62
examined cell death in the actual infection site, using a widely
accepted electrolyte leakage assay 59 during the first hours
after bacterial infection, as well as trypan blue staining of
Figure 3 Clarification of studies on autophagic cell death in plant immunity.
HR, hypersensitive response; UDP, uninfected, dying tissue
leaves infected with avirulent Hyaloperonospora arabidopsidis
and bacteria. So, the apparently different conclusions come
from studies of non-infected tissue, days after infection versus
infected tissue during HR execution (summarized in Figure 3).
In addition, the link between direct activation of autophagy in R
gene-triggered immunity is supported by recent discoveries in
mammals. Here, an R protein homolog, the cytosolic NOD1
receptor that provides a surveillance system for the detection
of intracellular pathogens, recruits the autophagic protein
ATG16L to the plasma membrane at the site of bacterial
entry. 66
In any event, these reports also seem to underscore the
importance of the autophagic machinery in limiting pathogen
infection in plants. Liu et al. 52 and co-workers found increased
titers of avirulent TMV in infected tissues of Beclin1 silenced
N. benthamiana plants, and Patel and Dinesh-Kumar 53
observed increased susceptibility towards virulent strains of
P. syringae in Beclin1 antisense Arabidopsis plants. Similarly,
Hofius et al. 62 observed increased growth of both virulent
P. syringae and Hyaloperonospora arabidopsidis in different
Arabidopsis atg mutants. Together, all these findings demonstrate
that autophagy can function in plant innate immunity.
Another important contribution comes from Yoshimoto et al. 67
Primarily scoring macroscopic lesions or visible death in leaves,
the authors found no difference in RPM1-triggered cell death
beyond the initial infection site in younger atg mutants. However,
in older atg mutants such as atg5, they observed lesions in noninfected
tissues 6–9 days after infection. Interestingly, these
effects were suppressed by removal of the phytohormone
salicylic acid (SA) and by mutations in non expressor of pr genes
(npr1). 67 The authors thus proposed that autophagy negatively
regulates cell death by controlling NPR1-dependent SA signaling,
although it is unclear why there is a difference between
young and old atg mutants.
Autophagy-deficient mutants lack the autophagic machinery
to remove accumulating cellular ‘garbage’, and in contrast
to younger or newly emerged leaves, older atg mutant leaves
contain higher levels of metabolites, disrupted organelles and
oxidized proteins. 24,25 Such accumulated cellular debris may
well disrupt homeostasis, leading to pleiotropic effects
Cell Death and Differentiation

Autophagy in disease resistance and HR-associated cell death
D Hofius et al
1261
including accumulation of danger-associated molecular
patterns (DAMPs) 68 triggering SA accumulation, and subsequent
production of secreted pathogenesis-related (PR)
proteins accompanied by ER stress. Autophagy is required
to dampen the deleterious effects caused by ER stress and it
is well described in other models that atg mutants die upon
increased ER stress. 69 Thus, accumulated ER stress would
be expected to increase the susceptibility of older atg mutants
to additional stresses. Interestingly, npr1 has reduced ER
stress and expression of PR genes, and mutants like bip2 die
upon SA-analog treatment. 70 This would explain why npr1
(and SA-deficient mutants) rescue older atg mutants; even in
uninfected tissues, DAMP signals and ER stress-related
effects are reduced due to reduced expression of defense
genes in npr1/atg5 double mutants. Again, Figure 3 attempts
to summarize some of the most important observation done
by the different groups.
Concluding Remarks
Many questions remain to be addressed on the roles of
autophagy in plants. Because autophagy is required for
cellular homeostasis, more specific autophagic functions in
plant–microbe interactions and immunity are hard to unravel.
