Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias
Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias
Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
16 t h International Congress on Animal <strong>Reproduction</strong><br />
Poster Abstracts 139<br />
<strong>in</strong>crease significantly <strong>in</strong> vitro fertilization with frozen-thawed rabbit<br />
semen.<br />
Our work were supported by Wellcome Trust (070246/Z/03/Z) and<br />
the EU FP6 (MEXT-CT-2003-509582, MRTN-CT-2006-035468).<br />
Poster 10 - Avian <strong>Reproduction</strong><br />
P338<br />
Comparison of various freez<strong>in</strong>g protocols of native<br />
roosters semen<br />
Barna, J*, Végi, B<br />
Avian <strong>Reproduction</strong> Group, Research Institute for Animal Breed<strong>in</strong>g and<br />
Nutrition, Hungary<br />
Efficiency of semen freez<strong>in</strong>g of Hungarian speckled roosters was<br />
evaluated <strong>in</strong> vitro. The aim of the study is the support of the ex situ<br />
gene conservation efforts on <strong>in</strong>digenous Hungarian chicken breeds.<br />
Semen of 10 <strong>in</strong>dividually placed males were collected twice weekly<br />
for 6 weeks. The pooled samples were divi<strong>de</strong>d <strong>in</strong>to 5 equal parts for<br />
the various freez<strong>in</strong>g protocols. The composition of the semen diluent<br />
was the same <strong>in</strong> all cases, the protocols differed <strong>in</strong> the type of<br />
cryoprotectants (glycerol, MA, DMA), the rates of cool<strong>in</strong>g (slow, fast)<br />
and the type of cryo-conteners (straw, ampoule). The slow cool<strong>in</strong>g<br />
with glycerol <strong>in</strong> ampoule us<strong>in</strong>g programmable freezer (Lake and<br />
Stewart, 1978) served as an etalon for comparison the various fast<br />
protocols <strong>in</strong> nitrogen vapour, as simple, quick and <strong>in</strong>expensive way<br />
for ma<strong>in</strong>ta<strong>in</strong><strong>in</strong>g of spermatozoa. For assessment of the effectiveness<br />
of protocols <strong>in</strong> vitro <strong>de</strong>term<strong>in</strong>ation of the survived, morphologically<br />
<strong>in</strong>tact sperm ratio was the ma<strong>in</strong> goal. Test<strong>in</strong>g the damag<strong>in</strong>g effect of<br />
cryopreservation procedures 4 qualifications/sample were performed<br />
at each steps of the protocols: 1. fresh undiluted semen; 2. diluted<br />
semen dur<strong>in</strong>g equilibration without cryoprotectants; 3. diluted semen<br />
at f<strong>in</strong>ish<strong>in</strong>g of equilibration with cryoprotectants; 4. semen after<br />
freeze-thaw cycle. In fresh samples the concentrations<br />
spectrophotometrically and the motility by subjective scor<strong>in</strong>g were<br />
measured. On the basis of membrane permeability the live/<strong>de</strong>ad cell<br />
ratios and the sperm anomalies were <strong>de</strong>term<strong>in</strong>ed us<strong>in</strong>g anil<strong>in</strong>e-eos<strong>in</strong><br />
sta<strong>in</strong>ed smears by count<strong>in</strong>g 200 spermatozoa/samples. Only those<br />
samples were frozen which had a concentration characteristic of<br />
breed, motility with maximum score and a live, morphologically<br />
normal cell ratio above 80%. On the effect of simple dilution sperm<br />
<strong>de</strong>cay was as double as <strong>in</strong> fresh semen (13%), at the end of<br />
equilibration with cryoprotectants there was a further <strong>in</strong>crease <strong>in</strong><br />
