Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias

16 t h International Congress on Animal Reproduction
Poster Abstracts 139
increase significantly in vitro fertilization with frozen-thawed rabbit
semen.
Our work were supported by Wellcome Trust (070246/Z/03/Z) and
the EU FP6 (MEXT-CT-2003-509582, MRTN-CT-2006-035468).
Poster 10 - Avian Reproduction
P338
Comparison of various freezing protocols of native
roosters semen
Barna, J*, Végi, B
Avian Reproduction Group, Research Institute for Animal Breeding and
Nutrition, Hungary
Efficiency of semen freezing of Hungarian speckled roosters was
evaluated in vitro. The aim of the study is the support of the ex situ
gene conservation efforts on indigenous Hungarian chicken breeds.
Semen of 10 individually placed males were collected twice weekly
for 6 weeks. The pooled samples were divided into 5 equal parts for
the various freezing protocols. The composition of the semen diluent
was the same in all cases, the protocols differed in the type of
cryoprotectants (glycerol, MA, DMA), the rates of cooling (slow, fast)
and the type of cryo-conteners (straw, ampoule). The slow cooling
with glycerol in ampoule using programmable freezer (Lake and
Stewart, 1978) served as an etalon for comparison the various fast
protocols in nitrogen vapour, as simple, quick and inexpensive way
for maintaining of spermatozoa. For assessment of the effectiveness
of protocols in vitro determination of the survived, morphologically
intact sperm ratio was the main goal. Testing the damaging effect of
cryopreservation procedures 4 qualifications/sample were performed
at each steps of the protocols: 1. fresh undiluted semen; 2. diluted
semen during equilibration without cryoprotectants; 3. diluted semen
at finishing of equilibration with cryoprotectants; 4. semen after
freeze-thaw cycle. In fresh samples the concentrations
spectrophotometrically and the motility by subjective scoring were
measured. On the basis of membrane permeability the live/dead cell
ratios and the sperm anomalies were determined using aniline-eosin
stained smears by counting 200 spermatozoa/samples. Only those
samples were frozen which had a concentration characteristic of
breed, motility with maximum score and a live, morphologically
normal cell ratio above 80%. On the effect of simple dilution sperm
decay was as double as in fresh semen (13%), at the end of
equilibration with cryoprotectants there was a further increase in
sperm death (7%), after freeze-thaw cycle 50 and 80% of spermatozoa
died in slow and fast protocol, respectively. Around 50% of recovered
cells had abnormal morphology in all cases, therefore the ratios of
live, morphologically intact cells which are presumably able to take
part in the fertilization were only 23.7, 12.5, 14.1, 4.3 and 9 % in
slow, fast with DMA in straw and ampoule and MA in straw and
ampoule protocols, respectively. Although, the slow freezing could
produce significantly higher survival rate the further perfection of the
simple method in nitrogen vapour using DMA and ampoule seems to
be promising.
P339
Effect of diets with different lipid sources in the ability of
rooster sperm to hydrolyze the inner perivitelline layer of
the egg
Bongalhardo, DC 1 *, Nunes, PM 2 , Oliveira, EB 2 , Anciuti, MA 3 , Rutz, F 4 , Ledur,
MC 5 , Deschamps, JC 2
1Departamento de Fisiologia e Farmacologia, Universidade Federal de
Pelotas, Brazil; 2 Faculdade de Veterinária, Universidade Federal de Pelotas,
Brazil; 3 Conjunto Agrotécnico Visconde da Graça, Universidade Federal de
Pelotas, Brazil; 4 Departamento de Zootecnia, Universidade Federal de
Pelotas, Brazil; 5 EMBRAPA Suínos e Aves, Brazil
maintained its membrane integrity and motility when compared with a
control. Compared with these in vitro evaluations of sperm quality,
the sperm:egg interaction assay predicts, with more accuracy, the
ability of sperm to fertilize the egg. This work aimed to verify if the
ability of rooster sperm to hydrolyze holes in the inner periviteline
layer (IPVL) of fresh chicken eggs would be affected by diets with
different lipid sources. Twenty roosters with 37 weeks of age were
divided in 4 groups and fed with one of the following diets: 1) control
(standard diet, without addicional lipid source), 2) corn (standard diet
+ 4% corn oil), 3) fish (standard diet + 4% fish oil), and flax (standard
diet + 4% flax oil). Gas chromatography analyses of these diets
showed the following amounts of n3 and n6 fatty acids: 2.6 and
48.3% for control, 1.1 and 50.7% for corn, 9.3 and 26.7% for fish, and
36.6 and 24.2% for flax. After 6 weeks on the treatments, semen was
collected and pooled by diet. This pool was then evaluated by its
ability to hydrolyze holes in the IPVL. After three repetitions, results
were analyzed by Kruskall-Wallis test, for non-parametric data.