For example, are plant atg mutants, in contrast to those of
other organisms, able to cope with prolonged ER stress and, if
not, what is the outcome Similarly, it may be problematic to
use older atg mutants plants, because of pleiotropic effects
caused by lifelong accumulation of the kind of cellular
‘garbage’ normally removed by autophagy. In addition, we
need to be circumspect in the selection of autophagic mutants
amenable for specific studies. For example, the strong
chlorotic phenotype of Beclin1 antisense plants suggests that
Beclin1 may also be involved in other cell death programs, as
is now apparent in metazoans. Moreover, the available
collection of atg mutants needs to be further explored to
analyze the role of autophagy in MAMP- and effectortriggered
immune responses of various host-pathogen
systems. Similarly, autophagy components and mechanisms
might be specifically targeted by pathogen effector proteins to
either suppress defense responses or to promote pathogenicity,
for example, of necrotrophic pathogens. Finally, diverse
microbial life styles and the changing ‘rules of engagement’ in
the evolutionary arms race indicate that autophagy may be coopted
for various purposes by hosts and microbes alike.
Therefore, it is possible that host-derived, perimicrobial
membranes 71 are actually autophagic in origin. If so, this
could represent an armistice to enable symbiosis for the
benefit of both microbes and plants.
Conflict of interest
The authors declare no conflict of interest.
1. Levine B, Klionsky DJ. Development by self-digestion: molecular mechanisms and
biological functions of autophagy. Dev Cell 2004; 6: 463–477.
2. Mizushima N. Autophagy: process and function. Genes Dev 2007; 21: 2861–2873.
3. Rodriguez-Navarro JA, Cuervo AM. Autophagy and lipids: tightening the knot. Semin
Immunopathol 2010; 32: 343–353.
4. Kourtis N, Tavernarakis N. Autophagy and cell death in model organisms. Cell Death Differ
2009; 16: 21–30.
5. Scarlatti F, Granata R, Meijer AJ, Codogno P. Does autophagy have a license to kill
mammalian cells Cell Death Differ 2009; 16: 12–20.
6. Kuma A, Mizushima N. Physiological role of autophagy as an intracellular recycling system:
with an emphasis on nutrient metabolism. Semin Cell Dev Biol 2010; 21: 683–690.
7. Levine B, Mizushima N, Virgin HW. Autophagy in immunity and inflammation. Nature 2011;
469: 323–335.
8. Mizushima N, Levine B. Autophagy in mammalian development and differentiation.
Nat Cell Biol 2010; 12: 823–830.
9. Yang Z, Klionsky DJ. Eaten alive: a history of macroautophagy. Nat Cell Biol 2010; 12:
814–822.
10. Klionsky DJ. Autophagy: from phenomenology to molecular understanding in less than a
decade. Nat Rev Mol Cell Biol 2007; 8: 931–937.
11. Pattingre S, Espert L, Biard-Piechaczyk M, Codogno P. Regulation of macroautophagy by
mTOR and Beclin 1 complexes. Biochimie 2008; 90: 313–323.
12. Geng J, Klionsky DJ. The Atg8 and Atg12 ubiquitin-like conjugation systems in
macroautophagy. ‘Protein modifications: beyond the usual suspects’ review series. EMBO
Rep 2008; 9: 859–864.
13. Klionsky DJ, Abeliovich H, Agostinis P, Agrawal DK, Aliev G, Askew DS et al. Guidelines for
the use and interpretation of assays for monitoring autophagy in higher eukaryotes.
Autophagy 2008; 4: 151–175.
14. Yang Z, Klionsky DJ. Mammalian autophagy: core molecular machinery and signaling
regulation. Curr Opin Cell Biol 2010; 22: 124–131.
15. He C, Klionsky DJ. Regulation mechanisms and signaling pathways of autophagy. Annu
Rev Genet 2009; 43: 67–93.
16. Klionsky DJ, Codogno P, Cuervo AM, Deretic V, Elazar Z, Fueyo-Margareto J et al. A
comprehensive glossary of autophagy-related molecules and processes. Autophagy 2010;
6: PMID: 20484971.
