Reproduction in Domestic Animals - Facultad de Ciencias Veterinarias

REPRODUCTION IN DOMESTIC ANIMALS 43 Supplement 3
Reproduction
in Domestic Animals
Vol. 43 • Supplement 3
July 2008 • 1-232
Editor-in-Chief: Heriberto Rodriguez-Mártinez
Book of Abstracts
of the
16th International Congress on Animal Reproduction
13–17 July 2008 - Budapest, Hungary
Workshop abstracts
Poster abstracts
ISSN 0936-6768 (Print)
ISSN 1439-0531 (Online)
www.blackwellpublishing.com
Official Organ of
European Society for Domestic Animal Reproduction
European Veterinary Society of Small Animal Reproduction
Spanish Society of Animal Reproduction
An online version is available
www.blackwell-synergy.com

Reproduction in Domestic Animals
Official Organ of European Society for Domestic Animal Reproduction, European Veterinary
Society of Small Animal Reproduction and Spanish Society of Animal Reproduction
Editor-in-Chief
Prof. Dr. H. Rodriguez-Mártinez
Division of Reproduction
Department of Clinical Sciences
Faculty of Veterinary Medicine and Animal Science
Swedish University of Agricultural Sciences (SLU)
Ullsvägen 14C, Clinical Centre. P.O. Box 7054,
Ultuna SE-750 07 Uppsala,
Sweden
Telephone: +46-(0) 18672172
Fax: +46-(0) 18673545
E-mail: heriberto.rodriguez@kv.slu.se
Editorial Advisory Board
Associate Editors
Prof. Dr. W.A. King
University of Guelph
Dept. of Biomedical Sciences
Guelph, Ont. N1G 2W1, Canada
Prof. Dr. E. Martinez-Garcia
Veterinary Teaching Hospital
Dept. of Vet. Pathology, University of Murcia
Campus de Espinardo, 30500 Murcia, Spain
Prof. Dr. M. McGowan
School of Veterinary Science
University of Queensland
St. Lucia QLD 4072l, Australia
Prof Dr. José Luiz Rigo Rodrigues
Universidade Federal do Rio Grande do Sul
Faculdade de Veterinária
Caixa Postal 15004
91501-970 Porto Alegre RS, Brazil
Prof. Dr. E. Sato
Laboratory of Animal Production
Graduate School of Agricultural Science
Tohoku University
Aoba-Ku, Sendai 981-8555, Japan
W. R. Allen, Newmarket – J. Aurich, Vienna – F. W. Bazer, Texas – H. Bertschinger, Pretoria – P. Bols, Antwerp – G. Brem, Vienna – B. Brück, Frederiksberg –
F. Camillo, Pisa – D. Cavestany, Montevideo – M. A. Crowe, Dublin – H. Dobson, Liverpool – G. Evans, Sydney – A. Fontbonne, Maisons–Alfort – G. Foxcroft, Alberta –
R. Geisert, Oklahoma – T. Greve, Frederiksberg – B. Hoffman, Gießen – T. Katila, Helsinki – B. Kemp, Wageningen – G. Kilian, Pennsylvania – A. Kunavongkrit,
Bangkok – C. Linde–Forsberg, Uppsala – C. Maxwell, Sydney – K. Niwa, Okayama – J. Nöthling, Pretoria – K. Okuda, Okayama – A. R. Peters, Potters Bar –
D. Rath, Neustadt – L. Renato de França, Belo Horizonte – E. Seidel, Ft. Collins – L. Solti, Budapest – T. A. E. Stout, Utrecht – S. S. Suarez, Ithaca – C. Tamanini,
Bologna – J. Vasquez, Murcia – E. Watson, Edinburgh – G. v.d. Weijden, Utrecht – A. Ziecik, Olsztyn
The Journal is indexed by: AgBiotech News and Information; Agricola C R I S; Animal Breeding Abstracts; BIOBASE; Biological Abstracts; BIOSIS Previews;
Chemical Abstracts; Current Contents; Dairy Science Abstracts; Derwent Biotechnology Abstracts; Food Science and Technology Abstracts; Forest
Products Abstracts; Forestry Abstracts; Index Veterinarius; MEDLINE; Nutrition Abstracts and Reviews; Personal Alert; Pig News & Information; Poultry
Abstracts; Protozoological Abstracts; Referativnyi Zhurnal; Review of Medical and Veterinary Mycology; Science Citation Index; Soybean Abstracts (Online
Edition); Veterinary Bulletin; Wildlife Review Abstracts; World Agricultural Economics and Rural Sociology Abstracts.
Reproduction in Domestic Animals is the official organ for the European Society for Domestic Animal Reproduction, the European Veterinary Society of
Small Animal Reproduction and the Spanish Society of Animal Reproduction.
Reproduction in Domestic Animals publishes comprehensive information concerning physiology, pathology and biotechnology of reproduction, paying special
attention to applied and clinical research. The evaluation of papers is made by a team of specialists who decide about acceptance, changes or rejection. For author’s
instructions please visit the journals homepage www.blackwellpublishing.com/rda
Responsible according to Berlin press law: Prof. Dr. H. Rodriguez-Mártinez.
Publication Rights Contributions published in this journal are protected by copyright. All rights, whether of the whole or part of the published material are reserved,
specifically those of translation, reprinting, re-use of illustrations, reproduction on microfilms or by other means. Duplication of this journal or parts thereof is forbidden.
Copying one article or parts thereof is only permitted under the provisions of the German Copyright Law of September 9,1965, in its version of June 24, 1985, and a
copyright fee must always be paid. Violations fall under the prosecution act of the German Copyright Law. Legally permitted copies are to be marked with the source
of the original as well as with the name of the copier.
Disclaimer The Publisher, Societies and Editors cannot be held responsible for errors or any consequences arising from the use of information contained in this journal;
the views and opinions expressed do not necessarily reflect those of the Publisher, Societies and Editors, neither does the publication of advertisements constitute
any endorsement by the Publisher, Societies and Editors of the products advertised.
Author material archive policy Please note that unless specifically requested, Blackwell Publishing will dispose of all hardcopy or electronic material submitted two
months after publication. If you require the return of any material submitted, please inform the editorial office or production editor as soon as possible if you have not
yet done so.
Copyright and Photocopying Journal compilation © 2008 Blackwell Verlag. All rights reserved. No part of this publication may be reproduced, stored or transmitted in
any form or by any means without the prior permission in writing from the copyright holder. Authorization to photocopy items for internal and personal use is granted by
the copyright holder for libraries and other users registered with their local Reproduction Rights Organisation (RRO), e.g. Copyright Clearance Center (CCC), 222
Rosewood Drive, Danvers, MA 01923, USA (www.copyright.com), provided the appropriate fee is paid directly to the RRO. This consent does not extend to other kinds
of copying such as copying for general distribution, for advertising or promotional purposes, for creating new collective works or for resale. Special requests should be
addressed to: journalsrights@oxon.blackwellpublishing.com
Subscription information Reproduction in Domestic Animals is published six times a year. Subscription prices for 2008 are: Premium institutional: £594 (Europe),
£653 (Rest of World), $1098 (The Americas); Personal: £177 (Europe, non Euro Zone), €266 (Europe, Euro Zone), £195 (Rest of World), $328 (The Americas).
Customers in the UK should add VAT at 7%; customers in the EU should also add VAT at 7%, or provide a VAT registration number or evidence of entitlement to
exemption. Customers in Canada should add 6% GST or provide evidence of entitlement to exemption. The Premium institutional price includes online access to the
current and all available previous year electronic issues. For other pricing options including access information and terms and conditions, please visit www.blackwell
publishing.com/rda
Back issues Single issues from current and recent volumes are available at the current single issue price from Blackwell Publishing Journals. Earlier issues may be
obtained from Periodicals Service Company, 11 Main Street, Germantown, NY 12526, USA. Tel: +1 518 537 4700, Fax: +1 518 537 5899, Email: psc@periodicals.com.
Publisher
Reproduction in Domestic Animals is published by Blackwell Verlag GmbH, Kurfürstendamm 58, 10707 Berlin, Germany. Tel: (+49 30) 327 906-65, Fax:
(+49 30) 327 906-77. Email: verlag@blackwell.de. Internet homepage: www.blackwell.de
Blackwell Verlag is now part of Wiley-Blackwell
Delivery Terms and Legal Title
Prices include delivery of print journals to the recipient's address. Delivery terms are Delivered Duty Unpaid (DDU); the recipient is responsible for paying
any import duty or taxes. Legal title passes to the customer on despatch by our distributors.
Journal Customer Services:
For ordering information, claims and any enquiry concerning your journal subscription please contact your nearest office:
UK: Email: customerservices@blackwellpublishing.com; Tel: +44 (0) 1865 778315; Fax: +44 (0) 1865 471775
USA: Email: customerservices@blackwellpublishing.com; Tel: +1 781 388 8599 or 1 800 835 6770 (Toll free in the USA & Canada); Fax: +1 781 388 8232
or Fax: +44 (0) 1865 471775
Asia: Email: customerservices@blackwellpublishing.com; Tel: +65 6511 8000; Fax: +44 (0) 1865 471775
Production editor Jovencio Laoag Jr. Tel: (+65) 6511 8188, Fax: (+65) 65118288, Email: RDA@oxon.blackwellpublishing.com
Journal publication manager Suzanne Albrecht. Tel: (+49 30) 327 906-65, Fax: (+49 30) 327 906-77. Email:
suzanne.albrecht@ber.blackwellpublishing.com
Access to this journal is available free online within institutions in the developing world through the AGORA initiative with the FAO and the HINARI initiative
with the WHO. For information, visit www.aginternetwork.org or www.healthinternetwork.org.
REPRODUCTION IN DOMESTIC ANIMALS (ISSN 0936-6768) is published six times a year. US mailing agent: Mercury Airfreight International Inc., 365 Blair Road, Avenel,
NJ 07001, USA. Periodical postage paid at Rahway, NJ. Postmaster: Send all address changes to REPRODUCTION IN DOMESTIC ANIMALS, Blackwell Publishing Inc.,
Journals Subscription Department, 350 Main St., Malden, MA 02148-5020.
Information for Authors Please send your manuscript to the Editor-in-Chief Prof. Dr. H. Rodriguez-Mártinez and find instructions for authors on the journal homepage
www.blackwellpublishing.com/rda
Our policy is to use permanent paper from mills that operate a sustainable forestry policy, and which has been manufactured from pulp that is processed using acidfree
and elementary chlorine-free practices. Furthermore, we ensure that the text paper and cover board used in all our journals has met acceptable environmental
accreditation standards.
Note to NIH Grantees Pursuant to NIH mandate, Wiley-Blackwell will post the accepted version of contributions authored by NIH grant-holders to PubMed Central
upon acceptance. This accepted version will be made publicly available 12 months after publication. For further information, see www.wiley.com/go/nihmandate.
ISSN 0936–6768 (Print) ISSN 1439-0531 (Online)
Printed in Singapore by Markono Print Media Pte Ltd.
For submission instructions, subscription and all other information visit: www.blackwellpublishing.com/rda
This journal is available online at Blackwell Synergy. Visit www.blackwell-synergy.com to search the articles and register for table of contents e-mail alerts.
The largest on-line library includes textbooks, proceedings, journals,
manuals, a calendar, and much more. Free unlimited access for
veterinarians, veterinary technicians and students.
Books in Veterinary Medicine:
o A Concise Review of Veterinary Virology by
Carter, Wise and Flores
o Topics in Bull Fertility by Chenoweth
o Recent Advances in Small Animal
Reproduction by Concannon et al.
o Recent Advances in Equine Reproduction by
Ball
o Recent Advances in Yak Reproduction by Zhao
and Zhang
o Recent Advances in Anesthetic Management
of Large Domestic Animals by Steffey
o Recent Advances in Goat Diseases by
Tempesta
o Recent Advances in Laparoscopy and
Thoracoscopy by Wilson
o Recent Advances in Veterinary Anesthesia
and Analgesia: Companion Animals by Gleed
and Ludders
o Clinical Avian Medicine by Harrison and
Lightfoot
o Equine Respiratory Diseases by Lekeux
o Care of Donkeys by Matthews and Taylor
o A Guide to Hematology in Dogs and Cats by
Rebar, MacWilliams, Feldman, et al.
o Dermatology for the Small Animal Practitioner
by Mueller
o Veterinary Toxicology by Beasley
o Animal Disease Factsheets The Center for Food
Security & Public Health - Iowa State University
Proceedings in Veterinary Medicine:
o NAVC - North American Veterinary Conference
o IPVS - International Pig Veterinary Society
Congress
o WBC - World Buiatrics Congress
o AAEP - American Association of Equine
Practitioners
o SIVE - Italian Association of Equine
Veterinarians Annual Congress
o BEPS - Belgian Equine Practitioners Society
Study Days
o Geneva Congress on Equine Medicine and
Surgery
o SCIVAC - Società Culturale Italiana Veterinari
per Animali da Compagnia Congress
o EENHC - European Equine Health and
Nutrition Biannual Congress
o AAVPT – American Academy of Veterinary
Pharmacology and Therapeutics
o WSAVA - World Small Animal Veterinary
Association Annual Congress
o Canine Cancer Conference: Genes, Dogs,
and Cancer
o Cross-Species Approach to Pain and
Analgesia
o EAVDI - European Association of Veterinary
Diagnostic Imaging
o EAZWV - European Association of Zoo and
Wildlife Veterinarians Biannual Meetings
o Lameness in Ruminants Symposium
Veterinarians, students and Technicians have free access to all books and
proceedings. Visit the IVIS Website at www.ivis.org and register today. For free!!

16th International Congress on Animal Reproduction
13-17 July 2008 – Budapest, Hungary
BOOK OF ABSTRACTS
Workshop abstracts
Poster abstracts

SPONSORS, EXHIBITORS & ADVERTISERS
The Organising Committee expresses its gratitude to Minitüb Abfüll- und Labortechnik GmbH & Co. KG,
Current Conceptions Inc. and Alltech Hungary Ltd. for providing travel grants to ICAR congress participants.

16 t h International Congress on Animal Reproduction
Table of Contents 3
TABLE OF CONTENTS
TABLE OF CONTENTS .............................................................................................................................................. 3
WORKSHOP ABSTRACTS........................................................................................................................................ 5
Workshop 01 - Pathophysiology and Immunology of Postpartum Uterine Disease in Cattle...................................... 5
Workshop 02 - Factors Affecting Pregnancy Rates in Estrus Synchronization Programs in Beef Heifers.................. 6
Workshop 03 - Factors Influencing the Embryo Quality.............................................................................................. 7
Workshop 04 - Imaging techniques in reproduction.................................................................................................... 8
Workshop 05 - Sustainable development in care of reproduction in small ruminants: efforts and per-spectives ..... 10
Workshop 06 - Reproduction of Camelidae .............................................................................................................. 11
Workshop 07 - Physiology, Clinical Relevance and management of postpartum anovulation in dairy cows............ 12
Workshop 08 - Reproductive Physiology and Management of Reproduction in Farmed Cervidae .......................... 13
Workshop 09 - Cryopreservation of gametes and embryo ....................................................................................... 15
Workshop 10 - Artificial Insemination and Related Methods in Pet Carnivores ........................................................ 16
Workshop 11 - International Trade of Semen and Embryos..................................................................................... 17
Workshop 12 - New Applications of Technology for Education in Reproductive Science......................................... 18
Workshop 13 - Physiological and management factors affecting expression of estrus in cattle ............................... 19
Workshop 14 - Zoo and Wild Animal Reproduction .................................................................................................. 20
Workshop 15 - Animals as biomedical models in reproductive (and regenerative) medicine ................................... 22
Workshop 16 - Recent Progress in Andrological Procedures and Evaluations ........................................................ 24
Workshop 17 - Equine Endometritis ......................................................................................................................... 25
Workshop 18 - Pregnancy, fetal well-being and the peri-parturient dam .................................................................. 26
POSTER REVIEWERS ................................................................................................................................................. 27
POSTER ABSTRACTS................................................................................................................................................. 28
Poster 01 - Bovine Reproduction.............................................................................................................................. 28
Poster 02 - Reproduction of Small Ruminants.......................................................................................................... 70
Poster 03 - Reproduction of Buffalo and Exotic Bovidae .......................................................................................... 89
Poster 04 - Reproduction of Camelidae.................................................................................................................... 93
Poster 05 - Equine Reproduction.............................................................................................................................. 97
Poster 06 - Porcine Reproduction........................................................................................................................... 114
Poster 07 - Reproduction of Pet Carnivores ........................................................................................................... 125
Poster 08 - Reproduction of Zoo and Wild Mammals ............................................................................................. 131
Poster 09 - Reproduction of Rabbit and Laboratory Rodents ................................................................................. 135
Poster 10 - Avian Reproduction.............................................................................................................................. 139
Poster 11 - Reproduction of Other Vertebrates (Fishes, Amphibians, Reptiles)..................................................... 140
Poster 12 - Neuroendocrine Control of Reproduction............................................................................................. 142
Poster 13 - Molecular Biology of Reproduction....................................................................................................... 145
Poster 14 - Ovary and Uterus ................................................................................................................................. 153
Poster 15 - Pregnancy, Parturition, New-Born Offspring ........................................................................................ 156
Poster 16 - Andrology, Male Genitals ..................................................................................................................... 160
Poster 17 - Artificial Insemination and Related Techniques ................................................................................... 172
Poster 18 - Oocyte and Embryo (Including Nuclear Transfer) ................................................................................ 184
Poster 19 - Biomedical Models in Reproductive and Regenerative Medicine......................................................... 202
Poster 20 - Gene Modified Animals (Transgenics) ................................................................................................. 203
Poster 21 - New Methods in Care of Reproduction ................................................................................................ 206
Poster 22 - Stress, Diseased State and Reproduction ........................................................................................... 207
Poster 23 - Conservation of Biodiversity................................................................................................................. 209

16 t h International Congress on Animal Reproduction
4 Table of Contents
Poster 24 - Toxicology of Reproduction.................................................................................................................. 211
Poster 25 - Developments in Sustainable Animal Production and Reproduction ................................................... 214
Poster 26 - Trends in Research, Care and Teaching of Reproduction ................................................................... 214
Poster 27 - Trace Minerals and Reproduction ........................................................................................................ 215
Poster 28 – Other topics......................................................................................................................................... 216
AUTHOR INDEX ......................................................................................................................................................... 220

16 t h International Congress on Animal Reproduction
Workshop Abstracts 5
WORKSHOP ABSTRACTS
Workshop 01 - Pathophysiology and Immunology of
Postpartum Uterine Disease in Cattle
Moderator: Martin Sheldon (UK)
WS01-1
The pathogens and the cause of uterine disease
Földi, J 1,2 ; Pécsi, A 3 ; Szabó, J 4 ; Kulcsár, M 2 ; Egyed, L 5 ; Huszenicza, G 2 *
1Intervet International B.V., Boxmeer, Holland; 2 Faculty of Veterinary Science,
Szt. István University, Budapest, Hungary; 3 Faculty of Agricultural Science,
University of Debrecen, Hungary; 4 Faculty of Medical Science, University of
Debrecen, Hungary; 5 Veterinary Medical Research Institute, Budapest,
Hungary
A wide variety of bacteria are present in the uterus of all cows at the
first 10-14 postpartum (pp) days, regardless of disease signs. Mostly
Streptococcus spp., Staphylococcus spp. and Bacillus spp. were
isolated from the uterus of cows with physiological involution, while
Arcanobacterium pyogenes (A. pyo), Escherichia coli (E. coli) and
different Gram negative (GN) anaerobic bacteria namely
Fusobacterium necrophorum, Prevotella spp. and Bacteroides spp.
were predominant in the uterus of clinically diseased animals. Series
of studies confirmed that clinical and reproductive consequences are
associated with these ‘primary uterine pathogen bacteria’. Although
E. coli plays a key role in puerperal metritis (up to 14 days pp) i.e.
systemic signs of the disease are endotoxin mediated, its influence
decreases by the time of involution. Clinical endometritis/pyometra
is mostly the result of a chain of re-infection with A. pyo and GN
anaerobes. A. pyo acts synergistically with F. necrophorum,
Bacteroides spp. and Prevotella spp. Isolation of A. pyogenes at the
late involution period (28-35 days) is associated with dramatically
decreased re-conception rate.
Bovine herpesvirus type 4 (BoHV-4) is a member of Rhadinovirus
genus within the Gammaherpesvirinae subfamily. BoHV-4 is unique
among the BoHVs concerning its wide tropism of species as well as
tissue distribution including reproductive organs. BoHV-4 has been
associated with abortion and (puerperal) metritis since 1973, however,
its endometriotropism and the symbiotic relationship between
endometrial stromal cells and macrophages persistently infected with
the virus has most recently been proven. It supports the concept that
BoHV-4, as a secondary pathogen, decreases the local immune
response and as such, promotes bacterial metritis.
Presence of pathogens in the uterus i.e. (bacterial) contamination does
not always result in inflammation. Even the colonization of the entire
uterine wall i.e. (bacterial) infection as such, does not necessarily
mean a clinical disease; it depends on the immune status of the host.
The course of uterine involution may be considered as a ‘see-saw
balance’: in a physiological situation the self-defence mechanisms are
able to counteract the bacterial and/or viral infection.
On a herd level, the most important risk factors of metritis are:
metabolic disorders i.e. hyperketonaemia and/or ketonuria,
hypocalcaemia; dystocia, retained foetal membranes, manual
intervention at calving (associated with poor hygiene), herd size,
season, parity, high milk production and lack of grazing.
WS01-2
The host and nature of postpartum uterine disease in
dairy cows
Gilbert, RO
Cornell University, Ithaca, NY, USA
Fetal membranes are usually expelled within 6 hours after delivery
and are regarded as retained after 12 or 24 hours. The incidence in
dairy cows is about 5 – 15%. Risk of retention is increased by
abortion, stillbirth, low birthweight, multiple birth, premature
parturition, dystocia, heat stress and hypocalcemia. Deficiency of
antioxidant nutrients such as selenium and vitamin E is also
implicated. Retention of fetal membranes is associated with impaired
prepartum immune function, particularly with reduced activity of
neutrophils. This impairment extends into the postpartum period and
mediates increased susceptibility to subsequent uterine disease and
mastitis.
Puerperal metritis, characterized by malodorous, red-brown uterine
exudate and uterine atony before 14 days postpartum affects up to
40% of dairy cows in some herds. Systemic signs including fever,
depression or malaise are inconsistent. Reduced dry matter intake in
late pregnancy, resulting negative energy balance and impaired
immune function contribute to the pathogenesis of this condition as
well as clinical and subclinical endometritis. Cows with metritis are at
increased risk for subsequent endometritis. Response to treatment is
generally favorable. Most cows with overt uterine disease do not
ovulate early in the postpartum period. Cows ovulating in the face of
continued uterine infection may be predisposed to development of
pyometra – an accumulation of purulent exudate in the uterine lumen
in the presence of a persistent corpus luteum.
Clinical endometritis is best diagnosed and treated after 4 weeks
postpartum when purulent material is demonstrable in the uterus or
vagina by ultrasonography, vaginoscopy, manual inspection, or use of
a specifically designed instrument (Metricheck®) or if the cervix
remains larger than 7.5 cm in diameter. Presence of these signs is
associated with reduced likelihood of subsequent pregnancy.
Pregnancy risk is increased by treatment with intrauterine cephapirin
or systemic prostaglandin F2alpha.
Many cows without overt signs of infection have persistent uterine
inflammation at the beginning of the rebreeding period. This
condition is best diagnosed by endometrial cytology, but may be
indicated by presence of a fluid column greater than 3 mm in diameter
in the uterine lumen. Subclinical endometritis is associated with
reduced first service pregnancy risk, increased days open, and
increased culling risk, making it an extremely costly condition of high
producing dairy cows.
WS01-3
The immune system and the mechanisms of uterine
disease
Sheldon, IM
Royal Veterinary College, London, UK
After parturition, contamination of the uterine lumen by microbes is
ubiquitous in dairy cattle. A third of animals develop clinical disease
and a third have sub-clinical endometritis. Infections cause infertility
by damaging the endometrium, but they also perturb ovarian function.
Effects on the ovary include slower follicle growth, reduced secretion
of oestradiol and fewer ovulations. In animals that ovulate and form a
corpus luteum, there are lower plasma concentrations of progesterone
and uterine disease disrupts luteolysis. The most important pathogens
are Escherichia coli, Arcanobacterium pyogenes and Bovine
Herepesvirus 4 (BoHV-4). Infection with E. coli precedes infection
with A. pyogenes and the development of uterine disease, as well as
being associated with ovarian dysfunction. The endotoxin of E. coli,
lipopolysaccharide (LPS), is found in high concentrations in the
uterine lumen and ovarian follicular fluid of animals with
endometritis. Detection of microbes and their pathogen associated
molecules in the genital tract depends on the innate immune system,
including pathogen recognition receptors such as the Toll-like
Receptors (TLR). Uterine epithelial and stromal cells, and ovarian
granulosa cells express the TLR4, CD14, MD2 receptor complex for
LPS. In vitro, LPS increases the expression of genes associated with
inflammation in endometrial cells, and LPS switches epithelial cell
secretion from prostaglandin F 2α to E 2 , which may explain how
uterine disease disrupts luteolysis. Granulosa cells treated with LPS
have lower aromatase expression and reduced oestradiol production,
which may explain how uterine disease perturbs ovarian follicle
growth and function. Severe uterine pathology is associated with the

16 t h International Congress on Animal Reproduction
6 Workshop Abstracts
presence of A. pyogenes or viral infection. The exotoxin of A.
pyogenes, pyolysin (PLO), causes epithelial and particularly stromal
cell death. Similarly, BoHV-4 is highly tropic for the endometrium,
causing a rapid cytopathic effect in stromal and then epithelial cells.
This tropism may be because viral replication is activated by
prostaglandin E 2 , which is constitutively secreted by the stromal cells.
Further exploration of the molecular mechanism of microbial
infection and immunity will lead to greater understanding of how
uterine disease impacts fertility, and provide insights to help develop
new therapeutic approaches.
This work was supported by the Wellcome Trust and BBSRC.
Workshop 02 - Factors Affecting Pregnancy Rates in
Estrus Synchronization Programs in Beef Heifers
Moderator: Gabriel Bo (Argentina)
WS02-1
Reproductive management of cycling and non-cycling
Bos taurus beef heifers in the USA
Lamb, G
North Florida Research and Education Center, University of Florida, Marianna
Estrus synchronization and artificial insemination (AI) are
reproductive management tools that have been available to beef
producers for over 30 years. Synchronization of the estrous cycle has
the potential to shorten the calving season, increase calf uniformity,
and enhance the possibilities for utilizing AI. Artificial insemination
allows producers the opportunity to infuse superior genetics into their
operations at costs far below the cost of purchasing a herd sire of
similar standards. These tools remain the most important and widely
applicable reproductive biotechnologies available for beef cattle
operations in the USA. However, beef producers have been slow to
utilize or adopt these technologies into their production systems.
Several factors, especially during early stages of development of
estrus synchronization programs, contributed to the poor adoption
rates. Initial programs failed to address the primary obstacle in
synchronization of estrus, which was to overcome the late onset of
puberty in heifers. Additionally, these programs failed to manage the
timing of ovulation precisely, resulting in more days over which
detection of estrus was necessary. This ultimately precluded fixedtime
AI (FTAI) with acceptable pregnancy rates. More recent
developments focused on the control of both the corpus luteum and
follicle waves in convenient and economical protocols to synchronize
the timing of ovulation, facilitating FTAI. This new generation of
estrus synchronization protocols uses two strategies which are key
factors for implementation by producers because they: 1) minimize
the number and frequency of handling cattle; and 2) eliminate the
need for detection of estrus by employing FTAI. However, developing
FTAI protocols in beef heifers has not been straightforward because
of the inability to synchronize follicular waves reliably with
gonadotrophin-releasing hormone (GnRH). For example, after an
injection of GnRH at random stages of the estrous cycle, 60 to 90% of
postpartum cows ovulated; whereas, only 48 to 60% of beef and dairy
heifers ovulated in response to the same treatment. Therefore, most
recent research continues to focus on inducing onset of puberty in
noncycling heifers and enhancing synchrony of ovulation by
incorporating progestin devices in GnRH-based protocols to facilitate
FTAI and improve fertility in heifers.
WS02-2
Why are pregnancy rates to fixed-time AI generally lower
in Bos indicus than Bos taurus cattle
McGowan, M*; Butler,S; Phillips, N
School of Veterinary Science, The University of Queensland, Brisbane,
Australia
The recent developments in quantitative and molecular genetics which
have led to improvements in our ability to select for a range of
important production traits in beef cattle (carcass quality, fertility,
health & welfare), have increased the need to develop practical and
effective programs which efficiently disseminate selected genetics. As
the major grazing rangelands for beef cattle are located in tropical and
subtropical regions, development of artificial breeding programs
which focus on maximizing the reproductive outcome in Bos indicus
cattle, the genotypes most suited to these environments, is essential.
However, most of the treatment protocols for synchronization of
oestrus have been developed for Bos taurus cattle with the assumption
being that usage in Bos indicus cattle will result in similar outcomes.
Although some publications report similar reproductive outcomes,
marked, frequently unexplained variation in response to hormonal
treatments to synchronise oestrus, continue to be important factors
limiting the widespread usage of this technology in extensively
managed Bos indicus herds. Progestin and progesterone implants
combined with prostaglandin F2α, oestrogen and gondaotrophin
treatments are most commonly used for fixed-time AI (FTAI) of Bos
indicus females. The reported responses to these treatments in terms
of animals detected in oestrus between 48 to 72 h after implant
removal, and animals diagnosed pregnant to FTAI vary considerably
(44 to 98% and 37 to 62%, respectively). A series of recently
completed studies conducted in northern Australia have shed some
light on potential causes of the observed variation in response of Bos
indicus heifers. When 300 cycling disease-free Brahman heifers
weighing 289±30 kg, were randomly assigned to be treated with
oestradiol benzoate (ODB) and intravaginal implants (8 day insertion)
varying in progesterone content (0.78g, 1.56g, 1.9g) followed by
ODB treatment (Day 9) and FTAI 48 to 54 hours after implant
removal, the overall pregnancy rate was 35%. However, the pre- and
post-AI progesterone profiles of a random samples of 10 heifers from
each group indicated that 32% (n=30) had plasma progesterone
concentrations of 1ng/ml. Consideration should be given to
investigating the role of hormonal treatments in inducing suboptimal
preovulatory follicular and corpus luteum development in Bos indicus
cattle.
WS02-3
Fixed-time artificial insemination in cycling and noncycling
Bos indicus beef heifers
Baruselli, PS 1 *; Sales, JNS 1 ; Crepaldi, GA 1 ; Sá Filho, MF 2 ; Carvalho, JBP 3 ;
Bo, GA 4
1Animal Reproduction Department, FMVZ/USP, São Paulo-SP, Brazil;
2FIRMASA-IATF, Campo Grande-MS, Brazil; 3 Vale do Paraíba Regional
Station-Apta, Av. Prof. Manoel Cesar Ribeiro, No. 320, Caixa Postal 7,
Pindamonhangaba, SP, Brazil; 4 Instituto de Reproducción Animal Córdoba,
J.L. de Cabrera 106, X5000GVD Córdoba, Argentina
Fixed-time artificial insemination (FTAI) protocols have generally
yielded poor results in B. indicus heifers. It was hypothesized that
follicular growth in Bos indicus heifers might be suppressed by
circulating progesterone concentrations during the treatment protocol.
It is speculated that lower steroid hormone clearance rates in Bos
indicus cattle may account for the higher circulating progesterone
concentrations during progesterone treatment resulting in reduced LH
pulsatility and follicular growth rates. A series of experiments were
designed to determine if synchronization of follicle wave emergence
and ovulation with estrogen and subluteal progesterone concentrations
during growth of the ovulatory follicle would improve the synchrony
of ovulation and pregnancy rates following FTAI. Treatment with
PGF at the start of progestin treatment resulted in decreased
circulating progesterone concentrations and increased the follicular
growth rates, dominant follicle diameters and ovulation rates. In
comparison to CIDR, norgestomet ear implants resulted in increased
dominant follicle growth rates leading to ovulatory follicles with
larger diameters. Dose and estradiol ester were important factors in
synchronizing follicle wave emergence. A dose of 2.5 or 5 mg
estradiol valerate resulted in a longer and more variable interval from
treatment to follicular wave emergence than 2 mg of estradiol
benzoate (EB), which affected preovulatory dominant follicle size

16 t h International Congress on Animal Reproduction
Workshop Abstracts 7
following progestin removal. Interestingly, satisfactory ovulation rates
occurred in both cycling and non-cycling heifers treated with
norgestomet ear implants, 2 mg EB at implant insertion and 1 mg EB
24 h after implant removal. Treatment with eCG at implant removal
also increased dominant follicle growth rate, preovulatory follicle
diameter, ovulation rate, and pregnancy rates in Bos indicus heifers
that were FTAI. Nevertheless, conception rates in heifers that
ovulated after treatment was lower in non-cycling than in cycling
heifers which may be related to the immaturity of the hypothalamopituitary
axis and the reproductive tract. An alternative in non-cycling
heifers may be to use a priming treatment with a progesterone
releasing device 20 to 40 days prior to initiating synchronization
treatments. Data suggest that FTAI in Bos indicus heifers can be
successful providing follicle wave emergence is synchronized and
methods that result in increased ovulatory follicle growth, such as
reduced progesterone concentrations and treatment with eCG are
employed.
Workshop 03 - Factors Influencing the Embryo Quality
Moderator: Li Ning (China)
Xiuchun Tian (USA)
WS03-1
Modifications in oocyte maturation and/or embryo culture
to improve quality of pig somatic cell cloned embryos
Zhang, Y 1,2 , Zhang, K 1,3 , Wie, H 1 , Li, J 4 , Li, Q 1 , Dai, Y 1 & Li, N 1 *
1State Key Lab of Agrobiotech., China Agr. Univ., Beijing 100094, China;
2College of Anim. Sci. Tech., Anhui Agri. Univ., Anhui 230036, China;
3Department of Animal Sciences, University of Florida, FL 32611-0910, USA;
4Dept. of Genet. Biotech., Facul. of Agr. Sci., Univ. of Aarhus, Tjele, 8830,
Denmark
Somatic cell nuclear transfer (SCNT) is regarded as a tool with great
potential in agriculture, medicine and basic research. For pigs, the
efficiency of producing viable offspring from cloned embryos is poor.
Suboptimal oocyte maturation and/or embryo culture are major
bottlenecks limiting commercialization of pig SCNT. Oocytes are
crucial starting material for SCNT therefore we examined effects of
oxygen tension, leptin addition during IVM on development of SCNT
embryos. Blastocyst rates and total cell number per blastocyst of
SCNT embryos from oocytes matured under low (7%) O2 tension
were significantly higher than those of embryos from oocytes matured
under higher (20%) O2 tension (blastocyst rates: 16.3±0.9% vs.
6.5±0.6%, total cell number per blastocyst: 38.4±2.0 vs. 30.4±2.2%,
respectively; P

16 t h International Congress on Animal Reproduction
8 Workshop Abstracts
the number of nuclei, the number of blastomeres was higher in
polyspermic embryos due to early fragmentation. Further studies are
needed to clarify the phenomenon of ploidy correction in polyspermic
zygotes.
During IVM, approximately 30% of oocytes fail to reach the M-II
stage and about 60-78% of them are arrested at a certain stage
characterized by a metaphase plate without polar body. This stage is
often referred as “metaphase-I (M-I) arrest”. Our previous studies
showed, that unlike real M-I oocytes, “M-I arrested” oocytes obtain
cytoplasmic maturation and have the ability to develop to the
blastocyst stage resulting in polyploid embryos. Chromosome
configurations of such oocytes are different from those of M-I oocytes
at 33h IVM and similar to those of M-II oocytes despite of their
tetraploid status. It is suggested that in “M-I arrested” oocytes
segregation of homologue chromosomes may occur during IVM,
however, the extrusion of the first polar body fails and a single
metaphase plate is formed again.
In conclusion, development to the blastocyst stage is not a perfect
indicator of embryo quality in porcine IVP systems, since polyploid
embryos can develop to blastocyst stage. Careful selection of M-II
oocytes for IVF, regular monitoring of polyspermy rates and further
improvements of IVF systems are necessary to reduce polyploidy in
porcine IVP systems.
WS03-4
Tyrosine kinase receptors (TRK) and bovine early
embryonic development
Gómez, E*, Rodríguez, A; Caamaño, JN; Díez. C; Facal, N; Muñoz, M
Genética y Reproducción, Serida, Gijón, Spain
Neurotrophins (NTs) mediate survival, growth and differentiation by
binding to two types of cell surface receptors, the anti-apoptotic Trk
and the low affinity p75 neurotrophin receptor (p75 NTR ), also termed
as p75 NGFR . Subtypes of Trk are NT-specific, such a way NGF binds
to TrkA, NT3 to TrkC, and NT4 and BDNF to TrkB; on the contrary,
p75 NTR is a common receptor for all NTs. Trk and p75 NTR receptors
can form complexes, and this association enhances affinity for ligand
binding and neurotrophin discrimination.
In previous work, we suggested a role for NTs during early embryonic
development, as we detected TrkA (a truncated isoform), TrkB and
TrkC proteins in immature oocytes, zygotes, 2-4 cell embryos,
morulae, expanded and hatched blastocysts, and the inner cell mass of
blastocysts. Using RT-PCR we found mRNA for TrkA, TrkC, p75 NTR
and FGFr2 in all the embryonic stages described above; mRNA levels
tended to increase during blastulation, and sharply peaked in hatched
blastocysts. However, single (NGF, NT3, NT4 or BDNF, at 20 ng/mL
each) or pooled NTs in embryo culture with the NT-cooperating
factor bFGF (2 ng/mL), did not show relevant effects on development
and cell counts. Comparable results were obtained in a recent
experiment in the absence of bFGF. bFGF was detrimental compared
to controls without bFGF, while NT3, with or without bFGF,
increased cell numbers in the ICM as opposed to NT4 and pooled
NTs. NT4 enhanced cell counts in the trophectoderm as compared to
controls with bFGF and pooled NTs only in the presence of bFGF.
Dose-response studies and new experiments to progress in research
with NTs and their receptors are in course. We have provided a novel
description of Trk proteins and TrkA, TrkC, p75 NTR and FGFr2
mRNA expression, throughout mammalian embryonic development.
This research may help to design future research with NTs in bovine
embryo culture and embryonic stem cells derivation and maintenance.
Grant support: AGL2005–04479. Spanish-Hungarian bilateral project
HH2005-0015 (TET E-20/2005). M. Muñoz is sponsored by FICYT.
Workshop 04 - Imaging techniques in reproduction
Moderator: Gregg P Adams (Canada)
WS04-1
Use of 3-D and 4-D ultrasonography in veterinary
research
Hildebrandt, TB 1 *, Drews, B 1 , Kurz, J 2 , Röllig, K 1 , Hermes, R 1 , Yang, S 3 ,
Göritz, F 1
1Reproduction Management, Leibniz Institute for Zoo & Wildlife Research,
Germany; 2 Institute for Genetik & General Biology, University of Salzburg,
Austria; 3 Yunnan Key Laboratory for Animal Reproduction, Kunming Institute
of Zoology, CAS, China
Three-dimensional-ultrasonography represents an independent (what
is meant by independent) imaging modality in human medicine with
a wide range of applications, including prenatal diagnosis,
gynecology, and oncology. Three-dimensional-ultrasonography
allows morphometric measurements in a volume data set and, more
recently, the analysis of data in tomographic ultrasound imaging mode
(TUI). The advantages of three-dimensional-ultrasonography have
also been realized in animal research. Ultrasound equipment used in
animals requires additional components and animal-specific scanners
for transrectal examination. After substantial system modification
transrectal three-dimensional-ultrasonography was applied intensively
to characterize embryo/fetal development in Asian and African
elephants. Three ultrasound systems were used during this study: a
stationary Voluson 530 and a 730 Expert, amd a portable Voluson I
(General Electric Inc.). Growth curves for elephant embryo/fetal
development were established. In render mode the surface structures
were imaged, and used to depict the transition from the oval-shaped
embryo to the complete fetus with its characteristic trunk. In inverserender
mode, the fluid-filled compartments were displayed separately.
This mode was also applied to imaging of ovarian follicular
development in rhesus macaques during superovulation. In
conjunction with a scientific consultancy for National Geographic,
additional investigations were performed in dogs, primates, hares and
dolphins. The main purpose was to identify useful morphological
parameters of the different developmental stages during pregnancy,
and examine intrauterine fetal behavior. For the latter, fourdimensional
ultrasound technology (3D in real-time) was applied. We
found dramatic differences between species regarding the level of
fetal activity, including some interesting behavioral patterns observed
from each species throughout their development. According to these
preliminary findings, we conclude that intrauterine behavior is an
important element during embryogenesis. There is also a strong
indication that intrauterine behavior has parallels to known postnatal
behavior in the different species. Four-dimensional ultrasonography
is, a useful tool for identifying species-specific behavioral elements
during intrauterine development. The definition of these key
behaviors and the consequences of their presence or absence for the
life history of an individual will improve our understanding of
evolution and help in clinical diagnosis of developmental disorders.
WS04-2
In vivo imaging of sperm transport and survival in the
female genital tract using fiber confocal fluorescence
microscopy
Druart, X 1 *; Cognié J. 1 ; Baril, G. 1 ; Clément F. 2 ; Dacheux JL. 1 and Gatti JL. 1
1UMR 6175 INRA, CNRS-Université de Tours-Haras Nationaux, Nouzilly,
France ; 2 INRIA, Paris, France
Introduction Fertility of ram sperm is reduced after 24 h of storage
at 15°C in milk diluent despite that the in vitro properties, such as
viability and motility, are well preserved. This might be explained by
a decrease of sperm transport and survival of stored ram sperm in the
female genital tract. We studied the influence of in vitro storage of
ram sperm on in vivo transport in the female genital tract of the ewe
using Fiber Confocal fluorescence Microscopy (FCM, Leica).

16 t h International Congress on Animal Reproduction
Workshop Abstracts 9
Materials and methods Semen collected from 3 adult Lacaune rams
was diluted in milk at 1.10 9 sperm/ml and stored for 1 h (fresh semen)
or 25 h (stored semen) at 15°C. Semen was then fluorescently stained
by addition of octadecyl-rhodamine B and MitoTrackerGreen FM,
and 75.10 6 sperm were inseminated by endoscopy into the base of
each uterine horn of estrus-induced ewes (n = 6 ewes / treatment). In
vivo imaging of sperm was done under general anesthesia 4 h after
insemination. The uterus and oviducts were exteriorized through a
mid-ventral incision and the microprobe of the FCM was inserted into
different anatomical regions of the genital tract: the base, middle and
tip of the uterine horn, the uterotubal junction and the oviduct. Stilland
video-images were recorded for each region of the genital tract,
and the distribution of fluorescent motile sperm was determined by
counting the number of motile sperm per field.
Results The influence of uterine contractions on sperm transport was
clearly observed by in vivo FCM. In addition to sperm transport via
massive uterine contractions, individual motility of sperm could be
imaged at the different regions of the genital tract. When fresh semen
was inseminated, the concentration of motile sperm in the lumen 4 h
after insemination showed an increasing gradient along the uterus:
10.0 ± 1.7, 15.3 ± 2.2, 22.6 ± 4.1 and 21.0 ± 2.9 sperm / field,
respectively, for the base, middle and tip of the uterine horn, and the
uterotubal junction (p500µ (bias 0.0). However, the agreement was variable for
CL (overall bias -3.72) owing to a less resolvable interface between
individual CL by ultrasonography. In conclusion, ultrasound
biomicroscopy can be used to accurately assess ovarian follicular
dynamics in vivo in the mouse.
Research supported by the Natural Sciences and Engineering
Research Council of Canada and the Saskatchewan Health Research
Foundation.
WS04-4
Feeding supplement improves spermatogenetic potential
during winter in young merino rams: Preliminary
morphometric data
Genovese, P 1 , Picabea, N 1 , Vinoles, C 2 , Gil, J 3 , Bielli, A 1 *
1Morphology and Development, Veterinary Faculty, University of Uruguay,
Uruguay; 2 Glencoe, INIA, Uruguay; 3 DILAVE Paysandú, MGAP, Uruguay
Nutrition influences testicular development before and after puberty.
Quantitative histological techniques allow estimation of the actual and
potential testicular spermatogenic capacity: greater seminiferous
epithelium volume reflects greater sperm producing capacity. The
effect of nutritional supplementation on testicular development was
examined in Merino rams (n=11) beginning at 17 months of age. The
rams divided into 2 groups and fed differentially from March (late
summer, breeding season) until the time of castration in July (midwinter,
beginning of the non-breeding season) at the Glencoe INIA
research station, Paysandú, Uruguay (Latitude, 32 º south). The rams
were given free access to native pasture at a stocking rate of 4 rams
per hectare. One group (n=5) was not given supplemental nutrition,
while the other group (n=6) was supplemented (0.75% of live weight)
with sorghum (70%) and soy meal (30%). Testes and epididymides
were weighed immediately after castration. Testicular samples were
processed for quantitative histological analysis. Paraffin sections (5
µm thick) were stained with hematoxylin-eosin, and 30 images were
taken (BX 50 Olympus microscope, CCD camera connected to pc) per
ram. The diameter of the seminiferous tubules and the fractional
volume of the seminiferous tubules, seminiferous epithelium,
seminiferous tubule lumina and testicular interstitium were measured
by means of computer assisted analysis with Image Pro Plus®
software. Fractional volumes were estimated by counting the
percentage of points in a point grid falling over the object of interest.
Absolute volumes of seminiferous tubules, seminiferous epithelium,
seminiferous tubule lumina and testicular interstitium were estimated
by multiplying fractional volumes by testicular volume (estimated
from testicular weight). The nutritionally supplemented group of rams
had a greater total testicular weight (g, 299.9 ± 24.0 vs 201.9 ± 42.8;
P

16 t h International Congress on Animal Reproduction
10 Workshop Abstracts
ultrasonography has started to become more common in animal
reproduction. This is an emerging technology that has the potential to
increase the diagnostic, monitoring, and predictive capabilities of
theriogenologists and research scientists. Transrectal color-, power-,
and spectral-Doppler ultrasonography have been used in our
laboratory to study ovarian and uterine blood flow and perfusion in
mares. The technology is based on Doppler-shift frequencies, wherein
the ultrasound frequency of the echoes from the moving red cells is
increased or decreased as the cells move toward or away from the
transducer, respectively. Color-flow Doppler ultrasound superimposes
color signals of blood flow on the B-mode (gray-scale) image so that
blood-flow velocities and perfusion can be assessed visually on an
image plane. Blood perfusion to an organ or structure can be
evaluated by scoring the percentage of blood flow (color spots) or by
counting the number of color pixels. Using the spectral mode,
evaluations of blood flow velocities and indices in an artery, which
include peak systolic velocity (PSV), end diastolic velocity (EDV),
time-averaged maximum velocity (TAMV), resistance index (RI), and
pulsatility index (PI), are computed and displayed for a selected
cardiac cycle. Recently, our laboratory has used Doppler
ultrasonography to test several biological hypotheses. These include
the mechanisms involved in follicle deviation, preovulatory follicle
growth, and ovulation; oocyte maturity and competence; embryouterine
dynamics; corpus luteum development, luteolysis, and PGFM
pulses; uterine cyst formation; and the effect of aging on preovulatory
follicle and uterus blood perfusion. Although some limitations have to
be considered, we have found this technology useful for our studies in
reproductive physiology. This presentation will focus on the main
findings of our experiments in mares that used Doppler
ultrasonography to study the relationship between blood flow and
perfusion to the reproductive organs and reproductive processes.
Workshop 05 - Sustainable development in care of
reproduction in small ruminants: efforts and perspectives
Moderator: Dominique Blache (Australia)
WS05-1
Maximising survival of lambs: recent advances through
mother-young bonding
Nowak, R 1 *, Bickell, SL 1 , Poindron, P 2 , Chadwick, A 1 and Blache, D 1,2
1UMR 6175 Physiologie de la Reproduction et des Comportements INRA-
CNRS-Université de Tours-Haras Nationaux, Nouzilly, France ; 2 School of
Animal Biology, The University of Western Australia, Crawley, WA.
In the reproductive process of ewes reared under extensive conditions
there are several points where lamb output can be increased, amongst
which the most important is twinning rate and lamb survival.
However, improvement in twinning rate is seen as unethical if
management systems are inadequate for maximizing the survival of
twin lambs. Despite four decades of worldwide research, lamb
mortality has not improved and recent data confirms that mortality is
still higher in twin than in single lambs. Both genetic and
environmental factors contribute to neonatal mortality. There are 3
opportunities for increasing lamb survival. The first involves breeding
of ewes that provide high levels of maternal care – this is effective but
direct measurements of maternal behaviour are impossible for largescale
operations. A better alternative is genetic selection for ‘calm’
temperament, for which practical on-farm tests are currently being
evaluated across Australia. The second opportunity for reducing lamb
mortality involves improvement of colostrum production. Feeding
supplements to twin-bearing ewes during the last week of pregnancy
almost double the amount of colostrum available at birth. In addition,
the colostrum that is produced by these ewes is less viscous and seems
to be easier for the lamb to suck. Boosting the colostrum intake by
newborn lambs is of particular interest because colostrum is essential
for providing nutrients, for conferring immunity to disease, and for
shaping the early ewe-lamb bond. Successful sucking at birth
facilitates attachment to the mother through a combination of the
rewarding effect of colostrum intake and a neurophysiological effect
of gastric distension. Delays in the provision of colostrum, or the
provision of only small amounts, will thus be detrimental to the ewelamb
relationship. The third opportunity for reducing lamb mortality
involves better management of ewe flocks during lambing. Most
importantly, we need to ensure that shelter, feed and water are nearby,
and that there is a calm lambing environment. This will promote,
rather than disrupt, the formation of the ewe-lamb bond by ensuring
that the mothers do not leave the birth site too soon after parturition
and thus deny sufficient access to the udder for the newborn. Any loss
of mother-young contact early after birth is likely to lead to the death
of twin lambs. Recent research into reproductive physiology and
behaviour has allowed to develop new strategies for increasing twinlamb
survival.
WS05-2
Towards better welfare for small ruminants
Blache, D
UWA Institute of Agriculture M082, University of Western Australia, Crawley
6009, Australia
Farmed animals are exposed to many and varied sources of stress
(stressors) in their life, and those stressors may impact on their
capacity for reproduction. However, to be able to develop strategies
that lead to more sustainable animal care, it is important first to define
and understand ‘stress’ and ‘welfare’.
There is no universal definition for animal welfare and no quantitative
method for measuring it. It is not intrinsic to animals but it is brought
on by the careers as they meet the needs of their animals. The ideal
state, where all needs are provided for, is summarized in the “five
freedoms framework” – freedom from hunger and thirst, from
discomfort, from pain and diseases, from fear and distress, and
freedom to express natural behaviours. Maximum welfare, on a
subjective scale, will be achieved when the animal supervisors do all
they can to prevent or reduce suffering or harm by providing enough
care to fulfill the five freedoms. Generally, the level of animal welfare
is related to the level of stress experienced by the animals. Stress can
be physical, such as inadequate nutrition, fatigue, heat or cold, or it
can be psychological, such as fear of isolation in flocking animals.
Stress can be acute or chronic, and it can be cumulative, and one
stressor can have a potentiating effect for another. Stress is not
necessarily bad for animals and the boundary between ‘good stress’
and ‘bad stress’ is also difficult to define. One useful criterion for
assessing the consequences of stress on welfare is the measurement of
the ability of animals to cope, physiologically and behaviourally, with
challenges.
How do we go towards better welfare for small ruminants As
described above, bad or good stress can be seen as a deviation from
the ‘norm’ and the amount of deviation can be assessed by animal
careers who have a deep knowledge of the biological ‘norms’ of their
animals. This means that animal carers or welfare officers need
education in husbandry, behavior and physiology if we are to assess
and then improve welfare. At the producer level, good stockman skills
are essential because stockmanship assumes respect, understanding
and empathy for animals, as well as dedication to the livestock. A
trained stockman will be able to read the behaviour of the animal and
will know how to handle a particular species. For example, instead of
using fear of noise and pain to make animals move, we can use their
flight zone and flocking behaviour. At the specialist level, training in
stress physiology, regulation of core temperature and behavioural
adaptation to environmental stress, will be necessary for conducting
in-depth welfare assessments. As a complement to these human
changes, selection of animals that are physiologically and
behaviourally better adapted to the farming environment will also
improve their welfare.
Improving animal welfare by reducing stress is obviously beneficial
for the animal but, equally as importantly, it is beneficial for
producers in two ways: i) the quantity and quality of product will
increase; ii) low stress animals are easiest to manage and will lead to
an improvement of the producer’s quality of life and job satisfaction.
Moreover, there is an urgent need for animal production to be ethical
by ensuring that animal welfare reaches the best possible standards –

16 t h International Congress on Animal Reproduction
Workshop Abstracts 11
this will improve the image and the public attitude towards animal
industries, so the intensity of the public scrutiny, extant already in
industrialised countries and growing in the rest of the world, will be
relaxed.
WS05-3
Seasonality of reproduction and MT1 receptor gene
polymorphism in Awassi sheep
Faigl, V 1 *; Árnyasi, M 2 ; Keresztes, M 1 ; Kulcsár, M 1 ; Reiczigel, J 1 ; Dankó G 2 ;
Jávor, A 2 ; Cseh, S 1 ; Huszenicza, G 1
1Szent István University Department and Clinic of Reproduction, Budapest,
Hungary; 2 University of Debrecen, Institute of Animal Sciences, Debrecen,
Hungary
In three consecutive experiments seasonal pattern of ovarian activity
was investigated in lactating, non-suckled dairy awassi sheep. In
Experiment 1. (Exp. 1.) resumption of postpartum (pp) ovarian
cyclicity was studied in autumn lambing (AL;n=27) and spring
lambing (SL;n=38) ewes. Cyclicity was monitored by means of
individual progesterone (P4) profiles (milk P4 was assayed trice
weekly from day (d) 5 to d100 pp). 89% of AL dams ovulated before
d 35 and became cyclic thereafter. Incidence of persistent corpus
luteum (CLP n=5) and short luteal phases (sCL n=8; CLP and sCL
together n=4) was frequent among non-conceiving dams. In contrast
only 39% of SL ewes ovulated before d70. P4 levels during luteal
phase in cyclic animals were lower, and length of cycle was longer in
SL compared to AL. No CLP or sCL was detected in SL. 61% of SL
remained acyclic till the end of trial. In Exp.2. influence of additional
lighting on the time of first ovulation was investigated in 48 AL ewes.
Long-day photoperiod (LD) group (n=23) was exposed to artificial
light from sunset till midnight (approx 16 hours light/8 hours dark).
Control group (n=25) received no treatment (natural photoperiod).
Sampling protocol was similar to Exp. 1. Time of first pp ovulation
tended to delay in LD animals compared to Control (average
25.87±1.63 vs 21.5±1.72 d pp; surv analysis P=0.093). In Exp.3.
interaction between melatonin receptor 1a (MT1) gene polymorphism
and out-of-season cyclicity was evaluated in 395 dams. Milk P4 level
was determined 3 times 7 days apart between 10-12 weeks pp. If P4
level was >4 nmol/L in at least one of the samples, animals were
judged cyclic. 10 weeks pp plasma leptin and insulin-like growth
factor I were measured, and MT1 polymorphism was determined.
Proportion of out-of-season cycling animals was depending on age
(P=0.003) and leptin level (P

16 t h International Congress on Animal Reproduction
12 Workshop Abstracts
response to intrauterine deposition of seminal plasma in alpacas.
Ovulation was induced in 14/15, 10/15, 7/17, and 0/45 alpacas given
seminal plasma intramuscularly, intrauterine with endometrial
curettage, intrauterine without curettage, and in combined salinetreated
controls, respectively (P

16 t h International Congress on Animal Reproduction
Workshop Abstracts 13
other reports, a high percentage of cows suffered from delayed
ovarian function: only 60.9% of the cows ovulated within the first 42
days pp. Survival analysis pointed out that resumption of cyclicity
tended to be later in cows with higher NEFA concentrations during
the dry period as well as lactation, albeit not statistically significant.
Pancreatic function was not related to the resumption of cyclicity.
However, insulin sensitivity was not taken in account; we are
currently doing research about this.
Conclusions Our study demonstrates a decrease of pancreatic
function during NEB and a negative association between NEFA and
pancreatic function, suggesting a noxious effect of NEFA on the β-
cell. Although a significant effect of pancreatic function on fertility
was not found, the low pancreatic response is likely to contribute to
fertility and health disorders, based on the effects of insulin found in
larger studies.
Although NEB is inevitable in high yielding dairy cows, management
has a big impact on cow welfare. In this workshop, we aim to provide
food for thought and discussion: what can the farmer do to improve
the cow’s energy status and hence combine high yield with acceptable
fertility and health
WS07-2
Opportunities to influence postpartum ovarian activity by
nutrition in the modern high yielding dairy cow
Webb, R*, Sinclair, KD; Fouladi-Nashta, AA; Mann, GE; Garnsworthy, PC
The University of Nottingham, School of Biosciences, Sutton Bonington
Campus, Loughborough, Leicestershire, LE12 5RD; UK
Reduced fertility in high yielding dairy cows has major implications
for the economics and sustainability of individual and national dairy
herds. The interaction between genetics and nutrition can impact on
ovarian function, resulting in altered follicle growth and oocyte
quality, with subsequent negative effects on early embryo
development and foetal loss. Indeed nutrition influences ovarian
function when diet is inadequate, excessive or imbalanced. Dietary
induced changes are also modulated by body condition and excess
body fatness reduces food intake in post-natal dairy cows, leading to
mobilisation of body fat, metabolic imbalances and impaired fertility.
Dietary regimes have been used to alter peripheral metabolic
hormones such that increased plasma insulin concentration stimulated
earlier resumption of oestrous cycles postpartum. However, overfeeding
of fat animals can result in hyperinsulinemia and impaired
embryo development, which is exacerbated over time. In contrast,
fatty acids were shown to improve oocyte quality resulting in higher
blastocyst production. (There are also a lot of papers showing that
some fatty acids have a significant negative effect on oocyte
maturation and embryo development! So, please specify which fatty
acids are meant!)
The nutritional requirements for optimum milk production may be
different from the requirements for fertility. Hence the challenge has
been to devise nutritional strategies that can maintain milk production
and quality without compromising ovarian function and fertility. In a
major series of studies, it was demonstrated that the optimum strategy
for fertility in high-yielding dairy cows was initially to feed a diet that
stimulated follicular development and then to feed a diet that
improved the post-fertilisation developmental competence of oocytes.
Using this strategy, pregnancy rate was enhanced significantly even
with high milk yields. Pregnancy rate was related negatively to milk
yield and mobilisation of body fat, and positively to the UK Fertility
Index, demonstrating that nutrition can overcome physiological and
genetic influences on fertility.
In conclusion, an improved understanding of this multi-factorial
process has enabled nutrition to be matched to genotype, with a
positive impact on follicular growth, oestrous activity, oocyte quality,
blastocyst development and pregnancy rate. These results also
demonstrated how quickly diet can have its effect and that these
effects are cumulative over time and closely integrated with body
condition.
Supported by Defra, RERAD, Provimi, BOCM Pauls, ABNA
WS07-3
Genetic aspects of postpartal ovarian resumption in dairy
cows
Flint, APF
Nottingham University, UK
There is an unfavourable genetic correlation between milk yield and
fertility, which has caused a decline in fertility in dairy cattle over the
past 20 years, as a result of selection principally on yield. This loss of
fertility has been evident in unfavourable trends in traditional
measures of fertility such as calving interval, days open and nonreturn
rate. Recognition of these trends has raised appreciation of the
need to take measures to reverse them, resulting in the introduction of
fertility indexes in a number of countries.
Development of fertility indexes has however been hindered by the
low heritability and poor recording of traditional fertility traits. For
example the heritability (h 2 ) of frequently used traits such as calving
interval, non-return rate, days in milk to first service and number of
inseminations per conception is generally less than 0.05. This
adversely affects the accuracy and timeliness of index calculation.
The low heritability of these traits reflects the extent to which they are
affected by management practice. Attention has therefore been paid to
fertility traits which depend less on management, and more on the
physiology of the cow itself. One such trait is time to first ovulation
postpartum, determined by measuring milk progesterone
concentrations. This trait, measured in days, has h 2 in the range 0.16 –
0.23, and is genetically correlated with calving interval and body
condition score.
To include milk progesterone data in fertility index calculation would
require the measurement of progesterone in large numbers of milk
samples, which would be expensive and time consuming.
Investigations have therefore been made of the practicality of
measuring progesterone in milk samples obtained monthly at milk
recording visits. This is readily carried out where the infrastructure
exists to collect the samples, but is expensive and requires large
number of daughters per bull to obtain usable data.
Measurement of time to first oestrus postpartum from milk
progesterone profiles therefore provides a route to genetic
improvement in fertility. However molecular genomics methodologies
becoming available in the near future potentially offer a more cost
effective and timely approach to selection through prepubertal
identification of beneficial alleles in sires.
Workshop 08 - Reproductive Physiology and
Management of Reproduction in Farmed Cervidae
Moderator: Debra Berg (New Zealand)
WS08-1
Constraints to optimal reproductive productivity of
farmed red deer in New Zealand
Asher, G
Agricultural Systems, AgResearch, New Zealand
Optimal reproductive efficiency of red deer (Cervus elaphus) in
pastoral settings in NZ is often constrained by maladaption to the farm
environment. Three principle sources of reproductive wastage are, (1)
the conflict between seasonal physiology and nutrition, (2) suboptimal
calving environments, and (3) genetic/nutritional interactions
influencing timing of hind puberty. While seasonal breeding confers
benefit to the species within its natural range, there is misalignment
within more temperate zones between the high nutritional demands of
lactation in summer and the peak of pasture production in spring. This
can lead to reduced calf growth and depressed dam weights. Emphasis
has been placed on altering the timing of births to better align animal
and pasture productivity. While early studies to advance calving
focussed on artificial manipulation of mating dates (eg. melatonin
treatments) the new paradigm involves genetic selection for earlybreeding
phenotypes (eg. Eastern European red deer : C.e.

16 t h International Congress on Animal Reproduction
14 Workshop Abstracts
hippelaphus) and identification of genes for earlier calving traits.
Recognition is also given to environmental and genetic effects on
gestation length of red deer. Perinatal calf mortality, which averages
8-12% of calves born, is arguably the greatest source of reproductive
wastage. It is mainly attributable to calf abandonment and dystocia
due to inappropriate calving environments that lead to adverse social
interactions between parturient hinds. Risk factors include lack of low
vegetative cover for parturition and calf concealment, high stocking
intensities and high calving synchrony, leading to inter-hind conflicts
and disturbance around parturition. A recent trend towards use of
extensive high-country rangelands for breeding units has been
associated with improved calf survival due to the provision of better
calving environments. Pubertal failure in 16-month-old hinds has been
seen as a major source of reproductive wastage over the last decade.
While various casual factors have been proposed, only the genetic
introgression of the larger Wapiti subspecies (e.g. nelsoni,
manitobensis, roosevelti) has been definitively shown to influence
female puberty. Recent studies have noted that crossbred females
(>30% wapiti parentage) often fail to attain sufficient liveweight by
16 months of age to enter puberty in their second year. This mainly
reflects inappropriate nutritional and health management for the larger
crossbred genotypes but may also be indicative of later maturation
characteristics of the Wapiti subspecies.
WS08-2
Development of large scale commercial AI for genetic
improvement in farmed red deer in New Zealand
McMillan, W
William McMillan Consultancy Limited, New Zealand
Highly invasive and labour intensive methods of artificially
inseminating red deer have been replaced by trans-cervical methods
using experienced teams of experienced bovine AB technicians on a
large scale. Semen can be harvested from stags of all ages, including
yearling stags from 4-6 weeks before the start of the female breeding
season. Fresh semen can be routinely used for 3 days after collection.
A deer specific intra-vaginal progesterone releasing device has been
developed to facilitate fixed time AI. Mean pregnancy rates of 60-
75% are achieved, although considerable herd to herd variation exists.
Pregnancy rates do not appear to be affected by the interval from the
end of synchrony treatment to insemination. Yearling hinds (15-16
months of age) can be induced to breed at least a month earlier than
usual with acceptable pregnancy rates. These technologies are being
combined to increase the rate of genetic gain in weight-for-age in red
deer in New Zealand as well as managing disease by eliminating the
need to bring in outside animals.
WS08-3
In vitro production of cervid embryos: results, limits and
future perspectives regarding endangered species
conservation
Locatelli, Y
MNHN, France
Despite conservation actions, more than five thousand vertebrates
species are threatened with extinction according to 2007 IUCN
evaluation. Conservation of animal species relies when possible on
conservation programs performed in or ex situ. For mammals, ex situ
programs relies on captive breeding in zoos or similar institutions and
are aimed in maintaining genetic variability of species. Within
cervids, about 40 subspecies are facing extinction (IUCN red list).
Reproductive technologies developed for cattle (sperm freezing,
artificial insemination, superovulation, in vitro production of
embryos, embryo transfer…) were proposed for deer as efficient tools
to increase number of breed per hind and for genetic
preservation/exchange between spots of conservation. If some
biotechnologies were quite easily transposed to deer species, it now
clearly appears that understanding of reproductive physiology of each
species is a key factor for successful transposition. Achievability of in
vitro embryo production methods was investigated in sika deer and
red deer as models for management of endangered deer species. After
in vitro maturation of cumulus-oocytes complexes, our recent findings
(Locatelli et al. 2005, 2006) indicates a 60-80 % fertilisation rate for
both species when synthetic oviduct fluid (SOF) medium
supplemented with 20% oestrous sheep serum was used for in vitro
fertilisation. Developmental competence was assessed for both red
and sika deer embryos in two different culture systems. Embryos were
cultured in SOF medium in the presence or absence of ovine oviduct
epithelial cells (oOEC). In contrast with classical SOF culture, high
proportion of embryos reached the blastocyst stage in presence of
oOEC. Theses results may indicate specific needs of deer embryo as
compared with sheep, goat or cow embryos. Viability of frozen and
vitrified red deer embryos produced in vitro on oOEC was confirmed
by successful embryo transfer to synchronised red deer recipients.
Viability of sika deer blastocysts was assessed by transferring 14
frozen/thawed embryos to 7 red deer recipients. One of the seven red
deer recipients was diagnosed pregnant by ultrasonography on day 56
after sika deer embryo transfer. A healthy male sika deer fawn was
born unassisted after 224 days of gestation (Locatelli et al. 2008).
Presents results illustrate achievability to produce viable embryos in
vitro in two deer species. Furthermore confirmation of interspecific
embryo pregnancy in deer may offer new possibilities for
conservation of rare deer species in future.
WS08-4
The ART of red deer (Cervus elaphus) cloning
Berg, D 1 *; Berg, M 1 ; Mackintosh, C 2 ; Li, C 3 ; Asher, G 4
1Reproductive Technologies 2Animal Health, 3Growth and Development,
4AgSystems, AgResearch, New Zealand
In New Zealand a unique opportunity existed to use antlerogenic
periosteum (AP) cells from red deer as nuclear donors for cloning by
somatic cell nuclear transfer (SCNT). AP cells, found only in the deer,
are stem cells that give rise to antlers in stags. They are proposed to be
retained foci of embryonic tissue and their multipotent nature (Anat
Embryol 204:375-388, 2001) makes them attractive for SCNT. SCNT
in all species cloned so far is associated with high incidences of
pregnancy failure throughout gestation (>90%), poor maternal
preparation for parturition and high incidence of neonatal mortality
(~67% of live offspring surviving to weaning). In cattle particularly,
standard farm management practices have been adapted to deal with
these issues. However, these farm practices may not be appropriate
when applied to a pastoral semi-domesticated species such as deer. In
preparation for red deer SCNT cloning, we adapted methods
developed for cattle cloning such as non-surgical embryo transfer,
intensive fortnightly pregnancy monitoring by trans-rectal and transabdominal
ultrasound, from Day 35 to Day 290 of gestation, and
rectal palpation to assess cervical dilation close to parturition and
applied them to deer pregnancies generated by in vitro fertilisation
(IVF). These were applied to two sets of SCNT (Biol Reprod 77: 384-
394, 2007): a preliminary trial using 14 recipients accustomed to
intensive handling, followed by a pastoral field trial involving the
non-surgical transfer of 70 single SCNT blastocysts. Gestation lengths
and birth weights were compared with contemporaneous naturally
mated half-siblings or AI offspring. The health of newborn calves in
all treatment groups were assessed by hematological and blood
chemistry analysis. Overall, the pregnancy rate at Day 35 was 39%
(33/84). However, only 11/84 surrogate dams were pregnant at Day
150, but there were no further pregnancy losses beyond this. Three of
these failed pregnancies required the manual extraction of mummified
fetuses. All SCNT surrogates exhibited normal signs of parturition
and calved without induction. The mean gestation length and birth
weight of SCNT calves were not different to the controls. All SCNT
calves were reared by their surrogate dams. No neonatal mortality
occurred for calves born in the preliminary trial (0/3); however 3/8
calves were lost within the first week in the field trial. The remaining
eight clones are now 2 and 4 years of age.

16 t h International Congress on Animal Reproduction
Workshop Abstracts 15
WS08-5
The strict timing of reproductive capacity in roe buck – an
ideal model system for seasonally reproducing cervidae
Schoen, J 1 *; Blottner, S 2
1Institute of Veterinary Biochemistry, Freie Universität Berlin, Germany;
2Leibniz-Institute for Zoo- and Wildlife Research, Berlin, Germany
The roe deer is a typical seasonal breeder with a short sexually active
period lasting from mid July to mid August. Activity of tissues which
are relevant for reproduction is very strictly regulated compared to
other cervids. Exogenous signals from the environment cause
manifest cyclic changes in the endocrine system of the animal, which
result in distinct alterations of morphological and functional
parameters within all reproductive organs. In the male, these
alterations concern sperm production within the testis as well as
structure and function of the epididymis and accessory sex glands. Of
course they also greatly concern behavioural aspects, which we will
however leave aside here. Only at the time of rut, functionality of the
reproductive tract is optimized so that sperm output of high quality
and quantity can be ascertained. Even in phases before and after the
mating period, spermatozoa are produced to a certain degree, but they
are morphologically and functionally of low quality, due to
suboptimal conditions in the reproductive tract. The gonadotropins
show cyclical releasing patterns throughout the year with an LH peak
at the beginning of spermatogenesis activation in March. This causes
modulations in the differentiation status of Leydig cells followed by
an increase of testosterone secretion. The endocrine variations trigger
the seasonal up and down of germ cell proliferation and
differentiation in the testis, which is mirrored by extreme changes in
tubulus diameter and testis mass. In the epididymis remarkable
alterations in the tissue composition of the duct as well as in its
expression patterns are necessary to assure controlled maturation of
spermatozoa during the rut. Lastly, the cyclic changes in volume and
exocrine activity of the accessory glands cause a seasonally modified
composite of the seminal fluid. All of this leads to enormous
variations in quality and quantity of sperm cells in the ejaculate.
The variability of the reproductive capacity of the roe buck is based
on the combined actions and the subtle interplay of the endocrine
system, germinative and somatic testicular cells, the epithelium of the
epididymis and the accessory glands. This fragile interaction is
necessary to facilitate the optimal timing of male reproductive fitness
towards rutting season. The non domesticated roe deer is an
absolutely fascinating model that enables us to study the different
levels of seasonally determined regulation of reproduction with hardly
any artificial influence.
Workshop 09 - Cryopreservation of gametes and embryo
Moderator: Sandor Cseh (Hungary)
WS09-1
Basic Cryobiology of Gametes and Embryos
Leibo, SP
Department of Biological Sciences, University of New Orleans; Audubon
Center for Research of Endangered Species, New Orleans, LA U.S.A.
The ability to cryopreserve spermatozoa, oocytes and cleavage-stage
embryos is essential for the efficient husbandry of all mammalian
species. Live offspring of more than fifty species have been produced
by artificial insemination of females or by in vitro fertilization of
oocytes with cryopreserved spermatozoa. Live young of at least
twenty-five species have resulted from transfer of cryopreserved
embryos or oocytes. For some species, offspring have been produced
from gametes or embryos that have been preserved in the frozen state
for at least twenty-five years, leading to speculation that
cryopreserved germplasm can probably be stored at least for
millennia.
Despite the diversity of species that have been successfully preserved,
the basic principles from which the procedures to cryopreserve them
have evolved are very similar. Gametes or embryos are suspended in
a solution of a cryoprotective additive (CPA) that causes the cells to
undergo partial dehydration by loss of cell water. Then, the cells are
either cooled to low subzero temperatures at high rates to “capture”
the cells in the dehydrated state, or the cells are first cooled rather
slowly to intermediate subzero temperatures causing dehydration in
response to the increasingly concentrated solution as extracellular
water is removed in the form of ice. In both cases, the purpose is to
prevent cell water from crystallizing within the cell. After storage,
cryopreserved cells are warmed to physiological temperatures and the
CPA is removed. In general, if cells have been cryopreserved by
being rapidly cooled, they are warmed rapidly; if preserved by slow
cooling, the cells are warmed relatively slowly.
Literally, thousands of experimental reports have been published in
which details of methods to cryopreserve gametes and embryos are
described. Various low molecular weight compounds have been used
successfully as cryoprotectants. Cooling and warming rates ranging
from less than 0.5ºC/minute to more than 10,000ºC/minute have been
used to cryopreserve germplasm. A wide variety of devices and
containers have been used to cryopreserve cells. In general, it appears
that it is not the actual cooling or warming procedure or the storage
temperature that damages germplasm. Rather, most evidence
indicates that the key to successful cryopreservation is the
composition of the suspending medium. Consequently, efforts
continue to determine the effects of such media on gametes and
embryos and to seek better media for cell preservation.
WS09-2
Update on Vitrification as a novel Cryopreservation
Technique for Oocytes and Embryos
Liebermann, J
Fertility Centers of Illinois, Chicago, IL, USA
The impact of cryopreservation on the growth and improved
efficiency of assisted reproduction in humans is becoming
increasingly appreciated, with close to a fifth of all births following in
vitro fertilization and embryo transfer Worldwide arising from
cryopreservation of supernumerary embryos. As culture techniques
and embryo quality improve, the ratio of fresh to cryopreserved
embryo babies will approach a more equal ratio, indicative of an
increased reliance on the use of embryos following cryostorage. One
of the most commonly discussed issues in cryobiology is whether
slow-cooling or rapid-cooling protocols satisfy the fundamental
cryobiological principles of reducing damage by ice crystal formation
during freezing and thawing. One way to achieve this target is by
attempting to establish a glassy or vitreous state, wherein molecular
translational motions are arrested without structural reorganization of
the liquid. Such recent studies have opened the door to a potentially
highly successful and consistent alternative to overcoming the
problems of slow-freezing and thawing cells, named vitrification.
Although initially reported in 1985 as a successful cryopreservation
approach for mouse embryos, vitrification has taken a backseat to the
much more widely adopted conventional freezing technology applied
to both gametes and embryos in animal and human assisted
reproduction. Recent years have seen a resurgence of interest in this
ultra-rapid cryopreservation technology, as the limitations of slowrate
freezing have become more evident in the clinical arena.
Vitrification is a simple technology, potentially faster, and
inexpensive. Furthermore, vitrification has proven to be consistent
and reliable when carried out properly, and it allows also more
individual patient flexibility. Vitrification has so far been used for
gametes and embryos (developmental days 1 to 5). However, its use
has been more advantagous with chill-sensitive cells such as oocytes
and blastocysts. Successful vitrification of human spermatozoa
without cryoprotectants was recently described. There is very few
data available concerning the vitrification of human ovarian tissue.
Although some problems remain to be fully addressed with
vitrification as a routine cryopreservation technique, we believe that it
shows much promise as a viable alternative to conventional freezing
technology. The issues with vitrification are well defined and limited
in number, and to our way of thinking easily surmountable.

16 t h International Congress on Animal Reproduction
16 Workshop Abstracts
WS09-3
Conventional cryopreservation of in vitro- and in vivoderived
bovine embryos
Hasler, JF
Bioniche Animal Health USA, Inc., 1551 Jennings Mill Rd., Bogart, GA 30622
USA
Data from the International Embryo Transfer Society indicate that
many hundreds of thousands of bovine embryos are cryopreserved
yearly on a world-wide basis. According to the American Embryo
Transfer Association, more than 200,000 in vivo-derived embryos
were cryopreserved during 2006 in the USA. Ethylene glycol (EG)
was the cryoprotectant of choice for >99% of the beef embryos and
>85% of the dairy embryos, while glycerol was used for the balance.
Less than 1% of the in vivo-derived embryos were vitrified. Also
during 2006, more than 120,000 IVF-derived bovine embryos were
vitrified in Canada, compared to only ~1,500 in the USA. An
additional ~1,200 IVF-derived embryos were frozen in EG during
2006 in the USA. With the advent of the so-called direct transfer (DT)
system, utilizing EG for freezing in vivo-derived bovine embryos, the
use of glycerol steadily declined. Numerous published and
commercial comparisons of the efficacy of the two cryoprotectants
have demonstrated that there is virtually no difference in pregnancy
rates. The DT system has the advantage of being much faster and
more convenient during thawing and transfer. While embryos frozen
in glycerol require the use of a microscope, a trained embryologist,
several media and 15 to 20 minutes of time from thaw to transfer,
none of these is necessary when DT freezing is employed. The gap
between pregnancy rates derived from the transfer of in vivo-derived
DT embryos and fresh embryos is less than 10 percentage points,
leaving only moderate room for improvement in the technology. A
census of protocols employed commercially have shown that
pregnancy rates are virtually identical when seeding of DT embryos is
conducted between -5 and -7° C and when the post-seeding cooling
rate is between 0.4 and 0.6°C. A slight decline in pregnancy rate was
noted when straws were thawed in air for more than 5 seconds prior to
being put into a water bath. In vivo-derived embryos appear to survive
at a high rate when vitrified in 0.25ml straws for DT. This system,
however, has not been widely adapted commercially. Most reports,
however, indicate that IVF-derived embryos do not survive at a high
rate when frozen in a traditional DT system or vitrified in straws for
DT. Currently, the best survival rates for IVF-derived embryos have
been in a traditional vitrification system employing ultra rapid
freezing. These systems do not lend themselves to DT and are not
convenient for commercial utilization.
Workshop 10 - Artificial Insemination and Related
Methods in Pet Carnivores
Moderator: Bodil Ström Holst (Sweden)
WS10-1
An update on preservation of feline gametes
Luvoni, GC
Department of Veterinary Clinical Sciences – Obstetrics and Gynaecology -
Faculty of Veterinary Medicine, University of Milan, Italy
Remarkable progress in the preservation of feline gametes have
recently been achieved. Artificial insemination (AI) with frozen
semen resulted in the birth of kittens and in vitro fertilization of stored
gametes resulted in the development of embryos. Despite these
successes, there are still no routine procedures for the preservation of
cat spermatozoa and oocytes, which survive cold storage
inconsistently.
Variability in the results of semen preservation is one of the factors
affecting the success of AI. The optimal inseminating dose for frozen
semen, although strictly dependent on the site of semen deposition
(intravaginal or intrauterine), has not yet been defined as cat
spermatozoa, both ejaculated or epididymal, are severely damaged by
cryopreservation. Plasmatic and acrosomal membranes are highly
susceptible to freezing and their integrity is hardly preserved after
thawing. Short-time preservation (cooling at 4-5°C) showed that cat
spermatozoa are more tolerant to cold shock than spermatozoa of
other species. Thus, membrane damages are attributed to freezing
rather than cooling per se or as a step of cryopreservation process.
In cat oocytes, the stage of nuclear maturity influences the success of
cryopreservation. We showed that viability and nuclear competence of
immature (Germinal vesicle-stage) oocytes can be preserved by slow
freezing and cat oocytes can be fertilized successfully after thawing,
although low rates of in vitro embryo development are observed. The
organization of cytoskeletal elements in immature oocytes is
preserved after slow freezing, but the embryo development in vitro is
enhanced when mature oocytes (Metaphase II-stage) are frozen. In
vitro fertilization and development still occur when both gametes have
previously been stored (frozen mature oocytes and chilled epididymal
spermatozoa). Preservation of female germ cells has also been carried
out in the cat by freezing isolated or in situ preantral follicles
(cryopreservation of ovarian tissue), even though low rates of follicle
survival were observed after thawing.
Feline spermatozoa and oocytes have been shown to survive storage
at low temperatures. The composition and permeability to
cryoprotectants of plasmatic and acrosomal membranes, as well as
zona pellucida and oolemma, need further investigation. This will
make it possible to develop standardized methods for the preservation
of viability and functional integrity of feline gametes at acceptable
levels.
WS10-2
Artificial insemination in cats: problems and possibilities
Chatdarong, K
Department of Obstetrics, Gynaecology and Reproduction, Faculty of
Veterinary Science, Chulalongkorn University, Bangkok, Thailand
Artificial insemination (AI) has been widely practiced in other
animals but its use in cats is limited. Semen collection in cats is
complicated. For collection with artificial vagina, an oestrous queen is
needed as teaser, whereas for electroejaculation the cat needs to be
anaesthetised. Moreover, ovulation must be induced in the queens.
Intravaginal insemination (IVI) using a tomcat catheter is easy and
non-invasive, but to achieve a conception rate similar to the one after
intrauterine insemination (IUI), a ten-fold higher number of
spermatozoa is required. This demonstrates that, to some extent, the
cervix prevents sperm transport into the female genital tract. Patency
of the cervix is therefore a crucial factor affecting conception rate
when IVI is used. A pregnancy rate of 33% can currently be achieved
by IVI with fresh semen (6.8-22 x 10 6 spermatozoa). When frozen
semen is used, the number of live frozen-thawed sperm and the site
for semen deposition are important factors influencing pregnancy rate.
A better result is achieved with IUI than with IVI. Although surgical
IUI yields a satisfactory conception rate, it is not allowed in many
countries due to animal welfare considerations. Transcervical IUI, a
non-invasive technique, is an alternative. However, the complicated
anatomy and modifications of the cat cervix during oestrus make
transcervical catheterisation difficult. In addition, the anatomical
structure of the cervix and vagina varies between individuals. A
single-sized vaginal catheter may not fit properly into the ventral
vaginal fornix of all cats. Using our specially designed transcervical
catheters the overall success rate of introducing the inner catheter
through the cervix is 35.2% (32/91 queens). Transcervical IUI with
frozen-thawed semen (20 x 10 6 spermatozoa with 70% post-thaw
motility) currently yields a pregnancy rate of 45.5% in queens that
ovulated (5/11). The current developments of AI in cats provide
promising results potentially for use also in other small felids.

16 t h International Congress on Animal Reproduction
Workshop Abstracts 17
WS10-3
Dissecting the sperm subpopulation structure of the
canine ejaculate
Pena, FJ
Department of animal medicine, University of Extremadura, Caceres, Spain
A two step clustering procedure using principal component analysis
derived indexes was used to disclose sperm subpopulations within the
canine ejaculate and their relation to sperm cryoresistance. Semen
from 4 dogs was frozen-thawed using a standard protocol. Before
freezing, computer assisted sperm analysis of motility (ISAS®) was
performed. After thawing motility analysis was performed again.
Cryoresistance was estimated as the change, in percent, between
progressive motility and sperm velocities after thawing compared to
before freezing. We used principal component analysis sperm derived
indexes (SVI sperm velocity index, and SMI sperm motility index)
and the SPSS® two step cluster method to disclose sperm
subpopulations. The two step clustering procedure revealed the
existence of 6 subpopulations. Subpopulations 4 and 6 were
characterized by high values of both SVI (> 200 arbitrary units) and
SMI (>90 arbitrary units), 2 and 3 by medium values (SVI; 100 to 130
and SMI, 30 to 40) and 1 and 5 were characterized by low values (SVI
below 100 and SMI below 30). The distribution of sperm
subpopulations was completely different among dogs. Circular
velocity (VCL) post thaw was explained by a model including two
sperm indexes, R2 = 0.997, this is, namely explained the 99% in the
variation (p

16 t h International Congress on Animal Reproduction
18 Workshop Abstracts
WS11-2
Biosecurity and bureaucracy: a point of view of the
regulator / auditor
Sauveroche, B
Food and Veterinary Office, European Commission, Ireland
Trust is of paramount importance in the development of trade. This
trust is built on a common understanding and evaluation of the
features and characteristics of the goods to be traded. In the trade of
semen and embryos these features refer not only to the quality of the
germplasm to be traded, but also to the control of associated animal
health risks. Biosecurity measures are therefore designed and applied,
in order to prevent, control or remove animal health risks during the
collection, production, processing, storage and transport of semen and
embryos.
As part of the transparency needed to build trust, these biosecurity
measures must be sound and verifiable. To this end, a bureaucratic
approach based on a rational, uniform set of rules and procedures may
ensure a reliable, predictable and auditable standard of risk
management. However, the overall objective of biosecurity appears
sometimes to be lost, when the emphasis put on conformity suggests
that the means becomes the end.
This presentation analyses the available options to reach a reliable
level in health safety, illustrating the subject with examples gathered
from recent international audits on the application of animal health
requirements for the collection and trade of semen and embryos.
WS11-3
The impact of the cow and bull on the results of embryo
transfer
Hasler, JF
Technical Services Advisor, Bioniche Animal Health USA, Inc.
Data provided by the International Embryo Transfer Society indicate
that worldwide, more than 789,000 embryos were produced from
130,000 superovulated donor cattle in 2005. The yield of good-quality
embryos resulting from the superovulation of cattle depends on
numerous factors involving both the donor female and the semen used
to breed the donor. Mean yields of embryos per donor reported
internationally are in the range of 5-7 and basically have not changed
in the past thirty years. Embryo production is similar whether donor
superovulation is initiated during mid-cycle or following the insertion
of a CIDR at a random stage of the estrous cycle. In addition, the
use of CIDRs has led to the successful shortening of the intersuperovulation
interval, allowing the production of more embryos per
unit time. Although beef breeds produce on average more embryos
than do dairy cattle, the differences are small. Also, superovulation
efficacy has not been greatly influenced by the numerous different
FSH preparations that have been employed over the years. Parity is
related to superovulation success, with more variability observed
among virgin heifers and fewer embryos recovered on average.
Superovulated cattle produce fewer embryos after reaching age 8 to
10 and heavy lactation, especially among dairy cattle, may decrease
response. Season has little effect on superovulation efficacy in
temperate climates, but elevated heat and humidity are detrimental,
especially when lactating dairy cattle are utilized as donors. Individual
variation among females in response to superovulation remains the
largest and least understood variable. Some females consistently
produce large numbers of embryos as a response to superovulation,
while other females of similar age, breed, management, etc. perform
poorly. The influence of the male on the outcome of embryo transfer
is evident at two levels. First and most obvious, is the percentage of
ova that are fertilized and the number of good quality embryos
produced. It clearly has been shown that sperm quality, sperm
number, and the timing of insemination are closely correlated with
fertilization success in superovulated cattle. Most superovulated
donors are inseminated with one unit of semen at 12 and 24 h post
onset of estrus. Of equal importance to fertilization is the ability of
embryos to establish pregnanices following transfer into recipients.
Even after fertilization and development into morphologically goodquality
embryos, differences in pregnancy rates relative to sperm
quality and among different sire have been demonstrated.
WS11-4
Recommended guidelines for semen and embryo straw
identification for international trade
Witschi, U*, Kneubuehler, J
Department of Production, Swissgenetics, Switzerland
Correct and reliable identification of semen and embryo straws is an
important element for traceability and sanitary security of these
products for international trade and their use in breeding programs
world-wide. Furthermore the technique, how the straw is identified,
affects every step of the marketing and selling process.
With regards to sanitary security most countries have set up
regulations on how semen-straws or embryos should be labeled.
Article 3.2.1.10, paragraph 3 in Appendix 3.2.1 of the OIE Terrestrial
Animal Health Code refers to the ICAR (International Committee of
Animal Recording) standards for labeling semen straws. Current state
is, that the required information is printed, with no barcodes, either on
the straw (for semen) or on the tube containing the embryo. This
means, that this information can be read by eye, but cannot be handled
electronically. International trade volume with embryos is rather low
compared to semen straws. Sales processes could be made more
efficient by introducing a system which allows the straw identification
to be read and handled electronically. To address this topic the EU-
QualiVet group has proposed a system to identify semen straws by
barcode, remaining within the frame set by the legislation and offering
a maximum of flexibility for semen processing and trading
companies. French trials have shown that the technical problems of
printing and reading bar-codes on semen straws have been solved.
Key factors to make the barcode readable and useable worldwide are:
the use of one uniform coding system (Code 128), the unique
identification of the processing AI Centres and that the information on
how to interpret the barcode is easily available. This proposal has
been submitted to the International Congress for Animal Recording
(ICAR).
To avoid parallel and inconsistent systems, negotiations are
continuing with the National Association of Animal Breeders
(NAAB) in order to harmonize the AI-Centres Identification with the
NAAB stud code system. Furthermore, ICAR would host a web site
which provides information about the content of the barcode by AI
centres. Coordinated action is needed to assure the advantages and
benefits for international trade are realized.
Workshop 12 - New Applications of Technology for
Education in Reproductive Science
Moderator: Phillip L. Senger (USA)
WS12-1
Feedback-Systems for Formative and Summative
Assessment in Lectures of Veterinary Medicine
Ehlers, JP 1 *, Kaske, M 2,3 , Tipold, A 4 , Bollwein, H 3
1eLearning-Consultant, University of Veterinary Medicine Hannover; 2 Chair of
Physiology, Center of Life and Food Science, Weihenstephan; 3 Clinic for
Cattle, University of Veterinary Medicine Hannover; 4 Small Animal Clinic,
University of Veterinary Medicine Hannover
Students in lectures stay rather passive which does not facilitate the
learning results. To activate the students and their reasoning about the
lecture topics the University of Veterinary Medicine Hanover since
summer 2005 uses an anonymous feedback system for formative
assessment and evaluation. The German law (TAppV) prescribes
more attendant-study exams. This causes a shift from the traditional
oral exams to written tests. The feedback system could also be used
for this summative assessment.
The acceptability was tested in six lectures with totaling 259 students
(F) and one exam with 222 Students (S). The survey was done with a
6-point-Likert-Scale (school grades). The students enjoyed using the

16 t h International Congress on Animal Reproduction
Workshop Abstracts 19
feedback system (F: 1.4, S: 1.5). It was easy to use (1.2, 1.4), students
thought they learned better (F: 2.9 vs 2.2, S: 3.2 vs 2.3) and wished a
more frequent use (1.7, 2.2) but not in every lecture (3.4, 3.9). The
use for formative assessment (1.9, 2.0) and evaluation (2.4, 1.9) was
preferred to the summative assessment (4.8, 2.8). Partly mistrust to
the new technique existed (41.1%).
In conclusion, there is a high acceptability to the use of feedback
systems and the University for Veterinary Medicine Hanover will
intensify its use.
WS12-2
Time Compressed Animated Delivery (TCAD) of follicular
dynamics resulted in Higher Learning @ Higher Speeds
among university students
Oki, AC 1 *, Trevisan, MS 2 , Gerard, S 3 and Anderson, B 4 , Senger, PL 1
1Current Conceptions, Inc., Pullman, WA, USA; 2 Assessment and Evaluation
Center, Washington State University, Pullman, WA, USA; 3 Oei Graphics,
Bellevue, WA, USA; 4 Arkitek Studios, Seattle, WA, USA
This study compared two content delivery methods that described and
explicated bovine follicular dynamics. Comparisons were made from
randomly assigned undergraduate students from six American
universities. One delivery method was a traditional classroom lecture
captured on video with duration of 34 min. The second method was
Time Compressed Animated Delivery (TCAD) (duration of 17 min.).
The TCAD incorporated 3-dimensional anatomical reconstructions,
step-wise animations, voice-over, streaming animations, and script
messaging. Students (n=181) viewing the traditional delivery method
(control) scored an average of 62.5% on a 20-item test taken
immediately after the viewing. Students (n=183) who viewed the
TCAD scored 78% on the same 20-item test taken immediately after
viewing the delivery. There was a 15% gain for the students receiving
the TCAD delivery method in one-half the delivery time. The
difference between means was statistically significant (p

16 t h International Congress on Animal Reproduction
20 Workshop Abstracts
In conclusion, both the number of animals in estrus at the same time
and parity affected expression of estrus, but not timing of ovulation
after estrus. These factors are not easy to influence. In practice,
intense estrus detection protocols or the use of pedometers could
improve estrous detection and subsequent timing of insemination.
WS13-2
Behavioral and endocrine responses to estradiol-17b (E)
in Holstein cows
Silvia, WJ*, Reames, PS and Hatler, TB
Department of Animal and Food Sciences, University of Kentucky, USA
Since 1960, there has been a decline in the duration of estrus in
Holstein cows from an average of 18h to less than 8h. The endocrine
factors regulating expression of estrus in cattle have been extensively
investigated yet many critical questions remain. Estradiol (E) clearly
is the endogenous hormone that induces estrous behavior. There is
experimental evidence to support the concept of a critical ‘threshold’
of E required for the expression of estrus. Higher concentrations had
no additional effect on intensity or duration of expression. In other
studies, the duration and intensity of estrus was related to the amount
of E present. Therefore, the first objective of this experiment was to
reexamine the concept of ‘threshold’ by administering different doses
of estradiol to ovariectomized cows. This also allowed us to meet the
second objective, to determine if individual cows differed in the
amount of E required to initiate estrus. The third objective was to
determine if the effects of E dose on the occurrence, timing and
duration of estrus were associated with similar effects on the
occurrence, timing and magnitude of the LH surge. Ovariectomized
Holstein cows (n=5) were used. In each replicate of the experiment,
each cow received an i.v. injection of E followed by a continuous i.v.
infusion of E designed to maintain 0, 3, 6, 9 or 12 pg/ml in blood.
This experiment was replicated so that each cow was treated with
each dose at least once. Three of the cows showed estrus at the 6, 9
and 12 pg/ml doses. The other two cows only showed estrus at the 12
pg/ml dose. Thus, cows differ in the amount of E needed to induce
estrus. Duration of estrus was less in cows that received the 6 pg/ml
dose (8.8 h) than in those that received the 12 pg/ml dose (17.1 h;
P

16 t h International Congress on Animal Reproduction
Workshop Abstracts 21
marsupials. Indeed, further examination revealed that paired sperm
migrate almost exclusively to the isthmus of the oviduct shortly after
mating. This is the first in vivo evidence of an adaptive advantage
conferred by sperm cooperation in any mammal.
In summary, the tammar, opossum and other marsupials provide
important examples of how metatherians have evolved alternative
reproductive adaptations in the face of selective pressures.
WS14-2
Non-invasive assessment of female reproductive
physiology in the Pygmy Hippopotamus (Choeropsis
liberiensis)
Paris, M 1,2 *; Millar, R 1,3 ; Colenbrander, B 4 ; Schwarzenberger, F 5
1Institute for Breeding Rare and Endangered African Mammals (IBREAM),
United Kingdom; 2 Dept. Equine Sciences, Faculty of Veterinary Medicine,
University of Utrecht, The Netherlands; 3 MRC Human Reproductive Sciences
Unit, United Kingdom; 4 Dept. Farm Animal Health, Faculty of Veterinary
Medicine, University of Utrecht, The Netherlands; 5 Dept. of Natural Sciences
– Biochemistry, Vet. Med., Austria
The pygmy hippopotamus (Choeropsis liberiensis) is listed by IUCN
as vulnerable, with 2000-3000 individuals remaining. In Nigeria it is
already listed as being critically endangered (IUCN Red list, 2006).
Thus, maintaining a viable population in zoological institutions is of
utmost importance. As a consequence of their cryptic behavior, there
is little information about this species collected in the wild. Current
information on reproduction is derived from studbook data and
behavioral descriptions, but hormonal characterization of the estrus
cycle had not yet been undertaken. The lack of basic reproductive
knowledge currently compromises the breeding management of the
pygmy hippopotamus in zoos.
The aim of this study was to obtain basic information on female
reproductive physiology by monitoring faecal reproductive hormones
in juvenile, sexually mature, and old-age females. Fecal sample
collections were collected for at least 1 year from 8 zoological
institutions throughout Europe. Currently collections are continuing
with 15 zoological institutions in total. The fecal samples were stored
at -20°C until transported frozen to the laboratory. After methanol
extraction, the analysis used group specific EIAs with antibodies
against 5ß-pregnane-3α-ol-20-one 3HS: (20 oxo-pregnanes), 5βpregnane-3α-20α-diol
3HS:BSA (Pg-diol) and estradiol-17ß-OH
17HS:BSA (total estrogens).
The data presented here are collected from 7 sexually mature females
(of which 4 have hormonal data obtained during pregnancy and/or
lactation), and 1 possible post-reproductive cow. The total estrogens
measured suggested monthly cycling patterns (33 ± 3 days). In
addition, estrogen rises were also recognized at several occasions
during pregnancy and also during lactation. Data obtained measuring
20 oxo-pregnanes were not interpretable. Pg-diol levels were elevated
significantly during pregnancy, but not during cycling.
In conclusion, data obtained so far indicate that the pygmy
hippopotamus can cycle year round, and that estrogens can reliably
monitor reproductive patterns. The absence of progesterone
metabolite rises during cycling indicate that either a) the assay needs
further refinement, or b) that this species is possibly an induced
ovulator, which would be in accordance with its solitary existence in
the wild. Further work is done to confirm or refute this hypothesis.
The data also show that follicular development takes place during
pregnancy and during lactation.
WS14-3
Faecal steroid hormone metabolites – a parameter for the
free (non protein bound) hormone fraction
Moestl, E
Department of Basic Sciences, Veterinary University, Vienna, Austria
In plasma steroid hormones are transported mainly in a protein bound
form and are excreted after extensive metabolism via urine and faeces.
Faecal sampling is easier than blood or urine collection and in case of
glucocorticoid determinations it does not cause a disturbance of the
animals.
The quantification of these steroid hormone metabolites is used as
surrogate parameter for the plasma concentration but the correlation
between steroid hormone values in plasma and faeces it is an open
question as there are no data if the metabolites in faeces represent the
“total” or the non-protein bound fraction of the plasma hormones.
Therefore, an artificial binding protein was raised in sheep by
immunising 12 sheep against cortisol-CMO linked to three different
carrier proteins (1 mg/animal, booster injections 0.5 mg using
Gerbu®-adjuvant in weeks 8 and 15).
A stimulation test using 0.25 mg ACTH i.v. (Synacthen®, Fa.
Novartis) was performed three times (two weeks before immunisation
and 11 and 17 weeks later). Heparinized blood samples were taken
from the jugular vein after 0, 30, 60, 120, 360 and 540 min. Faecal
samples were collected after 0, 4, 6, 8, 10, 12 and 14 hours.
In plasma, the titer against cortisol was determined using tritiumlabelled
cortisol and the concentrations of cortisol (plasma) and the
cortisol metabolites in faeces (immunoreactive 11-
oxoetiocholanolone) were measured using enzyme immunoasssays.
Only steroid concentrations from animals with a titer higher than 10%
at a dilution of 1:500 of the plasma were considered in the analysis (n
= 10).
The plasma concentrations of cortisol increased with increasing titer
(baseline values: 14 ± 7, 35 ± 22 and 47 ± 33 ng/ml plasma) whereas
in faeces the concentrations of the immunoreactive metabolites were
not significantly elevated by the higher cortisol concentrations in
plasma (285 ± 144, 180 ± 97 and 454 ± 393 ng/g faeces). This result
may lead to the assumption that the hormone metabolites excreted
derive from the “free” (non-protein bound) hormone fraction of the
plasma.
WS14-4
Deep intra-uterine insemination with sex-sorted semen in
elephants
Hildebrandt, TB 1 *, Goeritz, F 1 , Rath, D 2 , Behr, B 1 , Schnorrenberg, A 3 ,
Knieriem, A 4 , Sieg, B 2 , Hermes, R 1
1Reproduction Management, Leibniz Institute for Zoo & Wildlife Research,
Germany; 2 Institute for Animal Breeding, Federal Agricultural Research
Centre, Germany; 3 Schnorrenberg Surgical Equipment Development Inc.,
Germany; 4 Hannover Zoo, Germany
Since the introduction of the non-surgical artificial insemination (AI)
technique in 1995 (Hildebrandt and Schnorrenberg, 1996; Hildebrandt
et al. 1998) in captive elephant breeding programs the reproduction
rate has been increased dramatically especially in African elephants in
North America. However, this optimistic development is still not
sufficient to stop the global trend of aging of the captive populations
in African and Asian elephants. Historically, the in-situ populations
in Asia and Africa have always served as a source of new individuals
for ex-situ populations. However, the in-situ population are critically
endangered due to conversion of habitat for agriculture and the
encroachment of urban civilization resulting in fragmentation and
disturbed sex ratio. Due to this disappointing situation, in-situ
populations are no longer available to import wild-caught elephants
for re-populating the aged captive populations and, more importantly,
the captive populations have become paramount for the conservation
of the all elephant species and sub-species.
The positive impact of AI programs on the demographic situation of
the captive elephant populations can be accelerated by using X
chromosome–enriched sperm samples which would produce a higher
percentage of female offspring and future number of potential
breeding cows. In result the captive breeding management of
elephants can be improved.
This strategy, however, has to overcome two major obstacles. First
step was the successful development of an efficient staining and
sorting protocol for elephant spermatozoa using a flow cytometry
technology (Behr et al. in press). Second step was the development of
a non-invasive, intra-uterine insemination technique allowing the
semen deposition approx. 2.5 m inside the reproductive tract in a nonsedated
female due to the general low sperm count of sorted samples
and so called “sorting injuries” of the spermatozoa used. The sperm

16 t h International Congress on Animal Reproduction
22 Workshop Abstracts
placement during classical insemination is performed inside the
vagina or cervix. The paper presented will demonstrate a functional
elephant specific sorting protocol and introduce a newly-developed
intra-uterine insemination technique using a micro-catheter-sheath
technology. This method has been applied in nulliparous and
pluriparous elephants.
WS14-5
Diagnostic and treatment of reproductive disorders in
wild carnivores
Goeritz, F
Reproduction Management, Leibniz Institute for Zoo and Wildlife Research,
Germany
There is an increasing demand to manipulate reproduction in wild
carnivores. On one side, low reproductive performance interferes with
successful breeding of endangered species in captivity (e.g.
Amurleopard) and application of assisted reproduction technologies
(ART) is imperative. On the other side, there is a growing need to
control fertility in some feral and captive wild carnivore populations
(e.g. European brown bear). Regardless of whether fertility needs to
be increased or controlled, basic information on reproduction biology,
infertility and other reproductive disorders in female and male
individuals is paramount for breeding management. Therefore, the
development of reliable methods for reproductive assessment as well
as diagnosis and treatment of reproductive pathologies in wild
carnivores is needed. Although ultrasonography and laparoscopy are
widely used techniques for reproductive assessment, more recently
transrectal ultrasonography has also shown great promise in non
domestic carnivores. There is strong evidence that reproductive
disorders may cause infertility which is mainly responsible for limited
breeding success.
Evaluation of the reproductive performance of the captive Fossa
population revealed reproductive pathology in 50% of the females
(paraovarial and oviductal cysts) and 18% of the males (unilateral
cryptorchism). The European zoo population of Malayan sun bears
has decreased rapidly during the last 8 years from 73 to 49
individuals. Reproductive assessment revealed high incidence (32%)
of cystic alterations of the uterine cervix. In wild felids (ca. 100
animals from 12 different species/subspecies investigated) we found
uterine pathology in about 18% of the females, ranging from small
endometrial cyst accumulation to severe alterations such as pyometra,
sometimes combined with hydro- or pyosalpinx. The current
procedure for treatment of advanced uterine pathology even in
critically endangered big cat species is surgical ovariohysterectomy.
However, a transcervical uterine lavage technique allowed repeated
flushings of the uterine lumen and installation of therapeutics. In
several cases we were able to restore uterine integrity so that in future
more of female felids with diagnosed infertility can be successfully
treated. Entering the uterus non-surgically using special catheters with
endoscopical and ultrasonographical guidance offers also new
possibilities for assisted reproduction technologies (e.g. intrauterine
artificial insemination, embryo transfer) in wild carnivore species.
WS14-6
Transrectal ultrasound-guided ovum-pick-up in the
rhinoceros
Hermes, R 1 *; Hildebrandt, TB 1 ; Portas, TJ 2 ; Bryant, BR 2 ; Kelly, J 3 ; Maclellan,
LJ 4 ; Kaandrop, S 5 ; Goeritz, F 1
1Dept Reproduction Management, Leibniz Institute for Zoo and Wildlife
Research, Germany; 2 Western Plains Zoo, New South Wales 2830, Australia;
3Turretfield Research Centre, South Australian Research and Development
Institute, South Australia, Australia; 4 Goulburn Valley Equine Hospital,
Victoria, Australia; 5 Safari Park Beekse Bergen, The Netherlands
Ovum-pick-up techniques are well established in human reproduction
medicine and in the livestock industry. In its infancy the oocytes were
harvested from infertile patients by performing laparotomy and
follicle aspiration under direct visualisation of the exposed ovaries.
With only few exceptions, laparoscopic techniques were replaced in
favour of minimal invasive ultrasound-guided OPU techniques.
Depending on the species and the patient’s size, two OPU methods
are in use, utilising ultrasonography or endoscopy as imaging and
needle manipulation modalities during the aspiration process. The
ultrasound-guided OPU is performed through the vaginal fornix. The
endoscopic aspiration is carried out as laparoscopy from the patient’s
flank. To establish OPU as a tool for highly endangered but infertile
rhinoceroses we tested two approaches for OPU in black and white
rhinoceros 1) transvaginal laparoscopic follicular aspiration (TvL
OPU, n=3) 2) transrectal ultrasound-guided follicular aspiration (TrU
OPU, n=4). Females selected for this study were infertile, anoestrous
and treated with GnRH to stimulate follicle growths prior to follicle
aspiration. The TvL OPU was performed with a 3m flexible videoendoscope.
The technique allowed the visualisation of the entire
internal reproductive tract including the ovaries and oviducts after
substantial inflation of the abdominal cavity with CO 2 . The flexible
position and problematic fixation of the ovaries made a controlled
puncture of the follicles or penetration into the ovarian parenchyma
with this approach difficult. In addition, absorption of CO 2 into tissues
caused great post-surgical discomfort. No oocytes were collected with
TvL OPU. However, embryo transfer into the uterus in the rhinoceros
seemed feasible with this transvaginal laparoscopic approach. The
TrU OPU was performed using a micro-convex transducer equipped
with an integrated customized 1m aspiration needle system.
Transrectal ultrasound visualized the ovaries in close proximity to the
scan head. With TrU OPU follicle puncture and oocyte aspiration was
achieved in 3 black and 1 white rhinoceros. An average of 6 oocytes
was collected per animal. The ratio of punctured follicles to aspirated
oocytes was ~3:1. TrU OPU proved sufficient to collect oocytes from
infertile female rhinoceroses providing gametes for future in vitro
fertilisation programmes. The modified transvaginal laparoscopic
approach thus insufficient to collect oocytes will allow minimalinvasive
embryo transfer into recipients close to the utero-tubal
junction.
Workshop 15 - Animals as biomedical models in
reproductive (and regenerative) medicine
Moderator: Jan Motlik (Czech Republic)
WS15-1
The rabbit as a model in biomedical research
Bősze, Zs. 1 *, Hiripi, L. 1 , Baranyi, M. 1 , Bodrogi, L. 1 , Fan, J. 2
1Agricultural Biotechnology Center, Hungary; 2 Department of Molecular
Pathology University of Yamanashi, Japan
The rabbit is a standard laboratory animal in biomedical research, and
transgenic rabbits have been used as animal models to study a variety
of human disease. The laboratory rabbit has been traditionally and
extensively used as model for the study of infectious diseases such as
tuberculosis, fungal infections and syphilis. A number of research
groups have produced transgenic rabbits for the study of hypertrophic
cardiomyopathy, cardiac arrythmics, perturbed lipoprotein
metabolism, atherosclerosis, diabetes and cancer. When compared to
rodents which have different cardiovascular system and lipid
metabolism system from humans, the rabbit is superior for more
accurately simulating many aspects of human diseases. This is
specifically true for cardiovascular features. The cardiovascular
system (both arteries and hearts) of the rabbit is similar to that of
humans but unlike mice. Furthermore, rabbits metabolize fat and
cholesterol in a manner that is very similar to humans which
facilitates the study and development of new lipid-lowering drugs for
the treatment of hyperlipidemia. The rabbit is large enough to permit
surgeries, non-lethal monitoring of physiological changes, and newly
developed implantable medical devices can be readily tested in rabbits
without substantial modifications. Finally, rabbits are relatively
inexpensive (compared to other large animals such as dogs and cats),
and easy to breed, and are readily adapted to a wide spectrum of
medical research conditions. Transgenic rabbits have also proved to
be suitable bioreactors for the production of recombinant proteins, in

16 t h International Congress on Animal Reproduction
Workshop Abstracts 23
both an experimental and a commercial scale. These recombinant
proteins produced from transgenic rabbits can be used for both
research and treatment of human diseases. Creation of transgenic
rabbit models has been hampered due to the low efficiency of the
traditional pronuclear microinjection method and the un availability of
embryonic stem cell lines for targeted gene modifications. However
recent breakthroughs in animal cloning and lentiviral transgenesis
have created new means for establishing various transgenic rabbits
disease models. Rabbit genome annotations arising from the
sequencing project currently performed at Broad Institute /USA/ will
be invaluable to the rabbit platform to map and characterize genes that
are important in biomedical research.
Supporting grants: OTKA T 049034;GVOP-0071/3.0; MTA-
JSPS/102
WS15-2
In vivo imaging of reproductive features in biomedicine
animal models
Gonzalez-Bulnes, A 1 *, Pallares, P 2
1INIA, Department Reproduction Animal; 2 Animal Unit CNIC SPAIN
Animals have successfully been used as experimental models in
reproductive research. A great variety of species has been used
including amphibians, fish, avian and mammalian primates and nonprimates.
The most frequently used models are rodents, sheep, swine
and monkeys. In the beginning, direct observation after necropsy or
surgery was most commonly employed approach. However, such
techniques are invasive and impede successive dynamic studies on the
same animals. These can be alleviated by using non-invasive imaging
methods which also contribute to the improvement of animal
conditions, reducing the number of experimental animals and refining
the studies, in agreement with the philosophy of the 3Rs model of
Russell and Burch. When using animal models in biomedicine, studies
are predominantly translational in nature, facilitated by the application
the same diagnostic and observational techniques in experimental
studies and clinical practice. Important tools in this context are
imaging techniques such as X-rays, Computed Tomography (CT, 3-D
images from 2-D X-ray images taken around a single axis of rotation),
Positron Emission Tomography (PET, 3-D images by detecting
gamma rays produced by a positron-emitting radioisotope), Magnetic
Resonance Imaging (MRI, by using magnetic fields and radio waves),
Ultrasonography (US, by emission of sound waves with a frequency
higher than 2 MHz which produces echoes of the body),
Biomicroscopy (US at 40-70 MHz of frequency), Doppler US (US
evaluating movement of scatterers, usually in blood, by changes in the
echoes), Fluorescence (by tagging biological molecules with
fluorescent chemicals or fluorophores) and Bioluminescence (by
tagging biological molecules with luciferase). All these techniques
have different advantages and limitations; so there is not a “supreme”
imaging technique by itself. Most of them are technically complex,
very expensive, not commonly available, and need the animal to be
anaesthetized, which limits serial studies in successive days. Thus, in
many instances, ultrasound-based techniques are the imaging method
of choice, because they enable real-time viewing that cannot be
obtained by any other method, bear no secondary risk to animals, and
are of moderate cost. Moreover, the usefulness of Doppler and greyscale
imaging has been significantly enhanced over the past decade by
the improvement of ultrasound contrast agents, which are valuables
not only for their diagnostic use, but also for therapeutic applications
like targeted delivery of drugs.
WS15-3
The Miniature pig epidermal stem cells as a model for
wound heeling
Motlík, J 1,2 *; Klíma, J 1,2 ; Dvořánková, B 2,3 ; Herrmann, D 5 ; Carnwath, JW 5 ;
Niemann, H 5 ; Gabius, HJ 4 ; Smetana, K Jr. 2,3
1Institute of Animal Physiology, Academy of Science of the Czech Republic,
Liběchov, Czech Republic; 2 Charles University in Prague, Second Faculty of
Medicine, Center of Cell Therapy and Tissue Repair, Prague, Czech
Republic; 3 Charles University in Prague, First Faculty of Medicine, Institute of
Anatomy, Prague, Czech Republic; 4 Ludwig-Maximilians University, Faculty
of Veterinary Medicine, Institute of Physiological Chemistry, Munich,
Germany; 5 FAL, Institute for Animal Breeding, Department of Biotechnology,
Mariensee, Neustadt, Germany
Many tissues and organs harbor a distinct population of cells at a low
stage of differentiation with a potential to serve as multipotent
precursors of so-called somatic stem cells. These cells are responsible
for dynamic tissue renewal under normal conditions and they may
help to tissue repair to restore integrity after wounding. Epidermal
stem cells (EpSCs) are located in bulge region of outer root sheath of
hair follicle and in basal layer of interfollicular epidermis. Two
protocols were developed for in vitro isolation of these cells: 1.
counterflow centrifugal elutriation, separation of cell based on their
sedimentation velocity, and 2. migration from bulge regionof the
isolated hair follicles. A Beckman JE-6B elutriation rotor with a small
chamber (nominally 5mL capacity, suitable for fractionating between
2x 10 7 and 1x 10 9 cells) was used to obtain the EpSC enriched
suspension of keratinocytes. The first fraction contained cells
exhibiting keratin 19 and signal for nucleostemin as well as for
galectin-1 in the nucleus. Cells positive for these markers were small
i.e. 7.5-8.5 µm. Interestingly, that cells negative for nucleostemin
expression are bigger concerning the diameter than cells with positive
nucleoli. Practically all cells of this fraction were also positive for
keratin 14. No cells of this fraction express keratin 10 and the high
signal of galectin-1 binding to cytoplasm and nucleoplasm was also
observed. It is possible to conclude that cells of this fraction were
composed from cells of basal cell layer (presence of keratin 14 and
absence of keratin 10). Moreover, this fraction seems to be enriched
for EpSC because of expression of keratin 19, nuclear presence of
galectin-1 and although this marker is not exclusive for EpSC also for
expression of nucleostemin. The cells migrated from porcine hair
follicles were poorly differentiated and specifically express galectin-1
or galectin-1-binding sites in their nuclei in colocalization with
ΔNp63α. Exclusion of feeder cells from the culture system allowed
formation of spheroids (from 30-100 cells each, 3-4 bodies per
follicle) freely floating in medium. No similar spheroids were
observed if experiment was performed with interfollicular epidermis.
Using this knowledge, the porcine skin was used as animal model of
wound healing. Quantitative mRNA and immunocytochemistry
demonstrated that wound healing and reepithelisation has an influence
on the level of expression of galectins and their binding sites in
epidermal cells and in the dermis. Progression of the healing process
of damaged skin is associated with a dramatic upregulation of
galectin-1 expression in the dermis and induction of galectin-1
expression in the epidermal cells. Galectin-1 expression is not
correlated with the proliferative status of keratinocytes in healing
epidermis as both Ki67-positive and Ki67-negative cells exhibited the
galectin-1. Our results clearly demonstrate that the healing process
significantly influences the expression of galectins in the wounded
epidermis and dermis.
The most prominent observation was the induction of galectin-1
expression in wounded epidermis and significant upregulation of this
galectin expression in the dermis during the healing.
WS15-4
The perspectives of transgenic pigs for
xenotransplantation
Petersen, B*; Kues, WA.; Carnwath, JW.; Niemann, H
Biotechnology Institute for Animal Breeding, Germany
The acute shortage of donated human organs for transplantation
continues to be a life threatening problem for patients suffering from
organ failure. Alternatives to the use of human organs for
transplantation must be developed and these alternatives include stem
cell therapy, artificial organs and supply with organs from other
species, i.e. xenografts. A number of reasons favour the pig as the
preferred species as organ donor, incl. the physiological similarity
with humans, the ability to keep pigs under strict hygienic conditions
and the availability of established techniques for modifying the
porcine genome The use of porcine organs in human
xenotransplantation requires to make a series of precise genetic
modifications in the porcine genome, incl. the addition of genes for

16 t h International Congress on Animal Reproduction
24 Workshop Abstracts
factors which suppress the rejection of transplanted porcine tissues
and the inactivation or removal of undesirable genes critically
involved in the immunogenic response. This is now possible via
somatic nuclear transfer using donor cells with targeted genetic
modifications. As a first important step towards the production of
suitable porcine donor organs the alpha 1,3 Galactosyltransferase
(α1,3GalT) gene that encodes an important immunogenic epitope has
been knocked out in pigs by a homologous recombination in primary
cell cultures and their use in somatic cell nuclear transfer. The Galepitopes
are the major antigen causing hyperacute rejection of
transplanted pig organs. The transplantation of α1,3GalT-Ko porcine
kidneys and hearts into baboons gave encouraging results, leading to a
significant increase in organ survival, up to 179 days for the heart and
up to 83 days for the kidney without any signs of hyperacute rejection.
However, even with massive immunosuppressive treatment, the acute
vascular rejection and cellular rejection remain major obstacles for
long term survival of a porcine xenograft. It is becoming increasingly
clear that a multiple transgene, multiple knockout approach will be
necessary to produce an optimized xenotransplant donor animal. The
technology for either introducing beneficial genes or removing
undesired genes are available, but genetic modification of pigs and
testing the effectiveness of these modifications in a
xenotransplantation setting in nonhuman primates is a very expensive
and time- and labour consuming, interdisciplinary endeavour.
Prolonged survival of transplanted porcine islets into human patients
for up to 260 days demonstrates the potential of xenotransplantation
as a option for successful treatment of organ failure in the near future.
Workshop 16 - Recent Progress in Andrological
Procedures and Evaluations
Moderator: Peter Chenoweth (Australia)
WS16-1
Andrology procedures and standards: A potential weak
link in animal breeding
Chenoweth, P
School of Animal and Veterinary Sciences, Charles Sturt University, Wagga
Wagga, NSW 2678, Australia
Realisation of the full genetic potential of artificial insemination (AI)
requires the timely insemination of cycling, fertile females with an
effective sperm dose (EFD). In turn, the EFD for each species should
equal or exceed a prescribed number of competent sperm. Assurance
that shipped doses consistently contain an EFD is of great importance
for AI centres and their clients. Such assurance can be provided by
rigorous application of good andrological procedures at the AI centre,
as well as via 3 rd party monitoring by an andrology laboratory (AL).
The assessments conducted by the AL should be both accurate and
precise, reflect relevant “gold standards” for each trait, and be
conducted using good laboratory practices (GLP). Current gold
standards are; sperm motility – CASA; sperm concentration -
haemocytometer and sperm morphology – DIC microscopy (1000X
plus). Determination of the accuracy and precision of each procedure
is also important. Historically, laboratories have used statistical
estimates such as correlation coefficients, coefficients of variation and
regression analyses to provide such information, even though each has
its deficiencies. Data will be provided to illustrate current practices
and results, using the swine and cattle AI industries as examples. The
conclusion is that greater attention can be given to quality assurance
in the AI industries, and this should include improved training,
continuing education and monitoring by a competent 3 rd party
laboratory which has the confidence of the AI industry.
WS16-2
Standardization and product monitoring services in the
animal Andrology laboratory
Althouse, GC
Department of Clinical Studies – New Bolton Center, School of Veterinary
Medicine, University of Pennsylvania, USA
The purpose of a dedicated stud is to manage a continuous flow group
of male animals, and from these animals collect, screen and process
semen. This extended semen product is then distributed to customers
for use in their breeding program. In its simplest form, the stud
contributes 50% of the input into that customer’s reproductive
performance outcome. Consequently, if herd reproductive
performance outcomes come into question, as an external, major
contributor, the stud’s product is frequently one of the first areas to be
examined. This is due, in part, to practicality as the stud’s single
system input (e.g., extended semen doses) is simple to objectively
quantify and compare to contractual expectations. Therefore, given
the influence a stud’s product has on a production system and the ease
in verifying its quality, implementation of a total quality management
program which includes the extended semen product is prudent to
customer satisfaction.
A non-biased, third party is ideal for providing this end product (e.g.,
extended semen dose) monitoring. Although slight variations may
exist between species, in general, basic components in an audit of
extended semen doses includes: dose volume, sample sperm motility,
differential sperm morphology (including acrosomes), sperm
concentration and sperm per dose. From an interpretative standpoint,
information regarding handling and arrival temperature of doses, and
the presence and degree of sample agglutination are of value. In
addition to its monitoring value for dose quality, an appreciation for
stud hygiene and sanitation can be obtained through the screening of
doses for microbial contamination.
Because of the intended use of these data, all analyses performed
should be objective and quantifiable using validated referenced
techniques. Demand is growing amongst the various animal
industries that more uniformity and standardization be applied to
external semen analysis diagnostic services. Veterinary laboratories
which currently provide such services should make efforts to agree
upon protocols and techniques for semen analyses which are
scientifically validated and mutually recognized. Additionally,
consistency in the reporting of results by the laboratories could greatly
aid veterinarians and producers in assessment and interpretation of
results. An example of such a system will be discussed.
WS16-3
Flow cytometry in veterinary andrology: detecting sublethal
damage in spermatozoa
Pena, FJ
Department of Animal Medicine, University of Extremadura, Spain
Thanks to the increasing use of flow cytometry in research in
veterinary spermatology, many new membrane integrity assays have
been developed over the past decade. These assays are important
because of their superior ability to forecast fertility when compared
with other tests, such as sperm motility. This major component of the
sperm quality assessment has generated new investigations with the
aim of developing tests that can detect membrane damage in a very
early state. Using phospholipid transposition tests, early changes in
membrane permeability and fluidity can be assessed in a large number
of spermatozoa using fluorescent probes in combination with flow
cytometry. The kinematics of the apparition of apoptotic markers has
been studied flow cytometrically in equine spermatozoa subjected to
freezing and thawing in our laboratory. Caspase activity, low
mitochondrial membrane potential and increases in sperm membrane
permeability were observed in all the phases of the cryopreservation
procedure. Freezing and thawing caused an increase in membrane
permeability, and changes in the pattern of caspase activity; while
decreases in mitochondrial membrane potential were observed after
centrifugation and cooling to 4ºC and after freezing and thawing. It is
proposed that the sperm mitochondria may be directly involved in the
subtle damage that is present in most of the spermatozoa surviving
freezing and thawing.

