View - ResearchGate

240 Arnau et al.
6. Collect the flow-through (measured by absorbance at 280 nm) and pool fractions
containing the tag-free protein (TNF).
3.4. Removal of the Tag Alternative, Step 2: On-Column-Bound
pGAPase Treatment for Pyroglutamyl Removal
1. Place column 1 on top of column 2 and the set on top of column 3 (see Fig. 1B
and Subheading 2.6.).
2. Apply sample (∼40 ml) and set flow to 1 ml/min (see Note 10).
3. Wash the column with buffer C at a flow rate of 1 ml/min. Collect the flow-through
(measured by absorbance at 280 nm) and pool fractions containing the tag-free
protein (TNF).
3.5. DAPase Test for Pyroglutamyl Removal by pGAPase
Treatment of purified, tag-free TNF with DAPase can be monitored as it
yields a truncated form where the first six residues are removed when pyroglutamyl
has been removed from the N terminus. This results in a change in size that
can be monitored by SDS–PAGE (see Fig. 4). If removal of pyroglutamyl is not
effective, the DAPase test will result in a fraction of the protein not been cleaved.
1. Prepare a mixture containing 13.5 μl DAPase (10 units/ml) and 13.5 μl cysteamine
(200 mM).
2. Mix 25 μl purified protein (or 40–50 μg processed protein eluted from the
subtractive IMAC) and 27 μl DAPase mix.
3. Incubate at 37°C for 2 h (no mixing required).
4. Use 25 μl sample to run an SDS–PAGE comparing to the untreated processed
protein (see Fig. 4).
4. Notes
1. Sequence-dependent cleavage efficiency by DAPase (see Table 1).
2. NNNN depicts a stretch of four bases to allow for effective digestion
with restriction enzymes. In an alternative strategy, the cloning vector can
be modified to incorporate the UZ-HT15 sequence. Then, it is possible
to engineer restriction sites overlapping the last codon of the His-tag
sequence. One example of this is shown with PvuII (for blunt-end cloning).
vector... ATGAAACACCAACACCAACATCAACATCAACATCAACAT(CAA)CAGCTG...
vector or NdeI, where the last Gln is substituted with a Met (it can be removed
with DAPase). Here again, the stop Gln residue has to be added at the 5´ end
of the cloned fragment to ensure precise cleavage of the tag. vector... ATG
AAACACCAACACCAACATCAACATCAACATCAACATATG......vector
3. The high imidazole concentration in buffer B is required for the elution of TNF
as the protein is a trimer with high affinity for IMAC. For other proteins, 0.5 M
imidazole should be a reasonable concentration. Optimization can be performed
to further reduce the concentration of imidazole.