sperm <strong>de</strong>ath (7%), after freeze-thaw cycle 50 and 80% of spermatozoa<br />
died <strong>in</strong> slow and fast protocol, respectively. Around 50% of recovered<br />
cells had abnormal morphology <strong>in</strong> all cases, therefore the ratios of<br />
live, morphologically <strong>in</strong>tact cells which are presumably able to take<br />
part <strong>in</strong> the fertilization were only 23.7, 12.5, 14.1, 4.3 and 9 % <strong>in</strong><br />
slow, fast with DMA <strong>in</strong> straw and ampoule and MA <strong>in</strong> straw and<br />
ampoule protocols, respectively. Although, the slow freez<strong>in</strong>g could<br />
produce significantly higher survival rate the further perfection of the<br />
simple method <strong>in</strong> nitrogen vapour us<strong>in</strong>g DMA and ampoule seems to<br />
be promis<strong>in</strong>g.<br />
P339<br />
Effect of diets with different lipid sources <strong>in</strong> the ability of<br />
rooster sperm to hydrolyze the <strong>in</strong>ner perivitell<strong>in</strong>e layer of<br />
the egg<br />
Bongalhardo, DC 1 *, Nunes, PM 2 , Oliveira, EB 2 , Anciuti, MA 3 , Rutz, F 4 , Ledur,<br />
MC 5 , Deschamps, JC 2<br />
1Departamento <strong>de</strong> Fisiologia e Farmacologia, Universida<strong>de</strong> Fe<strong>de</strong>ral <strong>de</strong><br />
Pelotas, Brazil; 2 Faculda<strong>de</strong> <strong>de</strong> Veter<strong>in</strong>ária, Universida<strong>de</strong> Fe<strong>de</strong>ral <strong>de</strong> Pelotas,<br />
Brazil; 3 Conjunto Agrotécnico Viscon<strong>de</strong> da Graça, Universida<strong>de</strong> Fe<strong>de</strong>ral <strong>de</strong><br />
Pelotas, Brazil; 4 Departamento <strong>de</strong> Zootecnia, Universida<strong>de</strong> Fe<strong>de</strong>ral <strong>de</strong><br />
Pelotas, Brazil; 5 EMBRAPA Suínos e Aves, Brazil<br />
ma<strong>in</strong>ta<strong>in</strong>ed its membrane <strong>in</strong>tegrity and motility when compared with a<br />
control. Compared with these <strong>in</strong> vitro evaluations of sperm quality,<br />
the sperm:egg <strong>in</strong>teraction assay predicts, with more accuracy, the<br />
ability of sperm to fertilize the egg. This work aimed to verify if the<br />
ability of rooster sperm to hydrolyze holes <strong>in</strong> the <strong>in</strong>ner perivitel<strong>in</strong>e<br />
layer (IPVL) of fresh chicken eggs would be affected by diets with<br />
different lipid sources. Twenty roosters with 37 weeks of age were<br />
divi<strong>de</strong>d <strong>in</strong> 4 groups and fed with one of the follow<strong>in</strong>g diets: 1) control<br />
(standard diet, without addicional lipid source), 2) corn (standard diet<br />
+ 4% corn oil), 3) fish (standard diet + 4% fish oil), and flax (standard<br />
diet + 4% flax oil). Gas chromatography analyses of these diets<br />
showed the follow<strong>in</strong>g amounts of n3 and n6 fatty acids: 2.6 and<br />
48.3% for control, 1.1 and 50.7% for corn, 9.3 and 26.7% for fish, and<br />
36.6 and 24.2% for flax. After 6 weeks on the treatments, semen was<br />
collected and pooled by diet. This pool was then evaluated by its<br />
ability to hydrolyze holes <strong>in</strong> the IPVL. After three repetitions, results<br />
were analyzed by Kruskall-Wallis test, for non-parametric data.<br />
Means and standard errors for each treatment were 123 ± 51, 92 ± 47,<br />
73 ± 22 and 71 ± 42 holes/mm2 of IPVL for control, corn, fish, and<br />
flax, respectively. There was no significant difference (P>0.05)<br />
among treatments. It can be conclu<strong>de</strong>d that sperm modified by dietary<br />