16 t h International Congress on Animal Reproduction
Workshop Abstracts 25
Workshop 17 - Equine Endometritis
Moderator: Terttu Katila (Finland)
WS17-1
Uterine response to insemination in mares
Reilas, T
Department of Equine Research, MTT Agrifood Research, Finland
Breeding causes an acute endometrial inflammation characterised by
increased vascular permeability, exudation of fluids and leukocyte
migration into the uterine lumen. In reproductively normal mares, the
first polymorphonuclear neutrophils (PMNs) enter the uterine lumen
within 1 h after artificial insemination (AI), the highest numbers are
found around 8 h and at 48 h there are very few, if any PMNs left.
This protective process elicited predominantly by spermatozoa may
develop into persistent mating-induced endometritis (PMIE) if uterine
drainage mechanisms fail to remove excess spermatozoa, bacteria and
debris. In addition to predisposing factors for endometritis, the
composition and volume of the inseminate influence the kinetics of
endometrial inflammation. Insemination with small volumes of highly
concentrated frozen semen has been shown to provoke a greater
neutrophil response 6 h after AI than insemination with larger
volumes of less concentrated semen or infusion of extender. The
difference between frozen semen and extender is no longer visible at
96 h post-infusion. In studies where the volume has been constant (20
or 40 ml), higher sperm concentrations have resulted in higher
numbers of PMNs 2 h after AI, and lower numbers of PMNs 48 h
after AI. Unlike spermatozoa, seminal plasma has been shown to
suppress PMN chemotaxis in vitro. However, equine seminal plasma
increases the intensity of uterine inflammation in vivo. The increased
early inflammatory response may explain the reduced duration of
inflammation seen in another study when seminal plasma was present
in the inseminate. A strong inflammatory response to frozen semen
deposition has worried practitioners. However, it is not known to what
extent the beginning programs the end. More research is needed to
find out if down-regulation of the early stages of inflammation
benefits fertility. Bacteria propably play an important role in the
pathogenesis of PMIE. Mares, that had histopathological changes in
the endometrium, or were unable to clear intrauterine bacterial
inoculations within 96 h, were shown to have similar PMN numbers
as normal mares 24 or 96 h after AI with frozen semen. Many mares
suffering from PMIE have a delay in uterine clearance because of
diminished myometrial contractility. It is well-known that myometrial
contractions are required for resolution of inflammation. It has been
shown that treatment with oxytocin facilitates clearance of
intrauterine fluid and in doing so, also shortens the duration of
inflammation and improves pregnancy rates.
WS17-2
Equine endometrosis – an own entity or just a result of
chronic endometritis
Ellenberger, C 1 *; Mattos, RC 2 ; Schoon, HA 1
1Faculty of Veterinary Medicine, Institute of Pathology, University of Leipzig,
Germany; 2 REPROLAB, Departamento de Medicina Animal, Brazil
Equine endometrosis is the most important clinical chronic
endometrial disease associated with infertility in mares. It cannot be
discovered by conventional clinical examinations, whereas the
histopathological investigation of an endometrial biopsy specimen has
proven to be of high value. The term endometrosis describes a
periglandular and/or stromal endometrial fibrosis including glandular
alterations within fibrotic foci. The frequency and the degree of
endometrosis increases with the age of the mares, however there is no
correlation to the number of previous foalings.
For a detailed immunohistochemical (oestrogen and progesterone
receptors, endometrial secretory proteins) characterization of equine
endometrosis, 509 endometrial biopsies were selected from routine
submissions. Additionally, 200 biopsies from 20 mares with 5
consecutive experimentally induced bacterial (1 x 10 9 S. equi subsp.
zooepidemicus) endometritis and subsequent treatments with at least a
14-day interval were collected over a 2-year period to investigate the
potential effects of endometritis on the progress of endometrosis. One
day before and 5 days after each experimental infection, an
endometrial biopsy was taken from all mares.
Immunohistochemically, the endometrotic glands showed a cycleasynchronous
staining for oestrogen and progesterone receptors when
compared to non-affected healthy glands. These findings indicate that
affected areas become independent of the uterine control mechanisms
and exhibit own differentiation dynamics. Furthermore, there are
apparent deviations in the secretory protein expression patterns in
fibrotic areas. In 73% of the biopsies taken 5 days post infection of
mares with repeatedly experimentally induced endometritis an
exudative (30.1%), non-purulent (42.5%) or eosinophilic (27.4%)
inflammation was detectable. Half of these mares showed a temporary
metabolic activation of the endometrosis; however the degree of the
endometrosis had not changed over the 2-year period of the
experiment.
The findings indicate that an aberrant secretion of endometrial
proteins may be one disturbing factor in the intrauterine
microenvironment that contributes to the pathogenesis of
endometrosis induced fertility problems. Repeatedly induced
endometritis has no remarkable influence on the progress of
endometrosis. Therefore, endometrosis describes a degenerative
endometrial alteration independent of endometritis. Although
profibrotic effects of endometritis were demonstrated, the initial
reason of this disease still remains unclear.
WS17-3
Development of endometrial fibrosis in the mare
Oddsdottir, C*, Björnsdóttir, S, Riley, SC, Watson, ED
Division of Veterinary Clinical Studies, University of Edinburgh, Iceland
Endometrial fibrosis in the mare is an important cause of infertility.
The condition is characterised by an abnormal deposition of collagen
with advancing age. The fibrosis reduces the efficacy of uterine
defence mechanisms and the uterine capacity for foetal nutrition.
Organ fibrosis has been extensively researched, and found to be a
result of ongoing, altered tissue repair. Normally, the repair
mechanism is a self-limiting process involving collagen deposition
and degradation, resulting in reconstitution of tissue structure. Repair
occurring as a consequence of chronic tissue destruction will go on as
long as there is tissue injury, and eventually results in the
accumulation of excess collagen. This happens due to the deposition
of collagen without final scar resolution, and can be seen in chronic
inflammation of the liver, lung and kidney. Matrix metalloproteinases
(MMPs) are important enzymes capable of collagen remodelling.
Different individuals tend to develop varying degrees of fibrosis
when exposed to a similar stimulus, and certain genes carry a
predisposition to fibrosis. Furthermore, liver fibrosis can be halted
and even reversed to some extent.
Great individual variation is also seen in the severity of endometrial
fibrosis in mares, as well as the age of onset, which could indicate a
genetic predisposition similar to what is seen in other organs. No
treatment or preventative measures are known for the condition and
therefore a better knowledge of the pathogenesis is desirable. As in
other organs, it is likely that tissue injury instigates the deposition of
collagen in the endometrium, possibly due to the altered expression of
MMPs. In a study on uterine secretions and endometrial biopsies
from 49 mares, the relationship between endometrial collagen density
and various factors hypothesised to influence the deposition of
collagen was investigated. The activity of MMPs and their inhibitors
was not shown to correlate with collagen density in the endometrium,
possibly due to the absence of active collagen remodelling at the time
of sampling. A statistically significant positive relationship was
found between collagen density and an increase in inbreeding
coefficient. The results indicate that a genetic factor predisposes
individual mares to developing endometrial fibrosis with more
severity and at an earlier age than others.

16 t h International Congress on Animal Reproduction
26 Workshop Abstracts
Workshop 18 - Pregnancy, fetal well-being and the periparturient
dam
Moderator: Marcel A. M. Taverne (The Netherlands)
WS18-1
Assessment of fetal well-being during bovine and equine
gestations resulting from in vivo and in vitro produced
embryos
Chavatte-Palmer, P
INRA, UMR 1198; ENVA; CNRS, FRE 2857, Biologie du Développement et
Reproduction, Jouy en Josas, F-78350, France
Pregnant dams need to be monitored in order to precociously diagnose
any pathological process and start treatment. Pregnancies established
after natural breeding or artificial insemination may not require
specific monitoring if the dam is reproductively sound and in absence
of maternal pathology (i.e. colics in horses). In contrast, in vitro
produced embryos, and particularly cloned embryos, have been
associated with severe placental abnormalities and fetal losses,
requiring regular assessment of the health of both the recipient and the
fetus.
In terms of imaging technologies, rectal and transabdominal
ultrasound scanning have been used for a long time in the horse to
assess fetal growth and activity and evaluate placental health (mainly
through the measurement of the utero-placental thickness) throughout
pregnancy. Transabdominal ultrasound has also been used
successfully in cattle to diagnose the Large Offspring Syndrome
(increased fetal size, placental edema, abnormal placentome
structures) before clinical signs are prominent and maternal welfare is
affected. Transrectal doppler sonography of the uterine artery can also
be performed to evaluate uterine blood flow both in the mare and the
cow and will provide helpful information on placental perfusion.
More recently developed methods, like 3D Doppler scanning, are
being evaluated for visualizing the placenta in ruminants, but the use
of Magnetic Resonance Imaging is precluded both because of the
price and the size of the animals. Ultrasound guided amniocentesis
and allantoidocentesis have been performed both in cattle and horses
but remain so far too risky for routine use, especially if repeated. It
would be worth, however, developing safe procedures to be used in
practice as this is a simple technique providing potentially very useful
clinical information. Finally, placental biopsies can be performed in
cattle but may not provide significant information on fetal well-being.
Most useful maternal blood markers for fetal well-being include
estrone sulfate and progestagens in the horse. In cattle, the maternal
plasma concentration of placental Pregnancy Associated
Glycoproteins (PAG) is routinely used for pregnancy diagnosis but
may also be helpful in detecting animals likely to develop the Large
Offspring Syndrome. Finally, the diagnostic and prognostic interest of
other molecules, such has the acute phase protein Serum Amyloid A
(SAA) must yet be explored.
WS18-2
Monitoring of the bovine fetus during and shortly after
birth
Bleul, U
Department of Food Animals, Clinic of Reproductive Medicine, Switzerland
Approximately 3% of all bovine fetuses die during or shortly after
birth. In the majority of cases the reason for this peripartal mortality is
dystocia. This bears the risk of fetal damage caused by hypoxia,
hypercapnia and acidosis. In the field methods for monitoring the
well-being of the fetus during parturition are almost lacking. The
evaluation of vitality is based mainly on reflexes, meconium staining
of the fetus and the amniotic fluid or the detection of a heart beat in
the fetus, but they do not allow an accurate estimate of fetal acidosis.
In the last years new methods were described which may help to
recognize fetal distress.
In human medicine, cardiotocography measurement is the standard
procedure for fetal monitoring intrapartum and has been evaluated in
experimental studies with bovine fetuses. Cardiotocography measures
the fetal heart beat and the intrauterine pressure continuously and the
fetal heart rate correlates well with the neonatal outcome.
Further methods were recently described, which measure the fetal
oxygen saturation or blood gas parameters. Oxygen saturation was
measured using pulsoximetry by placing an oxygen sensor in the
mouth against the mucosa of the hard palate of the fetus. Although
postnatal acidosis can be predicted by continuously measuring the
oxygen saturation of the fetus intrapartum, technical modifications are
required to improve its usefulness. In experimental studies, bovine
fetal blood has been collected transvaginally from the umbilical
vessels, by centesis or catheterization of the carpal or digital veins.
Capillary blood has been collected from the dorsolateral aspect of the
distal pastern when the calf’s forelimbs protrude from the vulva.
Blood gas values during stage II labor were suitable in order to
diagnose fetal asphyxia and selected parameters showed high
correlations with the level of postnatal acidosis.
Determination of blood gas values of venous blood is an established
method for detecting the metabolic component of the mixed
metabolic-respiratory acidosis in calves immediately after birth.
Because the respiratory component of acidosis is difficult to
determine with venous blood, collecting arterial blood is a more
reliable method for evaluating pulmonary function by determination
of the partial pressure of carbon dioxide and oxygen of arterial blood.
Various methods of monitoring the calf during and after birth have
been established which may reduce fetal mortality by indicating the
right time for an obstetrical intervention, or the necessity of a
therapeutic intervention in the newborn calf.
WS18-3
The sow and her piglets during the farrowing process
Van Dijk, J
Faculty of Veterinary Medicine, Utrecht University, The Netherlands
Perinatal asphyxia is an important cause of perinatal mortality and
reduced viability and vitality of newborn piglets. The occurrence of
perinatal asphyxia is clearly associated with the farrowing process.
Consequently, several factors affecting the duration of the expulsive
stage of farrowing (DF) have been identified. Whereas the effect of
parity is controversial, breed significantly affects DF and in this
respect the Meishan holds a rather unique position as the number of
stillbirths is not related to DF. Furthermore, a decreased gestational
length and increased number of liveborn and / or stillborn piglets
result, independently of each other, in a significant increased DF. To
lower the risk for perinatal asphyxia at birth, attempts have been made
to reduce the DF by administration of oxytocin. However, despite a
reduction of DF, increasing numbers of intrapartum stillbirths with
ruptured umbilical cords and severe meconium staining at birth are
observed. Regarding factors affecting individual birth intervals
between piglets (BI), it has been shown that higher birth weights,
posteriorly presented piglets and stillborn piglets are associated with
increased BI. Besides, a curvilinear relationship exists between rank
(relative position in the birth order) and individual birth intervals and
breed significantly affects this relationship. Several of the factors
affecting BI are also shown to affect acid-base balance values in
umbilical artery blood samples of liveborn piglets at birth. Piglets
born with ruptured umbilical cords show significantly lower pH
values and a tendency for higher pCO2 values at birth. Interestingly,
decreased birth weights are associated with a slightly more severe
metabolic acidosis at birth. Furthermore, posterior presentation at
birth, increasing cumulative birth intervals and an increasing rank
result in a more pronounced mixed respiratory-metabolic acidosis at
birth. The degree of acidosis that gradually develops during the
expulsive stage of farrowing is not as severe as observed in newborn,
highly asphyxiated piglets at birth. Consequently, it has been stated
that traction, occlusion or rupture of the umbilical cord is an
inevitable factor in the evolvement of birth asphyxia and concomitant
mortality and reduced viability at birth. However, a model of
umbilical cord clamping (average duration of cord clamping: 7
minutes) in late pregnant sows suggests an additional role of
cumulative uterine contractions, occurring during the expulsive stage
of farrowing, in the evolvement of a more or less severe degree of
birth asphyxia.

16 t h International Congress on Animal Reproduction
Poster Reviewers 27
POSTER REVIEWERS
Local Organising Committee wishes to express its sincere gratitude
to all poster abstracts reviewers for their willingness
to act as poster abstract reviewer during the poster evaluation process.
Csaba BAJCSY
Agnes BALI PAPP
Orsolya BALOGH
Judit BARNA
Szilard BODO
Tamas CSAKI
Sandor CSEH
Andras DINNYES
Istvan EGERSZEGI
Vera FAIGL
Hedvig FEBEL
Ferenc FLINK
Jozsef FOLDI
Gyorgy GABOR
Elen GOCZA
Judit JUHASZ
Gabor KELEMERI
Monika KERESZTES
Fruzsina KISS-TOTH
Andras KOVACS
Karoly MAGYAR
Judit MENYHERT
Miklos MEZES
Peter NAGY
Szabolcs NAGY
Gabriella NOVOTNI DANKO
Anna PECSI
Istvan PENTEK
Zsuzsanna POLGAR
Csaba PRIBENSZKY
Angella PROHACZIK
Jozsef RATKY
Laszlo SOLTI
Zsuzsanna SZOKE
Julianna THUROCZY
Barbara VEGI
Laszlo WEKERLE
Zoltan ZOMBORSZKY
Attila ZSOLNAY

16 t h International Congress on Animal Reproduction
28 Poster Abstracts
POSTER ABSTRACTS
Poster 01 - Bovine Reproduction
P001
New Trends for Estrus Synchronization in Lactating Dairy
Cows
Amer, HA 1 , Abaza, F 2 *
1Department of Theriogenology, Faculty of Veterinary Medicine, Zagazig
University; 2 Department of Military Veterinary Services, Ministry of Defense,
Egypt
This study was conducted to through the light on estrus
synchronization in dairy cows. Four treatments were performed on
sixty Holstein Friesian cows. In treatment 1 (PP), cows received 2
injections of PGF2α on days 0 and 11 (n=14). In treatment 2 (PGP),
cows injected twice PGF2α on days 0 and 11 and 100 ug of GnRH on
day 3 after 1st injection (n=14). In treatment 3 (PGPE-0), cows treated
with PGP and 1 mg of estradiol cypionate (ECP) at same time of 2nd
PGF2α dose (n=16). In treatment 4 (PGPE-1), cows were treated with
PGP and 1 mg ECP one day after 2nd PGF2α injection (n=16). Cows
were examined rectally and ultrasonographically by B-mode System
[Pie-Medical Scanner-240] with a 6-8 MHz linear probe. Every cow
was blood sampled at selected intervals for progesterone and estradiol
assay and inseminated at estrus.
The results showed a higher percentage of GnRH-treated cows (PGP)
ovulated after 1 st PGF2α injection than non treated (PP) cows (64.3%
vs 50%; P

16 t h International Congress on Animal Reproduction
Poster Abstracts 29
hyperimmune serum were produced against Arcanobacterium
pyogenes and E. coli that were isolated in Iranian dairy farms. Cows
in group oxytetracycline (n=39) were treated with one intrauterine
infusion of 5gr oxytetracycline (10%). Cows that did not show any
clinical signs of postpartum endometritis were regarded as healthy
control group (HC, n =91). In group hyperimmunue serum and
oxytetracycline (OTC), all cows were re-examined 39–49 DIM. In
group hyperimmunue serum and OTC, cows were re-treated with
hyperimmunue serum if signs of endometritis were found. Cure rate
after the first treatment, defined as the absence of vaginal discharge at
the re-examinations, was 64.3 % and 61.5% in groups hyperimmunue
Serum and OTC (P > 0.05). Reproductive performance measures
showed no significant differences (P > 0.05) between the two
treatment groups. There was no significant difference (P > 0.05)
Service rate between treatments groups hyperimmunue Serum and
OTC, compared to HC. Conception rates to all services and
percentages of cows pregnant by 180 DIM were 90.48, 86.49 and
92.13 in groups hyperimmunue Serum, OTC and HC, respectively (P
> 0.05). In both treatment groups, cure rate and reproductive
performance measures were better for cows categorized E1 or E2,
than for cows categorized E3 but the differences were not significant.
Conception rate to all services for cows with endometritis (category
E1, E2 and E3) was 52.94 in group hyperimmunue Serum and 57.14
in group OTC compared 66.67 in HC (P > 0.05). The results of this
field trial suggest that hyperimmunue serum could be the alternative
no antibiotic treatment of choice for postpartum endometritis in dairy
cattle.
P005
GnRH-induced LH and ovulatory responses in dairy
heifers during diestrus and proestrus
Ambrose, DJ 1 *, Colazo, MG 1 , Bhuwanee, A 2 , Kumpula, B 2 , Lamont, AL 2 ,
Salmon, F 2 , Suddaby, P 2 , Terletski, S 2
1Agriculture Research Division, Alberta Agriculture and Food, Canada;
2Agricultural Food and Nutritional Science, University of Alberta, Canada
The objective was to determine whether pituitary LH response to
GnRH in Holstein heifers differed between diestrous and proestrous
stages of the estrous cycle. Fifteen postpuberal heifers (13 to 14 mo of
age, 404 to 479 kg body weight) were given 25 mg of dinoprost
tromethamine (PGF; Lutalyse, Pfizer Animal Health) im. Estrus
detection was done twice daily for 4 d after PGF treatment and
ovulation (Day 0) confirmed by ultrasonography. On Day (Mean ±
SE) 8.5 ± 0.6 after ovulation, 100 µg of gonadorelin acetate (GnRH;
Fertiline, Vetoquinol Canada Inc.) was given im to all heifers
(Diestrous stage treatment). Blood samples (n=15/heifer; from 15 min
before to 8 h after GnRH) were collected and plasma analyzed for LH
concentration. One blood sample taken prior to GnRH was analyzed
for progesterone. Ovulation was determined by ultrasonography 48 h
following GnRH treatment and heifers received an intravaginal
progesterone (P4; 1.9 g) insert (CIDR; Pfizer Animal Health) for 7 d,
with PGF administered at CIDR removal. Twenty-four h after CIDR
removal (Day 15.9 ± 0.6), GnRH was given im (Proestrous stage
treatment). Ovulatory response, P4 and LH concentrations were
determined as in Diestrus. Data were analyzed by Proc MIXED,
ANOVA, and Chi-square. Two heifers did not respond to PGF
treatment; both were excluded from the study. Plasma P4
concentration (ng/mL) at GnRH treatment was higher (P < 0.01) in
heifers treated during diestrus (5.7 ± 0.7) than during proestrus (1.0 ±
0.2). The ovulatory response to GnRH treatment was higher during
proestrus than diestrus (P < 0.02; 61.5 vs 15.4%). GnRH-induced LH
peak was lower (P < 0.04; 5.7 ± 0.8 vs 13.6 ± 3.0 ng/mL) and of
shorter duration (P < 0.01; 5.4 ± 0.3 vs 6.8 ± 0.3 h) in heifers treated
during diestrus than during proestrus. Regardless of the stage of the
estrous cycle at treatment, heifers that ovulated after GnRH had a
significantly longer interval from GnRH treatment to LH peak than
those that did not ovulate (P < 0.01; 1.7 ± 0.1 vs 1.0 ± 0.1 h).
However, in heifers treated with GnRH during proestrus, LH
concentrations did not differ (P = 0.60) between those that ovulated
and those that did not. In conclusion, heifers treated with GnRH
during diestrus had lower peak LH concentrations, delayed attainment
of LH peak, shorter duration of elevated LH concentrations, and lower
ovulatory responses than those treated during proestrus.
P006
The Effect of Adding Cholesterol, Vitamin A, Cod Liver or
Flax Oil Loaded Cyclodextrin on Bull Sperm Cryosurvival
Amorim, EAM 1,2 *, Graham, J 2 , Spizziri, B 2 , Meyers, M 2 , Amorim, LS 1,2 , Torres,
CAA 1
1Department of Animal Science, Federal University of Vicosa, Brazil;
2Department of Biomedical Sciences, Colorado State University, USA
Introduction Damage occurring to spermatozoa during
cryopreservation results in a loss of motile cells and cells that are
functionally normal, compared to fresh sperm samples. Treating bull
sperm with cholesterol-loaded cyclodextrins (CLCs) prior to
cryopreservation results in increased sperm cryosurvival, however,
adding cholesterol to bull sperm membranes alters their ability to
capacitate in vitro. This study compared the effect of adding four
compounds, which should incorporate into and increase membrane
fluidity at low temperatures thereby increasing cryosurvival.
Method Twenty-five ejaculates from four bulls were collected using
artificial vagina and extended with Tris, and then sub-divided into 11
treatments: No additive (negative control); 1.5 mg CLC/120 million
sperm (positive control); and 0.75 mg, 1.5 mg and 3.0 mg/120 million
sperm of cyclodextrin pre-loaded with vitamin A or Cod Liver oil or
Flax oil. Methyl-β-cyclodextrin was preloaded with cholesterol as
described by Purdy and Graham (2004). Spermatozoa were incubated
for 15 min at 22 o C. Then, samples were diluted 1:1 (v:v) in Tris with
20% Egg Yolk (EY) and cooled to 5 o C. After dilution 1:1 (v:v) with
Tris containing 10% EY and 16% glycerol, samples were allowed to
equilibrate for 15 min before packaging into 0.5 ml straws, freezing in
static liquid nitrogen vapor (4.5 cm above the liquid nitrogen) for 20
min and plunging into liquid nitrogen for storage. Straws were thawed
in a water bath at 37ºC for 30 sec and the percentages of total motile
in each sample were determined using a computer-assisted sperm
analysis (Hamilton Thorne Motility Analyser).
Results The percentages of motile total sperm cells were maintained
after thawing for bull sperm treated with CLC (45%) compared to all
other treatments (26-41%; P0.05).
Conclusion Therefore, increasing membrane cholesterol levels by
adding CLCs to bull sperm, prior to freezing, is a simple technology
that improved cell cryosurvival, whereas treatments with
cyclodextrins preloaded with other molecules did not.
Acknowledgments Supported by Colorado State University
Experiment Station and CNPq/Brazil.
P007
Bypass fat supplementation in zebu cows (Bos indicus)
in the early postpartum: an alternative to decrease the
open days period
Mesa, C 1 ; Mahecha, L 2 ; Ruiz, ZT 1 ; Gallo, J 3 ; Angulo, J 1,2 *; Olivera-Angel, M 1
1Grupo de Reproducción - Fisiología y Biotecnología, Facultad de Ciencias
Agrarias, Universidad de Antioquia, Colombia; 2 Grupo Grica, Facultad de
Ciencias Agrarias, Universidad de Antioquia, Colombia; 3 Soluciones
Nutricionales S.A., Medellín, Colombia
Introduction Traditional beef cattle production in tropical South
America is extensive and based primarily on Bos indicus cattle and its
crosses. This productive system involves the permanent contact of the
cow with its calf, feeding with low nutritional value grass and the
highly seasonal supply of forage. These characteristics are the main
causes of postpartum anoestrus and the long calving to conception
period (open days). Nowadays, there are some management strategies
which help to decrease the postpartum anoestrus and the open days.
The use of bypass fat in order to increase the energetic contribution of
the diet, and the restricted suckling practices, are some of them.
However, these practices are usually used in a separated way. The
objective of this study was to evaluate the effect of mixing a temporal

16 t h International Congress on Animal Reproduction
30 Poster Abstracts
suckling restriction (TSR) practice with bypass fat supplementation
(BFS) on the duration of the open days, and on pregnancy at day 100
days in a commercial beef cattle production in Colombia.
Materials and methods 32 commercial zebu cows were used and
three groups were designed: group I control (n=10) cow and calf in
permanent contact, group II TSR (n=10) cows with a mean of 65.7
days postpartum and TSR during 72 hours with heat detection, group
III TSR + BFS (n=12), cows supplemented from the 32 postpartum
day with BFS and TSR of 72 hours in 62 postpartum day with heat
detection. A chi-square test was realized to establish association
between the different groups and pregnancy at day 100 of the
experiment and a Kruskall-Wallis test was realized to establish
differences between the groups in the open days number. These
analyses were performed using SAS ver 8.0.
Results Although there was no association between the different
groups and pregnancy at day 100 of the experiment (X 2 = 4.097, P-
value = 0.1289), we found a tendency in the proportion of pregnant
cows in group II TSR and group III TSR + BFS. Besides, we found
statistical significative differences between the groups in the open
days number (Kruskall-Wallis test, test value = 8,70259, p-value =
0,0128901). In the group III TSR + BFS we found less open days
(83.3) followed by group II TSR (97.1) and group I control (136.3)
respectively.
Conclusions We recommend the use of bypass fat supplementation
with temporal suckling restriction as an alternative to decrease the
open days period in Colombian beef cattle production.
P008
Color-Doppler ultrasonography: a non-invasive method to
assess luteolysis in cattle
Araujo, RR 1,2 *, Ginther, OJ 1 , Ferreira, JC 3 , Siqueira, LGB 4 , Beg, MA 1 ,
Wiltbank, MC 5
1Pathobiological Sciences, University of Wisconsin - Madison, United States;
2Dairy Science, University of Wisconsin - Madison, United States; 3 Eutheria
Foundation - Cross Plains - Wi, United States; 4 Wcvm - Lacs, University of
Saskatchewan, United States; 5 Dairy Science, University of Wisconsin -
Madison, United States
Many studies have shown the relationship of corpus luteum (CL)
echotexture with functional status using B-mode ultrasonography.
Recently, Doppler ultrasonography was introduced as an additional
method for evaluating the structural and functional attributes of the
CL. Two ultrasound technologies (B-mode and Color-Doppler) were
used for comparing CL morphology with systemic progesterone
concentrations. Holstein heifers (n=14) were scanned using a duplex
B-mode and pulsed-wave color-Doppler ultrasound instrument (Aloka
SSD 3500; Aloka America, Wallingford, CT) equipped with a lineararray
7.5 MHz transducer. The scanning was performed daily starting
9 days after ovulation until the next ovulation. Real-time B-
mode/color-Doppler images of the continuous scans were recorded
with an online digital videotaping system. During each scanning,
percentage of CL area with color-Doppler signals for blood flow was
estimated. Blood samples were collected once a day for plasma
progesterone assay. Computer-assisted analyses of B-mode images for
mean pixel value, based on gray scale (0=black to 255=white), were
performed using a custom-developed software. Luteal blood flow,
mean pixel value and plasma progesterone were analyzed by SAS
MIXED procedure with a REPEATED measures statement and
differences among days were determined by paired t-tests. Pearson’s
correlation coefficients were calculated between luteal blood flow,
mean pixel value, and plasma progesterone. Data were normalized to
the examination in each heifer when the decreasing plasma
progesterone concentrations reached

16 t h International Congress on Animal Reproduction
Poster Abstracts 31
PGF2α[PG]-56h-GnRH[G2]-18h-AI). Ovsynch+FSH cows received
20 mg of FSH at time of PG. Ovarian ultrasound was performed at
G1, PG, G2 and 6d after G2. Blood samples were collected at G1, PG,
G2 and 13d after G2 to determine circulating P4 and/or E2. Luteolysis
was defined as P4

16 t h International Congress on Animal Reproduction
32 Poster Abstracts
Nelore cows were subjected to calf removal for 48 h and divided into
2 groups: GPE/eCG group (n=10) and GPG/eCG group (n=10). At
random stages of the estrous cycle (D-8) animals of the GPE/eCG
group were treated with a GnRH agonist (50 μg lecirelin, i.m.). Seven
days later (D-1) they received 400 IU eCG, immediately after PGF 2 α
treatment (250 μg d-cloprostenol, i.m.), and on Day 0 (D0), 1.0 mg
estradiol benzoate (EB). Cows of the GPG/eCG group were similarly
treated as those of the GPE/eCG group, except that EB was replaced
with a second dose of GnRH. Ovarian ultrasonography was performed
and blood samples were collected on days of hormone administration,
to allow retrospective discrimination of cows based on the presence or
absence of P4 priming, prior to induced ovulation. All animals were
challenged with oxytocin (OT, 50 IU; i.v.) 6, 9, 12, 15 and 18 d after
EB (GPE/eCG group) or GnRH (GPG/eCG group) administration and
blood samples were collected before and 30 min after OT. Frequency
distribution of animals, which underwent luteolysis before D18 was
analyzed by the chi-squared test. ANOVA was used to estimate the
effect of treatment, P4 priming and interactions for discrete variables.
Split-plot ANOVA was used to estimate treatment effect, P4 priming,
day of the estrous cycle and interactions for continuous variables. The
mean P4 plasma concentration during synchronization was higher
(p

16 t h International Congress on Animal Reproduction
Poster Abstracts 33
straws. Three hundred Nelore heifers were separated into 5 groups of
60 animals. For artificial insemination, the straws were thawed at
35°C for 20 sec and the females in each group were inseminated with
semen of the same bull, using 30 female for each semen extender
treatment. For in vitro fertilization, oocytes with homogeneous
cytoplasm and compact cumulus, collected from ovaries of
slaughtered cows were selected and maturated in groups of 25 in
droplets of 100µl TCM 199 medium with FCS, FSH, hCG and
estradiol, sodium pyruvate and amicacin, for 24 hours, under mineral
oil, in atmosphere of 5% CO 2 and 95% humidity in air, at 38.5ºC.
After maturation, the oocytes were placed in droplets with TALP
containing BSA, PHE and 10µg/ml of heparin with 1x 10 6 motile
spermatozoa/ml. Four straws (two – CE and two – AE) from same
bull and ejaculate were thawed and each straw was processed for one
spermatozoa separation method for pellet recover: washing medium
or Percoll gradient. After 22 - 24 hours, zygotes were stripped from
cumulus cells and cultivated in droplets of SOF medium
supplemented with 2.5% FCS and 0.5% BSA in 5% CO 2 and 95%
humidity in air, at 38.5ºC, for 9 days.
The results were analyzed by Qui-square Test, in contingency table,
with significance level of 5%. The pregnancy rates differed between
bulls (P

16 t h International Congress on Animal Reproduction
34 Poster Abstracts
purpose cows. An important observation was the presence of vagina
infection on the sponge treatment group. In conclusion, the use of
progesterone devices can improve overall conception rate in double
purpose herd. Therefore, the timed AI protocols can be used as tool
for reproductive management in tropical farms.
P020
The effect of high levels of proximal cytoplasmic droplets
on sperm functional competence.
Carreira, J 1 *; Koivisto, M 1 ; Mingoti, G 1 ; Leite, J 1 ; Perri, S 1 ; Rodrigues, L 2
1São Paulo State University, Araçatuba, Brazil; 2 Lagoa da Serra Artificial
Insemination Centre, Sertãozinho, Brazil
Introduction Semen conventional analysis may not adequately
represent the diverse number of biological properties that this highspecialized
cell can express (Hum. Repr.18:1023-1028,2003). The use
of more objective techniques, such as fluorescent probes to assess the
integrity of membranes and mitochondrial function of the sperm may
provide data on the occurrence of cryoinjuries (Acta Sci.Vet.33:327-
327, 2005). Frozen-thawed ejaculates with high levels of proximal
cytoplasmic droplets (PCD) produces low fertility rates
(J.Repr.Fert.51:109-116, 1997). The goal of this study was to evaluate
plasma membrane integrity (PL), acrossome status (ACR) and
mitocondrial function (MIT) of bovine semen with high levels of PCD
after cryopreservation, comparing to samples with normal parameters.
Methods Three batches of five (control group G1: with ≤ 15% of total
defects) and eight Bos indicus bulls (G2: ≥15% PCD) were analyzed.
The following tests were carried out: post thaw motility (MOT), vigor
(VI), concentration (CO) and morphology. The samples were
centrifuged (750rpm/ 5 min) twice with 500μL of TALP-Semen. CO
was adjusted to 25x10 6 sptz/mL. To an 30μL aliquot, 2μL of PI
(0,2mg/mL), 1,6 μL of JC-1 (0,5mg/mL) and 10 μL FITC-PSA
(100μg/mL) was added, after incubation at 38.5°C/8 min, 8μL was
evaluated by epifluorescent microscopy. Data were analyzed with
ANOVA. Results MOT, VI and CO were nor significant in both
groups (MOT: 45.42 vs 40.31; VI: 4.47 vs 4.03; CO: 29.18 vs 31.23
x10 6 sptz/mL for G1 and G2, respectively). The percentage of PCD
(G1= 0.51%; G2=24.35%), major defects (4.98% G1; 38.9% G2), and
total defects (G1 10.32%; G2 48.38%) were significantly higher in G1
when compared to G2. Minor defects were not different between
groups (G1= 5.38%; G2= 9.48%). G1 had significant higher results
for ACR (38.48% vs 29.70% G2), PL (38.16% vs 21.39%) and also
MIT (41.90% vs 23.22%) for G1 and G2, respectively. Conclusion
The results indicate that semen with high levels of PCD may be
functionally deficient and more susceptible to cryoinjuries as show the
lower levels of acrossome, membrane integrity and mitochondrial
potential.
P021
Evaluation of slow-release parenteral natural
progesterone and its effects in a modified Ovsynch
protocol in Holstein dairy heifers
Cavestany, D 1,2 *; Sanchez, A 3 ; Fernandez, D 3 ; Salazar, E 3 ; Leyton, L 4 Crespi,
D 2 , Meikle, A 5
1National Institute of Agricultural Research (INIA) Uruguay; 2 Department of
Reproduction, Veterinary Faculty, Uruguay; 3 Private veterinarians, Uruguay;
4Faculty of Agronomy, University of El Salvador, San Salvador; 5 Laboratory of
Nuclear Techniques, Faculty of Veterinary, Uruguay
The efficiency of the ovulation synchronisation (Ovsynch/TAI
protocol) can be improved by progesterone (P4) supplementation and
this increases the ovulation synchrony and pregnancy rate. The most
common P4 sources are intra-vaginal devices impregnated by natural
P4 and/or oral progestagens. In this experiment a slow-release
parenteral natural P4 was tested in the above-mentioned protocol.
Three trials were conducted. In trial 1, three multiparous milking
Holstein-Friesian (HF) cows (511±28 kg) and 3 HF heifers (372±21
kg) received three prostaglandin (PG) treatments at weekly intervals,
after which they received 400 mg of progesterone (4-pregnano-3.20-
dione) (Laboratory Rio de Janeiro, Santa Fé, Argentina)
subcutaneously and were bled frequently for 5 days to check plasma
P4 levels. Peak P4 levels were achieved 4 hours post treatment
(10.2±0.8 & 6.2±0.7 ng/mL, P0.1) for cows and heifers. In
trial 2, one-hundred-eleven heifers (374±4 kg) were allocated into 2
groups (control: Ovsych and treatment: Ovsynch + 400 mg P4 SC at
the time of the GnRH treatment). Oestrus detection was done from
day 5, and heifers in heat were inseminated. While synchrony of
ovulations improved in the treated group, 78% vs. 52% (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 35
0.06) for being higher than those of treated recipients without aCL
(6.8 ± 0.8 ng/ml, respectively).
In conclusion, luteal hCG treatment enhanced the survival of lowviability
embryos (half-embryos) in low endogenous P4
concentrations recipients (high-yielding lactating dairy cows). This
effect was associated to the increased plasma P4 concentrations in
recipients with induced aCL.
Acknowledgements – This experiment was funded by the grant CIISA
48 Embrio-ovárica.
P023
A successful estrus synchronization method
(Doublesynch) for timed artificial insemination in
anestrous dairy cows
Öztürk, ÖA; Cirit, Ü*; Baran, A; Ak, K
Department of Reproduction and Artificial Insemination, Faculty of Veterinary
Medicine, Istanbul University, 34320 Avcilar, Istanbul, Turkey
Recently, Cirit et al. (2007) have developed a new synchronization
method (Doublesynch) by injecting an additional PGF 2α two d before
the Ovsynch protocol. Doublesynch program increased pregnancy
rates 22.2 percentage units (50.0% vs. 72.2%), however, statistical
significance (P

16 t h International Congress on Animal Reproduction
36 Poster Abstracts
cows were given a CIDR for 10 d and 500 μg cloprostenol (PGF;
Estrumate, Schering-Plough Animal Health) at CIDR removal. Estrus
detection (Estrus=D0) was done 3x/d for 5 d after CIDR removal. On
D7-8, cows received 2 PGF treatments (12 h apart) and randomly
assigned to receive 100 μg GnRH at 36 (Control; n=6), 36 and 38
(n=7) or 36 and 40 h (n=7) after first PGF. Ovulation was determined
by ultrasonography. Blood samples (n=15/animal) were collected and
plasma analyzed for LH as in Expt 1. Blood samples were also
collected every second d from ovulation until 14 d after for plasma P4
concentrations. Data were analyzed using Proc MIXED and Kruskal-
Wallis test. In Expt 1, mean (± SE) LH (ng/mL) concentration was
affected by treatment (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 37
Botu-Bov extenders. Eighteen ejaculates of bulls from Alta Genetics –
Brazil were divided in two fractions and each one was frozen either
with Andromed (Minitub) or Botu-Bov (Biotech Botucatu) extenders,
according to the manufacturer recommendation. Andromed: initial
dilution 1:1 (v:v), 10 minutes at 37 o C, dilution again until final
concentration, maintenance for 1 hour at 18 o C, packing in 0.25mL
straws, stabilizing at 5 o C for 4 hours and freezing in the machine in a
curve of -30 o C/minute. Botu-Bov: total dilution at room temperature,
packing in 0.25mL straws, stabilizing for 4 hours at 5 o C and freezing
by the same method. Straws were thawed at 37 o C for 30 second in
water bath, then maintained in dry block at 37 o C for 4 hours. Motility
characteristics were evaluated at 10 minutes and 4 hours after thawing
by CASA (IVOS 12). Integrity of plasma and acrosomal membranes
was evaluated 10 minutes after thawing by epifluorescence with
Propidium Iodide, FITC-PSA and JC1. At 10 minutes after thawing,
Botu-Bov extender was statistically superior (P0.05) between extenders in progressive motility and
acrosomal integrity at this moment. At 4 hours after thawing, there
were no differences (P>0.05) in total motility (57 vs 64%),
progressive motility (25 vs 30%) and linearity (67 vs 75%) between
Botu-Bov and Andromed, respectively, except for straightness (42 vs
50%, P

16 t h International Congress on Animal Reproduction
38 Poster Abstracts
based on the utilization of an intravaginal device with progesterone
(DEV), upon the pregnancy at first service, returns to service and final
pregnancy (first service and returns). One hundred and fifty one cows
were used, Aberdeen Angus with calves, 42 to 60 days postpartum
with a mean body condition (± e.d.) of 3.04 ±0.24 (scale 1a 5).
At day 0, a DEV (CIDR, Pfizer Animal Health)) of first use was
administered, plus 2 mg of EB (Oestradiol Benzoate, Syntex S.A.).
On day 8 the DEV was removed and the animals were randomly
distributed to receive either 12.5 mg or 25.0 mg of Dinoprost
Trometamina, (Lutalyse®, Pfizer Animal Health). On day 9, 1 mg of
EB was applied. Return to service was resynchronized, administering
a fourth time DEV (CIDR, Pfizer Animal Health) from day 23 to 31.
At this time, the bases of the tail were painted (Ce-Lamark) to
determine oestrus according to the degree of paint removal.
Observations were made on days 33 and 34 twice in the day (am -
pm). The AI was applied by fixed-time (51 - 55 h after DEV
removal), using frozen semen in straws from two bulls. At return to
service all cows, which at the time of detection showed a degree of
paint removal between 0 and 3 (scale 1-5) were inseminated.
Pregnancy diagnosis was by rectal palpation at 50 days from the
return insemination. Evaluation of the treatment and bull effects and
their interactions was carried out using pregnancy at first service
percentages, return service and the two combined. Analysis was by
the subprogram CATMOD of SAS. Dose reduction of the from 25.0
to 12.5 mg of Dinoprost Trometamina did not affect the pregnancy
percentages (P>0.05) at first service (56.0% and 48.6%), return
(63.1% and 73.0%) and combined (72.0% and 77.6%). Neither was
there a bull effect nor an interaction (P>0.05). It is concluded that this
reduction in Dinoprost Trometamina does not affect pregnancy
percentages at first service, return or the two combined.
P032
Influence of uterine involution and ovarian activity on
pregnancy in dual purpose cows under different body
conditions at calving and with two feed levels
Dominguez, C 1 *; Ruiz, A 2 ; Martinez, N 3 ;Perez, R 1 ; Drescher, K 3 ; Pinto-Santini,
L 3 ; Rossini, M 2
1Instituto para el Desarrollo Sostenible de Sistemas Agro-ambientales,
Universidad Rómulo Gallegos, Venezuela; 2 Facultad de Ciencias
Veterinarias, Universidad Central de Venezuela, Venezuela; 3 Facultad de
Agronomía, Universidad Central de Venezuela, Venezuela.
The influence of uterine involution (UI) and ovarian activity (OA) on
pregnancy (PR) in dual purpose cows under different body conditions
at calving (BCAC) and different feed levels (FL) was studied. Twenty
seven cows (Bos taurus x Bos indicus) were randomly at one of the
four treatments (T): T1, low BC (2,5) + high FL (HCHFL, n =
7). Basal diet was made of hay from Cynodon nlemfuesis (11% crude
protein, CP) plus supplement (23% CP), with a 70:30 ratio. To assess
the UI, the following was considered: characteristic of cervical mucus
(CCM), horn symmetry (HS), cervix diameter (CD), and uterus
position (UP). Weekly, from 15 to 45 days postpartum (DPP), the
reproductive tract was evaluated by transrectal palpation,
ultrasonography (Aloka, 7.5 MHz), and plasma progesterone (P4) by
RIA. The OA was evaluated through the ovarian follicles (OF), which
were classified as: F1 (2-5 mm); F2 (6-9 mm) and; F3 (≥10 mm); and
the presence corpora lutea (CL). The PR was verified by rectal
palpation, ultrasound and P4. The metabolic changes were measured
as total cholesterol (TC) and fructosamine (FRTS) at 3, 15, 30, and 45
DPP. The hypothalamic and ovarian expression of leptin receptors
(EXPLEP) was determined by Western blot in 8 cows. The statistical
analyses used were: Kendall’s test for correlation, multivariate
(GLM), multiple regressions (Cox), and ANOVA. Results show a
significant association (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 39
P034
Potency of several GnRH agonists (Buserelin, Dalmarelin,
Gonavet and Gonazon) versus natural GnRH (Cystorelin)
in an in vitro functional assay.
Driancourt, MA 1 *, Fournier, R 2 , Ptaszinska, M 3 , Doornmalen, E 4 , Blomenrohr,
M 4
1Reproduction, Intervet Pharma R&D, France; 2 Intervet France, France;
3Intervet International Bv, The Netherlands; 4 Organon Bv, The Netherlands
Natural GnRH and several GnRH analogues are widely used to
synchronize oestrus and ovulation, as well as for treatment of
reproductive pathologies (cysts) in cattle. However, the relative
potency of each agonist relative to natural GnRH is not known. The
aim of the present study was to use an in vitro test (measuring
receptor activation) to compare the potency of natural GnRH (as
Cystorelin) versus several GnRH agonists. The agonists included
were Depherelin (D- Phe6-LHRH) (Gonavet, Veyx Pharma),
Lecirelin (D-Tle6, ProNHEt9- LHRH) (Dalmarelin, Fatro/Virbac),
Buserelin (D-Ser(But)6, Pro9-NEt- LHRH)(Receptal, Intervet) and
Azagly-nafarelin (D-Nal(2)6, α-aza-Gly10-LHRH)(Gonazon,
Intervet).The in vitro test used a CHO cell line expressing the human
GnRH receptor gene together with a beta lactamase reporter gene. In
this test, cells form β lactamase upon GnRH stimulation. B-lactamase,
in turn, cleaves a fluorogenic membrane permeable substrate (CCF4).
Non-responsive cells with low β lactamase appear green, while
responsive cells with high β lactamase appear blue. In the present
experiment, CHO-GnRH-R-β-lactamase bearing cells were plated for
16-20h before being challenged with GnRH. Cells were then
incubated with a range of concentrations of each test compound. Five
hours later, fluorogenic substrate (CCF4) was added to the cells and
the cells were incubated for 2h . The microplate was read with 405nm
excitation and 460 and 530nm emission. The data were plotted as a
ratio of the emissions at 460 (blue) and 530nM (green). Two separate
experiments were run, each dose response curve being generated by
four replicates. The effects of the different concentrations of GnRH or
GnRH agonists applied were compared using EC 50 (concentration
of GnRH applied generating a half maximum response) for each
compound. The sigmoid shapes of the dose-response curves were
similar in both experiments. In both assays, the dose-response curves
describing receptor activation by the different GnRH could be divided
into two sub-groups. On one hand, Buserelin, Azagly-nafarelin and
Depherelin displayed similar dose response curves resulting in similar
EC50-values (0.7 to 1.6ng/ml). On the other hand, Cystorelin and
Lecirelin (which behaved similarly) displayed higher EC50-values (8
to 15ng/ml). In both assays the slopes of the dose-response curves
proved similar, irrespective of the compound tested. The use of this
cell line therefore proved to be a potent tool to compare potencies of
different GnRH agonists.
P035
Screening of parturition time models of Holstein breed in
a dairy herd in Karaj suburb
Ebrahimi, A 1 *; Gharaghoozloo, F 2 ; Vojgani, M 2
1Department of Clinical Science, Faculty of Veterinary Medicine, Islamic Azad
University, Garmsar Branch, 2 University of Tehran, Iran
The influences of breeding group, age of dam, sex, calving problems
like dystocia, abortion and some calving abnormalities, like stillbirth
on the time of day of parturition were studied. Cross-sectional surveys
of 6606 calving records between 1989 and 2005 were analyzed by the
least-squares and the chi-squared procedures. The cases were divided
based on the time of parturition within 24 hours in four groups of six
hours each, as follows: 0-6, 7-12, 13-18, 19-24 hour with their
belonging calving numbers of 1762, 1787, 2031 and 1027,
respectively. The distribution within these groups were characterized
with the following percentages based on the calving process: normal
calving: 86.8, 79.4, 78.7 and 84.8, dystocia (grade one): 2.5, 5.3, 6.6
and 2.2, dystocia (grade two): 10.6, 14.7, 14.3 and 12.6, severe
dystocia (grade three): 0.2, 0.7, 0.4 and 0.4. The cases were divided in
four groups according to the seasonal distribution of parturitions so
24,4% of all parturitions occurred during spring, 26.2% during
summer, 26% during autumn and 23.4% during winter. The seasonal
occurrence of stillbirth were 3.9, 4, 3.8 and 5.5%, respectively
(P=0.06). The seasonal occurrence of dystocia were16.8, 14.8, 18.7
and 22.4% with P

16 t h International Congress on Animal Reproduction
40 Poster Abstracts
P037
Treatment of Uterine Infections in Non Cycling Cows with
Cloprostenol
Fernandes, C 1-2 *; Figueiredo, A 1-2 ; Alves, B 2 ; Oliveira, E 2 ; Viana, J 4 , Gioso, M
1; Oba, E 4
1Faculty of Veterinary Medicine, University of Alfenas, Brazil; 2 Biotran LTDA,
Brazil; 3 Embrapa-Gado de Leite, Brazil; 4 FMVZ-Unesp – Botucatu, Brazil
Recent findings on the mechanisms of uterine defense show the
eicosanoids as the main substances that modulate this activity. This
observation open an excellent chance for the treatment of uterine
infections, once the PGF2α and its analogous have activity on the
production of these substances in the uterus. Moreover, they would
provoke reduction in the progesterone (P4). P4 produces substances
that inhibit the uterine defense mechanisms and partially block the
production of eicosanoids. The application of PGF analogous was
capable of stimulating the PGF2 and other related substances
production in the uterus, as Leucotriene B4, which activate some
leucocitary functions, associated to the neutrophile, the most
important cell in the uterus defense mechanism. The aims of this
study were to evaluate and compare the efficiency of protocols of
Cloprostenol administration for the treatment of clinical endometritis
in dairy cows (Holstein) without luteal ovarian activity. Cows of six
herds were used, all presenting clinical endometritis, associated with a
involuted uterus (30-118 days post-partum) and absence of corpus
luteum. The diagnosis and classification of the endometritis was based
on abnormal uterine discharge on vaginoscopic examination. In
accordance with the infection degree (mucopurulent or purulent) the
animals had been randomized in four groups, and received IM
treatments: T1 (n=22): 2ml of saline solution; T2 (n=41): only one
dose of 0.530mg of Cloprostenol (2ml Ciosin Schering Plough-
Brazil); T3 (n=43): 2 doses of 0.530mg of Cloprostenol 24 hours apart
and T4 (n=40): 2 doses 0.530mg of Cloprostenol with interval of 48
hours. The cows were evaluated by vaginoscopy 20 to 30 days later.
The efficiency between the treatments was compared by the χ2 test.
There was no herd effect in treatment results. The efficiency was
18.18a; 39.02b, 71.42c and 47.50%b for groups T1, T2, T3 and T4,
respectively. The treatment with better efficiency was T3, (P5 mm), and number of follicles ≥4 mm on D7 were
analyzed by logistic regression using Glimmix procedure. Daily size
of follicles was analyzed by MIXED procedure. Surprisingly,
treatment with EB did not delay emergence of the follicular wave
(1.40±0.24 vs. 1.40±0.24 days, P=1.00) or alter largest follicle size at
any day post-treatment. In addition, there was no difference between
control and EB-treated cows in growth rate of the largest follicle from
D1 to D7 (1.50±0.05 vs. 1.21±0.16 mm/d; P=0.34) or D4 to D7
(1.20±0.17 vs. 1.40±0.16 mm/d; P=0.53); but, EB decreased growth
of the largest follicle from D1 to D4 (1.25±0.15 vs. 0.83±0.13 mm/d;
P=0.03). Unexpectedly, EB treatment increased number of follicles
≥4mm on Days 5, 6, or 7 (D7; Control=7.2±0.8 vs. EB=21.2±5.3
follicles; P=0.03). Thus, a dose of EB that normally delays follicular
wave emergence by ~4d was not effective in delaying emergence or
growth of the dominant follicle after follicular aspiration perhaps due
to absence of follicular products such as inhibin. However, EB
treatment following follicular aspiration produced a dramatic increase
in the numbers of small follicles even in the presence of a dominant
follicle.
P039
Ovarian Cysts Treatment with Fertirelin Associated or not
to Cloprostenol
Fernandes, C 1-2 ; Figueiredo, A 1-2 *; Alves, B 2 ; Oliveira, E 2 ; Viana, J 4 , Gioso,
M 1 ; Oba, E 4
1Faculty of Veterinary Medicine, University of Alfenas, Brazil; 2 Biotran LTDA,
Brazil; 3 Embrapa-Gado de Leite, Brazil; 4 FMVZ-Unesp – Botucatu, Brazil
The ovarian cysts was a of high occurrence pathology and for causes
significant alterations in the reproductive performance of the animals.
Its treatment must be effective, in the direction to minimize the
reproductive losses. The result of the successful treatment would be
the regression of the cystic structure and formation of a luteal mass
(corpus luteum) and the fast return to the cyclical luteal ovarian
activity and manifestation of regular estrous cycles. Braun et al.
(2000) shows considerable occurrence of cystic structures with
partially luteinized wall in dairy cows, and cite the possibility of
beneficial effect in the application of prostaglandins associated to the
analogous ones of the GnRH for treatment. The objective of this study
was to evaluate and to compare the efficiency of the Fertirelin Acetate
in association or not with the Cloprostenol for treatment of ovarian
cysts in dairy cows. 133 holstein cows between 30 and 90 days postpartum
had been used in four Farms. The cyst diagnosis was made by
ultrasonography (Esaote-Falco), considering as cyst a anecoic
structure above of 20mm beyond the absence of luteal mass in the two
ovaries. The animals had been randomized into two groups that had
received the following treatments, by IM way in only dose: G1
(n=51): 0,1mg of Fertirelin Acetate (Fertigen Schering Plough-
Brazil); G2 (n=49): 0,1mg of Fertirelin Acetate + 0,530mg of
Cloprostenol (Ciosin Schering Plough-Brazil) at the same time,
and G3 (n=35): Control Group (non treated). All the animals again
had been evaluated of 12 the 18 days later. The treatment was
considered efficient where in the second ultrasonography evaluation it
was detected the absence of the cystic structure and presence of luteal
mass. The efficiency of the treatments was evaluated by the χ2 test.
The results of the two treatments had been 54.91; 81.63 and 17.14%,
for the groups G1; G2 and G3, respectively (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 41
analogous one of the GnRH, was beneficial for resolution of this
pathology.
P040
Bull and sire effect for the pregnancy rate and embryonic
loss in dairy cow
Gabor, G 1 *, Balogh, OG 1 , Abonyi-Toth, Zs 2 , Toth, F 1 and Sasser, RG 3,4
1Department of Cattle Breeding Research Institute for Animal Breeding, H-
2053 Herceghalom, Hungary, 2 SzIE-AOTK, H-1074 Budapest, Hungary,
3Department of Animal and Veterinary Science, University of Idaho and
4BioTracking LLC, 105 E. 2nd, Moscow, ID, USA
Introduction The main limiting factors of reproductive performance
in dairies are pregnancy rate (PR) (influenced by embryonic loss
(EL)) and number of services per conception (NSC). Between 1st
January and 31st October 2007 our laboratory checked early
pregnancies of approximately 11200 AI’s. That required collecting
data from cows of 13 dairies. PR and NSC seemed to be affected by
the AI sire is why data were collected on the AI sires on the farm too.
We also recorded ovarian treatments of cows before AI, pregnancy
rates and embryonic losses in cows. Our main goal was to check sire
and bull effect for PR and EL. Based on the above mentioned data
statistical analyses were carried out to find out interactions between
PR and EL with other factors (farm, ovarian treatment, age, number of
AI).
Materials and methods Blood samples were collected once a week,
30-36 days post insemination (PI), and sent to the laboratory by
overnight mail. Data about the cow and AI were sent via email.
BioPRYN ® ELISA test (BioTracking, Moscow, ID, US) was run for
detection of early pregnancy. All open cows and pregnant cows which
had low optical density values (close to the cutoff) during the BioPryn
test were assayed for serum P4 concentration. P4 was checked by an
ELISA test (QuantiCheck, Veterinorg, Budapest). Re-check of
pregnancy status was done 60-90 days PI by rectal palpation.
Differences between the early and 60-90 days pregnancy detection
were called late loss. Pearson's Chi-squared test and logistic
regression was used to find the association among the data. Data from
AI bulls (AIB) and the bull’s sires (BS) which had more than 100
AI’s, and fathers of cows (FC) whose daughters had more than 100
AI’s were used for statistical analysis.
Results and discussion Significant correlation (P

16 t h International Congress on Animal Reproduction
42 Poster Abstracts
increase in days to CLA by selection for high yields can be reduced
by including selection for non-return rate without reduction in milk
yield, as evidenced by equal production levels in HMP- and HGMcows.
P043
Benchmarking in Reproductive Control Programs of
tropical dual purpose crossbred herds
González-Stagnaro, C
Zootecnia, Universidad Del Zulia, Facultad De Agronomía, Instituto De
Investigaciones Agronómicas, Venezuela
Medicine of Production, TQM and HACCP has proved that
reengineering livestock process, offer a new way to organize farm
works, applying updated technologies to improve production and
profit. In addition, has demonstrated that farmers are different, open
for research, but reluctant to make changes and adopt new
technologies; they only will take decisions, when the successfully
farmer shows their technical changes and economical benefits.
Benchmarking methodology adopted management practices from
more profitable farms, supported by the records evaluation,
computerized information and statistical process. This ¨strategic
emulation¨ of success practices by the less efficient farms, will
increase productive, reproductive and economic performance. The
first objective of this benchmarking work was the study of the
frequency of application of 33 technologies and biotechonogies in 32
dual purpose crossbred herds Bos taurus x Bos indicus: 16 improved
(IM) and 16 traditional (TM) managed system, located in Zulia state,
Venezuela (10ºNL, 32-36ºC, 1100mm). Differences between systems
were analyzed by “t” test. There were differences (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 43
and both ITGAD and ITGB7 were only expressed at the hatched
blastocyst stage.
This study demonstrates the variability in integrin expression during
preimplantation embryo development and pushes ITGα3β1, ITGα5β1
and ITGαVβ3 forward as candidate receptors for the embryo specific
FN1 splice variant. Further research is necessary to reveal the
subcellular distribution and organization of the integrin proteins as
well as downstream adhesion and signal transduction pathways.
P046
Reproductive management strategies to improve
pregnancy rate following Ovsynch/TAI protocol in dairy
cows and heifers
Gordon, M 1 *, Dinn, N 2
1Animal Science, University of British Columbia, Canada; 2 Ubc Dairy
Education & Research Centre, Canada
Physiological and environmental stresses of high milk production and
intensive management systems have affected the onset of postpartum
ovarian activity, expression of estrus, embryonic development, and
pregnancy in lactating dairy cows. Though prostaglandin (PGF2α) is
still the most widely used drug for the induction and synchronization
of estrus, the Ovsynch/TAI protocol, which strategically uses GnRH
and PGF2α to synchronize ovulation offers potential freedom to dairy
farmers from the time consuming chore of estrus detection. The
ovulation rate and pregnancy rate (PR) with Ovsynch/TAI protocol in
postpartum cows are around 80% and 30 to 40%, respectively and
lower in heifers. However, pre-synchronization before Ovsynch/TAI
protocol or the use of GnRH five to seven days after breeding has the
potential to improve PR and this was tested in the current study.
Multiparous and primiparous lactating cows (n=225) and nulliparous
heifers (n = 87) were used. Animals were randomly assigned to one of
three treatments for timed first service breeding (TAI) at about 75
days in milk (DIM) for cows and 15 months of age for heifers: A)
Control - Ovsynch protocol (GnRH injection given 7 d before and
another 48 h after one PGF2α injection); B) Presynch + Ovsynch (two
injections of PGF2α 14 d apart followed by Ovsynch 14 d later); C)
Ovsynch + post-AI GnRH (a GnRH injection given 6 d after TAI
following Ovsynch). A total of 10 blood samples (from heifers) or
milk samples (from cows) were taken from each animal (on days -38,
-31, -24, -10, -3, 0 (TAI), 7, 14, 21, 28) for progesterone (P4)
analysis. Pregnancy rate for heifers were 65%, 59%, and 59% and for
lactating cows were 44%, 48%, and 46% for treatments A, B, and C,
respectively, revealing no treatment effect on PR (p>0.05). However,
there was an interaction of DIM and BCS at TAI with PR (p=0.008
and p=0.20, respectively). The trend for cows in less BCS and less
DIM to have lower PR was seen most in the Ovsynch group.
Moreover, pregnant animals in group B and C had higher P4 levels on
day 21 and day 28 than did pregnant animals from control group
(p=0.15), which could be indicative of better functioning CL’s and
thus enhancing PR. These results show that the Ovsynch protocol can
be used to achieve acceptable PR rates in heifers using a synchronized
TAI protocol. Although differences in pregnancy were not significant
among treatments, PR and P4 results from this study show that
presynchronization and post insemination GnRH tend to benefit cows
which are in more negative energy balance.
P047
The effect of early or late breeding on milk production in
lactating dairy cows
Gumen, A 1 *, Keskin, A 1 , Yılmazbas, G 1 , Celik, Y 2 , Burucu, Y 2
1University of Uludag, Faculty of Veterinary Medicine, Department of
Obstetrics and Gynecology, Bursa, Turkey; 2 Tarfaş A. Ş., Karacabey, Bursa,
Turkey
Milk production and reproduction are two important factors with
respect to profitability of dairy farms and much attention has been
given to fertility parameters and their association with milk
production. Previous studies was reported that pregnancy adversely
affect milk production. Delaying of first breeding in high producing
dairy cows may increase overall milk yield. The objective of this
study was to compare effect of early or late breeding on milk
production in lactating dairy cows. Dairy cows (n=52) were divided
into two groups. In group 1 (early bred), cows (n=22) were
inseminated between 45 to 75 postpartum and group 2 (n=30; late
bred) were inseminated between 76 to 130 postpartum. All cows were
in second lactation. Cows were fed twice daily with a high-energy
lactating dairy cow ration fed as a TMR following NRC
recommendations. Estrus detection was recorded with pedometer and
visual observation. Milk yield was recorded every 5 days after calving
first 45 days then every 15 days until 270 days. Breeding of cows
were initiated after voluntary waiting period (45 days in milk) with
artificial insemination. Cows were inseminated only once and became
pregnant following their first postpartum estrus included in this study.
Average days in milk in early and late bred cows at the time of
artificial insemination were 65.2 and 102.6 days, respectively.
Average milk yield first 270 days was 37.8 and 39.0 kg for early and
late bred cows. Milk yield was not different between early and late
bred cows from calving to 270 days after calving. There was no
relationship between first 3 months milk yield and postpartum days of
insemination. Also, there was no relationship between overall milk
yied (calving to 270 days) and postpartum days of insemination.
Thus, milk yield was not affected by early or late breeding of cows
but further trials are needed to evaluate the repeatability of this
response.
P048
Effect of ketoprofen administration 15 and 16 days after
AI on conception rates in lactating Holstein cows
Guzeloglu, A 1 *, Erdem, H 2 , Cinar, M 3 , Kilic, K 4 , Talmac, M 4 , Gorgundur, A 4 ,
Gumen, A 5
1Obstetrics And Gyneacology, Selcuk University Faculty of Veterinary
Medicine, Turkey; 2 Selcuk University Faculty of Veterinary Medicine, Turkey;
3Nigde University, Bor Vocational School, Turkey; 4 Kocas Tigem Agricultural
Station Aksaray, Turkey; 5 Uludag University Faculty of Veterinary Medicine,
Turkey
It has been reported that timely administration of a non-steroid antiinflammatory
drug (NSAID), flunixin meglumine, around the time of
luteolysis (day 15 and day 16) increased pregnancy rates in heifers
(Guzeloglu et al., 2007) and lactating cows (Pfeifer et al., 2007). The
objective of this study was to determine if two injections of
ketoprofen would demonstrate the same effect as flunixin meglumine.
Ketoprofen has no milk residue in contrast to flunixin meglumine.
Two experiments were done in lactating Holstein dairy cows (milk
yield average 25 kg/day, 3 to 10 years old, average DIM 125 days). In
experiment 1, 86 cows were inseminated at detected heat and
randomly assigned to receive treatment (n=45; ketoprofen, i.m., 3
mg/kg BW on day 15 and 16 after insemination; 24 hours apart) or
control (n=41). In experiment 2, 84 cows were inseminated at fixed
time (TAI) following ovsynch program and randomly assigned to
treatment (n=43) and control (n=41) groups as described for
experiment 1. Pregnancy diagnosis was performed by ultrasonography
30 days after TAI. Conception rates did not differ between treatment
and control groups (In experiment 1, 47% (21/45) for treatment and
49% (20/41) control; in experiment 2, 30% (13/43) for treatment and
27% (11/41) control). In both experiments, no significant effects of
sire, days in milk, milk yield and parity were detected. In conclusion,
ketoprofen did not have beneficial effect on conception rates in
lactating cows as flunixin meglumine. Moreover, data suggests that
ketoprofen can be used in early pregnancy for treatment of possible
inflammatory conditions without having detrimental effects on
pregnancy.
P049
Relationship between uterine involution and pregnancy
rate in dairy cows
Hajurka, J
Equine clinic, University of Vterinary Medicine, Slovakia
The objectives of this study were to assess uterine involution and
pregnancy rate in dairy cows under field condition. Animals were

16 t h International Congress on Animal Reproduction
44 Poster Abstracts
divided into four groups according to the puerperium (normal or
abnormal) and parity (primiparous or pluriparous). Uterine involution
was monitored by gynaecological examination (vaginal and rectal) at
2-3 day intervals (three times per week). Criteria for involution were:
(i) stable uterine size (ultrasound using a rectal probe; (ii) normal
uterine tone and consistency (palpation per rectum); and (iii) absence
of pathological cervical discharge (vaginal inspection). In both firstcalf
heifers and pluriparous cows uterine involution was longer after
puerperal complications (retained placenta and/or uterine
inflammation) compared to animals with a normal puerperium
(primiparous: 23.0+/-5.3 days; n = 26 vs. 37.3 +/-7.4 days; and
pluriparous: 27.3 +/-5.3; n = 122 vs.37.3 +/-8.2 days; n = 102; p
0.0001).All animals were inseminated at the first suitable heat
observed beyond 40 days after calving. An abnormal puerperium
delayed the time to first insemination in primiparous cows by average
of 2 days an by 12.2 days in pluriparous cows (p 0.0001). First service
pregnancy rates after a normal purperium were 61.5% in primiparous
and 41.8% in pluriparous cows (p 0.05).Placental retencion and/or
uterine inflammation decreased first service conception rates more in
cows than in heifers (53.9% in primiparous vs. 37.3% in pluriparous;
p 0.05). In conclusion, pregnancz rates would be improved if care
taken to avoid complications in the puerperium, espacially in
pluriparous cows. (Supported by Ministry of Education of the Slovak
Republic, project AV 4/0009/07)
P050
Uterine blood flow during the first three weeks of
pregnancy in Holstein Friesian cows
Honnens, A 1 *; Voss, C 1,2 ; Herzog, K 1 ; Beindorff, N 1 ; Rath, D 2 ; Bollwein, H 1
1Clinic for Cattle, University of Veterinary Medicine, Hanover, Germany;
2Institute for Animal Breeding (FAL), Dept. Biotechnology, Mariensee,
Germany
Embryonic mortality during the first three weeks is one of the main
reasons for the low fertility rate in high yielding dairy cows.
Therefore, a number of studies have been carried out on the embryomaternal
communication during this time period. Investigations of
blood flow in the uterine arteries during early pregnancy indicated
that uterine blood flow ipsilateral to the embryo increases already in
the third week of pregnancy; but due to the use of invasive methods
they were carried out only in three cows. Since the introduction of
transrectal colour Doppler sonography genital blood flow can be
examined in clinical studies on a relatively high number of cows. The
objective of this study was to compare changes in uterine blood flow
between cyclic and early pregnant lactating dairy cows. Colour
Doppler examinations were carried out in 50 multiparous lactating
German Holstein cows on Days 3, 6, 9, 11, 13, 15, 18 and 21
(Day 0=oestrus). Fourteen cows were examined during the oestrous
cycle and 36 cows after insemination with cryopreserved sperm. After
each Doppler examination blood samples were collected for
determination of total estrogens (E) and progesterone (P 4 ) in plasma.
Uterine blood flow was reflected by the time-averaged maximum
velocity (TAMV) in the uterine artery ipsilateral to the corpus luteum.
As eighteen cows, that were not pregnant on Day 25, were excluded
from further analyses, data are from 14 cyclic and 18 pregnant cows.
In cyclic cows TAMV values stayed at a constant level (P>0.05)
between Days 3 and 13. Between Days 13 and 18 TAMV increased
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 45
by 60 days after calving, cows were received PG 25mg at six weeks
and eight weeks after calving. Artificial insemination (AI) was
performed only to the cow showing sings of estrus. Cows were
divided in to five groups as follows; group A: twice PG + hCG
1500IU at AI, group B: twice PG + hCG 1500IU at 5 days after AI,
group C: twice PG + EB 1mg at 2 days after second PG, group D:
only twice PG, control: no treatment. Blood samples were collected
weekly after calving and plasma progesterone (P4) level were
measured by EIA. Conception and pregnancy rate at 70 and 100 days
after calving and days open were recorded.
Results There was no difference in insemination rate and days open
among groups. At 70 days after calving, group B, C and D showed
higher (p

16 t h International Congress on Animal Reproduction
46 Poster Abstracts
The study was carried out on 44 multiparous lactating Holestein cows
(FCM = 7759.1 kg) in a commercial dairy herd. Scanning of the
ovaries was performed by transrectal ultrasound (5 MHz, Ami,
Canada) and blood samples for P 4 analysis were collected twice
weekly commencing from day 7 to day 66 after calving. Serum P 4
concentration was measured by a commercial validated
radioimmunoassay kit (Immunotech kit, France). Cows with normal
or abnormal postpartum ovarian activities were defined based on the
characteristics of their serum P 4 profiles (Shrestha et al., 2004.
Theriogenology 61:637-49). Of 44 cows studied, 22 (50 %) had
normal ovarian activity (ovulation occurring ≤45 days after calving,
followed by regular ovarian cycles); while, 17 (38.6 %) and 5 (11.4
%) had delayed first ovulation (DOV) and prolonged luteal phase
(PLP), respectively. Data were statistically analysed using Anova.
Logistic regression analysis indicated a significant interaction
between P 4 concentration on day 24 after calving and peak milk yield
(kg/day, 75-d postpartum). With the limited number of PLP observed
cows in the present study, statistical analyses showed that the
likelihood of the occurrence of PLP increased by 1.1 for each 1 kg
increase in peak milk yield of cows with P 4 concentration ≥ 1 ng/ml
on day 24 after calving (P=0.01, 95% CI=1.01-1.15). First postpartum
P 4 rise was observed significantly earlier in cows with PLP compared
to that of the cows with normal ovarian activity (23.2 ± 4.0 vs 32.2 ±
8.38; P

16 t h International Congress on Animal Reproduction
Poster Abstracts 47
P058
The effect of periparturient propylene glycol
administration on metabolism and on reproductive
performance in Holstein-Friesian cows
Kerestes, M 1 *; Faigl, V 1 ; Győrffy, A 1 ; Márton , A 2 ; Langer, D 1 , Kulcsár, M 1 ;
Gaál, T 1 ; Fébel, H 3 ; Húsvéth, F 2 ; Gabor, G 3 ; Bartha, T 1 ; Szenci, O 1 ;
Huszenicza, G 1
1Faculty of Veterinary Science, Szent István University, Hungary; 2 Pannon
University, Faculty of Agricultural Sciences, Keszthely, Hungary; 3 Institute of
Animal Husbandry and Nutrition, Herceghalom, Hungary
Negative energy balance in the early lactation is often accompanied
by decreased insulin secretion of the pancreatic β-cells and insulin
resistance of the peripheral tissues. In dairy practice the propyleneglycol
(1,2-propanediol, PGL) is often used for prevention of ketosis
and fatty liver. We examined the effect of periparturient PGL
supplementation on metabolic profile, liver lipid content, and on
reproductive performance in Holstein Friesian (HF) cows. The
glucose-induced insulin-response of the β-cells and the insulinsensitivity
of peripheral tissues were also investigated.
Fifty-one multiparous HF cows (previous lactation milk yield:
8042±214 kg) in a large scale dairy herd were involved in the study.
The supplemented group (n=20) received PGL powder corresponding
to daily 5.05 MJ NE, from d14 before the expected calving date till
d10 after calving, poured on the monodiet. The control group (n=30)
did not received PGL. Blood samples were taken regularly for ßOHbutyrate
(BHB), non esterified fatty acids (NEFA), glucose, insulin,
insulin like growth hormone-I (IGF-I), thyroxine (T 4 ) and 3,3',5,
triiodtironine (T 3 ). On d7-10 after parturition in a subsequent of 16
cows (Control=10; PGL=6) liver biopsy was taken to determine the
hepatic total lipid content. After biopsy a simultaneous intravenous
glucose and insulin challenge test was performed. During the glucose
tolerance test we examined the glucose induced insulin-response area
under the curve (AUC), the glucose-clearance rate, half time of
glucose (T 1/2 ), and maximum insulin-response time. From the insulintolerance
test we measured the glucose response to the insulin.
Resumption of cyclicity was monitored by milk progesterone profiles
from samples collected 3 times per week. After pre-synchronisation of
the ovarian activity with two PGF2a injections at 12 days interval, a
GPG protocol and fixed time AI was performed.
The PGL supplementation increased the insulin concentrations and
decreased the BHB levels in the last days of pregnancy. The treatment
had no effect on blood glucose, thyroid hormone and IGF-I levels.
The parameters measured during the glucose- and insulin-tolerance
test were not changed. In cows with subclinical form ketosis the
glucose-induced insulin-response and the glucose T 1/2 were notably
lower. PGL administration had no effect on the time of the first pp
ovulation (34.1±18vs. 34±16d) and on pregnancy rate (38% vs. 32%)
of the animals. The periparturient PGL supplementation somewhat
affected the metabolic status of the cows, but its effects remained
below our expectations.
P059
Corpus luteum function and morphology in relation to
nutrition in dairy cows
Knijn, HM 1 *, Uijttewaal, MJ 1 , Dieleman, SJ 1 , van den Hurk, R 1 , Zaaijer, D 6 ,
Vos, PLAM 1
1Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, The
Netherlands; 6 DAP Future Fertility Systems, The Netherlands
Anoestrus is an important problem in high yielding dairy cows, which
can have different causes, for example, a prolonged luteal phase.
Recently in veterinary practice, abnormal, large, spongy corpora lutea
(CLs) were diagnosed in non-cyclic dairy cows post partum. These
cows received a typical diet with low levels of sugar and rumen
fermentable starch, and a relatively high fraction of rumen
undegradable starch, in combination with high levels of protein. The
aim of the present study was to create a model to induce spongy CLs
by feeding this typical diet to dairy cows, and to investigate its effect
on CL morphology and function in comparison to control diet.
Twenty-four animals were selected based on parity (1-3), lactation
state (3-6 months in lactation) and normal cyclicity. All animals were
synchronized and at the end of the following cycle they were allocated
into three diet groups; rape- (high rumen fermentable protein > 18%
mainly from rape, low fermentable energy), soya- (high rumen
fermentable protein >18% mainly from soya, low fermentable energy)
and control group. Blood samples for progesterone analyses were
collected three times a week. The animals were ovariectomized at day
12 (day 0 is estrus) of the third cycle in which they were fed the 3
different diets. The obtained CLs were analysed histologically with
regards to surface and size of luteal cells using as marker 3-β-HSD
expression (a pivotal enzyme in the synthesis of progesterone).
Furthermore, the mRNA expression for IGF-1 (which stimulates the
steroidogenesis), and leptin (which is a elusive factor linking
reproduction and metabolic status) and their receptors was quantified
by Q-PCR technique.
During this trial, no spongy CLs have developed but a large variety of
both macro- and microscopic appearance of the CLs has been
observed. Remarkably, this was the first time that adipose tissue was
described in the CL, which was frequently observed near the centre or
cavity of the CL. In this respect, a significant difference (p

16 t h International Congress on Animal Reproduction
48 Poster Abstracts
key point to exposes all cows in the herd to the risk of becoming
pregnant at or very near the end of the voluntary waiting period.
P061
A spontaneous delayed post-ovulatory progesterone rise
discovered in Indigenous-Holstein cross-bred dairy
heifers
Kornmatitsuk, S 1 ; Kornmatitsuk, B 1 ; Chantaraprateep, P 2 ; Larsson, B 3
1Faculty of Veterinary Science, Mahidol University, Phutthamonthon, Nakhon
Pathom, 73170; 2 Council of Chulalongkorn University, Patumwan, Bangkok,
10330; 3 Uppsala County Administrative Board, Uppsala County, Uppsala,
Sweden SE-75186
Indigenous-Holstein (≥75%) cross-breed (Bos indicus × Bos taurus) is
the majority of dairy cows/heifers in South-East Asia including
Thailand and is claimed to well adapt to the tropical and sub-tropical
environments. However, Bos indicus had less potential for production
as well as lower fertility than Bos taurus cattle. These may contribute
to certain problems and limited success, especially in reproduction
aspect, in our dairy industries. The aims of the current study, hence,
were to illustrate figures for the characteristics of oestrous cycles
especially on follicular dynamics, corpus luteum and changes in
progesterone, in the Indigenous-Holstein cross-bred dairy heifers.
Twenty six healthy and sexual-mature virgin heifers were included.
Their ovaries were sonically examined once a day and the numbers
and the sizes of the follicles as well as of the corpus luteum were
documented. Blood samples were drawn as the same frequency as
ovarian examination and progesterone was determined by means of
EIA (Enzyme-linked immunoassay). In our study, certain diversities
comparing to of existed documents on dairy breeds were drawn for
follicular dynamics, corpus luteum and its progesterone: 1) the follicle
tended to quicker ovulate but with a smaller diameter at ovulation
(12.4 ± 1.1 mm in diameter); 2) the corpus luteum exhibited 4.0−16.5
mm in diameter of central cavity. Connecting to the levels of
progesterone, 3) the corpus luteum turned into active, as well as midluteal,
period quite late (6.0 ± 1.7 days and 9.80 ± 2.49 days, resp.),
and 4) the duration of the active period of the corpus luteum was
shorter (12.5 ± 1.7 days), but 6) at the end of the cycle –around the
day of oestrus, progesterone remained certain low but significant
levels (range 0.15 to 0.60 ng/ml.). To conclude, a spontaneous
delayed post-ovulatory progesterone rise was discovered, in
connection to a series of following events: 1) smaller ovulatory
follicle; 2) CL with cavity and delayed rise in progesterone and 3)
delayed CL regression. It is of challenge to figure out an (or a
combined) underlying cause of, and a precise manner to undo, the
loop of the delayed rise in post-ovulatory progesterone, either at
endocrine or at cell levels.
P062
Leukotrienes as modulators of ovarian and uterine
secretory functions in cattle in vivo
Korzekwa, A*; Kurzynowski, A; Woclawek-Potocka, I ; Bah, MM ; Skarzynski,
DJ
Department of Reproductive Immunology, Institute of Animal Reproduction
and Food Research, Polish Academy of Sciences in Olsztyn, Poland
Leukotrienes (LTs) beside prostaglandins (PGs) and tromboxan
belong to biologically active unsaturated fatty acids called
eikozanoids. Leukotrienes are known as potential inflammatory
factors and causing edema in respiratory tract diseases. The precursor
of LTs is 20-carbonated Arachidonic Acid (AA) – the component of
membrane fosfolipids. The enzyme which converts AA to LTs is
lipoxygenase (LO). The role of lipoxygenase pathway products such
as LTs in the regulation of bovine reproduction tract functions
remains controversial. The aim of the study was the determination of
the influence of LTs on changes in hormone homeostasis of
reproductive tract in cattle in vivo. Heifers (15 Day of estrous cycle)
were injected during 1 hour into aorta abdominalis with: LTC 4 in
doses: 10, 25 and 50 µg and LTB 4 in doses: 10 and 25 µg. The levels
of P4 and AA metabolites: PGE 2 and PGFM were measured in plasma
by EIA. Leukotriene C 4 and B 4 did not influence on P4 level although
the dose 25 µg LTB 4 prolonged the duration of luteal phase.
Leukotriene C 4 in dose 10 µg temporally increased the secretion of
PGE 2 (from 8 to 10 h after infusion) but simultaneously increased the
secretion of PGF 2α (PGFM). The dose 25 µg of LTC 4 caused the
increase of PGF 2α (PGFM) release, whereas 50 µg of LTC 4 did not
changed the secretion of hormones. Leukotriene B 4 in dose 10 µg
caused PGF 2α (PGFM) release and 25 µg of LTB 4 increased PGE 2
secretion. Moreover the acceleration of luteolysis for the doses of
leukotrienes: 10 µg, 25 µg LTC 4 and 10 µg LTB 4 was observed.
Resuming, the action of LTB 4 on reproductive tract depends on the
dose, because 10 µg is luteolytic while 25 µg prolongs the duration of
luteal stage. The action of LTC 4 is luteolytic for doses: 10 and 25 µg
but 50 µg of LTC 4 caused to be not effective in experiment. Further
studies are necessary for investigation of the influence of LTs on
hormone homeostasis of bovine reproductive tract with the
administration of LTs antagonists and other doses of LTs. The
implication of LTs can be the alternative to PGs method of estrus
synchronization or other cycle manipulation techniques in the future.
P063
The slope of the postovulatory progesterone rise
modulates pregnancy rate in Holstein-Friesian heifers
Kulcsár, M 1 *, Kátai, L 1 , Földi, J 1,2 , Gáspárdy, A 1 , Fébel, H 3 , Gabor, G 3 ,
Driancourt, MA 2 , Huszenicza, G 1
1Szent István University, Faculty of Veterinary Science, Budapest, Hungary;
2Intervet Pharma, Angers, France; 3 Institute of Animal Husbandry and
Nutrition, Herceghalom, Hungary
During peak lactation, the negative energy balance and its metabolic
consequences may interfere with the postovulatory progesterone (P4)
rise, hence affecting pregnancy rate and incidence of embryonic/early
fetal mortality (EM) in dairy cows. The aim of this study was to
explore whether metabolic markers could also be related to fertility in
heifers. In the hot summer season, sixty, 14-15-month-old Holstein-
Friesian heifers with medium or higher body condition score
(BCS:≥3.0) were inseminated (AI) at synchronized estrus
(Norgestomet impl. for 9 days combined with PGF 2α and eCG, 2 days
before and simultaneously with implant removal, respectively; AI:
56h later; AI=d0). Blood samples were collected on d0 and analyzed
for βOH-butyrate (BHB), non-esterified fatty acids (NEFA), insulin,
IGF-1, T 4 , T 3 and leptin. Progesterone (P4) was determined every 12
hours for 7 days following implant removal, every 24 hours thereafter
until d 14 and again on d 16, 19, 21, 23 and 36. 17β-estradiol (E2)
was assayed during the first 4 days. Pregnancy was checked on day 36
by (i) ultrasound (US) and (ii) plasma Pregnancy-Specific Protein B
(PSPB) measurement, and (iii) on day 45-60 by rectal palpation (RP).
The E2 patterns indicated well-synchronized growth and maturation
of follicles. The P4 profiles allowed conception (P4 at the time of AI:

16 t h International Congress on Animal Reproduction
Poster Abstracts 49
Introduction Cattle predominant in the Mexican tropics are Bos
taurus/Bos indicus crosses. Bos indicus influenced cattle have long
intercalving periods and poor estrus detection rates, which are the
main limitations to improve their reproductive efficiency. The
protocols for estrus induction and synchronization that eliminate
estrus detection by using timed artificial insemination (TAI) are
useful for this type of cattle. The use of an intravaginal insert
impregnated with 1.9 g of progesterone (CIDR®, controlled internal
drug-releasing device) has induced cyclicity in anestrous cows.
Administration of synthetic progesterone (P 4 ) and estrogen during
CIDR treatment has proved to enhance synchronization rate. We
evaluated the pregnancy rate in postpartum anestrous lactating Bos
taurus/Bos indicus crossbred cows treated with a CIDR, estradiol and
synthetic P 4 .
Methods On days -9, -6, -3 and 0 (day 0=start of treatment), anestrus
status was confirmed by transrectal ultrasonography and
determination of serum P 4 concentrations (0.05) and 17.6% (3/17) for the control group
(P 22,8cm); G2 (SC
21,6-22,6cm) and G3 (SC 20,1-21,2cm). Zootechnical, seminal and
endocrinologic traits were taken and analyzed as the animal achieved
puberty (4). Statistics was done and the mean values compared with
SNK test (2).
Results and discussion There was statistical difference of G1
compared to G2 and G3 for age, weight and testosterone
concentration at puberty. The G1 at twelve months had the higher SC
and the lowest weight at weaning in relation to other groups. Bos
taurus taurus reached puberty with a mean value of SC 27,8cm (1) and
similar values were described in Nelore bulls (3), which are similar to
those found in this work. The age at puberty in Nelore bulls has
decreased in the past years, due to genetic improvement and animal
selection. Parameters as SC and weight at weaning are relevant
markers of genetic selection for sexual precocity.
P066
Comparison of reproductive performance in dairy cows
bred by Natural Service or Timed Artificial Insemination
Lima, F 1 *; Risco, C 1 ; Thatcher, M 1 and Thatcher, WW 2
1College of Veterinary Medicine, University of Florida, USA; 2 Department of
Animal Sciences, University of Florida, USA
Despite the compelling advantages of artificial insemination (AI), a
significant number of dairy producers use natural service (NS) for
their breeding program. The most common use of NS was after
unsuccessful AI attempts due difficult to do heat detection. Estrus
detection in order to AI cows is inefficient because not all cows are
identified in estrus due to: human errors, attenuated expression of
estrus in high producing cows, and adverse responses to heat stress.
Therefore, dairy producers claim that more cows are bred by NS
compared to AI because human errors in estrus detection are avoided
when bulls are used. Systematic breeding programs for AI at a
predetermine time (Timed AI; TAI) without the need for estrus
detection, coupled with early rebreeding of non pregnant cows are
successful options for reproductive management of lactating dairy
cows. The objective of this study was to compare the reproductive
performance of two breeding system without estrus detection. Six
hundred and forty one lactating Holstein dairy cows from a single
farm located in Florida were randomized at 42±3 days post partum
into two groups TAI and NS, and. Cows in the TAI group were presynchronized
with 2 injections of PGF 2α 14 days a part. Fourteen days
later an Ovsynch modified program was started. Eighteen days after
TAI, cows received a CIDR insert followed by insert removal and
GnRH administration 7 days. Cows were diagnosed for pregnancy by
ultrasonography examination at 32 days after TAI. Cows diagnosed
pregnant were re–examined by palpation per rectum of the uterus 28
days later. Cows diagnosed open at 32 days after TAI were given
PGF 2α , followed with an injection of GnRH at 56 hours after PGF 2α
and TAI 16 hours later. Cows not pregnant were re-synchronized
again with the same protocol until diagnosed pregnant or at a
maximum of 223 days post partum. Cows in the NS group received
PGF 2α at days 42 and 56 and moved to a bull pen at 70 days post
partum. After 42 days of being turned in with bulls, cows underwent
an ultrasonography examination to determine pregnancy status. The
same interval pos partum was observed for cows at NS group. Median
times to conception estimated from 32 d after breeding for TAI and
NS bred cows were 104 d (95 % CI = 100 to 104) and 103 d (95 %
CI = 72 to 105), respectively. However, analysis of pregnancy rate
(PR) for first service differed through 91 d postpartum (P < 0.01).
Twenty five per cent of all pregnant cows conceived 11 d (69 vs. 81
d) earlier in the TAI group at the end of the voluntary waiting period
(VWP). Cows bred to TAI become pregnant at a faster rate for the
first service at the end of the VWP than NS bred cows. Because PR
from NS was good for the first service in our study, this difference is
attribute to the TAI management and not necessarily better fertility.
P067
Oxidative Stage in Bovine Corpus Luteum
López-Ortega, A 1 *, MáRquez, A 1 , MáRquez, Y 1 , Fuentes, M 2
1UNIHM, Centroccidental " Lisandro Alvarado" University, Venezuela;
2Socials Science, Centroccidental "Lisandro Alvarado" University, Venezuela
The reactive forms of oxygen (ROS), also known as free radicals
(FR), are constantly produced by the organism as part of many
physiological functions. However, excessive production of FR can be
toxic and conduced to Oxidative Stress (OS). The objectives of the
present study were: (1) to measure the amount of malondialdehyde
(MDA), and conjugated dienes (CD); (2) to determine the
antioxidative capacity of the superoxide dismutase enzyme (SOD); (3)
to detect the presence of SOD, in mature and in regression corpus
luteum (CL). Measurement of MDA and CD were performed in 30
CL from slaughter Holstein cows, placed in buffer Tris-saccharose
(250 mM pH 7.2) at 4ºC and homogenized to obtain the supernatant.
Technique of TBARS was used to determine MDA and isopropanol
extraction was used to analyze CD. Calbiochem kit was used to
quantify SOD activity from 26 CL following kit instructions. Indirect

16 t h International Congress on Animal Reproduction
50 Poster Abstracts
immunefluorescence (IFI) was used to detect CuZn-SOD presence
from 133 CL slides. Statistical differences were determine by t-test
(p

16 t h International Congress on Animal Reproduction
Poster Abstracts 51
study investigated the relationships between these factors. A total of
84 normal beef heifers had their oestrous cycles synchronised using
two injections of prostaglandin (PG), 11 days apart and were fitted
with HeatWatch® devices. The time of initial standing event followed
by successive mounting activity was taken as the onset of oestrus
(D0). Heifers recorded in oestrus were inseminated 5 – 21hrs after
onset using semen from a single ejaculate from a high fertility bull.
Ovarian structures were ultrasonically examined with a 7.5-MHz
probe starting 12 hours after onset of oestrus and repeated every 6
hours thereafter until ovulation (OV) occurred. Time of OV was
determined from the time of the first scan on which the dominant
follicle (DF) had disappeared minus 3 hrs. Ovaries were re-examined
on day D7 to confirm OV and to measure luteal structures. Blood
samples were collected at 12 hour intervals on D -1, D0 and again on
D7 for IGF-I and P4 which were measured by IRMA and RIA,
respectively. Embryo survival (EmSurv) was confirmed by
ultrasonography at D30 and D100 post AI. The relationships between
EmSurv and continuous variables were evaluated using logistic
regression. EmSurv at D30 was 69% with two of the heifers suffering
foetal loss between D30 and D100. OV occurred (Mean±S.D) 27.4 ±
5.9 h after the onset of heat. There was no relationship between the
interval from onset of heat to OV or the interval from AI to OV and
EmSurv. (P>0.05). There was evidence of a relationship between the
size of the ovulatory follicle and EmSurv (Odds ratio=0.79; P=0.07).
There was a positive relationship between concentration of P4 on Day
7 and EmSurv (Odds ratio=1.4; P0.05) between P4 on D7 and ovulatory follicle size, CL volume or
concentrations of IGF-I on D-1, D0 or D7. Similarly there was no
relationship (P>0.05) between IGF-I concentrations and EmSurv. We
conclude that there was considerable variation in the timing of OV
relative to the onset of oestrus. Time of AI relative to heat onset and
or time of ovulation had no effect on embryo survival rate. There was
a positive association between P4 on day 7 and embryo survival but
not for IGF-I. Plasma P4 was not related to the size of the ovulatory
follicle, CL volume or plasma IGF-I. Oocytes produced from large
dominant follicles may have impaired embryo survival.
P071
Prevalence of clinical and subclinical endometritis in
dairy cows and the impact on reproductive performance
Madoz, L 1 *, Ploentzke, J 2 , Albarracin, D 3 , Mejia, M 4 , Drillich, M 2 , Heuwieser,
WS 2 , De La Sota, RL 1
1Catedra y Servicio de Reproduccion Animal, Facultad de Ciencias
Veterinarias, Universidad Nacional de La Plata, Argentina; 2 Bovine
Reproduction Clinic, Fac. Veterinary Sciences, Free University of Berlin,
Germany; 3 Catedra de Patologia, Fac.de Cs. Veterinarias, Univ. Nac. de La
Plata, Argentina; 4 Practica privada, Argentina
The aim of this study was to evaluate the prevalence of clinical (CE)
and subclinical (SE) endometritis and their impact on reproductive
performance in dairy cows. Samples were collected from 211 Holstein
cows in three farms in Argentina. Cows were examined for diagnosis
of clinical endometritis (CE) between 21 and 62 days postpartum
(dpp) at a monthly herd visit. At examination, cows were first
inspected for presence of fresh and/or dry discharge on the vulva,
perineum, or tail. Then the mucus content of the vagina was evaluated
for color, proportion of pus to mucus, and odor; and a score was
assigned as follows: clear mucus (0, [NOR]), predominantly clear
mucus with flecks of pus (1, [CE1]), purulent mucus but not foulsmelling
(2, [CE2]), or purulent or red-brown mucus and foul
smelling (3, [CE3]). After clinical examination, if mucus content was
NOR, cows were examined (EX1) for diagnosis of SE by endometrial
cytology (n=165). Cows were reexamined 14±3 d later (EX2).
Endometrial cytology samples were collected using a cytobrush
modified for use in cattle. Cytology slides were prepared by rolling
the CB on a clean glass microscope slide, air dried, fixed with ethylic
alcohol and stored in a slide box. Slides were stained with a modified
Wright-Giemsa stain and the degree of endometrial inflammation was
assessed by counting a minimum of 200 cells at 400 x magnifications
and expressed as the percent neutrophils (PPMN). The diagnosis
criteria for SE was >18% PPMN in samples collected 21-33 dpp,
>10% neutrophils in samples collected 34-47 dpp and >5% PPMN in
samples collected 48-62 dpp. At 50 dpp, cows with normal mucus
were detected in heat twice a day and AI. All AI cows were diagnosed
pregnant by transrectal palpation at 35-65 d post AI. At examination,
78.2% (165/211) of cows were diagnosed NOR and 21.8% with CE
(56.5% [26/46] CE1, 37.0% [17/46] CE2 and 6.5% [3/46] CE3). The
cytobrush was done in 149 of 169 NOR cows. The prevalence of SE
was 10.1% (15/149). At EX2, 87.5% (49/56) remained negative,
10.7% (6/56) changed from positive to negative and 1.8% (1/56)
remained positive. Cows with SE needed more services per
conception (2.77±0.45 vs. 1.96±0.18, p

16 t h International Congress on Animal Reproduction
52 Poster Abstracts
P073
Incidence of postpartum endometritis in dairy cows in
Argentina evaluated by vaginoscopy and endometrial
cytology
Mapletoft, RJ 1 *, Chesta, PM 2 , Bonomini, Y 2 , Ramos, M 2 , Rogan, D 3 , Bo, GA 2
1Large Animal Clinical Sciences, WCVM, University of Saskatchewan,
Canada; 2 Instituto de Reproduccion Animal Cordoba, Argentina; 3 Research
and Development, Bioniche Life Sciences, Canada;
As part of a larger experiment, data were collected to determine
factors influencing the incidence of postpartum endometritis in dairy
herds in Argentina. Lactating Holstein cows (67 first parity and 179
second or more parity), 25 to 35 days in milk and with body condition
scores between 2 and 3.5 (1 to 5 scale), from seven different herds
located on the same dairy farm in Cordoba province, Argentina were
used. Cows were examined by rectal palpation, vaginoscopy and by
cytobrush for evaluation of endometrial cytology and classified into
the following groups: normal cows (with no evidence of clinical or
subclinical endometritis) and cows with endometritis. Cows with
endometritis were further subdivided into those with subclinical
endometritis (with no evidence of purulent discharge but with >18%
neutrophils in endometrial cytology) and cows with clinical
endometritis (purulent discharge and >18% neutrophils). Data were
analyzed by logistic regression to evaluate the effects of herd, month
of the year (December to May), milk production, parity, body
condition score and ovarian status on the incidence of postpartum
endometritis. The presence of purulent material was not always
indicative of endometritis. Based on the percentage of neutrophils
found in the endometrial cytology samples, 15.5% (9/58) of cows
with purulent material in the anterior vagina had

16 t h International Congress on Animal Reproduction
Poster Abstracts 53
As conclusion the BCSc could be associated positively with the ZICS
and inversely with the time of ovarian activity postpartum.
P076
Evaluation of COX-2 and PGES gene expression in whole
blood during the peripartum of dairy cows
Silva, E 1 ; Gaivão, M 1 ; Leitão, S 1 ; Costa, L 1 ; Mateus, L 1 *
1Department of Reproduction and Obstetrics, C.I.I.S.A., Faculty of Veterinary
Medicine, Portugal
During the peripartum period dairy cows are immunosupressed and
predisposed to develop uterine infections. This has been associated to
abnormal leukocyte function and to changes in neutrophil gene
expression. High intra-uterine levels of prostaglandin E 2 (PGE 2) were
associated with delayed uterine involution and with the severity and
persistence of endometritis. PGE 2 production is stimulated by LPS of
gram-negative bacteria that contaminate the puerperal uterus and act
as a mediator of the inflammatory response. PGE 2 synthesis is
accomplished by cyclooxygenase 2 (COX-2) and prostaglandin E
synthase (PGES) . The objectives of this study were to evaluate in
whole blood: i) the pattern of COX-2 and PGES gene expression
during the peripartum period and, ii) the gene expression response to
LPS stimulation during peripartum.
Blood was collected from 17 dairy cows (9 had a normal puerperium
and 8 developed uterine infection) at 1 and 2 weeks before parturition
(wbp), at parturition and at 1 week after parturition. COX-2 and PGES
gene expression, before and after whole blood stimulation with LPS,
were quantified by Real Time PCR. Results were normalized with the
housekeeping gene ß2MG.
COX-2 gene expression decreased until 6 hours before parturition and
then significantly increased (p

16 t h International Congress on Animal Reproduction
54 Poster Abstracts
P079
Evaluation of oestrus detection efficacy and accuracy by
three methods in a confinement or pasture management
system with Holstein–Friesian cows
Mee, JF 1 *; Palmer, MA 2 ; Olmos, G 1,3 ; Boyle, LA 1
1Dairy Production Department, Moorepark Dairy Production Research Centre,
Teagasc, Ireland; 2 Royal (Dick) School of Veterinary Studies, University of
Edinburgh, Scotland; 3 School of Agriculture, Food Science and Veterinary
Medicine, National University of Ireland
The objective of this experiment was to compare the efficacy of three
methods of oestrus detection [visual observation (VO), tail paint (TP)
and radiotelemetry-HeatWatch® (HW)] in two management systems
[cubicle housing with a total mixed ration (HOUSED) and rotational
pasture with concentrate supplementation (GRASS)]. The 46
randomly allocated and blocked, spring-calving Holstein-Friesian
cows were monitored by the three oestrus detection methods
simultaneously from ten days postcalving for nine weeks on the same
farm. The occurrence of nine selected behaviours associated with
oestrus was also recorded during the thrice daily 20 minute visual
observation sessions. Thrice weekly milk sampling for progesterone
analysis (EIA) was used to determine the dates of true standing
oestrus events (oestrus detection accuracy). Data were analysed by
proc Frequency, Genmod, Npar1way, Ttest and Univariate, as
appropriate, in SAS. All three detection methods had a higher oestrus
detection efficacy in the GRASS (VO 59, TP 65 and HW 69%)
compared to the HOUSED treatment (VO 20, TP 26 and HW 37%)
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 55
P082
An abnormal gonadal development in bovine XY female
may be caused by the formation of iso-Y chromosome
during meiosis
Miyake, YI 1 *, Matsui, M 1 , Moriyama, C 2 , Kamimura, S 2
1Department of Clinical Veterinary Science, Obihiro University of Agriculture
and Veterinary Medicine, Japan; 2 Department of Veterinary Science,
University of Miyazaki, Japan
Introduction It has been reported that some types of chromosomal
aberration relate with some types of abnormal development of genital
organs in domestic animals, especially in cattle. Those animals with
absolute or relative sterility are the object of that research; 1) to
eliminate them from herd, and 2) to understand the abnormal
conditions. Here, we would like to report some results about the cases
of bovine XY female. Results 1. Clinical findings: A total of 9 cases
were composed of Holstein (n=7), Japanese Black (n=1) and Jersey
(n=1). Although all cases showed a female type in appearance, they
did not show any estrous symptoms until 23 month old after the birth.
Genital organs The ovaries and uterus were very small. Moreover,
follicles and corpus luteum were not observed in ovaries. However,
none of male reproductive organs were detected after slaughter.
Chromosomal analysis The cells derived from blood, skin, spleen
and kidney cultures showed 60,XY only. In the one smallest
metacentric Y chromosomes, the only centromere was darkly stained
by G-banded staining, although the short arm was darkly stained in
normal Y chromosome.
Detention of Sry gene by PCR method In the normal bull (60,XY),
the Sry gene was detected by PCR method. On the other hand, the
Sry gene was not detected in normal female (60,XX) and in the
present cases (60,XY).
Analysis of structure of Y chromosome by FISH method In Y
chromosome from normal bull, one signal of the bovine Y-specific
primers, BC 1.2 was hybridized to the distal area of short arm, but in
Y chromosome from the present cases, two signals of BC 1.2 were
hybridized to same position of both arms. In Y chromosome from
normal bull, one signal of another bovine Y-specific primers, btDYZ-
1 was hybridized in close proximity to the centromere of short arm,
while in Y chromosome from the present cases, two signals of
btDYZ-1 were hybridized to the same position of both arms. 6.
Endocrinological measurements by RIA: The high levels of
peripheral FSH and LH, and low levels of peripheral P4, E2, T and irinhibin
were maintained during 23 days. Furthermore, the cyclic
changes of hormones as normal female were not observed.
Conclusion It was assumed that the abnormal Y chromosome from
the present cases is iso-Y chromosome composed of double short
arms which may be formed during spermatogenesis. Furthermore, a
set of Y chromosome without Sry gene and X chromosome will
induce gonadal dysgenensis and also abnormal endocrinologicalte
status in the present bovine XY female.
P083
Ovarian structures and ovulation rate following GnRH
and progesterone treatment in anestrous Bos indicus
cows
Montiel, F 1 *; Lamothe, C 1 ; Severino, V 2
1Faculty of Veterinary Medicine, University of Veracruz, Mexico; 2 Faculty of
Veterinary Medicine, Autonomous National University of Mexico, Mexico
Introduction Bos indicus cattle predominant in tropical regions
exhibit low reproductive efficiency because of prolonged periods of
postpartum anestrus, characterized by a pronounced delay of
development of dominant follicles and first ovulation. Many
treatments used for the re-establishment of postpartum ovarian
cyclicity include the use of a vaginal insert impregnated with 1.9 g of
progesterone (CIDR®, controlled internal drug-releasing device). In
these protocols, GnRH has been used to synchronize follicular wave
emergence and ovulation for timed artificial insemination (TAI). We
evaluated the effect of treatment with CIDR plus GnRH on the
ovarian structures and ovulation rate of postpartum suckled anestrous
Bos indicus cows.
Methods On days -14, -7 and 0 (day 0=start of treatment),
ultrasonography (US) was performed in all cows to confirm anestrus,
but with the presence of ovarian follicles ≥10 mm diameter on day 0.
On day 0, 68 cows received one of the following treatments: 1)
GnRH+CIDR+GnRH (n=15): cows were given i.m. 100 μg of a
synthetic GnRH (Gonadorelin) plus one CIDR, which remained in
situ 7 days, plus 100 μg of GnRH at 24 h after the CIDR removal; 2)
GnRH+CIDR (n=14): 100 μg of GnRH plus one CIDR (7 days in
situ); 3) CIDR+GnRH (n=15): one CIDR (7 days in situ) and 100 μg
of GnRH at 24 h after its removal; 4) CIDR (n=12): one CIDR (7 days
in situ); 5) Control (n=12): no treatment. From days 1 to 7, US was
performed daily to characterize changes in the ovarian structures as a
result of treatment. From days 8 to 10, US was performed every 6 h to
determine the time of ovulation.
Results The groups treated with CIDR and GnRH showed greater
number of follicles and larger average follicular size, compared to the
control group (P

16 t h International Congress on Animal Reproduction
56 Poster Abstracts
Results Number (±SEM) of follicles (34±1.16 vs 14±1.39, P

16 t h International Congress on Animal Reproduction
Poster Abstracts 57
NEFA in HPC (0,44 ± 0,08 mmol/l) opposite LPC (0,23 ± 0,11
mmol/l) ((P0,05). We recorded no significantly changes of
concentrations of TG, urea and AST between groups during ante and
postpartum period. Dynamic changes IGF–I, NEFA and glucose in
plasma or serum may help predict and evaluate relationship between
milk yield, nutrition and subsequent reproductive status of high
producing cows. (Funded by VEGA 1/3484/06 and AV 4/0009/07)
P088
Effect of restricted suckling on superovulatory response
and reproductive performance in early postpartum
Japanese Black cows
Oshima, K 1 *; Ochiai, Y 1 ; Pradhan, R 2 ; Kojima, T 1 ; Yamamoto, N 1
1National Agricultural Research Center for Western Region, Oda, Shimane,
Japan; 2 Graduate School of Hiroshima University, Higashi-Hiroshima,
Hiroshima, Japan
Factors such as suckling and nutrition affect the reproductive
performance after parturition in cows. The objective of this study was
to investigate the effect of restricted suckling on the superovulatory
response and subsequent reproductive performance in early
postpartum Japanese Black cows. Fifty cows were used in this study.
During the postpartum period, these cows were fed 100% of the
estimated daily nutrient requirements according to the Japanese
Feeding Standard for Beef Cattle (2000). Body weights of cows and
calves were measured twice monthly. The average daily gain (ADG)
was calculated for each month. At 7 days postpartum, the cows were
classified into 2 groups: (1) continuous access of calves to them from
birth to weaning at 3 months postpartum (ad libitum suckling; n = 21)
and (2) twice daily suckling by calves that were penned adjacent to
them (restricted suckling; n = 29). All cows received a controlled
internal drug releasing device (Easi-Breed; InterAg, Hamilton, New
Zealand) at 40 days postpartum and were subsequently
superstimulated with a total dose of 20 armour units FSH (Antrin 40;
Kawasaki-Mitaka, Kanagawa, Japan) twice daily, with gradually
decreasing doses from day 45 until day 47. Embryos were
nonsurgically collected 7 to 8 days after estrus. The ovaries were
examined by ultrasonography and the number of CL and remaining
follicles (RF) were counted. After uterine flushing, the cows were reemployed
for reproductive purposes. The intervals to first estrus and
conception after flushing and days open were examined. Data were
analyzed by Student’s t-test. ADG of cows in the second month
postpartum in the ad libitum suckling group was significantly smaller
than that in the restricted suckling group (P < 0.05). There were no
significant differences between the ad libitum and restricted suckling
groups in the number of CL (20.7 ± 10.0 vs.17.0 ± 9.2), RF (4.7 ± 3.6
vs. 5.9 ± 7.0), recovered ova or embryos (10.6 ± 7.4 vs. 11.1 ± 8.8),
and transferable and freezable embryos (6.4 ± 5.4 and 5.2 ± 5.0 vs. 7.4
± 7.0 and 6.2 ± 6.9). In contrast, the intervals to first estrus and
conception after flushing and days open in the restricted suckling
group were significantly shorter (P < 0.05) than those in the ad libitum
suckling group (9.0 ± 5.6, 27.1 ± 27.5, and 83.7 ± 27.5 vs. 28.0 ±
23.6, 44.2 ± 30.1, and 101.0 ± 30.2). These results suggest that
restricted suckling in early postpartum Japanese Black cows does not
affect the superovulatory response and embryo quality; however, it
does affect their reproductive performance after flushing.
P089
Integration of CIDR in timed artificial insemination
protocol in lactating dairy cows
Pancarci, SM 1 *, Gurbulak, K 2 , Gungor, O 1 , Orkun Demiral, O 3 , Thatcher, WW 4
1Department of Obstetrics,Gynecology & Reproduction, Faculty of Veterinary
Medicine, Kafkas University, Turkey; 2 Department of Obstetrics,Gynecology &
Reproduction, Faculty of Veterinary Medicine, Erciyes University,
Turkey; 3 Department of Artificial Insemination and Reproduction, Faculty of
Veterinary Medicine, Erciyes University, Turkey 4 Department of Animal
Sciences, University of Florida, United States
The objective of this study was to investigate the use of a controlled
internal drug [progesterone] release (CIDR) device inserted
concurrently with or the day after initiation of Ovsynch/TAI protocol.
Lactating Holstein dairy cows in central Turkey (n=162) were
assigned to receive the Ovsynch protocol (OVSYNCH;
synchronization of ovulation by injecting GnRH 7 d before and 56h
after PGF2α, followed by one fixed-time AI [TAI] 16 to 18 h after the
second GnRH injection; n=49], Ovsynch plus a CIDR insert for 7 d,
beginning at the first GnRH injection (OVSYNCH + CIDR7; n=63)
or Ovsynch plus a CIDR insert for 6 d, beginning the day after the
first GnRH injection (OVSYNCH + CIDR6; n=50). All cows used in
this study were restricted to not having a detected estrus prior to TAI
and had a palpable follicle at TAI. Pregnancies were diagnosed with
transrectal ultrasonography and palpation per rectum 32 and 45-60
days after TAI, respectively. Pregnancy rates at 32 days after TAI
were 30.6% (15/49), 39.7% (25/63) and 54.0% (27/50) in
OVSYNCH, OVSYNCH + CIDR7 and OVSYNCH + CIDR6 groups,
respectively. The stepwise logistic regression procedure indicated that
cows in OVSYNCH + CIDR7 group had 0.56 (0.26-1.19) times less
chance to get pregnant than those in OVSYNCH + CIDR6 group at 32
days after TAI. Similarly, cows in OVSYNCH group had 0.38 (0.17-
0.86) times less chance to get pregnant than those in OVSYNCH +
CIDR6 group at 32 days after TAI. Pregnancy rates 45-60 days after
TAI were 14.3% (7/49), 20.6% (13/63) and 38.0% (19/50) in
OVSYNCH, OVSYNCH + CIDR7 and OVSYNCH + CIDR6 groups,
respectively. Significant differences (P

16 t h International Congress on Animal Reproduction
58 Poster Abstracts
for Mobile communications upon activation of the device due to the
pressure of foetus and fluid engaged into the birth canal
http://www.sisteck.com/. There has been no such report in calving
management, therefore the objective of the present study was to
determine the onset of delivery by using the C6 Birth Control ® on
both calving Holstein Friesian heifers and cows.
Materials and methods The study has been carried out on 17 heifers
and 15 Holstein cows. Upon observation of signs of approaching
parturition the C6 birth control ® device was applied just upon the
ventral commissure of the vulva. At the onset of parturition the
obstetric examination was carried out in order to determine the extent
of cervical dilation, foetal presentation, position and posture. Length
of parturition time from alarm activation to complete foetal expulsion
was recorded.
Results The meantime needed to apply the device was 5.36±0.04 and
4.54±0.03 min. for heifers and cows, respectively (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 59
29.9±0.9, 33.4±1.0, 31.3±0.9, 32.9±1.0, respectively. At calving birth
was coded as 0 (eutocia; n=61) or 1 (dystocia including easy and hard
pulls, malpresentation, caesarean section; n=10).
Pelvic area of the heifers was taken by Rice Pelvimeter two months
prior to mating and at four months gestation. There was a relationship
between pelvic area at selection with dystocia (p=0.08) such that a
unit increase in pelvic area reduced the likelihood (odds) of dystocia
by 0.956 fold (p=0.07). There was no relationship between pelvic area
taken at 4 months and dystocia.
There was no effect of nutrition in trimester 1 on calf birth weight.
There was a significant effect (p=0.011) of nutrition in trimester 2;
high nutrition resulted in heavier calves (8.2%). The odds ratios
indicate that a one unit rise in calf weight (1kg) results in a 1.44 fold
increase in the likelihood (odds) of dystocia (p=0.003).
The effect of nutrition during critical periods of pregnancy on birth
weight, and the relationship between high birth weight and dystocia,
is evident. This effect of high nutrition on birth weight during this
window may indicate sensitivity of the developing fetoplacental unit
to insult at this time. Reports that feto-pelvic disproportion accounts
for the majority of losses in extensively managed herds (1) is
supported. As well as economic loss for the grazier of the calf and or
heifer there are welfare considerations which need to be addressed in
the effective management of the heifer herd.
1. Johnson et al (1988) J Anim Sci; 66:1081
P094
Effect of body condition at calving on glucose, insulin
and progesterone concentrations postpartum in dualpurpose
cattle under tropical conditions
Pinto-Santini, L 1 *; Drescher, K 1 ; Martinez, N 1 ; Ruiz, A 2 ; Dominguez, C 3 ;
Rossini, M 2
1Facultad de Agronomía, Universidad Central de Venezuela, Venezuela;
2Facultad de Ciencias Veterinarias, Universidad Central de Venezuela,
Venezuela; 3 Área de Agronomía, Universidad Rómulo Gallegos, Venezuela
To evaluate postpartum (PP) changes in the glucose (G) and insulin
(Ins) concentrations of dual propose (DP) cows with different body
condition score (BCS) at calving, and their relation with the return of
the ovarian activity (OA) through the plasma P 4 levels, 28 cows (3/4 a
5/8 Bos taurus x 1/4 a 3/8 Bos indicus) were randomly assigned to 1
of 4 treatments (T) in a 2x2 factorial arrangement with 2 levels of
BCS at calving (NIRD 1 to 5): high BCS (BCS1>2.5) and low BCS
(BCS20.05), but on day 45 there was a trend (P=0.08) the BCS in
accumulated G levels (mg/dL) (BCS1=262.6; BCS2= 239.4). BCS
affected Ins levels on all days evaluated with concentrations for days
3, 15, 30, and 45 of 9.3, 17.1, 25.8 and 34.2 mUI/ml for BCS1 and,
4.4, 8.6, 13.4 and 19.3 mUI/ml for BCS2, respectively. For P 4 , there
was found only effect of the BCS at 37 and 45 days. The
concentrations of P 4 (ng/ml) for BCS1 and BCS2 were: 3.214 vs.
0.731 at day 37 (P

16 t h International Congress on Animal Reproduction
60 Poster Abstracts
conditions on the onset of puberty in beef heifers in Uruguay.Thirty
six Angus x Hereford heifer calves weaned (8 month old, 138.7+3.1
kg) were managed to achieve three gains of weight rates for 16 weeks
(winter period): i) grazing on native pastures to loose weight (Low=L;
n=12), ii) grazing on improved pastures of a mixture of Lotus
corniculatus, Trifolium repens and Lolium multiflorum to allow
animals to present moderate LWG (Medium=M; n=12), and iii)
grazing on the same mixture pasture but to present high LWG
(High=H; n=12). After, all heifers were managed on the same
improved pastures during the following 27 weeks (spring and
summer). Animals live weight (LW) was recorded at biweekly
intervals. All heifers were blood sampled weekly for progesterone
analysis from week 18 to 43 and puberty was defined as the first of
two consecutive samples with progesterone greater than 1 ng/ml.
During winter period daily LWG was 0.134±0.03, 0.385±0.03 and
0.535±0.03 kg/a for heifers in L, M and H treatments, respectively
(P0.05) between group1 ( 91.6%, 41.2±1.6 h and 48.9%) and group2
(89.7%, 39±1.2 h and 55.8%). In conclusion using norgestomet
implant for 9 days with combined of steroids or GnRH on day 0 and
PG and PMSG on day 7 and 9 after implant insertion can be used to
synchronize estrus cycle with acceptable pregnancy rates in dairy
cattle. In this program injection GnRH or steroids has no significant
effect on the reproductive indices.
P099
BOVINE RENIN GENE EXPRESSION IN PREOVULATORY
FOLLICLES AND CYSTIC OVARIAN DISEASE
Rizzo, A,.*, Guaricci, AC., Minoia, G., Spedicato, M.*, Mutinati, M., Manca,
R., Trisolini, C., Sciorsci, RL.
Department of Animal Production, Faculty of Veterinary Medicine, Bari, Italy
Recent evidence indicates that the ovarian renin-angiotensin system
(RAS) may play a significant role in the process of ovulation and it
may be involved in the etiopathogenesis of polycystic ovarian
syndrome, in women. The aim of this study was to evaluate the renin
mRNA expression in ovarian cystic wall and preovulatory follicle in
cow .
Total RNA was extracted from wall strips of bovine preovulatory
follicle and cystic follicle, from ovaries collected at a local
slaughterhouse, using a commercial kit allowing DNAse treatment on
column during preparation. Retrotranscription of 2 micrograms total
RNA was performed using SuperScript III First Strand (Invitrogen,
Milan, Italy) and cDNA underwent PCR with specific intron-spanning
primers chosen on the alligned sequences of Homo Sapiens renin gene
(Genebank accession AY436324.1) and a partial Bos Taurus renin
gene (Genebank accession XM589248.3).
A test was conducted to check the exponential phase amplification of
renin gene. This test employed 120μl final volume PCR mixture (200
ng of cDNA, 1 unit of HotMaster taq polymerase, 0.25mM dNTPs, 1