17. He C, Levine B. The Beclin 1 interactome. Curr Opin Cell Biol 2010; 22: 140–149.
18. Doelling JH, Walker JM, Friedman EM, Thompson AR, Vierstra RD. The APG8/12-
activating enzyme APG7 is required for proper nutrient recycling and senescence in
Arabidopsis thaliana. J Biol Chem 2002; 277: 33105–33114.
19. Hanaoka H, Noda T, Shirano Y, Kato T, Hayashi H, Shibata D et al. Leaf senescence and
starvation-induced chlorosis are accelerated by the disruption of an Arabidopsis autophagy
gene. Plant Physiol 2002; 129: 1181–1193.
20. Yoshimoto K, Hanaoka H, Sato S, Kato T, Tabata S, Noda T et al. Processing of ATG8s,
ubiquitin-like proteins, and their deconjugation by ATG4s are essential for plant autophagy.
Plant Cell 2004; 16: 2967–2983.
21. Chung T, Phillips AR, Vierstra RD. ATG8 lipidation and ATG8-mediated autophagy in
Arabidopsis require ATG12 expressed from the differentially controlled ATG12A and
ATG12B loci. Plant J 2010; 62: 483–493.
22. Thompson AR, Doelling JH, Suttangkakul A, Vierstra RD. Autophagic nutrient recycling in
Arabidopsis directed by the ATG8 and ATG12 conjugation pathways. Plant Physiol 2005;
138: 2097–2110.
23. Phillips AR, Suttangkakul A, Vierstra RD. The ATG12-conjugating enzyme ATG10 is
essential for autophagic vesicle formation in Arabidopsis thaliana. Genetics 2008; 178:
1339–1353.
24. Wada S, Ishida H, Izumi M, Yoshimoto K, Ohsumi Y, Mae T et al. Autophagy plays a role in
chloroplast degradation during senescence in individually darkened leaves. Plant Physiol
2009; 149: 885–893.
25. Xiong Y, Contento AL, Nguyen PQ, Bassham DC. Degradation of oxidized
proteins by autophagy during oxidative stress in Arabidopsis. Plant Physiol 2007; 143:
291–299.
26. Liu Y, Xiong Y, Bassham DC. Autophagy is required for tolerance of drought and salt stress
in plants. Autophagy 2009; 5: 954–963.
27. Liu Y, Bassham DC. TOR is a negative regulator of autophagy in Arabidopsis thaliana.
PLoS ONE 2010; 5: e11883.
28. Menand B, Desnos T, Nussaume L, Berger F, Bouchez D, Meyer C et al. Expression and
disruption of the Arabidopsis TOR (target of rapamycin) gene. Proc Natl Acad Sci USA
2002; 99: 6422–6427.
29. Deprost D, Yao L, Sormani R, Moreau M, Leterreux G, Nicolai M et al. The Arabidopsis
TOR kinase links plant growth, yield, stress resistance and mRNA translation. EMBO Rep
2007; 8: 864–870.
30. Ahn CS, Han JA, Lee HS, Lee S, Pai HS. The PP2A regulatory subunit Tap46, a
component of the TOR signaling pathway, modulates growth and metabolism in plants.
Plant Cell 2011; 23: 185–209.
31. Rikihisa Y. Glycogen autophagosomes in polymorphonuclear leukocytes induced by
rickettsiae. Anat Rec 1984; 208: 319–327.
32. Nakagawa I, Amano A, Mizushima N, Yamamoto A, Yamaguchi H, Kamimoto T et al.
Autophagy defends cells against invading group A Streptococcus. Science 2004; 306:
1037–1040.
33. Gutierrez MG, Master SS, Singh SB, Taylor GA, Colombo MI, Deretic V. Autophagy is a
defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected
macrophages. Cell 2004; 119: 753–766.
34. Sumpter Jr R, Levine B. Selective autophagy and viruses. Autophagy 2011; 7: PMID:
21150267.
35. Sumpter Jr R, Levine B. Autophagy and innate immunity: triggering, targeting and tuning.
Semin Cell Dev Biol 2010; 21: 699–711.
