Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias

More documents

Recommendations

Info

$(Microsoft PowerPoint - Lecci\363n 2_07.ppt)$

16 t h International Congress on Animal Reproduction 152 Poster Abstracts the development, total number cells and relative abundance of Hsp70.1 of in vitro fertilized bovine embryos. Materials and methods COCs collected in slaughterhouse were matured and in vitro fertilized. The presumptive zygotes were randomly distributed in three groups of medium culture CR2aa supplemented with 10% of fetal calf serum (FCS); 10% knockout serum replacer (KSR) and 3 mg/ml of polyvinyl alcohol (PVA). Cleavage rate and blastocyst rate were determined respectively 72 and 168 hours post-fertilization (hpf). The total number of cells were determined at 192 hpf. Pools of ten embryos obtained at 192 hpf were frozen for RNA extraction and real time RT-PCR methodology was used to obtain quantitative data of Hsp 70.1 transcripts. Expression of GAPDH gene was used as endogenous reference. Calculations of relative quantification were performed by Comparative Ct method, using the value found in PVA group as calibrator. Data of cleavage and blastocyst rate were analyzed by the Kruskal Wallis test and the total number of cell by variance analyses. Means were compared by Student Newman Keuls test. Results and Discussion No significant difference (P>0.05) was found among FCS (57,8±4,6), KSR (62,2±4,5) and PVA (60,4±4,4) on cleavage rate. However, blastocyst rate (12,2±2,1 and 18,6±3,0) and total number of cells (105,9±5,9 and 109,4±6,1) were similar (P>0.05) for KSR and FCS, and higher (P0.05) between FCS and KSR groups. These data show that bovine embryos cultured in medium supplemented with KSR has similar patterns of development, quality and Hsp70.1 expression than those cultured in presence of the serum. In conclusion, KSR is able to support development of in vitro fertilized bovine embryos and it can be an alternative when serumfree culture medium is recommended. Thanks to Agrogenetica, FAPEMIG, CNPq P378 Melatonin treatment and undernutrition affect expression of uterine estrogen and progesterone receptors in ewes during the reproductive and the anestrous seasons Vázquez, MI 1 *; Sartore, I 2 ; Abecia, JA 1 ; Forcada, F 1 ; Sosa, C 1 ; Palacín, I 1 ; Casao, A 1 ; Meikle, A 3 1Animal Production and Food Science, Veterinary Faculty, University of Zaragoza, Spain; 2 Biochemistry, Faculty of Veterinary Medicine, University of Montevideo, Uruguay; 3 Laboratory of Nuclear Techniques, Faculty of Veterinary Medicine, University of Montevideo, Uruguay Melatonin treatment in ewes increases prolificacy and fertility. A reduction in PGF2α in vitro secretion by endometrial cells after melatonin addition has been reported, suggesting that melatonin could act directly on sheep endometrium. In previous studies we have shown that undernutrition affects endometrial sensitivity to estradiol and progesterone by decreasing their receptor concentration (ERα and PR, respectively) which could explain the lower pregnancy rates found in undernourished ewes. In this study we tested the hypothesis that melatonin treatment could counteract subnutrition effects, and thus ERα and PR content in different endometrial cell types were studied in undernourished ewes. Adult Rasa Aragonesa ewes were assigned to a 2 x 2 factorial design performed both in the reproductive (RS, n=25) and anestrous seasons (AS, n=24). They were treated (+MEL) or not (-MEL) with a subcutaneous implant of melatonin for 42 days (Melovine®, CEVA) and fed to provide 1.5 (Control, C) or 0.5 (Low, L) times daily maintenance requirements from synchronization day with intravaginal pessaries. Ewes were mated at oestrus (Day=0) and slaughtered on Day 5, when pieces of uterus were collected to determine PR and ERα by immunohistochemistry. There was an effect of season on the staining intensity of PR (P