16 t h International Congress on Animal Reproduction
Poster Abstracts 61
mM each primer) taking 10μl from the tube starting from cycle 28 up
to 35. The same procedure was followed for the house-keeping β-
actin gene utilized to demonstrate the integrity of extracted RNA and
for the semi-quantization of renin gene expression relative to a
normalized level of transcription.
PCR amplification profile includes a denaturation step of 94°C for 2
min, 34 cycles of 94°C for 45s, 58°C (56°C for β-actin) for 45s, 72°C
for 1min, and a final step at 72°C for 5min. All the amplification
products, together with a 100 bp DNA ladder, were ran on 1.5%
agarose gel stained with Ethidium Bromide and images were digitally
captured with a CCD camera. Densitometric analysis was performed
using the QuantityOne software (BioRad, Milan, Italy) and mRNA
renin expression was normalized against the level of β-actin mRNA.
A high renin gene expression was evidenced in both preovulatory and
cystic bovine follicles. The expected size fragments: 188 bp for renin
and 243 bp for β-actin were observed after gel electrophoresis. The
PCR quantification of Renin expression was performed calculating
the ratio between the amount of PCR product in the linear
amplification range of the target gene and the endogenous reference
gene.
The relative Renin gene expression level in the preovulatory follicle is
1.15 time higher than in the cystic follicle. These results well correlate
with previous evidence, conducted by Doppler ultrasonography. In
fact, our studies evidenced a more abundant vascularization in the
preovulatory follicle than in the cyctic one. Low levels of renin in the
cystic follicles are supposed to be an expression of a consistent
involvement of RAS in the development of cysts pathology.
P100
Pathological findings in the female genital tract of infertile
/ subfertile cattle with focus on endometrial biopsy
Rodenbusch, S 1 *; Ellenberger, C 1 ; Hauffe, C 2 ; Lenz, M 2 ; Kießling, A 3 ; Sobiraj,
A 2 ; Schoon, HA 1
1Institut für Veterinär-Pathologie, Universität Leipzig, Germany;
2Ambulatorische und Geburtshilfliche Tierklinik, Universität Leipzig, Germany;
3Forschungsprojekt der Interessengemeinschaft der
Erzeugerzusammenschlüsse (IGE) in Sachsen e.V., Projekt zur Erarbeitung
von Strategien zur Verbesserung der Fruchtbarkeit in Hochleistungsherden
der Sächsischen Milcherzeugung, Germany
Fertility disturbances are common in high-performance dairy cows. In
many cases, alterations of the endometrium are clinically not
detectable.
The genital tracts of 97 cows culled either due to symptomless,
clinically not definable infertility (70%) or deficiencies like low milk
yield (30%, fertility status not available) were collected. Ovaries,
fallopian tubes and uteri were examined macroscopically and
histologically. Of these animals, 30 cows were examined clinically
and gynaecologically with two endometrial biopsies taken of each 1-3
days before slaughter.
Regarding the ovaries, 59 animals did not show any alterations.
Pathological findings were luteinized (n=15) or Graafian follicle cysts
(n=15) or ovarian neoplasms (granulosa cell tumor, n=2, and rete
adenoma, n=6). Concerning the fallopian tube, in 11 % a hydrosalpinx
was diagnosed, 32 % revealed intraepithelial cysts, 36 % showed mild
to moderate salpingitis, and 32 % were without pathological findings.
By macroscopical examination, 81 uteri showed no alterations, 12
revealed clear mucus within the lumen and in 4 cases a purulent
endometritis was found. In contrast, by histopathological examination
only one uterus was without any pathological findings. Histological
alterations, varying in quantity and quality, could be detected in 96
uteri: 86 cows showed a periglandular fibrosis (“bovine
endometrosis”), 69 angiopathies, and 61 an endometritis, mostly
nonpurulent. In most cases, several alterations occurred
simultaneously.
Due to sampling artefacts, only 47 of 60 biopsies could be examined
histologically. In 29 of 30 cases, at least one of the two biopsies was
evaluable. There is a far-ranging conformity comparing the findings
in the biopsy with those in uterine samples collected post mortem.
In conclusion the majority of cows with subclinical fertility
disturbances exhibited endometrial findings which are not apparent by
conventional clinical or macroscopical examination but are detectable
by lightmicroscopy. A comparison of histopathological findings in
biopsies and in the uteri examined post mortem revealed nearly
identical alterations taking the quality and quantity into account.
Therefore, the endometrial biopsy is a potential tool to diagnose
subclinical endometrial alterations in infertile or subfertile cattle.
Nevertheless, in order to establish the potential diagnostic tool
“endometrial biopsy” in cattle as a prognostically meaningful method,
further investigations, especially in fertile animals, are necessary.
P101
The use of immunodulation with Mycobacterial Cell Wall -
DNA Complex (MCC) as a potential treatment for
endometritis in cattle
Rogan, D 1 *, Bo, GA 2 , Chesta, PM 2 , Bonomini, Y 2 , Ramos, M 2
1Bioniche Life Sciences, Canada; 2 Instituto de Reproduccion Animal Cordoba,
Argentina
An experiment was designed to evaluate varying doses of
Mycobacterial Cell Wall - DNA Complex (MCC) on neutrophil
(PMN) infiltration on the endometrium of 243 Holstein cows 25 to 35
days in milk. On Day 0, cows were examined by rectal palpation,
vaginoscopy and endometrial cytology (cytobrush) and grouped into
one of two disease categories: cows with no evidence of clinical
endometritis (further subdivided into normal and cows with
subclinical endometritis based on >18% PMN in the endometrial
cytology sample), and cows with clinical endometritis (purulent
cervical discharge). Cows in each disease category were then assigned
at random and by replicate into one of four treatment groups to
receive 1500, 4500 or 13500 µg of MCC diluted in 10 ml of
endotoxin-free water for injection or 10 ml of water (control
treatment). Endometrial cytobrush samples were taken on Days 2 and
7 to measure PMN response. Time-series data were analyzed using
the MIXED procedure for repeated measures and proportions were
compared by chi-square test. There was a day by treatment interaction
(P

16 t h International Congress on Animal Reproduction
62 Poster Abstracts
P102
Oestrus synchronization and non return rate in dairy
cows treated by two types of prostaglandin
Córdova, A 1 *; Ruiz, CG 1 ; Córdova, MS 2 ; Córdova, CA 3 ; Guerra, JE 4 ; Tapia, B 5
1Departamento de Producción Agrícola y Animal. Ecodesarrollo de la
Producción Animal. Cuerpo Académico: Salud y Bienestar Animal.
Universidad Autónoma Metropolitana-Xochimilco. Calz. del Hueso 1100 Col.
Villa Quietud CPP. 04960, México, D.F.
* aci57@prodigy.net.mx; 2 Laborarotorios Brovel, S.A.de C.V.; 3 Becario de
CONACYT-México. Estudiante de Doctorado. Universidad de León, España;
4Facultad de Agronomía. Universidad Autónoma de Sinaloa, México;
5Estudiante de Doctorado. Facultad de Veterinaria. Universidad Complutense
de Madrid, España
Introduction The implementation of technical and innovative
biotechnologies in the bovine production, improves the reproductive
efficiency, the oestrus synchronization it is an example; they can be
used similar of prostaglandins F2α to shorten the cycle oestrus; that
which improves the oestrus presentation, facilitates the artificial
insemination (AI), it can decrease the return percentage to oestrus;
obtaining a better handling of the cluster, since more homogeneous
partitions is obtained in the Unit of animal Production.
Objetive Value the effect of the administration of two prostaglandins
types F2α (Sodium Cloprostenol and right-handed Cloprostenol) on
the synchronization percentage and not return to oestrus in dairy
cows.
Methods 20 cows were used in production of race Holstein Friesian,
which were divided in two groups of 10 animals each one. Before
beginning the study, the animals were selected, by means of the
ecography use, to verify the ovarian health. In the group 1, 10 cows
were used, to which were administered 25 mg via intramuscular of
sodium Cloprostenol. The group 2, with animals, to which were
administered 25 mg of right-handed Cloprostenol via intramuscular.
The oestrus detection was carried out realized for observation of
characteristic clinical signs and AI was carried out by means of the
method AM/PM. The not return to the oestrus it was verified to the 21
days after the AI.
Results The results of oestrus synchronization for the first group
(sodium Cloprostenol) they were from 10% to the 12 hours, 20% at
the 24 hours, 40% to the 48 hours and 30% at the 72 hours after the
administration of the prostaglandin. The group 2 (right-handed
Cloprostenol), the synchronization percentage was from 20% to the
48 hours, 10% to the 56 hours and 70% at the 72 hours. In both
groups 90% was obtained of not return to oestrus.
Conclusion The administration of sodium Cloprostenol could
represent an alternative to be used in synchronization programs and
not return to oestrus in dairy cows in production.
P103
Effect of body condition on uterine involution, ovarian
activity and ovarian IGF-1 receptor expression in dual
purpose cattle during the postpartum period under
tropical conditions
Ruiz, A 1 *; Dominguez, C 3 ; Martinez, N 2 ; Perez, R 3 ; Pinto, L 2 ; Drescher, K 2 ;
Rojas, J 1 Fernandez, A 1
1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela,
Venezuela; 2 Facultad de Agronomía, Universidad Central de Venezuela,
Venezuela; 3 Instituto para el Desarrollo Sostenible de Sistemas
Agroambientales, Universidad; Experimental Rómulo Gallego, Venezuela
Differential responses on the reproductive performance of cattle,
depending on the body condition (BC) at calving and during the
postpartum period, have been shown. Insulin like growth factors
(IGFs) act modulating gonadotrophin action at a cellular level. Eight
(8) crossbred (Bos taurus x Bos indicus) dual purpose cows were used
and assigned randomly to one of two treatments: T1, low body
condition (BC < 2.5) and low feed level (LF, 85% of the nutritional
requirements) or high feed level (HF, 115% of the nutritional
requirements); T2, high BC (> 2.5) and LF or HF levels. Reproductive
activity and uterine involution (UI) were evaluated once a week by
means of transrectal palpation and ultrasound (Aloka SSD 900 Co.
Ltd., Tokyo, Japan) from 15 to 45 days post-partum (DPP) using a 7.5
MHz linear probe. Plasma progesterone (P 4 ) levels were measured by
RIA (DSL, Diagnostic Systems Lab, Inc., TX, USA) at 3, 15, 22, 33,
37, and 45 DPP. Uterine involution, characteristics of cervical mucus
(CCM), symmetry of uterine horns (SUH), uterine position (UP), and
cervix diameter (CD) were studied. Ovarian structures (corpora lutea
and follicles) were evaluated by ultrasound. Ovarian follicles were
classified according to their diameters: Class 1 (≤ 5 mm); Class 2 (6-9
mm) and; Class 3 (≥10 mm). At 45 DPP, ovaries were collected
within 30 min after slaughter. One ovary was used to evaluate the
morphology of oocytes, which were categorized as follows: type A
(oocyte with the presence of a clear and compact cumulus oophurus
and translucent ooplasm); type B (oocyte with dark and compact
cumulus oophurus and dark ooplasm) and; type C (oocyte with dark
and expanded cumulus oophurus and dark ooplasm). The other ovary
was used to study the IGF-1 receptor expression by Western blot
analysis. Results were analyzed by the SPPS (version 10), using a
non-parametric correlation and the Kruskal and Wallis tests. The nonparametric
ANOVA showed that BC at calving affected type C
oocytes (P< 0.01). A similar result was found by the correlation
analysis (-.816*). There was not any effect of BC at calving on UI and
follicle classes. Plasma P 4 levels were affected by BC at calving from
33 DPP. The ovarian IGF-1 receptor showed a higher expression in
animals under T1, compared with those animals in T2. The results
suggest that BC at calving is one of the factors involved in the
resumption of the reproductive activity during the postpartum period
under tropical conditions. Also, it appears that IGFs act as modulators
of gonadotrophin functions at the ovary level in this species.
P104
Ultrasonographic detection of embryo and its
development in crossbred cows
Sahatpure,SK.*, Pardhi.SM. & Khillare,KP.
Postgraduate Institute of Veterinary &Animal Science Akola Maharashtra
India-444104 (Under Maharashtra Animal &Fishery Science University
Nagpur )
Ultrasound was used for the detection of embryo and its development
in 6 cyclic crossbred cows from day 20 to day 60 after breeding.
In the present study, synchronization of estrus was carried out by
administrating Lutalyse (PGF 2 α). The number of cows responded to
treatment was 100 per cent and the average time required for onset of
estrus was 59.83 ± 1.14 hours.
In the present study all artificially inseminated crossbred Cows were
scanned with diagnostic ultrasound scanner equipped with a linear
array, 7.5 MHz transducer designed for intrarectal placement. All
animals were scanned ultrasonographically with an interval of 5 days
from day 20 to day 60 after breeding.
The embryonic vesicle was first visible on day 20. The embryo proper
was first time observed in all cows on mean day 25. The heart beats of
the embryo proper was detected on day 27.5 ± 1.44. The allontois,
amnion, forelimbs, hind limbs and optic area were first identified on
day 28.75 ± 1.25; 30; 32.5 ± 1.44; 33.75 ± 1.25 and 28.75 ± 2.39,
respectively. The spinal cord, ribs and fetal movements were observed
on average day of 47.5 ± 2.39; 55 and 53.75 ± 1.25, respectively.
The accuracy of early pregnancy diagnosis in means of
ultrasonography were 66.66, 83.33 and 100 per cent on day 20 th , 25 th
and 30 th day of gestation, respectively, whereas, sensitivity and
specificity of ultrasound pregnancy diagnosis was 75 and 50 per cent
on day 20 respectively and 100 per cent on day 25 and 30 of gestation.
P105
Frequency of detection of estrous behavior
accompanying early postpartum ovulations in fertile dairy
cows
Sakaguchi, M
National Agricultural Research Center for Hokkaido Region, NARO
Introduction Increased milk yield in dairy cattle causes a continuous
and serious decline in their fertility. Many factors such as genetic

16 t h International Congress on Animal Reproduction
Poster Abstracts 63
selection and management are involved with this problem, and
expression of estrous behavior is one of the important factors
determining the dairy cows’ fertility. It has been well known that
anestrous ovulations often occur during early postpartum period, but
the details on the frequency and timing of the events are not clear.
Materials and methods To confirm the occurrence of ovulation 100
lactations of Holstein cows were examined by ultrasonography or
rectal palpation 1 - 3 times per week. The cows were visually
observed at least 2 times per day to detect estrous behavior with the
aid of a heatmount detector or tail painting. Cows exhibited standing
estrus (ST) or mounting activity with other estrous symptoms (MT)
were considered to be in estrus, and that was confirmed by subsequent
ovulation. After 45-day of voluntary waiting period, estrous cows
with normal cyclicity were served AI. Conception was confirmed by
ultrasonography at 35-40 days after AI. Data were analyzed by
ANOVA, and P < 0.05 was considered significant.
Results Because 8 lactations were not accompanied with conception,
total 368 ovulations from 92 lactations of 69 cows were analyzed.
Total number of anestrous ovulation was 136 (37 %), and the
frequencies of first postpartum estrus expression were 11, 55, 28, 4,
and 2 % at 1st, 2nd, 3rd, 4th, and 5th ovulations, respectively. From
2nd to 5th ovulations, the frequencies of expressing ST were
increased from 10 to 74 %, while 19 – 24 % of ovulations were
accompanied with MT only. In 14 lactations, total 17 times of
anestrous ovulation was confirmed after the postpartum first estrus,
and almost all of the occurrences of returning to anestrus were
observed at 2nd to 4th ovulations. Mean 305-day milk yield was 8,067
kg (n = 36), 10,063 kg (n = 23), and 10,595 kg (n = 33) for 1st, 2nd,
and > 3rd or later lactations, respectively. The frequency of anestrous
ovulations in 1st lactation cows were 32 %, while those in 2nd and >
3rd lactation cows were 42 and 38 %, respectively. Cows exhibited
first estrus at 2nd (n = 50) and 3rd (n = 26) ovulation had significantly
shorter days open (92 and 85 days) than those at 1st (n = 10) and 4th
or 5th (n = 6) ovulation (118 and 127 days)
Conclusions These results on the frequency of estrus expression and
subsequent fertility in high-yielding dairy cows can be useful
information to study and improve their reproductive performance.
P106
Association among andrologic selection, semen freezing,
acrosome induced reaction by heparin (AIR) and profiles
of heparin binding proteins (HPB) of semen in young
Nelore bulls
Salvador, DF 1 *; Andrade, VJ. 2 ; Nogueira, LAG. 3 ; Vale Filho, VR. 2 ; Silvano,
JO. 4 ; Santoro, MM. 4 ; Folhadella, I 2 ; Salvador, RRS 4
1Center of Science and Distance Education, Fundação CECIERJ, Brazil;
2Faculty of Veterinary Medicine, Universidade Federal Minas Gerais, Brazil;
3Faculty of Veterinary Medicine, Universidade Federal Fluminense, Brazil;
4Institute of Biology Science, Universidade Federal Minas Gerais, Brazil
Introduction The profile of heparin binding proteins (HPB),
andrologic parameters, profile of semen freezing and acrosome
reaction was evaluated from the semen of young Nelore bulls.
Material Andrologic and semen freezing parameters were evaluated
from 55 young Nelore pre-selected bulls. However, the functional
tests of the sperm quality was performed in 16 bulls, as well as their
associations with proteins profile from seminal plasma, searching for
andrologic markers for high fertility and semen freezing. A specific
analysis for “heparin binding proteins”(HBP) and their association
with “acrosome induced reaction” (AIR) was performed. The analysis
of proteins was made a system of fast performance liquid
chromatographic (FPLC) with a column of affinity to heparin and
after by electrophoresis of poliacrilamide.
Results and discussion The overall mean for sperm motility, vigor
and viability were, respectively, 66.4±5.7; 4.8±0.4 and 76.3±8.5%
pre-freezing, and 29.4±8.5; 4.6±0.6 and 34.5±11.1% post-freezing.
The post-freezing recovery mean was 44.5±13.4%. The overall
average of post-freezing acrosome integrity was 84.9±6,05% reducing
to 76.1±8.14% after four hours of incubation. The mean of postfreezing
AIR was 18.53±9.59, ranging from 8 to 43%. Differences
(p>0.05) were not registered, when comparing bulls of high and low
AIR for the parameters: acrosome integrity, andrologic and sperm
freezing. The concentration of total proteins in the seminal plasma
ranged from 3,18 to 52,7 mg/ml, with average of 26,8±20,5 mg/ml.
The profile of the gel filtration in proteins of the seminal plasma
showed eight different fractions. In the seminal plasma there were
identified five different picks of proteins with affinity of heparin,
being identified 16 bands of proteins with different molecular
weights. The forth and fifth picks of seminal plasma proteins with
affinity of heparin were associated to the high percentages of AIR, as
well as the frequency of the proteins of 14, 18, 21 and 29 kDa. In the
proteins of the sperm membrane were identified three different picks
of heparin affinity, containing seven different bands. However, this
pool has only a 56 kDa protein which was associated to AIR.
Conclusions Semen freezing tests, acrosome integrity and AIR are
important complementary tests in bull selection for fertility, since they
showed high variability even in andrologicaly pre-selected bulls. The
evaluation of proteins with affinity to heparin in seminal plasma was
shown effective for prediction of AIR rate, and could act as
biochemical markers.
P107
The significance of uterine E. coli infection in the early
postpartum period of diary cows
Santos, NR*; Galvão, KN; Brittin, SB; Gilbert, RO
Department of Clinical Sciences, College of Veterinary Medicine, Cornell
University, United States
We studied postpartum uterine bacterial infection, endometrial
cytology and follicular function in 58 Holstein cows in a single dairy
herd in central New York. During the first postpartum week
Escherichia coli was the commonest organism isolated from the
uterus. Arcanobacterium pyogenes, which is more commonly
associated with persistent uterine disease, appeared later, peaking in
prevalence at around 3 weeks postpartum.
Cows with E. coli infection at one week postpartum were at increased
risk for A. pyogenes infection at 3 weeks postpartum (OR = 8.07, 95%
CI = 2.22 – 29.27; z = 3.18; P = 0.0015). These cows were also at
increased risk of being infected with anaerobic bacteria at 3 weeks
postpartum (OR = 4.53, 95% CI = 1.06 – 19.41; z = 2.037; P = 0.04).
In turn, cows infected with A. pyogenes at 3 weeks postpartum had
greater numbers of neutrophils in endometrial cytology samples at 5
weeks postpartum (31.1 +/- 25.7% vs. 10.5 +/- 12.1%; P = 0.0008)
and were at decreased risk of pregnancy by 150 days postpartum (OR
= 0.24, 95% CI = 0.06 – 0.95; z = 2.031; P = 0.04).
A known detrimental effect of postpartum uterine infection is
impaired ovarian follicular growth and function. In our study, the first
postpartum dominant follicle reached a significantly smaller
maximum diameter in cows infected with E. coli on the day of calving
than in cows free of E. coli at that time, regardless of infection with
any other bacteria (9.44 +/- 2.44 mm vs. 14.39 +/- 2.57 mm; P <
0.0001). Follicular size was not related to infection with other
bacterial species.
Our results indicate that uterine infection with E. coli in the first week
postpartum mediates impaired follicular function and increased risk
for subsequent infection with known uterine pathogens, leading to
development of subclinical endometritis, and reduced chance of
pregnancy by 150 days postpartum.
P108
The Effect of LH Surge on Regulation of Agiogenic
Factors (VEGF and Angiopoietin) and Matrix-Metallo
Proteinases (MMP) in Bovine Follicles
Berishak, B; Kliemk, H; Meyerk, HHD; Schamsk, D*
Physiology Weihenstephan, Technical University of Munich, Freising,
Germany
The aim of this study was to evaluate the regulation pattern of VEGF-
A (isoforms 121, 165, 189, VEGF-R1, VEGF-R2), Angiopoietin
(ANPT-1, ANPT-2, Tie-1, Tie-2) and Matrix-Metallo Proteinases
(MMP-1, MMP-2, MMP-14, MMP-19, TIMP-1, TIMP-2) in time

16 t h International Congress on Animal Reproduction
64 Poster Abstracts
defined follicle classes before and after GnRH application. Ovaries
containing periovulatory follicles or new corpora lutea (CL day 1-2)
were collected at 0h, 4h, 10h, 20h, 25h (follicles) and 60h (CL)
relative to injection of GnRH. The MMP-1 mRNA increased rapidly
4h after GnRH (during LH surge) and remained high during the whole
experimental period. In contrast, the MMP-19 mRNA increased
significantly only after ovulation. The TIMP-1 mRNA increased 4h
after GnRH and again after ovulation. Transcripts of VEGF isoforms
(VEGF121, 165, 189) were upregulated 4h after GnRH. All VEGF
isoforms and their receptors were upregulated again after ovulation.
The VEGF peptide content in follicular fluid decreased 20h followed
by an increase in follicle class 25h after GnRH. ANPT-1 mRNA
decreased significantly in follicles 4h after GnRH. ANPT-2 decreased
10h after GnRH and in the follicle group around ovulation. Tie-1 and
Tie-2 mRNA expression decreased in follicle group around ovulation,
with a further increase in early CL tissue. It is likely that the decrease
of ANPT-1 and therefore the increase of the ANPT-2/ANPT-1 ratio
during the LH surge is a basic mechanism of vascular remodelling in
follicles during periovulation. In conclusion, the temporal expression
pattern of angiogenic factors ANPT and VEGF as well as member of
MMP during periovulation suggests them to be important mediators
of the ovulatory process and the early CL formation (angiogenesis) in
cow.
P109
Changes of the cow’s endometrium, distribution of
growth stimulating and degradation factors in
postparturition period
Sematovica, I 1 *; Jemeljanovs, A 1 ; Pilmane, M 2
1Research Institute of Biotechnology and Veterinary Medicine „Sigra”, LUA
Latvia; 2 Institute of Anatomy and Anthropology, RSU, Latvia
Introduction Remarkable morphological and physiological changes
occur in the uterus tissue, blood vessels, and nerves during the
reproductive cycle and gestation. AIM of the research was to reveal
inflammatory factors, neuropeptide-containing innervation,
distribution of the growth stimulating and degradation factors, and the
apoptosis in the cows’ endometrium in after parturition period.
Materials and methods Nine cows were biopsied twice – in the first
and the fifth week after parturition. At the Institute of Anatomy and
Anthropology of Riga, Stradins University were performed analyses:
immunohistochemically (IMH) were detected matrix
metalloproteinases type 2 and type 9 (MMP–2 un MMP–9, working
dilution 1:100, R&D, England), tumor necrosis factor–α (TNF–α,
1:100, Abcam, England), interleukin–10 (IL–10, 1:400, Abcam,
England), vascular endothelial growth factor (VEGF, 1:50,
DakoCytomation, Denmark), nerve growth factor receptors p75
(NGFR p75, w.d. 1:150, DakoCytomation, Denmark) protein gene
product 9.5 (PGP 9.5, 1:1600, DakoCytomation, Denmark), and
TUNEL method was used for detection of apoptosis. Also staining for
hematoxylin and eosin was performed for each sample.
Results There were detected a significant increase of the number of
inflammatory cells, TNF–α amount, and expression of VEGF, NGFR
p75 (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 65
P112
Genomic characterization of Arcanobacterium pyogenes
isolates recovered throughout the puerperium of dairy
cows
Silva, E 1 *; Gaivão, M 1 ; Leitão, S 1 ; Jost, B 2 ; Carneiro, C 3 ; Vilela, C 3 ; Costa, L 1 ;
Mateus, L 1
1Department of Reproduction and Obstetrics, C.I.I.S.A., Faculty of Veterinary
Medicine, Portugal; 2 Department of Veterinary Science and Microbiology,
University of Arizona, USA; 3 Department of Microbiology and Immunology,
C.I.I.S.A., Faculty of Veterinary Medicine, Portugal
In dairy cows, the establishment and persistence of the puerperal
uterine infection is related to the characteristics of the bacteria that
colonize the uterus. The clinical signs and reproductive consequences
of the uterine disease are generally attributed to the presence of a few
pathogens, mainly Arcanobacterium pyogenes (A. pyogenes) alone or
in synergy with other bacteria. In order to identify factors that might
be associated with the establishment and persistence of uterine
infection, we characterized A. pyogenes isolates obtained throughout
the puerperal period of dairy cows from two unrelated herds.
The isolates were recovered from 26 cows (8 had normal puerperium
and 18 developed uterine infection). The genomic characterization of
A. pyogenes (n= 57) was performed by BOX-PCR typing and by
screening of putative virulence factors through conventional PCR.
Considering a genomic similarity of at least 86%, a total of ten
different clonal types (5 in each herd) were identified. These clonal
types were totally herd-specific and a single type appeared to
predominate in each herd. Only one clonal type was not associated
with endometritis, while four others were always associated with
uterine disease. However, 5 clonal types were present in cases of both
normal puerperium and endometritis. Throughout the puerperal
period, 1 to 3 clonal types were sequentially or simultaneously
isolated from the same animal.
In order to identify virulence factors associated with the development
of infection, all isolates were tested for the presence of 8 putative A.
pyogenes virulence genes: plo (encoding pyolysin), nanH and nanP
(encoding neuraminidases), cbpA (encoding a collagen-binding
adhesin) and four different fimbrial genes (fimA, fimC, fimE, fimG).
The 8 genes were present in 66% of the isolates, 5 of 8 genes (plo,
nanH, nanP, cbpA, fimA) were detected in all isolates, fimE in 97%,
while fimC and fimG were only present in a subset of isolates. There
was no association between BOX-PCR type, presence of the above
genes and development of uterine infection.
The results of this study suggest that the type of A. pyogenes may not
be a determinant factor in the development of uterine infection. Host
intrinsic factors and/or the synergism between A. pyogenes and other
bacteria may play a more relevant role in the establishment of
puerperal infections.
This research was funded by the grant POCTI/CVT/48773/2002 from
“Fundação para a Ciência e Tecnologia”. Maria Elisabete Silva is a
post-doc fellow from FCT.
P113
Bacteriological and histological studies of cow’s uterus
without and with retained fetal membranes
Skuja, S 1 *; Antāne, V 1 ; Feldmane, L 2
1Faculty of Veterinary Medicine, Latvian University of Agriculture, Latvia;
2Department of Pathological Anatomy, Riga Stradins University, Latvia
Introduction Retention of fetal membranes is economically important
disturbances during the postpartum period in cattle in Latvia. Several
methods have been suggested for the treatment of retained fetal
membranes, and controversial results have been published. The aim of
the study was to investigate the postpartum period of cows without
and with retained fetal membranes.
Materials and methods Bacteriological samples of the cow’s uterus
and biopsies of the uterus mucous membranes were collected from 29
Holstein cows. The bacteriological examination was performed in
cows with and without retained fetal membranes (RFM) two, 14, 40 –
50 days postpartum (PP). On day 40-50 all cows were biopsied from
the uterus endometrium and the uterus status was estimated
histologically. According to the 3rd stage of parturition process
(expulsion of fetal membranes), cows were divided into the following
groups:Control group – fetal membranes were expelled in 6-12 h
PP;Group 1 – cows with RFM, removed manually and treated;Group
2 – cows with RFM, it was not removed manually.Group 2 cows with
health disturbances (fever, milk fever, mastitis) were treated
adequately.
Results Bacterial isolates of uterus on day two PP in all cows (100%)
contained a wide spectrum of microorganism associations: in 41% of
cases there were single isolates – E. coli 33%, Streptococcus spp. 5%
and Clostridia spp. 3% , and in 59% there were mixed isolates – E. c.
27%, Streptococcus spp 3%, Clostridia spp 26%, Staphylococcus spp.
3%. On day 14 PP, 93% of cows had microorganisms in the uterus. In
addition to the above findings there was one isolate of A. pyogenes in
the cow with RFM that was removed manually two days PP. In the
next bacteriological examination (40-50 days PP) no bacteria were
found, and in 84 days PP after two times of artificial insemination the
cow became pregnant. In group 2 cows, which were treated, the
number of isolated bacterial species increased on day 14 PP. At the
same time cows of group 2, which were untreated, the number of
isolated bacterial species remained the previous one, and the number
of isolates decreased. On day 40-50 PP, bacterial isolates were found
in 86.2% of cows. Cows with a normal parturition process were 50%
with single bacterial isolates (Streptococcus spp. and
Corynebacteriom spp.). There were no differences between the
bacterial species and their number of group 2 treated and untreated
cows. In 82.8 % of all investigated cows, histological findings showed
evidence of mild to moderate endometritis.At this time, 33.3% ( 8
cows) become pregnant.
P114
Identifying AI bulls associated with poor fertility and high
rates of embryo loss
Sunde, J. 1 * and Refsdal, AO. 2
1Team Semin BA, P.O. Box 8146 Dep., N-0033 Oslo, Norway; 2 Geno
Breeding and AI association, N-2326 Hamar, Norway
The relationship between fertility and semen quality is not always
clear. Occasional AI bulls may show poor fertility even though semen
passes quality testing. These bulls represent a potential loss for the
dairy farmer, and may even possess undesirable genetic traits that
could affect fertility in future generations. It is therefore important
that these bulls are identified at an early stage in the breeding
programme as soon as insemination data are available for analysis.
Norwegian Red (NRF) is the dominant dairy breed in Norway and
semen is distributed by Geno, a farmer-owned cooperative. Close to
100% of inseminations are reported back to Geno and 95 % of
farmers also report data on calvings, stillbirths and culls through the
Norwegian Dairy Herd Recording System. These data allow
calculation of accurate non-return rates (NRR) and calving rates (CR)
on sire basis. At present, bulls with NRR60 < 65 % after approx. 1000
first inseminations of semen for progeny testing are routinely culled.
However, this parameter alone may not be sufficient to identify
animals with potential negative impacts on fertility traits. It was
therefore investigated whether further analysis of sire fertility data
would yield additional information.
The data set consisted of 479330 first inseminations on Norwegian
Red (NRF) heifers and cows, with semen from 692 qualified NRF test
and elite sires. Inseminations were performed between January 2000
and Oct 2007. The first day of return-to-service was registered as a
second insemination within 92 days after first insemination (pfi), and
a minimum of 1000 first inseminations per bull was required to
qualify for the study.
NRR curves were modelled using survival analysis, with day of return
as outcome parameter, adjusted for confounding factors. Sires were
classified as having either‘poor’ or ‘good’ fertility if their NRR92
deviated from the mean by more than 3 standard deviations.
Compared to high fertility sires, poor fertility sires showed a more
abrupt fall in NRR from 21 days onwards, suggesting a lower rate of
fertilisation and/or higher incidence of early embryo death (before
maternal recognition). These sires also displayed a higher number of
returns-to-service outside of the normal oestral cycle length. This

16 t h International Congress on Animal Reproduction
66 Poster Abstracts
suggests delayed oestrus indicative of late embryo death (after
maternal recognition on day 17). This may suggest a sire-specific
effect on embryo survival that partly could have a genetic component.
Further studies will include flow cytometric studies of sperm from
poor fertility sires.
P115
Na + /K + ATPase regulates tyrosine phosphorylation and
capacitation in bovine sperm through multiple signal
transduction pathways
Thundathil, J 1 *; Newton, L 1 ; Kastelic, J 1,2 ; Wong, B 3 ; van der Hoorn, F 4
1Department of Production Animal Health, Faculty of Veterinary Medicine,
University of Calgary, Canada; 2 Lethbridge Research Centre, Agriculture and
Agri-Food Canada, Canada; 3 Regional Fertility Program, Calgary Health
Region, Canada; 4 Department of Biochemistry and Molecular Biology,
University of Calgary, Canada
Introduction Cryopreservation prematurely capacitated bovine
sperm, reducing the fertile life-span of sperm in the female
reproductive tract. Understanding the cellular and molecular
regulation of sperm capacitation will have implications for improving
the fertility of frozen semen, as well as predicting bull fertility. In
somatic cells, inhibition of Na + /K + ATPase (a cell membrane protein)
with its specific inhibitor ouabain initiated cellular responses similar
to signalling mechanisms leading to sperm capacitation, suggesting a
role for this protein in the regulation of sperm capacitation. Although
the α1ß1 isoform of this protein is ubiquitous, α4ß3 is testicular
specific; both are sensitive to ouabain. We previously reported that
specifically inhibiting this protein with ouabain induced tyrosine
phosphorylation and capacitation in bovine sperm. The objective of
this study was to investigate the molecular regulation of tyrosine
phosphorylation and capacitation induced by inhibition of
Na + /K + ATPase
Methods Fresh sperm from Holstein bulls was incubated with specific
inhibitors of protein kinase A (PKA), protein kinase C (PKC),
receptor tyrosine kinase (rTK), or non-receptor tyrosine kinase (Src),
alone or in combination, for 30 minutes prior to a 4 hours incubation
with or without ouabain (100 µM). Sperm preparations were
electrophoresced and immunoblotted with anti-phospho-tyrosine
antibody. Capacitation status of sperm from parallel sperm
preparations were determined, based on their ability to undergo an
acrosome reaction.
Results Inhibition of Na + /K + ATPase activity with ouabain initiated
tyrosine phosphorylation in a cohort of sperm proteins and
capacitation in bovine sperm. However, pre-treatment with inhibitors
specific for rTK, PKA or PKC partially inhibited these processes,
suggesting involvement of these signalling molecules. Additionally,
there was evidence of cross-talk between signalling molecules.
Simultaneous inhibition of Src and rTK or Src, rTK and PKC in
combination resulted in greater inhibition of tyrosine phosphorylation
and capacitation than the individual effects of these inhibitors.
Conclusion We inferred that Na + /K + ATPase regulated tyrosine
phosphorylation and capacitation through multiple signalling
pathways involving protein kinase A, protein kinase C, receptor
tyrosine kinase and nonreceptor tyrosine kinase. However, since
ouabain inhibited both α1ß1 and α4ß3 isoforms, the unique role of
the testicular specific isoform of Na + /K + ATPase in the regulation of
sperm function remains to be elucidated.
P116
Effect of different energy sources on milk production,
body condition score and reproductive performance of
dairy cows during the transition period
Torres Artunduaga, MA*, Gesteira Coelho, S; Campos, BG; Quintao Lana, AM;
Matana Saturnino, H; Maia Borges, A; Braga Reis, R; Castro Meneses, G
Federal University of Minas Gerais, UFMG, Brazil
Introduction Solving reproductive problems of post partum dairy
cows has become one of the main targets of the scientific community
even thought the advances in this field are partial in most of the
conducted research, that is, some work is done with nutrition only and
others just focus on reproduction. Today there is a need to get
throughout the problem by a multidisciplinary strategy involving
nutrition and reproduction issues. However, the effects of negative
energy balance on reproductive performance have been elucidated and
formulation of balanced rations for post partum dairy cows in order to
minimize the decrease in dry matter intake and mobilization of body
reserves during post partum have been utilized, the reproductive
efficiency parameters such as conception rate, days open, interval
between parturition, among others, still show that dairy farms have
this problem without a practical solution.
Objective Based on the above mentioned considerations the objective
of this study was to evaluate the effect of the addition of different
energy sources such as calcium salts of polyunsaturated fatty acids
(Megalac –E), toasted soybean and propylene glycol on milk
production, body condition score and reproductive performance of
dairy cows during the transition period.
Material and methods 48 multiparous Holstein cows were used on
this trial. Cows received the energy sources from 28 days before the
expected calving date until 21 days post partum. Cows were
distributed randomly in 4 treatments (control, Megalac-E, toasted
soybean and propylene glycol). Body condition score was performed
at 21 days pre-partum and once per week until 46 days post partum.
Milk production was recorded on days 10, 20, 30 and 40 post partum.
All cows were scanned using ultrasound from 10 days post-partum
every two days until day 46 post-partum. Before each ultrasound
scanning, uterine involution was evaluated and scores were given
according to position of uterus on cavity and uterine content.
Results Milk production for control, Megalac-E, toasted soybean and
propylene glycol was 24, 25, 20, and 25 kg respectively. Body
condition score between groups did not differed but cows consuming
Megalac-E showed the more uniform score through the entire trial.
Expulsion of placenta on Megalac –E group was observed at 3,5 hours
after parturition. For control, toasted soybean and propylene glycol
this average time was 7,5, 9,5 and 4,5 hours after parturition. Cows on
control group had their first ovulation after parturition at 29 days
while cows receiving Megalac –E had it with 23 days after delivery.
The cows fed toasted soybean and propylene glycol had their first
ovulation at 30 and 35 days respectively.
Conclusions These preliminary report, indicate that the use of energy
sources such as calcium salts of polyunsaturated fatty acids could be
advantageous regarding animal health and reproductive performance.
P117
Evaluation of strategies to improve cyclicity in Bos
indicus-influenced heifers
Tribulo, HE 1 *, Chesta, PM 2 , Brandan, A 3 , Cuestas, G 2 , Lozano, P 3
1Facultad de Ciencias Agropecuarias, Universidad Nacional de Cordoba,
Argentina; 2 Area de Investigacion, Instituto de Reproduccion Animal Cordoba
-IRAC-, Argentina; 3 Produccion, Compania Anglo Cordoba de Tierrras SA,
Argentina
A study was designed to evaluate strategies to increase cyclicity prior
to breeding in 15 month-old Bos indicus-influenced heifers. The first
experiment evaluated the effect of progesterone (P4) priming,
beginning 40 or 20 days before breeding. Fifteen month-old, Bos
indicus X Bos taurus heifers (n = 547) with body condition scores of 3
to 3.5 (1 to 5 scale) were examined by ultrasonography (Chison Vet
500, 5 Mhz) 40 days before (Day -40) and at the beginning of the
breeding season (Day 0) to determine the presence or absence of a CL
(cyclicity). Heifers were allocated to one of three treatment groups: an
untreated control group and two P4-treated groups that received a P4-
releasing vaginal device (0.75 g of P4, Prociclar, Zoovet, Argentina)
for 8 days followed by 1 mg estradiol benzoate (Zoovet) at time of
device removal, beginning 40 or 20 days prior to the breeding season.
The percentage of cycling heifers on Day -40 did not differ among
groups (65.6%, 118/180; 65.0%, 115/117 and 66.8%, 127/190 for
heifers in the P4 on Day -40, P4 on Day -20 or the control groups,
respectively). However, the percentage cycling heifers on Day 0 was
significantly higher (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 67
experiment was designed to compare P4-priming with the
biostimulatory effect of vasectomized bulls beginning 30 days before
the breeding season. The experiment involved 639 15 month-old Bos
indicus X Bos taurus heifers from the same farm. Heifers were
examined by ultrasonography on Days -30 and 0 and allocated into
three treatment groups: a P4 treated group that received a Prociclar for
8 days followed by 1 mg of estradiol cypionate (Zoovet) at the time of
device removal, beginning on Day -30, a group that was exposed to
seven vasectomized bulls for 30 days and an untreated control group.
The percentage of cycling heifers on Day -30 did not differ among
groups (55.0%, 115/209; 55.7%, 117/210 and 55.5%, 122/220 for P4-
priming, bull-exposed and control groups, respectively). However, the
percentage of cycling heifers on Day 0 was significantly higher
(P

16 t h International Congress on Animal Reproduction
68 Poster Abstracts
of artificial insemination (AI) with dose containing low-sperm
numbers have been used to optimize use of elite bulls. The objectives
of the present study were to evaluate the effects of the semen dilution
to low-sperm number/dose on sperm motility and integrity of sperm
plasma membrane in the cryopreservation process, using 2
commercial extenders (Triladyl®, Bioxcell®) and LDL extender
prepared in our laboratory, 97 % purity. 15 ejaculates were collected
from 5 fertile crossbred bulls (Bos taurus x Bos indicus). After
collection, semen volume and concentration were assessed. Sperm
motility was evaluated by computer-assisted semen analysis
(Hamilton Thorne Biosciences), morphological sperm characteristics
were evaluated by differential interference microscopy and the
integrity of plasma membranes was determined using the hypoosmotic
swelling test (HOST). The semen was subsequently divided
into 3 aliquots and diluted with the 3 extenders. 15 ejaculates from 5
bulls were diluted to 120, 60 and 20 x 106 sperm /mL. The different
semen dilutions were packaged in 0.25 mL straws and frozen. Two
straws of semen from each treatment were thawed, and the semen
parameters were evaluated. The sperm motility post thawing at 120,
60 and 20x106 sperm/mL dilutions with the different extenders
respectively were: LDL 53.06 ± 4.6 %, 41.72 ± 4.6 %, and 29,33 ± 7.3
%, Bioxcell 45.79 ± 7.8 %, 33.33 ± 12.2 %, and 18.19±+ 6.2 %, and
Triladyl 46.39 ± 4.5 %, 32.59 ± 6.26 %, and 17,13 ± 5.7 %. With
respect sperm plasma membrane integrity the respective values for
each dilution with the 3 extenders were: LDL 52,59+/-2.08%,
41,40+/-7.31% and 30,35+/-6,29%, Bioxcell 46,12+/-3.45%,
34,12+/3,45% and 18,98 ± 4,86% and finally Triladyl 46,87 + 3,28 %,
35,06 + 5,52 % and 24,26 + 4,45 %. The statistical analysis
(ANOVA) revealed that LDL extender was more effective in
preserving sperm motility and integrity of sperm plasma membrane
than Bioxcell® and Triladyl® (p6.0 ng/mL)
categories of plasma [P4] in pregnant and non-pregnant animals were
compared using chi-square analysis. No CL was identified on the
ovaries of 58 (22.3%) animals. At least one CL was found on the
ovaries of 77.6% (201 of 259) of the recipients; but because the
quantity of embryos was limited only 182 received embryos.
Pregnancy rates were 56.4 and 30.2% for MOET and IVP derived
embryos, respectively. Plasma [P4] was greater in MOET recipients
that were later diagnosed as pregnant than in non-pregnant animals
(5.88±0.77 vs. 3.98±0.48 ng/mL, respectively; P0.05). Pregnancy
rates also did not differ among animals showing low, medium or high
plasma [P4] (P>0.1). Plasma [P4] was correlated with CL area (r=
0.60; P0.10), nor pixel heterogeneity (14.8 vs. 14.5; P>0.1)
amongst pregnant and non-pregnant MOET or IVP recipients. In
conclusion, corpus luteum area and echotexture was not a useful
predictor of pregnancy status in recipients. Plasma [P¬4] relationship
with pregnancy rate was evident for recipients inovulated with MOET
but not for IVF embryos, in which embryo quality seems to be a more
critical variable.
P122
Effects of breed and feed system on milk production,
body condition score and reproductive performance
Walsh, S 1,2 *; Buckley, F 1 ; Pierce, K 2 ; Byrne, N 1 ; Patton, J 1 ; Dillon, P 1
1Teagasc, Dairy Production Research Centre, Moorepark, Fermoy, Co.Cork,
Ireland; 2 School of Agriculture, Food Science & Veterinary Medicine, UCD,
Belfield, Dublin 4, Ireland
Introduction Intense genetic selection for milk production within the
Holstein-Friesian breed has resulted in marked improvements in milk
production, but has predisposed animals to decreased reproductive
performance. The correlated response in feed intake to selection for
milk yield is approximately half, resulting in a greater degree of body
tissue mobilization in early lactation, the duration and magnitude of
which can impact health and fertility. The aim of this study was to
investigate differences in milk production, reproductive performance
and BCS between alternative breeds and crossbreds.
Materials and methods The dataset consisted of 749 records from
309 cows across 5 years: 79 Holstein-Friesian (HF), 54 Montbeliarde
(MB), 24 Normande (NM), 57 Norwegian Red (NRF), 57 MB×HF
(MBX) and 38 NM×HF (NMX). Breeds were randomized to either a
low concentrate (LC~500kg/cow) or high concentrate feed system
(HC~1090kg/cow). Milk yield (kg/day) was recorded daily. Body
condition score (BCS) was recorded every 3 to 4 weeks. Reproductive
parameters included 24 day submission rate (SR24), pregnancy rate to
first service (PREG1), overall pregnancy rate (FINALPR) and calving
to conception interval (CCI). Milk yield, BCS and CCI were analyzed
using PROC MIXED, while SR24, PREG1 and FINALPR were
analyzed using PROC GENMOD (SAS, 2006). The model included
the effects of breed, feed system, parity, year and calving day of year.
A pre-experimental covariate was created for milk yield and BCS to
adjust for differences that may have existed in pre-experimental
performance. Interactions between breed and feed system were not
significant.
Results Breed and feed system influenced milk yield and BCS
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 69
P123
Comparison of ovulation, fertilization and early
embryonic survival in low-fertility beef cows as compared
to fertile cows and virgin heifers
Warnick, AC.*, and Hansen, PJ
Department of Animal Sciences, University of Florida, Gainesville Florida
USA
The objective of this research was to determine physiological causes
of low fertility in beef cows. Fertility was compared between lowfertility
beef cows (34 British cows during 2 years and 93 Brahman
crossbred cows during 3 years; defined as cows that did not get
pregnant when mated to fertile bulls in one or two breeding seasons);
fertile cows (16 Brahman crossbreds; defined as cows having a calf in
several of preceding breeding seasons) and virgin heifers (40
Brahman crossbreds at 2 years of age). All females tested were
negative for Brucella and Vibrio fetus. Females were mated by fertile
bulls and killed at either 3 or 34 days after breeding to obtain
reproductive tracts and determine ovulation, fertilization, and
condition of embryos. There were no differences between groups in
ovulation or fertilization rate at Day 3 of pregnancy. Overall,
ovulation rate was 85.9%, rate of recovery of oocytes/embryos was
82.1% and fertilization rate was 76.4%. The proportion of cows that
were not detected in estrus before Day 34 of pregnancy was lower
(P

16 t h International Congress on Animal Reproduction
70 Poster Abstracts
P126
Accuracy of ultrasonography in the diagnosis of silent
heat in cows compared to plasma progesterone
concentration
Zdunczyk, S*; Janowski, T; Ras, M; Baranski, W
Department of Animal Reproduction, University of Warmia and Mazury in
Olsztyn, Poland
Silent heat is defined as the lack of behavioral oestrus symptoms
although the genital organs are undergoing the normal cyclical
changes. It is the main reason of post-partum anoestrus in dairy cows
causing elongation of service period and, in consequence, substantial
economical losses. Rectal palpation is a main method used for clinical
evaluation of ovarian activity in dairy herds, but it may cause high
proportion of misdiagnosed and incorrectly treated animals.
Ultrasonography is considered an important diagnostic aid to rectal
palpation. The aim of this study was to assess the accuracy of
ultrasonography for the diagnosis of silent heat compared to plasma
progesterone concentration. The study was carried out in 5 dairy herds
in North-East Poland. Cows, which showed no visible oestrus signs
until day 60 postpartum were examined by ultrasonography twice, in a
10-day interval. A real-time, B-mode scanner (Honda 1500) with 5
MHz probe was used. Blood samples were collected simultaneously
from the tail vein into heparinised evacuated tubes. Progesterone
concentration in blood plasma was determined using RIA. Presence of
physiological ovarian structures (follicles, corpus luteum) was an
indication of cyclicity in anoestrous cows. High progesterone level on
the first, but low on the second examination or low on the first and
high on the second examination were interpreted as a silent heat.
Based on progesterone values silent heat was diagnosed in 145
anoestrous cows, whereas ultrasonographically 106 cows were found
with silent heat. The accuracy of ultrasonography in diagnosis of
silent heat in cows was 89.0 %. The sensitivity and specificity of this
method for diagnosis of corpus luteum were 94.7 % and 84.0 %,
respectively. Our results showed that ultrasonography is useful tool to
diagnose of silent heat in cows.
Poster 02 - Reproduction of Small Ruminants
P127
Trehalose improves ram semen cryopreservation when it
is present in conventional extenders
Aisen, E.*, Pelufo, V., Malcotti, V., Morello, H., Medina, V., Venturino, A.
Laboratorio de Teriogenología, Facultad de Ciencias Agrarias, Universidad
Nacional del Comahue. C.C. 85 (8303), Cinco Saltos (Río Negro), Argentina
It is well known that trehalose improve the post-thawing sperm
viability and fertility when it is added in hypertonic conditions. The
aim of this study was to apply trehalose in three different extenders
used commonly in ram semen cryopreservation. The solutions (with
or without trehalose 100 mosm/L), containing Tris, citric acid,
fructose or glucose, glycerol, egg yolk and antibiotics, were B1
(experimental), S (Salamon’s extender) and Tri (Triladyl®).
Ejaculates from four Merino rams were evaluated and pooled at 30°C.
The semen was diluted to contain 1x10 9 cells/mL, cooled to 5°C,
loaded into 0.25-mL straws, frozen and stored in liquid nitrogen. Postthaw
evaluation was based on sperm motility (MI), supravital stain
(Eo), acrosome integrity (AI), hyposmotic swelling test (HOST),
middle piece function (PI) and incubation resistance at 39ºC, 4 h
(TR).
Majority, post-thaw parameters were higher in those treatments with
trehalose, specially MI, AI, PI and TR, indicating that this
disaccharide in this conditions improve the morphology and function
status of cryopreserved spermatozoa. The extender S with trehalose
showed the best results: MI=63,0%; Eo=58%; TR=50%, PI=0,92;
AI=75,8%.
We conclude that, in that trial, trehalose protects membranes integrity
and physiological parameters, and could improve the fertility results
in artificial insemination programmes with cryopreserved ram semen.
P128
Measurement of sperm capacitation and acrosome
reaction - like changes by chlortetracycline test (CTC) can
predict the freezability of ram semen
Azevedo, HC. 1 *; Bicudo, SD. 2 ; Sousa, DB. 2 ; Maia, MS. 3 ; Rodello, L. 2 ;
Sicherle, CC. 2
1Embrapa Coastal Tablelands, Aracaju, Brazil; 2 Faculty of Veterinary
Medicine and Anim. Science, São Paulo State University, Brazil; 3 Embrapa
Tropical Semi-Arid, Petrolina, Brazil
The purpose of this study was to know if the chlortetracycline test
(CTC) applied to fresh semen can predict the performance of ram
spermatozoa in cryopreservation. Ejaculates of 25 Santa Inês rams
were collected and the CTC assay was applied in fresh semen diluting
a sample (24 x 10 6 spermatozoa) in 1000 μL of PBS (37 o C) and
submitting it to centrifugation (900 g/4´) to remove the seminal
plasma. The sperm pellet was then resuspended (150 μL – PBS) and
an aliquot (10 μL) was mixed with 10 μL of 1mM CTC (20mM - Tris;
130mM – NaCl; 5mM - L-Cysteine). The mixture was homogenized
for 20 seconds and then it was added to 10 μL of 1% of
glutaraldehyde solution (2M - Tris). A 10 μL-sample of this
suspension was placed on a heated slide (37 o C) and mixed with 10μL
of 0.22 M 1,4-diazabicyclo[2.2.2]octane (DABCO – PBS:Glycerol -
1:9). The mixture was covered with coverslips, compressed, sealed
and stored at 4 o C in the dark to be evaluated within 1 hour using an
epifluorescent microscope under oil (1000x). A total of 100 cells were
counted for each slide and distributed into 3 categories: uncapacitated
with intact acrosome (F), capacitated with intact acrosome (B) and
acrosomal reaction sperm (AR). To frozen semen, the ejaculates were
diluted in egg yolk Tris extender (100 x 10 6 spermatozoa/0.25mL),
cooled (0.25°C/minute to 5°C - 120 minutes), frozen (-20°C/minute to
-120°C) and thawed (42°C/20´´). The frozen-thawed semen was
evaluated as for spermatic plasmatic membrane integrity (PMI) by
association of propidium iodide (PI – 0.5 mg/mL) and Pisum sativum
agglutinin conjugated with fluorescein isothiocyanate (PSA-FITC -
100 g/mL). The rams were grouped in three cryoresistence levels
(CRYO) according to general average of PMI (X=22.1%), such as: 1
– inferior (X≤10.3%); 2 – intermediate (10.3%>X≤29.9%) and; 3 –
superior (X>29.9%). To all the variables it was used the variance
analysis (ANOVA) in a completely randomized design and Tukey
method was used to compare the averages (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 71
of a 14% CP supplement. The lambs were fed with at libitum access
of a 18% PC supplement since 15 th days old until 60 th days old. The
data on BW and WW were analyzed by Mixed Model procedures of
SAS program. The fixed effects utilized Breed of sire (BS), Breed of
ewe (BE), Sex (Sx), Litter size(L) and season(T) nested in BE (T(BE).
The random effects were Sire(S) nested in BS and Ewe(E) nested in
BE. BW and WW were influenced by BS, L , T(BE) (P 0.05). K lambs
ranked first in both measures, 3.42 ± 0.36 kg. and 11.62±1.53 kg. for
BW and WW, respectively. Ile(3.06±0.33) were intermediate and
DPN (2.96±0.32), DPB (2.87±0.33), BB(2.74±0.35) and
PB(2.82±0.33) were last for BW. For WW, Ile(9.95. ±1.44), DPN
(9.85±1.40), DPB(9.69±1.44), were intermediate and BB(8.77±1.53)
PB(8.45±1.45) were last. Singles lambs (3.69±0.32) had higher
weights than double(2.92±0.32) or multiple litter(2.32±0.34) for BW.
Also Single lambs (11.21±1.4) were higher than doubles (9.19±1.39)
which were higher than multiples (8.76±1.5). We observed that the
birth weight is affected by Specialized beef Breed of sire used,
without being a serious risk because they are low. Also the weaning
weight is improved although it is a trait more influenced by the ewe
performance than sire. Notice that the BB and PB ewes have a small
frame and multiple litters.
Project sponsored by CONACYT-SAGARPA-2004-C01-150
P130
Systemic concentrations of endo- and exogenous FSH in
anestrous ewes superovulated with Folltropin ® -V after
pretreatment with medroxyprogesterone acetate (MAP)-
releasing vaginal sponges and a single dose of estradiol
17β (E2 17β)
Bartlewski, PM 1 *; Alexander, BD 2 ; King, WA 1
1Department of Biomedical Sciences, Ontario Veterinary College, University
of Guelph, Guelph, Ont., Canada; 2 Department of Farm Animal Production
and Health, Faculty of Veterinary Medicine and Animal Science, University of
Peradeniya, Peradeniya, Sri Lanka
The synchronization of follicular wave emergence with progestin and
estradiol 17β (E 2 17β) prior to superovulation in anestrous ewes
reduces the variability in ovarian responses by an unknown
mechanism. Follicle stimulating hormone (FSH) is a primary
promoter of antral follicular growth and maturation, but the relevance
of changes in circulating FSH concentrations to the superovulatory
performance in ewes remains unknown. This report is comprised of
retrospective analyses of serum FSH concentrations in anestrous
Rideau Arcott ewes (May-June), which were superovulated with
Folltropin ® -V (porcine FSH), with (n=8; treated ewes) or without
(n=10; control ewes) a 14-day pretreatment with
medroxyprogesterone acetate (MAP)-releasing vaginal sponges (60
mg), and a single i.m. dose of 350 μg E 2 17β given 6 days after
insertion of sponges. The superovulatory treatment, started 6 days
after E 2 17β injection, consisted of six i.m. doses of Folltropin ® -V (2.5
ml x 1 and 1.25 ml x 5) given twice daily, followed by the bolus
injection of GnRH (50 μg i.m.). In order to avoid the effects of interbatch
variations in pFSH bioactivity, separate batches of Folltropin ® -
V were pooled to prepare sufficient quantities to treat all 18 animals.
Serum samples obtained during the superovulatory treatment were
analyzed by radioimmunoassays (RIA) for concentrations of ovine
(oFSH) and porcine FSH (pFSH), using species-specific standards and
primary antibodies. Both gonadotropins have been found to crossreact
with the heterospecific antibody; therefore, cross-reactivity was
subtracted from all FSH concentrations. The control ewes exceeded E 2
17β-treated animals in serum concentrations of oFSH at 2, 2.5 and 3
days after the first Folltropin ® -V injection (P0.05) between the two groups in pFSH concentrations.
The mean ovulation rate and number of recovered embryos did not
differ between the two groups of ewes (P>0.05), but the variability in
the number of luteal structures and in overall embryo yields was lower
in E 2 17β-treated ewes (F test; P

16 t h International Congress on Animal Reproduction
72 Poster Abstracts
P132
Freezing of goat semen in AndroMed ® , a soybean lecithin
based extender
Becker-Silva, SC. 1 ; Holtz, W. 2
1Santa Cruz State University, Ilhéus, Brazil; 2 Inst of Animal Husbandry and
Genetics, Georg-August-Univ., Goettingen, Germany
Introduction The composition of semen extenders containing
products of animal origin such as milk or egg yolk remains undefined,
making standardization impossible. Furthermore the risk of
contamination with infectious agents and introduction of animal
diseases into other regions or foreign countries must be considered.
Consequently, chemically defined extenders with no animal
components are desirable. In the past, several such extenders have
been examined with variable results. A commercially available semen
extender for the bovine (AndroMed ® , Minitueb, Tiefenbach,
Germany), containing soybean lecithin instead of material of animal
origin has been shown to be suitable for the freezing of ovine semen.
This investigation was designed with the intention of examining in
vitro the suitability of AndroMed for the cryopreservation of caprine
semen.
Materials and Methods From 4 mature Boer goat sires, 26 ejaculates
were collected with the aid of an artificial vagina. Each ejaculate was
split into half. One part was diluted at 30°C with conventional TRISegg
yolk extender containing 6.8% glycerol (TYG), the other with
AndroMed extender. Both were treated in a similar way, i.e. cooling
to 4°C within 2h, aspiration into 0,25ml straws, freezing in nitrogenvapor
at -120°C and storage in liquid nitrogen. After thawing at 38°C,
motility (MOT, expressed as percentage of native semen) and
membrane integrity (MI) after eosin-nigrosin staining (as percentage
of TYG results) were assessed. After 3 h of incubation at 38°C, MOT
was assessed once again.
Results The post-thaw MOT of goat semen cryopreserved in
AndroMed diluent was 54% as compared to 55% in semen frozen in
conventional TYG extender. The corresponding MI values were 118
and 100%. After 3h of incubation, the MOT for the AndroMed
samples was 31% vs. 37% for the TYG samples. None of these
differences were statistically significant (P > 0.05, Student’s t-test).
Conclusion On the basis of in vitro assessment, the cryopreservation
of caprine semen in AndroMed ® , a diluent free of animal protein
originally designed for bovine semen, was just as successful as
freezing in conventional TRIS-egg yolk-glycerol extender, and may
be considered a microbiologically safer option for storing and
shipping of goat semen. A final assessment will require large-scale
insemination trials.
P133
Effect of pre-ovulatory luteinizing hormone surge on the
mRNA expression of angiogeneic growth factors in the
ovine ovary
Chowdhury, WH 1 *, Scaramuzzi, RJ 2 , Wheeler-Jones, C 2 , Khalid, M 1
1Veterinary Clinical Sciences, The Royal Veterinary College, University of
London, United Kingdom; 2 Veterinary Basic Sciences, The Royal Veterinary
College, University of London, United Kingdom
Introduction Angiogenic factors are essential for neo-vascularisation
and development of ovarian follicles. Vascular Endothelial Growth
Factor (VEGF) and the angiopoietins (Ang-1, Ang-2) are important
and their expression in follicles differs with stage of the oestrous
cycle. However, their physiological control in follicles is unclear. This
study tests the hypothesis that the mRNA expression for VEGF, Ang-
1 and Ang-2 in antral follicles is regulated by pre-ovulatory LH surge.
Methods Twenty eight ewes were made hypogonadotrphic with
GnRH agonist (Buserelin) after which a combination of FSH and LH
was administrated for normal development of follicles. This was
followed by intravenous infusion of 0, 50, 100 or 200μg of LH over 4
or 8h as pre-ovulatory LH surge. Ewes were killed 8h after the LH
infusion. The ovaries were serially section (10μm) at -20°C. All
follicles ≥2.0mm in diameter were analysed for VEGF, Ang-1 and
Ang-2 mRNA by in situ hybridization using ovine riboprobes. mRNA
expression was quantified and the data were analysed using a mixed
model ANOVA.
Results Pre-ovulatory LH surge significantly increased (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 73
P135
Synchronization of oestrus and ovulation in non-seasonal
West African ewes treated with cloprostenol during early
stages of luteal development
Contreras-Solis, I 1 *; Vasquez, B 2 ; Diaz, T 1 ; Lopez-Sebastian, A 3 ; Gonzalez-
Bulnes, A 3
1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela,
Venezuela; 2 Instituto Nacional de Investigaciones Agrícolas, Venezuela;
3Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Spain
Cloprostenol (prostaglandin F2 alpha analogue) has been commonly
used to synchronise oestrus in non-seasonal and seasonal ewes during
the breeding season. The most usual protocol consist of two injections
9 to 11 days apart; however, the most recent studies indicate the
possibility of increasing efficiency of the treatment by applying
cloprostenol in early luteal phase (Contreras-Solis et al., in press). On
the other hand, information about efficacy of cloprostenol injection
during early stages of luteal development is controversial. Therefore,
the aim of this study was to assess if a low dose of cloprostenol (43.75
µg; Planate®, Schering Plough) is capable to induce synchronization
of oestrus and ovulation during the early stage of luteal growth in
non-seasonal hair sheep. Twenty-four adult West African ewes were
randomly assigned to three groups treated with cloprostenol at Day 3
(D3 n = 8), 5 (D5 n = 8) and 7 (D7 n = 8) after ovulation. Transrectal
ultrasonographies were performed at Day 0 (day of injection), 1 and
10 to detect the presence of luteal tissue and luteolysis. Oestrous
behaviour was detected every 4h from 20h after treatment using a
trained teaser ram, whilst ovulation was detected by ultrasonographic
scanning every 4 h from 16 h of the onset of oestrus. Assessment of
luteal function was performed by determining plasma progesterone
levels by radioimmunoassay. Seven out of eight ewes (87.5%) from
D3 and D5 groups and all ewes from D7 group showed functional
corpora lutea at timing of injection (P < 0.001; 1.4 ± 0.3, 3.0 ± 0.4 and
3.9 ± 0.3 ng/mL of mean plasma progesterone concentration,
respectively). Cloprostenol was effective to induce luteolysis and
oestrus in all ewes. Oestrous activity was observed at 28.6 ± 3.3, 34.3
± 2.1 and 36.5 ± 3.2 h after treatment for D3, D5 and D7 groups,
respectively. Onset of ovulation was detected at 51.4 ± 1.4, 52.0 ± 1.8
and 55.0 ± 1.7 h for D3, D5 and D7, respectively; with oestrusovulation
intervals of 22.9 ± 3.1, 18.4 ± 2.7 and 18.5 ± 3.4 h. The
number and function of corpora lutea were also similar among groups
(D3: 1.9 ± 0.2 and 5.6 ± 0.5 ng/mL; D5: 1.7 ± 0.2 and 5.6 ± 0.4
ng/mL; D7: 1.4 ± 0.2 and 4.5 ± 0.7 ng/mL). Thus, current study
indicates that cloprostenol is effective to induce luteolysis, oestrus,
ovulation and corpora lutea with normal life span in hair sheep when
is administered from Day 3 after ovulation.
Funded by FONACIT S1-2002000413 and CDCH-UCV. Contreras-
Solis et al., Anim. Reprod. Sci. In press.
P136
Conservation in refrigeration of the ovine semen
Córdova, A 1 *; Cortés, S 1 ; Córdova, MS 2 ; Córdova, CA 3 ; Guerra, JE 4 ; Tapia,
B 5
1Departamento de Producción Agrícola y Animal, Ecodesarrollo de la
Producción Animal, Universidad Autónoma Metropolitana-Xochimilco, Cuerpo
Académico: Salud y Bienestar Animal. Calz. del Hueso 1100 Col. Villa
Quietud CPP. 04960, México, D.F.(Córdova A. aci57@prodigy.net.mx);
2Laborarotorios Brovel, S.A.de C.V., Mexico; 3 Becario de CONACYT-México.
Estudiante de Doctorado. Universidad de León, España; 4 Facultad de
Agronomía. Universidad Autónoma de Sinaloa, México; 5 Estudiante de
Doctorado. Facultad de Veterinaria. Universidad Complutense de Madrid,
España
Introduction The preservation of semen allows the use of genetic
resources for long term, so that the cooling sheep sperm lets more
time preserve the ability of sperm fertilization after obtaining an
ejaculate. The rate of fertilization is used when cooled semen has a
fluctuation between 45 and 65%, when using fresh semen this
parameter is about 84%, this is because sperm got harm at the plasma
membrane, with the unavoidable reduction of motility and acrosome
damage during the process of preservation, which encourages further
works on the preservation of semen in the cooling of this kind.
Objective Evaluate the effect of the conservation in refrigeration of
the ovine semen on the spermatic quality: motility, viability and
acrosome integrity (NAR).
Methods Four lambs race English Suffolk 2 years were used,
obtaining 3 to 4 ejaculated per week and 24 samples were collected
from ejaculate with artificial vagina. The progresses of motility,
viability, pH, NAR were evaluated. Extenders 1 (Rangel, 1985);
extenders 2 (Tris-fructose egg-yolk ram semen - Salamon, 1990) and
extensor 3 basis triladyl were used in proportion of 1:3; semen keep
on chilling at 4 ° C for 24 hours and the variables were assessed at 0,
2, 4 and 24 hours.
Results There was found that the pH remains unchanged during the
first 24 hours in the three extenders. The motility and viability were
better with diluter than triladyl during the experiment. However, the
NAR had a better behave with the extenders 1 and 2. The results were
analyzed using descriptive statistics, which showed averages for each
variable and there was not found difference statistically significant
between the three tests.
Conclusion The diluter with the help of triladyl can represent an
alternative for the conservation of the ovine semen in refrigeration.
P137
Effect of glycerol concentration on the motility and
viability of cooled-stored ram semen
Crespilho, AC 1 *; Papa, FO 1 ; Dell’Aqua Jr., JA 1 ; Zahn, FS 1 ; Martins Jr, A 2 ;
Araujo, GHM 1 ; Oba, E 1
1 Department of Animal Reproduction and Veterinary Radiology, São Paulo
State University, Botucatu, Brazil; 2 São Paulo State University, Araçatuba,
Brazil
Several studies demonstrate the efficiency of glycerol as a sperm
membrane protector in many species during cryopreservation
procedures. However, few studies investigated its effect on the
maintenance of ram sperm viability during refrigeration. The aim of
the present study was to evaluate the effect of the addition of different
concentrations of glycerol on ram sperm viability under 5°C
refrigeration for until 120 hours.
One ejaculate of five Santa Inês rams, obtained by electroejaculation,
were used. Each ejaculate was divided into 4 equal samples, diluted to
a concentration of 10× 10 6 sperms/mL in TRIS (Tris(hydroximethyl)-
aminomethane, sodium citrate and fructose) extender without or with
1.5, 3.0 or 6.0% glycerol (G1, G2, G3 and G4, respectively). Samples
were packed in 0.5mL straws and cooled in a Minitüb® adjustable
refrigerator at -0.25ºC/min until 5ºC. Samples were maintained at 5ºC
and were evaluated at moments 0, 24, 48, 72, 96 and 120 hours for
sperm motion characteristics by CASA (IVOS – 12) and for integrity
of plasma and acrosomal membranes and mitochondrial potential by
epifluorescence with propidium iodide, FITC-PSA and JC-1 probes.
Data were analyzed by a Student’s t-test and a ‘t’ test with repeated
measures to compare each group in a function of time of refrigeration
and to evaluate the efficiency of each treatment to maintain sperm
viability at 120 hours of refrigeration.
There were no significant differences on parameters of motility and
integrity when different treatments were compared at moments 0, 24,
48, 72, 96 and 120 hours. However, a significant decrease in total
motility (MOT, P=0.018), sperm beat cross frequency (BCF, P=
0.0292) and acrosome integrity (P=0.0088) was observed in G1
samples at 120 hours of refrigeration. The addition of glycerol
enhanced the preservation of MOT during the period of refrigeration
and this effect was directly correlated to the concentration of
cryoprotectant in the extender (G2, P

16 t h International Congress on Animal Reproduction
74 Poster Abstracts
semen samples used on artificial insemination programs in ovine
herds.
P138
The End of Breeding Season in Subtropical Female Goats
Results From the Development of Refractoriness to
Winter Short Days
Delgadillo, JA 1 *; Aguilar, J 1 ; Malpaux, B 2
1Centro de Investigación en Reproducción Caprina, Universidad Autónoma
Agraria Antonio Narro, Torreón, Coahuila, México; 2 Physiologie de la
Reproduction et des Comportements, UMR 6175 INRA-CNRS-Université de
Tours-Haras Nationaux, Nouzilly, France
This study was carried out to determine if the end of the breeding
season of local female goats from subtropical Mexico results from
refractoriness to the stimulatory effect of short days of winter or to
the inhibitory effect of increasing day length following the winter
solstice. Does were ovariectomized and treated with a subcutaneous
implant constantly releasing estradiol-l7 ß (OVX+E). The control
group (n = 6) remained in open sheds under natural day length. The
experimental group (n = 6) was placed in a light-proof building and
exposed to constant short days (10 hours of light by day) from the
winter solstice. LH plasma concentrations were measured twice a
week. The seasonal decrease in LH secretion, indicative of the end of
the breeding season, was defined as the first of three consecutive
samples with LH concentrations lower than 1 ng/ml. The seasonal
decrease in LH secretion did not differ (P > 0.05) between
experimental (February 4 + 10 days) and control (February 3 + 5
days) groups. These results allow us to conclude that, as in temperate
latitudes, the end of the breeding season in female goats raised in a
subtropical latitude is not driven by winter increasing day length,
rather it appears to result from short day refractoriness. This suggests
the implication of an endogenous circannual rhythm in regulating
seasonal changes in reproduction in subtropical latitudes.
Supported by CONACyT grant (28420N).
P139
Effect of dietary supplement of phytoestrogens on
thyroid hormones, steroid production and localization of
carbonic anhydrase in testis, efferent ductules and
thyroid gland of male goat kids
Ekstedt, E 1 *; Holm, L 1 ; Ridderstråle, Y 1 ; Selstam, G 2 ; Madej, A 1
1Department of Anatomy, Physiology and Biochemistry, Swedish University of
Agricultural Sciences, Box 7011 S-750 07 Uppsala, Sweden; 2 Department of
Molecular Biology, University of Umeå, 90187 Umeå, Sweden
Exposure of xenoestrogens to humans and animals is an increasing
concern due to their effects on reproduction. Phytoestrogens are nonsteroidal
substances in many plants with capacity to bind to oestrogen
receptors (ER). Presence of ER in the efferent ductules of the mature
male goat indicates the importance of estrogens for male
reproduction, which in turn have an effect on carbonic anhydrase
(CA) activity (Zhou et al., 2001). The present study was undertaken to
investigate whether a low addition of phytoestrogens to a normal diet
affects thyroid hormone secretion, the establishment of testosterone
production and histochemical localization of CA in testis, efferent
ductules and thyroid gland during puberty in male goat kids. Four male
goat kids were given a standard diet and 3 were given an addition of 3 - 4
mg phytoestrogens/kg body weight in tablets containing genistein,
daidzein, biochanin and formononetin. The treatment commenced at 3
months of age and continued until slaughter at 6 months of age. Plasma
testosterone, oestrone sulphate, total and free triiodothyronine (T 3 ) and
thyroxin (T 4 ) were measured weekly. Testosterone and cyclic AMP were
measured in testicular tissue and CA was localized histochemically in
thyroids and reproductive organs. After four weeks of treatment, total T 3
concentrations were significantly higher in the phytoestrogen treated
animals than in the control ones (2.3 ± 0.3 vs. 1.2 ± 0.2 nmol/l, P < 0.01).
Plasma testosterone concentrations at week 7 were significantly (P <
0.05) higher in the phytoestrogen treated animals than the control ones
(37.5 ± 6.0 vs. 19.1 ± 5.2 nmol/l). Free T 3 concentrations in kids exposed
to phytoestrogens were significantly higher than in control animals during
week 8 and 9 of the experiment. At the end of the experiment plasma
testosterone concentrations were slightly lower in treated goats,
testosterone and cyclic AMP levels were lower in testicular tissue. Strong
staining for CA activity was present in testicular capillaries, nuclei
and apical membranes of the non-ciliated cells of the efferent
ductules. The thyroid gland showed strong CA activity in the
basolateral membranes of the epithelium. No difference was shown
between groups. In conclusion, the exposure of male goat kids to low
doses of phytoestrogens has an impact on the hormonal changes
during puberty as well as the content of cyclic AMP in the testis, but
did not alter CA localization in thyroids or reproductive organs.
This study was supported by Formas
P140
Efficiency of transabdominal ultrasonography in
pregnancy diagnosis during late embryonic and early
fetal stages of pregnancy in Konya Merino ewes
Erdem, H 1 *, Saribaym MK 2 , Tekeli, T 1
1Obstetrics and Gyneacology, Selcuk University Faculty of Veterinary
Medicine, Turkey; 2 Obstetrics and Gyneacology, Mustafa University Faculty
of Veterinary Medicine, Turkey
Objective of this study was to evaluate the efficiency of location (right
ingiunal region [RIR] or left ingiunal region [LIR]) of transabdominal
ultrasonography to determine pregnancy and number of embryo/fetus
during late embryonic and early fetal stages of pregnancy in Konya
Merino ewes. Eighty-four ewes were diagnosed as pregnant 34 days
after mating by transrectal ultasonograhy. Of these ewes, 45 had
single embryo and 39 had twin embryos. On days 34 and 50, these
ewes were again examined by RIR and LIR transabdominal
ultasonography. The results were compared with transrectal
ultrasongraphy and lambing records. On day 34, 62 % (28/45) and
64% (29/45) of single pregnancies and 33 % (13/39) and 28 %
(11/39) of twin pregnancies could be detected through RIR and LIR
transabdominal ultrasonography, respectively. On day 50, 88 %
(40/45) and 91 % (41/45) of single and 53 % (21/39) and 46 %
(18/39) of twin pregnancies were detected through RIR and LIR
transabdominal ultrasonography, respectively. Data were analysed by
paired simple t-test and there were no significant differences between
the days (day 34 vs day 50) and locations of examinations (RIR vs
LIR). In conclusion, twin pregnancies can not be effectively
diagnosed through transabdominal ultasonography during the first 50
days of pregnancy. However, when detecting number of embryo/fetus
is not important, pregnancy diagnosis can be performed with this
method starting on day 34.
P141
Melatonin-based induction of cyclicity in intensive dairy
(Awassi) flocks
Faigl, V 1 *; Keresztes, M 1 ; Árnyasi, M 2 ; Kulcsár, M 1 ; Nagy, S 3 ; Szenci, O 1 ;
Cseh, S 1 ; Huszenicza, G 1
1Faculty of Veterinary Science, Szent István University, Budapest, Hungary;
2Faculty of Agricultural Sciences, University of Debrecen, Hungary; 3 Awassi
Corporation, Bakonszeg, Hungary
Our aim was to compare three different cycle induction /
synchronisation protocols used out of the breeding season in Awassi
ewes. In the first experiment (Exp.1) 85 autumn lambing ewes of a
commercial dairy farm were used. Milk progesteron (P4) or fecal
gestegen metabolits were determined 3 times 7 days apart on d0, d7,
d13 (Exp.1 d0:10 th Febr). Gest group was treated in April with
gestagen sponge(d56-d70)+600IU eCG(d70). Mel+Gest group was
implanted with melatonin (Mel, Melovin®, CEVA, Libourne, France)
on d0 and synchronised as Gest group 56 days later. Mel+GPG
animals were treated with Mel (d0) and synchronised with
GnRH(d63)–PGF2α(d70)–GnRH(d72). Ewes were inseminated twice
(fix AI) and were introduced to rams 14 days later. Individual P4
profile was followed from d45 to d99. Pregnancy associated
glucoprotein was assayed on d99 and d133. Date of conception was

16 t h International Congress on Animal Reproduction
Poster Abstracts 75
determined according to lambing dates. In Exp.2 the whole protocol
was repeated with 115 spring lambing dams (Exp.2 d0:22 th June). In
Exp.1 39% of ewes were still cycling in Febr, however only 6%
remained cyclic by the end of April (NS). Significantly higher percent
of gestagen treated groups ovulated following synchronisation
(Gest:96% vs Mel+Gest:95% vs Mel+GPG:45%;P=0.040). 14% of
Gest and Mel+Gest group vs 3% of Mel+GPG concieved from Fix AI
(NS). 10% Gest, 5% Mel+Gest, 3% Mel+GPG became pregnant after
ram introduction (NS). Great proportion 31-43% conceived in the
following breeding season. 38-62% remained unpregnant for more
than 220 days. In Exp.2 4% of dams were cycling by d0 (June, NS).
Proportion of cyclic animals in Mel treated groups tended to be higher
by d45-d56 (19% Gest vs 44% Mel+Gest vs 47%
Mel+GPG;P=0.109). 100% of Gest and Mel+Gest vs 88% of
Mel+GPG ewes ovulated following synchronisation (NS), however
only 24% (Gest), 22% (Mel+Gest), 8% (Mel+GPG) conceived from
fix AI (P=0.190). In all treating groups 65% became pregnant after
ram introduction (NS). 8-27% of dams remained unpregnant until
d150 (NS). Survival analysis of day of conception showed no
significant difference between treatment groups (Exp.1
P=0.361;Exp.2 P=0.131). Concuding our findings reproductive
activity of Awassi sheep became markedly seasonal under temperate
latitude. Slow release melatonin implant inserted in Febr could not
induce cyclic ovarian function; however the same treatment had
beneficial effect when used in June. GPG protocol as a possible
alternative of longterm gestagen treatment for synhronisation for AI
can only be effective when used near to the natural breeding season.
P142
Effects of different egg yolk concentration and sodium
dodecyl sulfate during the freezing step of
cryopreservation on motility and viability of Markhoz goat
spermatozoa
Farshad, A.*, Khalili, B. and Fazeli, P.
Laboratory of Animal Reproduction of Department of Animal Science, College
of Agriculture, University of Kurdestan, Sannandaj, Iran (Farshad, A.
AFarshad@uok.ac.ir)
Cryopreservation induces cold shock and partially irreversible damage
to sperm membranes. Egg yolk and addition of sodium dodecyl sulfat
(SDS) to extenders prevents the effects of cold shock. Therefore, the
objective of our study was to evaluate the effects of egg yolk and SDS
on the cryopreservation of spermatozoa of goat.
In Experiment 1, effects of different concentrations of egg yolk were
investigated. Semen diluted (1: 4) with Tris-citric acid-fructoseglycerol
solution containing 5, 10, 15 and 20 % (v/v) egg yolk were
packed in 0.25 ml French straws at 37°C and cooled to 5°C over 2 h.
Than, samples were frozen in vapor of liquid nitrogen, stored in liquid
nitrogen for 24 h and thawed at 37°C for 1 min. After thawing,
samples were evaluated for motility (%), progressive motility (%),
viability (%) and morphological abnormality (%).
The results shows, the rates of motility, progressive motility, viability
and morphological abnormality in the dilution containing 5% egg yolk
(55.7±4, 42.3±6, 60.2±4 and 89.5±3, respectively) were significantly
higher (P0.05) between the 10 and 15 % egg yolk groups. The
parameters of spermatozoa diluted in extender containing of 20 % egg
yolk were significantly decreased (P

16 t h International Congress on Animal Reproduction
76 Poster Abstracts
Methods Twenty-eight goats that had tested positive for CAEV using
PCR on vaginal secretions were used as embryo donors. Embryos
with intact ZP were selected and washed ten times; they were then
frozen and used for transfer into CAEV-free recipient goats. Nineteen
of the forty-nine recipient goats gave birth, producing a total of 23
kids. Three blood samples were taken from each recipient goat, ten
days before, during, and ten days after parturition; these were tested
for CAEV antibodies using ELISA and for CAEV proviral DNA
using PCR. The mothers were then euthanized. Tissue samples were
taken from the lungs, udder, and retromammary and prescapular
lymph nodes. The kids were separated from their mothers at birth.
Seven of them died. At 4 months of age, 16 kids were subjected to
drug-induced immunosuppression. Blood samples were taken every
month from birth to 4 months of age; samples were then taken on day
15, day 21, and day 28 after the start of the immunosuppressive
treatment. The kids were then euthanized and tissue samples taken
from the carpal synovial membrane, lung tissue, prescapular lymph
nodes, inguinal and retro-mammary lymph nodes, and uterus.
Results All samples from the 19 recipient goats and 23 kids were
found to be negative for CAEV antibodies and/or CAEV proviral
DNA.
Conclusion This study, performed under field conditions, clearly
demonstrates that embryo transfer can be used to produce CAEV-free
kids from CAEV-infected biological mothers. Indeed, none of the 16
kids collected from infected mothers at the embryonic stage,
transferred to CAEV-free recipient goats, and subjected to
immunosuppressive treatment at 4 months of age, were found to be
positive for CAEV with any of the diagnostic methods used in all of
the analyzed target tissues of the virus. Similarly, none of the 20
recipient goats seroconverted, and none of the sampled tissues tested
positive for CAEV proviral DNA.
P145
Effects of a mutation in Bone Morphogenetic Protein 15
gene (BMP15) on natural ovulation rate and on the
response to superovulatory FSH treatment in Rasa
Aragonesa ewes
Folch, J 1 *; Alabart, JL 1 ; Martínez-Royo, A 1 ; Echegoyen, E 1 ; Cocero, MJ 2 ;
Jurado, JJ 3 ; Bodin, L 4 ; Calvo, JH 1
1Unidad de Tecnología en Producción Animal. CITA. Av. de Montañana, 930.
50059-Zaragoza, Spain; 2 Dpto. Reproducción Animal. INIA. Av. Puerta de
Hierro s/n. 28040-Madrid, Spain; 3 Dpto. Mejora Genética animal. INIA. Ctra.
La Coruña Km 7.5. 28040-Madrid, Spain; 4 INRA, UR631 Station
d'amélioration génétique des animaux, F-31326 Castanet-Tolosan, France
A MOET Program is applied to improve the efficiency of a selection
scheme for prolificacy in Rasa Aragonesa ovine breed. We have
recently found a new mutation in BMP15 gene (1) in the highest
prolific ewes of the Scheme. Since similar mutations are associated to
higher ovulation rate (OR) in heterozygous females in other ovine
breeds, we carried out a study to confirm the effect of this new
mutation on OR in Rasa Aragonesa, in both natural conditions
(Experiment 1) or after superovulation with oFSH (Experiment 2).
Experiment 1
Two lots of ewe lambs of similar age, body weigh and body condition
score were compared: BMP15 group (mutant animals) and control
group (non-mutant, non-selected). All animals were maintained
indoor and feeded ad libitum. At 9 months of age, lambs received
FGA sponges. The OR was recorded six days after sponge withdrawal
by laparoscopy and was repeated 17 and 34 days later. No males were
used for heats detection.
OR in Control group was similar to previously reported values in nonselected
Rasa Aragonesa ewe lambs, while BMP15 group presented
about 0.6 extra ovulations.
Genotype n OR1 OR2 OR3
OR
(Pooled)
BMP15 15 1.85 a 1.69 a 1.58 c 1.71 a
Control 18 1.09 b 1.14 b 1.13 d 1.12 b
n: Number of ewe lambs; OR: Ovulation rate in lambs ovulating
a, b: P

16 t h International Congress on Animal Reproduction
Poster Abstracts 77
P147
The Effect of an Opioid Antagonist on Blood
Progesterone levels of crossbreed ewes with GnRH
induced short luteal phase during the anoestrus season
Fuentes, HV-O. 1 *, Fuentes, CPI. 2 , Moreno, H. 3 , Parra, VM.
1Centro Universitario de los Altos, Universidad de Guadalajara, Km 7.5
Carretera a Yahualica, Tepatitlan de Morelos Jalisco CP47600 (Víctor
Octavio Fuentes Hernández Ph.D. victoro@servidor.unam.mx;
vfuentes@cualtos.udg.mx); 2 Department of Anesthesiology, Hospital Pemex
Sur Alta Especialidad DF , Mexico; 3 Facultad de Medicina Veterinaria y
Zootecnia, Universidad Michoacana de San Nicolas Hgo, Mexico
With the objective of studying the effect of an opioid antagonist on
progesterone levels in ewes with induced short luteal phase during the
anoestrous season. A group of 20 crossbreed ewes was used. Age
flutuated between 2 and 6 years. Housed in oppen paddocks with food
and choped barly hay ad libitum and complemented with 250 g of
concentrated feed. 10 ewes selected at random were implanted with
15 mg naloxone using cristaline microcelulose as a vehicle. The
remainig 10 ewes were used as control and were implanted with a
capsule of cristaline microcelulose free of any medicament. Seven
days after implant both groups; treated and control; were injected with
GnRH (250 ng iv at two hour intervals during 24 hours) at the end of
treatment 125 µg of GnRH was injected iv. Blood samples were
collected at 12 th hrs intervals since the comencement of the
experiment and sampling continued for 15 days after the last injection
of GnRH. It was observed that in two of the control ewes
progesterone levels increased 36 hrs after GnRH treatment, reaching a
highest level on day 7, on the 8 remaining control ewes short luteal
phases were observed with maximal progesterone concentrations of 1
ng/ml. 3 ewes treated with naloxone showed short luteal phase, while
in the remaining 7 ewes treated with naloxone, progesterone levels
were similar to those observed in control ewes with normal luteal
phase. During the statistical analysis a significant effect fue to
treatment was detected (P

16 t h International Congress on Animal Reproduction
78 Poster Abstracts
unilateral growth of the head of epididymis. The animal presented
right testicular enlargement, with higher temperature at the affected
testis and lower testicular mobility. This animal had a history of
haematuria and was treated with Pentabiotico® (penicillin) associated
with sexual rest. After that the ram was reintroduced to breeding
with 30 ewe and ten days later he showed the clinical signs of
epididymitis. The pregnancy diagnose from these ewes by
ultrasonography after 40 days showed 20 pregnant ewes (66,7%) of
30. In the andrological exam it was found many inflammatory cells
and low motility. It was made specific bacteriological exam for
Brucella sp, Mycoplasma sp., Ureaplasma sp and Campylobacter sp
resulting negative. It was isolated only Actinobacillus semnis. The
ovine production at the State of São Paulo, Brazil grows over the last
5 years. It has not many information about reproduction diseases in
ram in this state.
P151
Determination Sex and Scrapie Resistance Genotype 6f
Preimplantation Caprine Embryos
Guignot, F
Physiologie de la Reproduction et des Comportement, INRA, France
The aim of this study was to test the accuracy of sex and PrP genotype
diagnosis after whole amplification of DNA extracted from biopsies
obtained by microblade cutting of goat embryos, and to evaluate the
viability of biopsied embryos after freezing / warming and transfer to
recipients. Before genotyping, whole genome amplification was
performed using Repli-g® kit. Sex diagnosis was done by PCR
amplification of ZFX/ZFY and SRY sequences (duplex PCR) and PrP
genotype determination was performed on five codons: 142, 154, 211,
222 and 240. Embryos were recovered at Day 7 after oestrus from
superovulated goats. Blastocysts and expanded blastocysts were
biopsied immediately after recovery and frozen by vitrification.
Whole embryos were kept as control and also vitrified. After thawing,
two embryos were transferred directly into each synchronized
recipient. Transfer was performed on 28 recipients, 18 with biopsied
embryos and 10 with whole embryos. At Day 21 and 42 after oestrus,
pregnancy rate was assessed by progesterone RIA and
ultrasonography respectively. PrP genotyping was performed on kids
at birth. Pregnancy rates at Day 21, Day 42 and at kidding were not
significantly different between biopsied (83, 39 and 39%,
respectively) and control (100, 50 and 50%, respectively) embryos.
The embryo survival rate was 25% (9 kids from 36 transferred
embryos) and 35% (7/20) for biopsied and control embryos,
respectively. At birth, all diagnosed sexes were right (9/9; 100%). Kid
PrP genotyping and prediction were compared: among the 90
predetermined codons for PrP scrapie, 88 codons were accurately
predicted (97.8%). Kid PrP profiles were in agreement with parental
genotype. PrP genotyping results of biopsies from embryos who did
not induce pregnancy was compared to parent genotypes. Among 270
analysed codons (27 biopsies), 8 discrepancies were found, so 97% of
PrP genotype determination were concordant to parent genotype.
Whole genome amplification with Repli-g® kit coupled with sex
diagnosis and PrP genotype determination are very accurate
techniques to genotype goat embryo before transfer. This technique
will increase the efficiency and reduce the cost of selection process
aimed at scrapie sensitivity alleles eradication in French goat
population. Moreover, other target genes linked to other diseases or to
production traits could be analysed on the same biopsy conferring
more economical value to the multiple ovulation embryo transfer
(MOET).
P152
Cyclic female goats respond to males with an increase in
LH secretion during the breeding season
Hawken, P *; Esmaili, T; Jorre De St Jorre, T; Martin, G
1School of Animal Biology, University of Western Australia, Australia
Introduction The male effect is currently only used during anoestrus
because the long periods of elevated progesterone in cyclic females
are presumed to block the response. However, in a recent study in
sheep, we found that cyclic ewes respond to rams with an increase in
LH secretion [1]. In the present study, we tested whether cyclic,
female goats would respond to males with an increase in pulsatile LH
during the early, mid- and late luteal phases of the oestrous cycle.
Methods During May (breeding season; Southern Hemisphere) the
oestrous cycles of 16 Australian Cashmere goats were synchronised
using intravaginal progesterone pessaries. Pessary insertion was
staggered to produce early luteal (EL; n=8) and late luteal phase
groups (n=8). The late luteal phase group was further subdivided into
mid-luteal (ML; n=4) and late luteal (LL; n=4) groups, based on
differences in oestrous cycle length after progesterone withdrawal.
Results Exposure to males stimulated an increase in LH pulse
frequency in the EL (0.36 ± 0.06 versus 0.61 ± 0.08 pulses/h; P <
0.01) and LL groups (0.42 ± 0.08 versus 0.68 ± 0.09 pulses/h; P <
0.01). However, a significant increase was not observed in the ML
group (0.33 ± 0.07 versus 0.45 ± 0.05 pulses/h; P > 0.1). Exposure to
males caused an increase in mean concentrations of LH in the LL
group (0.20 ± 0.05 versus 0.34 ± 0.05; P < 0.05) but not in EL (0.14 ±
0.03 versus 0.21 ± 0.05 ng/mL; P < 0.1) or ML groups (0.12 ± 0.02
versus 0.12 ± 0.03 ng/mL; P > 0.1). There was no effect of male
exposure on LH pulse amplitude at any stage of the cycle (P > 0.1).
Progesterone concentrations differed among all groups on the day of
male exposure (EL: 3.50 ± 0.49; ML: 5.25 ± 0.47; LL: 0.72 ± 0.13
ng/mL; P ≤ 0.05) and declined significantly over the 12-h sampling
period in the LL group (0.72 ± 0.13 versus 0.32 ± 0.05 ng/mL; P <
0.05). There was no change in this variable in the EL (3.5 ± 0.49
versus 2.96 ± 0.56 ng/mL; P < 0.1) or ML groups (5.25 ± 0.47 versus
5.99 ± 0.66 ng/mL; P > 0.1).
Conclusion Exposure to males induced an increase in pulsatile LH
secretion in female goats in the early and late luteal phases of the
oestrous cycle. However, the high concentrations of progesterone
during the mid-luteal phase appear to block any effect of the male on
LH release. [1] Hawken PAR, Beard AP, Esmaili T, Kadokawa H,
Evans ACO, Blache D, Martin GB. The introduction of rams induces
an increase in pulsatile LH secretion in cyclic ewes during the
breeding season. Theriogenology 2007;68:56-66.
P153
Effect of the progestagen treatment length and different
eCG dosages on the pregnancy rate of ewes after fixedtime
superficial transcervical insemination
Iwamura, J 1 *, Oba, E 1 ; Souza, MIL 2 ; Pampani, FE; Leal, LS 1 ; Pavão, G 1 ;
Bittencourt, RF 1
1Department of Animal Reproduction and Veterinary Radiology, São Paulo
State University, Brazil; 2 Center of Biological Science and Health , Mato
Grosso do Sul Federal University, Brazil
The aim of this study was to analyze the Santa Ines sheep’s fertility
after estrous and ovulation synchronization with short, intermediate
and long-term protocols with progestagen (Progespon®, Syntex,
Argentina) and different eCG dosages (Foligon®, Intervet, Spain)
through fixed-time superficial transcervical insemination. Fifty and
three adult ewes were divided into 6 groups, according to the estrous
synchronization protocols (P) employed. In the P1 and P2, the animals
were synchronized with intravaginal sponges containing 60 mg of
acetate of medroxyprogesterona (MAP) during 6 days plus 500 or 350
i.u. eCG at the sponge removal, respectively. P3 and P4 animals had
the sponge removal after 9 days and received in this moment 500 or
350 i.u. eCG, respectively. In P5 and P6, the synchronization was
accomplished by MAP administration over 13 days with an injection
of 500 or 350 i.u. eCG, respectively, at sponge removal. The estrous
detection was carried out twice daily by sexually experienced adult
rams with proven high fertility, fitted with a marking harnesses,
introduced in the flock at the sponge removal. The semen was
collected by artificial vagina and the dilution (1/2) was carried out in
skimmed milk. The superficial transcervical insemination was
performed with 100µL of the diluted semen in fixed-time 48 hours
after the sponges withdrawal. The pregnancy diagnosis was performed
by ultrasonography exam, with a 5 MHz transducer, 60 days after the
artificial insemination. The blood samples were collected from all
ewes for progesterone determination by a direct solid-phase

16 t h International Congress on Animal Reproduction
Poster Abstracts 79
radioimmunoassay (Coat-A-Count progesterone; Diagnostic Products
Co., USA). The progesterone were measured in samples on the
beginning treatment, before the sponge introduction, on the sponge
removal day and 48h after the MAP removal. Data regarding the
pregnancy rate and progesterone concentration were analyzed by
using the qui-square test and the SNK test of the SAS statistical
package (version 5.0, 1996). The fertility rate in the protocols P1, P2,
P3, P4, P5 and P6 was of 30.0 %; 20.0%; 33.3%; 37.5%; 33.3% and
40.0%, respectively. No statistical difference for pregnancy rate was
observed among protocols, hence we can conclude that length of
progestagen treatment and the eCG dosages used had no influence on
fertility rate. The authors suggest the necessity of more studies with a
larger number of animals to verify the short-term estrus
synchronization protocol effectiveness in Santa Ines ewes and the
effect of the superficial cervical artificial insemination on the
pregnancy rates.
P154
Seasonal changes in physiologic and biochemical
parameters of Iranian Abadeh breed buck semen
Jelodar, G *, Razmi, N
Department of Physiology, Shiraz University, Islamic Republic of Iran
Introduction Goat is a seasonal breeder animal,the aim of this study
was to evaluate seasonal changes in physiologic and biochemical
semen characteristics of native Abadeah breed buck goats.
Methods Five Abadeah goats (3-4 years old) were trained to serve the
artificial vagina. Semen collection was performed every 2 weeks,
commencing in October (at onset of autumn) 2005 to September (end
of summer) 2006. Semen ejaculates were evaluated for volume, sperm
concentration, individual motility and the percentage live sperm.
Moreover, changes in the seminal plasma proteins of the goats were
also recorded and considered at the end of semen collection whit
providing electrophorogram (SDS PAGE Electrophoresis) of seminal
plasma proteins.
Result Semen of superior quality and quantity was especially
collected in late summer and throughout autumn (seasonal breeder).
during the autumn bucks recorded the highest (P

16 t h International Congress on Animal Reproduction
80 Poster Abstracts
P157
Role of exogenous leptin and season on thyroxine
release from thyroid gland in ewes
Klocek-Górka, B 1 *, Szczęsna, M 1 , Sechman, A 2 and Zięba, DA 1
1Department of Sheep and Goat Breeding, Agricultural University of Krakow,
Poland; 2 Animal Physiology Dept., Agricultural University, Krakow, Poland
Through its circadian release of melatonin, the pineal gland plays a
key role in integrating circannual responses in day length within the
neuroendocrine axis of the ewe. Leptin, which synthesis and release
are sensitive to acute changes in nutritional status, acts on target sites
within the brain that regulate appetite and energy balance. The
pituitary-thyroid system is regulated at multiple levels, one or more of
which might account for nutritional adaptation. Thyroid hormones are
obligatory for the annually recurring termination of reproductive
activity in a spectrum of seasonal breeders, including sheep. The
presence of leptin receptors in the thyroid gland has been reported and
some leptin effects may be, directly or indirectly, mediated by
hypothalamo-pituitary-thyroid axis. It was shown that, in the ewe, the
interaction between the thyroid gland and reproductive
neuroendocrine axes changes dynamically throughout the year. The
present study addresses questions related to timing of the interaction
between thyroid hormone - thyroxine (T4) and leptin in seasonal
breeding ewes. Studies were carried out on thyroid glands’ explants in
short-term culture. Glands were collected from nine ewes selected
randomly during long days (LD, i.e. Apr., May and July) and from
additional nine ewes during short days (SD, i.e. Sept., Oct, Nov). The
explants (approximately 30 mg) were equilibrated in 2.5 ml of
RPMI/F12 medium with 0.5% FCS for 30-min, followed by a 4.5 h
incubation in medium containing either 0, 50 or 100 ng/ml of
recombinant ovine leptin (roleptin) with melatonin (100 ng/ml) and
with or without TSH (100 ng/ml). Concentrations of T4 were
determined by RIA and expressed as means ± SEM. Thyroxine
concentrations in explants media were affected (P < 0.05) by season,
and melatonin had inhibitory effect (P < 0.05) on T4 secretion during
both long and short days. In explants cultures from thyroid glands
collected during SD, roleptin in both doses together with TSH
stimulated (P < 0.01) T4 release, however, those effects were
diminished by melatonin. In LD, high dose of roleptin applied with
TSH increased T4 secretion in comparison to control (P < 0.01), and
this effect was again inhibited by melatonin. The data obtained
provide an evidence for seasonal interactions between leptin and
thyroxine in ewes with higher T4 secretion during long days when
thyroid hormones are necessary for quiescence of the reproductive
activity in ewes.
P158
The use of melatonin and progestagen to advance
puberty in Awassi ewe lambs
Kridli, R 1 *; Jawasreh, K 2 ; Sawalha, M 1
1Department of Animal Production, Faculty of Agriculture, Jordan University of
Science and Technology, Irbid 22110, Jordan
2The National Center for Agriculture Research and Extension, Baqaa, Jordan
Introduction Ewes are generally culled at 6 to 7 years of age after
having produced 5 to 6 lamb crops. Advancing puberty age allows
ewe lambs to enter the breeding season at around 7 to 8 months of age
thus obtaining one more lamb crop per female during her productive
life. Attempts to breed ewe lambs at an earlier age in Jordan resulted
in limited success as only 20 to 30 % of the females lambed at one
year of age (personal communication). Thus, the objective of this
study was to advance puberty and initiate the breeding season in
Awassi ewe lambs through hormonal treatments.
Methods This experiment was conducted at the Khanasry Station for
Small Ruminant Development to evaluate the effect of administering
hormonal treatments [melatonin, progestagen and pregnant mare\'s
serum gonadotropin (PMSG)] on advancing puberty in Awassi ewe
lambs. Fifty one, 6-month old ewe lambs of similar body weights
(around 28 kg) were randomly assigned into four treatment groups; no
hormonal treatment (CON; n=14), melatonin (M; n=13), progestagen
and PMSG (PP; n=13) and melatonin plus progestagen and PMSG
(MPP; n=11). Ewe lambs in the PP and MPP groups were treated with
intravaginal progestagen sponges for 14 days. Four hundred IU
PMSG were administered to each of these ewe lambs on the day of
sponge removal. Ewe lambs in the M and MPP groups received
subcutaneous melatonin implants (Regulin®, 18 mg melatonin) 36
days before sponge insertion. The melatonin implants were applied in
mid May, around 6 to 7 weeks before the natural breeding season for
Awassi. Fertile, harnessed Awassi rams were introduced at the time of
sponge removal.
Results Hormonal treatment had no effect on body weight. Estrus
expression tended to be greater (P = 0.1) in the M, PP and MPP
compared with CON ewe lambs (92%, 92%, 100% and 71%,
respectively). The duration from ram introduction to onset of estrus
was shorter (P < 0.001) in PP and MPP than in M and CON ewe
lambs (12±3.5, 5.7±3.7, 23.9±3.5 and 26.5±3.9 d, respectively).
Pregnancy rate (evaluated by ultrasonography 60 days post ram
introduction) was similar among treatments although being
numerically greater in the MPP group (50%, 61.5%, 53.8% and 81%
in CON, M, PP and MPP ewe lambs, respectively).
Conclusion Results indicate that a combination of melatonin,
progestagen and PMSG appears to be effective in advancing puberty
in Awassi ewe lambs. The lack of significant differences in estrus
expression and pregnancy rate may be attributed to the low number of
animals.
P159
Luteinizing hormone (LH) and Follicle stimulating
hormone (FSH) induce the expression of Cyclooxygenase
-2 mRNA in cervical tissue of non-pregnant ewes
Leethongdee, S 1,2 *, Khalid, M 1 and Scaramuzzi, RJ 1
1The Royal Veterinary College, University of London, United Kingdom;
2Faculty of Veterinary Medicine and Animal Sciences, Mahasarakham
University, Thailand
Introduction The ovine cervix contains both LH and FSH receptors
and their concentrations are greatest at oestrus indicating
physiological roles in relaxation of the cervix. Cervical relaxation at
oestrus is mediated by prostaglandin E 2 whose synthesis is regulated
by the inducible enzyme, COX-2. Consequently, the high level of
FSH and LH during the peri-ovulatory period may stimulate COX-2
regulated PGE 2 synthesis leading to cervical relaxation at oestrus. Our
objective was to determine the effect of intra-cervical LH and FSH on
the expression of COX-2 mRNA in the cervix of the ewe during
oestrus.
Methods Eighteen ewes were assigned to 4 groups of 5 (groups 1 and
2) or 4 ewes (groups 3 and 4). Oestrus was synchronised using
progestagen pessaries and 500 IU PMSG at pessary removal. Intracervical
hormone was applied 24h after pessary removal: Group 1:
FSH 2 mg; Group 2: LH 2 mg; Group 3: Vehicle; Group 4: Control.
Cervices were collected 54h after sponge removal or 30 h after
hormone treatment and divided transversely into 6 sections; alternate
sections were formalin fixed, wax embedded and sectioned at 7μm.
The expression of COX-2 mRNA was determined by In situ
hybridization using a digoxigenin-11-UTP labelled riboprobe. COX-2
expression in cervical tissue was analysed in five tissue layers
(epithelium, stroma, circular, longitudinal and transverse muscle) and
three cervical regions (vaginal end, middle region and uterine end).
Results The expression of COX-2 mRNA in cervical tissue of ewes
treated with FSH was greater than in the gum vehicle (P = 0.004) and
control (P = 0.003) groups. Similarly, the expression of COX-2
mRNA in cervical tissues of ewes treated with LH was also greater
than in the gum vehicle (P = 0.007) and control (P = 0.006) groups.
The highest expression of the COX-2 mRNA was at the vaginal end
of the cervix. The expression of COX-2 mRNA at the vaginal end and
the middle region were significantly greater than at the uterine end
(both P < 0.001).There was no difference in COX-2 mRNA
expression between the vaginal end and the middle region (P = 0.683).
Among the tissue layers expression was highest in the luminal
epithelium and lowest in the stroma. The expression of COX-2
mRNA in smooth muscle and luminal epithelium were higher than in
the stromal layer (both, P < 0.001).