Cell Death and Differentiation

1262
Autophagy in disease resistance and HR-associated cell death
D Hofius et al
36. Deretic V, Levine B. Autophagy, immunity, and microbial adaptations. Cell Host Microbe
2009; 5: 527–549.
37. Ogawa M, Yoshimori T, Suzuki T, Sagara H, Mizushima N, Sasakawa C. Escape of
intracellular Shigella from autophagy. Science 2005; 307: 727–731.
38. Jackson WT, Giddings Jr TH, Taylor MP, Mulinyawe S, Rabinovitch M, Kopito RR et al.
Subversion of cellular autophagosomal machinery by RNA viruses. PLoS Biol 2005;
3: e156.
39. Medzhitov R. Recognition of microorganisms and activation of the immune response.
Nature 2007; 449: 819–826.
40. Zhao Z, Fux B, Goodwin M, Dunay IR, Strong D, Miller BC et al. Autophagosomeindependent
essential function for the autophagy protein Atg5 in cellular immunity to
intracellular pathogens. Cell Host Microbe 2008; 4: 458–469.
41. Joubert PE, Meiffren G, Gregoire IP, Pontini G, Richetta C, Flacher M et al. Autophagy
induction by the pathogen receptor CD46. Cell Host Microbe 2009; 6: 354–366.
42. Yu L, Alva A, Su H, Dutt P, Freundt E, Welsh S et al. Regulation of an ATG7-beclin 1
program of autophagic cell death by caspase-8. Science 2004; 304: 1500–1502.
43. Veneault-Fourrey C, Barooah M, Egan M, Wakley G, Talbot NJ. Autophagic fungal cell
death is necessary for infection by the rice blast fungus. Science 2006; 312: 580–583.
44. Berry DL, Baehrecke EH. Growth arrest and autophagy are required for salivary gland cell
degradation in Drosophila. Cell 2007; 131: 1137–1148.
45. Denton D, Shravage B, Simin R, Mills K, Berry DL, Baehrecke EH et al. Autophagy, not
apoptosis, is essential for midgut cell death in Drosophila. Curr Biol 2009; 19: 1741–1746.
46. Samara C, Syntichaki P, Tavernarakis N. Autophagy is required for necrotic cell death in
Caenorhabditis elegans. Cell Death Differ 2008; 15: 105–112.
47. Kwon SI, Cho HJ, Jung JH, Yoshimoto K, Shirasu K, Park OK. The Rab GTPase RabG3b
functions in autophagy and contributes to tracheary element differentiation in Arabidopsis.
Plant J 2010; 64: 151–164.
48. Yue Z, Jin S, Yang C, Levine AJ, Heintz N. Beclin 1, an autophagy gene essential for early
embryonic development, is a haploinsufficient tumor suppressor. Proc Natl Acad Sci USA
2003; 100: 15077–15082.
49. Pattingre S, Tassa A, Qu X, Garuti R, Liang XH, Mizushima N et al. Bcl-2 antiapoptotic
proteins inhibit Beclin 1-dependent autophagy. Cell 2005; 122: 927–939.
50. Takacs-Vellai K, Vellai T, Puoti A, Passannante M, Wicky C, Streit A et al. Inactivation of
the autophagy gene bec-1 triggers apoptotic cell death in C. elegans. Curr Biol 2005; 15:
1513–1517.
51. Fujiki Y, Yoshimoto K, Ohsumi Y. An Arabidopsis homolog of yeast ATG6/VPS30 is
essential for pollen germination. Plant Physiol 2007; 143: 1132–1139.
52. Liu Y, Schiff M, Czymmek K, Talloczy Z, Levine B, Dinesh-Kumar SP. Autophagy regulates
programmed cell death during the plant innate immune response. Cell 2005; 121: 567–577.
53. Patel S, Dinesh-Kumar SP. Arabidopsis ATG6 is required to limit the pathogen-associated
cell death response. Autophagy 2008; 4: 20–27.