lipids ma<strong>in</strong>ta<strong>in</strong> its ability to hydrolize holes <strong>in</strong> the membrane, and<br />
suggests that its ability to fertilize the egg would also rema<strong>in</strong><br />
unchanged.<br />
P340<br />
Sex <strong>de</strong>term<strong>in</strong>ation <strong>in</strong> juvenile Emus (Dromaius<br />
novaehollandiae) from feathers by PCR<br />
Costant<strong>in</strong>i, V 1 *; Guaricci, AC 1 ; Rausa, F 2 ; Bucci, FA 1 ; Lacalandra, GM 1<br />
1Department of Animal Production, Faculty of Veter<strong>in</strong>ary Medic<strong>in</strong>e, University<br />
of Bari, Italy; 2 Zoosafari Fasano, Italy<br />
Introduction The molecular sex<strong>in</strong>g methods DNA-based on the<br />
amplification of the chromo-helicase-DNA-b<strong>in</strong>d<strong>in</strong>g 1 (CHD1) gene of<br />
the sex chromosomes were successfully established for many avian<br />
species, but none of these tests is wi<strong>de</strong>ly applicable to ratite birds.<br />
Recently, the sequences of ESEXZ and ESEXW have been used for<br />
the <strong>de</strong>velopment of a two-primer CAPS (cleaved amplified<br />
polymorphic sequence) assay for sex i<strong>de</strong>ntification of the Emu<br />
(Dromaius novaehollandiae) (<strong>de</strong> Kloet 2001). In the current study,<br />
dur<strong>in</strong>g a captive breed<strong>in</strong>g program, we assessed the effectiveness of a<br />
molecular based assay with amplification of a sex-specific locus<br />
(kW1), W chromosome-l<strong>in</strong>ked <strong>in</strong> the North Island Brown Kiwi<br />
(Apteryx australis mantelli) and all ratite species, for sex<strong>in</strong>g young<br />
Emus, us<strong>in</strong>g genomic DNA from feather samples.<br />
Methods Genomic DNA was isolated from the calamus of small<br />
double feathers, collected from the back of 4 months old Emus, us<strong>in</strong>g<br />
GenEluteTM Mammalian Genomic DNA m<strong>in</strong>i prep kit (Sigma,<br />
Milano, Italy). The samples were <strong>de</strong>rived from birds of known sex,<br />
<strong>de</strong>term<strong>in</strong>ed by cloacal exam<strong>in</strong>ation (seven males and three females).<br />
The kW1 locus was PCR-amplified (forward primer:<br />
CCTTTAAACAAGCTGTTAAAGCA; reverse primer:<br />
TCTCTTTTGTTCTAGACACCCT). Amplification products were<br />
separated on 2% agarose gel and sta<strong>in</strong>ed with ethidium bromi<strong>de</strong>.<br />
Results Amplification of Emu DNA us<strong>in</strong>g the primers w1 and k7<br />
resulted, after run, <strong>in</strong> the production of a s<strong>in</strong>gle sex-specific band<br />
(~150 bp) only <strong>in</strong> female subjects (female-specific band).<br />
Conclusions In this report we <strong>de</strong>scribe a PCR approach from feather<br />
DNA <strong>in</strong> Emu (Dromaius novaehollandiae), with amplification of a<br />
sex-specific locus W chromosome-l<strong>in</strong>ked (kW1), that appears to be a<br />
rapid, reliable and no risks technique for sex <strong>de</strong>term<strong>in</strong>ation of this<br />
species, especially young, <strong>in</strong> breed<strong>in</strong>g programs.<br />
References <strong>de</strong> Kloet SR, 2001: Development of a CAPS (cleaved<br />
amplified polymorphic sequence) assay for sex i<strong>de</strong>ntification of the<br />
emu (Dromaius novaehollandiae). Molecular Ecology Notes 1 (4),<br />
273–275.<br />
Dietary lipids alter sperm membranes by the modification of specific<br />
fatty acids and may have an impact on sperm fertiliz<strong>in</strong>g ability.<br />
Previous work showed that sperm modifyed by dietary means