16 t h International Congress on Animal Reproduction
Poster Abstracts 81
Conclusions The results show that both FSH and LH stimulated
COX-2 mRNA in the sheep cervix at oestrus. The increased COX-2
induced by FSH and LH is probably associated with increased PGE 2
synthesis and cervical relaxation during the peri-ovulatory period.
P160
Synchronization with progestagen affects LH receptor
and function of corpus luteum in sheep
Letelier, C 1,2 *; Garcia, RA 3 ; Contreras, I 1 ; Garcia-Palencia, P 3 ; Sanchez, B 3 ;
Sanchez, MA 3 ; Gonzalez-Bulnes, A 1 ; Flores, JM 3
1Reproducción Animal, INIA, Spain; 2 Facultad Cs. Veterinarias, UACh, Chile
3Facultad de Veterinaria, UCM, Spain
Introduction Pregnancy in mammals is the consequence of an
adequate equilibrium between embryo and maternal factors; mainly
luteal activity, in terms of progesterone (P) secretion. The
gonadotrophin LH is the primary luteotropic hormone, supporting the
development and function of the CL, through LH receptors expressed
in ovary. Thus, we aimed to discern possible effects of
synchronization treatment on LH secretion and/or LH receptors
expression around the implantation.
Methods Oestrus was synchronized in 30 Manchega sheep; half of
the animals were treated with three injections of prostaglandin, 10
days apart (group, PGF), and the remaining 15 ewes, were
synchronized with intravaginal progestagens, applied for 14 days
(group FGA). Appearance of oestrus behaviour was detected with
rams and considered Day 0. Number and size of all CL were
determined daily by 7.5 MHz transrectal ultrasonography until Day
13, 15 and 17 of pregnancy. Blood samples were taken coincidentally
and plasma progesterone concentration and LH concentration were
measured by radioimmunoassay and ELISA, respectively. Ovaries
with corpora lutea of PGF and FGA group were collected on days 13,
15, 17 post mating, routinely processed in 4% paraformaldehyde and
paraffin-embeded. The corpora lutea (n= 45) were studied using
conventional immunohistochemical techniques for determining LH
receptor (LHr) expression.
Results In both groups, the total luteal tissue in sheep showed a linear
growth (p

16 t h International Congress on Animal Reproduction
82 Poster Abstracts
P163
Ram sperm morphometry: intra-individual variation and
relation with fertility
Mata-Campuzano, M. 2 *; Garcia-Macias, V. 1 ; Anel, L. 1 , Alvarez, M. 1 ; Bernardo,
J. 1 ; Chamorro, C 3 ; De Paz, P. 2
1Animal Reproduction and Obstetrics, University of Leon, 24071, León, Spain;
2Cell Biology, University of Leon, 24071, León, Spain; 3 Veterinary Anatomy;
University of Leon, 24071, León, Spain
Sperm head morphometry provides an objective analysis of a semen
sample since the development of computer assisted analysis
technology. Relationship between fertility and normal shape of
spermatozoa morphology has been studied widely in both humans and
animals.
This work has to main objectives: 1. to determine if sperm head
morphometry and fertility are related in ram sperm (assessing
ejaculates from 24 Assaf rams), 2. to test if there were differences
among the ejaculates of the same animal (6 animals, 3 separated
ejaculates, two weeks interval). All ejaculates were collected by
artificial vagina and diluted in extender (tris 3.322 g, citric acid 1.737
g, fructose 0.954 g and distilled water 100 ml) to a final concentration
of 400×10 6 spermatozoa/ml. Samples were fixed in 2% glutaraldehide
in BL1 medium (glucose 2.9 g, sodium citrate dehydrated 1.0 g
sodium bicarbonate 0.2 g and distilled water 100mL). Microscope
slides were prepared by placing a 5µl drop of the extended semen at
the edge of a frosted slide and dragging the drop across it. Slides were
air dried for at least two hours and stained using a Diff-Quik staining
method (QCA, Tarragona, Spain). Subsequently, slides were rinsed in
distilled water and air dried, then examined with a bright field
microscope at a magnification of 600x. At least 100 properly digitized
sperm heads for each sample were analyzed with a computer assisted
sperm morphology assessment (CASMA, integrated semen analysis
system v 1.0.9 PROISER, Valencia, Spain) system. Each sperm head
was measured for length (L, µm), width (W, µm), area (A, µm 2 ),
perimeter (P, µm); and four derived parameters of head shape:
elipticity (ELI): L/W; rugosity (RU): 4πA/P 2 ; elongation (ELO): (L-
W)/(L+W); and regularity (RE): π LW/4A. Mean values were L: 8.67;
W: 4.92; A: 36.37; P: 24.12; ELI: 1.76; RU: 0.78; ELO: 0.27; RE:
0.94.
In experiment 1 our results show statistically significant differences
(p0.05) with
fertility. Sample preparation and analysis techniques should be
improved in order to obtain more accurate results.
This work was supported in part by CICYT (AGL2005-07601),
Diputación de León and Junta de Castilla y León.
P164
Effects of aflatoxin B1 on ram epididymal and ejaculatory
sperm motility
Mirshokraei, P 1 *, Tajik, P 2 , Khosravi, A 3
1Department of Clinical Sciences, Faculty of Veterinary Medicine, Shahrekord
University, Shahrekord, Iran; 2 Department of Clinical Sciences, Faculty of
Veterinary Medicine, University of Tehran, Iran; 3 Department of Microbiology,
Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
In order to study the effects of aflatoxin on ovine spermatozoa,
epididymal and ejaculatory sperm were added different concentrations
of aflatoxin B1. When ram epididymal sperm were exposed to
different concentrations of aflatoxin, one-hour post incubation in
control group, 68.16% were motile, significantly (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 83
P166
Short term nutritional supplementation improves
reproductive performance in ewes maintained under
extensive conditions in arid central Mexico
Muñoz-Gutiérrez, M 1 *; Scaramuzzi, RJ 2 ; Escobedo Alcántara, JC 3 ; Trejo-
González, A 4 ; Retana-Márquez, MS 1 ; Damian-Matzumura, P 1 and Borregos
de Patria Nueva, AC 5
1Reproductive Biology Departament, Universidad Autónoma Metropolitana
Iztapalapa 09340 Mexico City, Mexico; 2 Department of Veterinary Basic
Sciences, Royal Veterinary College, Hawkshead Lane, North Mimms Herts
AL9 7TA, United Kingdom; 3 Fundación Mexicana para el Desarrollo Rural
Tepeji del Río A.C. 42850 Hidalgo, México; 4 Medicina Veterinaria y
Zootecnia. Facultad de Estudios Superiores Cuautitlán, Universidad Nacional
Autónoma de México, 54700 Cuautitlán Estado de México, Mexico;
5Comunidad de Patria Nueva Hidalgo, Mexico
In the arid regions of Mexico (Hidalgo, Central Mexico) sheep are
managed under extensive conditions on pastures that are of poor
nutritive value. The development and transfer of a simple and
inexpensive technology to improve the reproductive performance of
these flocks would be a significant economic benefit to these
subsistence farmers. Short-term nutritional supplementation of ewes
with a high energy and high protein diet for the last three days of the
oestrous cycle increases litter size of sheep managed under more
favourable grazing conditions in Australia, Uruguay and Europe. The
present trial was carried out to determine if short-term nutritional
supplementation of ewes grazing poor quality pasture in the arid zone
on central Mexico could improve their fertility. Seventy five mixed
breed (Corriedale X Rambouillet X Suffolk) adult cycling ewes
(median BCS = 2) were treated in the breeding season for 11 days
with progestagen sponges and 500 IU of eCG injected on the day of
sponge removal. The animals were supplemented for seven days with
a diet consisting of 250 g of rolled corn, 140 g of soya bean and 950 g
of alfalfa hay per animal per day. The diet was offered to the animals
starting three days before sponge removal and continuing until four
days after sponge removal. Twenty seven control ewes were allowed
to graze the available native pasture and their oestrous cycles were not
synchronized. The proportions were analyzed using the Chi squared
test. Following the introduction of fertile males, 81% (61/75 females)
of the ewes fed the supplement displayed oestrous behaviour 1.54 ±
0.05 days (mean ± SEM) after sponge removal and all 61 animals
became pregnant at the induced cycle. Of the 27 control ewes only 8
(30%) mated and only 5 (18.5%) became pregnant (P 70 days after lambing. Ovarian activity was
considered as cyclic if the P4 level was more than 3.2 nmol/l at least
in one sample, e.g. in 20 (37%) and 13 (43%) of the HPM and TS
ewes, respectively. The distribution of various MnII and RsaI
genotypes was quite similar in the two breeds (in HPM: MnII
AA=19%, AB=51%, BB=31%; RsaI AA=23%, AB=56% BB=21%;
in the TS: MnII AA=14%, AB=54%, BB=32%; RsaI AA=11%,
AB=61%, BB=28%; in case of both RFLP sites allele “A” means the
absence of the cleavage site). Association between genotypes and
seasonality was significant (P

16 t h International Congress on Animal Reproduction
84 Poster Abstracts
P169
Early sonographic diagnosis of embryo/fetal compromise
in sheep cloned derived pregnancies using heart rate,
crown rump length and abdominal circumference
measurements
Panarace, M*; Suarez, G; Cané, L; Garnil, C; Medina, M
GOYAIKE S.A.A.C.I. y F., Biotechnology Area, Carmen de Areco CC37, CP
6725, Buenos Aires, Argentina
Introduction Sheep cloning has been associated with an increased
incidence of abnormal development of the conceptus and a high rate
of pregnancy and neonatal loss. The overall efficiency remains low
and the production of live offspring is still an unpredictable event.
Thus, early prediction of the outcome of pregnancies initiated from
cloned embryos has became an important issue, both for reutilization
of recipients and also to prevent potential harm to the recipient, the
lamb or both. Ultrasonography has proven to be an important, noninvasive
method of screening that can be used as predictor of
embryo/fetal loss.
Objective The aim of this study was to determine if and which of the
in vivo ultrasound and Doppler observations of fetal and placental
development could be of predictive value for diagnosis of high-risk
pregnancies.
Materials and methods Forty-five natural-mated derived singleton
pregnancies were used as the control group (A). In addition, 113
Merino breed recipients bearing clones were split into three groups
according to the outcome of their pregnancies: (B) clones that died
between 31 and 90 days (n = 78), (C) clones that died between 91
days and 48 hours after birth (n = 33) and (D) clones alive with more
than six months old (n = 2). Measurements were taken every two
weeks by ultrasonography (Toshiba Nemio 20, Tokyo, Japan) using
two different convex probes, a 5-10 MHz from days 31 to 60 of
gestation (transrectal) and a 3-6 MHz thereafter (transabdominal).
Three parameters were measured: heart rate (HR, bpm) was
determined by Doppler interrogation of umbilical arteries; crown
rump length (CRL, mm) was measured in a longitudinal section of the
embryo and abdominal circumference (ABC, mm 2 ) was registered in a
cross section of the fetus abdomen. Data were analyzed by Chi-square
test and differences were considered significant when P < 0.05.
Results While fetal losses were relatively rare in ewes carrying
naturally mated ewes, losses were considerable in the cloned fetuses
(4% versus 97%, respectively). At 31 days of pregnancy 32% of
embryos that died before 90 days (B) and 21% of those that died after
90 days (C) had a HR < 188 bpm; the incidence of this abnormality
was higher (P < 0.05) in (B) and (C) than in (A) (0%). Also at 31
days, CRL < 16.5 mm was found in 14% of embryos in (B) being
different (P < 0.05) to that observed in (A) and (C), (0%). At 87 days
of gestation, 38% of the fetuses in (C) had ABC values > 228 mm 2 ,
this incidence was higher (P < 0.05) than that in (A), (0%). Given
these findings, it is entirely plausible that the early losses recorded in
our current study resulted partly from developmental defects of the
embryo/fetus proper and partly from placental failures (most of the
fetuses with enlarged ABC were simultaneously found with hydrops).
Conclusion A HR < 188 bpm or a CRL < 16.5 mm detected with
ultrasonography at 31 days of pregnancy were important markers for
clones that died between 30 and 90 days of gestation. In addition,
ABC at 87 days was a predictor of fetuses that developed large
offspring syndrome.
P170
Hyperglycaemia in day 9 of the estrous cycle did not
increase ovulation rate in ewes but modified plasma IGF-I
concentrations
Pérez-Clariget, R 1 *; López-Mazz, C 1 ; Regueiro, M 1 ; Crooker, BA 2 ; Carriquiry, M 1
1Department of Animal Production and Pastures, School of Agronomy,
UDELAR, Uruguay; 2 Department of Animal Sciences, University of
Minnesota, USA
To evaluate the effect on ovulation rate of increased glycaemia during
24 h in the luteal phase of cycling ewes, thirty-four non-lactating adult
Corriedale ewes (44.6±4.5 kg of body weight and 3.2±0.5 body
condition, in a scale 1-5) that grazed native pastures were used. Estrus
was synchronized with 2 doses of cloprostenol 8 d apart and on day 9
of the synchronized estrous cycle, ewes were randomly assigned to
receive an oral administration of a neoglucogenic solution (125 ml;
70% glycerol, 20% propilenglycol, 10% distilled water; n=17;
Group-G) or saline (n=17; Group-S), administrated every 6 h for a
24 h-period. All ewes were inseminated with fresh semen at the
following (natural) estrus and number of corpus luteum (CL) was
observed by laparoscopy at day 8 of the natural estrous cycle. Means
were considered to differ when P

16 t h International Congress on Animal Reproduction
Poster Abstracts 85
Grants: CICYT-FEDER AGL 2005-02614, CICYT-FEDER AGL
2007-61229 and DGA A-26/2005.
P172
Plasmatic progesterone and cortisol concentrations in
non-pregnant, pregnant and lactating Saanen breed goats
De Paula, M 1 ; Peruca Baldini, L 1 *; Greco, G 1 ; Bittencourt, RF 1 ; Maia, L 2 ; Oba, E 1
1Department of Radiology and Animal Reproduction, São Paulo State
University -UNESP- Botucatu, Brazil; 2 Department of Veterinary Clinics and
Pathology, Fluminense Federal University -UFF, Brazil
Progesterone is well known as being the main hormone capable of
maintaining pregnancy in domestic animals. Cortisol, on the other
hand, is released during stress, being responsible for the induction of
parturition through stimulation of progesterone catalysis. In the
bovine species, high cortisol concentrations have been detected
moments before birth and during the puerperal period. In comparison
to other domestic ruminants, few studies have been published
regarding the variations in the plasmatic concentrations of cortisol in
goats, according to their reproductive state. The present work had as
objective to determine the plasmatic concentrations of progesterone
and cortisol in non-pregnant, pregnant and lactating Saanen breed
goats. Forty-three (43) female Saanen goats, aging 24 to 32 months,
were assigned into three different groups according to their
reproductive state. Group 1 was composed of 15 non-pregnant goats.
Thirteen (13) goats experiencing their last month of pregnancy were
assigned to group 2. As for group 3, it was composed of 15 lactating
goats, whose kids were at most one month old. Blood was collected
between 8:00 and 10:00 am through jugular venipuncture into tubes
containing heparin, which were centrifugated at 3000 x g for 15
minutes. Plasma obtained was immediately stored at – 20 degrees
Celsius. Progesterone and cortisol concentrations were estimated
through radioimmunoassay, using Diagnostic Products Corporation®
(DPC) kits. The obtained data was statistically analyzed through the
Statistical Analysis System®, version 6.1, 1996. The concentrations
of progesterone and cortisol were compared between the groups using
the Student-Newman-Keuls test. The correlation between both
hormones measured concentrations was established using the PROC
CORR procedure. Significance levels were set as P < 0.05. No
correlation was found between cortisol and progesterone
concentrations (P > 0.05). Mean progesterone concentrations were
1.71 ng/mL +/- 2.18, 13.56 ng/mL +/- 5.21 and 0.2 ng/mL +/- 0.08 in
groups 1, 2 and 3, respectively. Pregnant goats had higher (P < 0.01)
progesterone concentrations than lactating and non-pregnant animals.
As for cortisol, mean concentrations were, respectively, 1.75 μg/dL
+/- 1.04, 1.21 μg/dL +/- 0.4 and 1.17 μg/dL +/- 0.6 in groups 1, 2 and
3. Plasmatic cortisol concentrations were similar between the
analyzed groups. Progesterone concentrations were higher in pregnant
than in lactating and non-pregnant animals. No correlation between
both hormones was found.
P173
Reproductive parameters of dairy goats submitted to
artificial bioclimatic conditions similar to the Eastern
Amazon Region
Pinho, RO. 1 ; Guimarães, JD. 1 *; Martins, LF. 1 ; Castilho, EF. 1 ; Borges, MCB. 1 ;
Paraizo, RM. 1 ; Torres, CAA 2 ; Vasconcelos, GSC 1 .
Veterinary Medicine Department, Viçosa Federal University, Brazil;
2Zootechnics Department, Viçosa Federal University, Brazil
This work deals with the reproductive behavior of Alpine and Saanen
female goats submitted to artificial bioclimatic conditions similar to
those of the Eastern Amazon Region, when compared to female goats
raised under normal typical bioclimatic conditions of regions where
they demonstrate seasonality. The study was conducted during the
reproductive season for goats, consisting of an adaptation period of 30
days and an experimental period of 60 days, in the bioclimatic
chamber. Group 1 (n=4) animals remained in the bioclimatic chamber
with temperature and air humidity control (8:00-12:00 hours: 30 ºC;
12:00-18:00: 36 ºC; 18:00-8:00: 26 ºC; with 60 % of average
humidity; and a 12 hour fotoperiod), thus simulating bioclimatic
conditions of the northern region of Brazil (next to the Equator line),
whereas group 2 (n=4) was kept under influence of the natural
climatic variations of the season. Physiological parameters were
measured twice a day, with daily follicular dynamics accompaniment,
besides blood collection twice a week for cortisol, progesterone and
estrogen dosages. During the experimental period, a difference was
observed (p0.05). There was no difference (p>0.05) in the duration of estral
cycle and estrus for the animals of groups 1 and 2. There was no
difference (p>0.05) in relation to the number of follicles observed in
the day of the estrus and to the ovulatory follicle diameter, as a
function of the groups and number of estrus evaluated, with average
values of 4 and 3.5 in the 1 st estrus, 5 and 3 in the 2 nd estrus, and 4 and
4.5 in the 3 rd estrus, for groups 1 and 2, respectively. The number of
follicular waves observed varied from 4 to 5 in group 1 and 2 to 4
waves in group 2. Although the animals of group 1 demonstrated
higher values of progesterone and estrogen in relation to the animals
of group 2, the endocrine secretion standard of these hormones
revealed to be similar for both groups in all the studied estral cycles,
as a function of time. The results indicated that female goats can be
raised under bioclimatic conditions, without modifying the related
physiological standards.
P174
Relation between superovulatory response and embryo
quality with hematological and biochemical blood
variables in hair ewes
Ramón, J 1 *, Sauri, I 2 , Navarrete, L 1 , González, E 2 , Cervera, D 1 , Sierra, A 1 ,
Piña, R 3 and Quintal, J 4
1Center of Ovine Selection and Reproduction, Technical Institute of Conkal,
Yuc., Mexico (J. Ramón jramon@itaconkal.edu.mx); 2 Central Regional
Laboratory of Merida, Yuc, Mexico. 3 Faculty of Medicine, Autonomous
University of Yucatan, 4 INIFAP-Mococha, Yucatán, México
Our aim was to correlate hematological (hematocrit and hemoglobin)
and biochemical blood variables (plasmatic proteins, total proteins,
albumin, glucose, cholesterol, creatinine, urea, ureic acid, alanine
aminotransferase, aspartate aminotransferase and alkaline
phosphatase) with ovulation rate and embryo quality in Pelibuey
sheep. No significant relationships were found (P > 0.05) between
ovulation rate and such variables. However, significant difference was
found (P < 0.05) between ureic acid and embryo quality a correlation
of 0.4686. By using a regression analysis, this equation was obtained:
embryo quality = 3.4050 + 1.5549*Ureic acid. This equation
expresses that for every 0.3 mg/dL increment in ureic acid levels, the
embryo quality improves 1.55 units of score. The levels of ureic acid
were proportionally inverse to urea, showing a tendency (P < 0.1)
only with creatinine over embryo quality. The supplementation before
and after the superovulatory treatment showed differences, on
hematocrit (P < 0.01), hemoglobin (P < 0.01), glucose (P < 0.05), urea
(P < 0.05) and alkaline phosphatase (P < 0.01). These results suggest
that biochemical parameters such as ureic acid, urea and creatinine,
may be involved together with methabolic pathways that contribute to
predict or explain levels of superovulatory response and embryo
quality with the applicattion of exogenous gonadothropins.
Supported by: DGEST 509.07-P and CONACYT-SAGARPA-2004-
C01-150/A-1

16 t h International Congress on Animal Reproduction
86 Poster Abstracts
P175
Expression of VEGF in Corpora Lutea of progestagen
synchronized-sheep
Sanchez, MA 1 *; Garcia-Fernandez, RA 1 ; Letelier, C 2-3 ; Sanchez, B 1 ; Garcia-
Palencia, P 1 ; Gonzalez-Bulnes, A 2 ; Flores, JM 1
1Faculty of Veterinary Medicine, UCM, Spain; 2 Animal Reproduction Dpt,
INIA, Spain; 3 Faculty of Veterinary Medicine, UACh, Chile
Introduction Vascular endothelial growth factor (VEGF) is expressed
in blood vessels in thecal derived compartiments and granulosa
derived-parenchymal lobules in corpora lutea (CL) 1,2 but there are
some discrepancies about its expression in luteal cells 2,3,4 in different
species. Though, our aim was to study VEGF expression in different
compartiments of the CL in progestagen-induced sheep and elucidate
its potential relation with different synchronization treatments.
Methods Ovaries from progestagen synchronized (n= 30) and natural
cycling (n= 30) Manchega ewes were collected on days 9, 11, 13, 15,
17 and 21 post mating, routinely processed in 4% paraformaldehyde
and paraffin-embeded. Later, 41 CL of progestagen synchronized and
48 CL of natural cycling ewes were studied using conventional
immunohistochemical techniques with a monoclonal anti VEGF. In
every CL were considered 4 different compartiments to evaluate
VEGF expression: CL peripheral blood vessels, thecal derived
compartiments, granulosa derived-parenchymal lobules and luteal
cells.
Results VEGF was positive in capillaries and small and medium
arteries in the different compartiments studied as well as in luteal
cells, but with differences in the intensity of immunostaining among
different CL. However, regarding treatments, only on day 9 and in the
peripheral blood vessels and granulosa derived-parenchymal lobules
capillaries was possible to see a significant increase (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 87
P178
Echo-Doppler evaluation of umbilical blood flow during
pregnancy in sheep
Suarez, G 1 *; Panarace, M 1 *; Cané, L 1 ; Garnil, C 1 ; Medina, M 1
1GOYAIKE S.A.A.C.I. y F., Biotechnology Area. Carmen de Areco CC37. CP
6725. Buenos Aires. Argentina.
Introduction Placental blood flow and vascular development are
essential components of normal placental function and are critical to
fetal growth and development. Umbilical Artery Doppler is an
ultrasound technique that allows one to gauge how much resistance
fetal blood encounters during its passage through the placenta. Ideally,
fetal blood should encounter very little resistance; with certain
placental abnormalities, increased resistance to flow may limit
oxygenation transfer to fetal blood. Therefore, blood flow in umbilical
arteries can be used to monitor placental development and fetal
hemodynamics and use these findings for assessing the condition of
the fetus.
Objective Based on the above mentioned considerations, and
considering that most of the studies of umbilical arteries in sheep has
been done in instrumented and/or anesthetized fetuses, we aimed to
characterize, noninvasively, the Doppler flow velocity waveform in
umbilical arteries of ewes with apparently normal pregnancies.
Materials and methods Fifteen multiparous, nonlactating Merino
breed ewes with singleton pregnancies achieved after natural mating
were examined weekly from 4 to 20 weeks of gestation.
Ultrasonography (Toshiba Nemio 20, Tokyo, Japan) was performed
using two different convex transducers, a 5-10 MHz (transrectal) from
4 to 8 weeks of gestation and thereafter using a 3-6 MHz
(transabdominal). Three resistance indices were calculated: S/D ratio,
Resistance index (RI) = (S-D)/S, and Pulsatility Index (PI) = (S-D)/M.
[S = systole, D = diastole, and M = mean maximum Doppler-Shift
frequency over the cardiac cycle]. A repeated measure ANOVA was
used to detect differences between mean values of each Doppler index
for every week of gestation using the Fisher test (InfoStat V1.5, FCA,
Universidad de Córdoba, Córdoba, Argentina). Correlation between
Doppler indices was also calculated. All data are shown as mean ±
S.D.
Results The duration of pregnancy was 148 ± 1.5 days, all lambs
were born naturally without any type of assistance. All three Doppler
indices were highly correlated: S/D versus RI versus PI, r > 0.84.
From weeks 4 to 9 of pregnancy, blood flow was characterized by a
systolic pattern (i.e. high resistance with absence of diastolic flow). At
10 and 12 weeks of gestation, 50% and 100% of the fetuses showed a
diastolic flow consistent with low resistance, respectively. All three
resistance indices decreased (by > 45%, P < 0.05) from week 10 (SD
= 7.62 ± 1.82; RI = 0.86 ± 0.03; PI = 1.70 ± 0.23) to week 16 (SD =
2.72 ± 0.52; RI = 0.62 ± 0.07; PI = 0.95 ± 0.18) of pregnancy, with no
substantial changes thereafter (P > 0.05).
Conclusion Umbilical artery blood flow pattern in ewes was initially
systolic (high resistance) but became diastolic (low resistance) from
week 11 of pregnancy onwards. Noninvasive Doppler sonography
was useful for assessment of umbilical blood flow from 4 to 20 weeks
of pregnancy, these reference values may be useful for assessing
placental function in high-risk pregnancies e.g. cloned derived
pregnancies.
P179
Estrogen and Progesterone Receptors in the vagina of
progesterone primed and GnRH treated anoestrous ewes
Tasende, C*, Acuña, S; López, C; Garófalo, E
Cellular and Mollecular Biology, Faculty of Veterinary Medicine, Uruguay
The Estrogen and Progesterone Receptors (ER, PR) concentrations
were investigated in vagina of anestrous Corriedale ewes treated with
GnRH or with Progesterone (P) plus GnRH. Twenty two ewes were
assigned to two groups: GnRH (n = 11) and P+GnRH (n = 11). The
P+GnRH ewes were treated with 0.33 g of P (CIDR) for 10 Days and
immediately after CIDR removal they were treated every 2 h with 6.7
ng of GnRH (i.v.) for 16 h, followed by bolus injection of GnRH (4
μg, Day 0) at 18 h. The GnRH ewes were treated according to the
same protocol without P pre-treatment. Ewes were killed on Day 1 (n
= 6, for each treatment) and Day 5 (n = 5, for each treatment) after
bolus injection. Samples of vagina and blood were taken for receptors
and P determinations when the ewes were killed. The ER and PR
determinations were performed by ligand binding assay. The ligands
used were 3H-E2 for ER or 3H-ORG-2058 for PR, while nonlabelled
ligands were diethylstilbestrol and ORG-2058 respectively. The ER,
PR and P concentration were analyzed by ANOVA. On Day 5 the P
concentration (mean ± pooled s.e.) were higher in the P+GnRH ewes
than in the GnRH ewes (6.5±0.54 vs. 3.1±0.61 nmol/L, respectively,
P

16 t h International Congress on Animal Reproduction
88 Poster Abstracts
decreased to the end of the regression phase (6.23±0.95 and
5.94±1.23) (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 89
LP ewes (1.2 ± 0.3; P < 0.05), but this was not associated with
differences in numbers of atretic or healthy follicles, follicular
dynamics or metabolic hormone concentrations. Supplemented ewes
had 2.3 ± 0.6 and 2.2 ± 0.6 healthy follicles on Days 3 and 7, less than
control ewes on Day 3 (4.6 ± 0.6; P < 0.01) but the same as controls
on Day 7 (2.0 ± 0.6). The largest healthy follicle from supplemented
ewes was larger (6.1 ± 0.2 mm) with more granulosa cells (3.7 ± 0.2
million) than in non-supplemented ewes (5.4 ± 0.2 mm and 3.0 ± 0.2
million; P < 0.05). Insulin, leptin and IGF-I concentrations were
higher in supplemented than in control ewes (P < 0.01). These results
suggest that, while metabolic hormones explain the positive effect of
short-term supplementation on follicular growth, they are not involved
in the increase in ovulation rate promoted by nutrition during
pregnancy. Meat & Livestock Australia and the University of Western
Australia supported this work.
P184
The use of artificial long days is not effective to induce
reproductive activity in Mediterranean goat does without
isolation from males
Zarazaga, LA 1 *, Gatica, MC 2 , Guzmán, JL 1 , Celi, I 1
1Universidad de Huelva, Carretera de Palos de la Frontera s/n, 21819, Huelva,
Spain; 2 Universidad Arturo Prat, Avda. Arturo Prat, 2120, Iquique, Chile
One experiment was designed to investigate whether the treatment
with artificial long days is effective to induce and synchronize
reproductive activity during the normal seasonal anoestrous in
Mediterranean goat does that were not isolated from males. Two
balanced groups of does according to their body weight (BW) and
body condition score (BCS) were used. One group was subjected to
artificial long days treatment (16L:8O) (LD, N=24) from 17 th
November to 5 th February, and the control group was maintained
under natural photoperiod (C, N=23). From November to May BW
and BCS were measured weekly. Oestrous activity was tested daily
using entire aproned males from the end of the photoperiodic
treatment to the end of the experimental period. Ovulation rate was
evaluated by laparoscopy 7 days after positive identification of
oestrous. Effect of LD treatment and month on BW, BCS, was tested.
The effect of treatment was studied on the date of the first detected
oestrous after the end of LD treatment during the normal seasonal
anoestrous, on the ovulation rate of the first detected oestrous and on
the percentage of females that showed oestrous. No effect of LD
treatment, month or interaction between both variables on BW was
observed. However, BCS was influenced by all analyzed factors (at
least P

16 t h International Congress on Animal Reproduction
90 Poster Abstracts
allele and genotype frequencies and Hardy-Weinberg equilibrium
were calculated. Allele frequency is 0.44 % for allele C and 0.56 %
for allele T; population is in Hardy-Weinberg equilibrium. Genotype
frequency is 20% for the genotype C/C, 34.5% for T/T and 45.5% for
C/T. Statistical analysis indicated that buffaloes carrying the genotype
C/C showed their reproductive activity (7 vs. 4; P 0.05 and for G2, T1 = 15.0% (3/20) and
T2 = 14.3% (3/21) P> 0.05. Although, when comparing treatments of
the two different groups T1 from G1, 57.1% vs T1 from G2, 15.0%;
P< 0.05 and T2 from G1, 52.4% vs T2 from G2, 14.3%; P< 0.05 and
T1 from G1, 57.1% vs T1 from G2, 15.0%, P< 0.05, it was observed
statistical difference.
Conclusions Although in the northeast of Brazil, the buffaloes are not
submitted to a marked day length variation between the favorable and
unfavorable reproductive seasons, the Ovsynch protocol did not show
acceptable conception rate in the unfavorable season what may be due
to the lack of progeserone during this period. Yet, the use of half of
the dose of GnRH in the second application showed to be as efficient
as the full dose what reduces the cost of the protocol without
compromising the conception rate.
P189
Production of sex-preselected embryos and offspring in
water buffalo (Bubalus bubalis)
Lu, YQ 1 *; Liang, XW 2 ; Chen, MT 2 ; Zhang, XF 2 ; Lu, SS 1 ; Zhang, M 1 ; Pang,
CY 2 ; Lu, KH 1
1Animal Reproduction Institute, Guangxi Key Laboratory of Subtropical
Bioresource Conservation and Utilization, Guangxi University, Nanning
530004, China; 2 Guangxi Buffalo Research Institute, Chinese Academy of
Agricultural Science, Nanning 530001, China
Buffalo is an important livestock resource in many Asian and
Mediterranean countries. Sex-preselection via sperm sexing would be
of great interest in buffalo species both in biological and economic
terms. The objective of the present study was to evaluate the potential
of OPU-IVEP system to produce sexed embryos and offspring in
buffalo species. Buffalo sperm was sorted into X-sperm enriched
population following the general procedure described by Johnson and
Welch (Theriogenology 1999;52:1323-41). Oocytes were picked up
from fertile Murrah and Nili-Ravi buffalo cows by ultrasound
transvaginal ovum retrieval. The oocytes (grade A and B) derived
from OPU were matured in TCM199 supplemented with 5% estrous
cow serum and 10 μg/mL FSH and then fertilized in vitro with sexed
or unsexed sperm in modified Tyrode’s medium supplemented with
0.6% BSA, 2.0 mM caffeine and 20 µg/mL Heparin (Anim Reprod
Sci, 2007;100:192-6). Twenty cycling Murrah and Nili-Ravi buffaloes
were repeatedly submitted to OPU in this study. An average of 4.6
oocytes was retrieved per session per animal, 70.9% of which was
Grade A and B. A total of 1064 oocytes were submitted to in vitro
maturation and fertilization. The results indicated that the
developmental competence of oocytes fertilized with sexed and

16 t h International Congress on Animal Reproduction
Poster Abstracts 91
unsexed sperm was not statistically different in terms of cleavage rate
(sexed 50.5% versus unsexed 50.9%, P>0.05) and blastocyst
development rate (sexed 15.3% versus unsexed 19.1%, P>0.05). Of
the embryos produced in OPU-IVEP system, nine out of 34 sexed
fresh embryos (26.5%) and 5 out of 43 sexed frozen embryos (11.6%)
transferred to recipients established pregnancies, while 7 out of 26
unsexed fresh embryos (26.9%) and 6 out of 39 unsexed frozen
embryos (15.4%) transferred to recipients established pregnancies.
Among embryos produced by sexed spermatozoa, eleven buffalo
calves were delivered (10 females and 1 male) and 3 abortions (2
females and 1 male) recorded following embryo transfer. Among
embryos produced by unsexed spermatozoa and following their
transfer into suitable recipients, ten calves were delivered (6 females
and 4 males) and 3 abortions (3 males) were recorded. These data
would suggest that fresh as well as frozen-thawed embryos produced
from OPU derived oocytes have similar viability, together with a
similar potential to implant into the uterus and to establish
pregnancies. Finally, the birth of sex-preselected buffalo calves
indicated the full developmental competence of embryos produced in
OPU-IVEP system using sexed sperm. This work was jointly
supported by National Science and Technology Supporting Program
(No. 2006BAD04A18.), Guangxi Key Technology R&D Programs
(No. 0537001-1 and 0447001) and Guangxi University Key Program
(No. 2005ZD05).
P190
Serial ovarian ultrasonography in wild-caught wood bison
(Bos bison athabascae)
McCorkell, R*
Department of Veterinary Biomedical Sciences, Western College of
Veterinary Medicine, Canada
The Committee on the Status of Endangered Wildlife in Canada has
defined the wood bison (Bos bison athabascae) as a threatened
species. One method to ensure bison conservation is the
cryopreservation of gametes and embryos. To do this, a detailed
understanding of female bison reproductive physiology is required.
This study’s objectives were to determine if wood bison are amenable
to daily examination and to characterize ovarian function during the
non-breeding season. Ten two-year-old wood bison heifers obtained
from Elk Island National Park were placed in a corral adjacent to a
handling system designed for restraining bison. The handling system
was left open to the corral allowing the bison to freely explore it for 2
months. Active acclimation followed for a 2-week period during
which the bison were herded daily through the handling system and
rewarded with whole oats. Finally, the bison were restrained in the
handling system and then rewarded with whole oats upon release.
Once conditioned, daily transrectal examination of the ovaries was
successfully completed in 100% of attempts for 30 days (January-
February) using a B-mode scanner with a 5-10 MHz linear-array
transducer (SonoSite Titan, Markham, Ontario). Follicle size and
numbers were recorded, and individual follicles were identified
serially. Blood samples were collected daily and the serum was
analyzed for FSH and cortisol concentrations. In 3 bison, ovarian
follicles did not exceed 5 mm in diameter during portions of the study,
2 had elevated serum cortisol concentrations relative to the others and
the third had the lowest body weight of the 10. Therefore, data from 7
animals was used. There were non-random changes (P

16 t h International Congress on Animal Reproduction
92 Poster Abstracts
meiosis stage in: Germinal Vesicle, Germinal Vesicle Breakdown,
Metaphase I, Metaphase II and Degenerated. Plasma progesterone
concentration was measured in the blood samples by use of a solidphase
radioimmunoassay (Coat-A-Count, Diagnostics Products
Corporation, Los Angeles, EUA) according to the manufacturer’s
protocol. The SAS statistic program was used to evaluate mean,
standard deviation and Pearson’s correlation between the studied
characteristics. For statistic analysis, the progesterone concentrations
were divided in four groups: ≤1.0; >1.0 to ≤3.0; >3.0 to ≤ 5.0 and
>5.0 ng/mL. The plasma progesterone concentration was 3.70 ng/mL
in average. The average proportions of grade I (GI, homogenous
cytoplasm with several layers of granulosa cells), II (GII, homogenous
cytoplasm with one layer of granulosa cells) and III (GIII, denuded
and expanded) oocytes recovered and of oocytes that reached
metaphase II (MII) stage were 29.00%; 34.81%; 36.19% and 59.63%,
respectively. There was no statistic difference between the
progesterone concentrations and the values of GI, GII, GIII and MII.
In this study, there was no effect of plasma progesterone
concentration at slaughter on recovery and in vitro maturation of
buffalo oocytes. Acknowledgments: Frigol, Better Beef and Frivale
slaughterhouses. This study was supported by CAPES and FAPESP
(05/51151-2) – Brazil.
P193
Relationship between reproductive performances and
somatic cell count in dairy buffaloes raised in northern
Italy
Stelletta, C. 1 *, Guizzo, L. 1 , Sabino, D. 2 , Romagnoli, S. 1
1Department of Veterinary Clinical Sciences, University of Padua; 2 Castello di
Silea Farm, Treviso, Italy
Subclinical mastitis reduces reproductive performances in dairy cows.
Intramammary infection influences reproductive performance through
the effect of endotoxins on pulsatility and surge of LH and/or the
effect of inflammatory mediators on corpora lutea maintenance. Also
in dairy buffaloes it has been reported that intramammary infections
are characterized by increases in somatic cell count or somatic cell
score (SCS). The aim of this study was to investigate the relationship
between SCS (Log 10 of somatic cell count), calving intervals (CI) and
calving-conception interval (CCI) (considering a pregnancy length of
315 days). A total of 1850 calving intervals and the related monthly
milk controls (N = 14267) were analysed depending on calving
month. The mean SCS increased with days in milk (DIM) and tended
to be greater in Winter and Spring months (December to May) than
Summer and Fall (June to November). CI and CCI ranged from 475 to
567 days and from 175 to 300 days, respectively, for October and
April as calving months. There was no significant influence of SCS
on CI or CCI, however there was an evident increase of both
parameters in parallel with the increase of SCS up to a score of 5.6.
Beyond this score there were other animal bands which would restart
with a low CCI (irrespective of the calving month) and increase up to
the score of 5.9. These two animals bands observed could be
indicative of two different levels of immune response and/or
productive status. Further detailed investigation is suggested to
examine the effects of other relevant factors (granulocytes
adhesion/migration capacities and production) on the reproductive
performances of dairy buffaloes for appropriate intervention.
P194
Optimization of the cryopreservative conditions increases
viability and longevity of post-thawing semen in Thai
swamp buffaloes (Bubalus bubalis)
Swangchan-Uthai, T 1 *; Jongejans, TI 2 ; Reijneveld, NJ 2 ; Tharasanit, T 1 ;
Sirivaidyapong, S 1
1Department of Obstetrics, Gynaecology and Reproduction, Faculty of
Veterinary Science, Chulalongkorn University, Thailand; 2 Faculty of
Veterinary Medicine, Utrecht University, The Netherlands
Introduction Semen cryopreservation is a valuable tool to preserve
genetic material and to accelerate the desired genetic improvement in
swamp buffaloes. However, overall success of this technique is
relatively poor. The purposes of this study were to compare the effect
of ethylene glycol (EG) with glycerol (G) on cryopreservability of
swamp buffalo spermatozoa with different equilibration times in eggyolk
TRIS extender (EYT) and to investigate the advantage of Equex
STM paste on post-thaw sperm quality.
Materials and Methods 16 ejaculates from two fertile buffaloes were
collected over 4 weeks. The pooled semen was divided into 3 aliquots.
Semen from 2 aliquots was diluted with an EYT containing either 6%
G or 6% EG to a concentration of 120 x 10 6 mL -1 and consequently
divided in 2 fractions, then equilibrated at 4ºC for 2 or 4 hours
respectively (Exp. I). The remaining aliquot was equilibrated in 6% G
plus 1% Equex STM Paste at 4ºC for 4 hours, whereas semen
equilibrated in EYT without Equex served as a control (Exp. II).
Semen samples were packed in 0.5 ml straws and conventionally
frozen. After thawing at 37ºC for 30 sec, the semen was assessed for
motility, viability, plasma membrane functional integrity and
acrosome integrity. Semen samples from the Exp. I were evaluated
immediately after thawing, while the semen samples from the Exp. II
were evaluated at 0, 10, 30, 60 and 120 min after thawing.
Results Exp. I, the post-thaw sperm quality did not significantly differ
between cryoprotectants employed and also equilibration times. In
addition, acrosome integrity of buffalo bull sperm was preserved well
for both cryoprotectants (% intact > 90%). Exp. II, freezing and
thawing significantly reduced sperm motility and viability. Sperm
motility and viability at 30 min were significantly greater in the Equex
group than control, which were 61.9 ± 1.3 vs. 46.9 ± 3.7 % (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 93
test and ANOVA were used. Significant differences (P

16 t h International Congress on Animal Reproduction
94 Poster Abstracts
3rd and 6th month pregnant dromedaries were fixed in 4% (w/v)
neutral formalin and embedded in paraffin wax. Morphometric
examinations were carried out on Haematoxyline-Eosin stained
sections. Histochemical reactions were performed to evaluate the
secretion of proteins with the bromophenol blue method and
carbohydrates by means of PAS (neutral mucosubstances /
glycoproteins), Alcian blue (AB) pH 2.5 (carboxylated
mucosubstances) and AB pH 1.0 (sulphated mucosubstances). In
addition, the analysis of oligosaccharides was performed with 5
lectins in association with sialidase (s) treatment.Uterine glands from
6 month pregnant dromedary (6mp) were larger and the columnar
epithelium was taller than 3 month pregnant (3mp) ones. Mean gland
diameter was 60.0 ± 10.6 μm in 6mp and 47.8 ± 17.9 μm in 3mp
(p

16 t h International Congress on Animal Reproduction
Poster Abstracts 95
CP 42 rotational viscometer Brookfield model DV-I at a speed
gradient of 0 s -1 to 230 s -1 . Shear stress (γ) was calculated from the
measured viscosity profiles and the corresponding rheograms were
plotted. Similar to what has been described in human semen, a
pseudoplastic behavior which fit the following model: τ = K γ n (τ =
shear stress; K= structural viscosity; γ= share rate; n= coefficient of
consistency) was observed. Based on the rheogram, K and n were
calculated. Descriptive analysis of the rheological characteristics was
performed.
Results The results obtained (Referential Values) were (mean +/-
SD): (i) Apparent Viscosity at 11.5 s -1 = 46 +/- 15 cpoise, VC % 33%;
(ii) Apparent Viscosity at 115 s -1 = 14 +/- 4 cpoise, VC % 29%; (iii)
Structural Viscosity (K) = 2.3 +/- 0.5 dyne s / cm 2 , VC% 22%; (iv)
Coefficient of Consistency (n) = 0.40 +/- 0.11.
Conclusion Measuring viscosity using a cone plate rotational
viscometer improves the repeatability and objectivity on semen
viscosity evaluation. The rheological variables determined and the
analysis of the rheological profile confirms the pseudoplastic behavior
of llama semen. These results will offer a better understanding of the
hiperviscosity in ejaculates of this specie, providing the basis for
future studies on the effects of this characteristic on llama
reproductive physiology.
P202
Effect of different GnRH analogues and follicular size on
ovulation and CL development in dromedary camels
(Camelus Dromedarius)
Nagy, P*, Juhasz, J
Production & Veterinary Department, Emirates Industries for Camel Milk &
Products, United Arab Emirates
Buserelin is frequently used in dromedaries to induce ovulation, but
Deslorelin, another synthetic GnRH analogue has not been tested yet
(Tibary and Anouassi 1997). Recent data suggest that development of
the corpus luteum is influenced by the size of the ovulatory follicle
(Nagy et al 2005). The aim of these studies were (1) to compare the
efficiency of two GnRH analogues, Buserelin and Deslorelin to
induce ovulation; (2) to compare CL development after ovulation of
small (< 1 cm) and large (1.5-2 cm) size dominant follicles. Two
studies were carried out during the breeding season. In the first, 20
female dromedary camels were randomly selected into 2 treatment
groups. Trans-rectal ultrasonography was performed daily. Animals
were treated either with Buserelin (20 mikrog/animal, i.v.; Receptal,
Intervet, Holland) or Deslorelin (2.1 mg/animal, sc. implant;
Ovuplant, Peptid Technologies, Australia) when the dominant follicle
reached 1.4-1.5 cm. Ovulation was detected with frequent
ultrasonography. Blood samples for progesterone were collected on
alternate days. In the second study, 4 dromedaries were given
Buserelin twice: (a) when the dominant follicle exceeded 1.5 cm, (b)
shortly after selection of the dominant follicle (< 1 cm). Blood
samples were collected daily. Plasma progesterone in the first and
second study was determined with RIA and ELISA, respectively. In
the first study, all but one, Deslorelin treated camel ovulated. There
was no significant difference in the mean time of ovulation between
Buserelin (mean ± SEM; 28.9 ± 0.38 hours) and Deslorelin (30.9 ±
2.07 hours) treated animals. There was larger variation in the time of
ovulation after Deslorelin (27 to 48 hours) than after Buserelin (27 to
30 hours). CL development and plasma progesterone concentration
were similar after both treatments. In the second study, all camels
ovulated large (mean ± SEM; 1.57 ± 0.05 cm) and small size (0.87 ±
0.06 cm, P

16 t h International Congress on Animal Reproduction
96 Poster Abstracts
spermatids lacked α-Fuc and GlcNAc, while having β-D-Gal-(1-4)-
GlcNAc. The acrosomes of elongated spermatids did not express α-
Fuc and α-Gal residues. Spermatozoa from ductuli efferentes and
caput, corpus and cauda epididymal regions showed different
expressions mainly consisting of GlcNAc and Gal residues. Sialic
acids (Neu5Acα2,3Gal and Neu5Acα2,6Gal/GalNAc) were probably
incorporated into the spermatozoa along the extratesticular ducts.
These findings indicate that the development and maturation of
spermatozoa in the alpaca are accompanied by changes in
glycoproteins expression, which is consistent with other mammalian
species.
P205
Endocrine changes during pregnancy in the guanaco
(Lama guanicoe)
Riveros, J 1,3 *; Urquieta, B 1 ; Bonacic, C 2 ; Bas, F 3 ; Hoffmann, B 4 ; Schuler, G 4
1Department of Animal Biological Science, Universidad de Chile, Chile;
2Fauna Australis Laboratory, Pontificia Universidad Católica de Chile, Chile ;
3Department of Animal Science, Pontificia Universidad Católica de Chile,
Chile ; 4 Clinics for Obstetrics, Gynecology and Andrology of Large and Small
Animals, Justus-Liebig-University Giessen, Germany
Plasma concentrations of progesterone (P4), oestradiol-17 beta (E2),
estrone (E1) and estrone sulphate (E1S) were measured during
gestation in eight guanacos held in captivity in the Mediterranean
ecosystem of Chile (33º 38’ 28” S, 70º 34’ 27” W). Blood samples
were obtained every 15 days from 1 st to 10 th month of gestation.
Afterwards sampling increased every second day until 2 days after
parturition. Plasma P4 and estrogens profiles were measured by
radioimmunoassay. Gestational length was 346.1 +/- 9.8 days. Plasma
P4 concentrations increased concomitant with the formations of the
corpus luteum and remained elevated (> 4.0 nmol/l) until the last
month of pregnancy. However, during the last 3 weeks of gestation,
they gradually decreased to (< 4.0 nmol/l) until the last 4 days of
gestation, when a precipitous decline occurred. They returned to basal
concentrations (< 1.0 nmol/l) two days after parturition. Mean E2
levels increased to 100pg/ml at day 250 of gestation and remained
over 200pg/ml until 3 days before parturition. They decreased to basal
level 1 day after parturition. Plasma E1S, increased to 2.0nmol/l from
day 300 of gestation, remained over 4 nmol/l during the last three
weeks and decreased to basal level one day after parturition. For E1,
only basal levels

16 t h International Congress on Animal Reproduction
Poster Abstracts 97
that in wild. Parturition timing and endocrine patterns show
similarities to those in domestic camelids.
P208
In vitro maturation of dromedary camel (Camelus
dromedarius) oocytes: effect of different protein
supplementations and epidermal growth factor
Wani, NA*, Skidmore, JA
Camel Reproduction Center, United Arab Emirates
The present experiment was aimed to compare the effect of different
protein supplementation sources, fetal calf serum (FCS), estrous
dromedary serum (EDS) and BSA, and the effect of different
concentrations of epidermal growth factor (EGF) on in vitro nuclear
maturation of dromedary camel oocytes. Ovaries collected from a
local slaughterhouse were brought to the laboratory in a thermos flask
containing warm normal saline solution (NSS) and cumulus oocyte
complexes (COCs) were harvested by aspirating the visible follicles
using an 18G hypodermic needle attached to a 20 mL syringe
containing PBS supplemented with 5% FCS. Pooled COCs were
randomly distributed to 4-well culture plates containing 400 μL of the
maturation medium and cultured at 38.5 0 C in an atmosphere of 5%
CO 2 in air for 36 h. The basic maturation medium consisted of TCM-
199 supplemented with 0.1 mg/mL L-glutamine, 0.8 mg/mL sodium
bicarbonate, 0.25mg/mL pyruvate, 50 μg/mL gentamicine, 10 μg/mL
bFSH, 10 μg/mL bLH and 1 μg/mL estradiol. In experiment 1, this
medium was supplemented with either 10% FCS, 10% EDS or 0.4%
BSA whereas, in experiment 2, the maturation medium was
supplemented with 0, 10, 20 or 50 ng/mL of EGF. At the end of the
culture period all intact COCs were denuded of cumulus cells. The
oocytes with a visible polar body, considered to be in metaphase-II
stage, were used for other experiments, while as all other oocytes
were fixed in ethanol: acetic acid (3:1) for 24 h and stained with 1%
(w/v) aceto-orcein stain. The slides were examined under phase
contrast microscope at magnification of 400X to evaluate the status of
nuclear maturation. Oocytes were classified as germinal vesicle (GV),
diakinesis (DK), metaphase-I (M-I), metaphase-II (M-II) or others
(those with degenerated, fragmented, scattered, activated or without
visible chromatin). In experiment 1, no difference (P < 0.05) was
observed in the proportion of oocytes reaching M-II stage between the
media supplemented with FCS (71.5 ± 4.8), EDS (72.8 ± 2.9) and
BSA (72.7 ± 6.2). In experiment 2, a high proportion (P < 0.05) of
oocytes reached M-II stage when the maturation medium was
supplemented with 20 ng/mL of EGF (81.4 ± 3.2) compared with the
media supplemented with 10 ng/mL (66.9 ± 4.1) and control (67.2 ±
7.1) groups. It may be concluded that all the three protein
supplementation sources used in this study are capable of supporting
oocyte nuclear maturation equally and a supplementation of 20 ng/mL
of EGF increases the maturation rate of oocytes in this species.
Poster 05 - Equine Reproduction
P209
Effect of an immunomodulator on estrogen alpha and
progesterone receptor expression in endometrial tissue
of healthy, endometritis resistant mares during the
estrous cycle
Acuña, S 1 *, Tasende, C 2 , Rivulgo, M 3 , Alzola, R 3 , Felipe, A 3 , Rogan, D 4 ,
Fumuso, E 5
1Cellular and Molecular Biology, Veterinary Faculty, Uruguay; 2 University of
the Republic, Uruguay, Uruguay; 3 Argentina; 4 Bioniche Life Sciences Inc.,
Canada; 5 Universidad Nacional del Centro de la Provincia de Buenos Aires,
Argentina
The estrogen alpha and progesterone receptor (ERα and PR)
expression was investigated in endometrial biopsies of healthy,
endometritis resistant mares treated by intrauterine administration at
estrous (ovarian follicles >29mm, folds and endometrial edema) with
1500 μg Mycobacterial Cell Wall-DNA Complex (MCC). The
follicular dynamic was followed by ultrasonography. Endometrial
biopsies were taken repeatedly from the same mares at diestrous (in
the previous estrous cycle on day 6 post ovulation, n=3, group D),
estrous (immediately before treatment, n=7, group E), 24 h post
treatment (n=7, group 24hPT), ovulation (n=7, group OvPT) and
diestrous (6 days post treatment, n=7, group DPT). An
immunoperoxidase staining technique was used to visualize ERα and
PR immunoreactivity. The immunoreactivity was analyzed in
Luminal Epithelium (LE), Glandular Epithelium (GE) and Stromal
(St) cells. Ten fields were analyzed for each cell types at a
magnification of 1000x. The average staining for each cell types was
calculated according to the following procedure = 1 x n (SI1) + 2n
(SI2) + 3n (SI3), where n = amount of cells per field exhibits SI (1),
moderate (2) and intense (3). The total positive cells (LE + GE + St)
and average staining was analyzed by ANOVA test. The model
included the effect of group, cell types and the interactions between
them. The level of significance was considered to be P

16 t h International Congress on Animal Reproduction
98 Poster Abstracts
was also evident at 30’ and 90’ and was statistically significant for all
concentrations tested. At 180’ motility of spermatozoa incubated in
the presence of 10-5 and 10-7 M DPDPE showed velocity values
comparable to those of the control. This work reports for the first time
a functional test on equine spermatozoa describing the involvement of
DOR in the control of sperm cells motility and provides new insights
to the concept of EOP as “local modulators” of reproductive activity.
P211
Use of day 3 postovulation embryo transfer recipient
mares
Alonso, MA 1 *, Fleury, P 1 , Alvarenga, MA 2
1Fleury Reproducao Equina, Brazil; 2 Department of Animal Reproduction,
FMVZ-UNESP Botucatu, Brazil
In order to have a successful embryo transfer programme, proper
selection of the recipient mare is mandatory. This selection is based
on synchrony in relation to the donor, absence of uterine folds and
fluid, presence of a corpus luteum and uterine and cervical tone.
Normally a window of synchrony of +1 (recipient ovulation one day
after donor) to – 3 (recipient ovulation 3 days after donor) is accepted
and good pregnancy rates are achieved. In some cases, this degree of
synchrony is not possible, and one must find another alternative. The
use of recipients earlier after ovulation allows a more flexible
synchronization between donor and recipient. The objective of this
study was to evaluate the use of recipient mares 3 days after ovulation
for embryo transfer. Donor mares were of different breeds, age
between 3 to 26 years old, maintained in different breeding farms and
in Fleury Reprodução Equina Center. Embryos were recovered
nonsurgically 7, 8 or 9 days after ovulation. Upon identification,
embryos were assessed for size, grade and developmental stage. Only
grade I embryos were used in this experiment. The embryos were
transferred nonsurgically into synchronized recipients, from 3 to 8
days after ovulation. The selection of recipients was done based on
uterine tone and echogenicity on day of transfer, being chosen the
mares presenting a homogenous and tubular uterus, with good tone. A
total of 905 embryo transfers were used. Recipients were of different
breeds from 3 to 14 years of age.. All of them were at Fleury
Reprodução Equina Center. Pregnancy test was performed 5 to 7
days after transfer. Data was analyzed by Chi-square test. Pregnancy
rates were similar among mares on all different days after ovulation
(d3, 75,90% (83); d4, 71,72% (198); d5, 71,49% (228); d6, 69,36%
(173); d7, 76,87% (147), d8, 68,42% (76) ). In conclusion, recipient
mares can be successfully used as early as day 3 post ovulation, with
adequate pregnancy rate, without exogenous progesterone
supplementation, being an interesting possibility when closer
synchrony is not possible. However, an appropriate selection based on
uterine tone and echogenicity is needed to obtain these results.
P212
Osmotic stress of stallion sperm exposed to hipertonic
solution of diferents cryoprotectants
Alvarenga, MA*; Papa, FO; Araujo, GHM; Freitas, CP; Dell’Aqua Jr., JA;
Medeiros, ASL
Department of Animal Reproduction and Veterinary Radiology – FMVZ /
UNESP, Botucatu- SP, Brazil
The osmotic stress induced on spermatozoa during the
cryopreservation process is an important feature on sperm viability,
the permeability of the cryoprotectants play also an important role on
osmotic injury during frozen thaw process. Recents works have
shown that Glicerol has a low membrane permeability inducing a
severe osmotic damage on stallion spermatozoa. The present study
aimed to evaluate the stallion sperm viability after induction of an
osmotic stress with hypertonic solution of amides (Dimethylacetamide
DA, Methylformamide MF, Dimethylformamide DF) and Glycerol
using a final concentration of 1 Molar. Ten stallions (two ejaculates)
were utilized. The semen was centrifugeded (600xg/10 minutos), the
pellets resuspended in the cryoprotectants hipertonic solutions and
incubated for ten minuts at room temperature. After this, the solutions
were diluted 6:1 (solution of 300 mOsm : cryprotectants solution)
aiming to return to a normal osmolarity (isoosmolarity). Motility by
CASA and Membrane integrity (fluorecents probes) were evaluated
before, during and after osmotic stress induction. A significant
decrease on total motility were observed after the incubation on
hypertonic solution (12,93±15,22 d ; 61,53±16,17 b ; 44,67±22,68 c ;
41,73±24,28 c , DA, MF, DF e GL respective) when compared with the
control group (81,4±9,15 a ). The lower motility was observed on the
DA treatment (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 99
P214
Efficiency of the use of sodic cloprostenol (Ciosin®) and
fertirelin acetate (Fertigen®) on the estrous cycle control
in mares
Bustamante-Filho, IC 1 *, Ferreira, BG 2 , Neves, AP 2 , Arruda, CV 2 , Petrucci,
BPL 2 , Jobim, MIM 3 , Mattos, RC 3
1Laboratório de Inseminação Artificial, Faculdade de Veterinária,
Universidade Federal do Rio Grande do Sul, Brazil; 2 Centro de Ciências
Rurais - Bagé , Universidade da Região da Campanha , Brazil; 3 Faculdade
de Veterinária , Universidade Federal do Rio Grande do Sul , Brazil
Estrous cycle control in mares is difficult due to their long follicular
phase and variability of time until ovulation. Drugs commonly used
for estrus synchronization are PGF2α and its analogues; hCG (Human
chorionic gonadotrophin); and GnRH (gonadotrophin releasing
hormone) and its analogues. The aim of this study was to evaluate the
use of sodic cloprostenol and fertirelin acetate on estrous cycle
manipulation in cycling mares. Forty adult, cycling mares of mixed
breeds were used. Twenty of them were given cloprostenol in the
presence of a functional corpus luteum, without further administration
of fertirelin, while the other group had cloprostenol plus
administration of fertirelin in the presence of a ≥ 35mm diameter
follicle. Analyzed parameters were: number of days to ovulation since
the cloprostenol injection; number of hours to ovulation since the
fertirelin injection; and pregnancy rates. There was no significant
difference between groups (p=0,10) in number of days until ovulation.
The group that had the fertirelin administration showed a significantly
lower (p=0,02) number of hours until ovulation. Pregnancy rates were
higher (p

16 t h International Congress on Animal Reproduction
100 Poster Abstracts
endangered breeds at risk of extinction. This study reports on the
validation and use of a sperm DNA fragmentation test for domestic
stallion and donkey spermatozoa in which the sperm chromatin
dispersion test (SCD) was applied to both chilled and frozen semen
samples. The SCD test was conducted on spermatozoa that been
processed for routine chilled and frozen-thawed insemination. The
SCD test was applied to sperm that were subsequently incubated at
37ºC for 0, 4, 6, 24 and 48h in an attempt to try and emulate postinsemination
conditions within the mare's reproductive tract. The
results of this investigation revealed that there was no significant
difference in the sperm DNA fragmentation index (sDFI) of sperm
evaluated initially after collection compared to those tested
immediately after chilling or cryopreservation. However, within 1h of
incubation at 37ºC, both chilled and frozen-thawed spermatozoa
showed a significant increase in the proportion of sDFI; after 6 h the
sDFI had increased to over 50% and by 48 h almost 100% of the
spermatozoa exhibited DNA damage. While the sDFI of individual
stallions and donkeys at equivalent times of incubation was variable,
an analysis of the rate of change of sDFI revealed no significant
difference between animals or the way in which the semen was
preserved. In terms of sperm DNA fragmentation dynamics, the
highest intensity of sperm DNA damage occurred in the first 6 h of
incubation. SDF dynamics varied with respect to individual animals
and it was possible to separate animals on the basis of the rate of
DNA degradation. In the case of donkeys, the analysis of sperm DNA
fragmentation coupled with other classical parameters of semen
quality provided a useful measure of the fertility of each animal.
Additionally, the application of the SCD in this study leads us to
conclude that sperm chromatin organization is analogous in stallions
and donkeys, although they do differ with respect to the actual rate of
protein depletion after a standard lysing treatment. We conclude that
the SCD methodology originally developed for domestic stallions can
also be applied for the assessment sperm DNA fragmentation in the
donkey or in related wild Equid species such about which there is
limited information about sperm quality.
P218
Is there an effect of dose rate of Cloprostenol given in
dioestrus on interval from treatment to ovulation in
mares
Cuervo-Arango, J 1 *; Newcombe, JR 2
1Royal Veterinary College, Department of Veterinary Clinical Science,
University of London, UK; 2 Equine Fertility Unit, Warren house farm,
Brownhills, UK
Introduction Although the ovulatory effects of prostaglandins are
well documented in several domestic species included horses, there
has been little attention paid to the use of this drug for clinical
purposes. Mares often grow large follicles during the luteal phase
which may or may not ovulate before progesterone levels decline.
Clinical observations of administering prostaglandins in dioestrus
mares with large follicles suggest that there may be a negative
correlation between follicular diameter and interval from treatment to
ovulation (ITO). The aims of this study were two fold: a) to assess
the effect of different doses of Cloprostenol (a PGF 2 alpha analogue,
Estrumate®) when given to dioestrus mares with a dominant follicle
larger than 28mm on the ITO and b) to evaluate the effect of the
diameter of the dominant follicle at the time of treatment on ITO.
Materials and methods Data from 529 TB mares from several stud
farms and breeding seasons were analysed. Mares with a dominant
follicle > 28mm were given either 12.5µg (n=99), 75µg (n=203),
250µg (n=108) or 625µg (n=119) of Estrumate® (250µg
Cloprostenol/ml) while in dioestrus as identified by ultrasonographic
examination of a visible CL and absence of uterine oedema. For data
analysis mares were classified as having a dominant follicle of either
28-31mm (n=190), 32-35mm (n=163) or >36mm (n=176). Mares
were scanned every other day until ovulation was detected. A general
linear model of variance was used to test the effect of dose rate and
follicular diameter on ITO.
Results There was a significant effect of dose rate (P=.003) and
follicular diameter (P=.000) on ITO. Higher doses of Cloprostenol
induced ovulation faster than lower doses (4.5, 4.4, 3.8 and 3.2 days
for 12.5, 75, 250 and 625µg respectively) regardless of follicular
diameter. In the same way, mares with larger follicles at the time of
prostaglandin induction ovulated faster than those with smaller
follicles (4.5, 3.9 and 3.4 days for follicles of 28-31, 32-35 and
>36mm respectively) regardless of dose. The fastest ITO was induced
by 625µg of Cloprostenol in mares with a dominant follicle >36mm
(mean ITO 2.4 days).
Conclusion Prostaglandin dose and follicular diameter at the time of
induction have a significant effect on interval to ovulation and
therefore can be useful tools for the prediction of ovulation. Doses as
low as 12.5µg of Cloprostenol (0.05ml Estrumate®) are sufficient to
induce luteolysis, oestrus and ovulation when the CL is mature.
P219
Histological characterisation of mucus secreting cells in
the lower equine reproductive tract
Cummins, C*, Duggan, V, Fitzpatrick, E, Reid, C, Carrington, S
UCD Veterinary Sciences Centre, UCD, Belfield, Dublin 4, Ireland
Introduction Surface epithelial cells of the equine cervical and
vaginal mucosa secrete a mucus gel which fulfils a defensive function
by preventing colonisation of the epithelium by pathogens. The
physical characteristics of this gel vary at different stages of the
reproductive cycle depending on the secretion of steroid hormones.
Around the time of ovulation, the low viscosity of the mucus gel
allows transport of sperm. During dioestrus, the mucus becomes more
viscous preventing migration of pathogens into the uterus and during
pregnancy a thick mucus plug forms. Recent studies on normal
cervical mucins in women have identified neutral, sialic acid- and
sulphate-containing oligosaccharides. We have undertaken an initial
histological characterisation of the mucus of the equine cervix and
vagina. This knowledge improves our understanding of the normal
equine reproductive tract and its defence mechanisms and will be
useful in detecting pathologies such as ascending placentitis.
Materials and Methods Samples of tissue were taken from 19 postmortem
mares, of these 6 mares were in oestrus, 12 were in dioestrus
and 1 mare was pregnant. Serum progesterone levels were measured
to determine the stage of the reproductive cycle. No vaginal sample
was available from the pregnant mare. Samples were fixed in 4%
paraformaldehyde. Mucins were demonstrated in paraffin sections
using the periodic acid Schiff (PAS) and alcian blue staining methods.
Lectin binding was also investigated to detect specific sugars.
Results Cervix: Positive staining for mucins during oestrus was
confined to the apical cytoplasm of surface epithelium. During
dioestrus and pregnancy, staining extended throughout the
supranuclear cytoplasm. During pregnancy, the cervical mucus plug
can be identified as positively-stained secreted material. Epithelial
cells stained positively for both acidic and neutral mucins. Neutral
staining appeared to predominate. With lectin binding epithelial cells
stained positive for (α-2,6)-linked sialic acid in the cervices of both
dioestrus and oestrus mares. Staining was positive only in low levels
in the pregnant mare’s sample. Vagina: The normal vaginal
epithelium is non-keratinised stratified squamous epithelium. The
epithelial cells are covered by a thin layer of mucus. The author has
found no reference to mucus secreting cells in the equine vagina.
However, columnar secretory epithelial cells were found on squamous
epithelium in the cranial part of the equine vagina. This description is
similar to that of the bovine vagina. The columnar secretory cells
produced both acidic and neutral mucins. Acidic staining appeared to
predominate. The cells stained positively for (α-2,6)-linked sialic acid.
Conclusions Previous studies suggest that the cervix is solely
responsible for the secretion of mucus in the lower equine
reproductive tract. Our histological study suggests that the vagina may
play an important role in mucus production such as the formation of
the mucus plug of pregnancy. This may be important in ascending
placentitis where failure of the mucus plug is thought to be an
important factor.

16 t h International Congress on Animal Reproduction
Poster Abstracts 101
P220
A retrospective study on the effect of prostaglandin and
hCG on double ovulation in mares
Dalin, AM. 1 *; Hellström, A. 1 ; Gånheim, A. 3 , Öhagen, P. 2
1Div. of Reproduction, Dept of Clinical Sciences, Swedish University of
Agricultural Science, Uppsala, Sweden; 2 Div. of Ruminant Medicine and
Epidemiology, Dept of Clinical Sciences, Swedish University of Agricultural
Science, Uppsala, Sweden; 3 Flyinge AB, Flyinge, Sweden
During the breeding season at studs, treatment with prostaglandins
(PG) to induce oestrus and treatment with hCG to induce ovulation
are common. However, it has been reported that PG and hCG can
affect the incidence of twin pregnancies. The aim of the present study
was to retrospectively study the effect of PG and/or hCG on the
incidence of multiple ovulations. Data from manual stud records
[identity, breed, age, lactation or not, treatment (PG, hCG,
combination PG and hCG), oestrus, ovulation (single, double),
pregnancy (single, twin, not pregnant) and type of AI (fresh, chilled,
frozen)] was collected on 454 Swedish Warmblood mares (of total
662 mares) including totally 658 oestruses for two different years (I
and II). The routines for treatment differed between yrs I and II due to
different veterinarians working at the stud. Results: The proportions of
lactating mares were 34.6 and 25.7% for the different yrs I and II,
respectively. The proportions of young mares (< 6 yrs) were the same
for the two years (13%) but differed for old mares (>15 yrs; 27 % and
45 %, resp.). The incidence of treated mares was the same for the two
years, 46 %. However, the distribution of the different treatments
varied (based on number of treated oestruses, totally 362). Yr I, for
PG, hCG and PG + hCG it was 36.7%, 45.7% and 17.6%, and for yr II
it was 76.4%, 14.9% and 8.6%. Mares inseminated in more than one
oestrus and being both treated and not treated at different oestruses
were picked out, i.e. the mares became their own controls when
studying results of treatment on double ovulations (175 mares and 272
oestruses for yr I and 160 mares and 228 oestruses for yr II) The
proportion of oestruses with double ovulations after “no treatment”,
PG, hCG or PG and hCG were for yr I : 6.0%, 21,7%, 7.0% and 9.1%
and for yr II 14.8%, 24.1%. 11.5% and 26.7%, resp. PG treatment
resulted in the significantly highest incidence of double ovulation
compared with no treatment, secondly came PG combined with hCG
which differed significantly from untreated yr II. Age and lactation
also had a significant influence on the incidence of double ovulations.
The incidence of twin pregnancy was also significantly higher in PG
treated mares than in non treated, 16.1% and 3.7% for yr I and 12.8%
and 8.2% for yr II, resp. Conclusion: this retrospective study of stud
records showed that PG treatment for induction of oestrus in mares
significantly affected the incidence of double ovulations. The result of
hCG differed depending on treatment routines. Also age and lactation
significantly influenced.
P221
Seasonal effects on follicular sensitivity to IGF-1 in mares
Doyle, LK 1 *; Donadeu, FX 1,2
1Easter Bush Veterinary Centre, Royal (Dick) School of Veterinary Studies,
University of Edinburgh, Roslin, Midlothian EH25 9RG, UK; 2 Roslin Institute,
Roslin BioCentre, Midlothian EH25 9PS, UK
Insulin-like growth factor-1 (IGF-1) is a key component of the follicle
selection mechanism and intrafollicular IGF-1 injection has been
shown to promote follicle growth and ovulation in cycling mares.
Since equine follicles during the transition into the ovulatory season
have reduced IGF-1 activity, IGF-1 administration could potentially
be used to hasten the onset of the ovulatory season in mares, provided
follicles maintained their responsiveness to IGF-1 during the
transitional period. To assess this, follicular sensitivity to IGF-1 was
compared between the transitional period (February to April) and the
ovulatory season (ovulatory period; June to August) in eight mares.
Granulosa cells were collected by ultrasound-guided transvaginal
follicle aspiration from small (15-24 mm) or large (25-34 mm)
follicles during the two periods and expression of IGF receptor type 1
(IGF-1r), FSH receptor (FSHr) and LH receptor (LHr) was
determined by qPCR. In addition, 10 μg recombinant human IGF-1 or
vehicle were injected into the largest follicle (transitional period) or
the second largest follicle (ovulatory period) of a follicular wave
before the beginning of diameter deviation between the two largest
follicles (mean diameters at injection, 19.2±0.3 and 20.0±0.5 mm
during the transitional and ovulatory periods, respectively). Follicular
fluid was collected 24 h after injection for determination of IGFBPs,
Inhibin-A and estradiol levels. Granulosa cells from large follicles
expressed higher levels of IGF-1r (P=0.01), FSHr (P0.1) in receptor expression in
small follicles between the two periods. Follicular IGFBP-5 levels
were higher (P0.1)
between periods or treatments. IGF-1 injection before the beginning
of deviation induced a ~2 fold increase (P=0.01) in follicular Inhibin-
A levels during each period and did not affect estradiol levels (P>0.1).
These results indicated that the sensitivity of equine follicles to IGF-1
before the beginning of deviation during a follicular wave is similar
during the transitional period and the ovulatory season. Therefore,
IGF-1 administration could potentially be used to induce early
ovulations during the transitional period in mares.
P222
Inflammatory lesions in the oviducts and its relationship
with endometritis and ovarian activity in the Criollo mares
Fiala, S 1 *, Amaral, MG 1 , Pimentel, CA 1 , Rodrigues, RF 1 , Cruz, LA 1 , Mattos,
RC 2
1Department of Morphology, Institute of Biology, Brazil ; 2 Reprolab., Faculty of
Veterinary Medicine, Brazil
The oviduct of a mare is 20-30 cm long and runs a tortuous course in
the mesosalpinx. Their functions in the mammalian are to serve as a
conduct for the oocyte and spermatozoa and to maintain the embryo
after fertilization until its arrival in the uterus. Salpingitis is a common
disease in domestic animals; especially the cattle, but there are a few
reports of inflammatory lesions in the mare’s oviducts. Nevertheless
this condition can impair fertility in this species. The objective of this
work was to study the frequency of salpingitis in mares and its
relationship with endometritis and ovarian activity, particularly in the
Criollo breed. With this purpose 150 genital tracts, from Criollo mares
sent to slaughter in an abattoir located at parallel 32° south in southern
Brazil, were collected once a week in April and from October until
December. Ovaries, uterus, cervix and vagina were collected. Ovaries
were weighed, dissected, and ovarian structures recorded (corpus
luteum and follicles). Mares were considered cyclic, in anestrus or in
the transitional period. The oviducts (n=300) and a sample from the
endometrium (n=150) were fixed in Bouin solution and processed for
histological examination of inflammatory lesions. Inflammatory cells
were present in 56.7% (170/300) of the oviducts studied. Bilateral
inflammation of the oviducts was observed in the most of the mares
(57.4%). Slight inflammation was observed in 74.3% (126/170),
moderate in 18.1% (31/170) and severe in 7.6% (13/170). Chronic
inflammation was observed in 151 mares (88.8%), acute in 5 (3%),
and subacute in 14 mares (8.2%). Endometrial inflammation was
detected in 81.3% (n=122) of the mares. However, only 58.0% of the
mares showed inflammation of the oviduct and of the endometrium.
No correlation was observed between the intensity of the endometritis
and the salpingitis. The most of the mares in this study were cyclic
mares (69.3%) (104/150), while 28 mares (18.7%) were in anestrous
and 18 (12%) were in the transitional period. No differences were
observed between the intensity of inflammation and ovarian activity.
We concluded that salpingitis in Criollo mares sent to slaughter is
frequent and can be a cause of infertility in this species.

16 t h International Congress on Animal Reproduction
102 Poster Abstracts
P223
Effect of a steroidal anti-inflammatory drug on the
viability of equine semen cooled for 24 hours
Fioratti, EG*; Melo, CM; Villaverde, AISB; Papa, FO; Alvarenga, MA
Department of Animal Reproduction and Veterinary Radiology - Faculty of
Veterinary Medicine and Animal Science, UNESP, Botucatu, Brazil
Post-breeding endometritis in mares is related to exacerbated
inflammatory process, which is stimulated by the presence of sperm
cells inside the uterus leading to the major cause of infertility. The use
of ecbolic drugs associated with uterine flushing and AI with reduced
sperm quantity provides the most common treatment. Based on
efficiency of steroidal anti-inflammatory drugs in minimizing uterine
fluid accumulation by its systemic administration and its possible
intra-uterine use, the present study aimed to evaluate the effect of
adding dexamethasone to the extender on equine sperm viability
during two hours of incubation at 37°C and after a 24 hours cooling
period. Four stallions from different breeds were collected twice using
an artificial vagina, obtaining a total of eight ejaculates. After
evaluation of sperm motility and concentration, two aliquots
containing 800 x 10 6 of viable sperm were diluted in a milk-based
extender (Botu-Semen®) reaching a volume of 15 mL for each
previous diluted aliquot. These samples were re-diluted with 15 mL of
Botu-semen® non-supplemented (control group) or supplemented
with 2 mg of dexamethasone (treatment group), resulting in a final
concentration of approximately 0.067 mg/ mL. One part of the
samples from both groups were cooled at 5°C for 24 hours in an
equine semen transport box (Botutainer®) and the other part was
incubated in a dry-block at 37°C during two hours. Sperm analyses
were performed at 0, 30, 60 and 120 minutes following dilution and
after a cooling period of 24 hours using CASA and a combination of
fluorescent probes to assess plasma (Iodide Propidium) and acrosomal
(FITC-PSA) membrane integrity and mitochondrial transmembrane
potential (JC-1). Comparing both groups among all evaluated
incubation moments, no significant difference (p < 0.05) was
observed for total motility, plasma membrane integrity and
mitochondrial transmembrane potential. Progressive motility and
percentage of rapid spermatozoa values were higher (p < 0.05) in the
control group. The treatment group showed lower (p < 0.05) values
for VAP at 30 and 60 minutes and higher (p < 0.05) values for
percentage of acrosomal membrane integrity at 0 and lower (p < 0.05)
at 60 minutes of incubation compared to the control group. The results
obtained in 24 hours cooled samples were not different (p < 0.05)
between both groups for all parameters mentioned above, except for
VAP, which was lower (p < 0.05) for the treatment group. In
conclusion, although the treatment group exhibited poor sperm
velocity, the steroidal anti-inflammatory drug did not impair sperm
viability.
P224
The effect of equine growth hormone and its interaction
with gonadotropins, estradiol and fetal calf serum on
cytoskeleton distribution in equine oocytes matured in
vitro
Gabriel Pereira, G 1 *, Liu, IKM 1 , Carneiro, GF 1 , Pegoraro, LM 2 , Lorenzo, PL 3
1Population Health and Reproduction, University of California, Davis, UCD,
United States; 2 Animal Reproduction, Temperate Climate Research
Corporation-EMBRAPA, Brazil; 3 Animal Physiology Department, Universidad
Complutense de Madrid, Spain
Microtubules and microfilaments are cytoskeletal components that
support cell architecture and modulate cyto- and karyokinesis. We
hypothesize that the limited success achieved with in vitro maturation
(IVM) of horse oocytes is due to abnormalities associated with
cytoskeleton structures. The objective of this research was to
investigate the effect and the interactions between equine growth
hormone (eGH), estradiol (E2), gonadotropins, and fetal calf serum
(FCS) on the IVM and cytoskeleton organization of equine oocytes.
Equine oocytes aspirated from each follicle

16 t h International Congress on Animal Reproduction
Poster Abstracts 103
(r=0.45). There were not multiple linear regressive models with R-
square > 0.2.
Conclusions No markers of fresh semen quality useful to predict
semen quality after thawing were found.
P226
Expression of the Cytokines TNFalpha and IFNgamma
and their Receptors in the Cyclic Equine Corpus Luteum
Galvão, A 1 *; Silva, E 2 ; Mateus, L 2 ; Korzekwa, A 3 ; Skarzynski, DJ 3 ; Ferreira-
Dias G 1
1C.I.I.S.A., Department of Physiology, Faculty of Veterinary Medicine, T.U.
Lisbon, Portugal; 2 C.I.I.S.A., Department of Reproduction, Faculty of
Veterinary Medicine, T.U. Lisbon, Portugal; 3 Department of Reproductive
Immunology, Institute of Animal Reproductive and Food Research of PAS,
Olsztyn, Poland
Corpus luteum (CL) development is characterized by differentiation
and proliferation of cells derived from the postovulatory follicle, and
changes in microvascularization. It presents an extremely rapid
growth and regression dynamics. This process is controlled by
different regulatory factors, such as prostaglandins, growth factors,
leukotrienes, cytokines (interferon-gamma - IFNγ, tumor necrosis
factor - TNFα, Fas Ligand - FasL) and nitric oxide (NO), among
others. The cytokines that are produced locally might have an
important role in CL function. Therefore, the main objective of this
study was to evaluate the expression of TNFα and IFNγ and their
receptors, in equine luteal structures from different stages of the luteal
phase. Corpora lutea were obtained post mortem from 16 cyclic mares
and classified into early luteal phase CL (Early-CL, n= 5), mid luteal
phase CL (Mid-CL; n=6) and late luteal phase CL (Late-CL, n= 5),
based on plasma progesterone concentration and ovarian structures.
Specific primers for target genes TNFα, IFNγ, TNFα receptor 1 and
IFNγ receptor 1, and for housekeeping gene (B2MG), were designed
and tested by conventional PCR. After primers optimization, relative
quantification of the genes expression was accomplished by Real
Time PCR ( ΔΔ Ct method). TNFα expression was four fold reduced in
Mid-CL, with respect to Early-CL (p≤0.01), and two fold decreased
with respect to Late-CL (p≤0.01). IFNγ presented the lowest
expression in Early-CL, increasing afterwards. From Early to Mid-CL
a four fold increase for IFNγ was observed (p≤0.01), while from
Early-CL to Late-CL there was a nine fold increase (p≤0.01). The
expression of TNFα receptor 1 was two fold higher during Early-CL,
compared to Mid-CL (p≤0.05) and Late-CL (p≤0.01). IFNγ Receptor
1 did not show a significant variation during the luteal phase. These
data suggest that TNFα might play a predominant role during early
luteal formation and regression, while IFNγ only shows a significant
action during luteal regression. The lack of variation in receptors
expression might be explained by the fact that they behave as
structural proteins. To the best of our knowledge, these data are the
first evidence that both TNFα and IFNγ expression varies in the
mare’s CL during the luteal phase. These results suggest an important
(auto-, paracrine) role of these cytokines in the regulation of CL
function including growth and luteolysis.
P227
Endocrinology of the estrous cycle in Miniature ponies
Gastal, MO 1 *; Neves, AP 2 ; Petrucci, BPL 2 ; Mattos, RC 2 ; Beg, MA 3 ; Gastal,
EL 3 ; Ginther, OJ 1,3
1Eutheria Foundation, Cross Plains, WI 53528, USA; 2 Department of Animal
Medicine, Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil;
3Department of Pathobiological Sciences, University of Wisconsin, Madison,
WI 53706, USA
Information on mare reproductive endocrinology has relied on studies
in larger breeds, owing to the lack of scientific study directly in
Miniature mares. Considering the small body size (approximately 100
kg) and selective breeding of Miniature mares, direct studies of the
endocrinology, as well as other aspects of reproductive physiology,
are needed. The purpose of the present study was to characterize the
circulating concentrations of FSH, LH, estradiol, and progesterone
during the estrous cycle of Miniature mares. Blood samples were
taken daily from 4 days before the first ovulation to 4 days after the
second ovulation of the interovulatory interval (IOI). Plasma
concentrations of FSH, LH, estradiol, and progesterone were studied
daily during 12 IOIs and 21 periovulatory periods in nine Miniature
ponies. Assay of ir-inhibin was done only on Days 10 and 18 to
represent the days of expected high and low concentrations of FSH,
respectively. The peak of the FSH surge that was temporally
associated with emergence of the future ovulatory follicle occurred
when the follicle was about 9 mm, compared to a reported diameter of
13 mm in larger breeds. The ovulatory LH surge involved a slow
increase between Days 13 to 18 (ovulation = Day 0; 0.6 ± 0.1 ng/day),
a minimal increase or a plateau on Days 18 to 21 (0.04 ± 0.1 ng/day),
and a rapid increase after Day 21 (2.2 ± 0.4 ng/day; P < 0.0001). The
end of the plateau and the beginning of the rapid increase in LH
occurred on the day of maximum concentration in the preovulatory
estradiol surge. An unexpected mean increase and decrease in LH
occurred (P < 0.04) on Days 5 to 9. Changes in concentrations of
estradiol and progesterone seemed similar to reported results in larger
breeds. Concentration of ir-inhibin was greater (P < 0.0001) on Day
18 than on Day 10, consistent with an FSH/inhibin relationship.
Apparently, the largest follicle in Miniature ponies begins to produce
adequate ir-inhibin for FSH suppression at a smaller diameter than for
larger breeds. Results indicated that in Miniature ponies the peak of
the FSH surge associated with emergence of the future ovulatory
follicle occurred at a smaller diameter of the future ovulatory follicle
than in larger breeds, the ovulatory LH surge increased in three
phases, and the ovulatory LH surge was followed by an LH increase
and decrease during the early luteal phase.
P228
Uterine blood flow and perfusion evaluated by color- and
power-Doppler ultrasonography in mares with uterine
cysts
Gastal, EL 1 ; Ferreira, JC 2 ; Ginther, OJ 1,2
1Department of Pathobiological Sciences, University of Wisconsin, Madison,
WI 53706, USA; 2 Eutheria Foundation, Cross Plains, WI 53528, USA
Uterine cysts have been described in diverse species of animals,
including horses, cattle, ewes, pigs, cats, dogs, elephants, and humans,
but the etiopathogenesis of uterine cysts is uncertain. Considering the
reports of a high incidence of cysts in older mares and reports of
degenerative changes in the uterine artery walls in older mares, there
may be a relationship among the presence of uterine cysts and
decreased uterine vascular perfusion. Transrectal color- and power-
Doppler ultrasonography was used to study uterine blood flow and
perfusion in mares with and without uterine cysts. Vascular perfusion
of the uterus and blood-flow velocities, vascular perfusion, diameter,
circumference, and area of a cross section of the mesometrial
attachment were evaluated. To study the effect of internal cysts, two
matched groups (cystic and control, n = 21 mares/group) were used.
Uterine vascular perfusion in mares with cysts was less (P < 0.0001)
in the cystic region than in the noncystic region and less (P < 0.0009)
than for controls. The vascular perfusion in the uterine regions
without cysts did not differ from the controls. Mares with cysts had
lower (P < 0.04) pulsatility index (PI) and greater end diastolic
velocity (EDV; P < 0.03) and time-averaged maximum velocity
(TAMV; P < 0.05) of the mesometrial vessels than controls. To study
the effect of size of internal uterine cystic area, paired mares were
arranged in four groups (n = 8-11/group): small uterine cystic area (≤
275 mm 2 ) versus controls and large uterine cystic area (> 410 mm 2 )
versus controls. A small uterine cystic area did not affect mesometrial
blood flow. Mares with large uterine cystic area had lower PI (P <
0.05) and greater PSV (P ≤ 0.05), EDV (P < 0.009), and TAMV (P <
0.005). To study the effect of age in mares that were not bred during
the last 10 yr, old versus young mares without cysts were compared (n
= 11/group). Old mares had greater EDV (P < 0.02) and TAMV (P <
0.01) than young mares, but uterine vascular perfusion was not
affected by age. Results demonstrated, for the first time in any
species, reduced uterine vascular perfusion in uterine segments that
contained cysts and a positive association between size of the cystic

16 t h International Congress on Animal Reproduction
104 Poster Abstracts
area and disturbed uterine hemodynamics at the mesometrial
attachment.
P229
Effect of protein source in stallion semen diluent on the
motility, acrosome integrity and morphology of sperm
Gibb, Z 1 *, Morris, L 2 , Grupen, C 1 , Evans, G 1 , Maxwell, C 1
1Faculty of Veterinary Science, The University of Sydney, Sydney, Australia;
2EquiBreed Ltd., Cambridge, New Zealand
Introduction Most stallion semen diluents utilise skim milk to
provide protective proteins for sperm. However, milk based diluents
impede sperm motility assessments and reduce the effectiveness of
staining procedures used to process sperm for flow cytometric sorting.
In addition, the variable protein levels and the presence of
unidentified toxic products in milk may vary results. Therefore, a
more precisely defined diluent protein composition is needed. The
aim of this study was to ascertain the optimal source of protein in a
traditional stallion semen diluent, Kenney’s Modified Tyrode’s 1
(KMT) Medium, for handling and processing stallion sperm prior to
flow cytometric sex-sorting.
Methods and Materials Two ejaculates were collected from each of
three Standardbred stallions. Each ejaculate was diluted in traditional
KMT that contained skim milk or KMT without skim milk and
supplemented with 0.25mg per ml of either bovine serum albumin
(BSA), β-lactoglobulin, glycine or fetal bovine serum (FBS). Diluted
semen samples were incubated at 34ºC or 5ºC. Subjective motility,
acrosome integrity and morphology were assessed over a 24 h period.
Results and Discussion After incubation for 3 h at 34ºC, there was no
significant difference between the diluents for total motility,
progressive motility or acrosome status of spermatozoa. After
incubation for 24 h at 34ºC in KMT, there was a lower incidence of
sperm tail abnormalities compared with the other diluents (9.3 vs.
23.2 – 24.5 %; p

16 t h International Congress on Animal Reproduction
Poster Abstracts 105
P232
Fertility of Thoroughbred stallions with special respect to
their use as dual-hemisphere (shuttle) stallions
Aurich, C 1 , Höhndorf, U 2 *
1Dept. for Animal Breeding and Reproduction, Centre for Artificial
Insemination and Embryo Transfer, Austria; 2 Veterinaermedizinische
Universitaet Wien
Thoroughbred stallions with a high genetic potential are often used for
breeding on the northern (NH) and southern hemisphere (SH) in the
consecutive breeding seasons of the same year. These stallions are
called shuttle stallions. It was the aim of this study to compare fertility
data of shuttle stallions to data of stallions that were just used for one
breeding season, i.e. on one hemisphere. Data from the breed
registries of Argentina, Australia, Great Britain/Ireland, New Zealand
and the USA on number of covered mares per stallion, number of live
foals per stallion and the rate of live foals per stallion and season were
statistically compared. Data from a total of 6686 stallions (year 2005)
were included, 144 of them were used for breeding in at least one
country of the NH and the SH in that year and thus were defined as
shuttle stallions. In the shuttle stallions, the number of covered mares
(62.4±3.1), live foals (42.7±2.2) and live foal rate (69.5±1.3%) per
season (average of the two breeding seasons in 2005) was
significantly (p

16 t h International Congress on Animal Reproduction
106 Poster Abstracts
P235
Prolactin Activity During the Follicular Phase in the Mare:
Evidence of an Extra-Pituitary Prolactin Source
King, SS 1 *, Roser, J 2 , Jones, KL 1
1Southern Illinois University Carbondale, IL; 2 University of California, Davis,
CA
Prolactin (PRL) activity in the equine follicle has been documented in
the form of PRL receptors on the corpus luteum 1 and PRL in the
follicular fluid 2 (FF). The objective of this study was to identify
locations and possible sources for PRL in the follicular phase ovary.
Circulating PRL concentrations were analyzed from three studies (61
cycles, 17 mares). Plasma PRL was determined by homologous
double antibody RIA 3 . PRL concentrations around ovulation (0-1d
postovulation) were compared with the early luteal phase (2-10 d).
The granulosa/theca layer was removed postmortem from anonymous
mares (n=10) and stored frozen (-80°C). Equine pre-PRL mRNA was
extracted and prepared for quantitative PCR using primers and
reaction conditions previously described 4 . Equine pituitary mRNA
was used to generate a standard curve from which concentrations of
pre-PRL mRNA transcripts were determined. Presence of PRL in
ovarian structures was determined by immunohistochemistry (IHC).
Whole ovaries (n=6) from cycling mares were fixed in 4%
paraformaldehyde, embedded in paraffin and cut into 5 um sections.
Sections were incubated with R4 PRL rabbit anti-porcine first
antibody (DL Thompson, Louisiana State Univ) and goat anti-rabbit
IgG-biotinylated (avidin-biotin complex) second antibody. Slides
were developed with DAB chromagen-Ni and counterstained with
nuclear fast red stain. Equine pituitary served as a positive control.
Plasma PRL demonstrated a short-term (1-2 d) increase (P=0.001)
around ovulation. Equine pre-PRL mRNA was detected in all
granulosa/theca samples in concentrations inversely correlated to
follicle size (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 107
P238
Immunocytochemical localization of leptin (Ob) and leptin
receptor (Ob-R) in preovulatory and in vitro matured
horse oocytes related to prepuberty and different weight
breeds
Lange Consiglio, A 1 *, Arrighi, S 2 , Bosi, GP 2 , Aralla, M 2 , Cremonesi, F 2
1Veterinary Clinical Sciences, Reproduction Unit, University of Milano, Faculty
of Veterinary Medicine, Italy; 2 Department of Veterinary Science and
Technologies, University of Milano, Faculty of Veterinary Med, Italy
The onset of puberty in humans and animals is associated with an
increase in fat and consequent increase in circulating leptin,
suggesting that leptin may be required for normal growth and
development of reproductive organs. Moreover, leptin amount in the
blood is proportional to body energy stores and/or body mass, so,
inadequate nutrition might impair reproductive function leading, for
example, to the delayed onset of puberty. A similar relationship
between nutrition and reproductive efficiency is not understood in the
mare where, besides many reports quantifying the correlation of
circulating concentration of leptin with body condition scores, only
few informations exist about the presence of leptin (Ob) and leptin
receptor (Ob-R) in the ovary or in the oocyte. Taking this into
account, we carried out an immunocytochemical study to investigate
the presence of Ob and Ob-R in compact cumulus oocytes recovered
from fillies and from mares of light or heavy body weight breeds after
slaughtering during the autumnal transition. The occurrence of
immunofluorescence was determined by scanning laser confocal
microscopy in oocytes immediately upon collection and after in vitro
maturation (IVM) using monoclonal antibody conjugated to a
fluorescent label. IVM was accomplished in TCM199 supplemented
with 1 mM pyruvate, 0.1 IU LH, 0.1 IU FSH, 100 ng IGF, 50 ng EGF,
1 µl ITS and 1 µl estrogen per ml. Oocytes were incubated for 40 h at
38°C at 5% CO2. Both Ob and Ob-R, detected in immature oocytes of
all kinds of animals analyzed, were uniformly distributed throughout
the ooplasm, but the intensity of reaction was lower either in light
weight mares or in fillies oocytes, than in oocytes of heavy weight
mares. After IVM, heavy breed mares had a higher proportion of
oocytes that reached metaphase II than light mares and fillies
(35.53±2.71%, 19,84±1.48% and 15,82±1,52 respectively; P

16 t h International Congress on Animal Reproduction
108 Poster Abstracts
problem mares, one may conclude that uterine cytology is the first
choice exam to detect endometritis in mares. Acknowledgements:
FAPESP 05/53112-4 and FAPESP 06/59003-5.
P241
Sperm morphology variation of stallion ejaculates in
different breeding seasons
Morrell, JM*, Dalin, AM and Rodriguez-Martinez, H
Division of Reproduction, Dept of Clinical Sciences, SLU, Box 7054, 75007
Uppsala, Sweden
Previous reports have described seasonal variation in the proportion of
stallion spermatozoa with normal morphology but there is a paucity of
data on variation between different years. The present report is a
retrospective analysis of morphology evaluations from 8 stallions over
several years. The stallions were all from a commercial stud (Flyinge
AB, Flyinge, Sweden). Three or four ejaculates were collected from
each stallion under a three-week period in June 2006. Aliquots of each
ejaculate were used to prepare air-dried stained smears or fixed in
formol saline for later evaluation as wet smears, using the procedure
described by Lagerlöf. The evaluation of sperm morphology was
performed by skilled, experienced technical personnel at SLU. The
proportion (%) of morphological spermatozoa was estimated and used
to establish a 95% confidence interval (CI) for normal morphology for
these stallions. Analyses were also available for individual ejaculates
from the same stallions in previous years and in 2007. The results
from other years were compared with the 95% CI for 2006: if the
results lay within the 95% CI, they were considered not to be
significantly different from the 2006 values; if they lay outside the
95% CI, they were considered to be significantly different. Therefore,
of the 21 evaluations made in years other than 2006, 12 were outside
the 95% CI and were considered to be significantly different from the
2006 means. Of these, 10 were higher than the 95% CI, whereas two
were lower. However, nine ejaculates were not statistically different
from the 2006 mean values. Interestingly, stallion R showed a steady
decrease in the proportion of spermatozoa with normal morphology
over 13 years. In conclusion, considerable variation in normal
morphology occurs between ejaculates from any individual stallion in
different breeding seasons, and this difference varies among stallions.
Acknowledgments: Funded by the Swedish Equine Research
Organisation, Stockholm. We thank Karen Selin-Wretling and Annika
Rikberg for their skilled sperm morphology analysis, and Flyinge AB
for semen samples.
P242
Impact of a single administration of hcg on free thyroid
hormone levels in mares at oestrus
Mutinati, M*, Rizzo, A; Nicassio, M; Matarrese, R; Spedicato, M; Minoia, G;
Lacalandra, GM; Sciorsci, RL
Department of Animal Production, Faculty of Veterinary Medicine, Bari, Italy
Human chorionic gonadotropin (hCG) is a glycoprotein hormone
sharing a high structural resemblance with the molecule of the thyroid
stimulating hormone (TSH). Furthermore, the extracellular domain of
the LH/CG receptor and TSH receptor, share 45% homology. The
aim of the study was to evaluate the effect of a single intra-muscular
administration of hCG, on serum concentrations of free
triiodothyronine (fT3) and free thyroxine (fT4) in mares. Twenty
healthy, adult mares in oestrus, were divided in two groups: group A
consisting of 10 subjects, treated with 5 ml of sterile saline solution,
(NaCl 0.9%); group B consisting of 10 subjects, treated with 4000
I.U. of hCG (Chorulon®, INTERVET). All mares underwent 7 blood
collections: T1, contextually to drug administration; T2, T3, T4, 2, 6
and 24 hours after drug administration, respectively; T5, T6, 3 and 6
days after drug administration. All mares were inseminated with
refrigerated semen belonging to the same, proved stallion, soon after
T3 and underwent a pregnancy diagnosis 14 days after insemination.
Dosages of fT3 and fT4 were performed on all the blood samples
collected, with immunoenzymatic competitive kits (EIA WELL®,
RADIM, Pomezia, Italy). Data were statistically analyzed with chi
squared, one way ANOVA and Student’s t-test. The conception rate
of group A was 40%, whereas in group B it reached 80% (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 109
Miniature mares are a potential model for comparative studies in
folliculogenesis within and among species.
P244
The effect of interval from mating to ovulation on
pregnancy rates and incidence of intra-uterine fluid in the
mare
Newcombe, JR 1 *; Cuervo-Arango, J 2
1Equine Fertility Unit, Warren house farm, Brownhills, UK; 2 Royal Veterinary
College, Department of Veterinary Clinical Science, University of London, UK
Introduction Persistent mating-induced endometritis (PMIE) is
known to be one of the main factors affecting pregnancy rates in the
mare. There has been extensive research on causes and treatments of
PMIE, however the interval from mating to ovulation (IMO) has
never been considered as a possible factor affecting the outcome of
PMIE and pregnancy rates. It is thought that natural cover is best
performed close to ovulation (0-48 h prior to ovulation) in order to
achieve optimum pregnancy rates. However, to date it is not known
whether mating “problem mares” at that interval will be detrimental
for pregnancy rates (PR). The objectives of this study were: a) to
assess the effect of IMO on PR and on the incidence of intra-uterine
fluid (IUF) 72 h post-mating (PM); and b) to determine the effect of
free IUF 72 h PM on PR.
Material and methods A total of 439 cycles from 315 Thoroughbred
mares were analysed. Mares were examined by transrectal
ultrasonography every other day until the mare was free from IUF (up
to 96 h from mating). Pregnancy diagnosis was preformed by
ultrasound 12-13 days post-ovulation and rechecked by 30 days. For
each mare, age, date of mating, name of stallion used, number of
services, IMO and depth of IUF 72 h PM were recorded. For data
analysis, three groups of IMO were used (0-48, 48-96 and 96-144 h).
A statistical general model of analysis of variance was used to assess
the effect of stallion, IMO, age and presence of IUF 72 h PM on PR.
Chi-square test was used to analyse the association among IMO, PR
and IUF 72 h PM.
Results Stallion, age and IMO had no effect (P > 0.05) on overall (all
services) PR. Pregnancy rates in mares with IUF 72 h PM was
reduced by 17.7 % (P < 0.01). Mares mated at the interval 0-48 h preovulation
were more likely (P < 0.01) to have IUF 72 h PM than at
48-96 and 96-144 h (68, 42 and 41 % respectively). Pregnancy rates
on first service were (69.3, 73.3 and 68.4 % for intervals 0-48, 48-96
and 96-144 h respectively, P > 0.05). However, on second service (n =
88 mares) they were lower (P < 0.05) in mares mated 0-48 h (54.5 %)
than in those mated 48-96h before ovulation (79.1 %) .
Conclusion Incidence of IUF 72 h PM is highest in mares mated 0-48
h before ovulation. Mating 0-48 h before ovulation is detrimental for
PR in mares which failed to conceive in first service. It appears that in
“problem mares” with delayed uterine clearance, a longer IMO gives
the mare an “extra” time to clear the uterine inflammation before the
cervix closes under progesterone influence.
P245
Apoptotic markers can be used to forecast the
freezeability of stallion spermatozoa
Ortega Ferrusola, C 1 *, Gallardo Bolaños, JM 1 , Gonzalez Fernandez, L 2 ,
Rodriguez-Martinez, H 3 , Tapia, JA 2 , Pena, FJ 1
1Reproduction, University of Extremadura, Spain; 2 Physiology, University of
Extremadura, Spain; 3 Reproduction, SLU, Sweden
In an attempt to identify valuable markers for potential freezeability
of the equine spermatozoa, three ejaculates were collected from five
Andalusian stallions and frozen using a standard protocol. Before
freezing, three apoptotic cell markers were studied by flow cytometry
(early changes in sperm membranes, mitochondrial membrane
potential and caspase activity). Post-thaw, spermatozoa were again
evaluated for these parameters and for sperm kinematics using CASA.
Receiving operating system curves were used to evaluate the relative
value of the apoptotic markers herein studied, as forecast for potential
freezeability. From all parameters studied, the outcome of JC-1 (as
proportion of spermatozoa showing simultaneously orange and green
fluorescence) had the highest diagnostic power. For potentially bad
freezers (less than 25% of intact spermatozoa post-thaw), the
significant area under the ROC-curve was 0.985, with a 100%
sensitivity and 99.8% specificity for a cut off value of 55.7.
P246
Effect of altrenogest-treatment in late pregnant-mares on
parturition, neonatal adaptation and adrenocortical
function in new-born foals
Palm, F 2 *; Neuhauser, S 1 ; Ambuehl, F 1 ; Moestl, E 3 ; Aurich, C 1
1Centre for Artificial Insemination and Embryo Transfer; 2 Clinic for Obstetrics,
Gynaecology and Andrology; 3 Institute for Biochemistry, University of Vet.
Sciences, Vienna, Austria
In mares with compromised pregnancies, treatment with the synthetic
gestagen altrenogest (allyltrenbolon) is common to maintain gestation
until term. However, there are no controlled studies on the effects of
altrenogest administration during late pregnancy on parturition and
development of the foals in the immediate postpartum period. In our
study, pony mares with normal pregnancies were treated with
altrenogest (0.088 mg/kg bwt; n=6) from day 280 of gestation until
spontaneous parturition or were left untreated as controls (n=7).
Stages of labour and clinical parameters were analysed and blood
samples were collected from immediately after birth until 48 hours
post natum for analysis of cortisol concentration, haematolgical and
acid base parameters. In order to assess adrenocortical function, an
ACTH stimulation test with 0.125 mg ACTH (Synacthen, Novartis)
was performed on days 1 and 5 after birth and cortisol release
calculated as area under the curve for the time period 0 to 120 min
after cortisol injection. Altrenogest-treated mares tended to have a
shorter gestation length (320±4 days) than control mares (327±2 days)
and showed a prolonged second stage of labour (p

16 t h International Congress on Animal Reproduction
110 Poster Abstracts
was diluted 1:1 with Botu-Semen ® (skim-milk based extender), split
in two aliquots and centrifuged at 600xg for 10 minutes. Pellets were
ressuspended using Botu-Crio ® (egg-yolk based extender with
aminoacids, 1% glycerol and 4% amides - Biotech Botucatu ® , Brazil),
or Botu-Crio ® Egg Free ® extender (same basis without egg-yolk -
Biotech Botucatu ® , Brazil), to a final concentration of
100x10 6 sperms/mL. Samples were prepared at room temperature.
After ressuspension, samples were loaded into 0.5mL straws,
stabilized for 20min at 5°C in refrigerator then placed 6 cm above
nitrogen level in isopor box (42L) filled with 3 cm of liquid nitrogen
for 20 min and finally immersed. Samples were thawed at 46°C for
20s and maintained in 1.5mL plastic tubes in dryblock at 37°C and
evaluated for sperm motility by CASA (IVOS 12) and plasma
membrane integrity with fluorescent probes (PI and CFDA). ANOVA
and Tukey test were performed by GraphPad InStat program. Results
obtained for Botu-Crio ® and Botu-Crio Egg Free ® extenders were:
total motility (61.4±16.2 x 61.4±15.9%), progressive motility
(27.0±9.8 x 26.7±10.6%), VAP (path velocity) (92.6±13.3 x
97.1±13.8µm/s), VSL (straight line velocity) (73.0±8.8 x
75.0±10.3µm/s), VCL (curvilinear velocity) (167.5±21.7 x
176.3±22.9µm/s), ALH (amplitude of lateral head displacement)
(6.7±0.5 x 7.0±0.4µm), STR (straightness) (78.1±5.2 x 77.0±2.4%),
LIN (linearity) (46.2±5.1 x 43.3±1.9%) and plasma membrane
integrity (53.4±11.5 x 57.4±7.0%), respectively. No difference
(P>0.05) was observed between extenders. In conclusion, as Botu-
Crio Egg Free ® , which is a completely chemically defined media, has
shown similar results when compared to Botu-Crio ® , it may be an
alternative for freezing equine semen. Further researches are
necessary to evaluate in vivo fertility when using this extender.
P248
Vaginal biotic flora and its antibiotic resistance profile in
terras de miranda jennets
Payan-Carreira, RM 1 *, Mota, VR 2 , Barroso, AT 2 , Quaresma, M 3 , Saavedra,
MJ 4
1Zootecnia Dept., University of Trás-os-Montes e Alto Douro, Portugal;
2University of Trás-os-Montes e Alto Douro, Portugal; 3 Veterinary Teaching
Hospital, University of Trás-os-Montes e Alto Douro, Portugal; 4 Veterinary
Clinics Dept., University of Trás-os-Montes e Alto Douro, Portugal
In this work authors report the preliminary results on the
characterization of the biotic flora found in the vagina of Terras de
Miranda jennets. Vaginal swab samples were obtained from the
vestibule and transported in transport medium for delivery to the
Microbiology Lab. This work was carried in a group of 21 jennets,
aged between 4 to 20 years old and the samples were obtained in two
retractions (15 animals + 6 animals). For the bacteriological analysis
of the vaginal samples different and selective culture media were
used, aiming a more significant bacterial growth. For the preliminary
identification of the isolated ones a set of biochemical tests was
carried through (oxidase, catalase, indol production, use of the citrate,
metil red, vogues proskauer and lactose fermentation). Antimicrobial
susceptibility testing was performed by disc-diffusion methods to
twenty seven antimicrobials (by CLSI recommendations), including
different beta-lactams, quinolone and aminoglicoside antibiotics.
From the vaginal samples, bacteria’s pertaining to the different
generic groups were found: Gram-positive bacteria, such as
Staphylococcus spp. and Enterococcus spp.; and Gram-negative
bacteria, such as Enterobactereaceae (E. coli, Klebsiella and
Enterobacter) and not Enterobactereaceae (Pseudomonas spp.).
Regarding to the resistance profile to antibiotics, the most frequently
observed resistance was to amoxicillin and ticarcillin (penicillins),
even when associated to the beta-lactamases inhibitor (acid
clavulanic), as well as the cephalosporin of 1st generation studied
(cephalotin). Resistance to aztreonam (antibiotic beta-lactam of the
group of the monobactams) was also observed in some cases.
P249
Does the microbial flora in the ejaculate affect the
freezeability of stallion sperm
Pena, FJ 1 *, Ortega Ferrusola, C 2 , Gonzalez Fernandez, L 2 , Macias Garcia,
B 2 , Rodriguez-Martinez, H 2 , Tapia, JA 2 , Alonso, JM 2
1Reproduction, University of Extremadura, Spain; 2 Spain
In an attempt to evaluate the possible relationship between the
microbial flora in the stallion ejaculate and its ability to freeze, 3
ejaculates from 5 stallions were frozen using a standard protocol.
Before freezing, an aliquot was removed for bacteriological analysis.
Bacterial growth was observed in all the ejaculates studied. The nonparametric
Mann–Whitney U-test was used to directly compare pairs
of values. The Spearman non-parametric test was used to study
correlations between microbiological findings (presence and quantity,
as number of CFU) and sperm quality post-thaw. The isolated
microorganisms were: Staphylococcus spp and Micrococcus spp (in
all the stallions), β-haemolytic Streptococcus (in stallions 3 and 4),
Corynebacterium spp (in stallions 1, 3-5), Rhodococcus spp (in
stallion number 2), Pseudomonas spp (in stallion number 1) and
Klebsiella spp in stallions 1, 3 and 5. The presence and richness of
Klebsiella and β-haemolytic Streptococcus in the ejaculate were
related to two sperm variables post-thaw, namely the proportion of
dead spermatozoa (EH+ cells; r=0.55, P

16 t h International Congress on Animal Reproduction
Poster Abstracts 111
caused by more than one bacterial clone (64%), whereas this was a
less pronounced in infections coused by E. coli (36%). Finally, we
observed no difference in the genetic diversity among S. equi ssp.
zooepidemicus or E. coli isolated from clitoris of mares from the
closed herd when compared to isolates from mares kept as on an
individual basis. In conclusion, it appears that no specific strain of S.
equi ssp. zooepidemicus or E. coli cause infectious endometritis in the
mare. Furthermore, positive cytology is a not a reliable tool to
evaluate the infectious status as presence of PMN’s was absent in
33% or 67% of infections caused by S. equi ssp. zooepidemicus or E.
coli, respectively.
P251
Luteal function and ovulation in mares treated with pgf2α
during early and mid-diestrus
Holland, BE; Pinto, CRF*
North Carolina State University, College of Veterinary Medicine, Raleigh,
North Carolina 27606,USA
PGF 2α is commonly administered as single injection to mares with a
mature corpus luteum (days 5 to 7 post-ovulation. In the present
study, it was hypothesized that complete luteolysis (plasma
progesterone < 1.0 ng/mL) will be achieved in mares receiving PGF 2α
for 3 consecutive days beginning as early as 2 days after ovulation
(early diestrus). The specific objectives of the present study were to
document ovarian dynamics (follicular growth, ovulation, CL
formation) using transrectal ultrasonography, and luteal function
determined by concentrations of plasma progesterone (P 4 ). The effect
of intramuscular administration of 2.5 mg PGF 2α on luteal function
(dinoprost tromethamine) given on day 10 after ovulation (Group 1)
and on days 2, 3, and 4 (Group 2) was examined in a switch back
design utilizing horse mares (n = 10). Transrectal ultrasonography
was performed three times per week or once daily on mares in estrus
with follicle diameters ≥ 30mm. Blood samples were taken daily and
plasma samples were stored at -20 ˚C until RIA analyses for P 4 .
Statistical analyses were done by ANOVA, with significance level set
at P < 0.05; data are presented as mean ± SEM. All mares in Group 1
(control) underwent complete luteolysis 2 to 3 days after PGF 2α
treatment with a mean of 2.4 ± 0.16 days; all mares in Group 1
ovulated 8.2 ± 0.75 days following PGF 2α treatment. In Group 2 (early
diestrus), 6 out of 10 mares underwent complete luteolysis 3.3 ± 0.2
days after beginning of treatment on day 2 post-ovulation; these mares
ovulated 9.4 ± 1.36 days after treatment. The remaining 4 mares in
Group 2 underwent partial luteolysis followed by resurgence in
circulating concentrations of plasma P 4 ; 3 out of these 4 mares
ovulated with relatively high circulating concentrations of plasma P 4
at day 9 (P 4 = 3.3 ng/ml), 15 (P 4 = 2.99 ng/ml) and 16 (P 4 = 3.29
ng/ml) following treatment, respectively; whereas the remaining mare
underwent natural luteolysis 16 days after treatment with its ovulation
occurring on day 19 following treatment. Complete luteolysis
followed by ovulation was observed in 60% (5/10) of mares treated
during early diestrus. We concluded that the equine corpus luteum
could be responsive to exogenous PGF 2α as early as 2 days post
ovulation. Increasing the dose or frequency of PGF 2α treatment
during early diestrus may provide novel protocols for use in
broodmare management.
P252
Pregnancy diagnosis in the mare by semi quantitative
relaxin quick assay kit
Ponthier, J 1 *; Van de Weerdt, M-L 2 ; Deleuze, S 1
1Equine Reproduction, Equine Veterinary Teaching Clinic, Faculty of
Veterinary Medicine, ULg, University of Liege, B41, 20, Boulevard de
Colonster, B-4000 Liege, Belgium; 2 Lab For Vet, 31 Rue Laoureux, B-4800
Verviers, Belgium
Few hormonal assays for pregnancy diagnosis are available in the
mare. Progesterone assay is not sensitive, not predictive of foetal
viability and is useless after day 120 of pregnancy. PMSG or eCG
diagnosis is short-windowed (from day 45 to 100) and can give falsepositive
results (in case of embryo mortality). Urinary estrogens assay
is only reliable in late pregnancy (after day 150) and requires bladder
catheterism. Estrone sulfate measurement predicts foetal viability but
is inadequate before day 100. Relaxin, a polypeptid produced by the
placenta in the mare, the bitch and the queen, is a candidate for the
pregnancy diagnosis and the foetal viability prognosis. Rapid
immunological tests have been developed to detect relaxin after day
28 of pregnancy in the bitch and 31 in the queen. In the bitch,
circulating relaxin measured by immunological procedure is at 1ng/ml
at 4 weeks and peaks at 4ng/ml at 6 weeks. In the queen, relaxin is at
5ng/ml at day 31 and reaches 9ng/ml at day 40. In pregnant mares,
relaxin detected by chromatography is basal until day 80 and then
reaches 80ng/ml for the mare and 10ng/ml for the pony mare. From
there on, concentration will increase in the pony and decrease in the
horse. In both cases, concentration falls dramatically at parturition.
The aim is to study the validity of a commercially available semiquantitative
quick immunological relaxin detecting test for dogs and
cats in the mare. Serums of ten mares (pony, saddle or draft) are used
for Witness Relaxin ® Test (Synbiotics Corporation, France): an
ELISA sandwich test. The sample is mixed with specific primary
antibodies, then this complex migrates on a membrane and is captured
by secondary antibodies. Positive reaction reveals a coloured band.
Proper migration on the membrane is confirmed by a second coloured
band (witness). Diagnosis and stage of pregnancy are assessed by
transrectal or abdominal ultrasonography. Sensibility and specificity
are determined and statistical significance is obtained by Fischer’s
exact test. Out of the 10 mares, 4 were non-pregnant and 6 were
pregnant over 100 days. No Witness Relaxin ® Test did show a
positive result, neither for pregnant nor for non-pregnant mares.
Sensitivity is 0% and specificity is 100%. Samples of the 6 pregnant
mares were sent to the Synbiotics laboratory for a classical ELISA,
but none showed a response for the antibodies used. Antibodies of the
Witness Relaxin ® Test have been used successfully in various species
(dog, cat, mice). Although equine relaxin has a similar structure with
two sub-units (A and B) and a comparable molecular weight, these
antibodies fail to recognize its sub-unit B. Further studies are required
to develop specific equine antibodies.
P253
Clinical Causes for Infertility in Jennets on “Planalto
Mirandês”
Quaresma, M 1 *, Payan-Carreira, RM 2
1Veterinary Teaching Hospital,; 2 CECAV; Univ. Trás-os-Montes and Alto
Douro, Vila Real, Portugal
A group of 24 jennets were reported by the local breeder’s association
to our Veterinary Teaching Hospital with complains of infertility.
Twenty-two animals belong to the breed “Asinina de Miranda”
(84,6%), a small portuguese breed of no more than 200 females
registered in the Book, and 4 were Miranda’s crossbreed (15,4%). The
group showed a wide ages distribution, ranging from 3 to more than
15 years old. The gynaecological evaluation of the jennets included
the reproductive anamnesis and examination of the external genitalia,
vaginoscopic and digital evaluation of the vagina and the evaluation
of the uterus and ovaries by transrectal palpation and ultrasonography.
The gynaecological examination detected six jennets having structural
anomalies: one with an imperforate hymen, two other animals with
severe hymenal constriction and two with cervical hypoplasia.
Another one evidenced a polyp in entrance of the uterine body.
Ultrasonographic examination evidenced bilateral granulosa cell
tumours in four of the jennets. It was also found a female with
multicystic uterus resembling “suisse cheese”, and isolated uterine
cysts in two of the females. In sixteen animals ultrasonographic
evaluation demonstrated an apparent normal ovarian activity, despite
that most of them being referred by owners as in anoestrus. It seems
that in many of those cases the owners were unable to detect oestrus.
Although the data presented here was collected in a relatively small
number of animals, it may reflect the high consanguinity that we tend
to observe in this breed due to the low number of animals available
for reproduction.

16 t h International Congress on Animal Reproduction
112 Poster Abstracts
P254
Effect of impaired uterine drainage via cervix in normal
mares after insemination
Reine, E 1 *; Reilas, T 2 ; Rivera Del Alamo, M 3 ; Katila, T 4
1Faculty of Veterinary Medicine, Latvian University of Agriculture, Latvia;
2Equine Research, MTT Agrifood Research Finland, Finland; 3 Faculty of
Veterinary Medicine, Autonomous University of Barcelona, Spain; 4 Faculty of
Veterinary Medicine, University of Helsinki, Finland
Introduction In normal mares, the acute endometrial inflammation
caused by artificial insemination (AI) peaks around 8 h and subsides
appreciably within 24 h after AI. In mares susceptible to endometritis,
inflammation and infection may persist because of reduced
myometrial contractions. The necessity of a patent cervix has been
recognized, and manual dilatation of the cervix has been used to aid
evacuation of fluid collections. The roles of lymhatic drainage and
drainage through an open cervix warrant further investigations.
Objective To examine the role of the cervix in uterine drainage, a
balloon-tipped catheter was used to impaire uterine drainage via
cervix. Numbers of polymorphonuclear neutrophils (PMNs) were
evaluated after AI in 3 treatments: A) AI, catheter closed for 25 h, B)
AI, catheter closed for 6 + 19 h, and C) AI, no intracervical catheter.
Methods Twenty-nine clinically normal mares were assigned to 4
groups and followed through 5 oestrus cycles. During the first, third
and fifth oestrus, the uterus was swabbed. In the second and fourth
oestrus, the mares were treated in the following order: group1) CA,
group 2) AC, group 3) CB, and group 4) BC. AI dose was 500 x 10 6
progressively motile sperm extended with skim milk (20 ml, pooled
semen from 2 stallions). In treatments A and B, clamped catheters
were inserted immediately after AI. Uterine fluids were collected
either using a tampon 25 h after AI in C (tampon fluid TF) or by
draining fluid from the catheter at 25 h in A, and at 6 and 25 h in B
(catheter fluid CF). Oxytocin was injected i.v. to aid fluid drainage. At
25 h, the uterus was lavaged using 500 ml of Ringer’s solution (lavage
fluid LF). PMNs were counted using a Bürker chamber.
Results In the second oestrus, at 25 h after AI, PMN concentrations
(10 6 /ml) were similar in treatments A and B (CF-A: 73.2 ± 8.4, CF-B:
66.3 ± 19.9, LF-A: 2.4 ± 0.4, LF-B: 2.4 ± 0.8), and lower in treatment
C (TF-group 1: 3.8 ± 0.5, TF-group 3: 2.9 ± 0.4). In the fourth oestrus,
PMN numbers in treatment C were 10 times higher than during the
second oestrus (TF-group 2: 27.7 ± 4.2, TF-group 4: 31.1 ± 12.5). In
treatments A and B, PMNs were only slightly elevated compared to
values in the second oestrus (CF-A: 143.3 ± 17.3, CF-B: 97.9 ± 16.7).
PMNs in LF between treatments did not differ. Draining the uterus at
6 h had no effect on PMN numbers in CF 19 h later. Swabs were
negative for bacterial endometritis.
Conclusion Impaired cervical drainage seemed to have a profound
effect on uterine inflammation showing the important role of the
cervix.
P255
Serum aldosterone concentrations in Spanish Purebred
mares during pregnancy
Satué, K*; Domingo, R
Faculty of Veterinary Medicine, Cardenal Herrera-CEU University, Valencia,
Spain
Introduction The need to supply oxygen and nutrients to the
fetoplacental unit and to counterbalance the effects induced by the
release of new gonadotropic hormones during pregnancy requires
important adjustments of all hormones involved in the regulation of
blood volume, hydration and electrolytic state, and therefore of blood
pressure.
Objectives The main purposes of this research were: 1) to establish
reference ranges for serum aldosterone (ALD) concentrations in
Spanish Purebred mares; 2) to analyze pregnancy-related changes
related to pregnancy in serum ALD concentrations and 3) to assess the
effect of the age of the mare in serum ALD.
Material and Methods Thirty-three Spanish Purebred broodmares,
aged between 4 and 17 years were selected for this study. Jugular
venous blood samples were taken every month during pregnancy in
the morning. After withdrawal, blood was centrifuged and serum was
harvested. Serum ALD concentrations were measured by competitive
immunoassay.
Results Mean serum ALD concentrations were 562.21 pg/ml, with
maximum and minimum values of 1936.77 and 101.50 pg/ml
respectively. Mean values in the 1 st month of pregnancy were 628.79
pg/dl, they diminished in the 2 nd month, when the minimum mean
values were achieved (346.09 pg/ml). In the 3 rd and 4 th months, serum
ALD progressively increased to reach maximum mean values in the
5 th month (795.19 pg/ml). From this moment on, the mean values
fluctuated without significant differences up to the partum, with
means comprised between 458.59 and 658.17 pg/ml. No significant
differences were detected in relation to the age of the mares.
Discussion The Spanish Purebred broodmares showed serum ALD
concentrations higher than those described for foals and adult horses
of different breeds. Most of the studies have been carried out in sport
horses and it is well known that the loss of Na in sweat leads to a
compensatory release of ALD. Serum ALD concentrations increased
two to three-fold in pregnant women, bitches and laboratory animals.
The main mechanisms involved in the increased serum ALD
concentrations during pregnancy could be: release of renin and
angiotensin II, and changes in ACTH concentrations.
Conclusions In conclusion, pregnancy in Spanish Purebred
broodmares induces a progressive increase in serum ALD
concentrations. This finding might imply a better conservation of Na
and water in the kidneys in order to favor the expansion of the
fetoplacental barrier. In this way, a suitable supply of nutrients and
oxygen to the fetus as well as a correct blood pressure would be
guaranteed, contributing to the internal homeostasis of the fetus and
the mare. In addition, this result could be a consequence of the
interaction of several neuroendocrine factors during pregnancy.
P256
The duration of the effects of active immunization against
GnRH to suppress ovarian activity in mares in South
Africa
Schulman, ML*; Botha, AE; Bertschinger, HJ; Guthrie, AJ
Faculty of Veterinary Science, University of Pretoria, South Africa
Introduction A GnRH-vaccine to suppress reproductive function was
administered to a large group of horse mares. The effects of
vaccination on ovarian activity were monitored over a period of one
year using serum progesterone concentration (SPC).
Methods Sixty five cyclic mares (age range: 3 to 24 years) were
assigned randomly in the middle of the summer season to either a
control (Group C, n = 10) or an experimental (Group E, n = 55)
group, respectively. Both groups were subdivided into three age
categories: Category 1 (3 to 5 years), Category 2 (6 to 14 years), and
Category 3 (> 15 years). On Day 0, all mares were examined by transrectal
palpation and ultrasound to establish their reproductive status.
Group E mares were injected intramuscularly with 2 mL of GnRHvaccine
(Improvac ® , Pfizer Laboratories, Sandton, SA). Group C
mares similarly received an equal volume of sterile normal saline
solution. The injections were repeated on Day 35, and the clinical
examinations on Days 35, 70 and 260. The last examination
corresponded approximately with the onset of the following summer
season. Blood samples were collected at weekly intervals from Day 0
until Day 360 from all mares for SPC using a radioimmunoassay kit
125
(Progesterone Coat-a-Count, Diagnostic Products Corp, Los
Angeles, CA, USA). As the SPC results correlated significantly with
the clinical findings, SPC alone was used to monitor ovarian activity
from Day 260 until 360. All data was analyzed using NCSS software
(Number Cruncher Statistical Systems, Kaysville, UT, USA) and a
multivariate analysis of variance (ANOVA) assessed the effects of
treatment and age on clinical parameters and SPC. Values were
considered to be statistically significant at P < 0.05.
Results On Day 0, all Group C and E mares showed clinical evidence
of ovarian activity. On Day 35, all Group C and 8 (14.5 %) Group E
mares showed ovarian activity. The SPC results showed all Group E
mares were non-cyclic by Day 56. On Day 70, examination and SPC
indicated all Group C, and none of Group E mares showed ovarian

16 t h International Congress on Animal Reproduction
Poster Abstracts 113
activity. All Group E mares remained in anoestrus until Day 175 with
SPC < 1 nmol/L. No effect of age category on suppression of cyclicity
within Group E was observed. On Day 260, only two (4 %) of the 48
Group E mares remaining in the trial were cyclic. On Days 280, 300,
320, 340 and 360, the number of cyclic mares was: 4 (8 %), 11 (23
%), 18 (38 %), 23 (48%) and 27 (56 %), respectively. A significant
age effect on the resumption of cyclicity was observed between
Category 3 and the other two age categories.
Conclusions All mares responded rapidly after immunization against
GnRH with complete suppression of cyclic activity for a minimum of
175 days, with 56 % resuming cyclic activity within one year of
vaccination.
P257
Effect of seminal plasma on the fertilizing capacity of
stallion epididymal sperm
Stout, TAE*, Sostaric, E; Kraan, H
Department of Equine Sciences, Utrecht University, Netherlands
The epididymis plays important roles in sperm maturation and storage
and, in the event of death or castration, represents a potentially useful
source of male germ plasm. However, while pregnancies have been
obtained in mares inseminated with frozen-thawed epididymal sperm,
success rates have been disappointing. This study aimed to determine:
at what point during epididymal transit stallion sperm acquire the
ability to acrosome react; whether cauda epididymal sperm are as
capable of capacitating and acrosome reacting as ejaculated sperm
and, if not, whether this can be rectified by exposure to seminal
plasma. In Experiment 1, spermatozoa recovered from the caput,
corpus and cauda epididymides were incubated under capacitating
conditions; aliquots were then exposed to progesterone or calcium
ionophore (A23187) to induce the acrosome reaction (AR). AR and
viability were examined by staining with fluorescein-conjugated
peanut agglutinin (PNA-FITC) and propidium iodode. Only cauda
epididymal sperm were able to undergo the AR in appreciable
quantities in response to progesterone (7 %) or calcium ionophore (17
%). In Experiment 2 an ejaculate was recovered from nine stallions at
daily sperm output; the sperm and seminal plasma were separated by
centrifugation. The stallions were then castrated and the sperm
flushed from the cauda epididymides and divided into two portions,
one of which was pre-incubated for 30 mins with homologous seminal
plasma. Three experimental groups were thus created; i) ejaculated
sperm (Ej); ii) epididymal sperm (E) and iii) epididymal sperm
exposed to seminal plasma (Es). After washing, sperm from all 3
groups were incubated under capacitating conditions. At intervals
during incubation, aliquots were examined for evidence of
capacitation (tyrosine phosphorylation and progesterone receptor
exposure) and the AR. After incubation for 2 or 4 hours, significantly
higher percentages of ejaculated than epididymal sperm showed
evidence of tyrosine phosphorylation, the AR (p

16 t h International Congress on Animal Reproduction
114 Poster Abstracts
better understanding of equine semen physiology, but other studies
are necessary to achieve better results for those stallions that are still
considered poor freezers.
Poster 06 - Porcine Reproduction
P260
Azoospermic boars in the Finnish Yorkshire and
Landrace breeds
Andersson, M 1 *, Kopp, C 1 , Ijäs, R 2 and Taponen, J 1
1Department of Production Animal Medicine, University of Helsinki,
Saarentaus, Finland; 2 FABA Breeding Service, Pieksämäki, Finland
In the period (1996-2005) ejaculates of 2048 boars were collected. All
boars were intended for use in artificial insemination or natural
breeding and had two descended testes. Azoospermia was found in 16
of 1097 Yorkshire boars (1.5%) and in 2 of 951 Landrace boars
(0.2%). The distribution of azoospermic boars into different groups
were (Y/L): pre-testicular azoospermia 0Y/1L, testicular azoospermia:
9Y/1L and post-testicular (obstructive) azoospermia in 7Y/0L. The
following diagnosis groups and number of affected boars were found:
in Yorkshire breed: arrest of spermatogenesis at the pachytene
spermatocyte stage in 8 boars and segmental aplasia of the Wolffian
ducts resembling the congenital unilateral absence of the vas deferens
and idiopathic epididymal obstruction in humans (CUAVD ) in 7
boars and Klinefelter syndrome in one boar. In Landrace breed the
azoospermic boars were less frequent and had a different diagnosis
and different aetiology compared with the Yorkshire boars: one boar
had a probable hypogonadotropic hypogonadism and another boar had
an arrest of spermatogenesis at the round spermatid stage with
degenerating round spermatids present in multinucleated cell bodies.
Morphometry of testicular tissue and distribution of different cells in
the seminiferous tubules were examined in thirteen boars; 4 normal
control boars, 3 boars with segmental aplasia of the Wolffian ducts, 3
boars with arrest of spermatogenesis at the pachytene spermatocyte
stage, one boar with hypogonadotropic hypogonadism, one boar with
an arrest of spermatogenesis at the round spermatid stage and one
boar with Klinefelter syndrome.
These findings indicate that the reason for azoospermia is mainly
genetic and in populations of different breeds different reasons for and
frequency of azoospermia was observed.
P261
Effect of different estrus synchronization systems on
embryo quality in multiparous sows and prepuberal gilts
Antosik, P 1 *, Kempisty, B 2 , Bukowska, D 1 , Lianeri, M 2 , Bieżyński, J 3 ,
Jaśkowski, JM 1
1Department of Agricultural Veterinary, University of Agriculture, Poznań,
Poland; 2 Department of Biochemistry and Molecular Biology, University of
Medical Sciences, Poznań, Poland; 3 Department and Clinic of Veterinary
Surgery, Wrocław University of Environmental and Life Sciences, Wrocław,
Poland
In this experiment, multiparous sows (n=63) and prepuberal gilts
(n=42) were used. The subgroups of these animals were treated with
PMSG (1500 U.I.) + hCG (500 U.I.) or PG-600 synchronization
systems. These animals were inseminated twice, 24 and 36 h after
hCG injection. The control gilts (n=20) were from the third subgroup
and were inseminated two times at 12 h intervals during their natural
estrus cycles.
We observed a statistically significant increased number of corpora
lutea (CL) and embryos between natural estrus and both
synchronization systems in multiparous sows (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 115
chance of losing their pregnancy after 5 weeks gestation. There was a
significant herd × wean-to-service interval interaction suggesting a
different effect of wean-to-service interval in each herd. Sows with
longer lactation periods had a lower chance of late pregnancy loss (P
< 0.05). Sows with a lactation period of 11 days had over a 20%
chance of late pregnancy loss compared to those with a lactation
length of 21 days. There were no significant effects of the number of
piglets weaned per farrowing on the outcome of the subsequent
pregnancy. The results of this analysis suggest that higher parity sows
with shorter lactations and longer wean-to-service intervals have the
greatest chance of late pregnancy loss during the seasonal infertility
period. M. Bertoldo is supported by a postgraduate scholarship from
the Australian Pork CRC.
P264
Morphological evaluation of preantral follicles from Large
White sow ovaries
Cardoso, RC 1 *, Oliveira, TM 1 , Monteiro, C 1 , Cagnini, DQ 2 , Amorim, RL 2 , Oba,
E 1
1Department of Animal Reproduction and Radiology, São Paulo State
University, Brazil; 2 Department of Veterinary Pathology, São Paulo State
University, Brazil
The study of porcine preantral follicles characteristics may contribute
for a better comprehension of the mechanisms that are involved in the
folliculogenesis during preantral stage. Moreover, preantral follicles
are a major source of oocytes, and their utilization as an important
tool to store large number of gametes for future use in reproductive
programs has already been investigated. In this study 46 ovaries were
evaluated, from 23 Large White sows aging around 6 months. After
the ovary collection, the ovaries were washed in saline and fixed in
10% formol saline for 24 hours. After that, the ovaries have been
embedded in paraffin wax, and the material was sectioned into 3μm
thick sections, preparing one slide at each 120 sections. The slides
were stained with hematoxilin and eosin. The preantral follicles were
morphologically classified as primordial, primary or secondary
follicles. Were defined as primordial follicles those containing,
around the oocyte, one flattened granulosa cells layer. The follicles
that presented one cuboidal granulosa cells layer were classified as
primary, and follicles that presented 2 or more cuboidal granulosa
cells layers were defined as secondary. The preantral follicles were
classified also according to their viability, as viable, moderately
atretic or severely atretic follicles. Viable follicles were defined as
those with well-ordered and intact basal layers, oocytes with less than
3 cytoplasmic vacuoles and intact germinal vesicles. The follicles that
presented oocytes with more than 3 cytoplasmic vacuoles and, initial
chromatin decondensation were classified as moderately atretic
follicles. And severely atretic follicles were defined as those with
seriously damaged oocytes and severe chromatin decondensation. The
average values and standard deviations found on the morphological
analysis of the follicles were: 61,1 ± 6,8% of primordial, 25,3 ± 5,6%
of primary and 13,6 ± 3,3% of secondary follicles. Among all the
follicles observed, 11,5 ± 5,5% were considered viable, 26,9 ± 5,1%
were considered moderately atretic and 61,6 ± 7,6% were classified as
severely atretic follicles. Therefore, the Large White sows that were
evaluated in this study presented preantral follicles at similar
developmental stages when compared to the results reported
previously for other breeds, however, with a higher incidence of
atretic follicles. So future studies are necessary to determine if this
high rate of atretic preantral follicles is directly related to the Large
White breed or to other factors that could have affected these results.
P265
Regulation of porcine sperm function by prostasomes
Fischman, ML 1 , Piehl, LL 2 , Molejón, MI 3 , Zampini, MC 3 , Cisale, HO 1 *,
Miranda, PV 3
1Area Física Biológica, Facultad de Ciencias Veterinarias, Universidad de
Buenos Aires, Argentina; 2 Cátedra de Física , Facultad de Farmacia y
Bioquímica UBA , Argentina; 3 Instituto de Biología y Medicina Experimental ,
CONICET , Argentina
The mammalian male reproductive tract has the ability to secrete
membrane vesicles usually called prostasomes. These vesicles can
interact with sperm but the function and relevance of this interaction
is controversial. In this report, the effect of vesicles isolated from pig
seminal plasma in sperm function was analyzed. Samples were
obtained by the gloved hand method. Prostasome-like vesicles were
isolated by ultracentrifugation of seminal plasma at 100000 g and
molecular filtration on a Sephadex G-200 column. Sperm were diluted
in Tyrode medium supplemented with 3 mg/ml BSA and incubated
for 3 hs at C under 5% CO2. After incubation, sperm were treated
with°39 g/ml) for 30 min to induce
acrosomeμLysophosphatidylcholine (LPC, 100 reaction (AR). To
analyze the effect of prostasomes on different sperm functions,
vesicles (3-fold seminal plasma concentration) were included during
the whole capacitation period. Tyrosine phosphorylation (TyrP) was
analyzed by Western blot. Apical plasma membranes were obtained
by nitrogen cavitation (600 psi) and sequential centrifugation.
Cholesterol (Cho) content was determined with the Colestat® kit
(Wiener Lab) and membrane fluidity by the order parameter (S) using
electron spin resonance (a decrease in S represents an increase in
membrane fluidity). Sperm incubation under capacitating conditions
increased 6±TyrP in a subset of proteins and made sperm sensitive to
LPC (AR= 28 2, p±vs 9

16 t h International Congress on Animal Reproduction
116 Poster Abstracts
spermatozoa (r2>0.9) regardless of the extender used. In all extender
the frequency of motile spermatozoa significantly decreased with the
preservation period (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 117
embryos cultured without PES (control, 100%; TI=1.0). In
conclusion, our results showed a significant decrease of lipid content
in lipid droplets of porcine embryos after in vitro culture in PEScontaining
medium. The findings also suggest that PES reduced
accumulation of lipids in cultured pig embryos.
P270
The using of the DSI telemetry implants in the
reproductive tract EMG recording in the sows in relation
to LH, P4,E2
Gajewski, Z 1 *, Pawliński, B 1 , Ziecik, AJ 2 , Zabielski, R 3
1Animal Reproduction, Warsaw University of Life Sciences, Faculty of
Veterinary Medicine, Poland; 2 Institute of Animal Reprod. and Food Res.,
Poland; 3 Physiology, Warsaw University of Life Sciences, Faculty of
Veterinary Medicine, Poland
Introduction The method of radiotelemetry system allows
transformation of biological signals from animal body into the radio
waves. Knowledge on oviduct electrical and motor activity is limited
though crucial for understanding the physiology and pathophysiology
of the reproductive system. The objective of the present studies was to
adapt implantable telemetry technique for uterus and oviducts EMG
studies and examine relationship between LH, E2, P4 level and EMG
activity of oviduct and uterine horn in sows with induced estrus
(PMSG/HCG).
Materials and Methods For examinations we used commercial
implants (DSI, USA) and silver bipolar electrodes. 11 nonpregnant
sows were surgically fitted with TL10M3-D70-EEE (DSI, USA)
implants positioned between the abdominal muscles, and 3 silicone
electrodes sutured on the left or right oviduct (bulb and mid part) and
the corresponding uterus horn. Three signal channels was filtered
(high cut-off 50 Hz, low-cut 10 Hz) and amplified (BioAmp,
ADInstruments, Australia). A four-channel PowerLab/4e unit and PC
computer with Chart v.4.1 (ADInstruments) software were used to
record, display and analyze the data. Blood samples were taken from
the jugular vein, stored at -20oC, until LH, P4 and E2 RIA analyses.
Results Registration was performed on the end of follicular phase of
estrous cycle i.e. before beginning of LH surge. A rise of progesterone
secretion (1-4 ng/ml) was found 36-40 hrs after preovulatory LH
surge. The E2 decrease after the LH surge from 150-180 pg/ml to 75-
85 pg/ml. Mean burst duration of ampulla contractions was 30.5 ± 2.4
s and the total duration of electrical activity tested 736.4 s. The same
parameters recorded from the uterine horn were 27.0±0.9 and 520.0 s,
respectively during 30 min of observation. The frequency of burst was
27 in the ampulla of oviduct and 21 in the uterine horn for 30 min
period of recording. The mean amplitude (mV) of spikes inside burst
was significantly higher in uterine horn than in ampulla of oviduct
(0.86±0.04 vs 0.32±0.01, respectively; p