54. Yousefi S, Perozzo R, Schmid I, Ziemiecki A, Schaffner T, Scapozza L et al. Calpainmediated
cleavage of Atg5 switches autophagy to apoptosis. Nat Cell Biol 2006; 8: 1124–1132.
55. Radoshevich L, Murrow L, Chen N, Fernandez E, Roy S, Fung C et al. ATG12 conjugation
to ATG3 regulates mitochondrial homeostasis and cell death. Cell 2010; 142: 590–600.
56. Dodds PN, Rathjen JP. Plant immunity: towards an integrated view of plant-pathogen
interactions. Nat Rev Genet 2010; 11: 539–548.
57. Jones JD, Dangl JL. The plant immune system. Nature 2006; 444: 323–329.
58. Nimchuk Z, Eulgem T, Holt III BF, Dangl JL. Recognition and response in the plant immune
system. Annu Rev Genet 2003; 37: 579–609.
59. Mackey D, Belkhadir Y, Alonso JM, Ecker JR, Dangl JL. Arabidopsis RIN4 is a target of the
type III virulence effector AvrRpt2 and modulates RPS2-mediated resistance. Cell 2003;
112: 379–389.
60. Seay M, Patel S, Dinesh-Kumar SP. Autophagy and plant innate immunity. Cell Microbiol
2006; 8: 899–906.
61. Yoshimoto K, Takano Y, Sakai Y. Autophagy in plants and phytopathogens. FEBS Lett
2010; 584: 1350–1358.
62. Hofius D, Schultz-Larsen T, Joensen J, Tsitsigiannis DI, Petersen NH, Mattsson O et al.
Autophagic components contribute to hypersensitive cell death in Arabidopsis. Cell 2009;
137: 773–783.
63. Gilroy EM, Hein I, van der Hoorn R, Boevink PC, Venter E, McLellan H et al. Involvement
of cathepsin B in the plant disease resistance hypersensitive response. Plant J 2007; 52:
1–13.
64. Hatsugai N, Iwasaki S, Tamura K, Kondo M, Fuji K, Ogasawara K et al. A novel membrane
fusion-mediated plant immunity against bacterial pathogens. Genes Dev 2009; 23:
2496–2506.
65. Pajerowska-Mukhtar K, Dong X. A kiss of death–proteasome-mediated membrane fusion
and programmed cell death in plant defense against bacterial infection. Genes Dev 2009;
23: 2449–2454.
66. Travassos LH, Carneiro LA, Ramjeet M, Hussey S, Kim YG, Magalhaes JG et al. Nod1 and
Nod2 direct autophagy by recruiting ATG16L1 to the plasma membrane at the site of
bacterial entry. Nat Immunol 2010; 11: 55–62.
67. Yoshimoto K, Jikumaru Y, Kamiya Y, Kusano M, Consonni C, Panstruga R et al.
Autophagy negatively regulates cell death by controlling NPR1-dependent salicylic acid
signaling during senescence and the innate immune response in Arabidopsis. Plant Cell
2009; 21: 2914–2927.
68. Krol E, Mentzel T, Chinchilla D, Boller T, Felix G, Kemmerling B et al. Perception of the
Arabidopsis danger signal peptide 1 involves the pattern recognition receptor AtPEPR1
and its close homologue AtPEPR2. J Biol Chem 2010; 285: 13471–13479.
69. Bernales S, McDonald KL, Walter P. Autophagy counterbalances endoplasmic reticulum
expansion during the unfolded protein response. PLoS Biol 2006; 4: e423.
70. Wang D, Weaver ND, Kesarwani M, Dong X. Induction of protein secretory pathway is
required for systemic acquired resistance. Science 2005; 308: 1036–1040.
71. Ivanov S, Fedorova E, Bisseling T. Intracellular plant microbe associations: secretory
pathways and the formation of perimicrobial compartments. Curr Opin Plant Biol 2010; 13:
372–377.
Cell Death and Differentiation