16 t h International Congress on Animal Reproduction Poster Abstracts 153 P380 HaeⅡ polymorphism at caprine inhibin-alpha gene and its relationship to litter size Hua, GH 1 ; Chen, SL 1 ; Shen, Z 2 ; Wen, QY 3 *; Zhang, ZR 3 ; Yang, LG 1 1China Education Ministry’s Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR China; 2 Animal Husbandry Bureau of Hubei Province, Wuhan, China; 3Animal Husbandry Bureau of Shiyan of Hubei, Shiyan, China Introduction Goats contribute largely to the livestock industry and livelihoods of people in the world. Goats are animals with moderate prolificacy. It is important to improve the fertility of the goat. Reproductive traits such as litter size and conception rate are crucial economic traits with low heritability. Marker association selection (MAS) is a useful method to improve animal fertility via genetic selection. Inhibin is a kind of glycoprotein hormone which plays an important role in animal reproduction for its regulation of pituitary FSH secretion. The decline in inhibin secretion is responsible for an increase in FSH which coincides with an increased rate of follicular depletion. The objective of this research is to detect the polymorphism of INHA in goat and to investigate the relationship between the genotypes and litter size. Materials and Methods A total of 387 adult females individuals from 3 breeds of goats were examined, including Boer (n=208), Matou (n=125), Haimen (n=54) goats. Approximately 10 ml of blood was collected aseptically from the jugular vein in EDTA. The genomic DNA was extracted from white blood cells using standard phenol-chloroform extraction procedure. The DNA samples were dissolved in TE buffer (PH=8.0) and stored at -20℃ for use. The primers were designed according the INHA sequence of sheep (Accession number: L28815) as follows: forward- 5’CCACACAGGACTGGACAGACA3’ and reverse-5’ GCAGGAACAGAGAGGACAACG-3’. PCR-SSCP, sequencing and PCR-RFLP were applied to detect the mutation and genotypes. The effect of INHA genotypes on the litter size of goat were analyzed by GLM procedure of SAS. Results 217bp fragments were obtained from PCR. A G284A mutation was tested by sequencing different genotypes of individuals separated by PCR-SSCP. A Haerestriction site was changed by the mutation. Genotyping was performed successfully for a total of 387 individuals. Of these, 286 were homozygous (GG) for the presence of the functional Hae restriction site, 27 were absence (AA), and 74 were heterozygous (AG). An association between the genotypes with litter size was examined. The GG individuals were positively associated with better litter size, followed by AA and AG. The mean litter sizes were 2.273, 2.231, 2.002 respectively. Conclusions The INHA gene can be used as a candidate gene for selection of litter size in the goat. The individuals with GG genotype is the favorable one for the goat breeding. Besides, it is necessary to search other loci in INHA gene in more samples. P381 Construction and expressed conditions optimization of an inhibin gene fragament prokaryotic expression plasmid Han, L 1 ; Cao, SX 2 ; Liang, AX 1 ; Zhen, YH 1 ; Wang, QL 1 ; S, L 1 ; Yang, LG 1 * 1China Education Ministry’s Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR China; 2 College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, China Introduction Improving reproductive efficiency in females is one of the major concerns in the monotocous animal, such as cattle. Inhibin plays an essential role in the regulating FSH secretion in various mammals. Previous studies have proved that active immunization and passive immunization against inhibin increase FSH secretions and ovulation rate in females. And they also proved that the peptide of subunit α(1-32) that can induce the special antibody was better than others. However, a synthetic peptide of a subunit of swine inhibin was an effective antigen when conjugated to a carrier protein. The synthetic peptide and complete inhibin molecule apparently contain similar epitopes to which antibody binding blocks inhibin's bioactivity. Hepatitis B surface antigen gene (HBsAg) has been used as a particulate carrier for various foreign gene products. So, the preparation of inhibin α(1-32) fragment is very important to improve the fertility in animals. Methods The single strands of porcine inhibin α (1~32) (INH) gene (NM_214189) was synthesized chemically by Sangon. The gene of an inhibin α fragment was annealed and fused to the downstream of 225 amino acids of the encoding region of HBsAg gene and the site of amino acid sequence 112-113, and the recombinant fragment was subcloned into the vector pET-28a to obtain an inhibin expression vector pETISI with high immunogenicity. The recombinant plasmid pETISI was then verified by restriction endonuclease analysis and the integrity of coding sequences was checked by sequence analysis (Sangon). Finally, the plasmid pETISI was transfected into the host of E.coli BL.21 which can express ISI