16 t h International Congress on Animal Reproduction
118 Poster Abstracts
P273
Modifications of prostaglandin synthesis enzymes gene
expression in the porcine oviduct after intrauterine
infusion of seminal plasma
Kaczmarek, MM*; Krawczynski, K; Kiewisz, J; Ziecik, AJ
Department of Hormonal Action Mechanisms, Division of Reproductive
Endocrinology and Pathophysiology, Institute of Animal Reproduction and
Food Research, Polish Academy of Sciences, Olsztyn, Poland
Introduction Recent studies have indicated that introduction of
semen/seminal plasma (SP) into the female reproductive tract
orchestrates striking molecular and cellular changes that facilitate
embryo development, conception and pregnancy. These changes were
also observed in the expression of enzymes of prostaglandin (PG)
synthesis pathway, however until now only seminal-induced
expression of PGHS-2 (prostaglandin-endoperoxide synthase 2)
mRNA in the porcine endometrium has been showed. Since the
oviduct plays a decisive role in reproduction providing a beneficial
environment for gamete maturation, fertilization and the early
embryonic development we have investigated whether intrauterine
infusion of SP can modulate PG synthesis in the porcine oviduct
through regulation of prostaglandin synthesis enzymes gene
expression.
Methods Fifty six synchronized crossbred gilts received 100 ml
intrauterine infusion of either SP or phosphate buffered saline (PBS;
control). Oviducts were collected 1, 3, 5 and 10 Day(s) after SP or
PBS-treatment. Expression of PGHS-2, PGF synthase (PGFS), PGE
synthase (mPGES-1), PG 9-ketoreductase (9-KR) and PGI synthase
(PGIS) mRNA in oviducts was assessed by the real time PCR.
Results Among tested enzymes only PGFS and 9-KR mRNA were
significantly lower (4.6- and 2.1-fold, respectively) in oviducts 24 h
after SP infusion into the uterine horns, when compared to PBStreated
animals (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 119
P276
Expression of integrins, transmembrane protein CD9,
leukocyte adhesion molecule CD18, and zonaglycoproteins
in porcine oocytes isolated from
multiparous sows and prepuberal gilts
Kempisty, B 1 *, Antosik, P 2 , Bukowska, D 2 , Jackowska, M 1 , Lianeri, M 1 ,
Jaśkowski, JM 2 , Jagodziński, PP 1
1Department of Biochemistry and Molecular Biology, University of Medical
Sciences, Poznań, Poland; 2 Department of Agricultural Veterinary, University
of Agriculture, Poznań, Poland
The developmental and meiotic competence of oocytes isolated from
age different female donors is well described. However, little is yet
known about the fertilization potential of these oocytes. Therefore, the
aim of this study was to determine the differences in the expression
pattern of sperm-oocyte interaction molecules in oocytes produced by
multiparous sows and prepuberal gilts.
Using reverse transcription (RT-PCR) and real-time quantitative PCR
(QR-PCR) analysis we compared the expression levels of integrins
(αL, αM, β1, β6), leukocyte adhesion molecule CD18, transmembrane
protein CD9, and porcine zona pellucida proteins pZPs (pZP1, pZP2,
pZP3 and pZP3α) in oocytes isolated from multiparous sows and
prepuberal gilts.
We found statistically significant increased expression of all integrins,
CD9, pZP2, and pZP3 mRNA in oocytes collected from prepuberal
gilts as compared to multiparous sows (P

16 t h International Congress on Animal Reproduction
120 Poster Abstracts
P279
The study on the temperature curve of boar straw frozen
semen
Hu, JH 1 , Li, QW 1,2 *, Jiang, ZL 1 , Yang, H 1 , Zhao, HW 2
1College of Animal Science and Technology, Northwest A & F University,
Yangling, Shaanxi 712100, P.R. China; 2 College of Environment and
Chemistry Engineering, YanShan University, Qinhuangdao, HeBei 066004,
P.R. China
The sperm-rich fraction was collected from 10 adult boars by the
gloved hand technique. Effects of seven kinds of extender on boar
sperm viability, acrosome integrity and membrane integrity were
studied in this experiment. The extenders were composed as follow
(for 100 ml sterile non-pyrogenic water): Ⅰ2.9g glucose, 1.0g
sodium-citrate, 0.2g sodium bicarbonate, 0.03g potassium chloride,
0.06g penicillin, 0.1g streptomycin and 20ml egg yolk. Ⅱ 5.0g
glucose, 0.3g sodium-citrate, 0.1g EDTA, 0.25g BSA, 0.06g
penicillin, 0.1g streptomycin and 20ml egg yolk. Ⅲ 1.1g glucose,
1.48g sodium-citrate, 2.42g Tris, 0.5g BSA, 0.06g penicillin, 0.1g
streptomycin and 25ml egg yolk. Ⅳ 1.5g glucose, 3.0g lactose, 0.8g
L-Glycin, 0.06g penicillin, 0.1g streptomycin and 24ml egg yolk. Ⅴ
4.0g glucose, 1.2g sucrose, 0.1g BSA, 0.06g penicillin, 0.1g
streptomycin and 24ml egg yolk. Ⅵ 5.1g glucose, 0.18g sodiumcitrate,
0.05g sodium bicarbonate, 0.16g EDTA, 0.06g penicillin, 0.1g
streptomycin and 20ml egg yolk. Ⅶ 1.48g sodium citrate, 2.42g Tris,
1.1g fructose, 0.06g penicillin, 0.1g streptomycin and 20ml egg yolk.
The results showed that the number Ⅲ extender was the best among
the seven extenders. After thawing, sperm viability, acrosome and
membrane integrity were 51.36%, 75.27% and 51.29% respectively,
all parameters were significantly higher than that of other extender
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 121
P282
Changes in oxytocin secretion during intrauterine
insemination and mating in sows
Norrby, M 1 *; Madsen, MT 2 ; Borg Alexandersen, C 3 ; Madej, A 1
1Department of Anatomy, Physiology and Biochemistry, Swedish University of
Agricultural Sciences, P.O Box 7011, SE-750 07 Uppsala, Sweden; 2 Danish
Pig Production, Axeltorv 3, DK-1609 Copenhagen, Denmark; 3 65 Rigtrupvej,
8370 Hadsten, Denmark
Mating stimuli are known to activate the release of oxytocin in the
peripheral blood in sows (Claus & Schams, 1990). It is also known
that both exogenous oxytocin and endogenously released oxytocin
stimulate uterine activity in oestrous sows (Langendijk et al., 2003).
Plasma levels of cortisol were increased in gilts following oxytocin
administration (Kotwica et al., 2002). In our previous study we have
demonstrated that prostaglandin F 2α metabolite (PGFM) dramatically
increase in intrauterine inseminated sows at the time when in mated
sows there was no production of PGFM and concentrations of cortisol
reached maximum (Norrby et al., 2007). The aim of the present work
was to monitor and compare the effects of intrauterine insemination
and mating on circulating concentrations of oxytocin. Two groups of
multiparous sows (Danish Landrace x Danish Large White) were
randomly formed and were served during their first oestrus after
weaning. Nine sows (IUI-group) were inseminated intrauterinally
with 80 ml of extended semen in EDTA using insemination catheter
“Deep goldenpig”. The other 8 sows (Boar-group) were mated by
Danish Duroc boars. The sows were checked for standing oestrus by
means of backpressure test and riding test. Before insemination sows
were stimulated after the 5-point stimulation principle and a boar was
activated in front of the sow. Blood samples were taken frequently
before, during and after service. The blood was collected in heparin
tubes containing Trasylol, immediately centrifuged and the plasma
was stored at –70°C until analyzed. The quantitative determination of
oxytocin in the collected plasma samples was performed by a
competitive immunoassay kit from The Assay Designs' Oxytocin
Enzyme Immunoassay (EIA) according to the manufacturer’s
recommendations with some modifications. Before oxytocin was
analysed, the plasma was extracted with acetone and petroleum
benzene. Repeated measurement analysis of variance was performed
using the MIXED procedure on the generated averages according to
the Statistical Analysis System program package. No significant
changes in the plasma concentration of oxytocin were seen before and
during stimulation of sows from IUI-group. After intrauterine
insemination commenced a significant decrease in oxytocin
concentrations was seen. In mated sows concentrations of oxytocin
significantly increased during premating behaviour and mounting. In
conclusion, human stimulation before intrauterine insemination does
not activate the release of oxytocin as it is seen in mated sows.
* Supported by Danish Pig Production.
P283
Effect of an essential omega-3 fatty acids premix on
boar’s semen characteristics and fertility parameters
Papaioannou, DS.*, Papatsiros, VG., Kyriakis, SC.
Hellenic Ministry of Rural Development and Food, Athens, Greece
Introduction Little attention has been paid to the possible beneficial
effects of diets enriched in n-3 polyunsaturated fatty acids (PUFA) in
domestic animal production. Research data underline the beneficial
effect of n-3 PUFA’s maternal dietary intake on the reproductive
performance of sows.
Objective The aim of the present study was to determine the effects
of a premix of essential omega-3 fatty acid on boar’s semen
characteristics and fertility parameters.
Materials and Methods Twelve semen donor healthy crossbred
boars of the same genetic background of a commercial farrow-tofinish
farm were paired by age and allocated to one of two diets (6
boars per diet). The six boars of the experimental group (EG) were fed
daily the experimental diet (2.5 kg/day), consisted of a typical
lactation diet supplemented with a premix of essential omega-3 fatty
acids at the rate of 2% («Optomega 50»). The six boars of control
group (CG) were fed 2.5 kg of lactation diet daily. The typical
analysis of premix was 50% oil, 4% protein, 3% fibre, 27% ash and
23.5 MJ /kg premix DE and its fatty acid profile was C18:2 4%,
C18:3 2%, C18:4 2%, C20:4 2%, C20:5 6-8%, C22:5 3%, C20:6 9-
11%. Ejaculates were collected at commencement, 6 weeks after and
12 weeks after the start of the experiment. The semen characteristics
(semen volume and density, sperm viability and motility, spermatozoa
with normal acrosome and abnormal morphologies) were evaluated. A
total of 105 multiparous sows (which exhibited weaning to oestrus
interval >5 days) were inseminated twice with semen from ejaculates
collected as mentioned above. A 2x3 factorial design was set
according to the experimental group of donors and the time of semen
collection. Return to oestrus rate, farrowing rate, pregnancy duration
and litter size at birth, were recorded.
Results Feeding essential omega-3 fatty acids for a period longer than
6 weeks increased the proportion of spermatozoa with progressive
motility and with a normal acrosome score and reduced the proportion
of spermatozoa with abnormal morphologies. The above findings are
in contrast with other studies, reporting no improvement in sperm
motility or acrosome integrity after fish oil supplementation.
Accordingly, there was no significant effect on performance
parameters of EG and CG inseminated sows, independently on the
time of semen collection, nor any group x time interaction was
recorded.
Conclusion The long-term dietary use of a premix of essential
omega-3 fatty acids in boars promotes their semen quality since it
results in a beneficial effect on semen motility and percentage of
normal spermatozoa.
P284
Effect of a PRRSV inactivated vaccine on health status
and semen characteristics of boars
Papatsiros, VG. 1 *, Alexopoulos, C. 1 , Boscos, C. 1 , Joisel, F. 2 , Kyriakis, SC. 3
1Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece,
2Merial SAS, Lyon, France, 3 Foundation of Biomedical Research of the
Academy of Athens, Greece
Introduction Porcine reproductive and respiratory syndrome (PRRS)
causes clinical signs in boars (anorexia, lethargy, fever, respiratory
problems, lack of libido) and adversely affects their semen
characteristics. During last decade, the control of PRRS is based on
the use of vaccines, but the published data regarding to PRRS virus
(PRRSV) vaccination of boars are limited. The majority of studies
which include trials with modified live vaccines (MLV), have
demonstrated that the use of MLV in boars is under discussion with
regard to safety.
Objective The aim of the present field study was the evaluation of the
effect of boar’s vaccination with a commercial European PRRSVinactivated
vaccine on their health status and the semen
characteristics.
Materials and Methods Seven healthy crossbred adult boars (1.1-2.2
years old) of the same genetic background were initially vaccinated
twice with PROGRESSIS ® (Merial SAS/France) 4 weeks apart. Each
vaccination was separated by at least 3 weeks from vaccinations
against other pathogens and all boars were boostered twice per year,
for a period of 18 months. The boars were monitored daily for side
effects until 15 days after each PRRSV vaccination. Ejaculates
collected 24 h prior, 24 h, and 15 days after each vaccination were
involved in the analysis. Semen characteristics (semen volume and
density, sperm viability and motility, spermatozoa with normal
acrosome and abnormal morphologies), were analyzed with regard to
time of semen collection / examination and booster vaccinations.
Results No systemic clinical signs and no local reaction on the area of
the injection were observed in all boars. Furthermore, they performed
normal appetite, behaviour and libido after each vaccination. No
changes in semen characteristics were noticed after each vaccination,
apart from an increase of sperm viability as vaccination repetitives
increased, which is more likely due to the increase of boars’ age than
the vaccination itself. Vaccinations resulted in a slight decrease of
semen characteristics 24 h after each injection, but their values
remained within normal levels and did not influence the semen
quality, because the sperm viability and motility remained above 70%,

16 t h International Congress on Animal Reproduction
122 Poster Abstracts
as in practice, ejaculates with viability/motility above 70% are
required to ensure semen of good quality.
Conclusion The results of the present study demonstrate the safety of
long-term vaccination of boars with PROGRESSIS ® . The above
conclusion has huge financial significance, as the production and use
of high quality semen is very important for the global swine industry.
P285
Ovariohysterectomy by means of endovideolaparoscopy
in Large White gilts
Parmigiani, E*; Bresciani, C; Di Ianni, F; Bigliardi, E; Morini, G; Vecchi, I; Di
Ciommo F; Bertaccini, G
Faculty of Veterinary Medicine, Parma University, Italy
To the Authors knowledge this technique has not been previously
reported. The aim of this study was to develop a laparoscopic
technique for ovariohysterectomy (OHE) in pig for reproductive
practical reasons and as a model for human and veterinary clinical
use. Five gilts 4 months old weighing 25-35 kg were considered. All
procedures were performed under general anaesthesia in dorsal
recumbency and a neuromuscular block was induced. Traction was
placed in order to lift the body wall about 4 cm away from the viscera,
a Veress insufflation needle was inserted over the umbilicus and
pneumoperitoneum was induced by CO 2 insufflation to a pressure of
15 mmHg. In the same place a 10 mm trocar was positioned and a 10
mm laparoscope (angle 0°) connected to a 3 CCD video camera with
light source was passed through (Karl Storz Endoscope ® equipment).
The patient was placed in Trendelenburg position. The laparoscope
was used to guide the entrance of 2 trocars away from viscera, one (10
mm) paramedian to the midline on the left and one on the right (5
mm), to provide two operating channels. A grasping forceps, passed
through the right cannula, was then used to lift the uterine horn and
visualized ovarian vasculature. Ovarian vascular pedicle with broad
uterine ligament was cauterized with a bipolar electrocautery (BEC)
and transected using a hook shaped monopolar electrocautery (MEC)
away from abdominal organs to prevent collateral thermal injuries.
The procedure was repeated for the same left structures. The uterine
body was grasped, coagulated and transected using BEC and MEC 1
cm proximal to the cervix. The “reproductive system” was then
withdrawn through the left cannula. The laparoscope and the cannulas
were also withdrawn and CO2 was allowed to escape. The stab
incisions were sutured with Vicryl ® EP 3.5. All the patients were
awake and standing in half an hour. There was no need to convert to
the open surgical approach in any case. The mean surgical time was
56±4 minutes. The BEC effectively sealed all vessels and tissues. No
postoperative complications were observed. Three trocars allowed all
procedures. This paper shows that laparoscopic OHE in the pig is
feasible, safe and advisable because does not require an enlarged skin
incision or extracorporeal ligation.
P286
Immunohistochemical studies on oestrogen receptor
alpha (ERα) and progesterone receptors (PR) in the sow
oviduct at oestrus and early pregnancy
Persson, EM 1 *, Srisuwatanasagul, K 2 , Srisuwatanasagul, S 2 , Dalin, AM 3
1Dept of Anatomy, Physiology and Biochemistry, Fac of Vet Med and Animal
Science, SLU, Sweden; 2 Dept of Anatomy, Fac of Vet Science,
Chulalongkorn Univ, Bangkok, Thailand; 3 Div of Reproduction, Dept of
Clinical Science, Fac of Vet Med and Animal Science, SLU, Sweden
Introduction: We have earlier shown in sows, a uterine presence of
oestrogen-alpha (ERα) and progesterone (PR) receptor proteins that
varied between oestrus and different stages of early pregnancy.
However, the presence of ERα and PR in the oviduct of these sows
was not investigated and is therefore the aim of the present study.
Methods: Eighteen sows were inseminated before ovulation (range 15
– 23 h) and slaughtered as follows: 5-6 h after insemination (group 1),
20-25 h (group 2) and about 70 h after ovulation (group 3), day 11
(day 1 = 1st day of standing, group 4) and day 19 (group 5). Prior to
slaughter, blood samples were collected for analyses of plasma
oestradiol-17β (E2) and progesterone (P4). Oviductal samples of three
different segments (isthmus, ampulla and infundibulum) were fixed,
embedded in paraffin and analysed by immunohistochemistry by use
of mouse monoclonal antibodies to ERα and PR. Semiquantitative
evaluation of staining intensity respectively proportion of positive
cells, was performed under the light microscope. Results: Hormone
levels and post-mortem observations: The highest level of E2 was
found at oestrus (groups 1) while the P4-levels were high at days 11
and 19 (groups 4 and 5). All sows slaughtered after ovulation were
pregnant (groups 2-5). Immunohistochemistry: Varying levels of
positive staining could be found in all tissue compartments (surface
epithelium, stroma and muscular layer). ERα: The most prominent
immunostaining was found in group 1 (at oestrus) in all tissue
compartments while both intensity and proportion of positive cells
was lower in the other groups, especially in the stroma and smooth
muscle at day 19 (group 5). PR: Apparent levels of positive staining
were found in all tissues and segments of groups 1-3 (oestrus, 20-25 h
and 70 h after ovulation) while a majority of the oviductal cells were
negative at d 11 and 19 (groups 4- 5). Conclusions: As for the uterus,
ERα- and PR-immunolabelling in the different segments and tissues
of the sow oviduct, showed highest levels at oestrus and lower at later
stages, especially low for PR at days 11 and 19, although not as early
as in the uterus (20-25 h after ovulation), indicating common
regulatory mechanisms related to the change from oestrogen to
progesterone dominance for both receptors, but not any apparent
influence by semen/insemination or pregnancy.
P287
Seasonal changes in reproductive function of Mangalica
boars
Rátky, J 1 *; Egerszegi, I 1 ; Nagy, Sz 1 ; Fébel, H 2 ; Tóth, P 3 ; Sarlós, P 1
1Department of Reproductive and Cell Biology and 2 Department of
Physiology, Research Institute for Animal Breeding and Nutrition, Hungary;
3Olmos and Tóth Ltd., Hungary
Introduction Seasonal effect could be observed in pig semen quality.
These seasonal changes can be monitored in the alteration of testes
volume too, which is related with hormone and semen production,
quantitative and qualitative parameters of the ejaculate. Parallel
investigation of these characteristics could give more profound result
about the degree of seasonality.
Objective Aim of the study was to determine seasonal changes in
testicular and endocrine function of Mangalica boars.
Methods Nine mature boars were involved in the experiment. Semen
was collected weekly for qualitative and quantitative analysis.
Volume of the testes was measured as described by Toelle and
Robison (J. Anim. Breed. Genet. 102 : 125-132, 1985) in each season.
At the same time GnRH treatment was performed to evaluate
testosterone productivity of the testes. Basic testosterone level and
hormone response to GnRH were determined by RIA. Data were
analysed by Statistica 6.0 Software (Friedman ANOVA + Wilcoxon
Matched Pairs Test, Spearman correlation).
Results Basic testosterone concentrations were distinct in seasons,
however significant difference was observed only between summer
and autumn samples (p=0.028). The highest median value was
measured in autumn (23.41 nmol/ml), and the lowest in summer (11.0
nmol/ml). The testosterone levels after GnRH injection were also
diverse with smaller deviations. Effect of seasonal changes was
recorded on the volume of the testes. The biggest value was registered
in autumn (758 cm 3 ), whilst the testes were smallest in winter (486
cm 3 ). Significant difference in volume was found between autumnwinter
(p=0.012) and autumn-spring (p=0.015) relation. The basic and
induced testosterone levels were significantly correlated with testes
volume in spring (r=0.75 and r=0.77; p

16 t h International Congress on Animal Reproduction
Poster Abstracts 123
Mangalica boars. However, further investigation is necessary to
confirm these results.
Founded by OMFB 0601-0602/2004.
P288
Cystic ovaries in Intermittently Suckled sows: follicle
growth and endocrine profiles
Soede, N
Department of Animal Sciences, Wageningen University, Netherlands
Studies have shown that 2-6% of culled sows have cystic ovaries (e.g.
Heinonen et al. (1998) Anim Reprod Sci 52: 235-244). Little is known
about the aetiology of cystic ovaries. Furthermore, most studies
examining hormone profiles of sows with cystic ovaries have used
ACTH to induce the cysts. The endocrine profile preceding and
during the formation of spontaneously developing cysts is not known.
In a number of experiments we attempted to induce lactation
ovulation by separating sows from their piglets for a number of hours
daily during established lactation (IS; Intermittent Suckling). In these
studies, sows repeatedly developed cystic ovaries. The aim of this
study is to describe the follicle development, hormone levels and
oestrus expression of these sows and of their normally ovulating
counterparts. Data came from 3 experiments in which IS-sows were
separated from their litters for 12h daily from day 14 of lactation
onwards. Control sows were fully lactating until weaning at day 21 of
lactation. The total number of IS sows included in the studies was 89,
of which 52 (58%) ovulated within 8 days after start of IS and 10
(11%) developed cystic ovaries. Of the 36 control sows, 34 (94%)
ovulated within 8 days after weaning and 2 (6%) developed cystic
ovaries. Differences were evaluated between cystic sows and their
normal ovulating counterparts, using SAS-GLM and taking into
account Experiment as a fixed effect. At days 1 to 4 after start of IS or
weaning, follicle diameter of sows that developed cystic ovaries was
similar to the follicle diameter of the sows that ovulated (P>0.10), but
follicle diameter was greater for sows developing cysts from day 5
onwards (P0.10), but in sows that developed cysts, E2 levels did
not return to basal levels within 48 h after peak E2. LH basal levels
were not significantly different, but the increase in LH after peak E2
was significantly lower in sows that developed cystic ovaries
(0.4±0.1ng/ml vs. 3.6±0.3ng/ml; P

16 t h International Congress on Animal Reproduction
124 Poster Abstracts
similar to or even below baseline values. The collected data suggest a
significant and so far not recognized influence of spermatozoa on the
regulation of the uterine immune responses after insemination.
P291
Effect of dietary supplementation with salmon oil on
cryopreservation of boar semen
Amorim, LS 1, Torres, CAA 2 *, Amorim, EAM 2 , Graham, J 2
1Department of Biomedical Sciences, Colorado State University, Fort Collins,
CO, United States; 2 Animal Science Department, Federal University of
Viçosa, Minas Gerais, Brazil
Cryopreservation of boar semen is not common, as the damage caused
to the cells is extensive. The fatty acid composition of boar
spermatozoa contain some docosapentaenoic acid (DPA) and
docosahexaenoic acid (DHA). The increase in the freezability of boar
spermatozoa by enhancing the DHA content of the plasma membranes
via changes in the lipid content of the feed is considered. The
objective was to find out whether DHA, given as salmon oil
supplementation, may have a beneficial effect on cryopreservation of
boar semen. Twenty-four boars Dalboard 85, 1–2 years old, were
distributed in a completely randomized factorial design (2×3) with
two oil sources (soybean and salmon) and three levels of antioxidant
(150, 300, and 450 mg of vitamin E/kg). The diets consisted of a basal
diet that was supplemented with 35g soybean or salmon oil (SO) per
kg diet. During a period of 10 weeks of feeding the diets, one
ejaculate from each boar was collected per week. An aliquot of the
sperm rich fraction was diluted 1:1 (v:v) in BTS and used for
assessment of fresh semen quality and sperm lipid analysis. Semen
was diluted with BTS at 30 o C and after kepted at 24 o C for 1 h, and
then, centrifuged with centrifugation diluent (CD) and rediluted with a
freezing extender (50 ml of 11% lactose in distilled water + 20 ml of
egg yolk, + 25 ml of CD, 1.5 ml Equex, 6 ml of 85% glycerol) to a
final concentration of 500x106 cells/ml and filled French straws (0.5
ml; Minitub, Brazil) and stored for 1 h at 5 oC. After, samples were
frozen 5 cm above liquid nitrogen. Thawing was in a noncirculating
water-bath 37 o C for 20s. For determining the fatty acid composition
of the spermatozoa, a sample of approximately 15 ml was taken from
each ejaculate shortly after collection and centrifuged for 20 min at
1000 x g. The remaining semen was frozen until analysed. Sperm
motility, morphology and lipid composition were assessed in fresh
and frozen–thawed samples. The DHA increased in the SO-group
from 23.3 to 46.7% and the DPA decreased from 11.5 to 5.2%
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 125
only to the ipsilateral ovary but are transported within the
mesometrium to both ovaries in a more systemic manner.
Poster 07 - Reproduction of Pet Carnivores
P294
IVF of in vitro matured dog oocytes using homologous
fresh or frozen-thawed spermatozoa
Alhaider, AK 1 *; Satake, N 1, 2 ; Watson, PF 1
1Veterinary Basic Sciences, Royal Veterinary College, UK; 2 Institute of
Zoology, Zoological Society of London, UK
Fertilization is the crucial test of both successful oocyte maturation
and sperm cryopreservation. The aims of this study were to
investigate the effect of sperm freezing and the influence of sperm
donor on the outcome of IVF of oocytes cultured under conditions
developed in our laboratory and to investigate the effect of Percollwash
frozen-thawed spermatozoa on IVF outcome. Cumulus oocyte
complexes (COCs) were collected from spay ovaries and cultured in
TCM 199 medium supplemented with 0.3 % BSA, 7 μg/ml
progesterone, 100 nM each of growth hormone, IGF-I, FGF and TGFα
for 48 h at 39 °C in 5 % CO2 in air in a humidified incubator. COCs
were then co-incubated with 1 x 10 6 /ml capacitated-fresh or frozenthawed
spermatozoa from the same dog for 12 h. COCs were cultured
for further 48 h before being denuded and fixed. Oocytes were stained
with propidium iodide and then evaluated under a laser scanning
confocal microscope. Fertilization rate was significantly higher in
oocytes inseminated with fresh semen (55.8 vs 37.2 %, P = 0.001).
There were no significant differences between oocytes fertilized with
fresh and frozen-thawed semen in cleavage rate (26.7 vs 18.5 %
respectively) and polyspermic fertilization (41.9 vs 50.0 %
respectively). However, significantly more embryos at the 2-cell stage
were recorded when fresh spermatozoa were used for fertilization (P
< 0.01). Individual analysis of each dog ejaculate revealed differences
in their sperm fertilizing ability after freezing. Freeze-thawing
significantly decreased fertilization rate in Dogs 2 and 4 but had no
effect on spermatozoa from Dogs 1 and 3. When the same analysis
was employed for cleavage rate, freeze-thawing significantly
decreased the number of cleaved embryos derived from COCs
fertilized with semen from Dog 1 only (fresh: 33.3, frozen-thawed:
8.0 %, P = 0.025). Percoll-wash had no effect on fertilization and
cleavage rates. In conclusion, freezing-thawing significantly reduced
fertilization rate in vitro, but not cleavage rate. Sperm donors
influenced fertilization and cleavage rates in both fresh and frozenthawed
semen. Moreover, oocytes matured in vitro under the
conditions developed in our laboratory were found to be competent to
achieve fertilization and sustain early embryonic development up to
48 h of IVC.
P295
Centrifugation and dilution effects on sperm quality and
freezability from dog
Nicolas, M 1 , Mata-Campuzano, M 1 , Gomes-Alves, S 2 , Garcia-Macias, V 1 ,
Alvarez, M 1 , Tamayo, J 1 , De Paz, P 2 , Anel, L 1 *
1Animal Reproduction and Obstetrics, University of Leon, Spain; 2 Cell
Biology, University of Leon, Spain
Semen processing before cryopreservation in wild animals
(electroejaculated) involves centrifugation. Dog ejaculates could be an
appropriate animal model to study semen manipulation in endangered
wild carnivores, in our case cantabric brown bear (Ursus arctos). The
aim of this study was to assess the effects of semen dilution before
centrifugation at 4 different dilution rates in dog spermatozoa. Sperm
rich fractions of ejaculates from 8 healthy dogs (means concentration
505.72x106 spermatozoa/ml), collected by digital manipulation, were
divided into 5 aliquots. 4 were diluted (Tris, glucose, citric acid,
antibiotics) at: 1:1 (a), 1:4 (b), 1:8 (c) and 1:16 (d) dilution rates, and
the other was not diluted (control) (e). All the aliquots were
centrifuged at 600 g for 6 minutes (Centrifuge 2-15, Sigma), then
supernatant was immediately removed. Each pellet was suspended
using a freezing extender (centrifugation extender with 7% glycerol
and 20% egg yolk) to a final concentration of 100x106
spermatozoa/ml, cooled at -0.25ºC/min and equilibrated at 5ºC for 1
hour. Diluted semen was placed into 0.25 ml straws, sealed (Ultraseal
21, Minitub) and frozen from 5ºC to -100ºC (-20ºC/min) in a
programmable cell freezer (Kryo 10, Planer). Straws were plunged
into liquid nitrogen until analysis and thawed in a water bath (65ºC 6
s). Semen quality was assessed at 3 different stages: immediately after
the collection, postcentrifugation and after thawing. Motility (total
motility TM, %; progressive motility PM, %) was assessed with
computer assisted sperm analyzer (SCA, Microptic, Barcelona).
Viability (%) was assessed by flow citometry using SYBR-14 and
propidium iodide staining. Motility parameters decreased according to
the increase of the dilution rate. Total and progressive motility had
lower values in postcentrifugate (TM: a 72.92; b 74.04; c 71.33; d
61.72; e 72.19; PM: a 29.16; b 24.82; c 17.07; d 16.18; e 29.83) and
after thawing samples (TM: a 32.98; b 41.51; c 44.52; d 48.86; e
40.70; PM: a 17.71; b 22.41; c 25.53; d 22.53; e 21.79) than in fresh
semen (TM:86.77; MP:50.23). Thus, total motility was lower in
postcentrifugate 1:16 diluted samples than in fresh semen showing
statistical differences (p0.05).
In conclusion, cat semen extended and frozen with EY-TFC and EY-
SMGT extenders, have been successful in post thaw motility and
morphological defect rates. However, EED and aborts was thought to

16 t h International Congress on Animal Reproduction
126 Poster Abstracts
be due to intrauterine inseminations at two different points. In the
future studies, it is suggested that, non-surgical intrauterine
insemination techniques are needed to be tried in queens.
P297
Assessment of reproductive histology and sex steroid
receptor expression in the domestic cat (Felis catus)
following chronic exposure to phytoestrogens
Bell, K 1 *, Ugarte, CE 1 , Tucker, LA 2 , Roe, WD 3 , Thomas, DG 1
1Institute of Food Nutrition and Human Health, Massey University, New
Zealand; 2 Waiti Hill, New Zealand; 3 Institute of Veterinary Animal Biomedical
Sciences, Massey University, New Zealand
Phytoestrogens are secondary plant compounds, incorporated into
commercially prepared felid diets through the use of soy-derived
ingredients. The phytoestrogens genistein and daidzein, have been
shown to elicit changes in reproductive tract histology and sex steroid
receptor expression in a variety of mammalian species. These
phytoestrogens are considered to be potential aetiological agents in
the infertility suffered by a large percentage of the captive cheetah
(Acinonyx jubatus) population. To investigate this hypothetical role in
felid reproduction, domestic cats (n = 6; 4 female, 2 male) were
exposed to dietary genistein and daidzein (300µg/g DM total
isoflavones) from weaning (8 weeks of age) until approximately 15
months of age. A control group of related cats (n = 10, 8 female, 2
male) were reared under identical conditions and fed the same diet
without the addition of phytoestrogens. Reproductive tracts were
collected from all animals during routine gonadectomy and processed
for histological and immunohistochemical analysis (IHC). Tissues
were collected from female animals (mean age 485 days) during interoestrous
as assessed by vaginal cytology, and from male animals at
350 days of age. Reproductive tracts were assessed for
histopathological changes, and other parameters including uterine
luminal epithelial cell height and follicular development in females.
The expression and distribution of Estrogen Receptor (ER)-α, ERβ
and Progesterone Receptor (PR) was assessed in ovarian and uterine
tissue using IHC techniques. Wet weight of the reproductive tracts did
not differ between groups and all but one tract (treatment group) were
within normal expected range of inflammatory cell infiltration.
Luminal epithelial cell height was greater in treatment animals
(5.39µm vs. 4.36µm; p < 0.05) but no differences were detectable in
ovarian histology. Expression of ERα and ERβ was up-regulated in
the tracts of treatment animals, whilst PR expression was generally
down-regulated, compared to controls (p < 0.05). Tissue- and
receptor-specific variation was apparent. Although isoflavones were
not found to be uterotrophic, the observed histological changes were
suggestive of oestrogenic activity. Furthermore, the ability of
isoflavones to modulate the proportional expression of sex steroid
receptors may have implications for fertility and fecundity in later life.
Future investigations in domestic cats utilising larger sample sizes,
regimes including in utero and/or lactational exposure and controlled
fertility and fecundity testing are warranted.
P298
The effect of GnRH on fertility of alpacas inseminated
with frozen-thawed semen
Bravo, W 1 *, Ramos, A 2 , Alarcon, V 3 , Ordoñez, C 2
1Camelid Veterinary Services, United States; 2 Centro Experimental La Raya,
Universidad Nacional San Antonio Abad, Cusco, Peru; 3 Facultad de
Agronomia y Zootecnia, Universidad Nacional San Antonio Abad, Cusco,
Peru
between the three groups, with 72.6% of females ovulating. There
was no significant difference in pregnancy at 21 days between the two
dosages of GnRH, with 75%, and 76.2% of females being pregnant
for 0.1 μg and 1.0 μg GnRH, respectively; however, 65% of females
of the control group were pronounced pregnant, which is significantly
different than the females that received GnRH (P 0.05). Lower
ERα and PR scores (P < 0.05) and higher numbers of leukocytes (P <
0.05) were observed in the pyometra groups than the normal bitches.
Differences of the ERα and PR scores were not seen between the
open- and closed-cervix pyometra (P > 0.05) whereas higher number
of neutrophils was found in the open-cervix than closed-cervix
pyometra (P < 0.05).
Conclusions The ERα and PR expressions in the cervix of dogs are
influenced by stages of the oestrus cycle. Neutrophils infiltration in
the cervical tissue appears to involve in cervical dilatation in
pyometra bitches.
Gonadotropin releasing factor (GnRH) was used immediately after
artificial insemination with frozen-thawed semen in alpacas. GnRH
diluted in Tris buffer was deposited in the uterine horn ipsilateral to
the ovary containing an ovulatory-sized follicle. Ovulation was
induced with hCG (Chorulon, Intervet) 24 hours before artificial
insemination in 157 adult female alpacas that were divided into three
groups: 58 control, 43 with 0.1 μg GnRH, and 56 with 1 μg of GnRH
(Fertagyl, Intervet). There was no difference in ovulation percentage

16 t h International Congress on Animal Reproduction
Poster Abstracts 127
P300
Acrosin activity evaluation in chilled/rewarmed dog
sperm during different capacitation times
De Los Reyes, M*, Godoy, N; Palomino, J
Animal Production, Animal Reproduction Unit, Faculty of Veterinary Sciences,
University of Chile, Chile
Introduction The acrosome reaction causes release of acrosin, a
proteolytic enzyme that facilitates sperm penetration through the zona
pellucida. The release of acrosin on in vitro capacitated
chilled/rewarmed canine spermatozoa is a time depending process.
Thus, the aim of the present work was to study the proteolytic acrosin
activity in chilled/rewarmed canine spermatozoa during in vitro
capacitation and acrosome reaction.
Methods Six ejaculates were collected from four adult dogs. Each
ejaculate was liquated into 2 fractions and centrifuged in tris buffer
medium. The pellet of one fraction was diluted in fert-talp medium
(fresh control sample), and the pellet of the other fraction was diluted
in a tris-fructose-citric acid and egg-yolk extender and then cooled at
4º C for 24 h. Sperm samples (fresh and chilled/rewarmed) were
centrifuged and the pellet rediluted in fert-talp medium and then
aliquoted into four tubes which were incubated separately for 0, 1, 2
and 3 h at 20º. At each time of cultured, acrosin activity was measured
by the gelatin-substrate film technique, where enzyme activity is
detected by the presence of halos around single sperm resulting from a
localized proteolytic digestion of gelatin. Gelatin suspension was
placed on pre-cooled slides and fixed in 0.05% glutaraldeyde, washed
and kept overnight. Sperm suspensions were placed on the slices and
incubated at 38°C in CO2 for 24 h. Slices were stained with Comassie
Blue and examined with light microscopy for evidence of digestion.
Results Fresh and chilled dog spermatozoa incubated for up to 3 h in
fert-talp medium, displayed digestion halos on gelatin films. Those
digestion halos were of three different mean sizes: small, medium and
large. Acrosin activity as measured by halo diameter on slides coated
with gelatin, showed a significant difference between fresh and
chilled sperm. A low proportion of large halos was observed in fresh
samples at the beginning of culture (time 0 and 1), while chilled
sperm showed a high rate of large halos at these times. During the
following hours (2 and 3) of culture, fresh sperm showed higher rates
of large halos than fresh sperm.
Conclusion These results indicate that acrosomal proteolytic activity
of chilled/ warmed dog sperm is different throughout the time from
that of the control fresh sperm Supported by Grant FONDECYT
1060602.
P301
Terminating pregnancy in bitches: compartive study of
side effects between four treatments
Fila Varela, D 1 *, Berglavaz, A 2 , de Leon, J 3 , Navarro, G 3 , Morgades, D 2 ,
Pereira, O 3 , Elhordoy, D 1 , Cavestany, D 1
1Animal Reproduction Department, Veterinary Faculty, Uruguay; 2 Private
Practitioner, Don Quijote Veterinary, Uruguay; 3 Private Practitioner, Zoolymar
Vet, Uruguay
To compare incidence of side effects in four medical treatments to
terminate unwanted pregnancies. 166 bitches were assigned to
different treatments: Group A: (n=38) aglepristone (Alizine, Virbac,
France) (10 mg/kg), two s.c. injections, 24 hours apart, around 25 to
30 days of gestation; Group D: (n=44) dexamethasone orally (0,2
mg/kg two times per day, by 5 days and then 0,1 mg/kg two times per
day, during 5 more days) around 28 to 30 days of gestation; Group E:
(n=45) estradiol (0,01mg/kg) intramuscularly within 48 hours of
mated; and Group L: (n=39) lotrifen (Privaprol, FATRO, Italy) (2,5
mg/kg) intramuscularly within 15 days of mated. In group A, there
were no side effects. In group D, the side effects were mild polydipsia
and polyuria that disappeared when treatment was discontinued.
Moreover, 7 of 44 bitches (15,91%) presented bloody vaginal
discharge during 7 days after treatment ended, without general
symptoms. In group E, 12 of 45 bitches (26,67%) developed cystic
endometrial hyperplasia-pyometra that forced ovary-hysterectomy. In
group L, 18 of 39 bitches (46,15%) developed cystic endometrial
hyperplasia-pyometra that forced ovary-hysterectomy. Data were
analyzed using X2 test and differences within treatments were
considered significant when p 0.05). They occurred in 6/6, 3/3,
5/6 and 5/6, 2/3, 4/5 of the animals of the DA, DA&ACY and
DA&ACY+2 groups, respectively. Estrous response appeared 5.0 ±
1.2, 10 ± 1.0 and 24.2 ± 11.7 days after treatment in the same groups
(P = 0.1).
Conclusions The GnRH antagonist, acyline, administered at two
different time points after a GnRH agonist failed to prevent estrous
response in most of these anestrous bitches. Although, in the
antagonist treated groups, estrous response had a tendency to appear
later. These findings suggest a postponement of the stimulation period
during the peak antagonistic effect. Further studies with repeated or
higher doses of antagonists are necessary.
Acknowledgements This study was funded by the National Agency
for Scientific and Technological Promotion, Argentina (Grant PICT
38376/05). The authors thank to NICHHD, NIH, USA and Peptech,
Australia for drug provision.
References Wright PJ, et al. 2001. The Suppression by Progestin of
Oestrus Responses of the Bitch to the GnRH Analogue Deslorelin. J
Reprod Fertil. 57: 283-8.
P303
Distribution of active mitochondria in canine oocytes is
related to reproductive cycle stage but can be damaged
during IVM culture
Iorga, AI*; Valentini, L; De Santis, T; Ambruosi, B; Guaricci, AC; Caira, M;
Dell’Aquila, ME
Department of Animal Production, University of Bari, Italy
Introduction We investigated the effect of the reproductive cycle
stage on the distribution of active mitochondria in canine oocytes
examined 1) at collection and 2) after in vitro maturation (IVM).
Methods Cumulus-oocyte complexes (ooplasmic size >120 µm in
diameter) were recovered from 20 bitches divided into five groups

16 t h International Congress on Animal Reproduction
128 Poster Abstracts
based on their reproductive status: anestrous (A, n=4), follicular phase
(F, n=4), ovulation (O, n=2), early luteal phase (until 15 days after
ovulation, EL, n=7) and mid/late luteal phase (MLL, n=3). IVM
culture was performed in TCM199 with 10% estrous canine serum
(72h, 5% CO 2 ). Oocyte mitochondrial (mt) distribution pattern was
revealed after 30’ incubation in 280 nM MitoTracker Orange CMTM
Ros and confocal laser scanning microscopy. Data were analyzed by
Chi-square Test.
Results In oocytes examined at collection, three mt patterns were
found: I) small granules diffused throughout the cytoplasm; II)
diffused tubular networks; III) pericortical tubular networks.
Significantly higher rates of oocytes showing heterogeneous mt
patterns (II and III) were obtained from bitches in F (21/28, 75%) and
in O (23/24, 96%) compared with bitches in A (4/13, 31%; F vs A:
P

16 t h International Congress on Animal Reproduction
Poster Abstracts 129
Gonadectomy not only affects hormonal homeostasis but also alters
the turnover of different components of the extracellular matrix in
urogenital tissues. Collagen is an important component of the bladder
and urethral walls and thus crucial for the mechanical properties of
normal lower urinary tract (LUT) functions. Collagen synthesis
appears to be modified by the hormonal environment, specifically
oestrogen and gonadotrophin levels, and receptors for these hormones
are expressed in the LUT. Interestingly, the expression of these
receptors varies between intact and gonadectomised dogs. The
objective of the present study was to determine whether there is any
difference in proportions of collagen and muscle tissues in the LUT of
intact and gonadectomised male and female dogs.
Materials and Methods All the animals used in this study were
clinically healthy and included 10 intact dogs (5 males, 5 females) and
10 gonadectomised dogs (4 males and 6 females). Four regions of
LUT including body and neck of the bladder as well as proximal and
distal urethra were collected. The proportion of collagen and muscle
were determined by staining the tissue sections with Masson’s
trichrome, which highlights collagen as blue and muscle as red.
Colour image analysis was performed on digitized computer data
using the Leica Q Win Version 3 Quips Programming Software. The
proportion of blue and red staining within each image was calculated
to determine relative proportions of collagen and muscle in each
sample. Data were statistically analyzed using Mixed Model
ANOVA.
Results The proportion of collagen and muscle tissue differed with
the reproductive status (intact and gonadectomised) and gender.
Gonadectomised dogs had a higher (P

16 t h International Congress on Animal Reproduction
130 Poster Abstracts
integrity (PMI) (propidium iodide and carboxyfluorescein diacetate)
and sperm concentration. Samples were divided into three equal
aliquots, which were first diluted with TOG and, afterwards, with
TOG supplement with 10% of glycerol in proportions that permitted
final concentrations of 3, 5 or 7% of glycerol. Sperm samples from
the same ejaculate contained equal final volume (100 or 150 µL) and
sperm concentration (40 to 60 x 10 6 / mL). After load into 0.25 mL
straws, samples were placed in a programmed refrigerator at 5 o C for
60 minutes, then in liquid nitrogen vapour during 15 minutes and
immersed. Sperm samples were thawed at 46 o C for 12 seconds and
analyzed immediately (CASA and IMP), 30 (CASA) and 60 (CASA)
minutes post-thawing. Data were submitted to statistical analysis by
ANOVA and Tukey test, with p < 0.05 taken as significant. Among
all post-thaw moments, VAP (average path velocity), VSL (straight
line velocity), BCF (beat cross frequency) and STR (straightness)
were not different between 3, 5 and 7% of glycerol groups. Higher
values for TM (total motility), PM (progressive motility), R
(percentage of rapid spermatozoa) and PMI (plasma membrane
integrity) were obtained in all evaluated moments after thawing for
groups 5 and 7% of glycerol, with no statistical difference between
them. Values for ALH (amplitude of lateral head displacement)
increased after thawing only in group 3% of glycerol. Group 7% of
glycerol exhibited lower VCL (curvilinear velocity) values compared
to groups 3 and 5%. Since frozen-thawed sperm samples containing 5
or 7% of glycerol showed better results compared to 3% of glycerol
and considering that glycerol is known to be toxic for spermatozoa,
we can conclude that a concentration of 5% of glycerol is suitable for
freezing domestic cat spermatozoa.
P310
Preliminary studies on isolation and culture of the
epithelial, stromal and endothelial cells from the uterus of
domestic cat-technical report
Siemieniuch, M., Skarzynski, DJ.*
Institute of Animal Reproduction and Food Research, Olsztyn, Poland
The most of the previous experiments concerning feline female
reproductive regulations, were based on the hormones plasma levels,
morphological examination of ovaries and CL during laparoscopy and
behavioral changes in the animals. The local, immuno-endocrine
events within the feline ovary and/or uterus, and such interaction
between different cells of the endometrium have been largely ignored.
Thus, we decided to establish methodology for the isolation and
culture of different types of endometrial cells (epithelial, stromal and
endothelial cells) from uteri of domestic cat. The main goal of the
study is to establish the model for further examinations of local,
immuno-endocrine regulations in cat uterus and mechanisms of early
embryo development.
Uteri of queen were obtained by ovariohysterctomy. A polyvinyl
catheter was inserted into the uteri horn, and the end of the horn near
the corpus uteri was tied shut in order to retain an enzyme solution for
solubilizing the epithelial cells. 1-2 ml of enzyme solution (sterile
HBSS containing (dispase I, collagenase I, DN-ase IV and 0.1% BSA)
was then infused into the uterine lumen through the catheter.
Epithelial cells were isolated by incubation twice at 37,5˚C for 45 min
and 20 min with gentle shaking. The cell suspension obtained from
the first and second digestions was pooled and washed 3 times by
centrifugation in the gradient and finally resuspended in culture
medium (DMEM/Ham's F-12; supplemented with 10% calf serum).
After isolation of epithelial cells, the horns were longitudinally slit
and the surface was scratched. The rest of endometrial tissue were
digested in 10-20 ml of the above-described enzyme solution. After
20, 40 and 60 minutes stirring, dissociated cells were collected. For
isolation of endothelial cells, horns from intact uterus were cut and
minced into small pieces (1 mm 3 ). The mix cells were isolated as
described for stromal cells isolation. The pure population of
endothelial cells was isolated using Dynabeads® M-450 magnetic
beads coated by the lectin BS-1.
The cells of each cell type were separately seeded at a density of 1 x
10 5 viable cells/ml in 24-well plates. The culture medium was
changed every 2 days until confluency was reached. When the cells
were confluent the homogenity of cells was estimated using
immunofluorescent staining for specific markers of epithelial
(cytokeratin), stromal (vimentin) or endothelia cells (von Willebrand
VIII factor). The test revealed 95%, 90% and 95 % of purity of the
epithelial, stromal and endothelail cells in the culture, respectively.
P311
Retroflexion of the urinary bladder in a rottweiler bitch
during pregnancy
Sontas, BH*; Apaydin, SO; Toydemir, TSF; Kasikci, G; Ekici, H
Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine,
Istanbul University, Turkey
Clinical case A 2.5-year-old, pregnant rottweiler bitch, weighing 29
kg, was presented with a 24-hour’ history of a large mass of tissue
visible through the vulvar cleft and difficulty in parturition.
Accompanying complaints were loss of appetite and increased licking
of the mass. No previous trauma was reported, but the bitch had been
continuously barking through the night because of a snake in the
garden. The bitch had mated several times with a mixed-breed dog of
the same size two months before presentation and one year before the
bitch had whelped five live puppies without requiring any veterinary
assistance.
On clinical examination a large, firm, non-painful round ball-shaped
mass of tissue, approximately 10 cm in diameter, was identified
blocking the entrance of the vulva. The tissue was clean with no
haemorrhage or ulceration. Abdominal ultrasonography demonstrated
several fetuses without heart beats and the absence of the urinary
bladder in its anatomical position in the abdominal cavity.
Ultrasonography of the mass revealed anechoic appearance with no
fetal vesicles inside. Vaginal cytology showed the presence of
neutrophils and parabasal cells, typical of a bitch in the luteal phase.
Haematology, serum biochemical analysis and radiographic
evaluation of the mass or the caudal abdomen were not performed
because of the cost. Diagnosis of pregnancy, fetal death and
retroflexion of the urinary bladder confined to the vagina were made
according to the clinical and ultrasonographic findings. Removal of
the gravid uterus by ovariohysterectomy was performed and the
bladder was manually repositioned. The bitch recovered well and was
sent home after the surgical procedure. One week later, the bitch was
healthy with no complaints of dysuria, stranguria or urinary
incontinence. Two months after the surgery, the owner reported that
the bitch was clinically normal with no recurrence of the retroflexion.
To our knowledge, this is the first case of a vaginal mass occurring
after the retroflexion of the urinary bladder in a pregnant bitch.
Discussion A mass of tissue that is visible from the vulva is the most
common sign of vaginal hyperplasia, neoplasia or prolapse
(Manothaiudom and Johnston 1991). However, in the present case,
the mass was associated with the urinary bladder which was
retroflexed into the space between the vagina and pelvic wall because
of a perineal hernia. Perineal hernias occur most commonly in the
male when degenerative changes develop in the muscles of the pelvic
diaphragm as a result of hormonal influences or pelvic fractures
(Hayes et al. 1978, White and Herrtage 1986, Risselada et al. 2003,
Angeli et al. 2005).
References 1) Angeli G, Bellezza E, Arcelli R, Padua S. XII
Congresso Nazionale Società Italiana di Chirurgia Veterinaria, Pisa,
Italy, june 16-18, 2005.
www.vet.unipi.it/clınıca/2005sicv/lavoridef/angeli.pdf. accessed in 02
july, 2007. 2) Hayes H M, Wilson GP, Tarone RE J Am Anim Hosp
Assoc 1978, 14: 703-707. 3) Manothaiudom K and Johnston SD. Vet
Clin North Am, Small Anim Pract 1991, 21(3): 509-521. 4) Risselada
M, Kramer M, Van de Velde B, Polis I, Görtz K. J Small Anim Pract
2003, 44: 508-510. 5) White RAS, Herrtage ME. J Small Anim Pract
1986, 27: 735-746.

16 t h International Congress on Animal Reproduction
Poster Abstracts 131
P312
Estrus induction in bitches by using HUMAN
MENOPAUSAL GONADOTROPIN & HUMAN CHORIONIC
GONADOTROPIN combination
Zahedi Abdi, A
No 25,Neshat Ave,Bargh St,Urumieh,West Azarbayjan,Iran-Post
Code:5715694884 tel:0098-441-3441977 Fax:0098-21-22707955
In this trial,5 leash of bitches were chosen for inducing of estrus by
using the combination of Human Menopausal Gonadotropin (H.M.G)
& Human Chorionic Gonadotropin(h.C.G).Such bitches were
controlled for nutrition and estrus signs in their new home(place)
since 2 months before the beginning of trial. To start the
trial,H.M.G(H.M.G,75 IU FSH,75 IU LH approx N.V Organon oss
Holland)was injected to all of the bitches (5 leash of dogs)during the
first 9 days and by the day of 10 th ,H.C.G(intervet Holland)was
injected I.M to each bitch. Since 1 month before the beginning of
treatment and also during the period of treatment and 1 month after
the end of treatment, blood progesterone concentration was detected
in such bitches and vaginal smears was obtained to recognize the
changes in vaginal cytology. The results showed that,all of the bitches
show the signs of proestrus and serosangunis discharge from their
vulva,8±0.7 days after the beginning of treatment.These signs were
continued upto 9.8±1.6 days.In 2 leash of such bitches breeding was
seen 2 days after the end of vaginal bleeding and in other 3 bitches the
signs of estrus was appeared in the state of split heat.In 2 leash of
bitches,that have matted ,the progesterone concentration increased by
the beginning of estrus and rised above a critical plateau(>1ng/ml)and
reached upto >20 ng/ml, one month later .But in 3 other bitches the
progestrone concentration didn't rise above the 1.5 ng/ml A cytology
of vagina was interpretated as superficial intermediate cells after the
end of treatment. These results show that the combination of H.M.G
& H.C.G can facilitate induction of proestrus in the bitches which
have no previous history of parturition.
Key words : HMG , HCG , dog, , estrus , proestrus
Poster 08 - Reproduction of Zoo and Wild Mammals
P313
Sperm sex sorting in Asian elephant
Behr, B 1 *, Rath, D 2 , Hildebrandt, TB 1 , Blottner, S 3 , Goeritz, F 1 , Sieg, B 2 ,
Knieriem, A 4 , Hermes, R 1
1Reproduction Management, Leibniz Institute for Zoo and Wildlife Research,
Germany; 2 Institute for Animal Breeding Mariensee, Federal Agricultural
Research Centre, Germany; 3 Reproduction Biology, Leibniz Institute for Zoo
and Wildlife Research, Germany; 4 Zoo Hannover, Germany
Introduction The captive population of the Asian elephant (Elephas
maximus) suffers from an insufficient reproductive rate to maintain a
self sustaining population. This negative trend leads to an increasing
demand for assisted reproduction tools with the artificial insemination
as new and promising supplement. As mainly females are affected
from premature aging processes and husbandry of several elephant
bulls involves challenging management situations, there is a strong
need for female elephant offspring in captivity. Application of flow
cytometric sex sorted spermatozoa in artificial insemination offers the
possibility to predetermine the sex of offspring.
Objectives The aims of this study were to determine a suitable semen
extender and basic parameters for flow cytometric sex sorting of
spermatozoa in the Asian elephant.
Methods 18 sperm samples were collected by manual transrectal
stimulation from one bull. Sperm quality parameters and sex
sortability of spermatozoa were evaluated after dilution in three semen
extenders and DNA labelling. Following sex sorting process, samples
were stored at 4oC for 12h, imitating the long transportation time to
the female designated for insemination.
Results Only skim milk containing semen extender was determined as
suitable semen extender for sex sorting spermatozoa from Asian
elephant, providing repeatable, high resolution between X and Y
chromosome bearing sperm populations compared to other extenders.
12 of 18 collected ejaculates could be sex sorted successfully at an
average sort rate of 1945.5 ± 187.5 spermatozoa/ sec resulting in a
population purity of 94.5 ± 0.7%. Best sortability of spermatozoa was
reached after DNA staining for 1.5 - 2h at 37°C. Sperm integrity,
progressive and total motility was ≥ 65% after collection, 42.6 ±
3.9%, 48.1 ± 3.3%, 59.4 ± 3.8% after DNA labelling, and 64.8 ±
3.2%, 57.9 ± 5.0%, 70.8 ± 4.4% after sorting process, respectively.
After liquid storage of sorted spermatozoa for 12 hours at 4°C, sperm
integrity, progressive and total motility was 46.4 ± 5.2%, 33.6 ± 4.9%
and 64.8 ± 2.4%, respectively.
Discussion This study describes flow cytometric sex sorting of Asian
elephant spermatozoa. Quality and purity of sex sorted spermatozoa
and a reasonable ability for liquid storage after sorting process
provide a promising base for the application of sex sorted
spermatozoa in artificial insemination of the Asian elephant.
P314
A comparison of three culture media for the incubation of
thawed red deer (Cervus elaphus hispanicus) epididymal
spermatozoa
Domínguez-Rebolledo, AE*, del Olmo, E; Martínez-Pastor, F; Fernandez-
Santos, MR, Espinosa, M; Esteso, MC; Soler, AJ and Garde, JJ
National Wildlife Research Institute (IREC) (UCLM-CSIC-JCCM) and Institute
of Regional Development (IDR), University of Castilla-La Mancha, Spain
The suitability of incubation media is of capital importance when
conducting IVF or other artificial reproduction techniques (ART) in
vitro. In this study we tested the effect of three different culture media
on frozen/thawed epididymal spermatozoa from red deer (Cervus
elaphus hispanicus). Epididymal spermatozoa are available from
hunted males, and use of ART on this species is increasing, thus it is
important to assess existing techniques for this kind of samples.
Frozen epidididymal samples from nine males were thawed, and
diluted to 10 7 mL -1 in three common media for IVF and embryo
culture (SOF, TALP, BGM) and control (freezing extender without
glycerol: Tris-citrate-fructose, 20% egg yolk) at 37 ºC 5% CO 2 and
analyzed at 0, 3, 6 and 9 h. Sperm motility index (SMI) and normal
acrosome ridges (NAR) were assessed subjectively (phase contrast
microscopy); sperm viability according to YO-PRO-1 staining
(necrotic and apoptotic sperm detection: VIAB), and mitochondrial
status by Mitotracker deep red (spermatozoa with active mitochondria
within VIAB: MT) were assessed by flow cytometry. The effects of
storage time and incubation media were analyzed by linear mixedeffects
models. All parameters decreased with incubation time
(P

16 t h International Congress on Animal Reproduction
132 Poster Abstracts
P315
Supression of ovarian cyclic function and estrous
behaviour in captive African lionesses (Panthera leo)
induced by the use of subcutaneous implants of the
GnRH agonist, deslorelin
Guimaraes, MABV 1 *, Pizzutto, CS 1 , Braga, DPAF 2 , Correa, SHR 3 , Oliveira,
CA 1 , Trigg, TE 4
1Animal Reproduction, University of Sao Paulo, Brazil; 2 Fertility Dept,
Assisted Fertilization Center, Brazil,; 3 Veterinary Division, Sao Paulo Zoo,
Brazil; 4 Managing Director, Peptech Animal Health Limited, Australia
Captive maintenance of large carnivores can produce overpopulation,
especially with highly prolific species such African lions.This
condition tends to promote the inbreeding of captive individuals
leading to a reduction of the genetic diversity. The increasing of the
captive population also brings the problem of space availability and
the consequent increase of fights between captive animals.The aim of
this work was to achieve suppression of the ovarian cyclic function
and the estrous behaviour in captive African lionesses (Panthera leo)
using subcutaneous implants of the GnRH agonist deslorelin. Four
captive adult lionesses, with successful breeding history, were treated
with subcutaneous implants containing 9.4mg deslorelin acetate
(Suprelorin 12®, Peptech Animal Health Pty Limited, Australia).
They were followed using serial collection, extraction and dosage of
fecal metabolites of estradiol and progesterone during 36 months. The
occurrence of estrous behaviour along the same period of time was
recorded, as well. During the whole period of the study, an adult
vasectomised male African lion was kept within the group in order to
detect heat. It was demonstrated that the effect of suppression of
ovarian cyclicity and estrous behaviour were achieved in all lionesses
and it lasted for 22 and 31 months for two of the animals and more
than 36 months for the remaining two. During the time of this study it
was observed marked reduction of aggression and improvement of the
general body condition. These results strongly suggest that the
deslorelin implants can be used for reversible contraception and
reduction of aggression in captive lionesses.
P316
Effect of a natural diet on the health and reproductive
success of captive giant pandas (Ailuropoda
melanolueca)
Hou, R*
Research Center, Chengdu Research Base of Giant Panda Breeding, China
The natural diet of giant pandas consists nearly entirely of bamboo. In
the 52 years of maintaining giant pandas in captivity in China,
however, the diet of these animals has contained a significant amount
of concentrated food items such as bovine milk, eggs, beef, corn, rice
and wheat. On this diet, captive giant pandas suffer from chronic
diarrhea and frequent bouts of intestinal pain and mucous faeces. In
September 2005, the Chengdu Research Base of Giant Panda
Breeding (Chengdu Panda Base) changed the diet of all its adult and
subadult giant pandas from the traditional captive diet to one
comprised almost entirely of bamboo and bamboo shoots. In the two
years since this nutritional adjustment, the health and reproductive
success of the pandas at the Chengdu Panda Base has improved
dramatically. The animals no longer have diarrhea, the occurrence of
mucous faeces is rare, faecal quality and quantity have improved, the
duration of post-weaning diarrhea in cubs has decreased significantly,
with no new cases of chronic diarrhea, and the body weights of adult
pandas have increased. Preliminary data comparing male reproductive
function on the traditional diet with that on the bamboo diet suggests
that testicular volume increased from 337.6 cm3 to 446.3 cm3 and
abnormal sperm decreased from 54.6% to 28.7%. The number of live
births has also improved greatly. In the seven years from 1999 to
2005, live births averaged 63.3% per breeding female (19/30). In 2006
and 2007, these figures increased to 92.9% (13/14). In conclusion, a
natural diet that allows ad libitum consumption of bamboo and
bamboo shoots and minimal supplementation with concentrates is
important to the health and reproductive success of captive giant
pandas.
P317
Successful production of Koala pouch young following AI
using electroejaculated and extended-chilled semen
Johnston, SD 1 *; Allen, C 1 ; Burridge, M 2 ; Mulhall, S 3 ; Holt, W 4 ; Carrick, F 1 ;
Lundie-Jenkins, G 5 ; Curlewis, J 1
1The University of Queensland, Australia; 2 Dreamworld, Australia; 3 Currumbin
Wildlife Sanctuary, Australia; 4 Institute of Zoology, England; 5 Environmental
Protection Agency (Queensland), Australia
Artificial insemination in the koala using chilled electroejaculated
semen provides for a marked improvement in the reproductive and
genetic management of captive colonies of koalas in Australia and
overseas, as well as making available the option of using semen
collected from wild populations to expand restricted gene pools.
Dilution of koala semen for artificial insemination is complicated by
this species being an induced ovulator and it is thought that ovulationinducing
factors are present in the semen, so that semen extension for
preservation purposes might be anticipated to result in a failure to
induce ovulation. This study was designed to determine whether
artificial insemination using undiluted, extended and extended-chilled
semen collected by electroejaculation was capable of inducing a luteal
phase and/or the production of pouch young. In Experiment 1, 1 mL
of undiluted electroejaculated semen, 2 mL of 1:1 diluted semen and 1
mL of 1:1 diluted semen resulted in 7/9, 6/9 and 6/9 koalas showing a
luteal phase respectively; in each treatment 4 pouch young were
produced. A second artificial insemination experiment was conducted
in which 2 mL of diluted (1:1) semen was deposited in 3 groups of 9
koalas. The first group received semen that had been collected and
diluted immediately without chilling, the second group received
semen stored chilled for 24 h, while the final group was inseminated
with extended ejaculates that had been chilled for 72 h. In the first
group, 5 females had a luteal phase but none gave birth. In the second
group, 2 of the 5 females that had a luteal phase gave birth, while in
the third group, 4 of the 6 females that had a luteal phase produced
pouch young. These experiments have shown that it is possible to use
undiluted, extended or extended-chilled semen to produce koala
offspring at conception rates similar to those achieved following
natural mating. These findings represent a significant advance in the
use of reproductive technology in marsupials and provide the basis for
the shipment of koala semen over long distances. The pouch young
produced in this study represent the first marsupials born following
artificial insemination using extended-chilled semen and bring the
total number of koalas produced by artificial insemination to 31.
P318
Hierarchical structure effect over reproductive function in
captive collared peccaries (Tayassu tajacu)
Mayor, P 1 , Couron, E 2 , Jori, F 3 , Manteca, FX 4 , Lopez-Bejar, M 1 *
1Animal Health and Anatomy, Universitat Autonoma de Barcelona,
Spain; 2 Station Expérimentale de Soucoumou,, Chambre d’Agriculture de
Guyane, French Guiana; 3 Tropical Veterinary Medicine and Production,
CIRAD, France; 4 Animal and Food Science, Universitat Autonoma de
Barcelona, Spain
Introduction The social organization may influence physiological
functions, especially the reproductive one. Thus, the study of the
effect of hierarchical structure of the herd on reproductive function is
essential to improve the efficacy of animal captive breeding systems.
A great variation in the reproductive performance of different captive
collared peccary females, and the presence in general of two kinds of
females has been reported: females with a good reproductive success
and continuous reproductive function, and females with no
reproductive event. The aim of this study was to determine the
relationship between the dominance index status and the estrous
cyclicity of collared peccary females maintained in captivity.
Material and methods Twelve collared peccary females were kept in
captivity on an experimental farm of Chambre d’Agriculture de
Guyane at Soucoumou, Kourou (French Guyana). Four experimental
groups, composed by 3 females and 1 male, were established in
paddocks with an area of 6.09 m2, which resulted in an average
occupied space of 1.52 m2 per animal. During an experimental period

16 t h International Congress on Animal Reproduction
Poster Abstracts 133
of 90 days, both behavioral and reproductive data were
simultaneously collected. Agonistic encounters were recorded and a
social dominance index was assigned to each female per group.
Sexual cyclicity of females was determined through the study of fecal
progesterone and vaginal cytology features every 3 days. Weight and
age of all females were also recorded.
Results and discussion Cycling females presented heavier body
weight than non-cycling females and showed an average estrous cycle
length of 28.63 ± 3.55 days (range: 22 to 33 days). Dominant females
were more likely to show regular cyclicity, compared with
subordinate females. All experimental groups presented at least a
cycling, and a non-cycling female. All dominant females were
cycling, and all but one subordinate female were non-cycling. This
study suggests that there exist a strong hierarchical structure in groups
of collared peccary females that largely affects their reproductive
function. In captive breeding systems, stress is an important cause of
impaired reproductive and maternal performance, throughout
mechanisms acting on the hypothalamic, pituitary, ovarian and uterine
function. This study pretends to provide information useful to develop
new management strategies that minimize any detrimental behavioral
and physiological consequences of breeding collared peccaries in
groups. The dominance index could act as a limiting factor over the
reproductive functionality of the collared peccary.
P319
Genome resource bank in Moscow Zoo
Maksudov, G 1 *, Shishova, NV 2
1Scientific department, Moscow Zoo, Russian Federation, 2 Genom
Conservation Laboratory, Institution on Cell Biophysic, Russian Acad. Sci.
Introduction In Russia, where natural resources are used intensively,
creation of cryobanks is the chance to save many species from
extinction. Considering that rare species generally have low number
and collection of germ plasm in situ is questionable, zoos are the
important source of germ plasm for banking. A practical
implementation of this idea is often troublesome. Reproductive data
exist only for a few species. They differ from their domestic
counterparts, which makes the direct transfer of cryopreservation
techniques a real challenge. Moscow "Frozen zoo" program includes
three main directions: vital semen collection; post mortal testes;
investigation of rare species semen parameters.
Materials and methods Semen was collected by electroejaculation
(Pulsator-IV, Lane Mfg) with self made probes (mammals), or by
massage techniques (birds). The post-mortem testes were excised
from dead males and stored at 4°С. Then spermatozoa were recovered
from the cauda epididymis, accessed and frozen. Semen assessment
was both standard and with sperm analyzer (SFA-500 Biola Ltd).
Pellet and straw methods, different extenders were used for freezing.
Glycerol for mammals, DMSO and DMF for cranes spermatozoa
were used as cryoprotectants
Results List of cryopreserved specimens now includes: 47 samples
from six males of Siberian crane Grus leucogeranus; 3 samples from
two white-naped cranes Grus vipio; one semen sample of Japanese
crane G. japonensis and one from sandhill crane G. canadiensis. 8
samples from four Amur leopard males Panthera pardus orientalis;
one sample from Amur tiger Panthera tigris altaica; 3 samples from
three males of Spectacled bear Tremarctos ornatus, two
electroejaculated and one post mortal sample; postmortal sample from
one markhor Capra falconeri male 2 post mortal samples from two
males of white-tailed gnu Connochaetes gnou; post mortal sample
from one East Caucasian tur Capra cylindricornis; 2 samples from
European mink Mustela lutreola and 4 samples from American mink
M. vison. Also we store goat and donkey semen samples. Some
samples from different species were thawed and investigated.
Conclusions Genome resource bank is important tool to save genetic
material of rare species in zoos, but further applications of
cryopreservation techniques are urgently needed. We collaborate with
EEP, IZW, Oka Crane Center and supported RFBR, grant N. 06-04-
49268.
P320
Deslorelin affects reproduction and behaviour of female
western grey kangaroos (Macropus fuliginosus
ocydromus)
Mayberry, C
School of Animal Biology, University of Western Australia, Australia
The control of wild animal populations by shooting is becoming less
socially acceptable, creating a requirement for more imaginative
means of limiting population growth. A promising approach uses
depot formulations of Gonadotropin Releasing Hormone (GnRH)
agonists. We are investigating the use of Suprelorin®, a depot
formulation of the GnRH super-agonist deslorelin, to suppress
reproduction as part of an Australia-wide project, the Koala and
Kangaroo Contraception Program. Two types of GnRH are found in
most mammals. GnRH-I drives the production and release of
pituitary gonadotrophins. GnRH-II affects sexual, feeding and
possibly other, behaviours. In mice and musk shrew exogenous
GnRH-II causes females to eat less when feed is abundant and to
restore sexual behaviour that has been suppressed by feed restriction.
In November/December 2006 on a reserve in the southwest of
Western Australia, we treated 24 free-ranging female western grey
kangaroos with 4.7 (n = 8) or 9.4 (n = 7) mg of deslorelin, or a
placebo (n = 9). Eleven of the kangaroos were either already pregnant
or conceived to give birth between November 2006 and February
2007. None of the kangaroos treated with deslorelin conceived more
than 15 days after treatment. Four kangaroos, one each from the
placebo and 4.7 mg groups, and two from the 9.4 mg group,
disappeared or died from unrelated causes. We monitored the morning
attendance of the remaining kangaroos at a feeding station from
March to October 2007. All 12 deslorelin-treated kangaroos attended
regularly at the feeding station. Six of the 8 placebo kangaroos
attended at the feeding station only intermittently after July.
Attendance at the feeding station was independent of pouch young.
Eight of the 12 deslorelin-treated animals had no pouch young and
two more lost their pouch young by May. Three of the eight placebo
animals had no pouch young and another lost her pouch young by
May. The six kangaroos that had pouch young all year and the three
kangaroos that lost their pouch young between February and May
2007 did not use the feeding station regularly after July. Although
favourable weather conditions in 2007 resulted in abundant natural
feed supplies on this reserve and placebo treated kangaroos decreased
their use of the feeding station, the deslorelin-treated kangaroos
maintained their use of the station. These results suggest that long
acting formulations of deslorelin may affect feeding behaviour in
female western grey kangaroos.
P321
Development of regular individual faecal sample
collections from group housed African wild dogs (Lycaon
Pictus) in a European Zoo setting: evidence of oestrus
without male presence
Paris, M 1,2 *; Schwarzenberger, F 3 ; Thomas, R 4 ; Jabbour, H 1,5 ; Farstad, W 6 ,
Millar, R 1,5
1Institute for Breeding Rare and Endangered African Mammals (IBREAM),
Edinburgh, UK; 2 Dept. of Equine Sciences, Faculty of Veterinary Medicine,
University of Utrecht, The Netherlands; 3 Dept. of Natural Sciences –
Biochemistry, Vet. Med., Austria; 4 Royal Zoological Society of Scotland,
Edinburgh Zoo, Edinburgh, United Kingdom; 5 MRC Human Reproductive
Sciences Unit, United Kingdom; 6 Dept. of Reproduction and Forensic
Medicine, Norwegian School of Veterinary Science, Norway
The African wild dog (Lycaon Pictus) is a group-living carnivore, and
they hunt and reproduce in a cooperative manner. European Zoos
generally attempt to imitate the natural situation as closely as possible
by group housing and carcass feeding. This makes collection of
regular individual faecal sampling for endocrine monitoring a
challenge. This study describes the development of a reliable food
marking technique to enable frequent individually identifiable faecal
collections. Three UK based zoological institutions participated in this

16 t h International Congress on Animal Reproduction
134 Poster Abstracts
study with a total of 8 female African wild dogs. Faecal samples were
collected from August until November 2006 (attempted 3
times/week). In Edinburgh Zoo, 5 adult females were group housed
and no males were present. In Colchester Zoo, 2 females were group
housed with 4 males. In West Midland Safari Park, a further 3 females
participated in the study. Two of these females were housed together
adjacent to the main pack which consisted of both males and females.
The third female was hand-reared and housed with 2 males. Initially,
dye was added to the food but this did not result in consistent
colouring of faeces; hence this approach was abandoned. Alternative
approaches included: a) the addition of beads (1-3mm), b) addition of
sweet corn, and c) the addition of a teaspoon of coloured glitter to a
small amount of minced meat given daily. The addition of beads was
successful but labour intensive. Both sweet corn and glitter
successfully marked the faeces in a reliable and consistent manner.
Samples were stored at -20 C, and transported frozen to the
laboratory. The hormone analysis used a group specific EIA with
antibodies against 20-oxo-Pregnane (20-oxo-P), total estrogens,
testosterone, epi-androsterone, and cortisol. In Edinburgh Zoo (no
male present), the dominant and second dominant female showed
elevated faecal 20-oxo-P levels, indicating a pseudopregnant cycle.
No elevations of 20-oxo-P were seen in the other females. Sample
collection at Colchester Zoo has been unsuccessful, due to the
combination of a newly formed group with several dominance coups.
At West Midland Safari Park, individual samples were collected
successfully, and data show elevated 20-oxo-P levels in 2 out of 3
females (1 in both sample groups). This study shows that 1) faecal
marking can be achieved consistently, 2) obtaining regular samples is
challenging, and 3) signs of oestrus in females kept without the
presence of a male are observed, which has been unknown so far, and
will further the general physiological understanding of this species.
Acknowledgements: We would like to acknowledge the zoological
institutions and their staff for the enthusiasm and efforts. In addition,
we are grateful to Dr Mervyn Jacobson, and the RZSS for financial
support.
P322
Experimental investigations on the phenomenon of
superfetation in European brown hares (Lepus
europaeus)
Roellig, K*, Goeritz, F; Hermes, R; Hildebrandt, TB
Reproduction Management, Leibniz Institute for Zoo and Wildlife Research,
Germany
Introduction Superfetation (SF) is conception in an already pregnant
female. This is assumed to be a reproductive mechanism in European
brown hares (EBH). Its functional mechanisms are still not very clear
due to difficulties in studying pregnancy in live EBH.
Objective We aimed to reveal the phenomenon of SF using a new
experimental design in live EBH. It was tested when SF occurs, and if
semen is stored from a previous mating.
Methods The study was performed on captive EBH. Frequent
examinations were conducted on pregnant females using high
resolution ultrasound (10-22 MHz linear transducer; Diasus, Dynamic
Imaging Ltd, UK). The study consisted of five parts: (I) Detailed
ultrasonographic characterisation of pregnancy (embryonic
development, ovarian activity; pregnancy length): males only present
for mating, n=35 (II) Detection of shortened interbirth intervals: males
permanently with females, n=27 (III) Natural induction of SF: males
present for first mating and prior birth (day 36 to 41), n=33 (IV)
Testing the hypothesis of sperm storage: vasectomised males mated
with females prior birth (day 36 to 41), n=6 (V) Experimental
induction of SF with Artificial insemination (AI) and ovulation
induction (GnRH-analogon): day 34 to 36, n=12; day 38, n=9
Results (I) Mean pregnancy length was 41.9±0.8 days. Prenatal
growth curves were calculated. Ultrasonographic milestones in
embryonic and CL development were defined. CL of pregnancy and
embryonic vesicles were first detectable on day three and six,
respectively. (II) In 85% (n=23) a new pregnancy was detected shortly
after birth. In 67% (n=18) a second litter was delivered. Mean
interbirth interval was significantly shorter (38.1±1.1 days, p

16 t h International Congress on Animal Reproduction
Poster Abstracts 135
aimed at identifying the vaginal epithelial cells of maned sloths
(Bradypus torquatus) as a possible way to study the phases of the
estrous cycle of this animal.
Material and methods The samples for vaginal cytology were
obtained from four free ranging maned sloths living in a protected
area of coastal forest in the South of Bahia. The sterile gynecological
brush was inserted up to the necessary distance to reach the pelvic
channel. Two smears were immediately immersed in absolute alcohol
for ten seconds to produce cell fixation. Staining was performed using
rapid Panotic Kit (Laborclin®). The methodology for differential
evaluation of the cells was based on Schutte’s work (1967).
Results and discussion Maned sloths BT033, BT065, and BT042
presented, respectively, 32%, 33%, and 7% of parabasal epithelial
cells (PB); 58%, 22%, and 10% of small intermediate cells (SI); 9%,
18%, and 6% of large intermediate cells (LI); 4%, 13%, and 24% of
superficial epithelial cell with a nucleus (NS); 8%, 14%, and 53% of
anucleated superficial epithelial cell (AS). Two cell samples were
collected for maned sloth BT464 with a 15 months interval.
Cytological differences were observed between the two samples (1ª
and 2 ª): 7.5% and 17.5% of PB cells, 6.5% and 25% of SI cells, 12%
and 15.5 of LI cells, 9.5% and 19.5% of NS cells and 70% and 22.5%
of AS cells, respectively. It’s interesting to remark that the percentage
of vaginal epithelial cells varied among sloths and also for the same
animal. This result suggests that vaginal cytology of maned sloth can
be used as a tool to evaluate of estrous cycle.
References SCHUTTE AP. Canine vaginal cytology. I – Technique
and cytological morphology. J. Small Anim. Pract., v.8, p 301-306,
1967.
Keywords: cells, vaginal epithelia, estrous cycle.
P325
Effects of culture medium McCoy 5A Modified® (Sigma-
Aldrich M-9309) in semen motility post-thawing of
bottlenose dolphin (Tursiops truncatus, Tursiops
aduncus, Tursiops gilli)
Ugaz, C
Veterinary and research, Dolphinaris, Mexico
Due to the grate interest in captive marine mammals, in recent
decades works on reproduction biotechnology in these species
increased. One of the most charismatic species in captivity is the
bottlenose dolphin, in witch many different researches have been done
to improve procedures for their semen freezing (Robeck T. 2004;
Robeck T. 2001, Ugaz C. et al. 2006). Many researches in different
species have used the amino acids additions in freezing extender,
generally glutamine (50mM), proving good results on the motility
percentage after thawing (Khlifaoui M et al, 2005; Yahui L, et al,
2003; Trimeche A et al, 1999; Vidament M et al, 2001). In present job
semen of the three male of the three different species was use
(Tursiops truncatus, Tursiops aduncus, and Tursiops gilli); kept in
captivity under the same life conditions. At least 3 ejaculate each was
extracted (table 1). It was frozen using a refrigeration rate -0.18°
C/min. and freezing rate -8.5° C/min. The Triladyl® (Minitube)
extender was use, according to the manufacturer's instructions, with a
concentration of 800 million sperm/ml. Thawing was made at 36°C
for 60 seconds, McCoy 5A Modified ® (Sigma-Aldrich M-9309) at
36°C was added, in 1:1 (v/v) dilution. The main characteristics of this
culture medium are that it has a lot off amino acids, and it is enriched
with L-Glutamine (219.15 mg/L) and NaHCO3. All results indicated a
significant increase in motility post-thawing (P= 0.0004; R squared:
0.6889; T paired test) with McCoy 5A Modified ®, 49.57 % is higher
versus semen post-thawing without culture medium.
Poster 09 - Reproduction of Rabbit and Laboratory
Rodents
P326
Effect of reproductive rhythm on the oocyte quality and
fertility rate in primiparous does
Arias-Álvarez, M 1 *; García-García, RM 1 ; Revuelta, L 1 ; Rebollar, PG 2 ;
Lorenzo, PL 1
1Dpto. de Fisiología (Fisiología Animal). Facultad de Veterinaria-UCM.
Madrid. Spain; 2 Dpto. de Producción Animal. ETSIA-UPM. Madrid. Spain.
The fertility and prolificacy of the primiparous rabbit does are low
when they are inseminated (AI) in the short period after kindling.
Strong nutritional needs and a lactation status may have consequences
on the quality of their gametes. Oocyte maturation is the first step that
affects the successful fertilization and preimplantation embryo
development and finally influencing the economic profits. The aim of
this study was to compare the effect of different reproductive rhythms
(semi-extensive and extensive) on meiotic and cytoplasmatic
maturation measured as cortical granules migration (CG) of rabbit
oocytes matured in vitro. A total of 90 primiparous New Zealand x
California white rabbits, under semi-intensive (Group A: AI at 11
postpartum day (ppd), n=45) or extensive rhythm (Group B: AI at 32
ppd, post weaning, n=45), were synchronized by biostimulation 24
hours. Fifteen animals by group were euthanasized according to the
bioethics committee of the University. Cumulus oocyte complexes
(COC) were aspirated from ovarian follicles ≥ 1 mm in size of one
ovary and were matured in TCM-199 medium supplemented with
10% FCS, 10ng/ml EGF and 100ng/ml IGF. Afterwards, a total of
301 COC (n=188, group A and n=113, group B) were treated
progressively with 2mM hyaluronidase, 0.5% pronase, 4%
paraformaldehyde, 0.02% Triton X-100 and 7.5% BSA. Oocytes were
incubated with 100 μg/ml FITC-LCA for GC staining and with
10μg/ml Propidium Iodide for nuclear staining, and observed under a
confocal laser-scanning microscope. Chi-square test was performed to
analyse fertility, nuclear maturation and CG migration index. Fertility
rate was significantly higher in group B than group A (53.6% vs
100%, p

16 t h International Congress on Animal Reproduction
136 Poster Abstracts
(BSA) as a model for establishing criteria for human IVF and GIFT
procedures.
Design Optimum concentrations of ECS and BFF in Ham's F-10 were
established by measuring blastocyst development of in vivo fertilized
zygotes from a mouse strain.
Animals eight-week-old, superovulated mice.
Result(s) In vivo-derived embryos were cultured in Ham's F-10, to
which one of the following groups: [1] BSA (4 mg/ml), [2] different
concentrations (10 and 20%) of ECS [3] different concentrations (10
and 20%) of FF, added two-cell stage. The proportion of embryos
developing was affected by the type of protein and concentration.
Reduced cleaved rates of embryo development were observed in
Ham's F-10 supplemented with 10% BFF and 10% ECS. The rates of
development of balstocystes in vitro were suppressed when the
embryos were cultured with 10% BFF or 10% ECS as compared with
BSA. Ham's F-10 supplemented with 20% ECS, 20% BFF and BSA
also supported the development of in vitro-derive embryos (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 137
P331
Sexual behaviour and semen quality of rabbits fed with
diets containing Myristica fragrans (Houtt) (Nutmeg)
Herbert, U.*, Ukar, IA.
College of Animal Science and Animal Production, Michael Okpara University
of Agriculture, Umudike, Umuahia, Nigeria
Introduction Rabbits, in Nigeria, have been exhibiting low
reproductive performance in terms of litter size, copulatory behaviour,
etc which could be attributed to several factors including genetic,
physiological and environmental factors (Herbert, et al., 2005).
Studies have been carried out to find out the aphrodisiac effect of 50%
Ethanolic extract of Myristica fragrans on male rats (Tajuddin, 2003)
with positive results. This study was designed to determine the sexual
behaviour and semen quality of rabbits fed diets containing whole
seeds Myristica fragrans.
Materials and Methods Eighteen mature crossbred rabbits divided
into 3 groups were used in the study. The whole nutmeg seeds were
dried and milled prior to incorporation into the diets at 0% (T 1 ), 2.5%
(T 2 ) and 5.0% (T 3 ) of dietary dry matter. The diets were fed the
animals ad libitum for 12 weeks. Semen was collected fortnightly
using an artificial vagina as described by Herbert and Adejumo (1995)
and analysed using standard methods. Data obtained were analysed
using the analysis of variance technique.
Results and Discussion There were no significant differences
(P>0.05) between the treatment groups in all the parameters
measured. Reaction time was however shorter in the T 3 group being
10.30 seconds as against 12.13 seconds in the T 1 , implying an
improvement in this parameter. Semen volume decreased with
increasing level of nutmeg in the diet with T 1 , T 2 and T 3 having values
of 0.95ml, 0.84ml and 0.76ml respectively. All the semen volumes
obtained in this study were higher than the 0.71ml reported by Herbert
and Adejumo (1995). The sperm concentration values obtained ranged
from 22.00x10 6 /ml for T 1 to 25.75x10 6 /ml for T 3 . These values are
lower than those reported by Herbert and Adejumo (1995). However,
the non-significant variations in the sperm concentration indicating
increase with increasing level of nutmeg suggests that further increase
in the level of nutmeg in the diet may lead to a significant variation in
the treatments. The values obtained for motility, live sperm proportion
and abnormal sperm fall within normal ranges in the literature. It is
concluded from this study that even though there were no significant
differences between the treatments, Myristica fragrans tended to
improve the reproductive performance of the rabbit bucks.
References Herbert, U, Ozoje, M O, Adejumo, D O (2005). Animal
Research 54(3):173-174.; Herbert, U. and Adejumo, D.O. (1995).
Delta Agric. 4: 99 – 108.; Tajuddin, Ahmad, S, Latif, A, Qasmi, I.A.
(2003). BMC Complement. Altern. Med. 3:6.
P332
Characterization of rabbit uterine electric and mechanical
activities associated to the presence of capacitated and
non capacitated spermatozoa
Lazcano-Reyes, JF 1 *; Montiel, JL 2 ; Medrano, A 2 .
1Programa de Maestria y Doctorado en Ciencias de la Producción y la Salud
Animal. 2 Departamento de Ciencias Pecuarias. Facultad de Estudios
Superiores – Cuautitlán. Universidad Nacional Autónoma de México.
Uterine motility is very important during gestation, parturition and
mating since it may play an important role for sperm transport and
capacitation, for instance, an increase in myometrial motility could be
displayed when a sperm subpopulation shows hyperactivation. The
objective was to characterize the electric and mechanical activity of
rabbit uterus after mating and other treatments. In the first stage,
contractibility was measured in 3 segments: uterus (UTE), uterotubal
junction (UTJ) and oviduct (OVI) from 20 adult does, before and after
the application of 200, 100 and 50 microlitres, respectively, of each
treatment: 1) Mating, 2) Seminal Plasma and 3) PBS. In the second
stage, either capacitated or non capacitated spermatozoa were
introduced into each uterine segment from 20 adult does, and
contractibility (g) and electric activity (mV) were recorded for 3
minutes before and after treatment. Data was analyzed by ANOVA to
determine possible differences between treatments and segments; a
correlation test between mechanic and electric activities was carried
out. Basal values for mechanical and electric activity were: 9.4, 9.1
and 9.4 g; 0.14, 0.09 and 0.13 mV for UTE, UTB and OVI
respectively. Regarding the effect of treatments, values of mechanic
and electric activity were: 8.8, 7.6 and 10.9 g; 0.08, 0.10 and 0.14 mV
for UTE, UTB and OVI respectively, with PBS. Values with Seminal
plasma were: 12.0, 8.8 and 8.5 g; 0.07, 0.06 and 0.11 mV for UTE,
UTB and OVI respectively. Values after mating were: 6.1, 6.7 and 8.7
g; 0.13, 0.08 and 0.10 mV for UTE, UTB and OVI respectively. In the
first stage, contractibility between uterine segments was not different
for PBS and Mating, but it was for Seminal Plasma (P

16 t h International Congress on Animal Reproduction
138 Poster Abstracts
In this study, 50 male Wister rats, each weighing 282±110g were
used. These animals were divided into five groups of tens: the control
group receiving normal food, the sham group receiving solvent
(distilled water), and three experimental groups receiving 0.05, 0.1,
and 0.2 g/kg extract of spathe respectively. The dosages of distilled
water and extracts were injected intra peritoneally for 14 days. Eight
hours after receiving last doses blood samples were taken and serum
concentration of lutein hormone (LH) follico stimulation hormone
(FSH) and testosterone were measured by RIA method.The results
were evaluated by SPSS and Tukey test.
Statistical analysis of the results indicates that concentration of
testosterone decreases significantly in experimental groups receiving
0.05 and 0.1 g/Kg extract, while serum concentration of LH and FSH
did not show any significant difference (π≤0.05) among various
groups.
According to the results alcoholic extract of phoenix dactylifera
spathe reduces serum testosterone and protein synthesis. In addition,
the presence of phytosterols in the extract which inhibit 5-a-reductase
and aromatase enzymes activities may diminish tissues sensitivity to
androgens. Finally, the reduction of sperms in somniferous tubules
may due to the estrogenic activities of phytosterols and coumarin.
P335
Synchronization of oestrus and ovulation in mice by
administration of progesterone and prostaglandin
analogues
Pallares, P 1 * and Gonzalez-Bulnes, A 2
1Fundacion CNIC. Madrid, Spain; 2 Dpto. Reproduccion Animal. INIA. Madrid,
Spain
Introduction Management of the oestrous cycle in the mouse is
scarce. Usual methods for induction of behavioural oestrus and
ovulation are “male effect”, by the introduction of a male, fertile or
vasectomized and “Whitten effect”, by the exposition to male
pheromones; however, the degree of oestrus synchronization reached
with these methods is very limited. Thus, we aimed to design and
establish a protocol for induction and synchronization of oestrus and
ovulation in mice, based in exogenous hormones.
Material and methods In four consecutive experiments, a total of 72
adult mice in breeding age were used to evaluate effectiveness of the
use, alone and combined, of exogenous progesterone and
prostaglandin analogues. Different strains (37 BALB/c, 10 C57BL/6
and 25 CD1) were treated for testing breed effects. All the animals
were maintained at the facilities of the CNIC Animal Laboratory Unit
in Madrid, Spain.
Results The higher synchronization degree and the higher fertility
rates were obtained by the use of a protocol consisting of two i.p.
doses of 0.5μg of cloprostenol, three days apart, plus a single s.c. dose
of 3μg of progesterone coincidentally with the first injection of
cloprostenol. Within main advantages of the new method, we have to
highlight the short time elapsed for appearance, and the high degree of
synchronization, of oestrus and ovulations (almost 100% of the
animals responding to the treatment in 48h; 78.4% with fertile mates
at 24h), plus the high fertility rate obtained after a programmed
mating (100%). The response was very repeatable between replicates,
which may be related to a high synchronization of the ovarian stage at
induction of luteolysis and introduction of the male. There were not
found significant differences between strains, except the expected
effect on prolificacy (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 139
increase significantly in vitro fertilization with frozen-thawed rabbit
semen.
Our work were supported by Wellcome Trust (070246/Z/03/Z) and
the EU FP6 (MEXT-CT-2003-509582, MRTN-CT-2006-035468).
Poster 10 - Avian Reproduction
P338
Comparison of various freezing protocols of native
roosters semen
Barna, J*, Végi, B
Avian Reproduction Group, Research Institute for Animal Breeding and
Nutrition, Hungary
Efficiency of semen freezing of Hungarian speckled roosters was
evaluated in vitro. The aim of the study is the support of the ex situ
gene conservation efforts on indigenous Hungarian chicken breeds.
Semen of 10 individually placed males were collected twice weekly
for 6 weeks. The pooled samples were divided into 5 equal parts for
the various freezing protocols. The composition of the semen diluent
was the same in all cases, the protocols differed in the type of
cryoprotectants (glycerol, MA, DMA), the rates of cooling (slow, fast)
and the type of cryo-conteners (straw, ampoule). The slow cooling
with glycerol in ampoule using programmable freezer (Lake and
Stewart, 1978) served as an etalon for comparison the various fast
protocols in nitrogen vapour, as simple, quick and inexpensive way
for maintaining of spermatozoa. For assessment of the effectiveness
of protocols in vitro determination of the survived, morphologically
intact sperm ratio was the main goal. Testing the damaging effect of
cryopreservation procedures 4 qualifications/sample were performed
at each steps of the protocols: 1. fresh undiluted semen; 2. diluted
semen during equilibration without cryoprotectants; 3. diluted semen
at finishing of equilibration with cryoprotectants; 4. semen after
freeze-thaw cycle. In fresh samples the concentrations
spectrophotometrically and the motility by subjective scoring were
measured. On the basis of membrane permeability the live/dead cell
ratios and the sperm anomalies were determined using aniline-eosin
stained smears by counting 200 spermatozoa/samples. Only those
samples were frozen which had a concentration characteristic of
breed, motility with maximum score and a live, morphologically
normal cell ratio above 80%. On the effect of simple dilution sperm
decay was as double as in fresh semen (13%), at the end of
equilibration with cryoprotectants there was a further increase in
sperm death (7%), after freeze-thaw cycle 50 and 80% of spermatozoa
died in slow and fast protocol, respectively. Around 50% of recovered
cells had abnormal morphology in all cases, therefore the ratios of
live, morphologically intact cells which are presumably able to take
part in the fertilization were only 23.7, 12.5, 14.1, 4.3 and 9 % in
slow, fast with DMA in straw and ampoule and MA in straw and
ampoule protocols, respectively. Although, the slow freezing could
produce significantly higher survival rate the further perfection of the
simple method in nitrogen vapour using DMA and ampoule seems to
be promising.
P339
Effect of diets with different lipid sources in the ability of
rooster sperm to hydrolyze the inner perivitelline layer of
the egg
Bongalhardo, DC 1 *, Nunes, PM 2 , Oliveira, EB 2 , Anciuti, MA 3 , Rutz, F 4 , Ledur,
MC 5 , Deschamps, JC 2
1Departamento de Fisiologia e Farmacologia, Universidade Federal de
Pelotas, Brazil; 2 Faculdade de Veterinária, Universidade Federal de Pelotas,
Brazil; 3 Conjunto Agrotécnico Visconde da Graça, Universidade Federal de
Pelotas, Brazil; 4 Departamento de Zootecnia, Universidade Federal de
Pelotas, Brazil; 5 EMBRAPA Suínos e Aves, Brazil
maintained its membrane integrity and motility when compared with a
control. Compared with these in vitro evaluations of sperm quality,
the sperm:egg interaction assay predicts, with more accuracy, the
ability of sperm to fertilize the egg. This work aimed to verify if the
ability of rooster sperm to hydrolyze holes in the inner periviteline
layer (IPVL) of fresh chicken eggs would be affected by diets with
different lipid sources. Twenty roosters with 37 weeks of age were
divided in 4 groups and fed with one of the following diets: 1) control
(standard diet, without addicional lipid source), 2) corn (standard diet
+ 4% corn oil), 3) fish (standard diet + 4% fish oil), and flax (standard
diet + 4% flax oil). Gas chromatography analyses of these diets
showed the following amounts of n3 and n6 fatty acids: 2.6 and
48.3% for control, 1.1 and 50.7% for corn, 9.3 and 26.7% for fish, and
36.6 and 24.2% for flax. After 6 weeks on the treatments, semen was
collected and pooled by diet. This pool was then evaluated by its
ability to hydrolyze holes in the IPVL. After three repetitions, results
were analyzed by Kruskall-Wallis test, for non-parametric data.
Means and standard errors for each treatment were 123 ± 51, 92 ± 47,
73 ± 22 and 71 ± 42 holes/mm2 of IPVL for control, corn, fish, and
flax, respectively. There was no significant difference (P>0.05)
among treatments. It can be concluded that sperm modified by dietary
lipids maintain its ability to hydrolize holes in the membrane, and
suggests that its ability to fertilize the egg would also remain
unchanged.
P340
Sex determination in juvenile Emus (Dromaius
novaehollandiae) from feathers by PCR
Costantini, V 1 *; Guaricci, AC 1 ; Rausa, F 2 ; Bucci, FA 1 ; Lacalandra, GM 1
1Department of Animal Production, Faculty of Veterinary Medicine, University
of Bari, Italy; 2 Zoosafari Fasano, Italy
Introduction The molecular sexing methods DNA-based on the
amplification of the chromo-helicase-DNA-binding 1 (CHD1) gene of
the sex chromosomes were successfully established for many avian
species, but none of these tests is widely applicable to ratite birds.
Recently, the sequences of ESEXZ and ESEXW have been used for
the development of a two-primer CAPS (cleaved amplified
polymorphic sequence) assay for sex identification of the Emu
(Dromaius novaehollandiae) (de Kloet 2001). In the current study,
during a captive breeding program, we assessed the effectiveness of a
molecular based assay with amplification of a sex-specific locus
(kW1), W chromosome-linked in the North Island Brown Kiwi
(Apteryx australis mantelli) and all ratite species, for sexing young
Emus, using genomic DNA from feather samples.
Methods Genomic DNA was isolated from the calamus of small
double feathers, collected from the back of 4 months old Emus, using
GenEluteTM Mammalian Genomic DNA mini prep kit (Sigma,
Milano, Italy). The samples were derived from birds of known sex,
determined by cloacal examination (seven males and three females).
The kW1 locus was PCR-amplified (forward primer:
CCTTTAAACAAGCTGTTAAAGCA; reverse primer:
TCTCTTTTGTTCTAGACACCCT). Amplification products were
separated on 2% agarose gel and stained with ethidium bromide.
Results Amplification of Emu DNA using the primers w1 and k7
resulted, after run, in the production of a single sex-specific band
(~150 bp) only in female subjects (female-specific band).
Conclusions In this report we describe a PCR approach from feather
DNA in Emu (Dromaius novaehollandiae), with amplification of a
sex-specific locus W chromosome-linked (kW1), that appears to be a
rapid, reliable and no risks technique for sex determination of this
species, especially young, in breeding programs.
References de Kloet SR, 2001: Development of a CAPS (cleaved
amplified polymorphic sequence) assay for sex identification of the
emu (Dromaius novaehollandiae). Molecular Ecology Notes 1 (4),
273–275.
Dietary lipids alter sperm membranes by the modification of specific
fatty acids and may have an impact on sperm fertilizing ability.
Previous work showed that sperm modifyed by dietary means

16 t h International Congress on Animal Reproduction
140 Poster Abstracts
P341
The effect of various diluents on pigeon semen stored
24h at 5 o C
Klimowicz, M 1 *, Batkowski, F 2
1Krakow Agricultural University, Faculty of Animal Breeding and Biology,
Department of Animal Reproduction and Anatomy, Al. Mickiewicza24/28, 30-
059 Krakow, Poland; 2 Wroclaw University of Environmental and Live Science,
Faculty of Veterinary Medicine, Student Scientific Association, ul. Norwida
31, 50-375 Wroclaw, Poland
The aim of the study was to identify a suitable extender for pigeon
semen preserved for 24h at 5 o C. Experiment was conducted 10 weeks.
Semen was collected twice a week, from 40 fancy pigeons. After
macroscopic analysis semen was pooled, diluted in Lake’s solution
and BPSE extender, and divided in two equal parts. One part of semen
was evaluated immediately and second one was stored at 5 o C and
evaluated after 24h. Every sample of semen was stained using 2
different methods - conventional eosin-nigrosin stain to estimate
morphology of spermatozoa and SYBR-14/PI to evaluate sperm
viability by flow cytometry. Sperm motility and velocity parameters
were estimated using computer-assisted semen analyser HTM IVOS
12.2 (CASA). CASA analysis revealed that sperm motility (MOT),
percentage of spermatozoa with a progressive motility (PMOT) were
significantly higher in BPSE than in Lake’s solution after 24h storage
(p≤0.05). Velocity parameters such as VAP, VSL, VCL, LIN, STR
and the percentage of viable spermatozoa were not different between
extenders. The percentage of morphologically normal spermatozoa
was significantly higher at 0h in semen diluted in BPSE than in
Lake’s solution (85.48±4.83 and 75.12±3.45; p≤0.01), as well as after
24h in vitro storage - 65.4±10.71 and 52.5±10.44 respectively
(p≤0.05). The deformation and damage of spermatozoal acrosome
was extremely higher in semen extended in Lake’s solution after in
vitro storage (p≤0.001). BPSE is a suitable semen extender for storage
of pigeon ejaculates at 5 o C. This diluent has been capable of
protection pigeon semen during in vitro storage and could potentially
improve methods of cryopreservation.
P342
The effect of short-term semen storage temperature and
period on South African indigenous cock breeds
Mphaphathi, ML*; Raito, MB; Mapeka, MH; Mantiziba, CW; Munyai, PH1;
Boshoff, MP; Suzette, F and Nedambale, TL
Agricultural Research Council-Livestock Business Division, Germplasm and
Reproductive Biotechnologies, Private Bag X2, Irene, 0062, RSA
The development of short and long term storage of South African
indigenous cock’s semen is needed to ensure a viable reserve of
germplasm for artificial reproduction. The aim of this study was to
examine the longevity of freshly collected semen of two different
indigenous cock breeds at room temperature (25 o C) and low
temperature (4 o C) for 4 h, 8 h, and 24 h. Abdominal massaging
technique was used to collect cock’s semen of Naked neck (NN) and
Venda (V) breed. Following semen collection, spermatozoa was
divided equally per treatment group; then microscopic characteristics
(motility and survival rate) were evaluated under polarizing BHTU
microscope and the sperm concentration was measured by spermacue.
Modified Brackett and Oliphant’s (BO) medium was used to dilute
(1:2) individual ejaculates per treatment group. The ejaculates
volume, concentration, and pH of NN and Venda breed were recorded
and evaluated for different time intervals. Data was analyzed by
ANOVA. Preliminary results demonstrated a higher concentration of
sperm in NN (8.14 x 10 8 /ml) than in Venda (4.46 x 10 8 /ml) breed. In
contrast, higher pH was recorded in semen collected from Venda cock
breed. However, there were no statistical differences in sperm motility
and survival rate of semen stored at 25°C and 4°C between NN and
Venda breed for all periods (Table 1). Regardless of time intervals
and cock breed, there was an increase in dead sperm percentage and
pH over time for semen stored at 4 and 25 o C. In summary, semen
collected from NN cock resulted in higher concentration of sperm.
This study also indicated changes induced by storage temperature,
breed and length of semen storage. Study on cryopreservation of NN
and Venda cock semen is on progress.
P343
Changes in sperm quality of broiler breeder males
supplemented with organic selenium
Végi, B*; Váradi, É; Ferencziné Szőke, Zs; Barna, J
Avian Reproduction Group, Research Institute for Animal Breeding and
Nutrition, Hungary
The fertility decline in the second half of reproduction cycle has been
a permanent problem in broiler breeders’ production. The aim of the
study was to find differences in the effect of inorganic and organic
selenium and the higher level of vitamin E on sperm parameters,
mainly in the second half of the reproduction cycle in two types of
broiler breeders. Selenium and the vitamin E play important role in
the antioxidant system of live organism and additionally, of the
membrane of avian spermatozoa. Due to the membrane damages the
sperm functions failure, which results in reduced fertility. Sperm
parameters of 20-20 males from ROSS 308 and Hubbard broiler
breeders were compared during the whole reproduction cycle by
weekly semen evaluations. The food of experimental groups was
supplemented with 0.3 ppm Sel-Plex (Alltech) and 200 ppm vitamin
E, while the food of control groups contained sodium selenite in
traces and 100 ppm vitamin E. Males of 26 weeks of age were placed
in individual cages feeding and keeping according to the management
manual, until 61 weeks of age. Sperm collections were made twice a
week by dorso-abdominal massage according to Burrows and Quinn
(1937). Concentrations were determined by spectrophotometer
(Accucell, IMV Technologies), motility by subjective scoring from 0
to 5, morphology of spermatozoa and live/dead cell ratio in stained
smears by aniline eosin. As a result, the 0.3 ppm organic selenium and
200 ppm vitamin E affected differently in the two types of males.
While in ROSS males they improved significantly the sperm motility,
concentration and the ratio of live, morphologically normal
spermatozoa in the second half of the production cycle, in the case of
Hubbard males there were no any significant improvements in sperm
traits. However, significant differences were found between the sperm
qualities of the two types regarding to the sperm volumes (.18 - .25
ml/ejaculate), the concentrations (4.9 – 1.9 million/µL), and the dead
cells’ ratios (15 – 17.8 %) in ROSS vs. Hubbard control males,
respectively. Thus, Hubbard males produced higher semen volume
with significantly less sperm concentration, less abnormal sperm cells
but significantly more dead cells, than ROSS males. As a
consequence, Sel-Plex with vitamin E could maintain the initial good
sperm quality of ROSS males until the end of the cycle. However, in
the case of Hubbard males the spermatological performance seemed
to be more stable during the reproduction cycle and less accessible by
exogenous factors.
Poster 11 - Reproduction of Other Vertebrates (Fishes,
Amphibians, Reptiles)
P344
Endogenous opioid system and sharpsnout seabream
(Diplodus Puntazzo) milt: detection of mu, delta and
kappa opiod receptors on sperm cells
Aiudi, G*; De Sandro Salvati, A; Bucci, FA; Micera, E; Albrizio, M
Department of Animal Production, University of Bari, Italy
Sharpsnout seabream, (Diplodus puntazzo) is the third most farmed
marine teleost species in Italy (Taddei et al., Cryobiology 42:244,
2001). Fish reproduction in aquaculture facilities is mainly obtained
through environmental/pharmacological conditioning. These
techniques may stress fish and decrease reproductive performances
(Cleary et al., Aquac. Res. 33:829, 2002). Endogenous opioid peptides
(EOPs) system is involved in stress response (Arends et al., J.
Endocrinol., 163:149, 1999), and affects several physiological

16 t h International Congress on Animal Reproduction
Poster Abstracts 141
functions, both in central nervous system and in peripheral tissues.
EOPs act through their specific cell membrane receptors (EOPr),
which are classified into three major categories: mu, delta and kappa
(Zadina et al., Nature, 386:499, 1997). The EOPs-EOPr binding
blocks the cellular calcium channels, giving rise to considerable
effects on all calcium-dependent metabolic pathways. Osmolality is
one of the most important factors in the regulation of marine Teleosts
sperm motility (Morisawa, Zool. Sci., 2:605, 1985). In fish
spermatozoa hyperosmolality increases the intracellular calcium
levels which allow the activation of flagellar beating (Oda and
Morisawa, Cell Motil. Cytoskeleton, 25:171, 1993). Because of the
recognized importance of calcium ions in marine Teleost sperm
initiation, the high levels of stressors in aquaculture, and effects of
EOPs on intracellular calcium balance, we evaluate the expression
and localization of mu, delta and κappa opioid receptors in sharpsnout
seabream milt by means of indirect immunofluorescence. Briefly, milt
was collected by gentle abdominal massage into a depressurized
syringe positioned at the genital pore and smeared onto poly-L-lysine
coated glass slides. Cells were fixed, washed and incubated in
blocking solution. A 1:1250 dilution of primary rabbit specific
polyclonal antibodies against each receptor were applied except for
the controls and let to react over night. After washing, slides were
incubating with an anti rabbit FITC-conjugated IgG secondary
antibody diluted 1:200 in Evans blue/PBS to counterstain negative
cells. Slides were observed under a fluorescence microscope equipped
with a specific filter. Our results show that mu opioid receptor is
predominant localized on the tail, while delta and kappa seem to be
located on the head. Opioid receptors detection on sharpsnout
seabream milt let us suppose that the opioidergic system could
modulate sperm motility, so that the use of opioid antagonists in fish
farm could be useful to decrease stress effects on reproductive
performances.
P345
Short-term storage of Abant Trout (Salmo trutta abanticus
Tontonese, 1954) semen and fertility trials
Hatipoğlu, T 1 ; Akçay, E 2 *
1Ministry of Environment and Forestry, General Directorate of national parks
and nature protection, Ankara, Turkey; 2 Department of Animal Reproduction
and AI, Faculty of Veterinary Medicine, University of Ankara, Turkey
Introduction In developing successful techniques for the preservation
of fish sperm, some specific considerations related to the fish species
must be taken into account such as biochemical structure and short
life span of sperm after their release into water and preservation
procedures. Most of the experiments in this field have focussed on
finding appropriate extenders and additive agents for salmonids.
Generally seminal plasma mimicking media and simple carbohydratebased
solutions have been used as extenders.
Objective The objective of this experiment was to evaluate
spermatological parameters and fertilizing ability of short term stored
semen in different extenders from endemic Abant trout (Salmo trutta
abanticus T,1954).
Materials and methods Semen was collected from 15 adult males by
the hand stripping method without anesthesia. Having determined the
main spermatological properties (volume, motility, movement
duration, concentration and pH), the pooled samples were diluted at a
1:2 ratio with two extenders (0,3 M Glucose and Ringer solution). The
diluted semen were stored for 48 hours at 4 °C. Following the cooled
storage, spermatological parameters of the semen were evaluated after
24 and 48 hours as regards to the post-cooled period. For the
fertilization, dry fertilization technique was used. Eggs were pooled
from 10 females. Fertilization took place in dry plastic dishes and 600
eggs were used in each fertilization trial. The sperm-egg ratio was
approximately 0,25x10 6 sp/egg. After insemination, 25 ml fertilization
solution (0.3% NaCl) were added on sperm-egg mixture. After
swelling, eggs were rinsed with hatchery water (7 o C) and batches
were placed into vertical incubation trays.
Results The experimental success was assessed from sperm motility
and the percent of eyed-egg 25 days after fertilization. Fresh semen
motility was 81,46±6,39 %. According to the results of the
experiment, the highest post-thaw motility (67 % after 24 h, 53 %
after 48 h) and movement duration (60 s after 24 h, 42 s after 48 h)
were determined by using glucose extender after 24 and 48 hours
storage. Fertility rate of fresh semen was 86,3 %. The highest eyedegg
rate (80.3%) obtained from semen stored with glucose based
extender after 24 h storage. After 48 hour storage fertilization yield
for the one diluted with 0,3 M Glucose decreased to 61,92 % and to
43,87 % for the one diluted with Ringer solution.
Conclusion Our results indicate that glucose based extender is a
better preservative than Ringer solution for short term preservation of
Abant trout semen.
P346
Comparative study about the use of Oxytocin
chlorohydrate administered intravenous or intramuscular
for induction of eggs deposition in non obstructive eggs
retention in captive breed turtles (Trachemys scripta
elegans )
Di Ianni, F*; Parmigiani, E; Bresciani, C; Bigliardi, E; Bertaccini, G
Faculty of Veterinary Medicine, Parma University, Italy
Introduction Non obstructive eggs retention in turtle may be the
result of some different factors including poor husbandry, not
appropriate nesting site, improper temperatures, inadequate diet,
dehydration, and poor physical condition of the female. Oxytocin,
from 1 to 20 IU/kg of body weight stimulates oviductal contraction
and induces eggs deposition. The aim of this study is to make a
comparison between intravenous (IV) and intramuscular (IM)
oxytocin chlorohydrate administration for the induction of eggs
deposition in Trachemys scripta elegans turtles.
Methods We considered 23 chelonia (Trachemys scripta elegans)
recovered in the Teaching Hospital from 2005 to 2007 with signs of
anorexia and restlessness. The turtles were radiographed and non
obstructive eggs retention was diagnosed. The eggs were counted and
the animals were divided in two groups with the same eggs number:
group A (10 animals) and group B (13 animals). Oxytocin (2 IU/Kg)
was administered IM in all the animals of group A and in the dorsal
caudal vein in group B. If the animals did not laide all the eggs, we
administered a second dose (2 IU/Kg) 60 minutes later and every 120
minutes up to the end of the deposition for both groups.
Results The animals of group A started laiding in a mean of 100.5 ±
54.08 minutes and laided the last egg in a mean of 246± 85.4 minutes.
For all animals (100%) was necessary to administer a second bole, for
7 of them (70%) a third for 3 of them (30 %) a fourth one. The
animals of group B started laiding in a mean of 51.38 ± 19.80 minutes
and laided the last egg in a mean of 141.92± 60.33 minutes. For 10
animals (77.92 %) was necessary a second bole and for 5 (38.46 %) a
third one. All the eggs were laided. The statistical comparison ( χ 2 )
was highly significant for the initial laiding time (P < 0.01) and
significant for the mean total time from beginning to the end all the
depositions (P < 0.05).
Conclusions In this study the Authors showed that oxytocin (2
IU/Kg) administered IV induces more quickly the deposition and that
this finishes in shorter time. The treatment technique results to be easy
to perform with no undesired collateral effects.
P347
Induced spermiation in Green Poison Frogs, Dendrobates
auratus (Amphibia, Anura, Dendrobatidae), and
ultrastructure of the spermatozoa
Lipke, C 1 , Meinecke-Tillmann, S 1 *, Meyer, W 2 and Meinecke, B 1
1Department of Reproductive Biology, University of Veterinary Medicine
Hannover Foundation, Hannover, Germany; 2 Institute of Anatomy, University
of Veterinary Medicine Hannover Foundation, Hannover, Germany
The sperm ultrastructure of the Green Poison Frog, Dendrobates
auratus, from Panama is described following induced spermiation in
living animals. For this purpose a new method for processing of low
concentration sperm samples (< 3.8*10 4 sperm/ml) had to be
developed. So far only data on testicular spermatozoa were reported in

16 t h International Congress on Animal Reproduction
142 Poster Abstracts
other dendrobatid frogs. But sacrificing endangered animals should be
avoided.
Sperm samples are obtained after gentle hormonal stimulation with
human chorionic gonadotropin (hCG) cloaca lavage and light
microscopic evaluation. Sperm cells are filiform with an arcuated and
21.1 µm long head and a single tail (35.0 µm length). Their acrosomal
complex is located at the anterior portion of the head and consists of
the acrosomal vesicle with low electron density, and the subjacent
electron-dense subacrosomal cone. The nucleus is circular in
transverse section (1.9 µm diameter), and conical in longitudinal
section. It is surrounded by several groups of mitochondria. The
highly condensed chromatin is electron-dense but shows numerous
electron-lucent inclusions. A short midpiece has a mitochondrial
collar with a proximal and a distal centriole. The latter gives rise to
the axoneme which alone forms the flagellum.
The sperm ultrastructure of D. auratus differs from that of other
Dendrobatidae because of the absence of a nuclear space and the
missing undulating membrane associated with an axial fibre. In
conclusion, it can be stated that the spermatozoa of D. auratus are the
first within the Dendrobatidae without accessory tail structures. This
tail conformation is analogue to these of Ranoidea and not
Bufonoidea. This observation is in contrary to Garda et al. (2002) and
Aguir-Jr. et al. (2004) who grouped the Dendrobatidae within the
Bufonoidea. Our findings indicate that the whole dendrobatid family
cannot be grouped within the Bufonoidea by means of the sperm tail
conformation.
Poster 12 - Neuroendocrine Control of Reproduction
P348
The preovulatory LH surge in the ewe appears to be
essentially timed by the hypothalamus
Ben Saïd, S 1 *; Clarke, IJ 2 ; Lomet, D 1 ; Caraty, A 1
1UMR Physiologie de la Reproduction et des Comportements, INRA-CNRS-
Université Tours/Haras Nationaux, 37380 Nouzilly, France ; 2 Department of
Physiology, Monash University 3800, Australia
The interval between the luteal regression and the preovulatory LH
surge is longer in high fecundity breeds like the Romanov (ROM),
than in breeds with lower fecundity, like the Ile de France (IF). This
difference in the surge onset persists when ovariectomized (OVX)
ewes of the two genotypes are challenged with an exogenous estradiol
(E) signal (Ben saïd et al, 2007). It has been suggested (Clarke, 1995)
that the preovulatory LH surge is the result of a coordinated positive
effect of E on the brain and pituitary and we hypothesized that a time
difference in the increase of pituitary sensitivity to E may exist
between the two breeds.
To test this hypothesis, we utilised the model of OVX Hypothalamo-
Pituitary-Disconnected (HPD) ewes receiving regular GnRH pulses
and monitored the effect of a preovulatory E signal on the LH
pituitary response in both genotypes during 2 successive artificial
cycles. Pituitary responsiveness was maintained with hourly i.v
injections of 250 ng GnRH (cycle 1) or 500 ng GnRH (cycle2),
throughout the experiment. After 12 days treatment with vaginal
progesterone implants, and 24 h after removal, a preovulatory E signal
was given (s.c. insertion of 2 x 3cm E implants) to the two genotypes
(4 ROM, 5 IF). LH secretion was monitored by sampling jugular
blood every 10 min for 30 h starting 4-5 h before E administration.
Before the E signal, and for the two GnRH doses, the amplitude of the
LH pulses was higher in ROM ewes compared to IF ewes (1.3 ± 0.2
ng/ml vs 0.5 ± 0.1 ng/ml for 250 ng/pulse (P< 0.05) and 2.1 ± 0.1
ng/ml vs 1.0 ± 0.0 ng/ml (P< 0.01) for 500 ng/pulse respectively,
values are mean ± SEM). Interestingly, around 10 h after E insertion
and for the two breeds, an increase in LH concentration occurs
resulting of both an increase of the basal level and of the GnRHinduced
pulses amplitude. Therefore, this E induced “LH discharge”
occurred earlier in the OVX-HPD-ROM ewes than in OVX-ROM
ewes treated by the same E signal.
In summary our results show that in the absence of hypothalamic
input, but with stable GnRH input, the increase in pituitary sensitivity
occurs earlier than in Hypothalamo-Pituitary-Intact animals and this
difference of timing is more pronounced in ROM ewes. The likely
explanation is that the latency to the onset of the LH surge is timed by
a negative feedback effect of E at the hypothalamic level which is
longer operative in ROM ewes. A possible role of other inhibitory
factors of hypothalamic or pituitary origin cannot be totally excluded.
P349
Transgenic domestic cloned kittens produced by
lentivector-mediated transgenesis
Gómez, MC 1 *, Pope, CE 1 , Kutner, R 2 , Ricks, DM 2 , Lyons, LA 3 , Truhe, M 3 ,
Dresser, BL 1 , Reiser, J 2
1Audubon Center for Research of Endangered Species, Audubon Nature
Institute, United States; 2 Department of Medicine, Gene Therapy Program,
Louisiana State University, United States; 3 School of Veterinary Medicine,
University of California Davis, United States
Introduction The domestic cat exhibits 90% homology to putative
genes of humans. Domestic cats carrying mutant human genes
associated with hereditary diseases would provide a powerful tool for
studying human disorders and developing gene therapy strategies. In
the present study, we evaluated 1) whether domestic cat cloned
blastocysts reconstructed with donor cells transduced with eGFPencoding
LV-vector carrying the human ubiquitin (hUbC) promoter
expressed the incorporated transgene and, 2) the in vivo viability of
transgenic cloned embryos after transfer into recipients.
Materials and methods High titer stocks of eGFP-encoding LVvectors
bearing hUbC promoter were generated for transduction of
donor cells. Domestic cat fetal fibroblasts (CFF) were infected
overnight with 82.000.000 IU/ml of a LV-UbC-eGFP vector stock.
Mature oocytes collected from cat donors were enucleated and a
single eGFP-positive CFF was introduced into the perivitelline space
of each oocyte. Fusion was induced by applying two electrical pulses
and fused couplets were activated 2 h later and placed in culture.
Transgene expression in cloned embryos was evaluated by observing
green fluorescence of blastomeres (Days 2, 5, and 8). To analyze LVvector
copies, qPCR quantification was performed on genomic DNA
derived from single blastocysts. A total of 186 transgenic cloned
embryos were transferred by laparoscopy to the oviduct of five
synchronous domestic cat recipients. The recipients were examined by
ultrasonography on day 22 to determine pregnancy status.
Results Cleavage rate (D2; 44/52=85%) and blastocyst development
(D8; 5/44=11%) of reconstructed embryos with hUbC promotercontaining
LV vectors was similar to those obtained previously with
hCMV-IE and hEF1 alpha promoter-containing LV vectors. On day 2,
32% of the cloned embryos expressed green fluorescence, and by day
5, the percentage of embryos expressing the eGFP transgene increased
to 41%. By day 8, all embryos displayed sustained transgene
expression and blastocysts (n=5) exhibited green fluorescence. In
blastocysts, each blastomere carried from 0.7 to 4 copies of the
provirus. Two (40%) recipient cats were pregnant when examined on
day 22. Five embryos (2.7%) had implant in two recipients. Three
fetuses were reabsorbed by day 39 and two near-term died in utero on
day 55 of gestation. The clonal status of the transgenic cloned kittens
was assessed by a standardize DNA identification panel for cats.
eGFP transgene expression was detectable by fluorescence imaging of
cloned kittens.
P350
Ontogeny of the daily rhythm in plasma melatonin
concentrations during postnatal development in wild and
domestic ewes
Gómez-Brunet, A 1 *; Santiago-Moreno, J 1 ; Chemineau, P 2 ; Malpaux, B 2 ;
Lopez-Sebastian, A 1
1Departamento de Reproducción Animal, SGIT-INIA, Madrid, Spain;
2Physiologie de la Reproduction et des Comportements, UMR INRA-CNRS-
Université de Tours-Haras Nationaux, Nouzilly, France
In seasonal reproductive species, melatonin, hormone synthesized and
released into the general circulation with a marked day-night rhythm,

