View - ResearchGate

118 Casey et al.
6) Wash four times as above, add substrate 100 μl/well O-phenylenediamine (OPD
Sigma P-3804), wait until color develops and stop color reaction with 100 μl/well
1 M HCl and read plate at OD 490 nm .
3.3. Titration of Phage
1) The titer of phage should be determined by preparing 10-fold serial dilutions of
phage and allowing re-infection of mid-log phase E. coli K91 cells for 30 min at
room temperature.
2) A sample of each dilution should be plated onto Luria broth (LB) agar plates
containing 40 μg/ml tetracycline; the titer can be derived by counting the number
of colonies. Phage titers are expressed as colony forming units per ml (CFU/ml).
3.4. Analyzing Individual Clones for Binding by ELISA
1) Streak out around four glycerol stocks and pick 10 individual colonies, inoculate
10 ml of SB media containing 40 μg/ml tetracycline and allow cultures to grow
overnight shaking vigorously at 37ºC.
2) Prepare phage as in Subheading 3.1., steps 10 and 11, and prepare glycerol
stocks for the individual colonies.
3) Perform an ELISA as in Subheading 3.2 to test whether individual clones bind
to the parent antibody.
3.5. Sequencing of Clones Selected from 20-Mer Phage
Peptide Library
The sequence of individual phage clones that have been shown to bind (see
Subheading 3.4.) can easily be obtained. If more than four different sequences
are obtained from sequencing of 10 clones, we recommend performing 1–2
additional rounds of panning and increasing the number of washes.
1) Streak out round four glycerol stocks, and pick colonies from each plate for
sequencing.
2) Polymerase chain reaction (PCR) the insert region using forward and reverse
primers: Reverse primer, GCCTGTAGCATTCCACAGACAG; Forward primer,
GTGTTTTAGTGTATTCTTTCGCCTCTTTC. PCR (50 μl): Colony, 1.0 μl (made
to 20 μl with sterile dH 2 O); Forward primer, 0.5 μl of a 1/5 dilution, (dilute
original stock of primer to 1 μg/μl); Reverse primer, 0.5 μl of a 1/5 dilution (dilute
original stock of primer to 1 μg/μl); Taq, 0.25μl; 25 mM MgCl 2 , 5 μl; 10× buffer,
5 μl; deoxynucleoside triphosphates (dNTP), 5 μl (2.5 mM final concentration of
each dNTP); sterile dH 2 O, 32.75 μl. PCR conditions: 94ºC for 5 min, 30 cycles
of 94ºC (30 s), 52ºC (30 s) and 72ºC (30 s) then 72ºC for 7 min.
3) After the reaction is complete, analyze a sample on a 1% agarose gel, use a PCR
clean up kit and send samples for DNA sequencing.