recombinant protein. The recombinant protein (41.2KDa) was detected by SDS-PAGE, which induced through the different concentration of IPTG and different induced time. The bioactivity of the recombinant protein was detected by western blot with mouse inhibin antibody (Thermo). Results The results of SDS-PAGE gel indicated that the recombinant protein was expressed in E.coli BL.21. And the highest expression of this protein was induced with 1mmol/L IPTG and 6 hour induced, at 37 centigrade. And the results of western blot indicated that the recombinant protein had high immunological activity of inhibin. Conclusion In a word, the inhibin gene could be expressed highly in the host E.coli BL.21 and the recombinant protein combined with HBsAg had high immunological activity. The large-scale preparation of this protein would settle the substance ground improving the fertility in animals, especially in monotocous animal. Poster 14 - Ovary and Uterus P382 Detection of apoptosis in bovine endometrium during early period of involution Domokos, M. 1 *, Ígyártó, B 2 , Pécsi, A. 3 , Földi, J. 4 , Kulcsár, M. 1 , Huszenicza, G. 1 , Neogrády, Zs. 1 , Gálfi, P. 1 1Faculty of Veterinary Sciences Szent István University Budapest; 2Department of Human Morphology and Developmental Biology Semmelweis University Budapest; 2 Centre for Agricultural Sciences and Engineering University of Debrecen ; 4 Intervet International BV, Angers, France In the postpartum uterine involution programmed cell death, apoptosis is needed for returning to the pre-pregnancy state. Apoptosis in contrast to necrosis makes possible dying cells without membrane disruption and consequent inducing of inflammation. Dairy cows undergo a period of negative energy balance in puerperium because energy output for milk production and uterine involution exceeds feed energy intake. In negative energy status involution may become moderate because involution process and apoptosis are energydependent as well. In this study cows were investigated in early period of involution to determine the apoptosis index with immunohistochemistry in their endometrium biopsia samples and to find out its connection with the beta-hydroxybutyrate (BHB) blood concentration labeling their energy status. Paraffin-embedded tissue samples were immunofluorescence stained for apoptosis detection with two methods. We used terminal deoxynucleotidyl-transferase mediated dUTP nick-end labeling (TUNEL) and PARP (monoclonal antibody against caspase-cleaved fragment of poly-ADP-ribosepolimerase) assays. At first we tested the methods on thymus samples from calf and they worked after some methodical changes acceptable. On the uterus samples only few cells were stained by the PARP assay and many of them were fals staining so we did not use it to determine the apoptosis index of the endometrium. While a lot of tissue samples were extremely infiltrated by inflammatory cells, antibody against CD45 (human leukocyte antigene) was used to exclude these tissue samples. After this procedure TUNEL staining was used for detection of apoptotic cells in uterus biopsies. In the hyperketonaemical group
Page 1 and 2:
REPRODUCTION IN DOMESTIC ANIMALS 43
Page 3 and 4:
16th International Congress on Anim
Page 5 and 6:
16 t h International Congress on An
Page 7 and 8:
Page 9 and 10:
Page 11 and 12:
Page 13 and 14:
Page 15 and 16:
Page 17 and 18:
Page 19 and 20:
Page 21 and 22:
Page 23 and 24:
Page 25 and 26:
Page 27 and 28:
Page 29 and 30:
Page 31 and 32:
Page 33 and 34:
Page 35 and 36:
Page 37 and 38:
Page 39 and 40:
Page 41 and 42:
Page 43 and 44:
Page 45 and 46:
Page 47 and 48:
Page 49 and 50:
Page 51 and 52:
Page 53 and 54:
Page 55 and 56:
Page 57 and 58:
Page 59 and 60:
Page 61 and 62:
Page 63 and 64:
Page 65 and 66:
Page 67 and 68:
Page 69 and 70:
Page 71 and 72:
Page 73 and 74:
Page 75 and 76:
Page 77 and 78:
Page 79 and 80:
Page 81 and 82:
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Page 95 and 96:
Page 97 and 98:
Page 99 and 100:
Page 101 and 102:
Page 103 and 104: 16 t h International Congress on An
Page 153: 16 t h International Congress on An
Page 205 and 206:
Page 207 and 208:
Page 209 and 210:
Page 211 and 212:
Page 213 and 214:
Page 215 and 216:
Page 217 and 218:
Page 219 and 220:
Page 221 and 222:
Page 223 and 224:
Page 225 and 226:
Page 227 and 228:
Page 229 and 230:
Page 231 and 232:
Page 233 and 234:
show all

Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?