16 t h International Congress on Animal Reproduction
Poster Abstracts 143
transduces photoperiodic information to regulate reproduction. In
ewes, melatonin secretion is under genetic control and an early pineal
function is important for the induction and timing of puberty. The
European mouflon (Ovis orientalis mussimom), is a wild sheep which
has a close phylogenetic relationship with the current domestic sheep
breeds (Ovis aries). This wild sheep, reaches puberty 2-3 months later
than most domestic ewes originating from and living at similar
Mediterranean latitudes, suggesting the possibility of differences in
the ontogeny of melatonin secretory rhythm between wild and
domestic types of ewes. This study examines the patterns of melatonin
secretion from birth to 32 weeks of age in Mouflon (n=7) and Merino
(n= 6) female lambs born in March. Lambs were kept under natural
day-length conditions (latitude 40º 25`N). They were bled (3ml) once
a day after birth, once a week from 1 to 6 weeks of age and then at 8,
10, 12, 16, 20, 24, 28 and 32 weeks of age. From one day to 4 weeks
of age, four blood samples were taken at hourly intervals, during the
night (from 23:00 to 02:00 h) and then during the following day (from
10:00 to 13:00h). Thereafter, from 5 to 32 weeks of age, only the
night-time blood samples were collected. A mean (± S.E.M) day/night
(D/N) difference in plasma melatonin concentrations with higher
values at night was evident as early as the day following birth in
Merino ewe lambs (D: 5,9 ± 1,0 vs N: 22,0 ± 3,3 pg/ml, P0.05). In Mouflon lambs, day/night differences were detected by 1
week of age (4,9 ± 0,3 vs 56,9 ± 15,3). ANOVA revealed a significant
effect of the breed (P< 0.05) and of age (P< 0.01) on the mean nighttime
plasma melatonin concentrations. In both types of lambs,
nocturnal plasma melatonin concentration increased between 1 and 32
weeks of age; however, the concentrations were lower in Merino than
in Mouflon lambs. This difference was detected as early as the first
week of age (Merino lambs: 22, 0 ± 5, 8 vs Mouflon lambs: 56, 9 ±
15, 3 pg/ml) and was maintained until 32 weeks of age (Merino
lambs: 230,4 ± 42,9 vs Mouflon lambs: 287,6 ± 36, 3 pg/ml). These
results demonstrate the existence of differences in the ontogeny of
melatonin secretory rhythm and in the amplitude of nocturnal plasma
melatonin concentrations between wild and domestic ewes.
P351
Characteristics of prolactin secretion by salsolinol in
ruminants
Hashizume, T 1 *, Shida, R 1 , Onodera, Y 1 , Isobe, E 1 , Sawai, E 1 , Kasuya,l E 2 ,
Oláh, M 3 and Nagy, GM 3
1Faculty of Agriculture, Iwate University, Morioka, Japan; 2 Laboratory of
Animal Neurophysiology, National Institute of Agrobiological Science,
Tsukuba, Japan; 3 Neuromorphological and Neuroedocrine Laboratory,
Department of Human Morphology, Hungarian Academy of Science and
Semmelweis University, Budapest, Hungary
Prolactin (PRL) secretion is under a dominant and tonic inhibitory
control of dopamine (DA); however, recently, it has been reported
that salsolinol (SAL), a DA-derived compound, is a putative
endogenous PRL-releasing factor in rats. More recently, our group has
also demonstrated that SAL is able to stimulate the release of PRL
both in vivo and in vitro in ruminants. On the other hand side, it is
well known that the secretion of PRL is stimulated by thyrotropinreleasing
hormone (TRH). The aim of the present study was to clarify
the some characteristics of PRL secretion induced by SAL in
ruminants. A series of intravenous (i.v.) injections of SAL or TRH
were given to goats with 2-hrs intervals for 6 hrs period, and secretory
responses to each secretagogue were compared. Interactions between
SAL, TRH and DA on PRL secretion were also examined in goats.
PRL-releasing responses to three consecutive i.v. injection of SAL (5
mg/kg body weight (b.w.)) or TRH (1 μg/kg b.w.) at 2-hrs intervals
increased plasma PRL levels after each injection (P

16 t h International Congress on Animal Reproduction
144 Poster Abstracts
immunohistochemistry. Exposure to ewes stimulated an increase in
LH pulse frequency (0.19 ± 0.12 vs. 0.75 ± 0.14 pulses/h; P < 0.01),
mean concentration of LH (0.16 ± 0.06 vs. 0.53 ± 0.21 ng/mL; P <
0.05) and basal concentration of LH (0.08 ± 0.01 vs. 0.13 ± 0.01
ng/mL; P < 0.05). Exposure did not affect LH pulse amplitude (0.55 ±
0.15 vs. 0.55 ± 0.15 ng/mL; P > 0.1). In Control rams, there was no
change (P > 0.1) in LH pulse frequency (0.25 ± 0.10 vs. 0.25 ± 0.10
pulses/h), mean concentration of LH (0.15 ± 0.03 vs. 0.11± 0.01
ng/mL), basal concentration of LH (0.08 ± 0.02 vs. 0.12 ± 0.02
ng/mL) or LH pulse amplitude (0.62 ± 0.09 vs. 0.70 ± 0.09 ng/mL).
Preliminary analysis of the histology indicates that Ewe-exposed rams
have a greater number of Fos-immunoreactive cells in the
ventromedial hypothalamus, and probably other regions, than Control
rams. This result corresponds with studies in the ewe that have
identified neural activation in the ventromedial hypothalamus of ewes
following stimulation by rams (1). 1. Gelez H, Fabre-Nys C. Neural
pathways involved in the endocrine response of anestrous ewes to the
male or its odor. Neuroscience 2006;140: 791-800. 2. Rosa HJD,
Bryant MJ. The 'ram effect' as a way of modifying the reproductive
activity in the ewe. Small Ruminant Research 2002;45: 1-16.
P354
Plasmatic thyroxine and triiodothyronine concentrations
in non-pregnant, pregnant and lactating Saanen breed
goats
Greco, G 1 *; Baldini, L 1 ; De Paula, M 1 ; Bittencourt, RF 1 ; Maia, L 2 ; Oba, E 1
1Department of Animal Radiology and Reproduction, São Paulo State
University -UNESP - Botucatu, Brazil; 2 Department of Veterinary Clinics and
Pathology, Fluminense Federal University -UFF, Brazil
Thyroid hormone receptors are expressed in most of the animal
tissues, being responsible for activating biochemical reactions and
organic responses. In pregnant goats, these hormones are essential for
normal fetal development and organogenesis and, during the
lactational period, they stimulate galactopoiesis. As in sheep, thyroid
hormones seem to be involved regulating reproductive sazonality in
the caprine species. In comparison to other ruminants, few studies
have been published regarding the variations in the concentrations of
thyroxine (T4) and triiodothyronine (T3) in goats, according to their
reproductive state. The present work had as objective to determine the
plasmatic concentrations of T3 and T4 in non-pregnant, pregnant and
lactating Saanen breed goats. Forty-three female Saanen goats, aging
24 to 32 months, were assigned into three different groups. Group 1
was composed of 15 non-pregnant goats. Thirteen goats experiencing
their last month of pregnancy were assigned to group 2. As for group
3, it was composed of 15 lactating goats, whose kids were at most one
month old. Blood was collected from animals through jugular
venipuncture into tubes containing heparin, which were centrifugated
at 3000 x g for 15 minutes. Plasma obtained was stored at – 20
degrees Celsius. T3 and T4 concentrations were estimated through
radioimmunoassay, using Diagnostic Products Corporation® (DPC)
kits. The obtained data was statistically analyzed through the
Statistical Analysis System®, version 6.1, 1996. Concentrations of T3
and T4 were compared between the groups using the Student-
Newman-Keuls test. The correlation between T3 and T4 measured
concentrations was established using the PROC CORR procedure.
Significance levels were set as P < 0.05. A highly significant (P <
0.01) positive correlation was found between T3 and T4 overall
concentrations. Mean T3 concentrations were 150.08 ng/dL +/- 46.7,
108.48 ng/dL +/- 41.1 and 171.55 ng/dL +/- 38.3 in groups 1, 2 and 3,
respectively. Pregnant goats had lower (P < 0.05) T3 concentrations
than lactating and non-pregnant animals. As for T4, mean
concentrations were, respectively, 5.40 μg/dL +/- 1.38, 3.76 μg/dL +/-
1.05 and 6.51 μg/dL +/- 1.43 in groups 1, 2 and 3. Lactating goats had
higher (P < 0.05) T4 concentrations than non-pregnant animals. T4
concentrations obtained from pregnant goats were significantly lower
(P < 0.05) than those in the remaining groups. In conclusion, T3 and
T4 concentrations are lower in pregnant Saanen goats, being the
concentration of T4 higher during the lactational period.
P355
Salsolinol as a hypothalamic neurotransmitter stimulating
prolactin release during suckling in ewes
Misztal, T 1 *; Gorski, K 1 ; Tomaszewska-Zaremba, D 2 ; Molik, E 3 ; Romanowicz,
K 1
1Department of Endocrinology, 2 Department of Neuroendocrinology, The
Kielanowski Institute of Animal Physiology and Nutrition in Jablonna, Poland;
3Department of Sheep and Goat Breeding, Agricultural University in Cracow,
Poland
Introduction Salsolinol is a dopamine-derived, endogenously
synthesized compound associated mainly with dysfunction of
dopaminergic neurons. Recent data suggest, however, that salsolinol
may also be involved in the dopaminergic regulation of prolactin
secretion. It has been shown that in rats, the brain salsolinol
concentration is elevated during situations when pituitary prolactin
secretion is increased. In the present study, we hypothesized that
salsolinol was present in the infundibular nucleus-median eminence
(IN/ME) of lactating ewes and that its extracellular concentration in
the IN/ME increased in response to suckling, similarly to the plasma
prolactin concentration. The second hypothesis was that exogenous
salsolinol, infused into the third ventricle (IIIv) of the brain, could
stimulate prolactin secretion in lactating ewes.
Material and Methods Stainless steel guide canullae were implanted
under stereotaxic control into the IN/ME (n=6) or into the IIIv (n=10)
through a drill hole in the skull in the second moth of pregnancy and
two experiments were performed during the fifth week of lactation. 1)
Perfusions of the IN/ME with Ringer-Locke solution were performed
in ewes bilaterally, from 10:00 h to 15:00 h, by the push-pull method
and were divided to the non-suckling and suckling periods, both for
2.5 h. At least 9 or 10 perfusates were collected during perfusion. 2)
Pulsatile infusions of salsolinol (5 x 1 μg/20 μl, n=5) or vehicle (n=5)
into the IIIv were performed from 12:30 h to 15:00 h, corresponding
to the suckling period in perfused ewes. The preinfusion period was
from 10:00 h to 12:30 h. In both experiments, plasma samples were
collected every 10 minutes, through a catheter inserted into the jugular
vein. The perfusate concentration of salsolinol and plasma
concentration of prolactin were assayed by HPLC and RIA,
respectively.
Results The presence of salsolinol, but not dopamine, was detected in
the perfusates collected from the IN/ME of lactating ewes. Perfusate
salsolinol concentrations during the non-suckling period vs. suckling
period were 56.82 ± 13.78 vs. 150.08 ± 16.85 pg/50 μl (mean ± SEM,
P

16 t h International Congress on Animal Reproduction
Poster Abstracts 145
Materials and methods Four group including eight adult male
Balb/C mice weighing 30 5g were used in this study. Normal saline
administered as placebo to control group and saffron extract in doses
of 25 , 50 and 100 were injected intraperitoneally for 20 days to
experimental groups. FSH, LH and testosterone in serum samples,
were measured by ELISA.
Results In comparison with plasebo the level of FSH, LH and
testosterone significantly increased in 100 saffron treated group, but
no significant differences were observed between other treatments and
placebo.
The results of this study indicate the efficacy of saffron extract in the
male reproductive endocrine function, and showed that it can modify
the reproduction activities.
Discussion The results of this research show that the extract of saffron
in the mass of 100mg/kg has an important effect on level of FSH and
LH and testosterone hormone. Saffron can have a key role in
increasing the generative power in male mice.
Poster 13 - Molecular Biology of Reproduction
P357
Goat as model for studying ovarian differentiation in
mammals
Auguste, A*; Montazer-Torbati, F; Kocer, A; Pannetier, M; Renault, L;
Mandon-Pepin, B; Cotinot, C; Pailhoux, E
INRA – UMR Biologie du Développement et Reproduction – 78350 Jouy en
Josas - France
In mammals, once the chromosomal sex XY or XX is set up at
fertilization, the presence of SRY gene (Sex-determining Region of Y)
will determine the fate of the gonad by initiating testis differentiation.
Following SRY expression, SOX9 the key testis differentiating factor
is up-regulated in the embryonic XY gonad thus triggering testis
differentiation. In the female counterpart, key genes for ovarian
differentiation have been isolated from genetics studies of female-tomale
XX sex-reversal. Three loci fit in the class of early ovarian
differentiating factors, the PIS locus (Polled Intersex Syndrome)
discovered in goat, RSPO1 in human and Wnt4 in mouse.
In goat, the pleiotropic PIS mutation leads to a phenotype without
horn in both sexes (dominant) and to a female-to-male sex-reversal in
all XX individuals homozygous for the mutation (recessive). This
mutation is a 11.7 kb deletion encompassing any genes, but acting on
the transcriptional regulation of at least 3 genes, PISRT1, PFOXic and
FOXL2, lying at 25 kb (PISRT1) and 300 kb (PFOXic/FOXL2) apart
the deletion. When the PIS region is present (PIS +/+ and PIS +/-
individuals), the 3 genes are highly expressed in the developing ovary,
from the onset of their differentiation. This expression is abolished in
the ovaries of XX fetuses homozygous for the deletion (PIS -/- ).
Concomitantly, the expression of SOX9 increased in these mutant
gonads and the first histological sign of sex-reversal appeared. So, it
seems that one of the PIS-regulated genes have an “anti-testis” effect.
Among the three genes, only FOXL2 encodes a conserved protein
belonging to the fork-head box family of transcription factors.
In order to better understand the role of these 3 genes, we have
restored PISRT1 expression in XX PIS -/- gonad of transgenic goats. As
no effect on the sex-reversal phenotype was observed, our current
working hypothesis is that FOXL2 is the only gene of the PIS locus
responsible for both pathological phenotypes. However, Foxl2
invalidation in mouse leads to an early block of follicle formation but
not to sex-reversal. Consequently, we hypothesize that FOXL2/Foxl2
could have additional roles in goat during the early stages of ovarian
differentiation, a period that is clearly different between goat and
mouse. By contrast to mouse, goat fetal ovaries show an early spatial
organization and produce estrogens under the control of FOXL2
before germ cell meiosis. In order to definitely precise the role of
FOXL2 in ovarian differentiation of non-rodent mammals, FOXL2
invalidation is currently under process in goat.
P358
Identification of genes expressed during sheep ovarian
development
Baillet, A*; Mandon-Pepin, B; Cabau, C; Poumerol, E; Pailhoux, E; Cotinot, C
INRA, UMR 1198; ENVA; CNRS, FRE 2857 Biologie du Développement et
Reproduction, Jouy-en-Josas, F 78350, France
In mammals, several genes involved in ovarian development have
been identified but the molecular cascade leading to a functional
female gonad remains poorly documented. Although, in the last
decade, progress has been made towards the identification of genes
controlling ovarian differentiation using transcriptomic approaches
and gene inactivation, most of theses studies have been achieved in
mouse.
The aim of this work is to identify genes involved in the two main
steps of ovarian development in sheep, germ cells meiosis and follicle
formation. In contrast to rodents both steps occur during fetal period
in several mammals (human, sheep, pig) promoting sheep as a good
model to study human ovogenesis and early folliculogenesis.
For this study, we used suppressive subtractive hybridization allowing
isolation of genes differentially expressed between two developmental
stages. This technique was used in order to compare two ovarian
developmental stages in sheep: 55dpc (onset of prophase I) and 82dpc
(first follicle formation).
Two subtractive libraries (55/82; 82/55) were constructed and 7296
clones were recovered. Among them, 6080 clones were sequenced.
Using SIGENAE bioinformatics facilities, clones sharing sequence
homology were grouped into 2090 unique contigs. Then all contigs
were blasted against databases of different mammalian species
(human, bovine and ovine) and annotad. In both libraries, 99% of
contigs have an Unigene annotation and 1% were unknown.
The comparison of the meiosis library contigs with another study of
SSH concerning mouse male germ cells revealed 30 genes in common
with our library. We have investigated the possible involvement of
these 30 transcripts in female meiosis by RT-PCR. Two of them were
never described in female and presented a differentially expression
pattern.
Their expression profile was performed by RT q-PCR in female and
male gonads during fetal life in sheep. Both genes showed a high
expression level during female meiosis I while their expression
remained low in male and during the other stages of ovarian
development.
Further investigations such as chromosomal localisation in sheep,
expression pattern in mouse gonads, cell type origin are currently in
progress for these two genes. Moreover, investigations of the
folliculogenesis library are in under progress. In parallel, these 2090
genes will be spotted on a nylon membrane to constitute a macroarray
dedicated to the ovine ovarian differentiation, in order to evaluate
sheep ovarian expression profiles in different physiological or
physiopathological conditions.
P359
Changes in gene expression of mouse blastocysts
treated with high hydrostatic pressure pulse
Bock, I 1 *; Mamo, S 2 ; Polgar, Zs 3 ; Pribenszky, Cs 4
1BioTalentum Ltd., Hungary; 2 Genetic Reprogramming Group, Agricultural
Biotechnology Center, Hungary; 3 Faculty of Natural Sciences, Constantine
the Philosopher University, Slovakia; 4 Faculty of Veterinary Science, St.
István University, Hungary
High hydrostatic pressure (HHP) treatment of mouse blastocysts
before vitrification was reported to increase their post-warming in
vitro developmental competence. Similarly, HHP treatment of
gametes or embryos has proved to increase substantially the efficacy
of the subsequent processes such as vitrification of porcine oocytes, in
vitro produced bovine or cloned pig embryos, somatic cell nuclear
transfer in pig, bull and boar semen cryopreservation. Proteomic
studies have revealed changes in the protein profiles of boar
spermatozoa that may relate to increased post-thaw survival and
fertility. Here we report the first results of HHP induced alterations in
the gene expression of mouse blastocysts.

16 t h International Congress on Animal Reproduction
146 Poster Abstracts
F1 (B6D2) female mice were superovulated and mated with DBA
males. Early blastocysts were collected from pregnant females and
cultured in KSOM till the expanded blastocyst stage, that were loaded
into 0.25 ml ministraws with CZB-Hepes. Embryos were treated with
600 bar pressure for 30 min at 23 ºC in a computer controlled
pressurizing device (Cryo-Innovation Inc., Budapest, Hungary).
Embryos were collected immediately and 120 min after the treatment.
Then, mRNA was isolated and cDNA prepared for real-time PCR
analyses.
To assess the change in gene expression profiles, nine stress related
genes and two reference genes (H2afz, and Ppia) were selected.
Primers were designed, optimized and standards prepared for real
time PCR analyses. Based on the analyses, the genes Azin1, Gas5,
Gadd45g and Sod2 were up-regulated (mean±SD) 1.88±0.25,
1.55±0.36, 1.47±0.59 and 1.41±0.25 fold, respectively after
hydrostatic pressure treatment, compared to the levels of the same
genes in the untreated control. All studied genes, but Gadd45g, have
returned to the control expression levels after 120 minutes culture.
The up-regulation of Gadd45g (1.92±0.60 fold) shows that
hydrostatic pressure has a prolonged effect on the transcription of this
gene. H2afz and Ppia genes were not significantly affected (P>0,05)
by the treatment, and this supports our previous results on the stable
expression of these genes during mouse preimplantation development.
This study demonstrates, for the first time, that HHP activates certain
stress related genes in the mouse embryo. The effects don’t
compromise developmental competence of the blastocysts, moreover
it may contribute to increased survival rates at the subsequent
cryopreservation.
Supported by OMFB-00364/2007 and NKTH/KPI Kozma F.
TUDAS-1-2006-0005
P360
Sexing in vitro produced bovine embryos with semen
selected by percoll or swim-up
Wolf, C 1 , Brass, KE 2 *
1Equine Reproduction, Federal University of Rio Grande do Sul, Brazil; 2 Large
Animal Clinics, Federal University of Santa Maria, Brazil
Preimplantation genetic diagnosis (PGD) is becoming a current issue
in animal reproduction biotechnology due to economical reasons.
Predetermining the sex of offspring is one example of PGD. This
study aimed to determine the percentage of male and female bovine
embryos in vitro produced after oocyte fertilization with Percoll
density gradient centrifugation or with self-migration (swim-up)
selected semen. In experiment 1, sperm selection was performed by
90%-45% discontinuous Percoll density gradient centrifugation (T1)
and swim-up (T2). In experiment 2, along side the discontinuous
gradient, a 67.5% continuous density gradient, and centrifugation time
of 5 and 10 minutes were used. A total of 4 treatment groups was
defined (TI = continuous, 5 minutes, TII = discontinuous, 5 minutes,
TIII = continuous, 10 minutes and TIV = discontinuous, 10 minutes).
Polymerase chain reaction (PCR) was used to determine the sex of the
embryos. T1 (n=185) resulted in 48.65% (n=90) male embryos and
51.35% (n=95) female embryos and T2 (n=142) in 58.45% (n=83)
male and 41.55% (n=59) female embryos. In experiment 2, the
percentages of male and female embryos obtained in TI (n=93), TII
(n=70), TIII (n=82) and TIV (n=82) were 49.46% (n=46) and 50.54%
(n=47), 57.14% (n=40) and 42.86% (n=30), 36.59% (n=30) and
63.41% (n=52) and 48.78% (n=40) and 51.22% (n=42), respectively.
There was no difference on the percentage of males and females in all
treatment groups from experiments 1 and 2 when these were
individually compared to the expected percentage of 50% of each sex.
There was also no difference in male and female embryo percentage
between treatment groups in experiments 1 and 2.
P361
Granulocyte-macrophage colony-stimulating factor (GM-
CSF) enhances glucose uptake in bovine granulosa cells
Bücher, DD 1 *, Castro, MA 1 , Beltrán, F 1 , Correa, JE 2 , Concha, II 1
1Instituto de Bioquímica, Universidad Austral de Chile, Chile; 2 Instituto de
Reproducción Animal, Universidad Austral de Chile, Chile
The granulocyte-macrophage colony stimulating factor (GM-CSF) is
a pleiotropic cytokine capable of stimulating proliferation, maturation
and function of hematopoietic cells. Receptors for this cytokine are
composed of two subunits alpha and beta and are expressed on
myeloid progenitors and mature mononuclear phagocytes, monocytes,
eosinophils and neutrophils, as well as in other nonhematopietic cells.
We have previously demonstrated that bull spermatozoa express
functional GM-CSF receptors that signal for increased glucose and
vitamin C uptake and enhance several parameters of sperm motility in
the presence of glucose or fructose substrates. The ovarian follicular
development involves a complex exchange of endocrine signals
between the hypothalamic-pituitary-ovarian system and within each
ovarian follicle in a cell to cell interaction that precisely coordinates
the process in a paracrine or autocrine manner. It is possible to assume
that GM-CSF plays a fundamental role during folliculogenesis. The
aim of the present work was to analyze the expression of GM-CSF
receptors in bovine granulosa cells of follicles at different
developmental stages and study the effect of GM-CSF on glucose
uptake by these cells. Immunolocalization and immunoblotting
analysis demonstrated that both subunits of GM-CSF receptors are
expressed in granulosa cells at an early stage of development up to
preovulatory stage of folliculogenesis. Using functional analysis with
2-D-3H-deoxyglucose we demonstrated that this cytokine enhances
glucose uptake via facilitative hexose transporters (GLUTs) in
granulosa cells isolated from follicles up to 6 mm in diameter
cultivated under serum free conditions for 24 hours. The results
suggest that GM-CSF interacts with factors present in the ovarian
environment such as IGF-I and FSH, modulating the process of
folliculogenesis. (MECESUP; DID D-2006-24; Escuela de
Graduados, Facultad de Ciencias Veterinarias; FONDECYT
1060135).
P362
Effect of undernutrition and pregnancy on hepatic and
adipose tissue gene expression
Carriquiry, M 1 *, Sosa, C 2 , Abecia, JA 2 , Forcada, F 2 , Meikle, A 1
1Facultad de Agronomia-UDELAR, Uruguay; 2 Facultad de Veterinaria,
Zaragoza, Spain
Undernutrition decreases embryo survival and pregnancy rates in
ewes. The effect of plane of nutrition and physiological status (cyclic
or pregnant) on hepatic and adipose tissue mRNA expression of genes
involved in the somatotropic axis and leptin was investigated.
Twenty-four ewes were fed either 1 or 0.5 times their maintenance
requirements, estrus-synchronized, and mated with intact (n=12) or
vasectomized (n=12) rams, to establish four treatment groups in a 2 x
2 factorial combination of plane of nutrition and physiological status.
Ewes were slaughtered at day 14 of estrous cycle or pregnancy (Day
0=estrus) The abundance of mRNA for growth hormone receptor
(GHR), GHR1A, insulin-like growth factor-I (IGF-I), leptin (LEP),
and an endogenous control (ribosomal protein L19; RPL19) was
measured by quantitative real time RT-PCR using SYBR Green.
Abundance of mRNA of target genes was normalized to RPL19 and
expressed in relative amounts to an external control (delta-deltaCT -
method). Data were analyzed using PROC MIXED (SAS Institute)
and considered to differ when P

16 t h International Congress on Animal Reproduction
Poster Abstracts 147
decreased by 30% with undernutrition. This diminished sensitivity to
GH in adipose tissue could result in reduced adipogenesis and
increased lipolysis. Leptin mRNA was highly correlated (r=0.68;
P

16 t h International Congress on Animal Reproduction
148 Poster Abstracts
were observed in the seminiferous tubules. The proliferation of germ
cells resumed and the differentiated spermatogonia appeared again at
6 weeks. The spermatogenesis was found to restore completely by 11
weeks after the injection. Among the proteins that reappeared
concomitantly with the spermatids, we focused on a protein migrated
to pI 4.0 and 66kDa on 2-D-gel. It was identified as a hypothetical
protein, NYD-SP26, by TOF-MS analysis. NYD-SP26 mRNA was
found to be specifically expressed in elongate spermatids at steps 10-
16 and its translates were first detected at step 13 and mainly localized
to the flagellar principal piece of the sperm. Furthermore it was found
that NYD-SP26 had calcium-binding properties.
Conclusions NYD-SP26 is a new member of the calcium-binding
proteins expressed in the elongate spermatids, which is subsequently
localized into the principal piece of flagella of matured sperm. These
data indicate that this protein plays a part of [Ca 2+ ] i signalling in
sperm.
P366
Identification of a novel ovine acrosome protein:
implications for sex-sorted spermatozoa
Leahy, T 1 *; Marti, JI 2 ; Evans, G 1 ; Maxwell, WMC 1
1REPROGEN, Faculty of Veterinary Science, The University of Sydney,
Australia; 2 CITA, Aragon, Spain
Sex-sorting subjects spermatozoa to numerous stressors. Sorted
spermatozoa are highly diluted and exposed to mechanical forces,
including propulsion into a collection tube at 90km/hr. This may
destabilise the sperm membrane by stripping proteins from its surface.
However, sorted ram spermatozoa have superior fertility to non-sorted
spermatozoa 1 as the sorting process gates out non-viable spermatozoa,
leaving a homogenous and possibly membrane-intact population. The
aim of this experiment was to detect differences in the membrane
protein profiles of a) viable sorted spermatozoa b) non-viable sorted
spermatozoa and c) non-sorted spermatozoa (control) and relate these
to variations in sperm function.
Semen was collected by artificial vagina (n= 3 rams), diluted in a
Tris-citrate-fructose buffer supplemented with 1% PVA and incubated
(1hr, 34°C) with 311uM Hoechst 33342. The incubated sample was
sorted to obtain a viable, non-viable and non-sorted (control)
population. The sperm samples were centrifuged (7500g, 5 min) to
obtain a pellet that was resuspended in membrane protein extraction
medium (2% SDS, 28% sucrose, 12.4mM TEMED, 185mM Tris
chloride) and incubated (100°C, 5 min). The incubated sample was
centrifuged (7500g, 5 min) and the proteins in the supernatant
analysed using one- and two-dimensional gel electrophoresis and
mass spectrometry.
A protein of 15kDa and isoelectric point of 4.99 was found in
abundance on the non-viable and non-sorted sperm membranes but
was not present on the membranes of viable spermatozoa. This protein
was identified as an intra-acrosomal, non-bacteriolytic, C lysozymelike
protein, termed SLLP1. This protein is exposed during the
acrosome reaction, and retained on the equatorial segment of the
sperm membrane. The absence of this protein in the viable, sorted
sperm population suggests that sex-sorting actively selects sperm that
are acrosome-intact. These results provide evidence that the sorting
process selects a superior, homogenous population of membraneintact
spermatozoa. This may explain why sorted spermatozoa survive
longer in the female tract than non-sorted spermatozoa and can
provide acceptable fertility rates with low-dose inseminations 1 . This
work was supported by XY Inc and the Major National Research
Facilities Program (Biomedical Node of the Australian Proteome
Analysis Facility). 1 de Graaf, S, et al. (2007) Reprod Dom Anim 42:
648-653
P367
The effect of VEGF on the change of P44/p42 MAP
kinases, Protein Kinase C and Protein tyrosine kinases of
ovine oocytes matured in vitro
Hailing, LUO 1 *, Xin, CAO 1 ,2, Ping, ZHOU 3 , Youzhang, ZHAO 2 , Guoqing,
SHI 3
1College of Animal Science and Technology, China Agriculture University,
Beijing 100094,P.R China; 2 College of Animal Science and Technology,
Gansu Agricultural University, Lanzhou 730070, P.R China; 3 Xinjiang
Academic of Agriculture and Reclamation Science, Shihezi, Xinjiang, 832000,
P.R China
P44/p42 MAP kinases (Erk1 and Erk2) and Protein Kinase C (PKC)
are mediate essential cellular signals required for activation,
proliferation, differentiation and survival. Protein Tyrosine Kinases
(PTKs) perform a critical role in signal transduction pathways that
control cell proliferation, differentiation, metabolism and apoptosis.
Our previous results proved that Vascular Endothelial Growth Factor
(VEGF) is a powerful mediator for vessel permeability and could
improve the quality of ovine oocyte maturation in vitro. In this study,
to investigate the effect of VEGF on the change of phosphorylation
ERKs, PKC and PTKs activity in ovine oocyte, 5 ng/ml VEGF was
supplied in media during maturation in vitro and the method of
ELISA was used to determine the ERKs, PKC and PTKs activities.
The results shown that the levels of phosphorylation ERKs, PKC and
PTKs activity in VEGF groups were higher than the without-VEGF
groups. Moreover VEGF was strongly enhanced the level of
phosphorylation ERKs and PKC activity but reduced PTKs activity
during the period of ovine oocyte maturation in vitro. The
phosphorylation levels of ERKs and PKC were slowly reduced from 0
hour to germinal vesicle breakdown (GVBD), subsequently
phosphorylation ERKs level rapidly rose when GVBD was
commencing and kept this higher level to MII phase, specially arrived
at top at 18 hours and 21 hours. Phosphorylation PKC level took on
fluctuant change but rose little by little and maintained high level at
MII phase, reached peak at 21 hours. The ERKs and PKC activity
reached the highest at 21 hour in vitro culture and descended again
from 21 hours to 24 hours but interestingly that the levels were mount
up again in the VEGF group at 24 hours compared to the control. The
level of PTKs activity rapidly lessened from 0 hour to GVBD,
fluctuant changed and kept low level during the residual period of
oocyte maturation, but reached high level at 21 hours. Protein tyrosine
kinase activity is often associated with membrane receptor protein
tyrosine kinases such as VEGFR. Phosphorylation of ERKs and PKC
by PTKs is essential for the regulation of oocyte maturation biological
mechanisms. It could hypothesis that activation of VEGFR-mediated
pathways occurs by supplying VEGF in ovine oocyte maturation
medium, which cross-link the VEGFR on the plasma membrane and
initiate receptor-mediated signaling pathways, leading to ERKs and
PKC activation by PTKs activity change. In conclusion, VEGF induce
the activation of ERK and PKC functions dependently of the
activation of PTKs, strongly supporting the view that VEGF could
enhance the ability of oocyte maturation.
Keywords VEGF, p44/p42 MAP kinases, Protein Kinase C, Protein
Tyrosine kinases, ovine oocyte
The present study was supported by National Natural Science
Foundation of China (No. 30371035)
P368
Mucin Gene Expression in the Equine Reproductive Tract
Maischberger, E 1 *, Irwin, J 1 , Cummins, C 1 , Duggan, V 1 , Carrington, S 1 ,
Corfield, A 2 , Reid, C 1
1Veterinary Sciences Centre, University College Dublin- School of Agriculture,
Food Science and Veterinary Medicine, Ireland; 2 Mucin research group,
University of Bristol, United Kingdom
Mucins, which are the principal gel-forming components of the mucus
gel, play an important role in lubricating, hydrating and protecting
mucosal surfaces. In particular, they contribute to a barrier against
microbial infection, toxins and other potentially harmful elements in
the supramucosal environment. We hypothesize that there are changes

16 t h International Congress on Animal Reproduction
Poster Abstracts 149
in the composition of the mucous layer of the endometrium/cervix of
mares with Persistent Post-Breeding Endometritis
(PPBEM)/Ascending Placentitis (AP), which affect normal barrier
function at these sites. Both of these conditions cause considerable
economic losses to the Irish equine bloodstock industry. PPBEM
manifests as a failure to clear semen, exogenous contaminants and
bacteria from the endometrium after breeding, leading to an embryotoxic
environment and failure to conceive. In AP, the cervical mucus
plug is breached by invading microorganisms late in pregnancy,
inducing abortion or premature birth. In an attempt to address this
hypothesis, our initial objective has been to determine the expression
of mucin genes within the reproductive tract of the mare. The
expression of the mucin proteins is encoded by approximately 20
genes and is under the influence of steroid hormones during the
oestrus cycle. We surveyed 16 mucin genes of the normal equine
vagina, cervix, endometrium and uterine tube during oestrus (n=6)
and dioestrus (n=12). Orthologues of human mucin genes were
identified in the horse genome and their expression determined by
PCR and agarose gel-electrophoresis. MUC1, a membrane-bound
mucin, and MUC2, a secreted mucin, are expressed in the human and
equine reproductive tract. MUC3 appears to be expressed in the
equine endometrium only during dioestrus, while MUC5B is
expressed only during oestrus. MUC5AC is one of the secreted
mucins that are expressed in very low concentrations in the human
reproductive tract and it is expressed in the equine lung. However, it
is not expressed in the equine reproductive tract. MUC7, which is not
expressed in the human reproductive tract, is expressed in the mare.
This study provides baseline data for normal mares and for future
comparison with mares affected by PPBEM or AP. Future work will
include real time PCR and in- situ hybridisation to determine gene
expression levels and tissue distribution within the reproductive tract
throughout the oestrus cycle in healthy and diseased mares.
P369
Endometrial expression of IGF-I, IGF-II and IGF-1R
throughout the cow oestrous cycle
Meikle, A 1 *, Carriquiry, M 2 , Chalar, C 3 , Sanguinetti, C 3 , Abreu, C 3 , Crespi, D 1 ,
Cavestany, D 1
1Laboratory of Nuclear Techniques, Veterinary Faculty of Uruguay,
Uruguay; 2 Agronomy Faculty, Uruguay; 3 Sciences Faculty, Uruguay
The insulin-like growth factor (IGF) system is expressed in bovine
uterus during the estrous cycle and early pregnancy and plays an
important role in regulating the development of the embryo and
uterus. IGF-I and -II mediate their effects through the type 1 IGF
receptor (IGF-1R). In this study, the expression of the IGFs and IGF-
1R was determined on endometrial transcervical biopsies collected on
days 0 (oestrus), 5, 12 and 19 of the cow oestrous cycle (n = 8). The
abundance of mRNA of IGF-I, IGF-II, IGF-1R, and an endogenous
control (ribosomal protein L19; RPL19) was measured by quantitative
realtime RT-PCR using SYBR Green. Abundance of mRNA of target
genes was normalized to RPL19 and expressed in relative amounts to
an external control (ΔΔCT -method). Results were analyzed with a
repeated measures analysis (PROC MIXED of SAS) and considered
to differ when P < 0.05. The expression of RPL19 mRNA did not
throughout the oestrus cycle. Endometrial expression of IGF-I mRNA
was the greatest at oestrus and day 5 (100%), and decreased to 47%
and 35% of the initial values on days 12 and 17, respectively.
Abundance of IGF-II mRNA peaked at day 12 and decreased sharply
thereafter (to one third of day 12 values). Interestingly, IGF-1R
mRNA expression showed the same pattern during the oestrous cycle
that IGF-II mRNA. IGF-1R mRNA showed reduced expression at
oestrus and day 5, increased by 1-fold on day 12, and decreased on
day 17 to values similar to the oestrus ones. These results show that
these IGF system components are distinctively regulated during the
oestrous cycle suggesting that modulation of IGF system may
influence uterine activity during this period. The earlier and later
increases found on IGF-I and IGF-II respectively, suggest a
differential role of these hormones on the early/late blastocyst and/or
on the regulation of uterine function. The increase in the uterine
sensitivity to IGFs during the late luteal phase – by IGF-1R
expression- may reinforce the role of IGF-II during the early
pregnancy.
P370
Regulation of Lefty2 in the oviduct of cyclic, pregnant,
and pseudopregnant rats.
Argañaraz, ME 1 , Valdecantos, PA 2 , Miceli, DC 1 *
1Instituto Superior de Investigaciones Biológicas, CONICET, Argentina;
2Facultad de Bioquímica,Cátedra de Biología Celular, Universidad Nacional
de Tucumán, Argentina
Transforming growth factor beta superfamily members are closely
associated with tissue remodeling events and reproductive processes,
being involved in the embryo development and in the maternalembryo
cross-talk. Moreover, transforming growth factor beta and
their receptors were found in the preimplantation embryo and the
reproductive tract (oviduct and uterus). Lefty2 an unusual member of
this family has been implicated in the regulation of other transforming
growth factor beta members such as nodal, activin, bone morphogenic
proteins and transforming growth factor beta 1 via cryto co-receptors
and by an antagonic mechanism. To date, the presence and regulation
of Lefty2 in the rat oviduct have not been described yet. The aim of
the present study was to investigate the expression of Lefty2 and its
co-receptor (crypto) in the oviduct. RNA; oviductal proteins and
tissues were collected from cyclic non-pregnant, pregnant, and
hormonally-induced pseudopregnant rats. Lefty is a pre-proprotein of
42 kDa that is proteolytic activated to a mature form of 26 kDa.
Lefty2 proteins were detected by western blots in the oviduct of
cyclic, pregnant, and pseudopregnant rats but were not influenced by
the estrous cycle. During early pregnancy, Lefty2 mature form was
significantly higher at day 4 (when the embryo is still in the oviduct)
and then it was gradually decreased while the pre-proprotein had not
significant modifications. During pseudopregnancy, both form of
Lefty2 protein were found at very low levels, without variations.
Crypto transcripts, analyzed by semi-quantitative RT-PCR, were
detected in the oviduct in the three studied conditions. Crypto
expression levels were increased at day 4 of pregnancy, as we have
reported for the lefty2 protein. Neither the estrous cycle nor the
pseudopregnancy showed variation in the crypto gene expression
pattern. These results suggest that Lefty2 and crypto are present in the
rat oviduct during pregnancy; that Lefty2 could act along a paracrine
pathway by binding to specific receptors on oviductal cells and that
their expression could be independent of steroid regulation. The
secretion of Lefty2 could be important for the embryo maintenance
during its pass through the oviduct.
P371
Oog1 is a maternal effect gene required for the
development of mouse preimplantation embryo
Minami, N 1 *, Imaichi, H 1 , Tsukamoto, S 2 , Ohta, Y 3 , Kito, S 3 , Kimura, K 4 , Imai, H
1Lab. Reproductive Biology, Kyoto University, Japan; 2 Physiology and Cell
Biology, Tokyo Medical and Dental University, Japan; 3 Research Center for
Radiation Safety, National Institute of Radiological Sciences, Japan; 4 Animal
Breeding and Reproduction Research Team, National Institute of Livestock
and Grassland Sci, Japan
Previously we identified an oocyte-specific gene, Oog1 (Minami et
al., 2001). The expression of Oog1 starts at E15.5 in embryonic ovary
and continues until the 2-cell stage. The expression is dramatically
degraded thereafter. The most interesting characteristic of Oog1
protein is nuclear accumulation during the late 1-cell to early 2-cell
stage (Minami et al., 2003). The period coincides with the time of
zygotic gene activation and the time of first mitosis. The molecular
biological feature of Oog1 is the association with small GTP binding
proteins, such as Ras and Ran (Tsukamoto et al., 2006). However, the
precise mechanism of Oog1 in embryonic development remains
unknown. In addition, since Oog1 is multicopy gene, knockout
approach can not be used. In the present study, we examined the role
of Oog1 in the development of mouse embryos using transgenic
RNAi approach. Two constructs differing in the sequence of Oog1
inverted repeats (IR1 and IR2) were employed in this study. To make

16 t h International Congress on Animal Reproduction
150 Poster Abstracts
transgenic constructs containing IR1 or IR2, each inverted repeat was
transferred to pRNAi-ZP3 cassette (Stein et al., 2003), to produce
pZP3-oog1IR1 or pZP3-oog1IR2. In these transgenic constructs, the
expression of Oog1 dsRNA hairpins is controlled by ZP3 promoter
which directs oocyte-specific expression. To analyze the phenotype of
the transgenic females, each founder females (C57BL/6J) was mated
with the same four wild type males (C57BL/6J) in a random
sequence. Successful mating was verified by detecting vaginal plug.
Mated females were then housed separately for observation and
recording the number of pups delivered per litter, which was averaged
to assess fertility. To test the suppressive effect of dsRNAs, fertilized
embryos were collected from transgenic F1 females mated with wildtype
males 24 h after eCG injection. Fertilized embryos were cultured
in KSOM medium and their development was recorded at 24 h
interval until 96 h after eCG. At the time of embryo collection, GV
stage oocytes were collected from the same female ovaries to examine
the amount of Oog1 mRNA by real-time RT-PCR. We obtained nine
transgenic founders and four female transgenic lines out of 5 were
sub-fertile. Embryos recovered from some transgenic F1 females
mated with wild-type males exhibit developmental block in culture.
These results suggest that Oog1 functions in early embryo
development in mouse. This approach provides a powerful method to
study the function of the genes transcribed during oogenesis and early
embryogenesis.
P372
Cloning and sequence analysis of Sheep fertilin β and its
tissue expression
Narenhua, N 1 *, Fu, L 1 , Li, N 1 , Bao, XRG 2
1College of Animal Science and Medicine, Inner Mongolia Agriculture
University, China; 2 Life Science of College, China
Fertilin β is member of the ADAMs (metalloproteinase-like,
disintegrin-like, cysteine-rich) protein family and is expressed on the
sperm surface where it has been proposed to play a role in mammalian
fertilization. Inhibition of the sperm-egg binding and sperm-egg
fusion make fertilin an attractive target for development of an
immunocontraceptive vaccine. This study examined fertilin β gene
activity in relation to fertilization in the ram testis. Mixed primers for
the polymerase chain reaction (PCR) were designed based on the high
sequence homology of selected regions of known bovine fertilin β
gene. PCR-amplified cDNA fragments generated by 3\' and 5\' rapid
amplification of cDNA ends (RACE) were combined to generate fulllength
cDNA sequence here for the first time. The 2217 bp cDNA has
an open reading frame encoding 738 amino acids, with a molecular
mass of ~82 KDa. The deduced amino acid sequence showed identity
at equivalent regions of bovine (87.1 %), porcine (73.2 %), mouse
(37.6%), human (58.1%), and macaque (58.0%). Bovine fertilin β
contains a domain with homology to disintegrins, snake venom
proteins that bind to integrins via an integrin-binding domain
containing the tripeptide RGD. This partial inhibition of fusion with
RGD peptides prompted the cloning of the sheep homologue of
bovine fertilin β to determine if it possessed the tripeptide RGD or
different amino acid sequence in its disintegrin domain. The
disintegrin domain of sheep has the tripeptide TDE (instead of RGD)
in its cell recognition region. In the present investigation we also
report RT-PCR and in situ hybridization studies that show that the
sheep fertilin β is transcripted only in adult ram testis and not in the
all 3 epididymal regions. In situ transcript hybridization shows the
transcript to be localized in round and enlongating spermatids in the
seminiferous epithelium. The work confirms that fertilin β is
expressed tissue specifically. Key word: fertilin β/disintegrin/RGD
peptide/binding and fusion
P373
Changes in serine/threonine phosphorylation associated
to the achievement of “in vitro” capacitation in boar
spermatozoa
Ramió-Lluch, L* and Rodriguez-Gil, JE
Unit of animal Reproduction, Dept. Animal Medicine and Surgery, School of
Veterinary Medicine, Autonomous University of Barcelona, Bellaterra, Spain
Several studies in different species have shown that tyrosine
phosphorylation of sperm proteins is a suitable marker of the
capacitation. Furthermore, capacitation has been linked to changes in
the spatial location of tyrosine-phosphorylation. However, there is
little information about changes on both serine- and threoninephosphorylation
status during sperm capacitation. Thus, the main aim
of this study has was the observation of putative changes in both
expression and location of serine- and threonine phosphorylation
during "in vitro" capacitation (IVC) of boar sperm. For this purpose,
boar sperm from fresh ejaculates were incubated in specific
capacitation medium durin 4 hours at 39ºC in a 5%CO2 atmosphere .
Sperm aliquots were taken at 0, 1, 2 , 3 and 4 hours after incubation
and both the general presence and spatial location of serine- and
threonine-phosphorylation were evaluated.
Our results showed that boar sperm had an specific pattern of
phosphorylation in both serine and threonine residues. Weight of the
main bands were around 25-30 KDa, 30-35 KDa and 50 KDa in
serine-phosphorylation, and around 30 KDa, 50 KDa and 75 KDa in
threonine-phosphorylation. IVC induced an observable rise in the
expression of serine phosphorilation during capacitation, specially in
the band around 30-35 KDa in both cases. These results were
accompanied with specific changes in the spatial location of both
serine- and threonine-phosphorylation in spermatozoa. All these
results indicate that IVC is associated with specific changes in protein
phosphorylation, in tyrosine residues and in both serine- and
threonine residues as well. Finally, the observed spatial changes in
protein phosphorylation indicates that they could be involved in the
achievement of a feasible IVC.
P374
Sperm DNA fragmentation and presence of varying levels
of protamine 1 mRNA in Ram and Goat
Roy, R 1 *, Gosalbez, A 1 , Lopez-Fernandez, C 1 , Arroyo, F 1 , García-Hurtado, J 1 ,
Casado, S 2 , De La Torre, J 1 , Gosalvez, J 1
1Biology, Universidad Autonoma de Madrid, Spain; 2 Research And
Development, Halotech Sl, Spain
Sperm DNA fragmentation has been the subject of numerous studies
because the incidence of a high rate of nuclei containing damaged
DNA is highly correlated with a loss of fertility. However, the origin
of DNA fragmentation is mostly unknown, although apoptosis,
oxidative stress, or persistence of DNA breaks produced during
chromatin protamination in spermiogenesis, could be direct causes of
chromatin damage. The aim of the present investigation was to
analyze the correlation between different levels of protamine 1 mRNA
in sperm cells from ejaculated semen samples in ram and goat with
the dynamics of DNA fragmentation after ejaculation and sperm
extension. For this purpose, 10 rams from Castellana breed and 10
goats all showing Sperm DNA Fragmentation (SDF) index below 6%
were assessed for SDF by using the Sperm Chromatin Dispersion test
(SCD; Halomax). The dynamics of SDF was assessed at T0,T1,T4
and T24 (numbers indicates hours after ejaculation in sperm samples
extended and incubated at 37ºC). SDF Values were plotted against
increasing incubation times. Results showed that differences in the
dynamic range of SDF do exist among different animals; each animal
reached a SDF index 50% of DNA fragmentation at different times
(ranging from 4 to 24 h). Simultaneously, the amount of protamine 1
mRNA from mature spermatozoa was analyzed using real-time PCR.
Interestingly, when levels of protamine 1 mRNA was compared with
the dynamic range of SDF present in the same samples, those
individuals showing a rapid increase in sperm DNA fragmentation,
exhibited the lower levels of protamine 1 mRNA. These results
suggest that sperm chromatin failing to achieve a proper

16 t h International Congress on Animal Reproduction
Poster Abstracts 151
protamination in condensing chromatin, facilitates DNA breakage. It
is suggested that a reduction in the level of deoxyribonucleic acid
protection, render the DNA molecule more sensitive to external
damaging agents.
P375
GnRH-a induced steroid hormone receptor regulation in
bovine endometrium
Singh, R*; Pretheeben, T; Perera, R; Rajamahendran, R
Animal Science, University of British Columbia, Canada
Introduction Ovarian steroids consistently influence the
endometrium and maintain its cyclicity by acting through their
corresponding receptors. Estrogen receptors(ER α and ER β) and
progesterone receptors (PR) are present in bovine endometrium in
follicular and luteal phases of the estrous cycle, bovine ovaries and
placentomes. We, most recently demonstrated the presence of GnRH
receptors (GnRH-R) in bovine endometrium at both mRNA and
protein level and localized these receptors to endometrial epithelial
cells in both the phases of the estrous cycle. Additionally GnRH-R
mRNA is also present in normal and carcinogenic human
endometrium and endometriosis, where GnRH acts in an apoptotic
and antiproliferative manner. GnRH is widely used in the bovine
reproductive management including estrous and ovulation
synchronization, induction of ovulation, post partum cyclicity,
treatment of cystic ovarian disease, to overcome early embryonic
mortality, and increase pregnancy rates; but there is clear lack of
information on its local modulatory role in the endometrium. We find
the co-existence of GnRH-R and steroid hormone receptors as
interesting and there are prior reports about ligand independent
activation of steroid hormone receptors. Whether GnRH through its
receptors could regulate these receptors in normal endometrium is still
not known and this study, for the first time examined the GnRH
induced regulation of ER α and ER β and PR in bovine endometrium.
Materials and Methods Uteri belonging to follicular and luteal
phases of the estrous cycle were collected from the local abattoir,
transported to lab within one hour. One hundred mg of endometrial
explants were cultured at 37 0 C, 5% CO 2 in humidified atmosphere.
After 20 h incubation, explants were treated with different doses of
GnRH agonist – buserelin (0, 200, 500, 1000 ng/mL respectively),
GnRH antagonist – antide (500 ng/mL) and a combination of antide
(500ng/mL) and buserelin (200ng/mL) for 6 h. Two µg of total RNA
extracted from each treatment was reverse transcribed using
commercially available kit and the mRNA levels of ER α, ER β and
PR were assessed by semi-quantitative RT-PCR and using the gene
specific primers G3PDH was used as an internal control in the
experiments. Optical intensity of individual bands was analyzed by
Scion imaging beta and statistically analyzed by comparing to control
and using student t test.
Results This study revealed that GnRH (200ng/mL) upregulated ER α
mRNA in both follicular and luteal phases of the estrous cycle and it
this effect was more pronounced (P≤ 0.05) in the luteal phase;
whereas mRNA levels of ER β and PR were not altered.
Conclusions GnRH induced upregulation of ER α could have
potential implications on reproductive process such as gamete
transport, fertilization, cellular proliferation, uterine receptivity,
implantation and maintenance of normal physiological status of the
uterus and increases our understandings of the molecular basis of the
reproduction at the endometrial level.
P376
Effect of pre-incubation of male and female gametes with
fibronectin prior to fertilization in vitro in cattle
Thys, M 1 *; Nauwynck, H 2 ; Maes, D 1 ; Van Soom, A 1
1Department of Reproduction, Obstetrics and Herd Health, Faculty of
Veterinary Medicine, Ghent University, Belgium; 2 Department of Virology,
Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent
University, Belgium
Carbohydrates and glycoproteins modulate various adhesion and
binding events in reproductive processes, including sperm-oviduct
adhesion, sperm-egg interaction and embryo implantation. When
fibronectin (Fn) – an extracellular matrix glycoprotein – is
supplemented to the fertilization medium, a substantial inhibition of
sperm penetration during bovine in vitro fertilization (IVF) was
observed. To identify whether Fn interacts with either male or female
gametes, 2 experiments were conducted incubating either sperm cells
or cumulus oocyte complexes (COCs) with Fn prior to IVF.
To evaluate the effect of Fn on sperm, 2 groups of in vitro matured
bovine COCs were fertilized in standard medium. One group was
inseminated with spermatozoa (1x10 6 sp/ml) previously incubated
with 500 nM Fn for 30 min. The second group was fertilized with
spermatozoa (same ejaculate) incubated with standard medium. Two
extra experiments – where the sperm cells were incubated for 2 h resp
4 h – were performed to evaluate effect of time of sperm preincubation
on inhibition of sperm penetration. To assess the effect of
Fn on the female gamete, in vitro matured COCs were divided into 2
groups. The first group was fertilized under standard conditions, the
second one was treated with 500 nM Fn for 30 min prior to IVF.
Subsequently, a similar setup was applied on zona-free oocytes.
Twenty hours after insemination, all presumed zygotes were fixed,
stained with Hoechst 33342 and evaluated by fluorescence
microscopy for sperm penetration and fertilization. Differences in
fertilization and penetration percentage were analyzed by binary
logistic regression (SPSS 15.0).
Pre-incubation of sperm cells with Fn significantly decreased the
sperm penetration compared to that of the control (75.2% vs 87.0%)
resulting in an inhibition of penetration of 13.6%. The same tendency
was observed for fertilization with or without Fn pre-incubated sperm
(68.6 % vs 78.2 %). Prolonging the duration of sperm pre-incubation
caused more prominent inhibition of penetration (22.2% after 2 h;
42.8% after 4 h). When pre-incubating COCs with Fn, penetration
was not significantly reduced (76.2% vs 83.0 %) compared to that of
the control, nor was the fertilization rate (67.3% vs 75.4%).
Furthermore, Fn pre-incubation of zona-free oocytes did not affect
sperm penetration (42.0% vs 46.9%) nor fertilization (37.1% vs
37.0%).
In conclusion, Fn inhibits sperm penetration in bovine COCs through
interaction with the sperm cell. To elucidate the underlying
mechanism, identification of receptors for Fn on bovine sperm is
required.
P377
Effect of replacer of fetal calf serum in the development
and gene expression in bovine embryos in vitro cultured
Serapião, RV 1 *; Boité, MC 1,2 ; Camargo, LSA 1 ; Polisseni, J 1 ; Viana, JHM 1 ;
Folhadella, I 1 ; Sá, WF 1 ; Fonseca, FA 4
1Laboratório de Reprodução Animal, Embrapa Gado de Leite, Brazil;
2Faculdade de Medicina Veterinária, Universidade Federal Fluminense,
Brazil; 3 Laboratório de Genética Molecular, Embrapa Gado de Leite, Brazil;
4Laboratório de Reprodução Animal, Universidade Estadual do Norte
Fluminense, Brazil
Introduction The period of post fertilization embryo culture is the
most critical affecting blastocyst quality. Knockout SR (Gibco Labs.,
Grand Island, NY) is a serum replacer optimized to support
embryonic stem cells in culture and can also be used to replace serum
during culture of bovine embryos. The expression of genes associated
to stress response, such as heat shock proteins (Hsp), can be affected
by in vitro culture conditions, including culture medium components.
The aim of this study was to evaluate the effect of Knockout TM SR on

16 t h International Congress on Animal Reproduction
152 Poster Abstracts
the development, total number cells and relative abundance of
Hsp70.1 of in vitro fertilized bovine embryos.
Materials and methods COCs collected in slaughterhouse were
matured and in vitro fertilized. The presumptive zygotes were
randomly distributed in three groups of medium culture CR2aa
supplemented with 10% of fetal calf serum (FCS); 10% knockout
serum replacer (KSR) and 3 mg/ml of polyvinyl alcohol (PVA).
Cleavage rate and blastocyst rate were determined respectively 72 and
168 hours post-fertilization (hpf). The total number of cells were
determined at 192 hpf. Pools of ten embryos obtained at 192 hpf were
frozen for RNA extraction and real time RT-PCR methodology was
used to obtain quantitative data of Hsp 70.1 transcripts. Expression of
GAPDH gene was used as endogenous reference. Calculations of
relative quantification were performed by Comparative Ct method,
using the value found in PVA group as calibrator. Data of cleavage
and blastocyst rate were analyzed by the Kruskal Wallis test and the
total number of cell by variance analyses. Means were compared by
Student Newman Keuls test.
Results and Discussion No significant difference (P>0.05) was found
among FCS (57,8±4,6), KSR (62,2±4,5) and PVA (60,4±4,4) on
cleavage rate. However, blastocyst rate (12,2±2,1 and 18,6±3,0) and
total number of cells (105,9±5,9 and 109,4±6,1) were similar (P>0.05)
for KSR and FCS, and higher (P0.05) between FCS and KSR
groups. These data show that bovine embryos cultured in medium
supplemented with KSR has similar patterns of development, quality
and Hsp70.1 expression than those cultured in presence of the serum.
In conclusion, KSR is able to support development of in vitro
fertilized bovine embryos and it can be an alternative when serumfree
culture medium is recommended.
Thanks to Agrogenetica, FAPEMIG, CNPq
P378
Melatonin treatment and undernutrition affect expression
of uterine estrogen and progesterone receptors in ewes
during the reproductive and the anestrous seasons
Vázquez, MI 1 *; Sartore, I 2 ; Abecia, JA 1 ; Forcada, F 1 ; Sosa, C 1 ; Palacín, I 1 ;
Casao, A 1 ; Meikle, A 3
1Animal Production and Food Science, Veterinary Faculty, University of
Zaragoza, Spain; 2 Biochemistry, Faculty of Veterinary Medicine, University of
Montevideo, Uruguay; 3 Laboratory of Nuclear Techniques, Faculty of
Veterinary Medicine, University of Montevideo, Uruguay
Melatonin treatment in ewes increases prolificacy and fertility. A
reduction in PGF2α in vitro secretion by endometrial cells after
melatonin addition has been reported, suggesting that melatonin could
act directly on sheep endometrium. In previous studies we have
shown that undernutrition affects endometrial sensitivity to estradiol
and progesterone by decreasing their receptor concentration (ERα and
PR, respectively) which could explain the lower pregnancy rates
found in undernourished ewes. In this study we tested the hypothesis
that melatonin treatment could counteract subnutrition effects, and
thus ERα and PR content in different endometrial cell types were
studied in undernourished ewes. Adult Rasa Aragonesa ewes were
assigned to a 2 x 2 factorial design performed both in the reproductive
(RS, n=25) and anestrous seasons (AS, n=24). They were treated
(+MEL) or not (-MEL) with a subcutaneous implant of melatonin for
42 days (Melovine®, CEVA) and fed to provide 1.5 (Control, C) or
0.5 (Low, L) times daily maintenance requirements from
synchronization day with intravaginal pessaries. Ewes were mated at
oestrus (Day=0) and slaughtered on Day 5, when pieces of uterus
were collected to determine PR and ERα by immunohistochemistry.
There was an effect of season on the staining intensity of PR
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 153
P380
HaeⅡ polymorphism at caprine inhibin-alpha gene and
its relationship to litter size
Hua, GH 1 ; Chen, SL 1 ; Shen, Z 2 ; Wen, QY 3 *; Zhang, ZR 3 ; Yang, LG 1
1China Education Ministry’s Key Lab of Agricultural Animal Genetics,
Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR
China; 2 Animal Husbandry Bureau of Hubei Province, Wuhan, China; 3Animal
Husbandry Bureau of Shiyan of Hubei, Shiyan, China
Introduction Goats contribute largely to the livestock industry and
livelihoods of people in the world. Goats are animals with moderate
prolificacy. It is important to improve the fertility of the goat.
Reproductive traits such as litter size and conception rate are crucial
economic traits with low heritability. Marker association selection
(MAS) is a useful method to improve animal fertility via genetic
selection. Inhibin is a kind of glycoprotein hormone which plays an
important role in animal reproduction for its regulation of pituitary
FSH secretion. The decline in inhibin secretion is responsible for an
increase in FSH which coincides with an increased rate of follicular
depletion. The objective of this research is to detect the polymorphism
of INHA in goat and to investigate the relationship between the
genotypes and litter size.
Materials and Methods A total of 387 adult females individuals
from 3 breeds of goats were examined, including Boer (n=208),
Matou (n=125), Haimen (n=54) goats. Approximately 10 ml of blood
was collected aseptically from the jugular vein in EDTA. The
genomic DNA was extracted from white blood cells using standard
phenol-chloroform extraction procedure. The DNA samples were
dissolved in TE buffer (PH=8.0) and stored at -20℃ for use.
The primers were designed according the INHA sequence of sheep
(Accession number: L28815) as follows: forward-
5’CCACACAGGACTGGACAGACA3’ and reverse-5’
GCAGGAACAGAGAGGACAACG-3’. PCR-SSCP, sequencing and
PCR-RFLP were applied to detect the mutation and genotypes. The
effect of INHA genotypes on the litter size of goat were analyzed by
GLM procedure of SAS.
Results 217bp fragments were obtained from PCR. A G284A
mutation was tested by sequencing different genotypes of individuals
separated by PCR-SSCP. A Haerestriction site was changed by the
mutation. Genotyping was performed successfully for a total of 387
individuals. Of these, 286 were homozygous (GG) for the presence of
the functional Hae restriction site, 27 were absence (AA), and 74
were heterozygous (AG). An association between the genotypes with
litter size was examined. The GG individuals were positively
associated with better litter size, followed by AA and AG. The mean
litter sizes were 2.273, 2.231, 2.002 respectively.
Conclusions The INHA gene can be used as a candidate gene for
selection of litter size in the goat. The individuals with GG genotype
is the favorable one for the goat breeding. Besides, it is necessary to
search other loci in INHA gene in more samples.
P381
Construction and expressed conditions optimization of
an inhibin gene fragament prokaryotic expression
plasmid
Han, L 1 ; Cao, SX 2 ; Liang, AX 1 ; Zhen, YH 1 ; Wang, QL 1 ; S, L 1 ; Yang, LG 1 *
1China Education Ministry’s Key Lab of Agricultural Animal Genetics,
Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR
China; 2 College of Animal Science and Technology, Nanjing Agricultural
University, Nanjing, China
Introduction Improving reproductive efficiency in females is one of
the major concerns in the monotocous animal, such as cattle. Inhibin
plays an essential role in the regulating FSH secretion in various
mammals. Previous studies have proved that active immunization and
passive immunization against inhibin increase FSH secretions and
ovulation rate in females. And they also proved that the peptide of
subunit α(1-32) that can induce the special antibody was better than
others. However, a synthetic peptide of a subunit of swine inhibin was
an effective antigen when conjugated to a carrier protein. The
synthetic peptide and complete inhibin molecule apparently contain
similar epitopes to which antibody binding blocks inhibin's
bioactivity. Hepatitis B surface antigen gene (HBsAg) has been used
as a particulate carrier for various foreign gene products. So, the
preparation of inhibin α(1-32) fragment is very important to improve
the fertility in animals.
Methods The single strands of porcine inhibin α (1~32) (INH) gene
(NM_214189) was synthesized chemically by Sangon. The gene of an
inhibin α fragment was annealed and fused to the downstream of 225
amino acids of the encoding region of HBsAg gene and the site of
amino acid sequence 112-113, and the recombinant fragment was
subcloned into the vector pET-28a to obtain an inhibin expression
vector pETISI with high immunogenicity. The recombinant plasmid
pETISI was then verified by restriction endonuclease analysis and the
integrity of coding sequences was checked by sequence analysis
(Sangon). Finally, the plasmid pETISI was transfected into the host of
E.coli BL.21 which can express ISI recombinant protein. The
recombinant protein (41.2KDa) was detected by SDS-PAGE, which
induced through the different concentration of IPTG and different
induced time. The bioactivity of the recombinant protein was detected
by western blot with mouse inhibin antibody (Thermo).
Results The results of SDS-PAGE gel indicated that the recombinant
protein was expressed in E.coli BL.21. And the highest expression of
this protein was induced with 1mmol/L IPTG and 6 hour induced, at
37 centigrade. And the results of western blot indicated that the
recombinant protein had high immunological activity of inhibin.
Conclusion In a word, the inhibin gene could be expressed highly in
the host E.coli BL.21 and the recombinant protein combined with
HBsAg had high immunological activity. The large-scale preparation
of this protein would settle the substance ground improving the
fertility in animals, especially in monotocous animal.
Poster 14 - Ovary and Uterus
P382
Detection of apoptosis in bovine endometrium during
early period of involution
Domokos, M. 1 *, Ígyártó, B 2 , Pécsi, A. 3 , Földi, J. 4 , Kulcsár, M. 1 , Huszenicza,
G. 1 , Neogrády, Zs. 1 , Gálfi, P. 1
1Faculty of Veterinary Sciences Szent István University Budapest;
2Department of Human Morphology and Developmental Biology Semmelweis
University Budapest; 2 Centre for Agricultural Sciences and Engineering
University of Debrecen ; 4 Intervet International BV, Angers, France
In the postpartum uterine involution programmed cell death, apoptosis
is needed for returning to the pre-pregnancy state. Apoptosis in
contrast to necrosis makes possible dying cells without membrane
disruption and consequent inducing of inflammation. Dairy cows
undergo a period of negative energy balance in puerperium because
energy output for milk production and uterine involution exceeds feed
energy intake. In negative energy status involution may become
moderate because involution process and apoptosis are energydependent
as well. In this study cows were investigated in early
period of involution to determine the apoptosis index with
immunohistochemistry in their endometrium biopsia samples and to
find out its connection with the beta-hydroxybutyrate (BHB) blood
concentration labeling their energy status. Paraffin-embedded tissue
samples were immunofluorescence stained for apoptosis detection
with two methods. We used terminal deoxynucleotidyl-transferase
mediated dUTP nick-end labeling (TUNEL) and PARP (monoclonal
antibody against caspase-cleaved fragment of poly-ADP-ribosepolimerase)
assays. At first we tested the methods on thymus samples
from calf and they worked after some methodical changes acceptable.
On the uterus samples only few cells were stained by the PARP assay
and many of them were fals staining so we did not use it to determine
the apoptosis index of the endometrium. While a lot of tissue samples
were extremely infiltrated by inflammatory cells, antibody against
CD45 (human leukocyte antigene) was used to exclude these tissue
samples. After this procedure TUNEL staining was used for detection
of apoptotic cells in uterus biopsies. In the hyperketonaemical group

16 t h International Congress on Animal Reproduction
154 Poster Abstracts
(BHB>1 mmol/l) the average apoptosis index was 23,83±6,44%, it is
significantly less than the result of the normoketonaemic (BHB

16 t h International Congress on Animal Reproduction
Poster Abstracts 155
acid supplementation can stimulate follicular dynamics and minimize
post-partum anestrous.
P386
Role of Adiponectin in Regulating Ovarian Theca and
Granulosa Cell Function in Cattle
Spicer, LJ*; Lagaly, DV; Aad, PY; Grado-Ahuir, JA; Hulsey, LB
Animal Science, Oklahoma State University, United States
Adiponectin is an adipokine that has been implicated in insulin
resistance, a condition associated with polycystic ovarian syndrome in
humans, and alters steroid production by rat and pig granulosa cells.
Furthermore, adiponectin receptor mRNA has recently been localized
within ovarian tissue of rats and chickens, but whether adiponectin
can directly affect ovarian theca or granulosa cell function in cattle is
unknown. Therefore, experiments were conducted to determine the
effects of adiponectin on proliferation, steroidogenesis and gene
expression of large-follicle theca and granulosa cells as well as
compare adiponectin receptor 2 (ADIPOR2) mRNA abundance in
theca and granulosa cells of small and large follicles. Fluorescent
real-time quantitative RT-PCR was used to elucidate the effects of
adiponectin on gene expression of side-chain cleavage enzyme
(CYP11A1) and LH receptor (LHR) in large-follicle theca and
granulosa cells, as well as expression of 17-hydroxylase (CYP17A1)
in theca cells and aromatase (CYP19A1) in granulosa cells.
Adiponectin (3 μg/ml) attenuated insulin-like growth factor-I (IGF-I)-
induced LHR, CYP11A1, and CYP17A1 gene expression in theca
cells as well as decreased (P < 0.05) LH plus insulin-induced
progesterone and androstenedione production by theca cells. In
contrast, adiponectin (3 μg/ml) decreased (P < 0.05) LHR mRNA
abundance in granulosa cells but did not affect steroidogenic enzyme
gene expression in granulosa cells. Theca cells from large (8-22 mm)
follicles had fourfold greater (P < 0.05) abundance of ADIPOR2
mRNA than theca cells from small (2-6 mm) follicles. In contrast,
granulosa cells from small and large follicles had similar (P > 0.10)
ADIPOR2 mRNA abundance and these levels did not significantly
differ from those of small-follicle theca cells. To evaluate if
hormones regulate ADIPOR2, theca cells from large follicles were
incubated in the presence of 0 or 30 ng/ml of IGF-I without or with 30
ng/ml of LH for 24 h. IGF-I decreased (P < 0.05) abundance of
ADIPOR2 mRNA by 14% in untreated theca cells but had no effect
(P > 0.10) on ADIPOR2 mRNA abundance in LH-treated largefollicle
theca cells. In contrast, LH increased (P < 0.05) theca cell
ADIPOR2 mRNA abundance by 17% and 27% in the absence and
presence of IGF-I, respectively. These results indicate that the
inhibitory effects of adiponectin on steroidogenesis are primarily
localized to theca cells and that the response system of theca cells to
adiponectin (i.e., ADIPOR2) may be regulated during follicle growth
by LH and IGF-I.
P387
Renal abscesses as a complication of ovaryhisterectomy
in a bitch
Vicente, WRR 1 *, Medeiros, MG 1 , Pereira, ML 2 , Bürger, C 2 , Voorwald, FA 1 ,
Motheo, TF 1 , Carvalho, MB 2 , Toniollo, GH 1
1Animal Reproduction, Faculty of Agriculture and Veterinary Sciences, São
Paulo State University, Brazil; 2 Veterinary Clinics and Surgery, Faculty of
Agriculture and Veterinary Sciences, São Paulo State University, Brazil
Rarely, renal abscesses are seen in dogs and can occur due to
pyelonephritis, nephrolithiasis, and kidney biopsy. The
ovaryhisterectomy (OHE) can show numerous complications such as
hemorrhage, uterine stump pyometra, pyometra, fistules, urether
ligature, hydronephrosis or pyonephrosis, urinary incontinence, partial
colon obstruction and granulomas. To date, there are no reports of
OHE complications resulting in kidney abscesses in this specie. A ten
year-old Rottweiler female was referred to the Veterinary Teaching
Hospital featuring anorexia, oligodipsia and vomiting for three days.
The bitch underwent OHE due to pyometra history three weeks ago.
Physical examination revealed prostration, moderated dehydration and
intense abdominal and lumbar pain. Laboratory findings revealed
normocytic, normochromic anemia, leukocytosis, mild azotemia, and
high levels of alkaline phosphatase. Results of the urinalysis showed
isostenuria, hematuria, leukocyturia and bacteriuria. A large round
mass appeared on abdominal radiograph as a soft tissue-density,
caudal to the right side of the liver. Abdominal ultrasound revealed a
round structure with multiple fluid-filled areas in the same region.
Laparotomy was performed for definitive diagnosis. During the
procedure, the right kidney was large, round, grey to yellowish,
irregular and adhered to the abdominal aorta. Immediately, the animal
underwent nephrectomy. There were cortical abscesses and pelvic
recesses thickening at the sagital section through the kidney. Medical
therapy included fluidtherapy for ten days, in addition to
metronidazole (15 mg/kg PO, bid), tramadol (2 mg/kg PO, tid) and
ranitidine (2.2 mg/kg PO, bid) for five days, and enrofloxacin (5
mg/kg PO, bid) for sixty days. Despite chronic renal failure, the
patient was discharged after sixty days from the surgery, and
recovered uneventfully. In summary, we hypostatized that the
abscesses formation was due to a lesion in the capsule of the kidney
that was promoted by a complication during the OHE procedure itself.
P388
Effects of endothelin-1 (ET-1) a vasoconstrictor and
bradykinin (BK) a vasodilator on luteal function in vitro in
ewes
Weems, Y 1 *; Johnson, D 1 ; Uchima, T 1 ; Raney, A 1 ; Lennon, E 1 ; Bowers, G 1 ;
Randel, R 2 ; Weems, C, 1
1Dept. of HNFAS, University of Hawaii, USA; 2 Agricultural Research and
Extension Center, Texas A&M University at Overton, USA
PGF 2 α is the uterine luteolysin delivered locally from the uterus to the
adjacent corpus luteum (CL)-containining ovary. However, cow CL
secretes PGF 2 α before the onset of luteolysis, but it also secretes the
PGE at a PGE:PGF 2 α ratio of 1:1 and PGE1 and PGE2 prevents
luteolysis (Weems et al. 2006; The Vet J:171:206-228 for review).
ET-1 has been reported to mediate PGF2α-induced luteolysis (Milvae,
Rev. Reprod. 5:1, 2000). Amounts of mRNA encoding ET-1
converting enzyme-1 (ECE-1), pre-pro ET-1, and the ET receptors
(ETA, ETB) increased in bovine luteal tissue from days 1 through day
10 postestrus, amounts on day 17 were similar to day 10, and were not
increased by PGF2α on day 10 when CL are responsive to the
luteolytic actions of PGF2α, but were increased by exogenous PGF2α
on day 17 only when luteolysis was already underway (Choudhary et
al., Domest. Anim. Endocrinol. 27:63, 2004). In addition, Nitric oxide
(NO) has been reported to be luteolytic by some in cows (Weems et
al. 2006; The Vet J:171:206-228 for review). Furthermore, ET-1 and
NO donors increased PGE secretion by bovine CL slices in vitro when
estrus was not synchronized or when estrus was synchronized with
PGF2α and did not affect CL PGF2α or progesterone secretion a . In
addition, ET-1 or NO donors infused chronically intrauterine or into
the interstitial tissue of the CL-containing ovine ovary delayed
luteolysis. Therefore, the objective of this experiment was to
determine whether ET-1 affected progesterone, PGE, or PGF2α
secretion by ovine CL. Days-12 or 16 ovine CL were collected,
weighed, and slices were incubated in vitro with Vehicle, ET-1,
Bradykinin (BK-vasodilator), Bradyzide (BZ-BK2 receptor
antagonist) or HOE-140 (BK1 receptor antagonist) at 39 C for 1 hour
without treatments and for 4 and 8 hours with treatments. Media
collected at 4 and 8 hours were analyzed for progesterone, PGE, and
PGF2α by RIA. CL weights were analyzed by a One Way ANOVA.
Hormone data were analyzed by a 2X5 Factorial Design for ANOVA.
CL weights differed (P

16 t h International Congress on Animal Reproduction
156 Poster Abstracts
P389
Lysophosphatidic acid influence prostaglandin synthesis
in the bovine endometrial cells: enzymatic mechanism
and early pregnancy dependence
Woclawek-Potocka, I*; Brzezicka, E; Korzekwa, A; Siemieniuch, M;
Skarzynski, DJ
Department of Reproductive Immunology, Institute of Animal Reproduction
and Food Research, PAS, Olsztyn, Poland
Lysophosphatidic acid (LPA) via receptor type 3 (LPA3) modulates
prostaglandin (PG) synthesis in the murine endometrium. The lack of
functional LPA3 may lead to implantation failures and embryo
mortality in mice. However, we proved recently that there is LPA1,
instead of LPA3 and LPA2, gene expression in the bovine
endometrium. Moreover, we showed that LPA via LPA1 modulate PG
secretion in vivo and in vitro from the bovine uterus at the end of
luteal phase. In the present study, we examined whether LPA
regulates PG synthesis in the bovine endometrial cells isolated from the
uteri at the estrous cycle and early pregnancy and what is the enzymatic
mechanism for this influence. Endometrial epithelial and stromal cells
were isolated from the uteri on 8/9 day of the estrous cycle and 8/9
day of early pregnancy. The cells were treated with LPA agonist
(LPA; 10 -5 M, 10 -6 M) and an embryonic signal – interferon-τ (IFNτ;
30 ng/ml) for 24 hours The concentrations of PGF 2 and PGE 2 were
measured in the culture medium by EIA method. Moreover, gene
expression for LPA1 and prostaglandin synthases (PGFS and PGES)
were measured in the cells by Real Time PCR. In stromal cells both
doses of LPA and IFNτ stimulated PGE 2 synthesis (190, 180, 170% of
control, respectively, for cells isolated from the uteri on 8/9 day of the
estrous cycle and 195, 186, 175% of control, respectively, for cells
isolated from the uteri on 8/9 day of pregnancy; P

16 t h International Congress on Animal Reproduction
Poster Abstracts 157
P392
A clinical case of bleeding vaginal varicose veins causing
severe anaemia in a late-term pregnant mare
Bresciani, C*; Parmigiani, E; Di Ianni, F; Morini, G; Bigliardi, E; Vecchi, I
Faculty of Veterinary Medicine, Parma University, Italy
Vaginal varicosities have been described in the mare as uncommon,
generally non-life threatening findings with a multifactorial aetiology.
In pregnant mare varicosities usually shrink after foaling. The authors
report a case in which vaginal haemorrhage from vaginal varicosities
led to a severe anaemia. Treatment became necessary to save both
mare and foal. A 18 years old pluriparous Standardbred mare 322
days pregnant at first examination showed poor body condition and
normal haematological values. Two days later a swelling due to
oedema mainly in the left perineum in standing position and episodes
of vulvar bleeding during recumbency were reported. Haematological
exams revealed a mild anaemia. Traction was made on vaginal
mucosa to arrest haemorrhage, which appeared to arise from a single
8 cm bursted varicosity on the left dorsolateral vaginal wall.
Vaginoscopic examination revealed also the presence of other
varicosities on the right side and excluded bleeding from urinary tract.
The combined thickness of the uterus and placenta (CTUP), the fetus,
fetal fluids and membranes, evaluated by use of transrectal and
transabdominal ultrasonography, were within normal ranges. Since
vaginal bleeding persisted, the large ulcerated varicosity vein was
resected and sutured. The status of placenta, fetus and the small
varicose veins were monitored and phenylephrine hydrochloride
cream was locally applied. The day after the mare became weak
showing pale mucous membrane, tachycardia and tachypnea. The
clinical and haematological values (PCV 12%; Hb 7 g/dl) induced us
to deliver 10 L of whole blood collected from 2 donors. In two days
PCV and Hb values became 30 % and 11 g/dl respectively. The
authors were concerned that the other varicosities could bleed again
and the clinical condition could worsen dangerously. The opening
cervix stage was checked and oxytocin (12 IU i.v.) was administrated
to induce parturition. Labour started ten minutes later and the mare
gave birth to a healthy foal. Within 3 hours the entire fetal membranes
were expelled and placenta showed no abnormalities. In the same time
the foal was standing up and suckled. Two weeks later mare and foal
were discharged. This study shows that in some cases bleeding from
vaginal varicose veins could be fatal and lifesaving medical
intervention is essential.
P393
Transrectal and transabdominal ultrasonographic study
of Amiata donkey pregnancy from day 150 to term
Crisci, A 1 *, Rota, A; Panzani, D; Sgorbini, M; Camillo, F
Dipartimento di Clinica Veterinaria, Università di Pisa, Italy
Introduction The Amiata donkey breed takes its roots from southern
Tuscany and is faced with the risk of extinction. To our knowledge,
ultrasound assessment of donkey pregnancy has never been reported
after day 60. Aim of this study was to describe ultrasonographic
characteristics of Amiata donkey pregnancy from day 150 to term.
Methods During 3 years, seven pregnancies of 4 Amiata jennies (3 of
them were studied on 2 consecutive pregnancies), were monitored
weekly from day 150 to foaling by transrectal (TRU) or
transabdominal (TAU) ultrasounds. The following parameters were
studied: diameter of foetal orbit (OØ), aorta (AØ) and chest (CØ),
foetal heart rate (HR), presentation (PRE) and position (POS).
Combined thickness of the utero-placental unit at the cervical pole
(CTUP), was also evaluated. The OØ and CTUP were evaluated by
TRU while AØ, CØ and HR by TAU.
Results Six/7 pregnancies gave birth to a living foal, 1/7 ended with
the death of both jenny and foal due to an intestinal torsion in the
mother at day 326 of pregnancy. In the remaining 6 jennies the
average pregnancy length was 343.5±9.5 days (range 333-361). Foetal
PRE and POS changed frequently until the days 233±54 (196-310)
and 315±31 (261-341) of pregnancy respectively; thereafter foetuses
were always found in anterior presentation and in dorsopubic position.
Between the 6 th and the 12 th month of pregnancy, the evaluated
parameters gradually increased except for HR which decreased. In the
first and the last month of evaluation mean values were respectively:
OØ (mm): 19.2 and 29.9; AØ (mm): 8.1 and 21.2; CØ (mm): 93.5 and
192.2; CTUP (mm): 6.0 and 10.9; HR (bpm): 138.1 and 82.1. In one
donkey, at 11 months of gestation, CTUP (18.3 mm) and placental
aspects were indicative of placentitis, and treatment resulted in
regression of symptoms, CTUP reduction (11.3 mm) and birth of a
living foal.
Conclusions This is, to our knowledge, the first study describing
foetal and placental parameters in jennies from mid-gestation to term.
Data from a larger number of subjects needs to be collected before the
normal ultrasonographic profile of donkey pregnancy can be
described. This could be useful to early diagnose and treat donkey
pregnancies at risk.
P394
Evaluation of cortisol and free thyroid hormones in goat
during the peripartal period
De Sandro Salvati, A* , Nicassio, M; Lacalandra, GM; Leoci, R; Aiudi, G
Department of Animal Production, Faculty of Veterinary Medicine, University
of Bari, Italy
In many animal species the prepartum plasmatic cortisol surge and
antenatal glucocorticoid administration cause functional and structural
changes in fetal tissues, so that the fetus is able to tough out both
labour and extrauterine life. These effects are in part mediated by
thyroid hormones. Forhead et coll. (Endocrinology, 2007) reported
that in fetus and pregnant ewe the surge of glucocorticoids influences
the variations of thyroid hormones in an opposite manner. In fetus it
increases circulating level of T3 through tissue specific modifications
of deiodinase D1 and D3 enzyme activity, while in pregnant ewe
causes a remarkable decrease in T3 and T4 plasmatic levels without
changing the deiodinase activity. The aim of this study was to
investigate, through goats peripartum, the correlation among cortisol
and free thyroid hormones, which are the metabolic active fractions of
thyroid. This trial was carried out in South of Italy on 13 healthy goats
aged 2-4 years, 45-50 kg/b.w. Blood sampling was done 24 hours
before parturition (T 0 ), the day of parturition (T 1 ), 24h and one week
after parturition (T 2 -T 3 ). Plasma cortisol, fT3 and fT4 were evaluated
with immunoenzimatic assay (EIA, RADIM, Italy). Obtained data
were analyzed with ANOVA test and considered significant for
P

16 t h International Congress on Animal Reproduction
158 Poster Abstracts
P395
The effect of intra-mammary infection on 205-day
adjusted weight of calves in a Brahman herd
Gonzalez-Castro, F 1 *, Scaramelli, A 2 , Cordero, F 2 , Tirado, MA 3 , Diaz, T 4 ,
Clerc, K 3
1Departamento Medico Quirurgico, Facultad de Ciencias Veterinarias, UCV,
Venezuela; 2 Patologia, Facultad de Ciencias Veterinarias, UCV, Venezuela;
3Medico Quirurgico, Facultad de Ciencias Veterinarias, UCV, Venezuela;
4Instituto De Reproduccion Animal, acultad de Ciencias Veterinarias, UCV,
Venezuela
In order to evaluate the effect of intra-mammary infection (IMI) on
205-day adjusted weight of calves (P205d) in a Brahman herd, 104
Brahman cows with >1 calving were used. Calving season spreads
from February 15th to June 15th. Restricted suckling, from day 30
postpartum, allowed 2 hours calf-cow contact in the morning and was
maintained until cow was diagnosed pregnant. Bacteriological
analyses were performed to individual quarter samples during early
lactation (EL; 30±7 d post-partum; n=104) and at weaning (W; 210 d
post-partum; n=66). Milk samples and their duplicates were collected
aseptically in sterile vials, and stored on ice for transportation to the
laboratory for bacteriological analysis, 6-8 h after sampling.
Staphylococcus sp. were identified using growth in blood agar (GBA)
and salt manitol agar, Gram staining (GS), catalase test (CT), OF
glucose test, coagulase test (CT). Streptococcus sp. were identified
using GBA, GS, CT, hypurate hydrolysis, aesculin hydrolysis, growth
in the presence of bile, tolerance to 6.5% NaCl and CAMP test. Gram
+ bacilli were identified by GBA, GC, growth in Tween 80 and in the
presence of 9.5% NaCl. Frequency distribution was used to determine
the IMI prevalence in cows and quarters. ANOVA was used to study
the effect of IMI on P205d, and only EL data was considered. The
prevalence of IMI in cows during EL and W were: Coagulase
negative Staphylococcus sp. different from S. epidermidis (CNS)=
19,2% (20/104) and 15,4% (10/65); Corynebacterium sp.= 7,7%
(8/104) and 4,6% (3/65); C. bovis= 3,8% (4/104) and 3,1% (2/65); S.
uberis= 3,8% (4/104) and 4,6% (3/65); S. agalactiae= 1% (1/104) and
1,5% (1/65); S. hyicus= 1% (1/104) and 1,5% (1/65); S. intermedius=
1% (1/104) and 0,0% (0/65); mixed infections= 4% (4/104) and 3%
(2/65), respectively. The prevalence of IMI in quarters during EL and
at W were: CNS= 10,2% (40/392) and 7,2% (18/249);
Corynebacterium sp.= 4,8% (19/392) and 3,6% (9/249); C. bovis=
2,6% (10/392) and 4,4% (11/249); S. uberis= 2,0% (8/392) and 1,2%
(3/249); S. agalactiae= 0,3% (1/392) and 1,6% (4/249); S.
intermedius= 0,5% (2/392) and 0,0% (0/249); S. hyicus= 0,0%
(0/392) and 0,4% (1/249); mixed infections= 1,1% (4/392) and 0,8%
(2/249), respectively. IMI had no significant effect on P205d. P205d
of calves from non-infected cows was 167.23±3 kg (n=52) and from
infected cows 163.05±3 kg (n=37). In conclusion, even though a
significant effect of IMI on P205d was not found, numeric differences
were observed, and non infected cows weaned slightly heavier calves
than infected cows.
P396
The effect of umbilical cord clamping on acid-base
balance of piglets at term
Jonker, FH 1 *, Van Dijk, J 2 , Van Loon, TPAM 3 , Taverne, MAM 1
1Farm animal Health, Faculty of Veterinary Medicine, Utrecht University, the
Netherlands, Netherlands; 2 Pharmacology, Pharmacy and Toxicology,
Faculty of Veterinary Medicine, Utrecht University, Netherlands; 3 Equine
Sciences, Faculty of Veterinary Medicine, Utrecht University, Netherlands
Umbilical cord clamping (UCC) was used to mimic the evolvement of
birth asphyxia, like observed in natural farrowings. A laparatomy was
conducted in 4 sows (on day 112 or 113) under general anaesthesia.
Successive fetal compartments were exteriorised and each fetus was
placed, with an intact umbilical cord and its head covered by a plastic
bag, under a heating lamp. Piglets were alternately subjected either to
5-8 min of UCC (n=23) or served as controls (n=24) during a similar
waiting period (WP). After cutting of the cord, 21 control and 21
clamped piglets had to be supported by manual ventilation with room
air to establish independent respiration (IR). In 4 control and 7
clamped piglets no IR occurred and these piglets were classified as
non-surviving (NSV). Mean birth weight and duration of UCC or WP
of NSV piglets did not differ significantly from surviving (SV)
piglets. Before UCC / WP, acid-base balance values and heart rates
(HR) of piglets did not differ within and between litters throughout
the 5 h of surgery (mean 291± 44 min). UCC resulted in an initial
fetal bradycardia, with a consecutive gradual increase in HR, followed
by a second decrease in HR at which moment UCC was stopped. HR
in control piglets remained constant during the WP. Mean body
weight (BW) and duration of UCC / WP did not differ between SV
control piglets (n=20; BW: 1336± 417 g; WP: 7.0± 1.9 min) and SV
clamped piglets (n=16; BW: 1392± 403 g; UCC: 7.0± 1.1 min). Only
a mild, mixed respiratory-metabolic acidosis in umbilical artery blood
was measured at 10 min after cutting of the cord in SV UCC piglets,
with lower pH (7.22; range 7.10-7.32) and BE (2 mmol/L; -3 to 7) and
higher pCO2 (9.8 kPa; 7.0 – 12.2) and lactate values (6.5 mmol/L; 5.4
– 8.9) compared to SV control piglets (pH: 7.31, range 7.17 – 7.38;
BE: 5 mmol/L, range -6 to 10; pCO2: 8.5 kPa, range 6.8 – 12.2;
lactate: 4.0 mmol/L, range 3.0 – 5.6), independently of spontaneous
breathing, manual ventilation and BW. This study demonstrates that
loss of umbilical cord function alone is not responsible for severe
asphyxia during birth. The response to UCC was rather variable with
respect to onset of the second HR decrease and the degree of acidosis.
The latter was not as severe as reported by Herpin et al. in 1996 (pH <
7.00; pCO2 >11.8 kPa; lactate >7.2 mmol/L ) for highly asphyxiated,
vaginally delivered piglets.
P397
Biochemical profile of the amniotic fluid at the delivery
moment of the Nelore calves conceived by in vitro
production and embryo transfer
Moya, CF 1 *; Piagentini, M 1 ; Prestes, NC 1 ; Lucidi, CA 2 ; Takahira, RK 2
1Department of Animal Reproduction and Veterinary Radiology, São Paulo
State University - FMVZ/UNESP, Brazil; 2 Department of Veterinary Clinics,
São Paulo State University - FMVZ/UNESP, Brazil
The purpose of the present study was to quantify biochemical
constituents of the amniotic fluid of the Nelore calves conceived by in
vitro production and embryo transfer at the delivery moment. Forty
cows divided in 2 groups were used in this experiment: 01- Twenty
cows pregnant with Nelore calves obtained by in vitro production
after follicular aspiration; 02 - Twenty cows pregnant with Nelore
calves obtained by superovulation of embryo donors. The animals
were fed on pasture with mineral salt, supplement of corn silage and
ration in the rural area in Avaré, São Paulo, Brazil. Near to the labor,
the cows were transferred to a maternal paddock, permitting delivery
observation. During the expulsion phase the amnion was punctured
and 15mL of fluid were collected, kept in a plastic tube and stored in a
freezer. The evaluation of the biochemical parameters were made
through commercial kits. Total protein, glucose, chloride and urea
were determined by colorimetric spectrophotometry. Creatinine and
gama glutamyltransferase (GGT) were determined by kinetic
spectrophotometry. Potassium and sodium were determined by flame
photometry. Statistics included analysis of variance and Tukey test
considering 5% as the level of significance. The mean values and their
standard error for the biochemical parameters obtained from the
amniotic fluid in the Group 01 were: 0.45±0.46 g/dL for total protein,
4.4±6.1 mg/dL for glucose, 8.0±5.3 mg/dL for creatinin, 40.3±16.5
mg/dL for urea, 17.2±14.6 UI/L for GGT, 63.7±31.5 b mmol/L for
chloride, 94.8±33.6 mmol/L for sodium and 8.3±7.1 a mmol/L for
potassium. The mean values and their standard error for the
biochemical parameters obtained from the amniotic fluid in the Group
02 were: 0.36±0.57 g/dL for total protein, 6.7±7.7 mg/dL for glucose,
5.9±4.9 mg/dL for creatinina, 38.3±20.5 mg/dL for urea, 22.6±13.0
UI/L for GGT, 88.8±23.8 a mmol/L for chloride, 77.7±33.4 mmol/L for
sodium and 3.9±1.8 b mmol/L for potassium (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 159
P398
Study of pituitary-adrenal axis in the trotter newborn foal
Sgorbini, M 1 ; Paci, V 2 *; Maccheroni, M 3 ; Luchetti, E 1 ; Rota, A 1 ; Marmorini, P 4 ;
Corazza, M 1
1Dipartimento Clinica Veterinaria, via Livornese lato monte, 56010 San Piero
a Grado (PI), Italy; 2 DVM, Florence, Italy; 3 Laboratorio Dosaggi
Endocrinologici, Azienda Ospedaliera Pisana, via Bonanno Pisano, 56100
Pisa, Italy; 4 DVM, Pisa, Italy
Introduction A rise in foetal plasma cortisol concentration has been
detected in many species at a time when the maturational changes are
occurring. A distinction between post natal cortisol levels in mature
and immature foals is present. The aim of the present work is to study
the trend of the plasmatic concentration of ACTH and cortisol in
trotter foals during the first 48h of life.
Materials and methods Fifty trotter foals different in sex and born in
the same farm during breeding seasons 2006 were included in this
study. Inclusion criteria: 1) 320-340 gestation days; 2) assisted
deliveries; 3) mares vaccination for influenza and EHV-1 and
treatment for GI parasites; 4) Apgar ≥7; 5) IgG concentration at 24h
≥800 mg/dl (SNAP ® Foal IgG, IDEXX, USA); 6) immediate suction
reflex and standing the head, sternal recumbency within 3 min,
quadrupedal position within 160 min, first suckling within 180 min; 7)
normal physical examination during the first week of life. Blood
samples were collected within 6h from birth (T1), at 24 (T2) and 48h
(T3) of life in EDTA and heparinised tubes. Samples were
immediately centrifuged and plasma was stored at -20°C. Both ACTH
and cortisol were analysed by chemoluminescence (Immunolite 2005
Analyzer, DPC, USA). X±SD were calculated both for ACTH and
cortisol. Correlation has been calculated for both the hormones in
relation with sampling times. Anova test has been applied both for
ACTH and cortisol vs different sampling times and the differences
were considered statistically significant for p

16 t h International Congress on Animal Reproduction
160 Poster Abstracts
Malnourished during second half of pregnancy, receiving 70% of their
energy and protein requirements (MN n=12); 3) Malnourished but
supplemented, two weeks before parturition, with 0.6 kg of ground
maize/animal (S, n=14). The following variables were recorded: 1)
dystocia, 2) motor activity and head reflex response in the first hour
after birth, 3) birth weight and 4) percentage of mortality during the
fist 45 days after birth. Proportion of dystocia was significantly higher
in MN compared to S and C groups (MN: 16/29, S: 7/32 and C: 3/23
kids, P0.05). After birth, kids from malnourished goats spent
longer time trying to stand up than kids from Control mothers (1380.2
± 291.2 vs 464 ± 75.9 sec., P=0.009), while non significant
differences were found between kids from S and MN, and those from
S and C goats. Similar results were found in the kid´s latency to be
completely stood up (2457.4 ± 243 vs 1461.2 ± 199.4 sec., P=0.01).
Proportion of kids showing positive response to the head reflex test
(head rising after a touch on their nose) was smaller in MN than in C
and S (MN: 7/16, C: 14/20 and S 20/27, P=0.04).While proportion of
kids shaking their head in response to tickling inside their ear tended
to be smaller in kids from MN than those from S and C mothers
(P=0.08). Kids from Control were heavier at birth than those from
Supplemented and Malnourished mothers (Control: 3.54 ± 0.1,
Supplemented: 3.04 ± 0.9 and Malnourished: 3.02 ± 0.1 kg, P=0.01).
Mortality from birth until the first 45 days of life was significantly
higher in kids from MN than those from Control and Supplemented
mothers (MN: 40%, C: 12% and S: 18%, P=0.05); non significant
differences were found between Control and Supplemented. It is
concluded that a high-energetic food supplementation few days before
parturition improves some aspects of vitality and consequently the
viability of kids from underfed mothers. Supported by PAPIIT
IN217205, FIS B/3872-1 and CATEDRA IN2-07.
P402
Neonatal clinical evaluation of Holstein calves born under
distinct obstetric conditions
Rodrigues, JA; Niemeyer, C; Silva, LCG; Lúcio, CF; Veiga, GAL; Vannucchi, CI*
School of Veterinary Medicine and Animal Sciences, University of São Paulo,
Brazil
During normal bovine parturition, uterine contractions compress
umbilical cord and uterine arteries, causing a reduction of fetal blood
flow and acidemia. However, during dystocia, uterine contractions are
more intensive, which even worsened these conditions.
Administration of oxytocin during maternal dystocia may compromise
fetal well-being due to maternal hypotension and increased fetal
stress. The aims of this study were to evaluate neonatal blood gases,
acid base and clinical parameters and to compare the initial period of
metabolic compensation under distinct obstetrical conditions. Animals
were allocated into 3 groups: Group 1–eutocia (n=10); Group 2–fetal
dystocia with obstetric assistance (n=10); Group 3–maternal dystocia
treated with oxytocin and calcium gluconate infusion (n=4). Neonates
were examined using the APGAR scoring and rectal temperature
measurement at birth, 5 and 60 minutes after calving. Arterial blood
samples were collected at delivery and after 60 minutes, in order to
evaluate blood gases, acid base parameters, hematocrit, hemoglobin,
Na, K, BUN and glucose. Calves of Group 2 showed reduced vitality
as compared to the other groups. Moreover, pH (7.15±0.15) and BE (-
9.1mmol/L±10.3) at birth were significantly lower than in the other
groups, while HCO 3 (19.1mEq/L±8.1) was only lower than the
reference values. Therefore, these results showed that dystocia can
cause fetal distress as demonstrated by metabolic acidosis due to
reduced blood supply to vital organs. Calves of Group 3 also showed
metabolic acidosis at birth (pH 7.23±0.03 and BE -4.5mmol/L±2.1)
and low pO2 at both measurements (44.5mmHg±10.6 and
42.2mmHg±11.2). However, there was no difference among groups.
Oxytocin infusion can cause distinct uterine contraction pattern
diminishing maternal-fetal circulation and increasing neonatal stress.
Group 3 exhibited significantly higher HCO 3 (26.3mEq/L±2.3) after 1
hour than the other calves, demonstrating the requirement to
compensate hypoxia after delivery. During asphyxia, blood flow
redistributes, resulting in lower renal perfusion and ischemic renal
injury. As a result, electrolytic disturbances such as hyponatremia,
hypopotassemia and uremia were observed. All newborns showed
lower hematocrit and hemoglobin results than reference values due to
umbilical hemorrhage or immature erytropoiesis. All calves born
normally or by assistance showed evident thermoregulation and
glucose maintenance1 hour after birth. The obstetric condition was
crucial to neonatal clinical development mainly affecting maternalfetal
circulation in dystocias and compromising the newborn vitality.
FAPESP 06/50485-7.
Poster 16 - Andrology, Male Genitals
P403
Seric testosterone concentration (STC) in young Guzerat
bulls (Bos taurus indicus) and its association with
reproductive traits
Andrade, VJ.*; Dias, JC.; Martins, JAM; Emerick, LL.; Ivo, JC.,Vale Filho, VR;
Silva, MA, Souza, FA.
Universidade Federal de Minas Gerais - Belo Horizonte, MG, Brasil
Introduction Positive associations have been found (Gwasdauskas et
al., 1980) among seric testosterone concentrations and reproductive
characteristics, indicative of bull fertility. This study aimed to
evaluate seric testosterone levels and their associations with
andrologic characteristics in young Guzerat bulls.
Material and Methods Blood samples collected at two hours
intervals from 7 AM to 7 PM and reproductive characteristics from 24
young Guzerat bulls, aging from 24 to 34 months, raised under
pasture conditions were evaluated. STC was determined by
radioimmunoassay. Andrologic evaluations were performed according
to Brazilian College of Animal Reproduction (1998) and the animals
submitted to the BSE for zebu (BSE-Z), according to Vale Filho
(1989). Pearson & Spearman correlations were used to estimate the
associations among reproductive traits and STC.
Results and discussion Means for age, weight, STC and andrologic
characteristics (Scrotal circumference – SC; Sperm motility – SM;
Vigor – Vig; Semen Volume – SVOL; Sperm Concentration –
SCONC; Major Sperm Defects – MD; Total Sperm Defects – TD and
BSE-Z. Means for age, weight, STC and reproductive characteristics
of Guzerat bulls aging from 24 to 34 months, raised on pasture STC
varied from 0.18 to 4.10ng/mL. It was also registered variation in
STC according to blood collection time, with highest concentration
(4.42 ng/mL) at 7 AM and lowest (0.36 ng/mL) at 7PM. It was also
recorded correlations (P0.05) among physical and morphological
semen characteristics as reported by Gwasdauskas et al. (1980).
Conclusion It was registered great variability in STC in young
Guzerat bulls, suggesting that it can be used as an auxiliary parameter
in identifying bulls with greater reproductive potential, based on its
favorable associations with reproductive characteristics.
P404
Absorptive activities in the efferent ducts of adult cat
studied by Aquaporin immunohistochemistry and lectin
histochemistry
Arrighi, S 1 *; Ventriglia, G 2 ; Aralla, M 1 ; Zizza, S 2 ; De Metrio, G 2 ; Desantis, S 2
1Department of Veterinary Science and Technologies for Food Safety, Faculty
of Veterinary Medicine, University of Milan, Italy; 2 Department of Animal
Health and Well-being, Faculty of Veterinary Medicine, University of Bari, Italy
Ultrastrucural features of the epithelium lining the efferent ducts (ED)
in the cat, as in other mammalian species, are strongly indicative of an
absorptive activity taking place towards the intraluminal fluids. It is
well-known that more than 95% of the fluid leaving the testis is
reabsorbed by the ED, but the cell structures involved in the
reabsorption processes are still a matter of debate. The purpose of the
present work was to study the absorptive pathways in the ED of adult

16 t h International Congress on Animal Reproduction
Poster Abstracts 161
cats by means of 1) the immunohistochemical localization of different
isoformes of the aquaporine family (AQPs), integral membrane water
channels that facilitate rapid passive movement of water, and 2) the
localization and the carbohydrate characterization of the endocytotic
apparatus by means of the lectin histochemistry. The results will be
interpreted in the light of ongoing electron microscopy studies. The
study was carried on fragments of cat epididymides obtained at
orchiectomy, fixed in neutral formalin and paraffin embedded.
Immunohistochemistry examined the localization of AQPs 1, 2 and 5,
whereas lectin histochemistry analyzed the glycoconjugates by a
panel of 12 lectins in association with sialidase (s) treatment. AQP1-
immunoreactivity was strongly evidenced at the apical surface of the
ED non-ciliated cells, whereas the ciliated ones were unstained. The
vasal endothelium was immunoreactive, too. No other AQP1-
immunoreactivity was observed throughout the epididymal duct.
Otherwise, AQP2 appeared absent in the ductuli efferentes but it was
well localized in the cauda epidydimidis. AQP5-immunoreactivity
was undectectable. Lectin histochemistry showed that the luminal
surface and the apical region of ED non-ciliated cells contain glycans
with terminal Neu5Acα2,3Galβ1,3GalNAc,
Neu5acα2,3Galβ1,4GlcNAc, Galβ1,4GlcNAc, GalNAc (s-PNA,
MAL II, RCA 120 , SBA reactivity) and with internal/terminal αMan
(Con A affinity). In addition, terminal GalNAc and
Neu5Acα2,6Gal/GalNAc (SNA reactivity) were present in glycans of
the luminal surface and the apical zone, respectively. Ciliated cells
expressed glycoconjugates only on cilia which showed terminal
Neu5Acα2,3Galβ1,4GlcNAc (s-RCA 120 staining), GalNAc, and
internal/terminal αMan, GlcNAc (s-WGA, GSA II staining). Our data
provide evidence for the involvement of different pathways in the
bulk reabsorption of water and low molecular weight solutes by the
non-ciliated cell of the cat ED. A combination of pathways is
possible, too: AQP-mediated trans-cellular route together with fluid
phase glycocalix-mediated endocytosis. Part of this work was granted
by University of Bari, Funds 2007.
P405
High and low motility ejaculates: a choice using laser
light
Carvalho, PHA 1 ; Barreto Filho, JB. 1 *; Rossi, RODS. 1 ; Braga, RA. 2 ; Andrade,
FSRM. 1 ; Rabelo, GF. 2
1Veterinary Medicine, Lavras Federal University, Brazil; 2 Engeneering ,
Lavras Federal University, Brazil
In semen analysis it has been widely accepted that spermatozoa
percent motility (M) and velocity (V) are highly related to the sperm
fertility. Assisted reproduction practices, like in vitro fertilization
(IVF) and sperm sexing involve semen manipulations that decrease
the cell mobility and thus objective techniques that allow rapid
selection or discard of ejaculates are of great benefit to the artificial
insemination (AI) industry. Laser light incidence (biospeckle) has
been previously described as a evaluating method of sperm cell
motility. The correlation between the intensity of the particle
movements, responsible to the scattered light, and the rate of pattern
change is the aim of the works to use that phenomenon as a source of
information. The goal of this work was to verify whether this optical
approach is capable of discriminate fast and slow motility cell patterns
in different ejaculates. Frozen semen of six bulls, evaluated by light
microscopy (LM), were divided in two groups according to their
motility patterns (group I, M > 50%; Group II, M < 50%;), each group
containing three animals. Sixty straws, 10 per bull, exhibiting sperm
cell concentration adjusted to 30 to 35 x 10 6 , in 0.5 ml volume were
thawed at 37ºC / 60 seconds. Ten µl aliquots were illuminated by a
coherent He-Ne laser beam light of 632 nm and 10 mW for 40
seconds, and the biospeckle index (inertial moment – IM) was
obtained. An index (IND) to grade motility and velocity [IND = (V x
20 + M) / 2] was proposed to express LM data and compare to IM.
The statistical analysis was based on correlation coefficients (CC)
among M, V, IND and IM using the Spearman correlation test with
5% nominal significance level. CC between IM and V, IM and M, and
IM and IND were, respectively, 42% (p

16 t h International Congress on Animal Reproduction
162 Poster Abstracts
seminiferous tubules (ST), percentual and absolute (AVST) volumes
of seminiferous epithelium and testicular interstitium, and number of
Sertoli cells/ST cross-section and /testis, diameter of epididymal duct,
of epididymal duct lumen, epithelium height of epididymal duct
(EHED). Epididymal variables were studied for caput, corpus and
cauda epididymal regions. Results (mean±sd) were compared with t
tests (p≤0,05). Selected Pearson correlations were studied. Mother
body weight (BW) at weaning (g, U vs C: 258.0±25.3***,
361.9±33.1), pup’s BW at slaughter (254.0±27.0***, 342.4±10.2),
paired testicular weight (2.7±0.3*; 3.0±0.2), paired epididymal weight
(g, 1.1±0.0**, 1.2±0.1), number of Sertoli cells/ST cross-section
(18.2±1.2**, 20.2±1.3) and /testis (30.5±4.2x10 6 *, 36.0±5.4x10 6 )
were smaller in group U. Mother BW at weaning was correlated with
pup’s BW at slaughter (0.86***), testicular weight (0.72***), AVST
(0.73***) and number of Sertoli cells/testis (0.69**). Pup’s BW at
slaughter was correlated with testicular weight (0.65**), AVST
(0.99***) and number of Sertoli cells/testis (0.64**). Testicular
weight was correlated with number of Sertoli cells/testis (0.61**).
Only EHED (corpus region) was different between groups (µm, U vs.
C: 31.3± 4.4** vs 17.05± 7.8). Epididymal duct diameter from caput
and corpus regions (0.039*), and from caput and cauda regions
(0.035*) were correlated. The EHED (corpus region) was correlated
with maternal BW at weaning (0.059*), pup’s BW at slaughter
(0.059*), testicular weight (0.041*) and EHED (caput region, 0.014*).
In conclusion, testicular structure, in particular the number of Sertoli
cells/testis (and consequently, maximal sperm production) in adult
rats is affected by undernutrition during fetal to prepubertal life.
Epididymides from such animals are lighter but show minor changes
in histological structure.
P408
Cryopreservation of ovine semen with different
techniques and cryoprotectors
Carneiro, GF 1,2 *; Maia, VN 2 ; Silva, SV 1,3 ; Gomes Neto, OC 1,2 ; Procópio,
OCS 1 ; Medeiros, LRD 1,2
1Caroatá Genética, Gravatá, PE, Brazil; 2 Clinica de Eqüinos Pedro Zaluski
LTDA, Recife, PE, Brazil; 3 Universidade Federal Rural de Pernambuco,
Recife, PE, Brazil
Introduction The use of Artificial Insemination (AI) associated with
semen cryopreservation enable a rapid multiplication in the number of
superior animals per sire and gives the possibility of storage and
manipulation of genetic material. Objective: To compare the
efficiency of three cryoprotectors: 7% glycerol (G), 7% ethilene
glycol (EG) and 3% dimethil formamide (DF) on cryopreservation of
ovine semen using two frozen techniques, conventional (with liquid
nitrogen vapor in the styrofoam box) and automated (with a
programmed frozen machine – TK 3000).
Methods The study was performed at Caroatá Genética, Gravatá - PE,
Brazil from August to November, 2006. Semen was obtained from
five Santa Inês breed mature rams with 3-5 years old, with proved
seminal quality. Semen collection was performed using artificial
vagina with a total of six ejaculates per animal, giving a total of thirty
ejaculates. Spermatozoa concentration was performed by
spectrophotometry (Spermacue). After evaluation of semen sample,
total volume was divided in three equal aliquotes, and diluents with
each cryoprotector to be tested was added. Semen was processed in
0,25 mL straws and divided in equal numbers for each frozen
technique. Straws were thawed for evaluation at least 5 days after
frozen. Progressive individual motility/vigor was assessed
subjectively under cover slip on a warm stage by phase contrast
microscopy. Data from the variables frozen technique and
motility/vigor was performed by chi-square (χ2).
Results No difference were seen between the frozen techniques
(p

16 t h International Congress on Animal Reproduction
Poster Abstracts 163
P410
Effect of Theriogon on fertility of native bulls and buffalobulls
El-Amrawi, G.A.*
Faculty of Veterinary Medicine, Alexandria University
Four native bulls and four buffalo-bulls (7-8 years of age) were used
for investigating the effect of Theriogon on libido and fertilizing
capacity. Serum and semen samples were collected for three weeks
(twice per week) before treatment to serve as controls. A single oral
dose of Theriogon (100 mg/ kg. body weight) was given to each
animal and serum and semen samples were collected twice per week
form all animals for three weeks post treatment. On collection, libido
index and reaction time (in seconds) were measured and the collected
semen samples were evaluated for: Ejaculate volume, pH, individual
sperm motility, percentage of live sperm, sperm cell concentration (in
millions/ml), total sperm number per ejaculate and sperm
abnormalities (primary and secondary). Testosterone concentration
was assessed in serum samples using RIA technique. The fertility of
each bull was assessed before and after treatment. The results revealed
that, a single oral dose of Theriogon leads to improvement in
testosterone level, libido, semen quality and sperm fertilizing capacity
in both bulls and buffalo-bulls.
P411
Seminal plasma heparin binding protein (HBP) in Gyr
bulls and its association with andrological characteristics
Folhadella, I. 1 *; Camargo, LSA. 2 ; Castro TS. 1 ; Salvador, DF 3 ; Sá, WF. 2 ;
Ferreira, AM. 2 ; Andrade, VJ. 1 ; Vale Filho, VR. 1
1Veterinary School of Federal University of Minas Gerais, Brazil; 2 Embrapa Dairy
Cattle, Juiz de Fora, Minas Gerais, Brazil; 3 CEDERJ, Rio de Janeiro, Brazil
Introduction Bulls subfertility represents a negative impact in beef
and milk cattle industry. Bulls with normal breeding soundness
evaluation (BSE) have different fertility profiles that may be
associated with differences in seminal chemical compounds, what
leads to a need to look for biochemical markers to these differences.
The aim of this study was to identify heparin binding proteins (HBP)
of seminal plasma and their association with andrological
characteristics such as scrotal circumference, motility, vigor, major
and total sperm defects, and Andrological Classification by Points.
Material and Methods welve Gyr bulls were evaluated by Breeding
Soundness Evaluation for Zebu (BSE-Z), according to Vale Filho
(1989). A sample of 1mL of fresh semen was frozen in liquid nitrogen
for purification, isolation, quantification and identification of HBP by
gel filtration chromatography and chromatography affinity. The
concentration was evaluated according to Lowry (1951) and HBP
identification by 1-D electrophoresis, with the reader in Totallab 100
program. Statistical analyses of possible associations between BSE-Z
and HBP were made by Pearson Correlation, using the SAS (2002).
Results and discussion Chromatography profile of HBP showed five
heparin affinity peaks. HBP concentrations varied from 0.02096 to
0.19025mg/ml. Within the five HPB peaks were found eighteen HPB
with different molecular weights. From these eighteen HBP band
found in electrophoresis gel, the most concentrated HPBs were those
with 13, 14, 16, 18, 20, 28, 29 and 30 KDa molecular weights. No
association was found among proteins and andrological parameters.
Conclusions HBP evaluations were not a feasible method for
predicting field andrological parameters. Its use alone does not allow
consistent results for selecting high reproductive performance bulls.
P412
Casa measurements of concentration, motility and
viability, compared to established procedures for bull
semen analysis: accuracy, reliability and its predictive
value for fertility
Frijters, A*
R&D, CRV Holding BV, Netherlands
Introduction The bull AI industry likes to use the most objective and
standard semen analysis methods, that are also useful to predict
fertility. The CASA instrument IVOS (Hamilton Thorne) was
compared to our current tests, of which some are subjective visual
microscopic assessments.
Materials and methods Ejaculates (n=262) of 39 HF test bulls (12-
15 months old) were collected, processed and frozen (15 million total
cells/dose) over a period of 3 months. Concentration and motility
were determined of fresh and thawed semen. IVOS was compared to
Coulter counting (CC) for concentration measurements, using Heamo
cytometry (HC) as the golden reference. IVOS was also compared to
our standard tests for motility and viability (both visual microscopic
assessments). Viability was only determined for thawed semen, using
IDENT/VIADENT stains for IVOS analysis, and Hoechst staining for
our standard test. For IVOS analysis 4-chamber slides were used
(LEJA). To evaluate reliability, Coefficients of Variation (CV) were
determined by processing and measuring samples in duplicate. The
predictive value of many sperm characteristics for fertility (NRR) was
analysed with GENSTAT (v 8.1).
Results Concentrations of fresh semen correlated highly between the
used methods (R≥0.89). Values obtained by IVOS and CC
respectively were 1.0 ± 16.5 (n=46) and 0.2 ± 8.2% (n=49) lower than
by HC (n=49). CV ± SD were 12.0 ± 10.0 (n=252) and 2.0 ± 1.8%
(n=254). Using thawed semen, IVOS and CC respectively counted 2.6
± 10.0 (n=256) more, and 2.1 ± 8.7% (n=256) less cells, compared to
the expected dose. CV ± SD were 5.9 ± 5.6 (n=256) and 4.2 ± 4.2%
(n=256). Motility measured by IVOS and our standard test did not
correlate when fresh or thawed semen was used. The range was higher
for thawed semen using IVOS: 18-69 vs 25-55% (n=256). Viability
measured by IVOS and our standard test correlated moderately
(R=0.76) for thawed semen, and resulted in CV ± SD of 5.6 ± 5.8
(n=255) and 2.3 ± 1.6% (n=256) respectively. The range was higher
using IVOS: 19-81 vs 41-78% (n=255). A better prediction of NRR is
possible using IVOS, but we were unable to quantify this, due to an
insufficient number of inseminations.
Conclusions When using IVOS, CC and HC correctly, concentrations
are the same. However, high reliability is easier and faster obtained by
CC. IVOS and our current tests do not measure motility and viability
similarly, while differences are easier detected by IVOS. More
inseminations are needed to study if IVOS predicts fertility better in
addition to, or instead of our current tests.
P413
Recrudescence of spermatogenesis following
downregulation with a GnRH-implant in the dog: first
morphological and hormone-analytical results
Goericke-Pesch, S 1 *; Spang, A 1 ; Bergmann, M 2 ; Hoffmann, B 1
1Clinic for Obstetrics, Gynecology and Andrology of Large and Small Animals,
Justus-Liebig-University Giessen, Germany; 2 Institute of Veterinary Anatomy,
Histology and Embryology, Justus-Liebig-University Giessen, Germany
Aberrations in semen quality causing infertility in males must still
often be classified as idiopathic as no other deviations from normal,
also in respect to peripheral hormone levels, have been found. Hence
not an absolute deficit but rather aberrations in the local availability of
hormonal control factors may be responsible for disruption of
spermatogenesis. Consequently recrudescence of spermatogenesis
was monitored after having achieved downregulation of testicular
function with a GnRH-implant (Gonazon®, Intervet 18.5 mg Azagly-
Nafarelin) in 30 Beagles. Implant removal was after 5 months (week
0) and 3-4 dogs were castrated at weeks 0, 3, 6, 9, 12, 15, 18, 21 and
24, the testes were conserved for further examination. To assess