Means and standard errors for each treatment were 123 ± 51, 92 ± 47,
73 ± 22 and 71 ± 42 holes/mm2 of IPVL for control, corn, fish, and
flax, respectively. There was no significant difference (P>0.05)
among treatments. It can be concluded that sperm modified by dietary
lipids maintain its ability to hydrolize holes in the membrane, and
suggests that its ability to fertilize the egg would also remain
unchanged.
P340
Sex determination in juvenile Emus (Dromaius
novaehollandiae) from feathers by PCR
Costantini, V 1 *; Guaricci, AC 1 ; Rausa, F 2 ; Bucci, FA 1 ; Lacalandra, GM 1
1Department of Animal Production, Faculty of Veterinary Medicine, University
of Bari, Italy; 2 Zoosafari Fasano, Italy
Introduction The molecular sexing methods DNA-based on the
amplification of the chromo-helicase-DNA-binding 1 (CHD1) gene of
the sex chromosomes were successfully established for many avian
species, but none of these tests is widely applicable to ratite birds.
Recently, the sequences of ESEXZ and ESEXW have been used for
the development of a two-primer CAPS (cleaved amplified
polymorphic sequence) assay for sex identification of the Emu
(Dromaius novaehollandiae) (de Kloet 2001). In the current study,
during a captive breeding program, we assessed the effectiveness of a
molecular based assay with amplification of a sex-specific locus
(kW1), W chromosome-linked in the North Island Brown Kiwi
(Apteryx australis mantelli) and all ratite species, for sexing young
Emus, using genomic DNA from feather samples.
Methods Genomic DNA was isolated from the calamus of small
double feathers, collected from the back of 4 months old Emus, using
GenEluteTM Mammalian Genomic DNA mini prep kit (Sigma,
Milano, Italy). The samples were derived from birds of known sex,
determined by cloacal examination (seven males and three females).
The kW1 locus was PCR-amplified (forward primer:
CCTTTAAACAAGCTGTTAAAGCA; reverse primer:
TCTCTTTTGTTCTAGACACCCT). Amplification products were
separated on 2% agarose gel and stained with ethidium bromide.
Results Amplification of Emu DNA using the primers w1 and k7
resulted, after run, in the production of a single sex-specific band
(~150 bp) only in female subjects (female-specific band).
Conclusions In this report we describe a PCR approach from feather
DNA in Emu (Dromaius novaehollandiae), with amplification of a
sex-specific locus W chromosome-linked (kW1), that appears to be a
rapid, reliable and no risks technique for sex determination of this
species, especially young, in breeding programs.
References de Kloet SR, 2001: Development of a CAPS (cleaved
amplified polymorphic sequence) assay for sex identification of the
emu (Dromaius novaehollandiae). Molecular Ecology Notes 1 (4),
273–275.
Dietary lipids alter sperm membranes by the modification of specific
fatty acids and may have an impact on sperm fertilizing ability.
Previous work showed that sperm modifyed by dietary means