16 t h International Congress on Animal Reproduction
164 Poster Abstracts
morphological changes approximately 200 tubule-cross-sections were
evaluated and grouped (A-D) according to the most developed germ
cell observed. Testosterone (T) and estradiol-17ß (E) were estimated
in blood collected during downregulation and at castration. Timing of
recrudescence showed distinct individual differences yielding
different numbers of dogs per group: Gr. A, spermatocytes (n=4); Gr.
B, round spermatids (n=3); Gr. C, elongating spermatids (n=6) and
Gr. D, elongated spermatids (n=17). T and E concentrations increased
from Gr. A to B (T: 0.14 ± 0.10 to 2.54 ±1.57ng/ml; E: 6.40 ± 2.19 to
9.73 ± 4.16pg/ml) and were constant thereafter. These first results
imply that onset of spermatogenesis occurs at low steroid hormone
levels, accompanied by expression of the androgen receptor, and is
rapidly stimulated by a further increase. To our knowledge, this is the
first study giving detailed information about recrudescence of
spermatogenesis of the dog following downregulation.
P414
Early Detection of Membrane Asymmetry in Frozenthawed
Buffalo Spermatozoa
Govindasamy, K 1 *; Kumar, S 2 and Sharma, B 3
1PhD Scholar, 2 Principle Scientist, Division of Animal Reproduction; 2 Indian
Veterinary Research Institute, Izantnagar, Bareilly (UP), India; 3 Principle
Scientist, Division of Animal Biochemistry, Indian Veterinary Research
Institute, Izantnagar, Bareilly (UP), India
Introduction Mammalian spermatozoa undergo tremendous chemical
and physical stresses during cryopreservation. The sperm plasma
membrane is one of the key structures affected by cryopreservation.
When the cell membrane is disturbed, phospholipid
phosphatidylserine (PS) is translocated from the inner to the outer
leaflet of the plasma membrane, which is one of the earliest signs of
membrane disruption. Annexin V conjugated to Fluorescein
isothiocyanate (FITC) fluorochrome retains its high affinity for PS
and therefore, serves as a sensitive probe that can be used for flow
cytometric detection characterized by the loss of membrane
asymmetry.
Methods Fifty six semen ejaculates, eight ejaculates from seven
healthy Murrah buffalo bulls (4-6 years age) maintained at standard
management conditions were used for the study. The standard
conventional cryopreservation protocol was adopted. Combination of
two fluorescent dyes, Annexin V and propidium iodide (PI) was used
to evaluate the membrane asymmetry in fresh and frozen thawed
spermatozoa in conjugation fluorescent microscope and flow
cytometry.
Results Four groups of spermatozoa were identified: (i) viable
spermatozoa (Annexin V-negative and PI-negative); (ii) viable
spermatozoa with early membrane disruption but integer plasma
membrane (Annexin V-positive and PI-negative); and two categories
of PI positive, dead spermatozoa (iii) early necrotic (Annexin V-
positive and PI-positive); and (iv) Late necrotic cells (Annexin V-
negative and PI-positive). The four sperm population varied
significantly between fresh and frozen thawed spermatozoa. In fresh
semen, the early sperm membrane change was observed only in 17%
of the total number of sperm. However, after freezing and thawing,
these sperm accounted for more than 31%. After freezing-thawing,
there was significant increase in the percentage of live cells with
phosphatidylserine externalization (early membrane changes) and
early necrotic cells, while reducing the percentage of live normal
cells.
Conclusions The Annexin V-binding assay is an effective tool to
provide early detection of membrane asymmetry in the viable
spermatozoa. Further, cryopreservation of buffalo spermatozoa
induces translocation of phosphatidylserine as in the early apoptosis
of somatic cells.
P415
Identification, Isolation and in vitro long term culture of
Male Germline Stem Cell in Porcine
Su Young, H*; Gupta, MK; Uhm, SJ; Lee, HT
Dept of Bioscience & Biotechnology, ARRC, Konkuk University, Seoul 143-
701, Korea
Male germline stem cells are the basis of spermatogenesis and reside
on basement membrane of seminiferous tubule in testis. Due to the
lack of specific markers, identification of male germline stem cells is
difficult to study in pig. In this study, we investigated to determine
isolation and long-term culture system of male germline stem cell in
neonatal pig testis. We used farm piglets 5~10days old, testis were
digested by sequential enzymatic system, including 1mg/ml
collagenase, 1mg/ml hyaluronidase and 0.25% trypsin/EDTA. Cells
were separated by discontinuous density gradient and differential
plating to increase of purity. Isolated cells were cultured in DMEM
medium supplemented with 15% FBS, and specific growth factors as
1000 IU/ml leukemia inhibitory factor (LIF) and 10ng/ml glial cell
line-derived neurotrophic factor (GDNF) at 37℃ incubator with 5%
CO2. We have used STO cell line for feeder layer treated by
mitomycin C for mitotically inactivation. After 7-8 days culture, three
dimensional colonies appeared as original generation. Alkaline
phosphatase (AP) staining expressed positively. Also these germ cells
expressed stem cell markers OCT-4, SSEA-1, and spermatogonial
stem cell markers PGP9.5, Dolichos Biflourus Agglutinin (DBA) in
immunocytochemistry. These cells have been investigated by RT-
PCR using specific primers, pgp 9.5 and pigvasa, which is expressed
specifically in the porcine undifferentiated spermatogonia. We
established porcine male germline stem cell lines from neonatal testis
and in vitro long-term culture system. These results could be used for
identifying the mechanism of spermatogenesis and applying for
transgenesis.
P416
In vitro effect of sodium nitroprusside (SNP) on sheep
sperm motility
Hassanpour, H*
Department of Basic Sciences, College of Veterinary Medicine, Sharekord
University, Iran
Nitric oxide (NO) has been recently shown to regulate many functions
of sperm such as Acrosome reaction, sperm chemotaxis and motility.
The aim of this study is to investigate the effects of sodium
nitroprusside (SNP) as nitric oxide donor on sperm motility of sheep.
After collecting of normozoospermic samples by artificial vagina
from twenty Bakhtiari rams, motile spermatozoa were harvested by
the swim-up technique using SOF-HEPES medium then incubated for
120 minutes in the presence of SNP (0.1, 0.5, 0.7 μM). sperm motility
assessed in four grades (rapid progressive motility, grade A; slow or
sluggish progressive motility, grade B; non-progressive motility,
grade C; or immotility, grade D.).In this study, SNP in the
concentration of 0.1µM non-significantly increased sperm motility at
grades A & C, and decreased at grades B & D. Concentration of 0.5
µM increased grade B & D, and decreased grade C. SNP at the
concentration of 0.7 µM significantly decreased sperm motility at
grade A (15.1%) and increased at grade D (16.7%), in comparison
with their control groups (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 165
P417
The effect of centrifugation and dilution on
concentrations of reactive oxygen species in canine
semen
Heaton, L*, Pinto, CRF
Population Health & Pathobiology, North Carolina State University College of
Veterinary Medicine, United States
Reactive oxygen species (ROS) are produced by sperm in small
quantities as part of cell signaling cascades that enable the
capacitation and acrosome reaction required for fertilization; however,
excess ROS production has deleterious effects on DNA and fertility.
Semen handling techniques should therefore minimize elevated ROS
levels to maintain optimal fertility, but there is limited information
regarding what circumstances inadvertently increase ROS. In the
present study, it was hypothesized that both centrifuged and undiluted
semen samples would have increased ROS concentration and that the
addition of semen diluents (extenders) would reduce the
concentrations of semen ROS. Canine ejaculates (n = 14) were
collected manually and divided into four aliquots, two of which were
extended 1:1 using EZ-BF with ticarcillin. Initial ROS concentrations
were obtained using chemiluminescence (Lumat LB 9507, Berthold
Technology, Oak Ridge, TN). Immediately thereafter, raw semen was
analyzed for concentration, motility, viability, morphology,
membrane integrity, acrosome integrity, and for the presence of
leukocytes in the ejaculate. Following the initial analysis, one
extended and one non-extended fraction were centrifuged for 10
minutes at 900 g. After centrifugation, the fractions were evaluated
for ROS concentration, motility, viability, morphology, membrane
integrity, and acrosome integrity. The ROS concentration, assessed by
eleven relative light unit (RLU) readings, was averaged and
standardized as RLU/106 spermatozoa. Data was analyzed using two
way ANOVA with the significance level set at P = 0.05. The Tukey
Test was used for all pairwise multiple comparison procedures of the
mean responses to the different treatment levels. There was a
significant effect of dilution (P < 0.05); undiluted (raw) semen
samples had greater RLU means ROS concentrations than those
diluted with semen extenders (320.1 and 87.9, respectively). The
effect of dilution within the factor centrifugation was also significant
(P < 0.05); there was a consistent trend for greater means of ROS
concentrations in centrifuged samples than in non-centrifuged
samples. This elevation of ROS did not appear to affect motility or
other seminal parameters analyzed, suggesting that evaluating motility
or even membrane integrity alone is not sufficient to identify
oxidative stress and potential fertility problems. These results
emphasize the benefits of using semen extenders prior to laboratory
processing to reduce potential ROS-induced detrimental effects on
semen quality.
P418
Testicular Growth curve of Guzerat (Bos taurus indicus)
raised in the savannah region at pasture and
supplemented with silage during the dry period
Henry, M 1 *, Osorio, JP 1 , Bergman, JAAG 2 , Carmo, AS 1
1Clinics and Surgery Department, Federal University of Minas Gerais, Brazil;
2Animal Science Department, Federal University of Minas Gerais, Brazil
Introduction The early detection of superior reproductive traits is
desired in any selection program. Unanian and co-workers (2000)
stated that scrotal circumference (SC) and testicular volume (VL)
need to be evaluated when selecting young males due to the fact that
the association of both characteristics improve the confidence in the
selection process. The aims of the present study were to characterize
some reproductive traits of young males in order to subsidize
evaluation and selection of sires of the Guzerat breed as well as to
evaluate the correlation between SC and VL.
Material and methods Three hundred and thirty Guzerat males were
evaluated at three months interval from five to 70 months of age. Data
included a total of 1,757 observations. SC, length and width of both
testicles were measured and VL was estimated according to Bailey et
al. (1996). Electro-stimulation seminal collection was attempted when
males had SC above 19cm. Onset of puberty was considered when at
least one motile sperm cell was detected in the ejaculate. Descriptive
statistics were performed, Pearson correlation between both traits was
calculated and SC and VL growth were modeled using Logistic
function and General Linear Model Procedures (SAS, 1997).
Results and discussion Growth curves for SC and VL reached
inflection points, respectively, at 12.8 (18.1cm) and 23.3 months of
age (389.4 cm3). Average age at puberty was 20.2 month with mean
SC of 22.79cm and a VL of 298.28cm3. Estimated SC and VL for 75
months of age were, respectively, 36.2cm and 778.8cm3. The average
growth rates of SC and VL, for the period before and after the
inflection point were .58cm/mo, 16,3cm3/mo, .29cm/mo,
7,7cm3/month of age, respectively. Direction and strength of
correlation between SC and VL (.91; P

16 t h International Congress on Animal Reproduction
166 Poster Abstracts
P420
Seasonal variations in the sperm parameters in dairy
bulls regularly used for artificial insemination in Algeria
Iguer-Ouada, M 1,2 *, Ayad, H 2 , Abbas, G 2 , Azzeradj, M 2
1Department of Organisms and Populations, Faculty of Nature and Life
Sciences, University of Bejaia Algeria, Algeria; 2 Department of Organisms
and Populations, University Abderahmane Mira, 06000, Bejaia, Algeria,
Algeria
The present work is the first report describing bull semen quality
variations during the different annual seasons in this part of the word
(North Africa). Data from 503 ejaculates collected during 14 months
from 06 mature Holstein bulls were analyzed and different semen
parameters were evaluated. Semen volume was measured using
calibrated plastic vial, and gametes concentration was determined
using a haemocytometer. Mass motility of semen was graded from a
0–5 scale, based on the appearance of waves and swirls created by
sperm movement when visualized by keeping one drop of semen on a
glass slide, without cover slip, under low power microscopic
magnification (10×). The individual motility of freshly diluted semen
was assessed after covering a semen drop on a glass slide with a thin
cover slip under high power magnification (40×). The individual
motility was recorded as the percentage of progressive motile sperm.
Semen concentration and motility percentage showed a parallel
evolution with a regular decrease form the spring season were the
highest values were observed to reach the lowest values in the
summer season. For motility percentage the values were 55.96 ± 1.94,
54.07 ± 1.9, 50.82 ± 2.46 and 37.33 ± 7.12 respectively for spring,
winter, autumn, and summer seasons (Mean ± SE). The semen
volume showed an inverse evolution increasing from winter (6.29 +
0.19 ml) to reach maximum values in summer (7.1 + 0.69 ml). It was
concluded in the present work that season affected significantly
different bull semen parameters. However, in one hand the
confounding effects of ambient temperature and photoperiod on the
semen quality variation in North Africa region needs further
examinations as well as the impact of these variations in term of
fertility.
P421
Hyperthermia is more important than hypoxia as a cause
of disrupted spermatogenesis
Kastelic, J 1 *; Wilde, R 1 ; Bielli, A 2 ; Genovese, P 2 ; Bilodeau-Goeseels, S 1 ;
Thundathil, J 3
1Agriculture and Agri-Food Canada, Lethbridge Research Centre, Canada;
2Facultad de Veterinaria, Universidad de la República, Montevideo, Uruguay;
3Faculty of Veterinary Medicine, University of Calgary, Canada
Mammalian testes operate on the brink of hypoxia; furthermore, it is
believed that hyperthermia-induced disruptions in sperm quality and
production are primarily due to hypoxia. The objective of this study
was to determine the relative effects of hypoxia versus hyperthermia
on sperm quality and production. We tested the hypothesis that
hypoxia would disrupt sperm quality and production, whereas
hyperoxia would prevent hyperthermia-induced reductions in sperm
quality and production. Forty-eight CD-1 mice (approximately 50
days of age), were randomly allocated into six groups and exposed to
environmental conditions of 20 vs 36 °C and oxygen (O 2 )
concentrations of 13, 21, or 95% (2 x 3 factorial experiment) for 12
hours on two occasions (separated by 12 hours at 20 °C and 21% O 2 ),
and euthanized (CO 2 ) 14 or 20 days later. One cauda epididymis was
minced and placed in PBS for 30 minutes; sperm motility was
assessed subjectively, and smears were prepared and stained with
Eosin Y. One testis was fixed in Bouins (24 hours), transferred to
70% alcohol, and sections prepared and stained with hematoxylin and
eosin. Morphological assessments were done ‘in the blind’ on semen
smears (200 sperm/mouse) and testicular sections (30 videocamera
fields/mouse). Data are mean±SD (combined for both days). There
were primarily main effects of temperature; mice exposed to 20 vs 36
°C had differences in testis weight (110.4±14.3 vs 101.3±17.6 mg,
P

16 t h International Congress on Animal Reproduction
Poster Abstracts 167
under extensive rearing with natural mating and are characterized by
lack of selection, poor record keeping and infrequent veterinary
assistance. Besides, breeding bulls are selected based mainly on
phenotype, neglecting the importance of the breeding soundness
evaluation (BSE) (1).
Materials and Methods A single BSE was performed in 38 sires
placed in 26 beef cattle farms managed under extensive rearing and
continuous mating from the south area of Costa Rica. Bulls belonged
to Brahman (n=8), Simmental x Brahman crosses (n=17), Simmental
(n=6), Brown Swiss x Brahman (n=3) and other crosses (n=4). These
bulls were under single sired mating breeding with 24.0±13.6 (5-73)
adult cows. After the BSE, bulls were classified as Sound: Bulls that
fitted the physical exam, with a scrotal circumference (SC) according
to breed and age standards (2), healthy reproductive organs and
without deviations in the spermiogramme. Deferred: Sires who did
not meet the above requirements but with a favorable prognosis for
recovering. Unsound: Serious clinical and spermiogramme
abnormalities compromising gravely their potential breeding
efficiency. Simultaneously, the conception rate (CR) was evaluated in
the herds by rectal palpation and ultrasound. Thereafter, the cows
were ranked as pregnant or not, being the cycling activity determined
by the presence of a corpus luteum.
Results and Discussion Mean SC (cm) and age (yrs) for sound
(n=23), deferred (n=5) and unsound (n=10) sires were 37.4±3.3 and
4.5±2.4, 39.0±4.4 and 4.7±2, 37.6±5.2 and 4.2±2 respectively. In the
unsound group, one bull had low SC and the remnant had clinical and
spermiogramme deviations typical of testicular degeneration. The CR
calculated solely upon the cycling cows was 82.5%±12.1 (64-100) for
sound, 77.4%±27.2 (36-100) for deferred and 28.4%±30.5 (0-79) for
the unsound sires. The CR was p0.05 when
comparing the sound vs. the deferred group. Given the conditions of
cattle rearing prevailing in the tropics, the BSE is an efficient tool in
order to identify those bulls with an unsound andrological status. The
presence of those sires in the herd, contributes to impair seriously the
productive proficiency of the beef cattle system.
P424
Effect of epididymis storage temperature and
cryopreservation on mitochondrial potential, membrane
integrity and motility of bovine epididymal sperm
Nichi, M 1,2 *, Rijsselaere, T 3 , Goovaerts, IGF 2 , Van Soom, A 3 , Barnabe, VH 1 ,
De Clercq, JPB 2 , Bols, PEJ 2
1Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine
and Zootechny (FMVZ), University of São Paulo (USP), Brazil; 2 Laboratory of
Veterinary Physiology, Faculty of Pharmaceutical, Biomedical and Veterinary
Sciences, University of Antwerp, Belgium; 3 Department of Reproduction,
Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University,
Belgium
Introduction Cryopreservation of sperm recovered from
epididymides is potentially a useful tool in case of unexpected death
of animals with high genetic value, species endangered of extinction,
or when the collection of sperm by other means is not possible.
Studies indicate that maintaining the epididymis at a lower
temperature during storage and transport improves the quality of the
retrieved sperm. The objective of this experiment was to study
whether the storage temperature of the epididymis following slaughter
influences sperm membrane resistance against lipid peroxidation,
resistance to cryopreservation, and fertilizing capacity, and if the
percentage of cytoplasmic droplets would play a role in this event.
Methods Thirty two epididymides (16 bulls) were collected after
slaughter and divided into two groups, stored at 4 and 34ºC for 2-3
hours, after which semen was collected from the caudae
epididymides. The epididymal sperm was then evaluated using
CASA, and an aliquot was stained with SYBR14/PI/JC1 to evaluate
membrane integrity and mitochondrial membrane potential. Sperm
was then frozen using an automatic device. Post thaw sperm was also
analyzed using CASA and SYBR14/PI/JC1.
Results A marked negative effect of cryopreservation on sperm
motility was observed in the samples collected from epididymides
stored at 4ºC. Significant effects of temperature of epididymal storage
and of cryopreservation were observed on motility parameters as well
as on cell viability and mitochondrial activity. Pre-cryopreservation
sperm motility, progressive motility, and velocity were higher in
samples from epididymides stored at 4 o C, while post-thaw sperm
motility, progressive motility, and velocity did not differ between
samples from epididymides stored at 4 or at 34 o C. Although the drop
on motility was not evident on sperm samples collected from
epididymides stored at 34ºC, the effect of temperature before
cryopreservation may have influenced those results. Strong
correlations (r>0.6) were found for samples collected from
epididymides stored at 34ºC between pre-freeze sperm motility
indexes and mitochondrial potential and between post-thaw sperm
motility and membrane integrity.
Conclusions Results indicate that the conditions in which
epididymides are handled after cryopreservation may influence postthaw
sperm quality, especially due to an impaired mitochondrial
potential in sperm samples collected from epididymides stored at
higher temperatures. This effect may have caused a higher
susceptibility to membrane damages due to cryopreservation.
P425
Assessment of spermatozoal characteristics in extended
boar semen incubated at 18 o C using flow cytometry
Niżański, W 1 *; Partyka, A 2 ; Dubiel, A 1 ; Łukaszewicz, E 2
1Department of Reproduction, University of Environmental and Life Sciences
in Wrocław, Poland; 2 Department of Poultry Breeding, University of
Environmental and Life Sciences in Wrocław, Poland
Extended liquid boar semen is commonly used for insemination for up
to 5 days after collection. A litter size and farrowing rates are reduced
when using semen stored > 3 days. The aim of our study was to
estimate changes of spermatozoal characteristics in extended boar
semen incubated at 18oC for 240 hrs using fluorescent staining and
flow cytometry. The study was carried out on 35 ejaculates collected
from 7 boars. Semen samples were extended in Safe Cell+ diluent
(IMV Technologies). Spermatozoal characteristics were evaluated at
24, 48, 96, 168 and 240 hrs after collection. Spermatozoal viability
was determined by SYBR-14/PI fluorescent staining. The DNA status
of spermatozoa was assessed using the metachromatic properties of
acridine orange (AO) in the sperm chromatin structure assay (SCSA).
DNA fragmentation index (DFI) and high DNA stainability (HDS)
were evaluated. Acrosomal integrity was measured by Pisum sativum
(PSA) agglutinin labeled by a fluorescent probe that stains acrosomereacted-
or damaged spermatozoa only. The mitochondrial function of
spermatozoa was evaluated with Rhodamine 123 (R123). Samples
were analysed in a FACSCalibur flow cytometer (Becton Dickinson,
San Jose, CA). The percentage of live spermatozoa did not change
significantly during the 168 hrs of storage. A significant increase of
the dead spermatozoa percentage (p

16 t h International Congress on Animal Reproduction
168 Poster Abstracts
P426
Phenotypic correlations among andrologic markers of
Nelore bulls from two to six years old, raised under
pasture condition at Minas Gerais state, Brazil
Nogueira, LAG. 1 *; Fragua, JD 2 ; Salamanca, E 2 ; Andrade, VJ. 1 ; Martins, JAM 1 ;
Emerick, LL. 1 ; Souza, FA. 1 Vale Filho, VR. 1
¹Veterinary Medicine School, Federal University of Minas Gerais, Brazil;
²University of Applied and Environmental Sciences, UDCA, Bogota, Colombia
Introduction Scrotal Circumference (SC), physical and
morphological semen characteristics, expressed by Breeding
Soundness Evaluation for Zebu (BSE-Z) index, can be taken as
reference for evaluation of bulls, since sexual maturity phase. The aim
of this study was to estimate phenotypic correlations among
andrological markers of Nelore bulls from 2 to 6 years old.
Material and Methods A total of 163 Nelore bulls from 2 to 6 years
old were evaluated according to CBRA (1998) and classified by BSE-
Z according to Vale Filho et al. (1988). Pearson’s and Spearman’s
correlations were estimated by CORR procedure using SAS (2002)
with 5% of significance.
Results High correlations of BSE-Z, motility and total sperm defects
(TD) were, respectively, 0.65 and -0.67 (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 169
factors such as: blood, urine, bacteria, or debris that possibly lead to
reduced fertility. In dogs, blood is known to negatively affect semen
preservation. Improving the quality of contaminated semen by
purification prior to preservation or fertilization may increase the
overall success rate in terms of pregnancy. The density gradient
centrifugation method has been demonstrated as simple, inexpensive,
and results in favorable sperm cell recovery. Our aim was to compare
different commercial media [Isolate®, Percoll®, PureCeption®,
PureSperm®] in their ability to optimally separate viable, motile
sperm from non-motile sperm and red blood cells (RBC).
Methods The sperm-rich 2nd fractions of 4 dogs were pooled. The
pooled semen was analyzed with Spermvision for concentration,
motility, morphology, and diluted to 300 x106/ml with CaniPro®
chilled extender. Canine whole blood (10% v/v) was added to semen
to mimic contamination. One ml of the blood/sperm admixture was
pipetted over 4 ml of a double layered-column of the following
gradients: Isolate®, Percoll®, PureCeption®, and PureSperm®. After
centrifugation at 400 x g for 20 min at 23°C, the gradients were
divided into 1 ml fractions (Top, B, C, D, E, Pellet). The 1 ml
fractions were analyzed with Spermvision. Morphology of the Dif
Quik stained smears of the fractions were examined under light
microscopy (1000X). For the RBC/sperm ratio, 100 cells were
counted in three fields in each slide, and an average was obtained.
Results The fraction with the highest concentration of motile sperm
and the lowest ratio of RBC for each media is a follows:
PureCeption® pellet; PureSperm® E; Percoll® D, pellet; and
Isolate® D, pellet. The percent recovery of sperm cells from the
fraction with the highest concentration in each media was as follows:
PureCeption® (93.0±2.25%) concentration, (72.0±12.97%) motility;
PureSperm® (44.8±25.9%) concentration, (53.5±17.11%) motility;
Percoll® (31.0±22.48%) concentration, (70.39±32.10%) motility;
Isolate® (49.67±41.37%) concentration, (59.7±21.38%) motility.
PureCeption® had a significantly higher percent recovery of motile
sperm cells compared to the other sperm separation media (P

16 t h International Congress on Animal Reproduction
170 Poster Abstracts
P432
The effect of the addition of seminal plasma and
antioxidants to frozen thawed ram semen
Sicherle, CC 1 *, Maia, MS 2 , Bicudo, SD 1 , Green, RE 1 , Azevedo, HC 2
1Department of Animal Reproduction and Veterinary Radiology, UNESP,
Botucatu, São Paulo, Brazil; 2 Embrapa Semi Árido, Petrolina, Pernambuco,
Brazil, d Embrapa Tabuleiros Costeiros, Sergipe, Alagoas, Brazil
Intoduction The structural changes in ram spermatozoa after
cryopreservation are a fact assumed by several authors (1). This fact
can be explained by a combination of factors that include a low level
of membrane phospholipids and also by the oxidation process that
generate the reactive oxygen species (ROS) which, when in high
levels, are toxic to spermatic cells (2). The seminal plasma (SP) is a
complex mixture of components as proteins, sugars and antioxidants.
Evidence of high levels of pregnancy after cervical insemination in
ewes with frozen thawed semen after a swim-up procedure
supplemented with SP indicates a way to improve fertility using this
method for artificial insemination in sheep (3). The aim of this study
was to evaluate the effect of the addition of SP and the antioxidants
catalase (CAT) and Trolox (TRO) on the structural and kinetics
parameters on frozen thawed ram semen, independent of individual
characteristics of cryopreservation resistance.
Materials and Methods With this purpose four groups were
established, CO (semen sample + 200µL PBS), CAT (12,5mg/mL+
PBS = 200µL), TRO (100µMol/100 x 10 6 sptz + PBS = 200µL) and
SP (60% of seminal plasma diluted in PBS) added to semen samples
in the proportion of 1:1. The SP was obtained from tree different
rams, after semen collection all ejaculates were pooled, centrifuged
and filtered as described by Mortimer & Maxwell (4). Semen samples
were obtained from 13 rams and after dilution for a final
concentration of 100 x 10 6 sptz/0,25mL were frozen. One sample
from with ram per group were thawed and immediately mixed on the
solutions groups for posterior analyses after 5 minutes of incubation.
The kinematics parameters, as total motility, progressive motility,
average path velocity, curvilinear velocity and straight-line velocity
were analyzed using the computer assisted sperm analyzer (CASA).
The membrane integrity (MI) were determined by by the combination
of fluorescent probes Propidium Iodide and Carboxyflorescein, and on
the capacitation status analyzed by the assay using Chortetracycline
(CTC) (4).
Results and Discution There were no statistic differences (P>0,05)
between groups on the kinematics parameters, on the membrane
integrity, and on the capacitation status analyzed by the assay using
Chortetracycline (CTC). Probably in our experimental conditions the
oxidative stress generated wasn’t high enough to permit the
effectiveness of the antioxidants.
P433
Semen quality (SQ) and scrotal circumference (SC), in
Nelore bulls, from 2 to 6 years old
Silva, PAR. 1 *, Emerick, LL. 1 , Martins, JAM. 1 , Andrade, VJ. 1 , Quintao Lana,
AM. 1 , Leite, TG. 1 ,Vale Filho, VR. 1 , Salamanca, E. 2
1Medicine Veterinary School, Federal University of Minas Gerais, Brazil;
1Universidad de Ciencias Aplicadas Y ambientales, UDCA, Bogota, Colombia
Introduction SC and SQ are important parameters for selecting bulls
with adequated reproductive efficiency during the first 21 days of
breeding season. However, there are still some doubts related to bull
age in relation to semen quality, as far as reproductive efficiency is
concerned (Feliciano Silva et al., 1993). The aim of this study was to
evaluate the evolution curve of SC and total semen defects (TD) from
2 to 6 year-old Nelore bulls, elucidating doubts concerning SQ as the
animal ages.
Material and Methods Semen samples from 163 Nelore bulls, aging
from 2 to 6 years, were collected by electro ejaculation and evaluated
according to Brazilian College of Animal Reproduction (1998).
Models of linear and quadratic regression were estimated (Sampaio,
2002), verifying the evolution of TD and SC according to age.
Results A linear model (Y=0.59-0.53X; R²=0.92, p

16 t h International Congress on Animal Reproduction
Poster Abstracts 171
P435
Potential fertility estimation in bulls using polyacrylamide
gel instead of cervical mucus in the sperm penetration
test
Taş, M 1 *, Bacinoglu, S 2 , Cirit, Ü 2 , Özgümüş, S 3 , Kaşgöz, H 3 , Pabuccuoglu, S 2
1Department of Reproduction and Artificial Insemination, Faculty of Veterinary
Medicine, Dicle University, 21280 Diyarbakir, Turkey; 2 Department of
Reproduction and Artificial Insemination, Faculty of Veterinary Medicine,
Istanbul University, 34320 Avcilar, Istanbul, Turkey; 3 Sub Department of
Chemical Technologies, Department of Chemical Engineering, Faculty of
Engineering, Istanbul University, 34320 Istanbul, Turkey
The aim of the study was to develop a polyacrylamide gel that could
be used instead of bovine cervical mucus in the cervical mucus
penetration test (CMPT) to obtain coherent and replicable results in
bulls. The frozen semen samples of six Holstein bulls, which were
divided into two fertility groups as high and low according to their
non-return rate (NRR), were used. The modified CMPT (mCMPT)
was carried out within 0.25 ml transparent plastic straws with an inner
diameter 1.7 mm in this study. The penetration ability of spermatozoa
to bovine cervical mucus and to polyacrylamide gels swollen with two
different solutions [NaCl (G1) and PBS (G2)] was compared. For the
penetration test, the straws filled with cervical mucus and both gels
were dipped into thawed semen samples and incubated at 37 °C for 15
min. After the incubation, straws were frozen in liquid nitrogen
vapour and stored at -20 °C. On the evaluation day, the frozen straws
were cut at 1.5–1.75 cm (penetration distance range = PDR1), 3.25–
3.5 cm (PDR2) and 5.0–5.25 cm (PDR3), beginning from open-end of
the straws. The separated frozen parts were then immediately
transferred onto special counting slides by pushing with a mandrel
and left to thaw. Thawed samples were covered with cover glass and
penetrated spermatozoa in these parts were counted. The relation
between the results and fertility of bulls was determined. When
compared with the low fertility group, the number of penetrating
spermatozoa was found to be significantly higher in the high fertility
group in mucus at PDR3 (p

16 t h International Congress on Animal Reproduction
172 Poster Abstracts
P438
Correlaction between bovine sperm membrane integrity
and mitochondrial cytochemical activity in Bos taurus
bulls
Zuge, RM 1,2 ; Bertolla, RP 3 ; Nichi, M 1,4 ; Soler, TBS 1,3 ; Cortada, CNM 2 *; Bols,
PEJ 4 ; Barnabe, VH 1
1Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine
and Zootechny (FMVZ), University of São Paulo (USP), Brazil; 2 Paraná
Technology Institute (Tecpar), Brazil; 3 Department of Human Reproduction,
Federal University of São Paulo (UNIFESP), Brazil; 4 Laboratory of Veterinary
Physiology, Faculty of Pharmaceutical, Biomedical and Veterinary Sciences,
University of Antwerp, Belgium
Introduction Previous studies with varicocele in men and European
bulls in tropical region, indicated that heat stress would induce
deleterious effects to all structures of the spermatozoa, with special
regard to the mitochondria. The disruption of the spermatic
mitochondria could have a potential damaging effect not only to an
individual cell but to the surrounding cells, specially regarding to the
sperm membrane. This could be due to the release of a high amount of
reactive oxygen species (ROS) produced in this environment, rich in
electrons and oxygen that would lead to an event known as lipid
peroxidation.
Methods To study whether sperm cells with disrupted mitochondria,
would show higher amount of membrane damages probably due to
higher levels of ROS attack, semen samples of eleven heat stressed
Simmental bulls were collected by electroejaculation, the method of
choice when working under field conditions in Brazil. The staining 3-
3’ diamino benzidine (DAB), as an index of mitochondrial activity,
the hypo-osmotic swelling test (HOST), as an index of membrane
integrity, and the measurement of tiobarbituric acid reactive
substances (TBARS), an index of spontaneous lipid peroxidation were
used. Data was analysed using the SAS system for Windows.
Results Results showed a positive correlation between sperm cells
with full mitochondrial activity (DAB class A), and percentage of
cells with intact membrane by the HOST (r=0.93, p

16 t h International Congress on Animal Reproduction
Poster Abstracts 173
can conclude that treatments of 8 or 9 days of duration would be of
election and from practical point of view; the insemination time
would be earlier when EB is injected at device removal than 24 h
later. Granted by NUMdPlata.
P441
Evaluation of different lipid sources in frozen-thawed ram
semen
Alvarez, M 1 *, Bernardo, J 1 , Boixo, JC 1 , Gomes-Alves, S 1 , Mata-Campuzano,
M 2 , Anel, E 1 , De Paz, P 2 , Anel, L 1
1Animal Reproduction and Obstetrics, University of Leon, Spain; 2 Cell
Biology, University of Leon, Spain
The use of substances free of animal proteins in semen extenders is an
important tool to improve the healthy conditions of ovine
reproduction programmes. Hygienic control and chemical
composition of extenders are important factors that affect the
spermatozoa lifespan. Egg yolk provides protection against cold shock
and particularly the low density lipoprotein fraction is the responsible
of this effect. Other lipoproteins have been demonstrated to be good
cryoprotectants (soy bean) but their use is limited. The aim of this
study is to test the fertility of frozen-thawed semen from Churra breed
rams, cryopreserved with four extenders (different source of lipids).
Extenders were made with different sources and concentrations of
lipids: egg yolk (UL), low density lipoproteins (LDL), soy lecithin 1%
and soy lecithin 2% (granulated commercial soy bean). Semen from
ten rams (two consecutive semen collections per session, two
sessions) was evaluated (volume, mass motility and spermatozoa
concentration). For each ram, the two ejaculates of a session were
pooled if both had good quality. Thus, the final ejaculate was divided
in 4 aliquots and diluted (1:1) with the 4 freezing extenders: UL
(TesT-fructose-10% egg yolk -4% glycerol- antibiotics), LDL8
(TesT-fructose-8% LDL-4% glycerol- antibiotics), SOY1 (TesTfructose-1%
soy -4% glycerol- antibiotics) and SOY2 (TesT–fructose-
2% soy-4% glycerol- antibiotics). The samples were cooled at 5ºC (-
0.25ºC/min) and extended to a final concentration of 100x106
spermatozoa/ml. Diluted semen was placed into 0.25 ml straws,
sealed and frozen from 5ºC to -100ºC (-20ºC/min) in a programmable
cell freezer (Kryo 10, Planer). The straws were plunged into liquid
nitrogen until analysis and thawed in a water bath (65ºC, 6 s). The
fertilizing capacity was evaluated by laparoscopic intrauterine
insemination. The oestrous of the ewes were synchronized using
intravaginal sponges with 40 mg fluorogestone acetate (14 days) and
500 UI of eCG (im) at withdrawal. Laparoscopic inseminations were
performed at 64 h after the removal of the sponges. The number of
inseminated ewes (total 576 from four farms) with each extender was:
UL (144), LDL8 (146), SOY1% (146) SOY2% (140). Fertility was
not significantly affected by freezing extender, although UL and LDL
seemed to show better results (UL: 43.06%; LDL: 49.32%; SOY1:
41.78% and SOY2: 40.71%). The lipid sources assayed are suitable
for freezing the ram semen applied by intrauterine insemination. This
work was supported in part by CYCYT (AGL2005-07601/GAN),
Ovigen, Diputación de León and ASSAF.E.
P442
Effect of different thawing rates on post-thaw sperm
viability, kinematic parameters and motile sperm
subpopulations structure of bull semen
Peña, AI 1 *; Muiño, R 1 ; Rivera, MM 2 ; Rigau, T 2 ; Rodriguez-Gil, JE 2
1Faculty of Veterinary Medicine, University of Santiago de Compostela,
Spain; 2 Faculty of Veterinary Medicine, Autonomous University of Barcelona,
Spain
The aim of the present study was to evaluate three thawing rates for
bull semen frozen in 0.25 ml-straws: placing the straws in a water
bath at 37ºC for 40 s, at 50ºC for 15 s or at 70ºC for 5 s. In a first
experiment, the 3 thawing rates were compared in relation to postthaw
sperm motility, determined subjectively, and sperm plasma and
acrosomal membrane integrity, examined by flow cytometry, after 0
and 5 h of incubation at 37ºC. In a second experiment, the three
thawing rates were evaluated based on post-thaw sperm motility,
determined using a CASA system, after 0 and 2 h of incubation at
37ºC. In addition, for the motile spermatozoa, the individual motility
descriptors were analysed using a multivariate clustering procedure to
test the presence of separate sperm subpopulations with specific
motility characteristics in the thawed bull semen samples. Finally, it
was investigated if the thawing rate had any influence on the relative
frequency distribution of spermatozoa within the different
subpopulations. In terms of overall post-thaw motility or plasma and
acrosomal sperm membrane integrity there were no significant
differences between the 3 thawing methods evaluated. The statistical
analysis clustered all the motile spermatozoa into 4 separate
subpopulations with defined patterns of movement: 1) moderately
slow and progressive sperm (27%); 2) “hyperactivated-like” sperm
(15.4%); 3) poorly motile non progressive sperm (34.3%) and 4) fast
and progressive sperm (23.3%). The thawing rate had no significant
influence on the frequency distribution of spermatozoa within the 4
subpopulations, but there was a significant effect (P

16 t h International Congress on Animal Reproduction
174 Poster Abstracts
P444
Effective low dose insemination with sex-sorted ram
spermatozoa
Beilby, K*; Grupen, C; Maxwell, WMC; Evans, G
The Faculty of Veterinary Science, The University of Sydney, Sydney,
Australia
Sex-sorted ram sperm is an attractive breeding management tool in
commercial production systems. However, the time required and cost
associated with sorting large commercial sperm doses limits the use of
this technology. Previous research has shown that insemination with
sex-sorted ram sperm resulted in equal, if not superior, fertility
compared to non-sorted controls at dose rates of 1, 5 and 15 million
motile sperm 1 . Pregnancy rates were similar for sex-sorted sperm at
these dose rates. Therefore, the current study aimed to determine the
minimum dose that could be inseminated before fertility was
significantly reduced. Semen was collected from 3 merino rams. Half
of each ejaculate was frozen immediately (non-sorted, control sperm)
and the remaining half was sex-sorted via modified flow cytometry
and then frozen (sorted sperm). Oestrus was synchronised in ewes
(N=138) using progestagen pessaries (12 days) and PMSG at pessary
removal (PR). Ovulation was further controlled using GnRH given
36h after PR. All animals were inseminated by laparoscopy 58h after
PR with either 5 x 10 5 (n = 60), 1 x 10 6 (n = 39) or 15 x 10 6 (n = 39)
sorted or non-sorted, frozen-thawed motile spermatozoa. Pregnancy
rates were assessed at day 60 after insemination using cutaneous realtime
ultrasound. There was no difference in pregnancy rate for groups
inseminated with sorted or non-sorted spermatozoa across all dose
rates. Furthermore, there was no difference between doses of 1 and 15
million spermatozoa. However, the pregnancy rates were lower (P <
0.05) for the 5 x 10 5 sperm dose (15 and 13%, for non-sorted and
sorted, respectively) compared with doses of 1 (49 and 41%) and 15 x
10 6 spermatozoa (44 and 49%). More than 90% of lambs born were of
the predicted sex. This study confirmed that a dose of 1 x 10 6 sexsorted
frozen-thawed motile sperm is the minimum that can be used
for laparoscopic insemination of ewes before fertility is reduced. This
is much lower than the current industry standard of 20-40 x 10 6
frozen-thawed sperm/inseminate. These results provide the sheep
industry with a promising assisted reproductive management strategy
that is not only effective, but practically applicable.
P445
Advantages of the association of glutamine and LDL (Low
Density Lipoprotein) for freezing canine sperm
Bencharif, D 1 *, Tainturier, D 1 , Pascal, O 1 , Larrat, M 1 , Langlois, ML 2 , Barrière,
JP 2 , Amirat-Briand, L 1
1Department of Biotechnologies and Reproductive Pathology, Nantes
Veterinary College, Nantes, France; 2 Department of Reproductive Pathology,
Mother and Child, CHU Hôtel Dieux, Nantes, France
Introduction Various studies have demonstrated the cryoprotective
action of glutamine (Glut). The latter improves spermatozoa motility
and provides superior protection for the cytoplasmic membrane. This
preliminary study aims to determine the ideal concentration of
glutamine when combined with 6% LDL to improve the
cryopreservation of canine semen.
Materials and method Exp n°1: 20 ejaculates were collected from 6
dogs (Beagle, Golden Retriever) aged from 3 to 6 years. Semen with a
motility of between 2 and 5 were frozen in different media: Basic
Medium (BM)+20% egg yolk (e.y), BM+6% LDL, and BM+6%
LDL+60, 70, 80, 90, or 100 mmol of Glut. Following collection, the
spermatic and prostatic fractions were mixed and diluted in the
different freezing media at +37°C to obtain a final concentration of
100x10 6 spermatozoa/ml. Exp n°2: In the same way as for Exp n°1,
the ejaculates were frozen in different media: BM+20% e.y, BM+6%
LDL, and BM+6% LDL+10, 20, 30, 40, or 50 mmol of Glut. Exp n°3:
10 ejaculates were collected from these same 5 dogs, and frozen in:
BM+20% e.y, 6% LDL milieu (e.y extract), and 6 % LDL
medium+20 mmol Glut. The semen was cooled to +4°C for 1 hour
then aspirated into 0.25 ml straws and stored for 30 min at +4°C. The
straws were placed in the liquid nitrogen vapours at -110°C for 10
minutes, before being plunged into the liquid nitrogen. The straws
were thawed in a water bath at +37°C for 30 seconds. The semen was
assessed 10 minutes after thawing with a HAMILTON THORN
CERROS 12 image analyser. For Exp 3, spermatozoa integrity was
analysed using Acridine orange, HOS, PSA-FITC, and Spermac ®
tests.
Results Exp n°1: the motility results were superior in the 6% LDL
media than the other media (BM+20% (e.y), BM+6% LDL+60, 70,
80, 90, 100 mmol of Glut) (43,13% vs 27,3, 28,7, 30,9, 24,1, 31,1,
27,8% respectively) (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 175
P447
The effect of plant lipid extender component on quality of
frozen ram semen
Palasz, A 1 , Bochenek, M 2 *, Gogol, P 2 , Kareta, W 2 , Smorag, Z 2
1INIA, Dpto Reproduccion Animal, Crta. Coruña, km 5, 9-28040 Madrid,
Spain; 2 Dept. Biotechnology of Animal Reproduction, NRIAP, 32-083 Balice,
Poland
Experiment was designed to test different concentrations and different
homogenization protocols of soybean lipids liposomes for the use as a
milk replacement in ram semen freezing extender. Lipids were
homogenized by high pressure homogenization (800 bars) and then
5% (Y1 extender) or 10% (Y2 extender) liposomes were mixed with
8% glycerol. As additional group, lipids and glycerol were
homogenized together (LIPO extender). All 3 extenders (Y1, Y2,
LIPO) were prepared in Tris buffer containing citric acid and fructose.
As control group milk/egg yolk (MY) extender was used. The semen
was collected from 3 rams with artificial vagina. Post thaw motility
and survival time (total of 11 ejaculates), lipid peroxidation (total of 7
ejaculates) and sperm membrane integrity (total of 3 ejaculates) were
examined in 4 extenders tested. Immediately after collection each
ejaculate was divided into 4 parts, diluted with Y1, Y2, LIPO and MY
extenders and processed according schedule. Post thaw motility and
survival time: Mean sperm motility examined immediately after
thawing for Y1, Y2, LIPO and MY extenders was 51.4%, 46, 8%,
50.6% and 44.4% respectively. Mean survival time of spermatozoa
kept at 42°C was 200, 220, 255 and 135 minutes for Y1, Y2, LIPO
and MY extenders respectively. Lipid peroxidation was monitored by
chemiluminescence method. Iron induced luminescence of
frozen/thawed sperm cells was assessed using a luminometer. It was
shown that Y1, Y2 and LIPO semen extenders had significantly lower
peroxidation level than MY extender. The values of Integral
parameter for Y1, Y2, LIPO, MY extenders was 4,57; 5,49; 4,31;
28,70 respectively. Sperm membrane integrity: After thawing semen
sample was diluted with PBS to 20mln/ml concentration and kept for
1h at room temperature. Sperm membrane examination (“live/dead”)
was performed by double staining with SYBR-14/propidium iodide
fluorochromes and analysis by flow cytometry. Data of 20 000
spermatozoa were collected for each sample. The percentage of
membrane intact (“live”) spermatozoa was taken for statistical
analysis. The mean percentage of live spermatozoa for Y1, Y2, lipo
and milk extenders were 10.79%, 10.61%, 10.82% and 4.71%
respectively. Statistically significant differences was found between
milk and Y1, Y2, LIPO (test t, P

16 t h International Congress on Animal Reproduction
176 Poster Abstracts
P450
Factors affecting pregnancy rates following fixed-time AI
in beef cattle in Argentina
Cutaia, L 1 *, Lopez, P 2 , Videla Dorna, I 2 , Leblic, D 2 , Castagneto, N 2 , Diaz, T 2 ,
Bo, GA 1
1Instituto de Reproduccion Animal Cordoba (IRAC), Argentina; 2 Syntex SA,
Argentina
Field data on 54,457 inseminations in 396 herds were analyzed to
determine the factors that affected pregnancy rates following fixedtime
AI (FTAI) of beef cattle in Argentina between 2004 and 2006.
Cattle were treated by 39 different veterinarians with a new or onceused
progesterone releasing device (1.0 g progesterone; DIB, Syntex,
Argentina) for 7 or 8 days, combined with 2 mg estradiol benzoate
(EB, Syntex) at DIB insertion, 150 µg D(+) cloprostenol (Ciclase,
Syntex) at DIB removal and 1 mg EB 24 h later. Cattle were FTAI 52
to 56 hours after DIB removal. Lactating beef cows in poor body
condition also received 400 IU eCG (Novormon, Syntex) at DIB
removal. Pregnancy rates were determined 30 to 60 days following
FTAI by ultrasonography or rectal palpation. Data were analyzed by
logistic regression. The overall pregnancy rate was 49.5%. Body
condition score was not included in the model because of
inconsistencies in methodology and scoring among veterinarians.
Breed significantly influenced pregnancy rates (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 177
Methods A total of eight clinically normal, sexually mature twoyears-old
dairy-Gyr bulls (25.7 ± 0.8 months old) with average score
84.4 ± 15.6 points in the CAP evaluation (zero to 100 scale), scrotal
circumference 34.4 ± 2.5, body weight 354.7 ± 26.3 Kg and scanned
for andrological features from 18,2 ± 0.8 months old had their semen
collected by eletroejaculation. The bulls were raised, from weaning to
21.2 ± 0.8 months old, under tropical pastures of Brachiaria brizhanta
receiving mineral salt supplementation and from there they were kept
individually in a feeding-lot under full diet management based in corn
silage and 27% crude protein / 83% total digestible nutrients ration.
Sperm Motility (MOT) and vigor (VIG) were immediately analyzed.
The semen was diluted in both EYL and Bioxcell ® diluters until 60.0
x 10 6 sptz/mL and loaded in 0.5 mL straws at room temperature being
stored at 5ºC for a cooling stabilization period from four to six hours.
The negative curve was performed by the Brazilian machine
CRYOGEN ® until -135ºC, when the straws were immersed in liquid
nitrogen. A total of 160 straws were evaluated (10 from each bull per
extender used) for MOT and VIG post-thawing and also for the Host
and compared by the SNK test (p

16 t h International Congress on Animal Reproduction
178 Poster Abstracts
P457
Microfluidic sorting of boar spermatozoa
Holt, W 1 *, Satake, N 1 , Smith, GD 2 , Alhaider, A 3 , Takayama, S 4 , Watson, PF 3
1Institute of Zoology, Zoological Society of London, United Kingdom;
2Department of Obstetrics and Gynecology, University of Michigan, United
States; 3 Veterinary Basic Sciences, Royal Veterinary College, United
Kingdom; 4 Department of Biomedical Engineering, University of Michigan,
United States
Microfluidic sperm sorter devices, developed at the University of
Michigan, are able to sort a highly motile subpopulation of human
spermatozoa, where motile spermatozoa traverse the boundary
between two laminar flowing streams (one containing spermatozoa
and the other comprising culture media alone) and are collected at an
outlet reservoir (1). The aim of the present study was to investigate
the application of this technology to the physical separation of
putative boar sperm subpopulations. We have previously shown
statistically that bicarbonate exposure significantly stimulates the
motility of a (boar-dependent) sperm subpopulation (2), while others
remain unaffected; physical separation of these populations has never
been achieved. Percoll washed spermatozoa from 3 boars were
incubated (10 min at 38ºC) in Tyrode’s based medium without
bicarbonate, then 15mM bicarbonate/CO 2 was added to the medium
before loading into sperm-sorters (provided by Strex Inc., Japan); the
sorters were then left for 30 minutes at 38°C. Two outlet populations
were collected and 60μl samples of each were subsequently analysed
using a CASA system (Hobson Sperm Tracker, Hobson Tracking
Systems, Sheffield, UK). In a preliminary study, spermatozoa were
stained with SYBR14 and Propidium Iodide before loading into sperm
sorters; videomicrography of the sorting channel showed that >95% of
spermatozoa in the ‘sorted’ channel were live (PI−ve), although they
were highly diluted. The proportion of immotile spermatozoa was
reduced from 45% in the unsorted channel to 26% in the sorted
channel. The proportion of progressively motile spermatozoa also
decreased upon sorting (from 45% to 22%), but there was a surprising
increase in the proportion of hyperactivated spermatozoa (from 10%
to 52%). These results demonstrate the feasibility of using the sperm
sorters for the isolation of a boar sperm subpopulation. Given that
progressive motility is required for the sorting process to occur, the
prevalence of hyperactivated spermatozoa after sorting suggests that
the sorting may induce the final stages of capacitation.
P458
Time oriented A.I. in cattle with reduced number of sperm
cells
Kanitz, W. 1 *, Becker, F. 1 , Bhojwani, S. 1 , Alm, H. 1 , Nehring, H. 2 , Nürnberg, G. 1
1Research Institute for the Biology of Farm Animals, Dummerstorf, Germany,
2Institute for Reproduction of Farm Animals, Schönow, Germany
Among others number of spermatozoa per A.I. and time of
insemination with regard to oestrus symptoms or ovulation are
important determinants for pregnancy rate in cattle. In addition, the
necessary number of spermatozoa per A.I. is under investigation with
an aim of better utilisation of A.I. sires and the insemination of sorted
spermatozoa. Because, data on fertilisation rate after A.I. with reduced
sperm number are unavailable, we performed the following
experiment. Altogether 116 heifers (German Holstein) received
PGF 2 (0.5 mg Cloprostenol ® , Jenapharm, Germany; i.m.) between
day 8 to 14 of oestrous cycle. 60 hours later 50 µg GnRH agonist
(Depherelin ® ; Veyx, Germany, i.m.) was injected. Subsequently, 13
hours later the animals were inseminated once with frozen/thawed
semen of 4 proven sires. The number of spermatozoa was 15x10 6 ,
5x10 6 or 1x10 6 per A.I. (G1/G2/G3). After surgical recovery of the
oviduct and the tip of the uterine horn ipsilateral to the C.l. embryos
and oocytes were flushed from the oviduct on day 4 after
insemination. The recovered oocytes and embryos were classified
according their morphology and fixed using BFS medium (buffered
formol solution, Merck, Germany). All oocytes and embryos were
stained with HOECHST 33258 (Sigma, Germany) to identify
accessory sperm cells. For statistical analyses fertilisation rates and
portions of intact embryos were compared by means of Chi-squaretest.
The influence of the factors sire, and sperm number on
fertilisation rate was tested by GLM-procedure of SAS ® (Release 8.2,
SAS Institute, Inc., Cary, NC 1999). Of the 116 heifers treated 106
animals ovulated (ovulation rate 91.5 %). The mean recovery rate for
oocytes and embryos was 80.2 %. Mean fertilisation rates and the
portions of intact embryos were 92.3/84.6 % (G1), 96.2/80.7% (G2)
and 78.8/75.8 % (G3). Mean number of accessory sperm cells per
embryo was significantly higher in G1 and G2 than in G3 (G1:
26.6±8.4, G2: 45.3±8.6, G3: 6.5±7.2). From the data obtained it can
be concluded that time oriented A.I. can result in high fertilisation
rate. Moreover, the portion of intact embryos does not depend on
sperm number per insemination after time oriented A.I. Finally, the
number of accessory sperm cells is not correlated with the portion of
intact embryos after time oriented A.I.
P459
A simple technique for minimal dose DIUI in PMSG
multiple-ovulating dairy heifers
Kornmatitsuk, B 1 *; Charoenyongyoo, P 1 ; Pattharanukulkit, K 1 ;
Akkhawattanangkul, Y 1 ; Chaiprasat, S 2 ; Kornmatitsuk, S 1
1Faculty of Veterinary Science, Mahidol University, Phutthamonthon, Nakhon
Pathom, 73170; 2 Livestock Semen Production Center-Inthanont Royal
Project, Department of Livestock Development, Ministry of Agriculture and
Cooperatives, Maung, Chiang Mai, 50300
The aim of the present study was to investigate an accomplishment of
minimal dose deep intra-uterine insemination (DIUI) using a simple
embryo transfer (ET) pistolet, in connection to relative fertilisation
rates and early embryo qualities on day 7 post-service, studying in
pregnant mare serum gonadotropin (PMSG) multiple-ovulating dairy
heifers. Ten heifers of crossbred Holstein Frisian (≥75%) were
included. They were characterised for their oestrous cycles,
afterwards subjected to the superovulatory programme using PMSG/
Prostaglandin F2alpha (PGF2alpha) protocol, and fixed-time artificial
insemination: Group 1, 3 heifers inseminated with 20×10 6 sperm cells
at body of uterus; Group 2, 4 heifers inseminated with 10×10 6 sperm
cells at tip of the uterine horns and Group 3, 3 heifers inseminated
with 10×10 6 sperm cells at body of the uterus.. Embryos were nonsurgically
recovered and categorised on 7 days subsequent to the
insemination. On the day of each treatment, the ovaries of the heifers
were ultrasonographically examined. Prior to the treatment, majorities
of the follicles observed in all heifers were of small sizes (

16 t h International Congress on Animal Reproduction
Poster Abstracts 179
P460
Improved sperm tail viability differentiation by coloured
mounting medium
Kovács, A 1-2* , Sarlós, P 1 , Egerszegi, I 1 , Oláh, J 2 , Révay, T 1 , Vass, N 2 and
Jávor, A 2
1Research Institute for Animal Breeding and Nutrition; 2 Debrecen University,
Centre for Agricultural Sciences, Institute for Animal Breeding Sciences
Introduction Head membrane permeability and acrosome status of
spermatozoa of different domestic mammals can be well
differenciated by the combined trypan blue – Giemsa staining
(Kovács A., Foote R.H.: Viability and acrosome staining of bull, boar
and rabbit spermatozoa. Biotechnic & Histochemistry 67: 119-124,
1992; Nagy Sz. et al.: Evaluation of sperm tail membrane integrity by
light microscopy. Theriogenology 52: 1153-1159, 1999), as well as by
the similar Chicago sky blue - Giemsa (Kútvölgyi et al.: Viability and
acrosome staining of stallion spermatozoa by Chicago sky blue and
Giemsa. Biotechnic & Histochemistry 81: 109-117, 2006) staining.
The evaluation of the tail membrane permeability may be often
uncertain due to its narrowness and different backgrounds caused by
seminal plasma and extender components.
Materials and methods Both combined stainings are routinely
applied in our laboratories using a yellow filter helping the better
differentiation of the acrosome status. Preparations from fresh ram
and boar, and frozen-thawed bull and ram semen samples were
mounted with immersion oil (Merck 4699) control evaluated with a
yellow filter, or with the same immersion oil saturated with Sudan I.
(Peking Chemical Works, Peking, China) or with dimethyl yellow
(Sigma D6760). The saturated solutions were the supernatants of the
centrifugated oversaturated ones.
Results and discussion Sudan I. or Dimethyl yellow solved in
immersion oil resulted in not only a good differentiation of the
acrosome status similarly to the control, but also a better
distinguishing of membrane permeable „dead” and impermeable
„live” tail domains of spermatozoa even in the case of background
caused by the extender. The effect can be explained by the relief-like
nature of the smears - the yellow mounting medium is more thick
around the cells than above them. The yellow surroundings of the
cells are lighter than the coloured „dead”, but darker than the
unstained „live” sperm tails ensuring their easy and clear
differentiation. The tail membrane of spermatozoa is more sensitive to
the harmful effects of the freezing-thawing procedure than their head
membrane, therefore its correct evaluation is extremely important for
the quality control.
P461
First foal born in Italy using flow cytometrically sorted
spermatozoa
Mari, G 1 *; Rizzato, G 1 ; Iacono, E 1 ; Merlo, B 1 ; Seren, E 2 ; Tamanini, C 2 ; Galeati,
G 2 ; Spinaci, M 2
1 Veterinary Clinical Department, University of Bologna, Italy; 2 Dep. of
Veterinary Morphophysiology and Animal Production, University of Bologna,
Italy
Introduction Sex-preselection of stallion spermatozoa is possible
using a modified flow cytometer to separate spermatozoa into X and
Y-chromosome bearing cells on the basis of DNA content. The
objectives of this study were to evaluate vitality, motility
characteristics and fertilizing ability of equine sexed semen.
Methods Semen from 4 thoroughbred stallions of proven fertility
(65% pregnancy rate per cycle) was diluted 1:1 with KMT and
analysed by Computer Aided Sperm Analysis (CASA). Total motility
(TM), progressive motility (PM), velocity average path (VAP) and
rapid spermatozoa (RAP) were recorded. For sorting, samples were
diluted to 200 x10 6 spermatozoa/ml and stained with Hoechst 33342
for 1.30 h at 35° C in the dark. Just prior to sorting a final
concentration of 100 x10 6 spermatozoa/ml was reached and red food
dye was added. A MoFlo SX® sperm sorter was used. Sorted
spermatozoa were evaluated for motility parameters by CASA and for
viability by SYBR-PI staining. The fertility of sexed spermatozoa was
assessed by inseminating 4 mares (7 estrous cycles). Mares were
histeroscopically inseminated at the utero-tubal junction, ipsilateral to
the preovulatory follicle, with 5 x10 6 spermatozoa in 250 μl, 30-32 h
after 2500 IU hCG administration for induction of ovulation.
Pregnancy diagnosis was carried out 15 days after ovulation.
Results Sperm motility characteristics were negatively affected by
sorting (pre vs. post-sorting: TM 79.6±5.5 vs. 38.6±14.5; PM
32.3±9.4 vs. 10.6±5.4; VAP 116.4±12.4 vs. 99.9±13.3; RAP
67.0±12.0 vs. 30.2±12.0; p0.05, T
student test). Pregnancy rate was 28.6% (2/7), and a pregnancy was
loss at 30 days while the other was carried to term with the birth of a
healthy filly.
Conclusions Sperm motility parameters are negatively affected by the
sorting process. On the other hand, viability is only slightly and nonsignificantly
affected. Usually, mares are inseminated with 500 x 10 6
motile spermatozoa; being that the number of sexed spermatozoa/h is
about 15 x 10 6 , and it would take too time to obtain the optimal dose,
the histeroscopic insemination allows to use low numbers of sexed
spermatozoa. Pregnancy rate obtained is lower than that reported in
literature (Lindsey et al., 2002: 38% with 5 x10 6 motile spermatozoa),
likely due to the lower number of motile spermatozoa in the
inseminating dose used in the present study. The Authors wish to
thank “Società Italiana Produttori Sementi”.
P462
Viability of equine spermatozoa recovered from the
epididymis cauda submitted to refrigeration
Martins, MIM*; Nagao, JF; Gomes, RG
Department of Veterinary Clinics, University of Londrina State (UEL), Brazil
The recovery of spermatozoa from the epididymis cauda may be an
important tool in equine reproduction because it makes possible the
recovery of viable cells after the death of valuable stallions. The
purpose of this study was to compare the viability of the spermatozoa
recovered from the epididymis cauda submitted to refrigeration.
Epididymals were obtained from five horses (English Thoroughbreds
and two mixed –breed) from a slaughterhouse. During the
transportation to the lab, the specimens were maintained in a 0,9%
saline solution in an ice box. The recovery of the spermatozoa was
accomplished by compressing the epididymis cauda and part of the
deferent duct with help of an anatomic nipper on a Petri dish
containing the extender Botu-Sêmen® (Biotech Ltda, Botucatu,
Brazil). The sperm samples were evaluated for motility, vigor, sperm
concentration, percentage of viable cells and morphology. The semen
was diluted (final concentration of 100x10 6 /mL) and stored in 1,5 mL
plastic tubes and packed in a transportation system Botu-Tainer®
(Biotech Ltda, Botucatu, Brazil) for 18 hours. After this period, the
tubes were transferred to a container with 400mL of water and kept in
the refrigerator (4ºC) for 24 hours. The semen samples were analysed
in three different moments: collection (M1), removal from the
transportation boxes (M2) and after 24 hours of refrigeration at 4ºC
(M3). The average motility (%), vigor (0-5), alive (%) and normal
spermatic cells (%) were 64.0, 3.7, 90.6 e 60.0 (M1); 56.0, 2.9, 91.8
and 57.8 (M2); 56.0, 3.1, 88.4 and 56.0 (M3). The most frequent
spermatic alterations were: abaxial tail insertion (6.3%), proximal
cytoplasmic droplet (7.3%), distal cytoplasmic droplet (3.0%) and
strongly bended tail (13.4%); probably because the spermatozoas
were from the epididymis cauda. Transportation was considered
efficient for the maintenance of spermatic quality after 24 hours at 4
ºC and no significant difference was observed among the evaluations.
The process of spermatozoa recovery and refrigeration obtained from
the epididymis cauda is promising, however, new experiments must
be carried out aiming the analyses of in vivo and/or in vitro fertility of
these cells.

16 t h International Congress on Animal Reproduction
180 Poster Abstracts
P463
Pregnancy rates following fixed-time embryo transfer in
Bos indicus recipients synchronized with progestin
devices and estradiol or GnRH and treated with eCG
Mayor, JC 1 *, Tribulo, HE 2 , Bo, GA 2
1Escuela para Graduados, Facultad de Ciencias Agrop, Instituto de
Reproduccion Animal Cordoba, Universidad Nacional de Cordoba, Argentina;
2Instituto de Reproduccion Animal Cordoba, Argentina
An experiment was designed determine the effect of the addition of
eCG to a GnRH-based treatment protocol in recipients that received
embryos at a fixed-time. The experiment was performed in the Cauca
Valley region of Colombia. Bos indicus x Bos taurus heifers, 380 to
420 kg of weight and a body condition score between 2.5 to 3.5 (1 to
5 scale) were randomly allocated into one of three treatment groups.
On Day 0, heifers in the control group received an intravaginal
progesterone releasing device (DIB, 1 g progesterone, Syntex SA,
Argentina) and 2 mg of estradiol benzoate (EB, Syntex SA) plus 100
mg progesterone (Gestavec, Vecol, Colombia) i.m. On Day 5, heifers
received PGF (500 μg cloprostenol, Estrumate, Schering Plough,
USA) and 400 IU eCG (Novormon 5000, Syntex SA) i.m. DIB were
removed on Day 8 and 1 mg of EB was administered i.m. 24 hours
later. Heifers in the GnRH treatment group received a DIB device and
100 μg of GnRH (Cystorelin, Merial, USA) i.m. on Day 0, PGF at
DIB removal on Day 7 and a second GnRH on Day 9. Heifers in the
GnRH+eCG group were treated similarly to those in the GnRH group
except that they also received 400 IU eCG i.m. on Day 3. All heifers
were examined by ultrasonography 8 days after EB treatment or 7
days after GnRH and those with a CL >16 mm in diameter received a
frozen-thawed embryo by Direct Transfer. Pregnancy was determined
by ultrasonography 30 days after embryo transfer. Conception rates
and pregnancy rates were compared by Chi-square test. The number
of recipients selected/treated was higher (P0.05).
Conclusion Semen thawing methods did not affect the pregnancy
rates of Nelore cows, raised under pasture conditions, suggesting the
use of T1 based on costs benefits.
P465
Quality of frozen/thawed bovine semen tested with
common AI lab tests or flow cytometric analysis
Padrik, P 1 *, Hallap, T 1 , Januskauskas, A 2 , Jaakma, Ü 1
1Department of Reproductive Biology, Estonian University of Life Sciences,
Estonia; 2 Department of Non-Infectious Diseases, Lithuanian Veterinary
Academy, Lithuania
Introduction Evaluation of frozen/thawed (FT) bull semen with
routine AI laboratory methods gives good preliminary results for
estimation of semen quality but the number of evaluated sperm is too
low to guarantee objectivity of the measurements. Precise evaluation
of sperm motility in combination with other semen traits is needed to
improve breeding efficiency. Our aim was to study the correlations
between the results of routine AI lab tests, flow cytometric analysis of
sperm membrane status, mitochondrial membrane potential and field
fertility. Another aim was to study whether these characteristics are
influenced by bulls` age.
Materials and methods Forty five FT semen batches from fifteen
Estonian Holstein dairy AI-bulls (7 young bulls < 16 months and 8
mature bulls 30…72 months) were examined for motility
(subjectively, using microscope and objectively, using a computer
assisted motility analyzer (CMA)), hypo-osmotic swelling (HOS),
membrane lipid disorder (Merocyanine 540 staining) and
mitochondrial membrane potential (Mitotracker Deep Red 633
staining). Fluorescence of the stained sperm samples was assessed by
flow cytometer.
Results Significant positive correlations were found between sperm
subjective motility (SubMot), general motility (GMot), progressive
motility (PMot) and the proportion of live sperm with stable
membrane (LSM) and also, the proportion of sperm cells with high
mitochondrial activity (MTDR-H ) on batch (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 181
P466
Identification of sperm subpopulations with defined
motility characteristics in ejaculates from Holstein bulls:
effects of cryopreservation and between-bull variation
Muiño, R 1 *; Tamargo, C 2 ; Hidalgo, CO 2 ; Peña, AI 1
1Faculty of Veterinary Medicine, University of Santiago de Compostela,
Spain; 2 Servicio Regional de Investigación y Desarrollo Agroalimentario
(SERIDA), Spain
The aims of the present study were: 1) to determine the existence of
sperm subpopulations with specific motility characteristics in fresh
ejaculates from Holstein bulls, 2) to investigate the effects of semen
cryopreservation and post-thaw incubation on the distribution of
spermatozoa within the different subpopulations, and 3) to evaluate
the existence of between-bull variation in the sperm subpopulations
structure of fresh and frozen-thawed semen. Six ejaculates were
collected from each of 9 Holstein bulls and cryopreserved following a
standard protocol. Overall sperm motility and the individual kinematic
parameters of motile spermatozoa, determined using a CASA system,
were evaluated before freezing and after 0, 2 and 4 h of post-thaw
incubation at 37ºC. Data from 16,740 motile spermatozoa, defined by
VCL, VSL, VAP, LIN, STR, WOB, ALH and BCF, were analysed
using a multivariate clustering procedure to identify and quantify
specific subpopulations within the semen samples. The statistical
analysis clustered all the motile spermatozoa into four separate
subpopulations with defined patters of movement: Subpopulation
(Subp.) 1) moderately slow but progressive spermatozoa (23.2%),
Subp. 2) highly active but non-progressive spermatozoa (16.0%),
Subp. 3) poorly motile non-progressive sperm (35.5%), and Subp. 4)
highly active and progressive sperm (25.3%). Subpopulations 2 and 4
significantly (P

16 t h International Congress on Animal Reproduction
182 Poster Abstracts
P469
A modified Cosynch protocol for timed artificial
insemination in beef cattle
Schmitz, W 1 *, Driancourt, MA 2 , Hoppe, S 1 , Friedrich, M 1 , Erhardt, G 3 , Gauly,
M 1 , Holtz, W 1 , Schmitz, W 1
1Institute for Animal Husbandry and Genetics, Goettingen University,
Germany; 2 Intervet Pharma R&D, France; 3 Department of Animal Breeding
and Genetics, Giessen University, Germany
The Ovsynch protocol for timed artificial insemination (TAI) is
widely used. In beef cattle the Cosynch protocol is often preferred, as
TAI and the second GnRH injection may be conducted
simultaneously, thus reducing the number of handlings. Pregnancy
rates achieved with either protocol are not fully satisfactory. Critical
points influencing the success rates are the proportion of animals
ovulating after the first GnRH injection, the progesterone producing
capacity of the corpus luteum and the incidence of short cycles after
TAI. Possibly, an insufficient LH peak following induction with
exogenous GnRH may be the reason why these problems occur.
Human chorionic gonadotrophin (hCG) may serve as an alternative to
GnRH, due to its longer half-life. The aim of this study was to
determine the effectiveness of the Cosynch program using GnRH
(Buserelin), hCG (Chorulon) or a combination of GnRH and hCG in
beef cows. The trial was conducted on 240 beef cows (120 Simmental
(SIM), 120 German Angus (DA)) at the experimental farm Rudlos of
Giessen University. At the onset of the breeding season about 70 days
after the previous calving all animals were subjected to the Cosynch
program, involving a single TAI. Four variations of the Cosynch
program were randomly applied taking breed, age and days post
partum into account: hCG-PG-hCG (Group 1), GnRH-PG-GnRH
(Group2 = standard Cosynch), hCG-PG-GnRH (Group3), GnRH-PGhCG
(Group4). All inseminations were carried out by the same
experienced person. Semen of the different sires (5 Charolais, 5
Limousin) was distributed systematically among treatments. Blood
samples taken on days -9, 0, 7 (day of PG treatment) and 9 were
analysed for progesterone to determine the stage of the estrous cycle
prior to treatment and to evaluate the response to the respective
hormone treatment. Breeding sires were introduced into the herds to
impregnate return cows. In cows treated with hCG on day 0,
progesterone concentrations prior to PG treatment (day 7) were higher
than in GnRH-treated cows (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 183
P472
Effect of extender and equilibration time on post-thaw
motility of cryopreserved dairy Gyr bull semen, using
computer-assisted semen analysis (CASA)
Vale Filho, VR. 1 *; Leite, TG. 1 ; Arruda, RP. 2 ; Andrade, AFC. 2 ; Emerick, LL. 1 ;
Martins, JAM. 1 ; Andrade, VJ. 1 ; Ferreira, MBD. 3
1School of Veterinary Medicine, Federal University of Minas Gerais, Brazil;
2Faculty of Veterinary Medicine and Zootechny, University of São Paulo,
Brazil; 3 EPAMIG - Uberaba, Brazil
Introduction There is still some doubts remaining related to semen
equilibration time (Coulter, 1992; Gao et al, 1997). The aim of this
study was to evaluate the effect of equilibration time and extender on
post-thaw motility of cryopreserved bovine semen using computerassisted
semen analysis (CASA).
Material and methods Semen samples from 12 andrologicaly normal
adult dairy Gyr bulls (24 to 50 months) were collected by
eletroejaculation and evaluated according to Brazilian College of
Animal Reproduction (1998). Every semen samples were divided in
two aliquots and each of them diluted with different extender
(Bioxcell® or Tris) at 34ºC, to a concentration of 50 x 10 6
sperms/mL. The extended semen was cooled to ambient temperature
(25ºC) and packaged in 0.50-mL straws and transferred to
automatized freezing machines (model TK-3000®). The same cooling
(0.25°C/min.) and freezing (20°C/min) rates were used for all six
treatments (two extenders – Bio and Tris, and three equilibration
times at 5ºC: 0h (T0), 2h (T2), and 4h (T4). Later, semen samples
were thawed (37ºC/30 sec.) and post-thaw motility evaluated by
CASA. Data were analyzed using SAS (2002) procedures.
Results There were interactions among equilibration times and
extenders. The treatments without equilibration time showed the
lowest results (p0,05) between 2 and 4h, within each extender. The
extender Tris showed the highest results (p0.05), for both parameters evaluated was found.
Conclusion The results indicated that equilibration time is necessary
for higher post-thaw motility parameters, and that Tris (with egg yolk)
is recommended when using equilibration time, assuring high postthaw
motility.
P473
Estrus Synchronization in beef heifers using a
progesterone device comparing the application of
Estradiol Cipionate or GnRH in TAI programs
Vater, A. 1 *; Rodríguez Aguilar, S. 1 ; Nazarena, T 2 y Callejas, S. 3
1Private Activity Ia Total Group, B. Juarez, Buenos Aires, Argentine;
2Veterinary student, Veterinary School, UNCPBA, Tandil, Buenos Aires,
Argentine; 3 Animal Reproduction Area, Veterinary School, UNCPBA, Tandil,
Buenos Aires, Argentine
The use of estradiol at the time the progesterone device is removed
has been studied in several papers. As well the use of GnRH al the
moment of insemination has been demonstrated the effect
synchronizing the ovulation in cattle. An experiment was designed to
evaluate the effect in the pregnancy rate using estradiol cipionate
(ECP) at the day of remotion of a progesterone device compared
with the application of GnRH at the moment of time insemination 48
hs after progesterone device was removed in beef heifers. 39 Red
Aberdeen Angus (RedA) and 42 Polled Hereford (PH) heifers were
used in this trial. All heifers were maintain on pasture, with similar
age (18-20 months) and body condition (BCS=4-6, scale from 1-9).
On day 0 they received a progesterone device (DIB®, 1g of
Progeterone, Syntex S.A. Argentine) with an injection im. of 2 mg
Estradiol Benzoate (BE, Syntex S.A. Argentine). At day 7 DIB was
removed and heifers receive 150 ug of D(+) Clorprostenol
(CPTENOL®, Lab. Prof. E. Capaul, Argentine), and for both breeds
they were randomly allocated in two groups. One group receive 0.5
mg of Estradiol Cipionate (ECP, König, Argentine) (Group ECP0h) at
the same time DIB was removed and inseminated (TAI) 48 hours
afterwards (Group ECP0h; RedA=19; PH=21). The other group
receive 10 ug of Busereline (CPRH®, Lab. Prof. E. Capaul,
Argentine) 48 hours after the DIB was removed at the same time of
the insemination (TAI) (Group GnRH48; RedA=20; PH=21). The
insemination was using frozen/thawed semen for one bull for each
breed (RedA: Rosendo; PH: Farolero). Ultrasonography was used for
pregnancy diagnostic 30 days after TAI using a 5 MHz transductor
(CHISON VET500). CATMOD Proceeding with SAS was used to
evaluate effect in pregnancy rate of each treatment (ECP0h vs.
GnRH48h); breed effect (RedA vs. PH) and bull effect. No statistical
difference were found for treatment (ECP0h: 40,0% vs. GnRH48h:
50,0%; P>0,05); breed and bull (RedA/Rosendo: 38,5% and
PH/Farolero: 51,2%; P>0,05). The use of ECP at the moment of the
remotion of the progesterone device has the same effect in the
pregnancy rate as using GnRH at TAI 48 hours after the Progesterone
dev ice is removed in beef heifers.
P474
Progesterone release patterns in lactating dairy cows
treated with vaginal devices impregnated with different
amounts of progesterone
Videla Dorna, I 1 *, Cutaia, L 2 , Feresin, F 3 , Bo, GA 4
1Veterinary Division, Syntex SA, Argentina; 2 Syntex SA , Argentina; 3 Private
Practitioner, Argentina; 4 nstituto de Reproduccion Animal Cordoba (IRAC),
Argentina
Various intravaginal progesterone releasing devices are commercially
available and each is impregnated with different amounts of
progesterone. An experiment was designed to characterize plasma
progesterone profiles following intravaginal insertion of devices
containing different amounts of progesterone. Cycling Holstein cows
(n=14) with body condition scores of 2.0 to 3.0 out of 5, 79±27 days
in milk and producing 25.2±5 kg of milk per day were used. On Day -
1, all cows with a ultrasonically detected CL received two injections
of 150 µg cloprostenol (PGF; Ciclase, Syntex SA, Argentina) 12 h
apart and were randomly assigned to one of three groups to receive a
new DIB (1 g progesterone; Syntex SA), a previously used DIB, or a
new DIB 0.5 (0.5 g progesterone, Syntex SA) the following day (Day
0) for 7 days. Blood samples were taken daily for progesterone
analysis with a modified human double-antibody RIA kit (DPC Coata-Count;
Diagnostic Products Corporation, Los Angeles, CA, USA).
Time-series hormone data were analyzed using ANOVA for repeated
measures. The highest mean concentrations of progesterone were
calculated and compared by ANOVA. There was a significant effect
of day (P

16 t h International Congress on Animal Reproduction
184 Poster Abstracts
P475
Effect of density gradient and single layer centrifugation
on motility and survival of boar spermatozoa
Wallgren, M*, Saravia, F; Rodriguez-Martinez, H; Morrell, JM
Dept. of Clinical Science, Div. of Reproduction, SLU, Uppsala, Sweden
Density gradient centrifugation was compared with centrifugation on
a single layer of colloid for preparing boar spermatozoa, using
species-specific colloid formulations developed at SLU. Ejaculates
(12) from four boars were extended 1:1 with Beltsville thawing
solution (BTS) within 15 minutes of collection. The sperm
concentration was adjusted to 100 million per mL, again with BTS;
the sperm suspensions were used either immediately or after overnight
storage at room temperature. Aliquots (1.5 mL) of the extended semen
were layered on a density gradient of silane-coated silica colloid
formulations (2 mL of a high density and 2 mL low density colloid
formulations) or a single layer (4 ml) of the high density colloid
formulation, before centrifugation at 300 g for 20 minutes. The sperm
pellet was subsequently washed in BTS by centrifugation at 500 g for
10 minutes and resuspended in 1.0 mL BTS. Sperm motility of
incubated aliquots (37°C for 30 min) of the sperm suspensions was
assessed subjectively every day. Sperm motility was significantly
better (P0.05) of CL counts among Treatments A (8.9 ± 1.3), B (11.4 ±
1.3) and C (12.0 ± 1.1), respectively. The total number of recovered
structures from Treatment A (6.9 ± 1.5) was no different from
Treatments B (5.7 ± 1.5) and C (9.8 ± 1.2). Transferable embryos
from Treatments A (2.4 ± 0.7) and B (1.7 ± 0.6) were lower (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 185
droplets aggregation and: 1) perinuclear mitochondrial (mt)
distribution; 2) fertilization after intracytoplasmic sperm injection
(ICSI) in equine oocytes matured in vitro.
Methods Equine oocytes from slaughtered mares were cultured for in
vitro maturation (IVM). After culture, oocytes classified as
morphologically normal, according to zona pellucida thickness and
integrity, perivitelline space wideness, ooplasmic size and oolemmal
integrity, were categorized as having aggregation (A) or uniform
distribution (U) of lipid droplets within the cytoplasm. Those oocytes
showing the 1 st polar body extruded underwent either to mt
distribution analysis (Experiment 1) or to ICSI (Experiment 2). The
mt distribution was revealed after 30’ incubation in 280 nM
MitoTracker Orange CMTM Ros and confocal microscopy. IVM and
ICSI were performed as previously reported (Dell’Aquila et al., Biol
Reprod 2003;68:2065-72).
Results In Exp. 1, 54 oocytes, 29 A (54%) and 25 U (46%) were
analyzed. The nuclear maturation rate (metaphase II + polar body)
was significantly higher in A oocytes compared with U (83%, 24/29
vs 0%, 0/25; P

16 t h International Congress on Animal Reproduction
186 Poster Abstracts
P481
Ovine oocytes fertilization followingICSI: effect of
interspecific sperm injection, oocyte activation and
sperm treatment
Bogliolo, L*, Fois, S; Ariu, F; Rosati, I; Zedda, MT; Pau, S; Ledda, S
Department of Veterinary Pathology and Clinic, University of Veterinary
Medicine, Italy
Ovine oocytes fertilization following ICSI: effect of interspecific
sperm injection, oocyte activation and sperm treatment Bogliolo, L;
Fois, S; Ariu, F; Rosati, I; Zedda, MT; Pau, S; Ledda , S Department
of Veterinary Pathology and Clinic, University of Sassari Introduction
Intracytoplasmic sperm injection (ICSI) is a very powerful technique
in domestic livestock species. In ovine species, although the birth of
normal lambs has been reported, the efficiency of blastocyst
production after ICSI is very low probably owing to defective
activation of the oocyte. In the present study, we investigate the effect
of interspecies sperm injection, oocyte artificial activation and sperm
treatment on sheep oocyte fertilization following ICSI. Materials and
methods Exp 1-Cumulus-oocyte complexes collected from sheep
ovaries were matured in vitro for 24 h before being injected with: a)
frozen-thawed ram semen (RS); b) frozen-thawed stallion semen (SS).
Motile ram and stallion spermatozoa were selected by swim-up
technique. Injected oocytes were thereafter cultured 18-20 h, fixed
and stained with aceto: lacmoid to assess the presence of male and
female pronuclei. Exp 2- On the basis of the results of Exp1, we tried
to optimize sheep oocyte fertilization with the aid of activation of
oocytes with ionomycin (5 μM, 5 min) and 6-DMAP (3h)and/ or ram
sperm pre-treatment with 0.1% Triton X-100 (5 min). Fertilisation
rate was evaluated by oocyte staining as previously described.
Statistical analysis was done using the Chi-square test. Results Exp 1-
A significantly (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 187
P484
Morphological and ultra structural evaluation of the
interaction of Porcine Parvovirus with porcine oocytes
during in vitro maturation period
Athayde, CS. 1 ; Pavão, DL. 1 ; Piccolomini, MM. 1 ; Palazzi, EG. 1 ; Bersano, JG. 2 ;
Catroxo, MHB. 3 ; D’Angelo,M. 1 *
1Cell Biology Lab, Instituto Biológico de São Paulo, Brazil; 2 Porcine Lab,
Instituto Biológico de São Paulo, Brazil; 3 Electron Microscopy Lab, Instituto
Biológico de São Paulo, Brazil
The biotechnological advances in animal reproduction aim to
optimize the reproductive efficiency on distributing valuable genetic
material. By using commercially these biotechnologies, the
improvement of better techniques for infectious diseases prevention is
needed. Therefore, studies must be performed to evaluate the potential
risk of pathogens transmission by in vitro fertilization technique. The
aim of this study was to elucidate porcine parvovirus (PPV) and
porcine oocytes interaction during in vitro maturation period,
evaluating the morphological changes by optical microscopy and the
possible oocyte infection by electron microscopy. Cumulus-oocyte
complexes (COCs) with intact zona pellucida were retrieved from
slaughtered pre pubertal gilts ovaries and separated into control
(n=593) and exposed (n=600) groups. The exposed group was
inoculated with 60l of PPV virus suspension and both groups were
in vitro maturated in NCSU23 medium for 44h at 39ºC. Oocytes were
then fixed, included in paraffin, cut with ultra microtome and
incubated with PPV specific antibody with colloidal gold for ultra
structure analysis. At morphological evaluation, the exposed group
showed irregular cumulus cells expansion, with some cellular
individualization; ooplasm presented brownish with dark points and
granules. The control oocytes showed regular cumulus cell expansion
and uniform brownish ooplasm. The ultra structural analysis showed
exposed oocytes with chromatin marginalization of the cumulus cells
nucleus as well as viral inclusions immunologically marked by the
colloidal gold. These viral inclusions were spread through cumullus
cells, zona pellucida and inside the oocytes. These changes were not
seen at the control group. The morphological changes observed on
optical microscopy were not severe and considering that COCs are
selected according to their morphology on procedures for embryo in
vitro production, it seems that this criterion do not guarantee that
these embryos are pathogens free. Electron microscopy showed the
presence of viral inclusions with the PPV immunologically marked
inside the oocytes, which suggest viral replication and an interaction
with the oocyte. Further studies must be performed to verify these
oocytes viability until the embryo transfer stage. A criterion should be
established to enable porcine oocytes and embryos evaluation for in
vitro procedures. It would assist the prevention of infectious diseases
transmission besides avoiding losses of the biotechnique viability.
P485
Improvement of embryo recovery rates by modified
flushing techniques in Holstein cattle at a commercial
embryo transfer station
Detterer, J 1 *; Wolgast, T 1 ; Reuss, W 1 ; Meinecke-Tillmann, S 2 ; Schmidt, T 3
1AI- and ET-Center Georgsheil, Südbrookmerland, Germany; 2 Department of
Reproductive Biology, University of Veterinary Medicine, Hannover,
Germany; 3 Intergen GmbH; Höchstädt, Germany
During the last 30 years an embryo recovery rate (RR) of about 65%
to 75% was reported after flushing of superovulated cattle. This
indicates that the collection techniques might be suboptimal and that
embryos might be left in the reproductive tract. The aim of our study
was to find a way to improve the recovery rate in commercial embryo
transfer (ET) with the support of uterotonic drugs, which should
promote the release of embryos by myometrial contractions. After
estrus synchronisation with prostaglandin analogues and
superovulation with 630 IU FSH (Folltropin-V ® ), 169 Holstein cows
(1-12 lactations) were divided at random into five experimental
groups. Four of these were treated with different drugs and/or placebo
and embryo collection (EC) was performed with a double flushing
procedure, while the fifth served as a standard control without any
additional treatment and with a single uterine flushing. Group A
(n=36) got a luteolytic dose of Dinoprost (25 mg/5 ml i.m.,
Dinolytic ® ) 12 to 16 hours before flushing and 10 IU Oxytocin (10
IU/1 ml i.v., Oxytocin Albrecht ® ) at the beginning of the flush. Group
B (n=34) was treated with Dinoprost and placebo (1 ml i.v., 0.9%
NaCl). Group C (n=37) received placebo (5 ml i.m., 0.9% NaCl) and
Oxytocin; group D (n=30) got a placebo twice (timing as in Group A,
respectively). Group E (standard control) included 32 animals. EC
was done by a single technician. Each uterine horn was flushed
separately with 400 ml DPBS on D7 of pregnancy. 30 min after the
first flush the catheter was reintroduced and EC was repeated with the
same amount of medium (group A-D) to control the effect of the
drugs. The embryos in the different flushings were counted and
classified according to the standards of the IETS. Corpora lutea were
counted ultrasonically (7.5 MHZ, Sonovet 2000) after EC, and RR
was determined. RR in Group A-D averages 72.5%, 78.4%, 66.1%,
69.1% and 69.6%, respectively (Group A: 10.7±8.9 oocytes/embryos
(O/E) with 6.3±5.3 transferable embryos (tE); Group B: 10.6±6.1 O/E
with 6.6±5.2 tE; Group C: 9.2±7.9 O/E with 4.9±5.2 tE; Group D:
11.0±8.1 O/E with 5.6±5.6 tE; Group E: 9.5±7.7 O/E with 5.2±6.5
tE). This indicates that an uterotonic treatment as well as a double
flushing procedure improves embryo recovery rates. An enhancement
of RR via double flushing is more noticeable in the placebo group D
(increase comparing 1 st flush to 2 nd flush: Group A: 3.9%, B: 2.7%, C:
4.4%, D: 5,8%) It can be concluded that an uterotonic support
especially with Dinoprost could enhance embryo recovery rates in
commercial ET.
P486
Determination of oocyte membrane permeability
coefficients and their application to cryopreservation in
a rabbit model
Liu, J 1 ; Mullen, S 2 ; Meng, QG 1 ; Critser, J 2 ; Dinnyes, A 1 *
1Genetic Reprogramming Group, Agricultural Biotechnology Center, H-2100
Gödöllő, Hungary; 2 Comparative Medicine Center and Department of
Veterinary Pathobiology, University of Missouri at Columbia, Columbia,
Missouri, USA
Introduction It is essential to establish good animal models for
human oocyte cryopreservation and the rabbit is among the
candidates. Having an effective means to cryopreserve human oocytes
would offer more flexibility in healthcare services for infertility
patients, and obviate cryopreservation of preimplantation embryos.
Attempts to improve oocyte cryopreservation are often empirical, with
results often irreproducible. Cryopreservation protocol may be
optimized by modeling the changes in oocyte volume and the
associated damages incurred during the addition and dilution of
cryoprotective agent (CPA). Unlike rabbit oocytes, the permeability
to water and several cryoprotective agents (CPAs) has been
determined for human oocytes. The objectives of the current study are
to determine cryobiological properties of rabbit oocytes, including the
isotonic volume (V iso ), osmotically inactive cell fraction (V bp ),
permeability to water (L p ), dimethylsulfoxide (P DMSO ), ethylene glycol
(P EG ), and glycerol (P GLY ). Using these new data, we modeled both
rabbit oocyte and human oocyte responses to CPA addition and
dilution.
Materials and method Mature rabbit oocytes were held by two
injectors that were mounted on Narishige micromanipulators to an
Olympus microscope. The oocytes were perfused with 15% (V/V)
CPA medium (dissolved in 1X PBS). The osmotic responses of the
oocytes were videotaped. A two-parameter model was fit the
experimental data to determine the values of L p , and P CPA .
Equilibrium oocyte volumes exposed to 285, 600, 900, and 1200
mOsm/kg solutions were normalized to their respective isotonic
values and then plotted versus the reciprocal of normalized osmolality
in Boyle van’t Hoff plot. T-tests were used in statistical analyses.
Result The average radius of rabbit oocytes in an isotonic solution
was determined to be 55.7 ± 1.2 μm (n=16). The rabbit oocyte
exhibited an “ideal” osmotic response in the range from iso-osmolity
to 1200 mOsm. The V bp was determined to be 20% of isotonic value

16 t h International Congress on Animal Reproduction
188 Poster Abstracts
with r 2 = 0.97. The values of L P were determined to be 0.79 ± 0.26,
0.82 ± 0.22, and 0.64 ± 0.16 μm⋅min -1 ⋅atm -1 and the P CPA values were
determined to be 2.9 ± 1.3, 2.7 ± 1.3, and 0.27 ± 0.18 x10 -3 cm⋅min -1
for DMSO, EG and GLY respectively. There were no significant
differences (p>0.05) between values for L P and P CPA in presence of the
DMSO and EG. However, these values were significantly different
from the values in presence of GLY.
Conclusions Similar to human oocytes, rabbit oocytes behave as ideal
osmometers in the range osmolalities tested with values for V bp nearly
identical to human oocytes. However, rabbit oocyte isotonic volume is
smaller than human oocytes. Previously published mean values for L p
in human oocytes falls within the 95% confidence limits for rabbit
oocytes; the same is true for the permeability to DMSO. Rabbit
oocytes are more permeable to EG in comparison to human oocytes,
however. Higher P CPA values for rabbit oocytes result in less volume
excursions than those for human oocyte during CPA addition and
dilution. Supported by Wellcome Trust (Grant No.070246), EU FP6
(MEXT-CT-2003-509582, MRTN-CT-2006-035468) and Chinese-
Hungarian Bilateral projects (TET CHN-28/04, CHN-41/05).
P487
Different response of Bos indicus Vs Bos taurus oocyte
on maturation, cleavage and embryo development under
in vitro system
Escalona, F*; Mercado, J; Rodríguez, A; Rodríguez-Sallaberry, C; Kowalski, AA
Laboratorio de Embriología y Endocrinología Molecular, Decanato de
Agronomía, Universidad Centroccidental Lisandro Alvarado (UCLA), Lara,
Venezuela
The in vitro of production embryos represents an alternative to the
cattle industry for generating large numbers of F1 embryos. The
objective of this study was determine the differences of in vitro
maturation, fertilization and culture (IVM, IVF, IVC) of two oocytes
groups; Brahman (Br) and Holstein (Ho) oocytes. Ovaries from
slaughterhouse were transported in saline 0.9% at 30 ±1.1°C; complex
oocytes-cumulus (COCs) were collected from Br (52) and Ho (51)
ovaries and used for IVM, IVF and IVC. The number of oocytes from
each ovary were: Br (13.65±1.3) Ho (7.30±3) respectively. COCs
were cultured on TCM-199 supplemented with BSA, piruvate, L-
glutamine, FSH, LH y EGF during 22 hrs, and incubated at 38°C on
5% CO 2 in a humidified environment. The COCs were transferred to
IVF-TALP supplemented with heparin, penicillamine, hypotaurin and
epynephrine. The fertilization was made with sperm from Ho bulls.
The semen was separated by percoll gradient and washed in spermtalp.
In both groups the semen concentration was 1 x 10 6 sperm/mL
and incubated for 18 hrs. The zygotes were incubated for 7 days in
KSOM supplemented with BSA, L-glutamine, EAA and NEAA. The
cleavage rate was Br (92.36±0.8%) and Ho (69.4±18.7%) (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 189
P490
Use of immunomodulation in susceptible mares to clear
an experimentally induced endometritis effect on proinflammatory
cytokines: IL-1β, IL-6 and IL-8 mRNA
expression
Fumuso, E* 1 ; Giguère, S 2 ; Rogan, D 4 , Rivulgo, V 1 ; Wade, J 3 ; Rodriguez, E 1 ;
and Sánchez Bruni S 1
1Faculty of Veterinary Medicine, UNCPBA, Tandil, Argentina 7000, Argentina;
2Coll.Vet. Med. Gainesville, FL, USA; 3 Ireland; 4 Bioniche Life Sciences Inc,
Belleville, Ontario, Canada
The effect of an immunomodulator, Mycobacterial Cell Wall Extract
(MCWE), on IL-1β; IL-6 and IL-8 mRNA expression was studied in
mares susceptible to endometritis after experimental uterine infection
with Streptococcus zooepidemicus. Thirty endometritis susceptible
mares, based on the presence of uterine fluid during both diestrus and
estrus, were inoculated with 5 × 10 6 CFU of S. zooepidemicus on day
1 of estrus. Twenty-four hours later, the progression of infection was
evaluated by ultrasonography, bacteriology, exfoliative cytology, and
uterine biopsy. Forty eight hours after inoculation and confirmation of
uterine infection, mares were randomly assigned to one of four
unbalanced experimental groups in order to receive: Group A: 1500
μg total dose of MCWE (Settle) by intrauterine route (IU) (n = 10),
Group B: the same treatment as Group A, but using the intravenous
(IV) route (n = 10), Group C: Distilled water as placebo (PL) IU (n =
5) and the Group D: was treated as Group C using the IV route (n =
5). Endometrial biopsies were taken when infection was confirmed
(day 0), at ovulation (day 3) and 7 days post-ovulation (day 10) for
measurement IL-1β; IL-6 and IL-8 mRNA expression. Total RNA
was isolated, treated with DNAse-I and cDNA was synthesized.
Relative quantitation of mRNA expression (RmRNA) was determined
by real-time PCR. The effect of treatment (MCWE vs PL),
administration route (IU vs IV), and day of sampling (0, 3, 10) on
RmRNA mixed model analysis of a split-unit experiment with
repeated observations. There was no effect of route of administration
on RmRNA. As a result Groups A & B (treated) and groups C & D
(PL), were combined in the final analysis. There were no significant
differences in RmRNA between PL and treated groups on day 0. On
days 3 and 10, MCWE treated mares had significantly lower IL-1β,
IL-6 and IL-8 mRNA expression than mares in the PL group. We
previously demonstrated the effect of immunomodulation after AI in
susceptible mares to post breeding endometritis (Fumuso et al. 2003,
2007); this effect was confirmed in the present study through
experimentally induced endometritis. Results indicate that MCWE
exerts an anti-inflammatory effect on cytokine RmRNA that may
contribute to resolution of endometritis caused by S. zooepidemicus in
mares.
P491
The addition of malondialdehyde during in vitro
maturation of bovine oocytes improves subsequent
cleavage rate after in vitro fertilization
Garcia-Ispierto, I 1 *, Leroy, JLMR 2 ; Lopez-Béjar, M 1 ; López-Gatius, F 3 ; De
Clercq, JPB 2 ; Andries, S 2 ; Goovaerts, IGF 2 ; Bols, PEJ 2
1Department of Animal Health and Anatomy, Autonomous University of
Barcelona, Spain; 2 Laboratory of Veterinary Physiology, Department of
Veterinary Sciences, University of Antwerp, Belgium; 3 Department of Animal
Production, University of Lleida, Spain
Introduction Oxidative stress has been related to heat shock on
embryos and has been considered to play a critical role in the success
of in vitro fertilization protocols. Malondialdehyde (MDA) is the
major endogenous product of lipid peroxidation due to oxidative
stress. It has been demonstrated that MDA can have toxic effects on
bacterial and mammalian cells. Oxidative stress is high during the
postpartum period and this can be exacerbated by heat stress during
the hot seasons.
Objective The aim of the current study was to apply MDA combined
with high temperature conditions during in vitro maturation of oocytes
to evaluate possible effects on oocyte developmental competence.
Methods Bovine ovaries were obtained from the slaughterhouse. A
total of 1209 immature Grade I cumulus–oocyte complexes (COCs)
were aspirated from follicles 2–6mm of diameter. COCs were
cultured in groups of 50 for 24 h in 500µl serum-free maturation
medium (20 ng/ml mEGF) with or without MDA (8µM) under normal
(38.5ºC) or high temperature (41ºC) conditions in a humidified 5%
CO 2 incubator. Four treatment groups were used during maturation:
control (C), MDA (M), high temperature (T) and MDA plus high
temperature (TM). After IVM, all oocytes were routinely fertilized by
co-incubation per 100 with spermatozoa (frozen bull semen selected
by percoll gradient) at a final concentration of 10 6 sperm cells/ml for
20 h at 38.5ºC in fertilization medium, in a humidified 5% CO 2
incubator. Presumptive zygotes were cultured per 25 in 500µl droplets
of modified SOF medium with 5% FCS, under mineral oil for 8 days.
Results Binary logistic regression procedures were performed using
cleavage and blastocysts rate (blastocysts per oocytes matured) as
dependent variable, and treatment and replicate as independent
variables (SPSS 16.0). Cleavage and blastocyst rate were 70.5+7.5
and 29.4+3.1 in C, 80.6+8.5 and 35.5+11.3 in M, 40.8+12.9 and
4.9+3.4 in T, and 39.3+3.4 and 7.6+7.8 in TM groups, respectively.
Based on the odds ratio the cleavage rate decreases in the high
temperature group (by a factor of 0.27, P

16 t h International Congress on Animal Reproduction
190 Poster Abstracts
with 2 pronuclei and no visible sperm; oocytes with 2 pronuclei and
one sperm; oocytes with 1 pronucleus and one sperm; others, oocytes
with other nuclear structures, such as more than 2 pronuclei or no
analyzable oocytes. Oocytes injected with TX sperm pretreated and
caffeine during and after micromanipulation had a lower oocyte
activation rate than the other experimental groups (25.4% vs. 54.4-
69.1%; P

16 t h International Congress on Animal Reproduction
Poster Abstracts 191
2007) supplemented with 0, 0.002, 0.02, and 0.2% (w/v) L-Car. In
vitro maturation of in vitro grown oocytes was carried out for 44
hours following the culture. Apoptosis indexes of granulose cells
cultured in 0 or 0.02 % (w/v) L-Car were assessed using In situ Cell
Detection Kit (Roche Diagnostics, Tokyo). To assess the cytchrome c
oxidase activity on electron microscopy, the ultrathin sections of the
in vitro grown and in vivo grown OGCs were observed by TEM. The
proportions of oocytes survived, GVBD and matured were calculated
based on the number of OGCs cultured. Data were analyzed by
Fisher’s PLSD test following ANOVA. Proportions of apoptotic cells
were compared by t test. When OGCs were cultured in 0.02% L-Car,
proportions of oocytes survived after 14-days culture, GVBD and
matured after IVM were 43%, 32%, and 25%, respectively. These
values were significantly higher (P

16 t h International Congress on Animal Reproduction
192 Poster Abstracts
Bone marrow cells were collected by washing the bone cavity with
saline. The cell viability was examined by trypan blue vital staining
and the DNA fragmentation was examined by comet assay. The
procedure of SCNT was performed as previously reported
(Wakayama et al. 1998 Nature 394, 369-374) with a piezo-actuated
micromanipulator system. In SCNT experiment, 4 groups of mouse
cells (fresh bone marrow cells, bone marrow cells frozen either at –
25oC or at –80oC and fresh cumulus cells) were used as the nuclear
donors. After nuclear injection, the nuclear dynamics of SCNT
embryos in each donor cell group was observed using DAPI staining
and a fluorescent microscope at 0, 1, 7 and 24 h after nuclear
injection. Data were analyzed by Student′s t-test. The cell viability
after thawing were 85.4%, 6.4% and 13.4% in fresh, frozen at –25oC
and frozen at –80oC bone marrow cells, respectively. There was
severe DNA fragmentation in both frozen-thawed bone marrow cells.
At 7 h after nuclear injection, SCNT embryos injected with frozen
bone marrow cells, regardless of freezing temperature, had more
single pro-nuclei (67%; 54/81, P

16 t h International Congress on Animal Reproduction
Poster Abstracts 193
and eCG (500IU). Albendazole was administered orally to eight ewes,
at the beginning of oestrus, in a single dose of 11.5 mg/kg b.w.,
(group A), while the other eight ewes were used as controls (group C).
At the end of oestrus all non-atretic 2-8 mm diameter follicles were
aspirated. Grade A cumulus oocyte complexes were identified under
stereoscope and cultured for 24 hours in Modified Parker’s Medium at
38.5 ºC, 5% CO 2 in humidified air. Nuclear maturation was assessed
microscopically, after orcein (2%) staining. Albendazole was detected
in follicular fluid using HPLC. Progesterone and 17-β estradiol
concentrations in follicular fluid were assessed using RIA. Data were
analyzed using independent T-test and Chi square test.
Results Albendazole metabolites were detected in all follicular fluid
samples. Mean progesterone concentration in the follicular fluid did
not differ significantly (p>0.05) between groups (group A:
0.028±0.021 ng/μl and group C: 0.073±0.060 ng/μl). Mean 17-β
estradiol concentration in the follicular fluid of group A (26.97±24.42
pg/μl) was significantly lower (p0.05) compared to the rate of maturation in group C
(65.71%).
Conclusions Oral administration of albendazole affects steroid
hormone balance in follicular fluid of ewes but does not seem to
affect significantly in vitro nuclear maturation of ovine oocytes.
Further research is necessary to elucidate whether the detected steroid
hormone imbalance could affect cytoplasmic maturation of oocytes
and, consequently, their fertilization ability and developmental
competence.
P502
Ultrastructural characteristics of non-matured and in vitro
matured oocytes collected from follicular, luteal and
inactive ovaries of domestic cat during non-breeding
season
Martins, LR 1 *, Fernandes, CB 1 , Minto, BW 2 , Landim-Alvarenga, FC 1 , Lopes,
MD 1
1Animal Reproduction, University of State of Sao Paulo, Brazil; 2 Small Animal
Surgery, University of State of Sao Paulo, Brazil
Objective The aim of this experiment is to describe the ultrastructural
characteristics of non-matured (NMo) and in vitro matured oocytes
(IVMo) recovered from queen during the non-breeding season
(January, February and March) in southeast of Brazil.
Methods Transmission electronic microscopy (TEM) was performed
in NMo immediately after harvest and IVMo were matured for 36 hrs
before TEM. Specimens were divided into oocytes from inactive
ovaries (NMI/IVMI); follicular ovaries (NMF/IVMF) and luteal
ovaries (NML/IVML).
Results NMI and NMF presented a narrow perivitelline space covered
with microvilli. On the other hand, microvilli were less evident in
NML. Cumulus cell projections penetrate the ZP forming junctional
complexes with the oolemma in all NMo. In the cytoplasm of NMI
lipid droplets and vesicles were evenly distributed in the ooplasm
except for the cortical zone, were clusters of mitochondria were
observed. NML was also characterized by peripheral mitochondrial
clusters, but greater clusters could also be seen centrally in the
cytoplasm. Differently, NMF were characterized by evenly distributed
mitochondria within the ooplasma. In NMI and NML cortical
granules were seen only in the peripheral area of the cytoplasm, but
the electron density of these organelles appeared to be lower and
Golgi complex were often seen in association with these granules. The
density of cortical granules in NMF was higher but they were also
present in central regions of the ooplasm. In all NMo a well developed
Golgi complex was observed. In IVMo mitochondria clusters are no
longer observed and these organelles presented an even distribution
towards the ooplasm. Cortical granules were present in the peripheral
region of IVMI, IVMF and IVML oocytes, although a small number
could still be observed in central region of the ooplasm of IVMF. The
perivitelinic space was more proeminent in IVMo. However the
amount of microvilly was similar with the one observed in NMI.
Granulosa cell projections were no longer seen.
Conclusion These results indicate that in vitro maturation was
efficient in inducing the morphological changes necessary for
cytoplasmic maturation of cat oocytes, independently of the ovarian
status.
P503
Superovulation fsh-p protocol in sarda ewes without
progestagen synchronization treatment
Mayorga, I. 1,2 *, Masia, F. 2 , Mara, L. 2 , Chessa, F. 2 , Casu, S. 2 , Juyena, N. 1,2 ,
Dattena, M. 2
1Department of Veterinary Clinical Sciences, University of Padova, 35100
Padova, Italy; 2 DIRPA-AGRIS Sardinia, 07040 Olmedo, Italy
The aim of this study was to evaluate the effect of superovulation
response to FSH-p treatment without the use of intravaginal
progestagen sponges. Twenty animals were divided into 2 groups
such as single sponge (SS) 40 mg FGA for 12 days (n=10) and natural
oestrus (NT) (n=10). Superovulatory treatment per sheep consisted of
350 I.U. of porcine FSH (Folltropin ® , Bioniche Animal Health,
Ireland) administered in eight (i.m.) decreasing doses at every 12 h (2
ml x 2, 1.5 ml x 2, 1.0 ml x 2 and 0.5 ml x 2) starting 48 h before
sponge removal in the SS group and on day 4 after onset of oestrus
(day 0) in the NT group. A single dose of 125 µg (i.m) cloprostenol
was injected on day 6 after oestrus detection in the NT group to
induce ovulation. Ewes were naturally mated 24 h after sponge
removal in SS group and after cloprostenol injection in the NT group.
Seven days after mating, inguinal laparotomy was performed and the
number of corpora lutea (CL) was recorded. Embryos were
recovered by flushing each uterine horn according to the technique of
Tervit and Havik (1976) with some modifications. The recovered
embryos were evaluated according to their stage of development and
their quality was scored on a scale of 1 to 3 (Niemann et al., 1981).
Embryos with a score of 1 were considered of high quality. Data on
number of corpora lutea (CL), embryos recovered (ER), embryos
fertilized (EF), and high quality embryos (EQ 1 ) per ewe were
analysed by ANOVA (GLM SAS procedure). Length of treatment for
each group was also assessed. Data on recovery (RR), fertility (FR)
and embryo quality (Q 1 R) rates per treatment were analysed by a Chi
Square analysis. Statistical differences were founded between SS and
NT groups only in the number of CL/ewe (7 ±3.2 vs 10.7± 3.4)
(p

16 t h International Congress on Animal Reproduction
194 Poster Abstracts
re-suspended in fresh medium, motility was evaluated and sperm
concentration was determined. The suspension volume was adjusted
in order to obtain 4 samples with a final concentrations of 0.025, 0.1,
0.5, 1 x10 6 msp/ml, and supplemented with PHE 20 μl/ml and
heparine 10 μg/ml. Matured oocytes were co-cultured in 100 μl
droplets of the different IVF suspensions under mineral oil for 18 h at
38.5°C in 5% CO 2 . After fertilization, cumulus cells were removed
and presumptive zygotes were cultured in SOFaa plus BSA 16 mg/ml
at 38.5 °C in 5% CO 2 . Cleavage was determined after 12 h of IVC and
embryos were cultured in the same medium supplemented with 10%
FBS until day 9.
Results Cleavage rate, morulae-blastocyst rate on day 6 and
blastocyst rate on day 9 were lower (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 195
cell complexes (OGCs) on the viability and the meiotic competence of
in vitro grown oocytes. In this study, we assessed the morphology of
OGCs on the antrum formation of OGCs, the viability and the meiotic
competence of in vitro grown oocytes. Porcine OGCs were recovered
from early antral follicles with diameter of 300-700 μm and intact
oocytes with intact granulosa cells were selected. OGCs categorized
into 3 categories according to the quantity of granulose cells attached
with oocytes (Category A: 1-3 layers of granulose cells (GCs); B: 3 or
more layers of GCs attached with a small amount of theca cells; C: 3
or more layers of GCs surrounded with theca cells). OGCs were
cultured for 14 days in the medium (containing 2%
polyvynilpyrrolidone, estradiol-17β, ascorbic acid, Insulin, sodium
selenite, transferring and BSA, Hashimoto et al., 2007) supplemented
with 0.02% (w/v) L-Carnitine under 5% oxygen tension. In vitro
maturation (IVM) of in vitro grown oocytes was carried out for 44
hours following the culture. The antrum formation rate of OGCs in
category A (18%) was significantly lower (P

16 t h International Congress on Animal Reproduction
196 Poster Abstracts
were inseminated with thawed sexed semen. Motile spermatozoa were
obtained by centrifugation on a Percoll gradient (45-90%) diluted to
1x10 6 /mL (IVF) of four different ejaculates of each bull, previously
evaluated. The presumptive denuded zygotes, without the cumulus
oophorus cells, were transferred to culture droplets of synthetic
oviductal fluid medium added of BSA. On Day 7 after IVF, embryos
classified as Grade 1 were counted. The rate of viable embryos was
calculated by the number of Grade 1 obtained embryos divided by
viable oocytes. The total rate of viable embryos differed (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 197
Kg) of zoo (ZOO SAFARI-Fasano-BR). Ovaries were kept in
physiological saline and maintained at 35°C before oocyte recovery.
Ovary were placed in phosphate buffered saline (PBS) supplemented
with 50 micrograms/ml of gentamicin. Each ovary was sliced
repeatedly with scalpel blade to release cumulus-oocyte complex
(COCs) in a 90 mm culture dish containing PBS at 37°C. COCs were
immediately fixed in formalin (2%) and they remain over-night at 4°C
temperature. Subsequently oocyte were collect and fixed on slide two
each. Only one oocyte was collect by leopard ovaries. Oocytes was
stained with Hoechst 33258 and observed at fluorescence microscope
(E600 Nikon, 365 nm excitation) for assess the meiotic status.
Evaluation of oocytes diameter was done by stereomicroscope (Nikon
ECLIPSE 50 I).
Results Cat oocyte external diameter (100 micron on average) was
smaller than in leopard (230 micron on average), however the
nucleus-cytoplasm ratio is approximately the same 0,13 micron (14,17
micron GV diameter Vs 109 micron oocyte diameter for cat’s oocyte)
vs 0,17 micron (50,13 micron GV diameter Vs 229,65 micron oocyte
diameter for leopard oocytes).
Conclusions Though the effective size of leopard oocytes is greater
than cat’s oocytes the proportion of oocytes share are keeped. Is only
the first study that shown the size of oocyte in leopard, and other
research needed. Knowledge of morphology and size is important for
subsequent in vitro maturation (IVM) an in vitro fertilization (IVF)
for maintenance of genetic diversity in dangerous species.
P514
Correlation analyses of a porcine in vitro production
system for prediction of blastocyst rates
Petersen, KM*, Avery, B; Schmidt, M; Bogh, IB
Veterinary Obstetrics and R, Faculty of Life Sciences, University of
Copenhagen, Denmark
The aim was to find the best predictor for blastocyst formation in a
standard porcine IVP system. For that purpose blastocyst rates were
compared with 2-pronuclear-, polyspermy- and cleavage rates, where
rates were calculated over total number of IVF oocytes, and the data
subjected to correlation analyses (GraphPad Prism 3), under the
assumption that when two variables vary together, there is a
correlation between them. The correlation coefficient r, which ranges
from – 1 to + 1, quantifies the direction and magnitude of correlation,
and how well X and Y vary together. The best way to interpret the
value of r is to calculate r 2 , which ranges from zero to one, and is the
fraction of the variance in the two variables that is shared. For
example, if r 2 =0.25 then 25 % of the variance in X can be explained
by variation in Y. Linear regression assumes that the data are linear,
and finds the line that best predicts Y from X, according to the
equation Y = αX + B. An r 2 value of 0 means that there is no linear
relationship between X and Y, where an r 2 value of 1 indicates a
perfect correlation. The oocytes were collected from slaughterhouse
sow ovaries, IVM was performed for 44 h in TCM-199 with EGF,
hCG, eCG and 10 % ECS, IVF for 24 h in a Krebs-Ringer bicarbonate
based solution with 2 mM caffeine and 0.6 % BSA, supplemented
with washed semen, originating from fresh ejaculates in extender, and
IVC for a week in PZM with 5 % ECS. IVM and IVF incubations
were done under 5 % CO 2 in 95 % air, and IVC in 5 % CO 2 , 5 % O 2 ,
and 90 % N2 at 38.5 º C. Blastocyst and cleavage rates were assessed
at day 6 post insemination, penetration rates after fixation 24 h post
IVF in acid methanol and subsequent Orcein staining. In conclusion,
none of the combinations showed perfect correlation; however the
most precise predictor for blastocyst formation was the 2-pronuclear
rates, which showed a significant correlation, whereas the correlations
for polyspermy or cleavage were very weak (low r 2 and high P). The
weak correlation for the cleavage rate is probably due to the fact that
cleaved embryos are a mix of 2-PN and polyspermic oocytes, which
pulls in opposite directions with regard to blastocyst formation.
P515
Influence of oocyte and embryo transport interval time on
efficiency and commercial profitability of a large bovine
in vitro embryo production scale
Rodrigues, JL 1 *, Queiroz, LM 2 , Feltrin, C 1 , Peixer, M 2 , Malard, P 2 , Santana,
G 2 , Xavier, M 2 , Rodrigues, B 1
1Laboratory of Embryology and Biotechnics of Reprod, Faculty of Veterinary
Medicine, Federal University of Rio Grande do Sul, Brazil; 2 Animal
Biotechnology, BIO, Brazil
Introduction During the last 5 years the extraordinary increase in the
number of Nelore females submitted to ultrasound guided follicular
aspiration (ovum pick up - OPU) in Brazil, has leading to the
development of different estrategies to overcome logistical barriers
and achieve profitable pregnancy rates after transfer of IVF embryos.
The objective of this experiment was to evaluate the influence of
interval time transport on viability of oocytes and embryos: Group 1
(G1) 1 to 2 h; Group 2 (G2) 3 to 5 h; Group 3(G3) 6 to 9 h and Group
4 (G4) 10 to 16 h.
Materials and Methods Oocytes were collected by OPU (zero time),
washed in modified PBS solution, and loaded into plastic cryovials
containing modified TCM199 HEPES maintained at 38°C to provide
oocyte in vitro maturation (IVM) during the transport period to the
laboratory. At arrival to the laboratory oocytes were transferred to
modified TCM199 and cultured at 39ºC in a 100% humidified
atmosphere containing 5% CO2. The in vitro fertilization procedure
was initiated 24 hours after OPU, and during the next 24 hours the
oocytes were incubated with the spermatozoa in the same conditions
as described above. After that, the presumptive zygotes were
transferred to modified SOFaa medium and then cultured for 7 days at
the same IVM conditions under atmosphere containing 5% CO2, 5%
O2 and 90 N2 %. On day 7 the embryos were evaluated,
morphologically classified and loaded in 0,25 ml straws containing
modified SOFaa HEPES supplemented with BSA and kept at 38°C.
The embryos were transferred into previously synchronized recipients
and pregnancy diagnosis was performed by ultrasound 60 days later.
Statistical analysis was performed by the Chi-square test (P

16 t h International Congress on Animal Reproduction
198 Poster Abstracts
small volume of adjacent cytoplasm was aspirated into the same
pipette. Then, the pipette was withdrawn from the oocyte and the
karyoplast was released out. Thereafter the pipette with the remaining
donor cells was re-introduced into ooplasm through the same hole of
zona pellucida which was made during enucleation, and the donor cell
was directly introduced into the cytoplasm of the enucleated oocyte.
The reconstructed embryos were activated by electrical stimulation
and cultured for 7 days.
Results The blastocyst rate of the novel OSNT embryos was 14.5%
(16/110) while the same blastocyst rate for standard SCNT embryos
was 10.7% (15/140, P < 0.05). In addition, OSNT reduced steps and
duration for SCNT program in our laboratory.
Conclusion The simple, new OSNT system enables large scale
cloning by reduction of procedural steps. Gene expression analysis
data of HSP70, Glut-1, poly A, Pou5f, Nanog, Sox9, Cdx2 and Eomes
will be presented at the meeting. This study was supported by the
Korea Science and Engineering Foundation (KOSEF) grant funded by
the Korea government (MOST) (M10641000001-06N4100-00110 and
R01-2007-000-10316-0).
P517
Porcine parthenogenote embryo developmental
competence under different in vitro maturation systems
using Roscovitine
Salvador, I 1 *, Alfonso, J 2 , Garcia-Rosello, E 3 , Garcia-Mengual, E 4 , Silvestre,
MA 4
1CITA (Centro de Investigación y Tecnología Animal), Instituto Valenciano de
Investigaciones Agrarias (CITA-IVIA), Spain; 2 Instituto de Medicina
Reproductiva, Spain; 3 Universidad CEU-Cardenal Herrera, Spain; 4 Instituto
Valenciano de Investigaciones Agrarias, Spain
With the aim of extending the “time frame” to manipulate oocytes for
techniques such as ICSI and NT, we adopted a parthenogenetic model
to determine the developmental potential of oocytes submitted to
different in vitro maturation conditions, involving the use of
roscovitine and longer IVM duration. Immature cumulus-oocyte
complexes (COC) collected from ovaries of slaughtered gilts were
matured in four different maturation systems: 45IVM (control group);
50IVM; corresponding to 45 or 50 hours maturation, respectively, in
IVM medium (M199 supplemented with 0.1% PVA, 0.57 mM
cysteine,10 ng/mL EGF, antibiotics and hormones for the first 22h
maturation period (0.1 IU/ml recombinant human-FSH and -LH);
5R+40IVM and 5R+45IVM, in which COC were cultured in
hormone-free IVM medium with 50 µM of roscovitine (Sigma,
R7772) for the first 5h, then washed twice and allowed to reach
normal maturation in IVM medium for 40 or 45 hours, respectively.
Parthenogenote development was induced by stimulating MII oocytes
with an electrical set of two DC pulses of 1.2 kV/cm for 30 µsec
delivered on an electro-cell porator. After activation, embryos were
washed twice and allowed to culture for 7 days in PZM-3 (Yoshioka
et al., 2002). When COC were cultured with the
5R+40IVM treatment, nuclear maturation and cleavage rate were
significantly lower than with the 45IVM, 50IVM and 5R+45IVM
culture treatments (54% vs. 73 -77%, P < 0.05 and 59%; 81-88%, P <
0.05, respectively). However, this difference between groups did not
reach statistical significance in blastocyst rates (ranged from 17% to
25%). Regarding embryo quality, blastocysts from 5R+40IVM group
presented the lowest average number of cells per blastocyst (P <
0.05). No differences were observed either in MII, cleavage and
blastocyst rates or in blastocyst cell number between 45IVM, 50IVM
and 5R+45IVM experimental groups. Under our experimental
conditions and using parthenogenote embryos as model, we observed
that it is feasible to prolong the “time frame” by at least 5 hours to
manipulating porcine oocytes in the laboratory without loss of
efficiency by using either 5h pre-treatment with roscovitine or
prolonging until 50 hours in vitro maturation. This work was
supported by INIA and FEDER (RTA2007-0110-00-00).
P518
Melatonin supplementation during ovine oocyte IVM
enhance blastocyst output and affects protein expression
patterns
Succu, S 1 *; Satta, V 1 ; Bebbere, D 2 ; Madeddu, M 2 ; Berlinguer, F 2 ; Leoni, G 1 ;
Naitana, S 2
1Dept. of Physiological, Biochemical and Cellular Sciences; 2 Dept. Animal
Biology; Veterinary Medicine Faculty; Sassari University, v. Vienna 2, 07100
Sassari (Italy)
Melatonin exerts a variety of systemic and local functions. Recently
evidence of the presence of melatonin receptors in the ovary has been
demonstrated. It has been shown to increase the cleavage rates of
bovine and porcine preimplantation embryos in vitro, most likely by
its anti-apoptotic effect and scavenging activity. The aims of the
current study were to test whether melatonin supplementation during
ovine oocyte in vitro maturation is able to enhance further
developmental rates in vitro, and to verify if its actions at the germ
cell level are mediated by a modification in oocyte protein expression
pattern. Adult ovine oocytes collected after slicing of abattoir derived
ovaries were randomly divided into three experimental groups for in
vitro maturation: A) TCM199 plus 10 µg/ml FSH/LH and 100µM
cysteamine (MM) supplemented with 10% oestrus sheep serum; B)
MM containing 0.4% bovine serum albumin (BSA); C) MM
containing 0.4% BSA and 100 μM melatonin. After 24h, oocytes
were fertilized and cultured in vitro up to the blastocyst stage. The
cleavage rate did not differ between the three groups (85%, 82.9% and
87.8% for A, B and C respectively). Blastocyst output was
significantly higher (P < 0.01) in A (47.1%) and B (41.7%) groups
when compared to C (23.5%). 2D-electrophoresis was performed on
both matured oocytes (10 oocytes/group) and granulosa cells of B and
C groups. Silver staining of electrophoresed gels demonstrated a high
protein number expressed in C electrophoretic gels compared to B,
while two proteins were evidenced in B but not in C gels. Some of
these differences may be related to a shift of the isoelectric point,
probably due to post-translational modifications. These data provide
evidence that melatonin added to oocyte in vitro maturation medium
is able to enhance blastocyst output to levels comparable to those
obtained routinely using oestrus ovine serum as medium supplement.
Moreover, 2D-electrophoresis results revealed that melatonin acts
altering oocyte and cumulus cell protein expression patterns, inducing
both ex-novo protein synthesis and post-translational modifications.
New insights on melatonin actions at the COC level will be drawn
after sequencing ex-novo expressed proteins found after in vitro
maturation with melatonin (Supported by Fondazione Banco di
Sardegna).
P519
Establishment of parthenogenetic embryonic stem cell
lines in mouse
Rungarunlert, S 1 ; Rungsiwiwut, R 1 ; Suphankong, S 2 ; Panasopolkul, S 1 ;
Thongphakdee, A 1 ; Dinnyes, A 3,4 ; Tharasinit, T 1 ; Techakumphu, M 1 *
1Department of Obstetrics, Gynaecology and Reproduction, Faculty of
Veterinary Science, Chulalongkorn University, Bangkok, 10330 Thailand;
2Department of Medical Science, Faculty of Medicine, Chulalongkorn
University, Bangkok, 10330 Thailand; 3 Molecular Animal Biotechnology
Laboratory, Szent Istvan University, H-2100 Gödöllö, Hungary; 4 BioTalentum
Ltd, H-2100 Gödöllö, Hungary
Introduction Establishment ES cell from parthenogenetic activated
blastocysts would allow creating histocompatible cells for
regenerative medicine.
Objective The objective of this study to establish embryonic stem
(ES) cell lines from parthenogenetically activated of mouse oocytes as
a model system for human research.
Methods Mature oocytes (n=145) were collected from oviducts at 15
h post-hCG injection and subsequently activated by using 10 mM/ml
Sr2+ with 5 µg/ml Cytochalasin B in Ca 2+-free CZB medium for 6
h. Activated oocytes with two pronuclei (2PN) (n=131) were cultured
further in vitro in KSOM-AA medium at 37ºC, 5% CO2 in a
humidified atmosphere. 96 h after activation expanded blastocysts

16 t h International Congress on Animal Reproduction
Poster Abstracts 199
were used for ES cells establishment (n=18) or differential stained for
cell number counting. All pathenogenetic embryonic stem (pES) cell
lines were characterized by morphology, pluripotency marker of
murine ES cells (AP, Oct-4, SSEA-1, Sox2 and Nanog), chromosome
number as well as in vitro differentiation.
Result The rate of activation and blastocyst formation from MII
oocytes were 90±3.13 and 82.5±2.95%, respectively. The total cell
number, ICM cell number and ICM: trophectoderm ratios of
parthenogenetic blastocysts were 66.8±2.88, 8.1± 0.63 and 1:7.24,
respectively. Four pES cell lines were established and the efficiency
of ES cell lines establishment were 10-37.5%. All pES cell lines
presented a typical morphology of murine ES cell with high nuclear:
cytoplasmic ratio, round shape and clear edge colonies. Three of them
presented normal chromosome number (2n=40). The pES cell lines
possessed high levels of alkaline phosphatase and expressed
pluripotency marker including Oct4, Sox2, SSEA1 and Nanog after
detecting by immunocytochemistry and RT-PCR. During in vitro
differentiation, the pES cell lines formed cystic embryoid bodies in
suspension culture and created spontaneous beating clusters in
gelatine-coated culture dishes.
Conclusion We succeeded to produce ES cell lines from
parthenogenetic blastocysts with presenting pluripotency markers and
normal chromosome numbers in mouse model. This work was
supported by grant from CHE-TRF Senior Scholars, grant No
RTA5080010, The National Research Council of Thailand, The Royal
Thai Government Scholarship (PhD-SW-INV_20060202/49) and EU
FP7 (IAPP 2007 - 218205).
P520
Vitrification versus slow-cooling: higher survival rates for
vitrified two-cell mouse embryos
Temple-Smith, P*; Wang, X; Aguirre Maclennan, I; Momtaz, F; Fage, R;
Patel, D; Philips, S; Pangestu, M; Catt, S
Education Program in Reproduction and Development, Centre for
Reproduction and Development, Monash Institute of Medical Research,
Australia
Introduction Cryopreservation of cleavage stage embryos by slow
cooling is now routine but recently vitrification has gained
prominence. Few studies, however, have compared the two techniques
using the same cohort of embryos.
Here we compare embryo viability in slow-cooled, vitrified or fresh
cultured two-cell mouse embryos (2-CEs).
Methods Oocytes collected from superovulated female mice [F1
(C57Bl6JxCBA)] were fertilised in vitro with epididymal sperm.
Oocytes were washed free of cumulus and sperm and cultured (24h;
modified KSOM, 5% CO2 in air). All 2-CEs (cleavage rate, 84%)
were distributed randomly into 3 groups (slow-cooling, vitrification
and unfrozen controls). For vitrification, 2-CEs were equilibrated (3
min; 37°C) in 10% v/v ethylene glycol, 10% v/v DMSO and placed in
vitrification solution (17% v/v ethylene glycol, 17% v/v DMSO,
0.75M sucrose). Each 2-CE was transferred to a fibreplug (2ul),
touched on a pre-cooled metal block in liquid N 2 and inserted in a precooled
straw (CVM kit, Cryologic). For slow-cooling (SC), up to
seven 2-CEs were put in 11% v/v propanediol in KSOM Hepes (10
mins) followed by 10 min in a final freeze solution [11% v/v
propanediol, 0.5M sucrose in KSOM Hepes medium; room temp
(RT)], and frozen individually in straws using conventional slowcooling
protocols in a programmable freezer (Cryologic CL856).
Vitrified embryos were warmed at 37°C in 3 solutions (0.3M, 0.2M,
0.1M sucrose, 5min in each); SC embryos were thawed at RT in 3
solutions (0.5, 0.25, 0.125M sucrose). Lysis was assessed 2h after
thawing, and all surviving 2-CEs were cultured (72h) to blastocyst
and hatching blastocyst stages assessed. Differences between groups
were examined using a Chi Square test.
Results Lysis rates after thawing were higher for SC embryos (29/113
21.2% cf 4/88 4.5%, P=0.001). Survival and hatching rates after
thawing for vitrification (70/84, 82.6%; 42/84, 50% respectively) and
SC (67/84, 79.7%; 42/84, 50% respectively) groups were not
significantly different from unfrozen controls (73/94, 77.6% and
54/94, 57.7% respectively). However, blastocyst development rate
(67/113, 59.2%) of thawed 2-CE in the SC group was significantly
lower than in the vitrification group (70/88, 79.5%, P=0.002).
Conclusion Comparison of two cryopreservation methods on the
same cohort of cleavage stage embryos revealed lower lysis rates after
vitrification than after slow cooling, but not higher blastocysts rates
from those 2-CE that survived. We suggest that either or both
methods could be used for cryopreserving cleavage stage embryos.
P521
Flat-headed cat cloned embryos and preliminary embryo
transfer
Thongphakdee, A 1 *, Manee-In, S 1 , Rungsiwiwut, R 1 , Numchaisrika, P 1 ,
Siriaroonrat, B 2 , Kamolnorranath, S 2 , Chatdarong, K 1 , Techakumphu, M 1
1Department of Obstetrics Gynaecology and Reproduct, Faculty of Veterinary
Science, Chulalongkorn University, Thailand; 2 Zoological Park Organization
of H.M. the King, Thailand
Introduction Critically endangered flat-headed cat (FC; Prionailurus
planiceps) is one of the small wild cats in Thailand’s captive breeding
program. Inter-generic nuclear transfer (ig-NT) offers the possibility
of FC embryos/offspring production. The purposes of the study were
to evaluate (1) in vitro development and quality of ig-NT FC embryos
(Study 1) and (2) in vivo developmental competence of their transfer
to recipients (Study 2).
Methods In Study 1, 145 ig-NT FC couplets were reconstructed by
fusion of the enucleated in vitro matured (IVM) domestic cat oocyte
together with the starved FC fibroblast cell. The couplets were
activated by inducing electrical pulses, with subsequently incubation
in activation medium, comprised of cycloheximide and cytoclalasin
B, for 4 h. The embryos were cultured in synthetic oviductal fluid
medium supplemented with amino acids and fetal bovine serum, at
38.5°C, 5% CO2 in the humidified atmosphere, and monitored for 7
days. The blastocyst quality was evaluated by cell number count.
Total of 620 IVM cat oocytes were in vitro fertilized (IVF) and served
as control. The cleaved embryos collected at 27 h postinsemination
(pi) were divided for their in vitro development observation in Study 1
(n = 171) and in vivo development after transferred to recipients in
Study 2. The rest of the cleaved embryos were selected for further
study. In Study 2, reconstructed ig-NT FC (n = 135) and IVF cat
embryos (n = 75) were transferred to uterine tubes of gonadotrophintreated
recipients (n = 3 in each group) on Day 2 after hCG-induced
ovulation. Pregnancy was assessed by ultrasonography on Day 30.
Results The reconstructed ig-NT FC couplets were 73.8%
successfully fused. The fused couplets developed to 88.8% cleavage,
44.8% morula and 8.4% blastocyst stages. Oocytes from control IVF
cleaved 54.5% at 27 h pi and those embryos developed to 98% 8-cell,
92% morula and 63% blastocyst stages. The cell number of ig-NT FC
(n = 5) and IVF cat blastocysts (n = 22) was not significantly different
(69±21 vs. 106.4±43). All (3/3) recipients receiving IVF cat embryos
became pregnant and 2 recipients gave to-term kittens, whereas, none
(0/3) receiving ig-NT FC embryos was pregnant.
Conclusions This study establishes the efficiency of ig-NT FC
embryo production. However, developmental ability of ig-NT FC
embryos may be one of the limiting factors of pregnancy
establishment.
P522
Retinol during in vitro fertilization improves development
of mouse embryo
Towhidi, A 1 *, Farshidpour, MR 2 , Chamani, M 3 , Gerami, A 4 , Nouri, M 1
1Animal Science, Islamic Azad University, Shahre Qods Branch, Islamic
Republic of Iran; 2 Animal Science, Islamic Azad University, Varamin Branch,
Islamic Republic of Iran; 3 Animal Science, Islamic Azad University, Science
and Research branch, Islamic Republic of Iran; 4 Statistics, University of
Tehran, Islamic Republic of Iran
Introduction Retinoids are recognized as important regulators of
vertebrate development, cell differentiation, and tissue function.
Pervious studies, were performed both in vivo and in vitro, indicated
the influence of retinoids on several reproductive events, including
follicular development, oocyte maturation and early embryonic

16 t h International Congress on Animal Reproduction
200 Poster Abstracts
development. The present study investigated in vitro effects of adding
all-trans retinol to media containing fertilizing and developing
embryos of mouse.
Methods The mice were maintained according to guidelines of the
committee at laboratory animals of Razi Institute. Oocytes were
produced by the superovulating 150, six week old NMRI female mice.
Sperm was obtained from the cauda epididims of 4, four month old
NMRI male mice. In first experiment, collected mouse oocytes were
fertilized in concentration 0 (control), 1, 5 and 10 micromole of
retinol in HTF medium and were transferred to CZB culture medium.
In second experiment, fertilized mouse embryos were cultured in
concentration 0 (control), 1, 5 and 10 micromole of all-trans retinol in
CZB medium. Embryos were evaluated to blastocyst stage every day.
The data analysis was carried out by using proc MIXED of SAS and
the Duncan’s multiple-range test was used to determine differences
among means.
Results In the 1 st experiment, addition of 1 or 5 micromole of retinol
improved (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 201
P525
Laparoscopic ovum pick-up (OPU) in goat and sheep
Wieczorek, J*, Kosenyuk, Y, Rynska, B; Cegla, M
Department of Biotechnology of Animal Reproduction, National Research
Institute of Animal Production, Krakowska 1, Balice/Kraków Poland
New techniques for repeated, minimal-invasive oocyte recovery in
living donor including goat and sheep are necessary. The employment
of laparoscopy and videosurgery allowed for the working out the OPU
methods. However, their use is restricted by the relatively low
efficacy and reproducibility of the results. The aim of the study was to
develop new techniques for repeated recovery of goat and sheep
oocytes useful for culture and fertilization in vitro and cloning and
evaluation of the efficacy of the established method. Oocytes were
aspirated with originally designed catheter for aspiration. The oocytes
donors were 65 goats and 45 sheep. Estrus was synchronized with
intravaginal sponges (Chronogest CR, Intervet) for 14 days.
Superovulation was obtained by the single injection of eCG (1000 IU
IM) 16 - 24 hours before the removal of the sponges. Oocytes were
collected 24 hours after sponge removal. The animals were
premedicated, then general anesthesia was induced. The general
anesthesia lasted about 15 – 20 min. The endoscope was inserted into
the abdominal cavity through umbilicus. Two trockars for putting the
manipulators were inserted 15 cm below the udder. Oocytes were
collected by aspiration of the follicular fluid from the ovarian
follicles. Depending on the size, the single aspiration of up to 8
follicles was performed. The collected oocytes were evaluated under
stereo microscope. The following classification of the oocytes were
established: class I – homogenous cytoplasm, at least 3 layers of the
granulosa cells, class II – homogenous cytoplasm, 1-2 layers of
granulosa cells, class III – homogenous cytoplasm, no granulosa cells,
class IV – heterogenous cytoplasm, independent of the granulosa
cells. Oocytes class I, II and III were qualified for the culture. Goats:
488 ovarian follicles were aspirated, 276 (56.6%; p

16 t h International Congress on Animal Reproduction
202 Poster Abstracts
P528
Development of reconstructed embryos from human
somatic cells and ovine enucleated oocytes and isolation
of putative human embryonic stem cell clones
Zhou, MH*; Zhao, J
Faculty of Bioengineering, Inner Mongolia Agricultural University, China
Introduction Since the difficulty of obtaining human embryos limited
the production of human embryo stem cells this research was to clone
heterogeneous embryos by using human fetal skin fibroblast cells as
nuclear donor cells and the enucleated ovine oocytes as recipient
cytoplasts for examining the developmental potential of the
reconstructed embryos to attempt to isolate human embryonic stem
cells.
Methods Ovine oocytes were collected from slaughterhouse-derived
ovaries, in vitro matured and enucleated then used as recipient
cytoplasm. Human fibroblast cells was obtained from an aborted 4-
month aged fetus skin and employed as donor somatic cells. The cell
was injected to sub-zona pellucida of oocyte and fused electrically
into ooplasm then activated by Inomycin with 2 M/ml 6-
dimethylaminopurine (6-DMAP). Only the activated reconstructed
embryos were co-cultured with ovine cumulus cells in synthetic
oviduct fluid supplemented with amino acid (SOFaa) and 10% (v/v)
fetal calf serum (FCS). These heterogeneously cloned embryos were
morphologically monitored for their developmental competence at
48h to 168 h of culture. The cell mass of morula or blastocysts were
cultured on mouse fibroblast feeder layer and used for the isolation of
embryonic stem cell clones. The clones of putative human embryonic
stem cell were identified by alkaline phosphatase (AKP).
Results The human fetal skin fibroblast cells maintained
morphologically normal characteristics and normal numbers of
chromosomes (2n = 64) in culture. The reconstructed human embryos
completed the first cleavage of between 24 to 48 h and
morula/blastocyst development in 72 h to 168 h after activation. 27%
of the reconstructed embryos underwent the cleavage while only 15%
of the cleaved embryos proceeded to develop to morula/blastocyst.
The clones of putative embryonic stem cell grew on fibroblast cell
layer, with nest- or islet-like morphology after 3 to 7 days culture.
AKP staining of the clones showed positive reaction.
Conclusions Human fetal fibroblast cell nuclei can be reprogrammed
in ovine enucleated oocytes. The heterogeneously nuclear-transferred
human embryos can undergo the meiosis division and subsequent
development to morula/blastocyst stage thus serving as an alternative
for obtaining human embryonic stem cells. The improvement of the
reconstructed embryo developmental ability, however, is a future
challenge.
Poster 19 - Biomedical Models in Reproductive and
Regenerative Medicine
P529
Embryonic Stem Cells derived from Separated
Blastomeres of Cynomolgus Monkey as a Model System
of Regenerative Medicine
Hosoi, Y 1 *, Teramura, T 2 , Takenoshita, M 3 , Takehara, T 1 , Matsumoto, K 1 ,
Saeki, K 1 , Fukuda, K 2 , Iritani, A 1
1Dept of Genetic Engineering, Kinki University, Japan; 2 Dept of Orthopedic
Surgery, Kinki University, Japan; 3 Keari Co. Ltd., Japan
Objective Recently, ESCs (Embryonic Stem Cells) were established
from single blastomeres of preimplantation embryos in mice and
humans. These methods have been suggested to reduce ethical
concerns since we can obtain pluripotent ESCs without interfering
embryonic development. Furthermore, these results also give rise to
important information about polarity of mammalian embryos.
Although totipotencies of separated blastomeres have been
experimentally determined in rodents and some domestic animals,
only one live-birth was reported in primate. Here, we succeeded in
establishment of ESCs from single blastomeres of two-cell and fourcell
embryos in cynomolgus monkey.
Methods In this study, we cultured the separated blastomere in zona
pellucida prepared from inmatured oocytes. Manipulated embryos
were cultured in mCMRL medium until blastocyst stage. By this
method, the blastomeres could maintain cell-to-cell interaction with
each blastomere after cleavage, and resulted in blastocysts with
normal morphology. ICMs were collected from the embryos by
immunosurgery, and cultured on mitotically inactivated-MEF feeder
layer. Pluripotency and undifferentiated status of ESCs were
evaluated by RT-PCR, immunocytochemical staining and formation
of teratoma.
Results Two ESCs were established from separated blastomeres
(Two-cell; 1/8, Four-cell; 1/4, Normal embryos as control; 3/11). Both
cell lines expressed ALP, Oct-4, Nanog, SSEA-4, TRA1-60 and
TRA1-81 in undifferentiated state. Furthermore, differentiation
potencies were also determined by in vitro differentiation and
teratoma formation.
Conclusion We succeed to establish ESCs from separated
blastomeres of non-human primate. It could be important model for
developmental competence of cleaved blastomeres, and suggest an
effective tool for pre-clinical research for a regenerative medicine.
P530
Effects of physiological and non-physiological insulinlike
growth factor-1 (IGF-1) concentrations on the in vitro
development of bovine embryos
Velazquez, MA 1,2 *; Korsawe, K 1 ; Niemann, H 1
1Department of Biotechnology, Institute for Animal Breeding, Mariensee,
Neustadt, Germany; 2 Escuela Superior de Ciencias Agropecuarias,
Universidad Autonoma de Campeche, Mexico
Introduction Physiological concentrations of IGF-1 can exert
positive effects in bovine embryos. However, detrimental effects on
bovine oocyte morphology (Reproduction 133:1121-28, 2007) and
murine embryo development were found with high concentrations of
IGF-1, resembling the non-physiological IGF-1 levels associated with
early pregnancy loss in women with the polycystic ovary syndrome
(Diabetes 56:2228-34, 2007). Determination of the effects of normal
and abnormal IGF-1 milieus on embryo development is important for
the understanding of embryonic plasticity in order to improve the
effectiveness of embryo technologies. The goal of this study was to
determine the effects of physiological and non-physiological
concentrations of IGF-1 on the development and number of cells of in
vitro-produced bovine embryos.
Materials and methods Oocytes obtained by slicing from abattoir
ovaries were matured (24 hrs) and fertilized (18 hrs) in vitro. For
culture, zygotes were placed randomly in three groups: a) control
(synthetic oviduct fluid [SOF]/Bovine serum albumin [BSA]), b)
physiological IGF-1 (SOF/BSA + 100 ng/mL IGF-1) or c) nonphysiological
IGF-1 (SOF/BSA + 1000 ng/mL IGF-1). On day 8,
blastocyst rates were recorded and differential cell staining was
applied to count the number of inner cell mass (ICM) and
trophectoderm (TE) cells. Data from 14 replicates were analyzed
statistically.
Results Cleavage was improved by both 1000 (62.7 ± 2.1, P=0.001)
and 100 (59.3 ± 3.7, P=0.04) ng IGF-1 over controls (52.4 ± 3.2). The
proportion of hatched blastocysts was enhanced by 100 (5.1 ± 1.3,
P=0.006) and 1000 (4.1 ± 0.8, P=0.02) ng IGF-1 compared to controls
(1.9 ± 0.4). Total blastocyst rate was increased by 100 ng IGF-1 (30.9
± 1.8, P=0.03) over controls (25.0 ± 1.9), but not by 1000 ng IGF-1
(28.4 ± 2.0 P=0.25). There was a tendency (P = 0.07) for the 100 ng
IGF-1 group (45.0 ± 4.5) to have less degenerated embryos compared
to 1000 ng IGF-1 (53.9 ± 3.8). 1000 ng IGF-1 increased the number
of cells in the ICM (37.0 ± 2.2, P=0.007) and the proportion of
blastocysts (22.8% P=0.01) with an increased ICM:total cell ratio (≥
40 %) compared to controls (26.0 ± 1.4 and 0% respectively).
Perspective Gene expression and apoptosis analysis are needed to
further characterized the effects of different IGF-1 milieus on bovine
preimplantation embryo development. M.A.V. is supported by
DAAD.

16 t h International Congress on Animal Reproduction
Poster Abstracts 203
Poster 20 - Gene Modified Animals (Transgenics)
P531
Glycemia and leptinemia are related to changes in
reproductive fitness of transgenic mice overexpresing
pancreatic glucokinase
Ballester, J 1 *; Agudo, J 1 ; Bosh, F 1 ; Rodriguez-Gil, JE 2
1CBATEG, Autonomous University of Barcelona, E-08193 Bellaterra. Spain;
2Dept. Animal Medicine and Surgery, Autonomous University of Barcelona, E-
08193 Bellaterra. Spain
This study was focused in the effects of the overexpression of the
glucokinase (GK) gene in pancreatic islets on reproductive fitness by
utilising an specific Ins-GK transgenic mice showing this phenotype.
The GK overexpression induced a clear drop in the prolificacy of Ins-
GK mice (8.14±0.83 newborn/delivery in control mice vs. 3.73±0.17
newborn/delivery in Ins-GK animals). At the same time, Ins-GK
animals showed a clear hypoglycemia (90.4±2.9 mg/dL in control
mice vs. 61.3±2.4 mg/dL in Ins-GK animals) besides a significant
(P

16 t h International Congress on Animal Reproduction
204 Poster Abstracts
Conclusions These preliminary data suggest that flow cytometry
could be used for evaluating sperm DNA binding capacity. Besides
this study shows that under our experimental conditions the capacity
of binding of DNA to bull frozen-thawed bull spermatozoa is related
to viable and unviable cells. These facts maintain opened the
possibility of using this technique in IVF systems for generation of
transgenic bovine embryos.
Supported by BIOCARM 10BIO2005/01-6463 and MEC-FEDER
AGL2006-03495
P534
On the role of LIF and LIFR expression during rabbit
embryonic stem cell line establishment
Gócza, E.*, Catunda, AP., Hiripi, L., Bősze, Zs.
Agricultural Biotechnology Center, 2100, Szent-Györgyi A. str. 4, Gödöllő,
Hungary
Embryonic stem cells (ES) have become an important tool for
generating transgenic mice. Embryonic like stem cells and ES
chimeric animals have been reported for several farm animal species,
but germ line transmission was not reported.
Rabbit ES cells, established in our laboratory, by their growth in
tightly packed, flat colonies resembled to human ES cell lines, while
expression of alkaline phosphatase, Oct-4, Nanog, SSEA-1 and CD9
which were detected by immunostaining made them similar to mouse
ES cells.
Leukemia inhibitory factor (LIF) is necessary for mouse ES cell selfrenewal,
but it fails to maintain self-renewal in human and non-human
primate ES cells. To examine the role of LIF and leukemia inhibitory
factor receptor (LIFR) at rabbit ES cell line establishment, the
expression patterns of LIF and LIFR were analysed at different stages
of rabbit embryonic development and LIFR expression in rabbit ES
cells by RT-PCR at different passages. LIFR mRNA was first
detected around implantation in 6.5 d.p.c. rabbit embryos, while LIF
mRNA expression was already present at rabbit blastocyst stage. In
attached ICM and in ES cells after the 1st passage, very low level of
LIFR expression was found. After the 2nd passage high expression of
LIFR was detected in rabbit ES cells.
Since commercial rabbit LIF is not available we had to find the most
effective recombinant LIF for rabbit ES cell establishment. With this
object human, rat and mouse recombinant LIFs were compared. At
early passages we could not find any difference in their effect, but at
higher passage numbers, the rat LIF was found to be the most efficient
factor in the prevention of the differentiation. LIF withdrawal resulted
the differentiation of rabbit ES like cells into cardiomyocytes. These
findings suggest that the the LIF-LIFR signal pathway has an
important role in maintenance of pluripotency of rabbit ES cells.
This work was supported by grant OM-00367/2004, OTKA T037582
and Bilateral Intergovernmental S and T Cooperation D-26/02
(HUN02/045).
P535
Succesful h-lactoferrin transgenic goat embryo transfer
after SCNT
Mutto, A 1 * # ; Kaiser, GG 2# ; Mucci, N 2# ; Hozbor, F 2 ; Sanchez, E 2 ; Ugalde, R 1 ;
Alberio, RH 2
1IIB, UNSaM, Argentina; 2 INTA Balcarce, Argentina
#Authors contributed equally to the present work
Because of its properties (digestibility, composition, taste), goat milk
is suitable to be used as a substitute for cow milk in patients with cow
milk allergy and for human nursling babies with no tolerance to
lactose. By adding some sugars, lisozime C and lactoferrin it will be
possible to have a “humanized” goat milk.
The objective of this work was to produce transgenic clone embryos
and pregnancies for human lactoferrin in goats by using somatic cell
nuclear transfer of transfected fetal goat fibroblasts.
Materials and methods A 1960bp human lactoferrin cDNA (Gen
Bank n: NM_002343) obtained from ATCC encompassing the entire
coding region was used as template. It was cloned into pBC1 milk
expression vector (Invitrogen, Ca, USA) between the intron 1, exon 2
and exon 7 of goat β-casein gene. An eukaryotic selection marker
cassette with a Blasticidin-S resistence gene was added, under h-EF1α
promotor.
Goat fetal fibroblasts obtained from 30 day pregnancies were sexed
by PCR and karyotyped and female cell lines were transfected by
liposomes (Lipofectamine 2000®, Invitrogen, USA). Colonies were
selected after 10 days of culture with Blasticidin and grown in
complete culture media (D-MEM). Stable transfections were
confirmed by FISH.
Oocytes were obtained by laparoscopic ovum pick-up of stimulated
goats during the reproductive season, in vitro matured and subjected
to nuclear transfer as described by Baldassarre et al (2004).
Presumptive zygotes (24 hs after NT) were transfered by a surgical
procedure in both oviducts of those animals that presented at least 2
hemorrhagic corpora lutei.
Results A total number of 331 oocytes were recovered from 480
follicles after 5 sessions of LOPU (8 goats each session). All oocytes
that presented a polar body were enucleated and transferred (n=238).
There was an overall fusion rate of 51%. A total number of 121
presumptive zygotes were transfered to 12 goats (7 to 12 per
recipient), resulting in 5 pregnancies at day 30 (41.6% pregnancy rate)
and 2 at day 83 (16.6%). Two pregnancies were twins, one remaining
until day 83.
We can conclude that under our conditions it is posible to obtain
transgenic goat fetal fibroblasts, embryos and pregnancies for human
lactoferrin. For our best knowledge this is the first report of goat h-
lactoferrin transgenic pregnancies by using SCNT technique.
P536
Towards generation of human A20 gene transgenic pigs
with improved features in xenotransplantation
Oropeza, M 1,2 *, Petersen, B 1 , Herrmann, D 1 , Hassel, P 1 , Lucas-Hahn, A 1 ,
Lemme, E 1 , Queisser, AL 1 , Niemann, H 1
1Dept. of Biotechnology, Institute for Animal Breeding, Mariensee, Neustadt,
Germany; 2 University of Veterinary Medicine, Hannover, Germany
Introduction Xenotransplantation is considered as promising to close
the growing gap between demand and availability of appropriate
human organs. While the hyperacute rejection response can already be
reliably controlled, the acute vascular rejection (AVR) remains a
major hurdle for longterm survival of xenografts in a porcine-toprimate
organ transplantation. The human A20 (hA20) gene exhibits
both antiapoptotic and anti-inflammatory properties in endothelial
cells (Transplantation 82 : 36-40, 2006) and could thus prevent
endothelial cell activation leading to AVR and xenograft destruction.
The goal of this project is to produce transgenic pigs with improved
features in xenotransplantation by transgenic expression of hA20.
Materials and Methods The hA20-expression vector driven by the
ubiquitous CAGGS hybrid promoter (chicken β-actin-/ rabbit β-
globin) containing an IRES-neomycin resistance cassette (9.1 kb) was
transfected into porcine fetal fibroblasts (PFFs) derived from German
Landrace porcine fetal explant cultures. Transfection of 3 x 10 6 cells
was accomplished at 450 V and 350µF with 10 µg plasmid DNA.
G418-resistant (800 µg/mL) cell clones were screened by PCR with
hA20 specific primers for hA20-integration. Somatic cell nuclear
transfer (SCNT) was performed as recently described (Cloning Stem
Cells 7: 35-44, 2005).
Results A total of 80 cell clones were hA20-positive in PCR
screening from 4 rounds of transfection after a 14 days G418 selection
period. 30 positive cell clones were re-selected for 14 days with G418.
Four of these cell clones were used as donor cells for SCNT.
Immediately after SCNT, reconstructed embryos were transferred to a
total of 10 synchronized recipient sows. Ultrasound examination on
day 23-25 of pregnancy confirmed established pregnancies in 7 of 10
recipient sows. Two animals were sacrified on day 30 of pregnancy
and a total of 8 fetuses were isolated. PCR and Southern Blot analysis
showed integration of the hA20 gene in 6 of 8 fetuses.
Conclusions The hA20-vector can be integrated in PFFs and hA20
transgenic PFFs can successfully be used in SCNT to establish
pregnancies. Further analysis will focus on the expression patterns in
A20-positive cell clones and the biological function of hA20 in
transgenic piglets. A second approach will be to introduce an

16 t h International Congress on Animal Reproduction
Poster Abstracts 205
endothelial specific promoter active in pigs and thus target expression
of hA20 to the endothelial cell layer. Providing the endothelial cells
with a higher antiapoptotic potential could decrease their
susceptibility to cell death.
P537
Expression of an omega-3 fatty acid desaturase gene
from scarlet flax in bovine transgenic embryos cloned
from transfected somatic cells
Saeki, K 1 *, Indo, Y 1 , Tatemizo, A 1 , Suzuki, I 2 , Matsumoto, K 1 , Hosoi, Y 1 ,
Murata, N 3
1Department of Genetic Engineering, School of Biology-Oriented Science and
Technology, Kinki University, Japan; 2 Laboratory of Plant Physiology and
Metabolism, University of Tsukuba, Japan; 3 National Institute for Basic
Biology, Japan
Introduction Long chain n-3 fatty acids are considered desirable in
human diets because they can lower the risk of coronary artery
disease, cancer and inflammatory diseases. n-3 fatty acids are found in
fish oils and specific plant oils. But their levels in animal meats are
quite low, because mammals lack the gene for converting linoleic acid
to alfa-linolenic acid. Recently, it has been reported that a humanized
nematode gene, hfat-1, can be used to increase the levels of n-3 fatty
acids in transgenic pigs. We report here functional expression of a
plant-derived gene for an omega-3 fatty acid desaturase (FAD3) in
gene-transfected bovine cells and production of embryos cloned from
the transfected cells.
Methods The gene was isolated from immature seeds of scarlet flax,
because the level of alfa-linolenic acid of the flax seeds is the highest
among terrestorial plants. Bovine muscle satellite cells were isolated
from a 9-month-old male calf. The codon usage of the flax FAD3
cDNA was optimized (humanized) for high expression in mammalian
cells. A plasmid (pIRES2-EGFP) containing the humanized FAD3
gene (hFAD3) under the control of the CAG promoter, and a
neomycin-resistance cassette (pCAG/hFAD3/IRES/EGFP/(neor)) was
transfected to the satellite cells with a transfection reagent (
GeneJammer ). The stably transfected cells were differentiated to
multilocular adipocytes by culturing with bFGF, dexamethasone and
octanoic acid. Total lipids were isolated from the adipocytes and their
fatty acid composition was analyzed by gas chromatography. We then
produced cloned bovine embryos using the hFAD3 cells. The cloned
embryos were cultured to the blastocyst stage. Blastocyst rates and
gene expression of EGFP and hFAD3 were then examined.
Results The level of total n-3 fatty acids in the hFAD3 cells (12.5%)
was higher than that in the control cells (9.1%, P4 to 8 mm in diameter) sizes of ovarian
follicles were transfected with liposome alone, both liposome and
EGFP, or liposome and EGFP in combination with pEGISI
respectively. The transfection procedure was performed according to
the Lipofectamine2000 manufacturers’ instructions. Cell proliferation
was quantified by the CellTiter 96® AQueous One Solution Cell
Proliferation Assay. Cell apoptosis was detected using an Annexin V-
FITC/Propidium Iodide for flow cytometry. Steroidogenesis was
evaluated by measurements of both estradiol and progesterone in
culture via radioimmunoassay methods. Maturation of oocytes cocultured
with transfected GCs and subsequent embryo developments
were also investigated.
Results The transfection with pEGISI inhibited proliferation of GCs
from medium follicles (P

16 t h International Congress on Animal Reproduction
206 Poster Abstracts
follicles. The apoptosis of GCs was increased in pEGISI treatment
group compared with controls from both medium and small follicles
(P

16 t h International Congress on Animal Reproduction
Poster Abstracts 207
pH. The mean duration of surgery was 30±10 minutes (Group A) and
20±5 minutes (Group B). Average healing times were 5 days (Group
A) and 7 days (Group B).
As for pCO2, statistically significant differences (p

16 t h International Congress on Animal Reproduction
208 Poster Abstracts
|Both groups were kept together under the same management
conditions. Fifty days after embryo transfer, the pregnancy diagnosis
was performed. Results- The group of seropositive recipient heifers
showed a pregnancy rate of 72.7% and the seronegative group a
pregnancy rate of 81.8%. There was no significant difference between
them. Conclusions- There was no interference of Neospora caninum
infection on the pregnancy rates of embryo recipient heifers during
the first third of the gestation period.
P546
Alleviation of maternal hyperthermia-induced early
embryonic death by administration of DL-α-tocopherol
acetate accompanied by a reduction of physiological
oxidative stress in mice
Ozawa, M 1 *, Sakamoto, N 2 , Yokotani-Tomita, K 2 , Morimoto, A 2 , Ijiri, D 2 ,
Hirabayashi, M 2 , Ushitani, A 2 , Yukio, K 2
1Division of Animal Sciences, Reproductive Biology, National Institute of
Agrobiological Sciences, Japan; 2 Graduate School of Life and Environmental
Science, University of Tsukuba, Japan
Maternal hyperthermia induces pre-implantation embryo death, which
is accompanied by enhanced physiological oxidative stress. We
evaluated whether the administration of DL-α-tocopherol acetate (TA)
to hyperthermic mothers mitigated pre-implantation embryo death.
Mice were exposed to heat stress (35°C, 60% relative humidity) for
12 h or not heated (25°C) on the day of mating. Twelve hours before
beginning the temperature treatment, TA was injected
intraperitoneally at a dose of 1 g/kg body weight. After the treatment,
zygotes were recovered and the developmental abilities and
intracellular glutathione (GSH) levels were evaluated. Another set of
mice, with or without TA treatment, was exposed to heat stress for 12,
24, and 36 h and the urinary levels of the oxidative stress marker 8-
hydroxy-2’-deoxyguanosine (8-OHdG) were measured. Heat stress
significantly decreased the blastocyst development rate and the GSH
content in zygotes, as compared to the non-heat-stressed embryos,
while TA administration significantly mitigated the deleterious effects
of heat stress with regard to both parameters. Moreover, although the
urinary levels of 8-OHdG gradually increased according to the
duration of heat exposure, with or without TA administration, the
levels were lower in the TA-administered group than in the placeboinjected
mice. These results suggest that heat stress enhances
physiological oxidative stress, and that TA administration alleviates
the hyperthermia-induced death of pre-implantation embryos by
reducing physiological oxidative stress.
P547
Heat shock-induced damage in bovine oocytes
Paula-Lopes, FF 1 *, Milazzotto, MP 1 ; Assumpção, MEOA 1 ; Visintin, JA 1
1 Department of Animal Reproduction, School of Veterinary Medicine and
Animal Sciences, University of São Paulo, Brazil
The series of events associated with oocyte growth and maturation are
susceptible to disruption by elevated temperature compromising the
ability of the oocyte to undergo adequate fertilization and embryonic
development. The objective of the current study was to examine
whether exposure of bovine oocytes to a physiological heat shock
(HS) during IVM induces cell death and compromises oocyte
developmental competence. In the first study slaughterhouse
crossbred Bos indicus cumulus-oocyte complexes (COCs) were
exposed to control (39°C for 22 h) or HS (41°C for 12 h followed by
39°C for 10 h) during IVM. Approximately 22 h after IVM oocytes
were denuded (1 mg/ml hyaluronidase) and subjected to a membrane
permeability based triple staining using 5 µg/ml Hoechst 33342, 1
µg/ml propidium iodide (PI) and 2.5 µM YO-PRO1 as DNA staining
markers for live, necrotic and apoptotic cells, respectively. Exposure
of bovine oocytes to HS during IVM reduced the proportion of
oocytes that reached the metaphase II stage (61.43 + 6.25 and 30.13 +
6.25% for control and HS, respectively; p< 0.05). This experiment
was replicated 5 times using a total of 152-161 COCs/treatment.
Even though HS compromised oocyte nuclear maturation there was
no effect on the proportion of necrotic and apoptotic oocytes. In the
second experiment COCs were exposed to control or HS temperatures
as described in experiment 1. Oocytes were subjected to in vitro
fertilization and culture at 39°C. Heat shock reduced the proportion
of oocytes that cleaved (62.90 + 2.06 and 49.64 + 2.06% for control
and HS, p< 0.0001) and reached the blastocyst stage (20.01 + 1.08
and 7.41 + 1.14 % for control and HS; p< 0.0001). This experiment
was replicated 10 times using a total of 1309-1042 COCs/treatment.
A blastocyst subset harvested from 4 random replicates (n=65 and 25
blastocyst/treatment for control and HS) was subjected to the
membrane permeability based triple staining as described in
experiment 1. Exposure of bovine oocytes to HS did not affect
blastocyst cell number or the percentage of necrotic cells/blastocyst.
However, HS increased the proportion of apoptotic cells/blastocyst
(8.75 + 1.14 and 13.00 + 1.71% for control and HS, respectively; p<
0.05). Therefore, exposure of bovine oocytes to a physiological HS
during IVM compromised oocyte maturation and developmental
competence. However, such moderate HS did not induce oocyte
apoptosis or necrosis. In conclusion, direct exposure of crossbred Bos
indicus oocytes to a physiological HS compromised the oocyte
machinery without inducing oocyte death. (Support: CNPq).
P548
Efficacy of 18 and 36 mg subcutaneous melatonin implant
to reversibly suppress estrus in queens
Stornelli, MA 1 *, Giménez, F 1 , Stornelli, MC 1 , Savignone, CA 1 , Tittarelli, C 1 ,
Videla Dorna, I 2 , De La Sota, RL 1
1Servicio y Cátedra de Reproducción Animal, Facultad de Ciencias
Veterinaria. Universidad Nacional de La Plata, Argentina; 2 Syntex SA,
Argentina
The aim of this study was to assess the efficacy of 18 and 36 mg
subcutaneous melatonin implant (SMI) to reversibly suppress estrus in
queens. Fourteen queens aged between 12 and 14 months and
weighting between 2 and 4 kg were maintained under artificial
illumination (14 h light: 10 h dark) and assigned to one of two
treatments (TRT). At interestrus (IE), queens assigned to TRT18
received a SMI (18 mg; Syntex SA, Argentina; =7), and queens
assigned to TRT36 received SMI (36 mg; Syntex SA, Argentina;
n=7). Blood samples were taken when queens showed proestrus signs
(PE) to measure E2 by RIA. Before implant administration and once a
month during IE, blood samples were taken to measure P4 by RIA
and melatonin (MEL) by ELISA. After the trial was concluded, ten
queens were mated and pregnancy was diagnosed by ultrasonography
20 days after mating. No significant differences in IE length, serum
MEL concentration, or the area under the curve were detected
between TRT18 and TRT36 queens (65.0±14.9 vs. 65.6±13.4 d,
P>0.97; 42.6 vs. 45.6 vs. 9.4, P>0.89; 2682±726 vs. 2732±593,
P>0.95). A significant rice in serum MEL concentration was observed
after implant insertion in both TRT (before vs. after insertion, 30.2 vs.
43.8±2.9 pg/ml, P0.27). E2 serum concentrations were similar
between TRT18 and TRT36 implants (E2, 54.9±10.7 vs. 60.1±9.6
pg/ml, P>0.73). On the contrary, a significant difference in serum P4
concentrations was detected. On day of implant insertion, serum P4
concentrations were higher than 4 ng/ml in 6 of 14 queens studied
and decreased below 1 ng/ml around 19.6±13.4 d of implant insertion
in both groups (TRT18 [n=1] vs. TRT36 [n=5], P>0.39). During this
period serum P4 concentrations were similar for both groups
(P>0.11). In the other 8 queens no significant differences in serum P4
concentrations were detected between TRT (P>0.46) and
concentrations were below 1 ng/ml during the study period. Although
spontaneous ovulation and pseudopregnancy may explain high P4
concentrations (>4 ng/ml) and non return to estrus during the first 19
d of IE, after day 19MEL concentrations from the implant were
responsible maintaining the non return to estrus from day 19 onwards
in these 6 queen. The pregnancy rate to the first mating was 60%
(6/10). Thus, both MEL implants were equally effective to
temporarily and reversibly suppress estrus in queens for two months
with no side effects.
Key words: queen; reversible contraception; melatonin

16 t h International Congress on Animal Reproduction
Poster Abstracts 209
P549
Effects of husbandry practices and animal welfare on
reproductive indicators in sheep
Veksler Hess, J.*; Schuh, A.; Coppola, M.; Decaminada, E.; Miralles, M.;
Ghirardi, M.
Department of Veterinary Sciences; University of Buenos Aires. Buenos
Aires. Argentina
With the purpose of evaluating the influence of husbandry practices
and animal welfare on reproductive indicators in sheep we determined
the impact of both factors on a Romney Marsh pure- breed flock in a
farm in “General Lavalle”, Buenos Aires, in a region known as
“Cuenca del Salado”. We evaluated the effects of two treatments (A
and B) on a flock of 50 ewes (n=50) ranging from 19-30 months of
age, with a Body Score of 3.5 (Scale 1-5). Both treatments received
the same sanitary and reproductive management, with natural service
using 2% rams. In treatment A, husbandry practices followed the
Animal Welfare regulations (Thirsty-free; hunger-free; comfortability,
free of fear and stress). The diet during the maximum requirement
stages (mating, G2, milking) consisted of Lotus tenui, Trifolium
repens and Lolium perenne.
Treatment B differed from A in husbandry practices and nutritional
management. This treatment not corresponded with the University\'s
animal welfare rules. The basic regulations of animal welfare were not
followed (change of personnel, aggressive treatment of animals,
inadequate facilities and herding, etc.). In treatment B the diet
consisted of a natural pasture composed primarily of Distichlis
spicata, a graminea frequently found everywhere in Buenos Aires
province, preferably in salty and humid soils, due to its salinity
tolerance. Its nutritional value is acceptable but since it is a small
plant, its forrage offer is scarce. In treatment B the requirements of the
different productive stages were not taken into account and the ewes
grazed always in the same paddocks.
Method A resulted in 42 finished lambs (n=42) which represented
113% lambing rate. Method B resulted in 35 lambs (n=35); 70%
lambing rate.
Significant differences were observed (p0.05) of the initially normal follicles remained intact after
cryopreservation. But the proportions of the degenerated follicles
were significantly increased after freezing.
Conclusion Our results suggest that cryoprotective solution is toxic
for the preantral follicles. Moreover, freezing solution composed of
PROH seems to be more adapted to the cryopreservation of bovine
ovarian tissue. Nevertheless, evaluation of such freezing solution
needs to be performed in a larger population. (Grant from Region
Rhône-Alpes)

16 t h International Congress on Animal Reproduction
210 Poster Abstracts
P552
Effect of semen collection method on pre- and post-thaw
Black Manchega ram spermatozoa and its relationship
with heterologous in vitro fertilization ability
García-Álvarez, O 1 *; Maroto-Morales, A 1 ; Martínez-Pastor, F 2 , Garde, JJ 2 ,
Pérez-Guzman, MD 1 ; Soler, AJ 1,2
1CERSYRA. Consejería de Agricultura de Castilla-La Mancha, Valdepeñas,
Spain; 2 IREC, (CSIC-UCLM-JCCM), Albacete, Spain
Introduction The Black Manchega sheep is an endangered species
and the FAO suggests its conservation. However, there are no studies
about sperm cryopreservation for this breed for constitution of a
sperm bank in order to preserve this specie. For it, the objective of this
work was to evaluate the effect of two methods of semen recovery
(electroejaculation or post-mortem from the epidydimes) on the
production and quality of fresh and cryopreserved Black Manchego
ram spermatozoa and on heterologous in vitro fertilization ability.
Methods Semen was collected from six adult black Manchego rams.
After sperm recovery, the samples were diluted at room temperature
in a commercial extender Biladyl® and were frozen after a cooling
period. We evaluated the effect of semen collection method on fresh
and frozen-thawed spermatozoa quality parameters, including:
subjective sperm motility (SM), intact apical ridge using a phasecontrast
microscopy, sperm membrane integrity by nigrosin-eosin
staining and for frozen-thawed semen, we also evaluated membrane
stability by YOPRO-1 using flow cytometry. Furthermore, we studied
sperm velocity parameters (VCL, VSL, VAP) determined by CASA
(SCA®). The fertilizing ability of frozen-thawed sperm samples was
assessed using calf oocytes matured and fertilized in vitro. Thawed
spermatozoa were co-incubated with the oocytes (one million per
well) for 40 h, and the cleavage rate was evaluated. Statistical analysis
carried out was a GLM. Significance level was set at p

16 t h International Congress on Animal Reproduction
Poster Abstracts 211
but not all the parameters; the magnitude of the changes in the sperm
kinematic parameters was quite similar for each of the 8 bulls between
fresh and post-thaw semen. Immediatly after thawing, VCL and VAP
showed significant differences among the 8 bulls, however VSL was
no significantly different. Individual variation in semen freezability is
recognized to exists in bovine, and has been related with the incidence
of motile distinct sperm subpopulations in the fresh ejaculate, but
further results are needed to complete the Asturiana de la Montaña
genetic resource bank characterization.
This work was performed in collaboration with ASEAMO and
supported by RZ2004–00031–C02–01.
P555
Captive breeding strategies affect sperm traits in
Peromyscus leucopus
Martinez-Pastor, F 1 *; Malo, AF 2,3 ; Alaks, G 2 ; Lacy, RC 2
1National Wildlife Research Institute (IREC) (UCLM-CSIC-JCCM) and
Institute of Regional Development (IDR), University of Castilla-La Mancha,
Spain; 2 Chicago Zoological Society, Dept. of Conservation Science, 3300
Golf Road, Brookfield, IL 60513, USA; 3 Smithsonian Institution, Center for
Conservation and Evolutionary Genetics, National Zoological Park,
Washington D.C. 20008, USA
Captive breeding programs are the only option for many endangered
species. However, it is believed that inbreeding and genetic adaptation
to captivity may make the descendants from many captive programs
unsuitable for release back into the wild. Male fertility is one of the
traits potentially affected, so there is a need to known how captive
breeding programs affect sperm traits. We have measured the effects
of 10 generations of three different captive breeding strategies on
Peromyscus leucopus, originating from the same wild population: (1)
random mating (RAN), (2) minimizing the mean kinship (MK) of the
offspring (Species Survival Plan breeding strategy; SSP) and (3)
selecting for docility (DOC), by which more docile mice (behavioral
scores) are bred (mimicking the default breeding strategy in
captivity). Twenty males from each group were euthanized (CO 2 ).
Cauda epididymes were collected and put in a 0.5-mL drop of
modified Tyrode (300 mOsm/kg), covered with paraffin oil (37 °C),
and pierced. After 5 min, the medium was transferred to microtubes.
We evaluated the number of spermatozoa (Neubauer hemocytometer),
% of motility (light microscopy ×400) and viability (eosin/nigrosin
staining, ×400). Spermatozoa were challenged using an osmotic
resistance test (ORT): osmolality was raised to 500 mOsm/kg, and
after 5 min reverted to 300 mOsm/kg, assessing motility and viability
5 min later. The effect of the 3 groups on sperm traits was analyzed by
ANOVA and Tukey test (results as median and interquartile range).
RAN yielded significantly more spermatozoa (146.4×10 6 [113.3,
191.6]) than DOC (100.8×10 6 [80.3, 116.7]), SSP being in between
(138.2×10 6 [85.1, 176.6]). Motility (77.5% [68.8, 85]) and viability
(61% [53.8, 70.6]) were not different between groups. After ORT,
viability decreased (48% [38.9, 55]), but the change was not
significantly different among groups. However, motility was
significantly lower for DOC (27.5% [20, 36.3]) than for RAN (40%
[35, 42.5]) or SSP (42.5% [38.8, 55]). Overall, sperm numbers and
motility were reduced in the DOC group, announcing the negative
reproductive effects of not minimizing MK and suggesting the
absence of large differences between RAN and SSP. Our results
suggest that the breeding strategy affects sperm traits, and that
selecting the more docile individuals as breeders might pose a risk.
However, genetic drift might also be playing a role. Lastly, this study
might help with the setup of sperm banks for the conservation of
endangered species from this genus (e.g., Alabama beach mouse, P.
polionotus ammobates).
P556
Ovarian tissue cryopreservation in the doe rabbit: from
freezing to birth
Neto, V*; Joly, T; Salvetti, P; Lefranc, AC; Corrao, N; Guérin, P; Buff, S
Université de Lyon, Unité Cryobio - ENVL/ISARA Lyon, Ecole Nationale
Vétérinaire de Lyon, 1 avenue Bourgelat, 69280 Marcy l’Etoile
Introduction Ovarian tissue cryopreservation aims to preserve
simultaneously thousands of immature (primordial to primary stage)
follicles of the ovarian stock. It may allow preservation of the
reproductive potential of women who are at risk of becoming sterile
and may also contribute to preserve the animal genetic resources. The
objectives of this study in the doe rabbit were to determine the
influence of different freezing parameters and to propose a slow
freezing process for the cryopreservation of the ovarian tissue.
Methods A fractional experimental design was used to discriminate
5 freezing parameters. The nature (DMSO vs. 1,2-PROH) and the
concentration (1.5M vs. 2M) of the cryoprotectant, the nonpenetrating
cryoprotectant (sucrose or trehalose), the equilibration process (1 vs.
3 steps) and the post-seeding freezing rate (0.3 vs. 2°C/min) were
evaluated. The morphological analysis of the preantral follicles was
performed before (control) and after freezing. The best combination
of freezing parameters was finally challenged by orthotopic autograft
and in vivo resumption of folliculogenesis. Cryopreserved ovarian
fragment was grafted to the controlateral ovarian pedicle of
16 females. Then, females were inseminated along 9 months.
Results The experimental design showed that 1,2-PROH (p=0.08) and
trehalose (p=0.07) tended to improve the morphology of preantral
follicles submitted to freezing. The freezing rate seemed to have the
greatest impact on the follicular morphology which was improved by
the use of a freezing rate of 0.3°C/min (p

16 t h International Congress on Animal Reproduction
212 Poster Abstracts
dehydrogenase (LDH)], spermatological and histological changes
were investigated at the end of the 3 weeks comparatively with
control group (n=6). It was observed there was a statistically
significance in serum ALT, AST and LDH levels (P

16 t h International Congress on Animal Reproduction
Poster Abstracts 213
P561
Precocious development of bulbourethral glands in male
pigs exposed to di(2ethylhexyl) phthalate before puberty
Ljungvall, K 1 , Veeramachaneni, KNR 2 , Magnusson, U 1 *
1Division of Reproduction, Dep Clinical Sciences, Swedish University of
Agricultural Sciences, Sweden; 2 Animal Reproduction and Biotechnology
Laboratory, Colorado State University, United States
Phthalates are common industrial chemicals used in large volumes in,
for instance, cosmetic products, in paints, and as plastic softeners.
Acute toxicity is generally considered to be low, but reproductive
effects have been reported in laboratory rodents. Typically these
effects have been seen after exposure during development, especially
during the foetal period. Data on effects in other, non-rodent,
mammals is scarce and so are those regarding accessory reproductive
glands. The objective of the current study was therefore to investigate
the effect of di(2-ethylhexyl) phthalate (DEHP) on the bulbourethral
glands in the pig. In this split-litter design experiment, male piglets
were exposed orally three times weekly to 300mg/kg of DEHP or
placebo between 3 and 7 weeks of age. The effects on the
bulbourethral glands were examined morphologically immediately
after the exposure at seven weeks of age in one sub-group, and
postpuberally at nine months of age in the other. Three of the seven
DEHP- treated animals in seven-week-old group had bulbourethral
glands at a stage of maturation far more advanced than that of
controls. While there were no obvious differences in the cellular
composition between the treatment groups in nine-month-old animals,
the bulbourethral glands were heavier (p

16 t h International Congress on Animal Reproduction
214 Poster Abstracts
and preoovulatory follicles number in the exposed group (p< 0.04)
were observed. Ambient air pollution seems to affect selectively the
ovarian follicles, decreasing the antral follicle number and not
affecting the pool of immature follicles (small and growing). These
results suggests that changes in follicle maturation could be one of the
mechanisms involved in reduced fertility in female mice exposed to
ambient levels of air pollution.
Poster 25 - Developments in Sustainable Animal
Production and Reproduction
P565
Reproductive efficiency of F1 Holstein x Zebu crossed
cows raised in pasture conditions of central part of Brazil
Ruas, JRM 1 *, Silva, MA 2 , Borges, AM 3 , Carvalho, BC 4 , Ferreira, IC 5 , Valente,
DB 5 , Menezes, GCC 5 , Matos, CRA 5
1Research Department, Minas Gerais Agricultural Research Corporation-
EPAMIG, Brazil; 2 Animal Science Department, Faculty of Veterinary
Medicine-UFMG, Brazil; 3 Veterinary Clinics and Surgery, Faculty of
Veterinary Medicine-UFMG, Brazil; 4 MG Agricultural Research Corporation-
EPAMIG, Brazil; 5 Faculty of Veterinary Medicine-UFMG, Brazil
During the last decade significant increase in milk production and
expressive reduction in reproductive efficiency of herds of specialized
cows in Brazil were observed. Intensive genetic selection for
maximizing milk production has resulted in metabolic and hormonal
modifications that negatively affected milk production. Today the
Brazilian’s great challenge of milk production systems is to search for
adapted genotypes that show high productive and reproductive
efficiency in pastures conditions, high profitability and preserve the
environment This research evaluated the reproductive efficiency of
243 F1 Holstein x Zebu crossed cows raised in pasture conditions of
the central part of Brazil in the Experimental Research Center of
EPAMIG (Minas Gerais Agricultural Research Corporation). The
cows during the summer season are maintained in pastures of
Brachiaria decumbens and Brachiaria brizantha and during the dry
season lactating cows are additionally fed corn silage and sugar cane.
Mechanic milking with cow’s calf presence and natural mating are
used in the herd. First mating average (24 months), cow average age
(33.6 months) and cow average weight at first calving (451.5kg) were
considered satisfactory since these cows were raised in pasture
conditions. Cow body weight increased up to fourth calving
suggesting these animals did not reach the adult body weight yet.
Milk production average of 2,773.1kg was very high in comparison to
national milk production average 1,350.0kg (Embrapa – CNPGL,
2006). Days open averages were, respectively, equals to 163.7, 96.0,
88.4 and 70.6 for first, second, third and fourth calving cows.
Productive efficiency can be evaluated by kilogram of milk / calving
interval ratio but days open that is a reproductive trait has an effective
effect on herd productive efficiency. The results suggest a great ability
of F1 Holstein x Zebu cows to adapt to pasture conditions and to show
high reproductive and productive efficiency in this production
systems. Factors related to animal behavior and to mechanic milking
adaptation should be considered in further studies.
Poster 26 - Trends in Research, Care and Teaching of
Reproduction
P566
Scanning Electron Microscopic (SEM) analyses of the
trophoblast of the term placenta of the Asian elephant
(Elephas maximus)
Loderstedt, S. 1 ; Hoffmann, A. 1 ; Eulenberger, K. 2 ; Flügger, J. 3 ; Seeger, J. 1
1Institute of Veterinary Anatomy, Department of Histology and Embryology,
Faculty of Veterinary Medicine, University of Leipzig, An den Tierkliniken 43,
04103 Leipzig; 2 Zoological Garden Leipzig GmbH, Pfaffendorfer Straße 29,
04105 Leipzig; 3 Zoo Hagenbeck Hamburg GmbH, Lokstedter Grenzstraße 2,
22509 Hamburg-Stellingen
Cognitions about structure and physiology of the Elephant placenta
are rare. The detailed characterization of the epithelial layer of the
chorion on different locations is poorly understood. Investigation with
ultrastructural procedures, scanning electron microscopic (SEM)
analyses are the first findings to investigate the morphological
features of the fetale membrane of the placenta in the Asian elephant
(Elephas maximus).
We used 3 term placentas (Zoological Garden Leipzig, Zoo
Hagenbeck Hamburg) and selected different sites of the placental
band and the extra placental Allantochorion.
The placental band has a sponge like surface, and consists of fetal
lamellae enclosing maternal blood vessels. The lamellae are covered
from the cytotrophoblast. The trophoblast cells show surface
modifications, like microvilli and mikroplicae. The fetal capillaries
are located directly underneath the cytotrophoblast and tend to invade
the epithelium. In some locations there are less than 2µm between
basallaminae of maternal and fetal intraepithelial capillaries. In none
of the investigated specimens the placental border has been reduced.
There is always a narrow trophoblastic cytoplasm band in between.
Microscopically the placental band can be divided in to two portions.
The apical, towards the uterus, and the basal, towards the fetus. The
apical layer is dispersed. Between the fetal, placental lamellae, blood
cells and amorphic material are located. The surface of the basal part
of the placental band is very dense. Fetal lamellae getting in direct
contact with maternal capillaries. Free blood cells, like in the apical
part can not be found. Maternal blood vessels are surrounded from
thickened basallaminae. There is a distinct difference between the
basallaminae of ematernal and fetal blood vesels. It must be proposed,
that the trophoblast cells are eroding the maternal basallaminae, and
the endothelial cells are producing even more collagenic material to
keep the laminae intact.
The chorionic surface is structured, and chorionic villi can be shown
entirely. The SEM analyses revealed a cobblestone-like architecture
of the epithelial cells, wich are covered with microvilli and
microplicae themselve. Surprisingly, the findings of intraepithelial
capillaries intend the trophoblast cells presume an nutrient exchange
also outside of the placental band with her gross functional
metabolism.
This study revealed some unknown and interesting features of the
epithelial layer of the chorion in the placenta of an Asian Elephant.
Perhaps, with a detailed knowledge of the morphology of the
epithelium we convey an better understanding of functional cohesions
of elephant placentation.
Acknowledgements
We are extremley gratful to Dr. M. Flügger of the Zoo Hagenbeck
Hamburg and also Prof. K. Eulenberger, Dr. J. Junhold and Mrs.
Bachmann of the Zoological Garden Leipzig for their continued
interest in this investigation and for their practical help in gathering
samples.

16 t h International Congress on Animal Reproduction
Poster Abstracts 215
P567
Effect of in utero metabolic programming on postnatal
metabolism of mink kits
Matthiesen, CF. 1 *; Blache, D. 2 ; Tauson, A-H. 1
1Faculty of Life Sciences, Department of Animal and Veterinary Basic
Sciences, University of Copenhagen, Denmark; 2 Faculty of Natural and
Agricultural Sciences, School of Animal Biology, University of Western
Australia
Introduction It is well recognised that in utero malnutrition may
cause long-term metabolic programming in the offspring, increasing
the risk of disease in later life. The outcome of in utero malnutrition
may depend on when it is imposed and whether this occurs during
certain sensitive time periods called “critical windows” in gestation.
These critical periods in development are periods of rapid cell
division in a developing tissue. Inadequate nutrient supply in each of
these critical periods may cause a different metabolic programming
response in the offspring. The objective of the present study was to
investigate how in utero nutrient supply affects growth and
metabolism of mink kits during the first two months of postnatal life.
Materials and methods Thirty two male mink kits were used, out of
which 16 (P) were exposed to in utero metabolic programming by
feeding their dams a low protein diet for three weeks in late gestation,
whereas the dams of the remaining 16 kits (C) had been adequately
fed during gestation. The kits were divided into two feeding groups,
each comprising 8 C and 8 P. One group was given an adequate level
of protein (A; 32% of metabolizeble energy (ME) from protein) and
the other was given an insufficiently low level of protein (L; 18% of
ME from protein) during three weeks, starting when the kits were 7
weeks old. All animals were fed ad libitum and feed intake was
recorded. Respiration and balance experiments were performed by
means of indirect calorimetry in an open-air circulation system.
Plasma samples were collected for analyses of insulin, IGF-1, cortisol,
GH, leptin, T3 and T4 by radioimmunoassays. The animals were
killed at the end of the experiment for collection of organ material to
perform Quantitative RT-PCR on fat and liver samples.
Results and Conclusions The body and liver weights of kits fed the
A diet postnatally were significantly higher (P

16 t h International Congress on Animal Reproduction
216 Poster Abstracts
Poster 28 – Other topics
P570
Opinions and regulations of breed registries in Europe on
stud book registration of cloned horses
Aurich, J 1 *, Knauss, L 2 , Aurich, C 2
1Animal Breeding and Reproduction, University of Veterinary Sciences,
Austria; 2 Graf Lehndorff Institute for Equine Science, Neustadt (Dosse),
Germany
Cloning of production farm animals so far is virtually irrelevant for
breeding programmes. In contrast, horses with high breeding value are
cloned with the goal to produce offspring and contribute to genetic
progress. Of special interest is the cloning of geldings successful in
equestrian sports in order to produce offspring from copies obtained
by somatic cell nuclear transfer. The use of cloning requires
acceptance of this biotechnology by the regulations of breed
registries, i.e. stud book registration of cloned horses and their
offspring. We have conducted a survey on the regulations of European
breed registries for cloned horses and the opinion of the persons
responsible for breeding programmes. A total of 34 questionaires
were returned from 8 countries. None of the breed registries have so
far registered cloned horses. Only two registries have specific
regulations for cloned horses while 29 have not (no answer: 3). With
current regulations, 5 breeds would register cloned horses (4 in
Germany, one in Austria) and 5 registries are planning changes in the
regulations. There are no regulations on validation of cloned status.
Registry managers considered cloning mainly a technique for
conservation of endangered horse breeds (82%) and less to obtain
clones from elite mares (44%), stallions (33%) or geldings (37%) or
to obtain copies from individual horses with high emotional value for
the owner (4%). Out of the persons asked, only few thought that
cloning will contribute to genetic progress (15%) but most expected
cloning to help maintaining genetic material in rare breeds (78%). Out
of the registry managers, one was of the opinion that performances
tests of the „parent“ should be valid for the clone, 30 expected clones
to undergo performance testing, 23 agreed that cloned horses should
be admitted to equestrian competitions. Ethical objections against
assisted reproductive technologies were raised in 15% and against
cloning in 35% of the questionaires, only 19% had objections against
cloning for animal welfare reasons. When asked on the opinion of
their members on cloning, 77% of breed managers expected a
rejection of cloning and 13% classified their members as slightly
positive, 52% answered that their members were sceptical but
interested in current developments on cloning. In conslusion, a board
acceptance of cloning by sport horse breed registries is unlikely.
There are no major ethical concerns but cloning is not expected to
contribute to genetic progress. This biotechnology appears to be more
justified for breeding programmes in rare breeds.
P571
The effect of addition of vitamin B12 in the extender on the
post-thaw motility, acrosome morphology and plasma
membrane integrity in the bull semen
Hu, JH 1 , Chen, YL 1 *, Li, QW 1,2 , Jia, YH 3 , Zhu, DN 3 , Wang, LQ 1
1College of Animal Science and Technology, Northwest A & F University,
Yangling, ShaanXi Province 712100, P.R. China; 2 College of Environment
and Chemistry Engineering, YanShan University,Qinhuangdao, HeBei
Province 066004, P.R. China; 3 Domestic Animal Improving Station in
ShaanXi Province, Jingyang, shaanXi 713702, P.R. China
*Corresponding author. Yu-Lin Chen. Present address: College of Animal
Science and Technology, Northwest A & F University, Yangling, ShaanXi
Province 712100, P.R. China, Tel.:+86 29 87092102; Fax.: +86 29
87092164; E-mail address: myxy11@263.net
in the extender, as compared to the control. The results indicated that
the motility and VSL, VCL, STR, VAP values of sperm supplemented
with 2.50 mg/ml vitamin B 12 were significantly higher than that of
other concentrations (p0.05). However, vitamin B 12
significantly decreased sperm motion characteristics and the
percentage of grade a spermatozoa at a concentration of 5.00 mg/ml in
extender. The percentages of acrosome-intact and plasma membraneintact
spermatozoa was significantly improved (p0.05). Therefore, the data were
pooled for both cycles and reported as a single data set. New follicle
wave emerged on Day 3-4. This follicle reached to 9.51± 0.47 mm in
diameter on Day 7 after GnRH treatment. Corpus luteum was detected
at the size of 14.86±0.58 (12-17.3) mm on Day 5 after induction of
ovulation. Corpus luteum continued to grow until Day 7 when it
reached to maximum size of 16.81±0.84 (12-21) mm. Progesterone
concentrations initiated to increase on Day 5 and reached to maximum
concentrations of 1.12±0.14 ng/ml on Day 7. In conclusion, steroid
treatment (2 mg estradiol benzoate + 100 mg progesterone), injected
on Day 2 after induction of ovulation, did not have any effect on
follicle development, CL formation and progesterone concentrations
in Bactrian camel.
Key words Bactrian camel; Steroids; GnRH; Follicle development;
Progesterone
To investigate the effects of supplementation of vitamin B 12 on bovine
sperm post-thaw motility and quality, it was added at concentrations
of 1.25, 2.50, 3.75 and 5.00 mg/ml to bovine semen cryoprotective
medium. Analysis of results showed that the motility and the primary
motion characteristics were improved in the presence of vitamin B 12

16 t h International Congress on Animal Reproduction
Poster Abstracts 217
P573
Sperm morphology of beef bulls evaluated by nigrosineosin
and differential interference phase contras
Freneau, G 1 *, Chenoweth, P 2 , Ellis, RW 3 , Rupp, G 4
1Lab. Andrologyand Semen Technology Animal Sc, Veterinary school /
Federal University of Goias, Brazil; 2 School of Agricultural and Veterinary
Sciences, Charles Sturt University, Wagga Wagga, NSW, Australia; 3 Dept. of
Clinical Sciences Integrated Livestock Ma, Colorado State University, United
States; 4 Great Plains Veterinary Educational Center, University of Nebraska,
United States
The objectives of this study were to compare two different methods of
evaluating bull sperm morphology: bright-field (BF) microscopy of
eosin-nigrosin (EN) stained dry-mount semen smears and differential
interference phase contrast (DIC) microscopy of wet-mount semen
‘fixed’ in isotonic formal saline; both at 1000X. Seventy-two
ejaculates were evaluated, representing both pre- and post-breeding
season ejaculates collected from 40 2-yr. old beef bulls via electroejaculation.
For both methods, 200 sperm were counted in random
fields with defects categorized as major (MAD) and minor (MID).
Sperm abnormalities were also placed into two other categories: those
considered to be most influenced by process (wet or dry; METHD)
and those whose depiction could be influenced by optics (BF or DIC;
OPTD). Differences (P0.05) in percent normal sperm 69.1 /
70.4 or sperm head defects 7.5 / 8.3. Acrosome, tail and droplet
defects were observed in 98.2 / 80.5, 86.1 / 100 and 98.2 / 94.4
percent of bulls for DIC and BF respectively (P

16 t h International Congress on Animal Reproduction
218 Poster Abstracts
southwest of China. Gayal has a calving behavior that the cows are
out of the herd lonely when calving. The special calving behavior has
not been covered so far. The objective of this study was, through the
investigation of calving behavior of to collect relevant information on
ethology, which, hopefully, would benefit in protecting the herds in
immigration and feeding management whenever making the most of
gayal scientifically. The study was carried out on the Mithun
conservation farm of Phenix mountain at Lushui county in Yunnan
province (98°59′--99°03′E, 25°58′--26°04′N, an altitude of 2700--
3200m)from June 1 st to 21 st , 2007, by observing three gayal cows
being about to delivery(two of multiparous, one of primiparous,
average age of 9.0±5.6) and one adult bull(age of 3.5 years old) under
free grazing on two hectare fenced improved pasture consisting of
Dactylis glomerata, Trifolium repense and free grazing on the sward
of native grasses with the same management. Average temperature
and relative humidity recorded during the experiment were
16.85±1.01 and 74.27±4.54%, respectively to an elevation of
2420m. Relative behavior was recorded with digital vidicon and
camera on Day 3 before the parturition, and monitored gayal cow with
full track at daylight and at every 2h interval for 30 min at night. The
results were shown that gayal behaved out a series of preparative
behavior before the delivery, namely calving behavior were expressed
as: 60% cows would leave the herd to look for food and proper
delivering place alone from 10 to 3 days before calving, preventing
milk sucking from the previous calves with more watchful walking
from 24 to 12hours before calving. Impatience and mounting behavior
(including mounting on gayal bull) of the cows were observed from 8
to 1 hour before calving. In a few hours before calving, Gayal cows
performed strongly the behavior of signory, rudely chasing the other
animals. Rather flat sward on the higher place with lower gradient
was naturally selected by cows as parturition site, where the tall grass
in 4~6m 2 was cleaned up by the cows to provide a convenient and
safe parturition area for calves. Calving was from 7 o’clock in the
morning to 6 o’clock in the afternoon, tending towards a sort of
daylight delivering system. Activity of calving took 63.33±101.16min
after chasing other animal and lying on the ground for calving,
25.00±5.00min. From calf born to placenta expelled, it took
11.74±10.89h. The number of getting up and lying down of cows
were 7.00±6.00 times during the delivery course. Average birthweight
was 17.83±1.04kg for male and female without any dystocia case.
Activity time of new calf: From birth to the first standing, it took
52.70±29.69min; from the first standing to the first milk sucking,
38.7±29.14min and from the first milk sucking to walking around,
61.33±1.53 min. The study indicated that calving performance of
gayal was orderly processed with hardly undystocia case, good
maternity, better ability of rearing calf, and the best capability of
reproduction and survival in the wild condition.
Keywords System of Semi-intensive management; Mithun(Bos
frontalis); calving behavior; investigation.
P577
Treatment of postpartum dairy cows ‘not-detected in
oestrus’ with gonadotrophin releasing hormone,
prostaglandin and progesterone
McDougall, S
Animal Health Centre, New Zealand
Oestradiol benzoate (ODB) has been extensively used in synchrony
programmes in dairy cattle to manage follicle wave emergence and
timing of oestrus. However, ODB has recently been banned by the
European Union and hence removed from other markets. Thus
alternate protocols to synchronise cows are required. The objective of
this study was to assess the efficacy of 3 treatments of dairy cows ‘not
detected in oestrus’ before the start of seasonal breeding programme
(PSM). The ovaries of 2222 cows not detected in oestrus by 9 days
before the PSM were examined using ultrasonography and randomly
assigned to be treated with: 1. Gonadotrophin releasing hormone
(GnRH), prostaglandin F2a and GnRH at 7 and 2-day intervals,
respectively; with fixed time artificial insemination 1 day after the
second GnRH treatment (‘GPG’ programme), 2. ‘GPG’ and insertion
of an intravaginal progesterone-releasing device between the first
GnRH injection and the PG, with fixed time artificial insemination 1
day after the second GnRH treatmen (GPG + P4) , 3. As for 2, but
with oestrus detection for 3 days after the PG treatment, and with the
second GnRH treatment occurring only where oestrus has not been
detected by 3 days after PG (GPG + P4 + heat), or 4. No treatment
(Control). Pregnancy status was assessed using ultrasonography at
35 days after the PSM. Data were analysed using logistic regression
models which included treatment group, age, herd, CL status
(presence or absence) and days from calving to the PSM. Estimated
marginal means (95% CI) were calculated and the multiple
comparisons among treatment groups accounted for by using the
Bonferroni adjustment. The conception rate to service within the first
7 days was higher in the treatment groups which included
progesterone than in the control or GPG groups (0.43 (0.36-0.50),
0.56 (0.49-0.63), 0.48 (0.41-0.55), 0.34 (0.23-0.44) for the GPG,
GPG+P4, GPG+P4+heat and Control groups, respectively; p = 0.48,
0.001, and 0.04 compared to the Control group). Additionally, the
pregnancy rate (i.e. total number of cows confirmed pregnant/total
number of cows treated) varied among groups (0.40 (0.34-0.47), 0.54
(0.47-0.60), 0.46 (0.40-0.54), 0.08 (0.05-0.11) for the GPG, GPG+P4,
GPG+P4+heat and Control groups, respectively. The control was
lower than all other groups (p

16 t h International Congress on Animal Reproduction
Poster Abstracts 219
incidence of subclinical hypocalcaemia varies between 5% and 10%
of all dairy cows, it could be a safe of money.
P579
Boar sperm quality after addition of pentoxifylline to
short-term extender
Yeste, M*; Briz, M; Pinart, E; Sancho, S; Bussalleu, E; Casas, I; Fàbrega, A;
Puigmulé, M; Garcia-Bonavila, E; Bonet, S
Biotechnology of Animal and Human Reproduction, Department of Biology,
University of Girona
Pentoxifylline has been used in humans to improve sperm motility in
low motility ejaculates and for inducing an early onset of sperm
capacitation. The aim of the present study was to assess sperm
viability, motility, morphology and capacitation after adding five
different concentrations of pentoxifylline (Ptx): 0.25, 0.5, 1, 2 and 4
mM to semen diluted in Beltsville thawing solution (BTS) over twoday
of storage at 15ºC. Semen samples were obtained from 21 healthy
Piétrain post-pubertal boars and sperm parameters were determined
before (control) and after applying the five treatments. Sperm viability
was assessed using a multiple fluorochrome staining procedure, sperm
motility and morphology by means of computer assisted sperm
analysis (CASA) and the capacitation status using chlortetracycline
(CTC) antibiotic staining. In each case, the various sperm parameters
outlined above were assessed after incubation at 37ºC for 15 min (day
0), or after 1 or 2 days of storing at 15 ºC. Data were transformed to
arcsin √x when necessary for accomplishing normality assumptions
and then analysed with a repeated measures ANOVA and post-hoc
Dunnet’s test. The level of significance was set at P

16 t h International Congress on Animal Reproduction
220 Author Index
AUTHOR INDEX
A
Aad, PY ............................................. 155
Aba, M ................................................. 93
Abaza, F .............................................. 28
Abbas, G ........................................... 166
Abd El-Razek, IM ........................ 28, 176
Abecia, JA ......................... 146, 152, 188
Abonyi-Toth, Zs ....................... 31, 41, 58
Abreu, C ............................................ 149
Acuña, S.................................. 77, 87, 97
Adams, GP ................................ 9, 11, 37
Adrien, ML ........................................... 28
Afsharnia, M ........................................ 60
Afzali, N ............................................... 79
Agudo, J ............................................ 203
Agüera, EI ........................................... 64
Agüera, S ............................................ 64
Aguilar, D............................................. 88
Aguilar, J ............................................. 74
Aguirre Maclennan, I ......................... 199
Ahmadi, MR......................................... 28
Aisen, E. .............................................. 70
Aiudi, G........................94, 140, 157, 196
Ak, K............................................ 35, 196
Akçay, E ............................................ 141
Akkhawattanangkul, Y....................... 178
Akpolat, N.......................................... 129
Aktas, A ............................................. 211
Alabart, JL ........................................... 76
Alaks, G............................................. 211
Alarcon, V.......................................... 126
Albarracin, D........................................ 51
Alberio, R............................. 88, 172, 204
Albrizio, M.............................. 91, 97, 140
Alexander, BD ..................................... 71
Alexopoulos, C .......................... 119, 121
Alfonso, J................................... 189, 198
Alhaider, A......................................... 178
Alhaider, AK ...................................... 125
Ali Al Ahmad, M........................... 75, 172
Allen, C.............................................. 132
Aller, J ......................................... 88, 172
Alm, H........................................ 178, 185
Alonso, JM......................................... 110
Alonso, MA .......................................... 98
Alpízar, E........................................... 166
Althouse, GC ....................................... 24
Alvarenga, MA.............98, 102, 107, 109
Alvares, CTG................................. 71, 90
Alvarez, M ...........82, 125, 173, 209, 210
Alvarez, RH ....................................... 184
Alves, B ............................................... 40
Alves, BRC .......................................... 33
Alzola, R .............................................. 97
Amaral, MG ....................................... 101
Amaral, TF........................................... 33
Ambrose, DJ.................................. 29, 35
Ambruosi, B............................... 127, 184
Ambuehl, F ........................................ 109
Amer, HA............................................. 28
Amirat-Briand, L ........................ 172, 174
Amorim, EAM .............................. 29, 124
Amorim, LS ................................. 29, 124
Amorim, RL ....................................... 115
Anciuti, MA ........................................ 139
Anderson, B ........................................ 19
Andersson, M .................................... 114
Andrade, AFC .................................... 183
Andrade, FSRM ................................ 161
Andrade, VJ .58, 63, 160, 163, 168, 169,
170, 176, 180, 183
Andries, S.................................. 189, 190
Anel, E............................... 173, 209, 210
Anel, L ................. 82, 125, 173, 209, 210
Angulo, J ....................................... 29, 54
Angulo, MC ....................................... 116
Annandale, CH.................................... 44
Antāne, V ............................................ 65
Anton, M...................................... 67, 172
Antosik, P .................................. 114, 119
Anzai, M .................................... 191, 194
Aparicio, IM ............................... 177, 217
Apaydin, SO ...................................... 130
Apichela, SA........................................ 96
Aralla, M ............................ 107, 156, 160
Arana, P .............................................. 99
Araneda, R .......................................... 38
Araneda, S ........................................ 159
Arashiro, EKN ..................................... 68
Araujo, GHM ................................. 73, 98
Araujo, RR..................................... 30, 40
Araya, R .............................................. 96
Argañaraz, ME .................................. 149
Arias-Álvarez, M................................ 135
Ariu, F........................................ 147, 186
Árnyasi, M ............................... 11, 74, 83
Arrighi, S ........................... 107, 156, 160
Arroyo, F ................................... 150, 206
Arruda, CV .......................................... 99
Arruda, RP ......................................... 183
Artegoitia, V......................................... 28
Asadi arghmaleki, M.......................... 144
Asher, G ........................................ 13, 14
Ashkar, FA .......................................... 30
Assumpção, MEOA........................... 208
Athayde, CS ...................................... 187
Atlagich, M ........................................ 159
Atzeni M ............................................ 218
Auguste, A......................................... 145
Aurich, C ............. 98, 105, 106, 109, 216
Aurich, J ............................................ 216
Avery, B............................................. 197
Ayad, H ............................................. 166
Ayala, W.............................................. 59
Aydin, H............................................. 211
Ayres, H ........................................ 30, 40
Azevedo, HC ............................... 70, 170
Azevedo, NA ..................................... 180
Azzeradj, M ....................................... 166
B
Bacinoglu, S .............................. 171, 196
Baeza, J ...................................... 70, 175
Båge, R ............................................... 56
Bah, MM........................................ 48, 64
Baillet, A ............................................ 145
Balbino, SC ......................................... 90
Baldini, L ........................................... 144
Ballarales, PP.................................... 171
Ballester, J ................................ 114, 203
Balogh, O ............................................ 31
Balogh, OG ................................... 31, 41
Banchio, A........................................... 57
Bao, XRG .......................................... 150
Baran, A .............................. 35, 125, 211
Baranski, W................................. 70, 143
Baranyi, M ........................................... 22
Barbosa, EM ....................................... 92
Baril, G ............................................ 8, 75
Barna, J..................................... 139, 140
Barnabe, RC ..................... 161, 168, 169
Barnabe, VH..... 147, 161, 167, 168, 169,
172, 173
Barón, FJ........................................... 177
Baroni, M............................................. 75
Barreto Filho, JB ....................... 154, 161
Barrière, JP ....................................... 174
Barros, CM .......................................... 31
Barros, MHC ....................................... 76
Barros, PMH...................... 161, 168, 169
Barroso, AT ....................................... 110
Bartha, T ............................................. 47
Bartlewski, PM .............................. 30, 71
Bartolomeu, CC............................. 71, 90
Baruselli, PS.................. 6, 173, 175, 181
Bas, F.................................................. 96
Basso, A............................................ 195
Bathgate, R ......................................... 67
Batista, RITP ....................................... 59
Batkowski, F...................................... 140
Batzias, GC ....................................... 192
Bebbere, D ................................ 147, 198
Bech-Sàbat, G............................. 32, 184
Becker, F........................................... 178
Beckers, JF ......................................... 81
Becker-Silva, SC ................................. 72
Beg, MA ...................................... 30, 103
Beheshti Govij, R .............................. 135
Behr, B ........................................ 21, 131
Beilby, K ............................................ 174
Beindorff, N ............................. 32, 44, 60
Belibasaki, S ............................. 192, 212
Bell, K................................................ 126
Beltrán, F........................................... 146
Ben Saïd, S ....................................... 142
Bencharif, D ...................................... 174
Bencharif, J ......................................... 67
Benezra, M.......................................... 52
Berg, D ................................................ 14
Berg, M........................................ 14, 117

16 t h International Congress on Animal Reproduction
Author Index 221
Berglavaz, A ......................................127
Bergman, JAAG.................................165
Bergmann, M .....................................163
Bergqvist, A-S....................................114
Berishak, B ..........................................63
Berlinguer, F ..............................147, 198
Bernardo, J ..................................82, 173
Berry DP Butler, S ...............................55
Bersano, JG.......................................187
Bertaccini, G ..............................122, 141
Bertan, CM ..........................................31
Bertoldo, M ........................................114
Bertolla, RP ...............................147, 172
Bertschinger, HJ ................................112
Betancourt, R.......................................37
Bethencourt, A...................................136
Bhojwani, S................................178, 185
Bhuwanee, A .......................................29
Bianchi, C ............................................93
Bickell, SL............................................10
Bicudo, SD.............................70, 77, 170
Bielli, A...................................9, 161, 166
Bieżyński, J........................................114
Bigliardi, E .........................122, 141, 157
Bijttebier, J.........................................185
Bilodeau-Goeseels, S........................166
Bindslev, MM .....................................110
Binelli, M ..............................................31
Binetti, F ..............................................94
Bini, PP................................................89
Biscarde, CEA .....................................52
Bittencourt, RF.................78, 85, 91, 144
Bizhi H ...............................................217
Björnsdóttir, S ......................................25
Blache, D ...............................10, 88, 215
Bleul, U ................................................26
Blitek, M.............................................118
Blomenrohr, M .....................................39
Blottner, S....................................15, 131
Bo, GA .......6, 52, 61, 174, 176, 180, 183
Bochenek, M......................................175
Bock, I................................................145
Bodin, L ...............................................76
Bodo, S..............................................138
Bodrogi, L ............................................22
Boe-Hansen, GB ...............................205
Bogacka, I..........................................118
Bogacki, M.................................118, 124
Bogh, IB.............................................197
Bøgh, IB.....................................110, 205
Bogliolo, L..................................147, 186
Boité, MC...................................151, 186
Boiti, C ...............................................154
Boixo, JC ...................................173, 209
Bojesen, AM ......................................110
Bollwein, H.........................18, 32, 44, 60
Bols, PEJ ...........167, 172, 189, 190, 213
Bonacic, C ...........................................96
Bonet, S.............................................219
Bongalhardo, DC ...............................139
Bonomini, Y ...................................52, 61
Bores, R...............................................70
Borg Alexandersen, C .......................121
Borges, AM..................................33, 214
Borges, JC...........................................32
Borges, MCB .................................76, 85
Borragan, S ...............................209, 210
Borregos de Patria Nueva, AC ............83
Boscos, C ....................................33, 121
Bosh, F ..............................................203
Boshoff, MP .......................................140
Bosi, GP ............................................107
Bosman, AM ........................................44
Bossaert, P ..........................................12
Bősze, Zs.....................................22, 204
Botha, AE ..........................................112
Bouwman, EG ...................................117
Bowers, G..........................................155
Boyle, LA .............................................54
Bozzo, G............................................196
Braga Reis, R.......................................66
Braga, DPAF .....................................132
Braga, RA ..........................................161
Bragado, MJ ......................................217
Brandan, A...........................................66
Brass, KE...........................................146
Bravo, W............................................126
Brecchia, G........................................154
Bresciani, C .......................122, 141, 157
Briand, L ..............................................67
Brittin, SB.......................................41, 63
Briz, M ...............................................219
Brozos, C.............................................33
Bruni, M ...............................................28
Bryant, BR ...........................................22
Brzezicka, E.......................................156
Bua, S................................................218
Bucak, MN .........................................171
Bucci, FA ...................................139, 140
Bücher, DD ........................................146
Buckley, F............................................68
Budik, S .......................................98, 106
Buff, S........................................209, 211
Bukowska, D..............................114, 119
Bürger, C ...........................................155
Burns, B...............................................53
Burridge, M ........................................132
Burucu, Y.............................................43
Bussalleu, E.......................................219
Bustamante-Filho, IC...........................99
Butler,S..................................................6
Byrne, N...............................................68
C
Cabau, C ...........................................145
Cabezas, M .........................................33
Cabot, RA ..............................................7
Cabrera, P .........................................136
Cagnini, DQ .......................................115
Caira, M .............................................127
Caixeta, L ............................................41
Caldini, EG ................................212, 213
Callejas, S ...........................37, 172, 183
Calvo, JH .............................................76
Camargo, LSA .......59, 68, 151, 163, 186
Camillo, F ..........................................157
Campos, BG ........................................66
Cané, L ..........................................84, 87
Cánovas, S........................................ 203
Cantalapiedra, J ................................ 165
Cao, SX ............................................. 153
Caraty, A ........................................... 142
Carbajo, M......................................... 210
Carballo, C .......................................... 28
Carcangiu, V................................ 89, 218
Cárdenas, J ......................................... 33
Cardoso, PBS....................161, 168, 173
Cardoso, RC...................................... 115
Carmo, AS......................................... 165
Carneiro, C .......................................... 65
Carneiro, GF..............................102, 162
Carnero, S ........................................... 94
Carnwath, JW...................................... 23
Carreira, J.................................... 34, 128
Carretero, I .......................................... 94
Carri, JA ............................................ 165
Carrick, F........................................... 132
Carrington, S .............................100, 148
Carrino, C ............................................ 91
Carriquiry, M..................28, 84, 146, 149
Carvalho, BC .........................33, 59, 214
Carvalho, CAB................................... 181
Carvalho, JA.................................. 71, 90
Carvalho, JBP ............................... 6, 181
Carvalho, MB..................................... 155
Carvalho, PHA................................... 161
Casado, S.......................................... 150
Casao, A....................................152, 188
Casaretto, C ........................................ 94
Casas, I ............................................. 219
Casavola, V ......................................... 90
Cassano, CR ..................................... 134
Castagneto, N ................................... 176
Castejón, FJ .................................. 64, 99
Castellana, E ....................................... 90
Castellucci, B....................................... 75
Castilho, EF................................... 76, 85
Castrillo, F ........................................... 99
Castro Meneses, G .............................. 66
Castro TS .......................................... 163
Castro, MA ................................116, 146
Casu, S.............................................. 193
Catenacci, LS .................................... 134
Catone, G ...................................... 75, 95
Catroxo, MHB.................................... 187
Catt, S ............................................... 199
Catunda, AP ...................................... 204
Cavestany, D.......................34, 127, 149
Cavilla, M............................................. 93
Cebrián-Pérez, JA ......................... 72, 84
Cebrian-Serrano, A ........................... 189
Cegla, M ............................................ 201
Celi, I ................................................... 89
Celik, Y ................................................ 43
Cernota. S ........................................... 56
Cervera, D ................................... 85, 175
Chaboche, S...................................... 104
Chacón, J ..................................162, 166
Chadwick, A ........................................ 10
Chagas e Silva, J ................................ 34
Chaiprasat, S..................................... 178
Chalar, C ........................................... 149
Chamani, M ....................................... 199

16 t h International Congress on Animal Reproduction
222 Author Index
Chamorro, C........................................ 82
Chantaraprateep, P............................. 48
Charoenyongyoo, P........................... 178
Chatdarong, K ..................... 16, 126, 199
Chavatte-Palmer, P............................. 26
Chebloune, Y....................................... 75
Chemineau, P.................................... 142
Chen, J .............................................. 206
Chen, MT............................................. 90
Chen, SL ........................................... 153
Chen, YL ........................................... 216
Chenoweth, P.............................. 24, 217
Chessa, F .......................................... 193
Chesta, PM.............................. 52, 61, 66
Childs, S .............................................. 50
Chiodi, S.............................................. 75
Choi, Y-J............................................ 197
Chowdhury, WH .................................. 72
Church, DB........................................ 128
Cianci, D.............................................. 90
Ciani, E................................................ 90
Cinar, M............................................... 43
Cirit, Ü ................................. 35, 171, 196
Cisale, HO ......................................... 115
Claramunt, M....................................... 28
Clarke, IJ ........................................... 142
Clément F.............................................. 8
Clerc, K.............................................. 158
Cob, L.................................................. 83
Cocero, MJ .......................................... 76
Coelho, LA......................................... 186
Cognié J ................................................ 8
Çolak, M .............................................. 35
Colás, C............................................... 72
Colazo, MG ................................... 29, 35
Colenbrander, B ...................... 21, 44, 86
Concha, II .................................. 116, 146
Conde, T.............................................. 99
Cong, PQ................................... 196, 201
Contreras, I.......................................... 81
Contreras-Solis, I................................. 73
Coppola, M ........................................ 209
Corazza, M ........................................ 159
Cordero, A ........................................... 94
Cordero, F ......................................... 158
Córdova, A .................................... 62, 73
Córdova, CA.................................. 62, 73
Córdova, MS ................................. 62, 73
Corfield, A.......................................... 148
Corrada, Y; ........................................ 127
Corrao, N................................... 209, 211
Correa, AB......................................... 176
Correa, GSS...................................... 176
Correa, JE ......................................... 146
Correa, SHR...................................... 132
Cortada, CNM ................................... 172
Cortés, S ............................................. 73
Cortes-Gutierrez, E ..................... 99, 206
Costa, E............................................... 37
Costa, L ......................................... 53, 65
Costa, S............................................... 59
Costantini, V ...................................... 139
Costello, LM ........................................ 36
Cotinot, C .......................................... 145
Couron, E .......................................... 132
Covaci, A........................................... 213
Cremonesi, F............................. 107, 115
Crepaldi, GA.................. 6, 173, 175, 181
Crespi, D ..................................... 34, 149
Crespilho, AC ...................................... 73
Crespilho, AM...................................... 36
Crespo, F ............................................ 99
Crisci, A............................................. 157
Critser, J............................................ 187
Crooker, BA ......................................... 84
Cruz, ACB ......................................... 134
Cruz, LA ............................................ 101
Cseh, S ......................................... 11, 74
Cuervo-Arango, J ...................... 100, 109
Cuestas, G .......................................... 66
Cuicas, R............................................. 48
Cummins, C .............................. 100, 148
Cunha, AP..................................... 20, 30
Curlewis, J......................................... 132
Cutaia, L.................................... 176, 183
Czeglédi, L .......................................... 83
D
D’Angelo,M........................................ 187
Dacheux JL ........................................... 8
Daglioglu, S....................................... 211
Dahl, E................................................. 81
Dai, Y..................................................... 7
Dalbiès-Tran, R ................................. 200
Dalin, AM................... 101, 108, 117, 122
Dall’Aglio, C....................................... 154
Damaceno-Rodrigues, NR ........ 212, 213
Damian-Matzumura, P ........................ 83
Danesh Mesgaran, M.......................... 47
Dankó G .............................................. 11
Das, ZC ............................................. 192
Dattena, M......................................... 193
Davis, GH............................................ 79
Davis, T ............................................. 152
De Clercq, JPB.................. 167, 189, 190
De Coen, W....................................... 213
de Kruif, A ......................................... 105
De la Fuente, J.................................. 210
De La Sota, RL...................... 36, 51, 208
De La Torre, J ............................. 99, 150
de Leon, J ......................................... 127
De Los Reyes, M....................... 127, 159
De Metrio, G.......................... 67, 93, 160
De Oliveira, RR ................................... 76
De Paula, M ................................. 85, 144
De Paz, P .................... 82, 125, 173, 210
De Sandro Salvati, A................. 140, 157
De Santis, T .............................. 127, 184
De Schauwer, C ................................ 105
De Vita, B .................................. 107, 109
De Vliegher, S ............................. 12, 105
Decaminada, E.................................. 209
Deflorio, M........................................... 93
del Olmo, E ....................................... 131
Del Rei, AJ .......................................... 90
Del Valle, I........................................... 84
Deleuze, S......................................... 111
Delgadillo, JA ...................................... 74
Dell’Aqua Jr., JA...... 36, 73, 98, 107, 109
Dell’Aquila, ME.................. 127, 184, 212
Delrei, AJ............................................. 71
Demir, K ............................ 125, 196, 211
Desantis, S............................ 67, 93, 160
Deschamps, JC................................. 139
Dessiris, EA....................................... 212
Detterer, J ......................................... 187
Dettori, ML................................... 89, 218
Devito, LG ......................................... 106
Dewit, M ............................................ 136
Dhaliwal, G........................................ 168
Di Ciommo F ..................................... 122
Di Giambattista, A ............................... 57
Di Ianni, F.......................... 122, 141, 157
Di Summa, A ....................................... 67
Dias, F................................................. 37
Dias, JC..................................... 160, 169
Diaz, T............. 37, 67, 73, 136, 158, 176
Dick, A................................................. 37
Dieleman, SJ....................................... 47
Dillon, P............................................... 68
Diniz, P................................................ 34
Dinn, N ................................................ 43
Dinnyes, A......................... 138, 187, 198
Dirtu, AC............................................ 213
Diskin, MG..................................... 36, 50
Dochi, O .............................................. 37
Dolhnikoff, M ..................................... 212
Domingo, R ....................................... 112
Dominguez, C ................... 38, 52, 59, 62
Domínguez-Rebolledo, AE ............... 131
Domokos, M ...................................... 153
Donadeu, FX ..................................... 101
Doornmalen, E .................................... 39
Doyle, LK........................................... 101
Drescher, K ....................... 38, 52, 59, 62
Dresser, BL ....................................... 142
Drews, B................................................ 8
Driancourt, MA ................ 39, 46, 48, 182
Drillich, M ............................................ 51
Druart, X................................................ 8
Dubiel, A............................................ 167
Dufek, A ............................................ 191
Duggan, V ................................. 100, 148
Dupont, J........................................... 200
Dvořánková, B..................................... 23
E
Ebersohn, K ........................................ 44
Ebrahimi, A.......................................... 39
Ecco, R.............................................. 159
Echegoyen, E...................................... 76
Egerszegi, I ....................... 116, 122, 179
Egyed, L ................................................ 5
Ehlers, JP............................................ 18
Ekici, H .............................................. 130
Ekstedt, E.................................... 74, 120
El-Amrawi, G.A.................................. 163
Elhordoy, D ....................................... 127
Ellenberger, C ......................... 25, 54, 61
Ellis, RW............................................ 217
EL-Saidy, BE..................................... 176

16 t h International Congress on Animal Reproduction
Author Index 223
El-Shamaa, IS ...................................176
Emanuelson, U ....................................50
Emerick, LL.58, 160, 168, 169, 170, 176,
183
Emmanuel, DGV..................................35
Erdem, H .......................................43, 74
Ereno, A.............................................195
Ereno, RL ............................................31
Erhardt, G ..........................................182
Erokhin, A ..........................................176
Escalona, F ........................................188
Escobedo Alcántara, JC ......................83
Escribano, BM ...............................64, 99
Eshlami, M.........................................216
Eslampour, MA ....................................79
Esmaili, T.....................................78, 143
Esper,CR .............................................32
Espinosa, M.......................................131
Eulenberger, K...................................214
Evans, ACO.........................................55
Evans, G..............67, 104, 114, 148, 174
F
Fàbrega, A.........................................219
Fage, R..............................................199
Faigl, V ..............................11, 47, 74, 83
Fan, J...................................................22
Fang, M .............................................205
Farhoodi, M .........................................47
Faria Junior, SP.................................175
Faria, MB ...........................................107
Farquhar PA ........................................79
Farshad, A ...........................................75
Farshidpour, MR................................199
Farstad, W .........................................133
Fatahnia, F ..........................................39
Fazeli, P...............................................75
Fébel, H ...........................31, 47, 48, 122
Feldmane, L.........................................65
Felício, GB...................................36, 109
Felipe, A ..............................................97
Felipe-Silva, AS .........................176, 180
Feltrin, C ............................................197
Ferencziné Szőke, Zs........................140
Feresin, F ..........................................183
Fernandes, C.......................................40
Fernandes, CB ....................91, 106, 193
Fernandez, A .........................62, 99, 136
Fernandez, D.......................................34
Fernandez, JL....................................206
Fernandez-Santos, MR .....................131
Ferrari, LDR.........................................75
Ferrari, MV...........................................75
Ferraz Júnior, MVC. ..........................154
Ferreira, AM.......................................163
Ferreira, BG.........................................99
Ferreira, CR.......................................195
Ferreira, IC ........................................214
Ferreira, JC..................................30, 103
Ferreira, JCP .......................................52
Ferreira, MBD ............................176, 183
Ferreira, RM ..................................30, 40
Ferreira-Dias G..................................103
Ferreiro, JM .......................................165
Fésüs, L...............................................31
Fiala, S ..............................................101
Fieni, F.........................................75, 172
Figueiredo, A .......................................40
Fila Varela, D.....................................127
Filannino, A........................................212
Fioratti, EG ................................102, 129
Fischman, ML ....................................115
Fitzpatrick, E......................................100
Fleury, P ..............................................98
Flint, APF.............................................13
Flores, E ....................................114, 116
Flores, JM......................................81, 86
Flügger, J...........................................214
Fois, S .......................................147, 186
Folch, J ................................................76
Földi, J .........................5, 46, 48, 58, 153
Folger, J...............................................55
Folhadella, I .........................63, 151, 163
Fondevila, J .........................................99
Fonseca, FA ......................................151
Forcada, F .........................146, 152, 188
Fossum, C .........................................117
Fouladi-Nashta, A ...............................188
Fournier, R...........................................39
Fraga, M ..............................................41
Fragua, JD.................................168, 169
Franceschini, PH .................................32
Freitas, CP...........................................98
Freneau, G ........................................217
Friedrich, M........................................182
Frijters, A ...........................................163
Fu, L ..................................................150
Fu, Q....................................................93
Fuentes, CPI........................................77
Fuentes, HV-O.....................................77
Fuentes, M...........................................49
Fujihara, CJ .........................................52
Fujihara, M.........................................217
Fukuda, A ..........................................194
Fukuda, K ..........................................202
Fumuso, E ...................................97, 189
G
Gaál, T.................................................47
Gabius, HJ...........................................23
Gabor, G............................31, 41, 47, 48
Gabriel Pereira, G..............................102
Gadea, J ............................................203
Gadella, BM.........................................86
Gaivão, M ......................................53, 65
Gajda, B.............................................116
Gajewski, Z........................................117
Galeati, G ..................................179, 182
Gálfi, P...............................................153
Gallardo Bolaños, JM ........................109
Gallego, E..........................................213
Galleguillos, M ...................................159
Galli, A ...............................................102
Gallo, J ..........................................29, 37
Galvão, A...........................................103
Galvão, KN ....................................41, 63
Gambarini, ML................................... 195
Gånheim, A ....................................... 101
Garcia, JM ......................................... 106
Garcia, LAD......................................... 36
García, P ........................................... 127
Garcia, RA........................................... 81
Garcia, T............................................ 137
García-Álvarez, O.............................. 210
Garcia-Bonavila, E ............................ 219
Garcia-Fernandez, RA ........................ 86
García-García, RM ............................ 135
Garcia-Herreros, M....................177, 217
García-Hurtado, J......................150, 206
Garcia-Ispierto, I.......................... 32, 189
Garcia-Macias, V......................... 82, 125
Garcia-Marin, LJ........................177, 217
Garcia-Mengual, E ....................189, 198
Garcia-Palencia, P ........................ 81, 86
Garcia-Rosello, E ......................189, 198
Garde, JJ...................................131, 210
Gardón, JC .................................... 64, 99
Garmo, RT........................................... 41
Garnil, C ........................................ 84, 87
Garnsworthy, PC ......................... 13, 188
Garófalo, E .................................... 77, 87
Gáspárdy, A ........................................ 48
Gastal, EL..............................9, 103, 108
Gastal, MO ................................103, 108
Gatica, MC .......................................... 89
Gatti JL .................................................. 8
Gauly, M ............................................ 182
Geng, LY ........................................... 205
Genovese, P..........................9, 161, 166
Georgiadis, M ...................................... 33
Gerami, A ..................................199, 216
Gerard, S............................................. 19
Gerrits, FA ......................................... 117
Gesteira Coelho, S............................... 66
Ghanbari, A ......................................... 95
Gharaghoozloo, F................................ 39
Ghasemzadeh, H ................................ 39
Ghavami, M ....................................... 138
Gheisari HR......................................... 28
Ghirardi, M......................................... 209
Gibb, Z............................................... 104
Giguère, S ......................................... 189
Gil, J ...................................................... 9
Gil, MC ......................................177, 217
Gilbert, RO ..........................5, 31, 41, 63
Giménez, F........................................ 208
Ginther, OJ ..........................30, 103, 108
Gioso, M .............................................. 40
Giraldo, CA.......................................... 54
Giraldo-Echeverri, CA ....................... 129
Giuliano, S........................................... 94
Glover, KMM ....................................... 88
Glowacz, M........................................ 124
Gobbetti, A ........................................ 154
Gobello, C ......................................... 127
Gócza, E............................................ 204
Godoy, N ........................................... 127
Goel, S .............................................. 217
Goericke-Pesch, S ............................ 163
Goeritz, F.......................21, 22, 131, 134
Gogol, P ............................................ 175

16 t h International Congress on Animal Reproduction
224 Author Index
Gomes Neto, OC............................... 162
Gomes, RG ....................................... 179
Gomes, RRR ....................................... 71
Gomes-Alves, S ........125, 173, 209, 210
Gómez, E .............................................. 8
Gómez, MC ....................................... 142
Gómez-Brunet, A............................... 142
Gonçalves, PEM.................................. 58
Gonçalves, RF................................... 147
Gonzalez Fernandez, L............. 109, 110
González, E......................................... 85
González, Y....................................... 136
Gonzalez-Bulnes, A...23, 73, 81, 86, 138
Gonzalez-Castro, F ........................... 158
González-Stagnaro, C......................... 42
Gooraninejad, S .................................. 42
Goossens, K........................................ 42
Goovaerts, IGF..........167, 189, 190, 213
Gordon, M ........................................... 43
Gorgundur, A....................................... 43
Göritz, F......................................... 8, 134
Gorski, K............................................ 144
Goryo, M............................................ 168
Gosalbez, A............................... 150, 206
Gosalvez, J.......................... 99, 150, 206
Goudet, G.......................................... 184
Goulas, P........................................... 192
Govaere, J......................................... 105
Govindasamy, K ................................ 164
Grado-Ahuir, JA................................. 155
Graham, J............................ 29, 124, 136
Grcak, D ............................................ 120
Greco, G ...................................... 85, 144
Green, RE ................................... 77, 170
Gregory, L ........................................... 77
Greying, JPC ....................................... 56
Groppetti, D ....................................... 156
Grupen, C..................104, 114, 174, 177
Guaricci, AC ..................60, 91, 127, 139
Guelfi, G ............................................ 154
Guérin, P ................................... 209, 211
Guerra MP........................................... 86
Guerra, JE ..................................... 62, 73
Guerra, L ............................................. 90
Guignot, F............................................ 78
Guillaume, D...................................... 104
Guimarães, JD .............................. 76, 85
Guimaraes, MABV............................. 132
Guimarães, MFM............................... 186
Guizzo, L ............................................. 92
Gumen, A ...................................... 20, 43
Gungor, O............................................ 57
Guoqing, SHI..................................... 148
Gupta, MK ......................... 164, 190, 192
Gurbulak, K ......................................... 57
Gustafsson, H................................ 50, 56
Guthrie, AJ ........................................ 112
Gutierrez, CG ..................................... 188
Gutiérrez-Adan, A.............................. 203
Guvenc, K.......................................... 104
Guzeloglu, A........................................ 43
Guzmán, JL ......................................... 89
Gvozdic, D......................................... 120
Győrffy, A ............................................ 47
H
Hackbart, KS ....................................... 40
Hailing, LUO...................................... 148
Hajurka, J ............................................ 43
Hallap, T............................................ 180
Hamali, H .......................................... 177
Hammadi, M.................................. 93, 94
Han, L................................................ 153
Hansen, PJ.......................................... 69
Hart, K ................................................. 88
Hashimoto, S............................. 190, 194
Hashizume, T .................................... 143
Hasler, JF...................................... 16, 18
Hassanpour, H .................................. 164
Hassel, P........................................... 204
Hatipoğlu, T....................................... 141
Hatler, TB ............................................ 20
Hauffe, C ............................................. 61
Hawken, P................................... 78, 143
Hazeleger, W .................................... 117
Heath, DA............................................ 88
Heaton, L........................................... 165
Hegedűšová, Z.................................. 191
Heilkenbrinker, T ......................... 54, 154
Heinemann, R ................................... 123
Hellström, A....................................... 101
Heneine, LGD ................................... 128
Henry, M.................................... 128, 165
Hera, A .............................................. 120
Herbert, U.......................................... 137
Hermes, R ................. 8, 21, 22, 131, 134
Hermo, G........................................... 127
Hernández, D .................................... 213
Hernández, H .................................... 159
Hernandez, R ...................................... 37
Herrmann, D................................ 23, 204
Herzog, K ............................................ 44
Hettel, C .............................................. 60
Heuwieser, WS ................................... 51
Hidalgo, CO............................... 181, 210
Hildebrandt, TB ......... 8, 21, 22, 131, 134
Hirabayashi, M .................................. 208
Hiripi, L ........................................ 22, 204
Hoedemaker, M........................... 54, 154
Hoffmann, A. ..................................... 214
Hoffmann, B ................................ 96, 163
Höhndorf, U....................................... 105
Holasek, R......................................... 191
Holland, BE ....................................... 111
Holm, L................................................ 74
Holroyd, R ........................................... 53
Holt, W....................................... 132, 178
Holtz, W....................................... 72, 182
Holyoake, PK .................................... 114
Honnens, A ................................... 32, 44
Hoogewijs, MK .................................. 105
Hoppe, S ........................................... 182
Hoppen, HO ...................................... 106
Horea, S ............................................ 120
Horváth, A ......................................... 119
Horváth, G......................................... 119
Hosoi, Y............................. 191, 202, 205
Hosseini Vashan, SJ ........................... 79
Hosseini, A .......................................... 28
Hou, R ............................................... 132
Hozbor, F ............................ 88, 172, 204
Hu, JH ......................... 69, 120, 216, 219
Hua, GH ............................................ 153
Huanca, T............................................ 94
Huanca, W .................................... 11, 94
Hulsey, LB......................................... 155
Húsvéth, F........................................... 47
Huszenicza, G.. 5, 11, 31, 46, 47, 48, 58,
74, 153
Hynes, AC ........................................... 36
I
Iacono, E ................................... 179, 193
Ibañez, W ............................................ 59
Ibrahim, MAER.................................. 176
Iglesias, A.......................................... 165
Iguer-Ouada, M................................. 166
Iguma, LT ............................................ 59
Ígyártó, B........................................... 153
Ijäs, R ................................................ 114
Ijiri, D ................................................. 208
İleri, İK ............................................... 196
Imai, H ............................... 149, 194, 217
Imaichi, H........................................... 149
Inayoshi, Y .......................................... 69
Indo, Y............................................... 205
Iorga, AI..................................... 127, 184
Ireland, JJ............................................ 55
İrez, T ................................................ 196
Iritani, A ............................. 191, 194, 202
Irons, PC ............................................. 44
Irwin, J............................................... 148
Ishii, M................................................. 44
Ishikawa, H........................................ 168
Isobe, E ............................................. 143
Iviciak, J .............................................. 56
Ivo, JC ............................................... 160
Iwamoto, D ........................................ 191
Iwamura, J........................................... 78
Izaike, Y ............................................ 168
Izquierdo, D....................................... 195
J
Jaakma, Ü ......................................... 180
Jabbour, H......................................... 133
Jackowska, M.................................... 119
Jagodziński, PP................................. 119
Jaiswal, RS ........................................... 9
Janowski, T ................................. 70, 143
Januskauskas, A............................... 180
Jaśkowski, JM........................... 114, 119
Jávor, A ................................. 11, 83, 179
Jawasreh, K ........................................ 80
Jelodar, G............................................ 79
Jemeljanovs, A.................................... 64
Jeremejeva, J...................................... 45
Jia, YH................................. 69, 216, 219
Jiang, F ............................................. 205
Jiang, ZL ........................................... 120
Jianlin, Han ......................................... 11
Jimenez, C ........................................ 166

16 t h International Congress on Animal Reproduction
Author Index 225
Jiménez-Diaz, MA ...............................96
Jimenez-Krassel, F..............................55
Jiwakanon, J......................................117
Jobim, MIM ..........................................99
Johannisson, A ..................................105
Johnson, D ................................152, 155
Johnston, SD ...............................99, 132
Joisel, F .............................................121
Joly, T ........................................209, 211
Jones, KL.....................................45, 106
Jongejans, TI .......................................92
Jonker, FH .........................................158
Jori, F.................................................132
Jorre De St Jorre, T .....................78, 143
José Pontes, H ..................................195
Jost, B..................................................65
Juengel, JL ..........................................79
Juhasz, J .......................................12, 95
Jurado, JJ ............................................76
Juyena, N ..........................................193
K
Kaandrop, S.........................................22
Kaart, T................................................51
Kaczmarek, MM.................................118
Kafi, M .................................................45
Kaiser, GG.........................................204
Kaixin, Q ............................................217
Kajimura, A ..........................................46
Kamimura, S........................................55
Kaminska, K ..............................118, 124
Kamolnorranath, S.............................199
Kaneko, E ............................................44
Kaneko, H..............................................7
Kang, H..............................................197
Kanitz, W ...................................178, 185
Karami, H...........................................215
Kareskoski, M ....................................105
Kareta, W...........................................175
Kaşgöz, H ..........................................171
Kasikci, G ..........................................130
Kask, K ................................................45
Kaske, M..............................................18
Kastelic, J ....................................66, 166
Kasuya,l E .........................................143
Kátai, L ..........................................46, 48
Kataoka, M ....................................35, 44
Katila, T .....................................105, 112
Kato, H.......................................191, 194
Kauerova, Z .......................................118
Kawashima, A....................................147
Kawashima, C .........................35, 44, 46
Kayar, A.............................................211
Keisler, D .............................................89
Kelly, J .................................................22
Kempisty, B ...............................114, 119
Kenny, DA ...........................................50
Kerestes, M .........................................47
Keresztes, M............................11, 74, 83
Keskin, A .............................................43
Khalid, M................................72, 80, 128
Khalifa, TAA.......................................212
Khalili, B...............................................75
Khillare,KP...........................................62
Khoramian, B.......................................79
Khorchani, T ........................................94
Khosravi, A ..........................................82
Kida, K ...........................................46, 53
Kießling, A ...........................................61
Kiewisz, J...........................................118
Kikuchi, A...........................................147
Kikuchi, K...............................................7
Kilic, K..................................................43
Kilicarslan, MR...................................104
Kim, ES......................................196, 201
Kimura, K ...........................................149
Kindahl, H ..........................................106
King, SS.............................................106
King, WA........................................30, 71
Kiossis, E.............................................33
Kishigami, S.......................................191
Kito, S ................................................149
Kliemk, H .............................................63
Klíma, J................................................23
Klimowicz, M......................................140
Klindworth, HP...................................154
Klipper, E ...........................................207
Klocek-Górka, B ............................80, 89
Knauss, L...........................................216
Kneubuehler, J ....................................18
Knieriem, A ..................................21, 131
Knijn, HM .......................................47, 86
Koblischke, P...............................98, 106
Kocer, A.............................................145
Koivisto, M ...................................34, 128
Kojima, T .............................................57
Kokoli, A ............................................207
Kolodziejek, J ......................................98
Koolabadi, G........................................47
Kooyman, DL.....................................159
Kopp, C..............................................114
Kornmatitsuk, B ...........................48, 178
Kornmatitsuk, S ...........................48, 178
Korsawe, K ........................................202
Korzekwa, A ..................48, 64, 103, 156
Kosenyuk, Y ......................................201
Kotsaki-Kovatsi, VP...........................212
Kovács, A ..........................................179
Kovács, K ............................................31
Kowalski, AA................................33, 188
Kraan, H ............................................113
Krawczynski, K ..................................118
Kridli, R ................................................80
Krzysztofowicz, E ..............................116
Kubica, J............................................191
Kues, WA.............................................23
Kulcsár, M...5, 11, 31, 46, 47, 48, 74, 83,
153
Kumar, S............................................164
Kumpula, B ..........................................29
Kumru, S............................................129
Kunavongkrit, A .................................124
Kunetkova, M.....................................118
Kunkitti, P ..........................................126
Kurz, J ...................................................8
Kurzynowski, A....................................48
Kutner, R ...........................................142
Kútvölgyi, G .......................................119
Kyriakis, SC...............................119, 121
L
Labat, E ............................................. 128
Lacalandra, GM..67, 90, 93, 94, 97, 108,
139, 157, 196, 212
Lacy, RC............................................ 211
Lagaly, DV......................................... 155
Lamb, G................................................. 6
Lamont, AL .......................................... 29
Lamothe, C.................................... 48, 55
Landim-Alvarenga, FC ..77, 91, 106, 193
Lange Consiglio, A ....................107, 115
Langer, D............................................. 47
Langlois, ML ...................................... 174
Langner, K........................................... 60
Laricchiuta, P..................................... 196
Larrat, M ............................................ 174
Larsson, B ........................................... 48
Laurenssen, BFA............................... 117
Lavon, Y ............................................ 207
Lavrentiadou, S ................................. 207
Lazcano-Reyes, JF ........................... 137
Leahy, T ............................................ 148
Leal, LS ......................................... 78, 91
Leblic, D ............................................ 176
Leboeuf, B ........................................... 75
Ledda, S ....................................147, 186
Ledur, MC.......................................... 139
Lee, HT..............................164, 190, 192
Lee, K .................................................... 7
Leethongdee, S ................................... 80
Lefranc, AC ...............................209, 211
Leibo, SP............................................. 15
Leitão, S ........................................ 53, 65
Leite, J................................................. 34
Leite, R ......................................159, 207
Leite, TG..............................58, 170, 183
Leitner, G........................................... 207
Lemme, E .......................................... 204
Lennon, E .......................................... 155
Lenz, M................................................ 61
Leoci, R ............................................. 157
Leoni, G.....................................147, 198
Leroy, J................................................ 12
Leroy, JLMR ......................189, 190, 213
Leso, B ................................................ 56
Letelier, C ...................................... 81, 86
Leveau, M.......................................... 104
Leyton, L.............................................. 34
Li, C ..................................................... 14
Li, J ........................................................ 7
Li, N ............................................... 7, 150
Li, Q ....................................................... 7
Li, QW .................................69, 120, 216
Li, ZH ................................................. 201
Lianeri, M...................................114, 119
Liang, AX........................................... 153
Liang, XW............................................ 90
Liberda, J........................................... 118
Liebermann, J...................................... 15
Lilli, L ................................................. 154
Lima, F ................................................ 49

16 t h International Congress on Animal Reproduction
226 Author Index
Lima, V .............................................. 128
Lindeberg, H........................................ 81
Lins, GJV............................................. 77
Lins, GPV ............................................ 77
Lipke, C ............................................. 141
Liu, IKM ............................................. 102
Liu, J.................................................. 187
Ljungvall, K........................................ 213
Lobato, Z ........................................... 159
Locatelli, Y........................................... 14
Loderstedt, S ..................................... 214
Löf, E ................................................... 50
Lomet, D............................................ 142
Lonergan, P......................................... 55
Lopes da Costa, L ............................... 34
Lopes, MD ................................. 129, 193
López, C ........................................ 77, 87
Lopez, H .............................................. 20
Lopez, P ............................................ 176
Lopez-Bejar, M .................................. 132
Lopez-Béjar, M .................................. 189
Lopez-Fernandez, C............ 99, 150, 206
López-Gatius, F................... 32, 184, 189
López-Mazz, C..................................... 84
López-Ortega, A .................................. 49
Lopez-Sebastian, A..................... 73, 142
Lorenzo, PL ............................... 102, 135
Lorenzoni, SLG ................................. 107
Losurdo, M .......................................... 67
Lozano, H .......................................... 166
Lozano, P ............................................ 66
Lu, KH ........................................... 90, 93
Lu, SS............................................ 90, 93
Lu, YQ ........................................... 90, 93
Lucacin, E............................................ 50
Lucas-Hahn, A................................... 204
Luchetti, E ......................................... 159
Lucidi, CA .......................................... 158
Lúcio, CF ........................................... 160
Lukasik, K............................................ 64
Łukaszewicz, E.................................. 167
Lundeheim, N ...................................... 56
Lundie-Jenkins, G ............................. 132
Luther, I ............................................... 44
Luvoni, GC .......................................... 16
Lymberopoulos, AG........................... 212
Lynch, CO ........................................... 50
Lyons, LA .......................................... 142
M
Maccheroni, M................................... 159
Machado, T ....................................... 143
Machaty, Z............................................. 7
Macias Garcia, B ............................... 110
Mackintosh, C...................................... 14
Maclellan, LJ ....................................... 22
Madeddu, M ...................................... 198
Madej, A .............................. 74, 120, 121
Madej, M............................................ 120
Madoz, L.............................................. 51
Madsen, MT .............................. 120, 121
Maedomari, N........................................ 7
Maes, D ............................. 151, 185, 200
Maggio, V .......................................... 115
Magnani, L ............................................ 7
Magnasco, M....................................... 36
Magnasco, RP..................................... 36
Magnusson, U ................................... 213
Magyar, K............................................ 83
Mahdi, D .............................................. 81
Mahecha, L ......................................... 29
Mahmoud, K...................................... 192
Maia Borges, A .................................... 66
Maia, L......................................... 85, 144
Maia, MS ..................................... 70, 170
Maia, VN ........................................... 162
Maio, JRG ......................................... 181
Maischberger, E ................................ 148
Maksudov, G ..................................... 133
Malard, P ........................................... 197
Malcotti, V ........................................... 70
Mällo, GK ............................................ 51
Malo, AF............................................ 211
Malpaux, B .................................. 74, 142
Mamali, P .......................................... 192
Mamo, S ............................................ 145
Manca, R............................................. 60
Mancuso, R ......................................... 95
Mandon-Pepin, B .............................. 145
Manee-In, S....................................... 199
Manes, J............................................ 172
Manfredi, E.......................................... 75
Manteca, FX...................................... 132
Mantiziba, CW............................. 56, 140
Mapeka, MH................................ 56, 140
Mapletoft, RJ ................................. 37, 52
Mara, L .............................................. 193
Maranesi, M ...................................... 154
Marchi, B ............................................. 89
Mari, G............................................... 179
Marko, O ............................................. 12
Marley, W .......................................... 136
Marmorini, P...................................... 159
Maroto-Morales, A............................. 210
Marques Filho, WC ............................. 52
Marques, MO .................................... 175
MáRquez, A ........................................ 49
MáRquez, Y ........................................ 49
Marti, JI.............................................. 148
Martin, G ......................... 19, 78, 88, 143
Martin, I ....................................... 52, 129
Martín, T.............................................. 99
Martin-Caballero, J............................ 137
Martínez Sarrasague, M...................... 94
Martinez, AC ..................................... 184
Martínez, M ....................................... 136
Martinez, N........................ 38, 52, 59, 62
Martinez-Pastor, F..................... 210, 211
Martínez-Pastor, F ............................ 210
Martínez-Royo, A ................................ 76
Martins Jr, A ................................ 73, 186
Martins, JAM ....... 58, 160, 168, 170, 183
Martins, LF .................................... 76, 85
Martins, LR.......................... 91, 106, 193
Martins, M ......................................... 128
Martins, MIM ..................................... 179
Márton , A............................................ 47
Masia, F ............................................ 193
Masironi, B .......................................... 93
Mata, M ............................................. 209
Mata-Campuzano, M .......... 82, 125, 173
Matana Saturnino, H ............................ 66
Matarrese, R ....................... 94, 108, 184
Mateus, L .............................. 53, 65, 103
Mateusen, B ...................................... 185
Matos, CRA....................................... 214
Matsuda, M ....................................... 147
Matsui, M..................... 35, 44, 46, 53, 55
Matsumoto, K .................... 191, 202, 205
Matsunaga, N...................................... 35
Matthiesen, CF.................................. 215
Mattiauda, D........................................ 28
Mattos, RC ............ 25, 99, 101, 103, 108
Maxwell, C......................................... 104
Maxwell, WMC .................... 67, 148, 174
Mayberry, C....................................... 133
Mayes, J.............................................. 53
Mayor, JC.......................................... 180
Mayor, P............................................ 132
Mayorga, I ......................................... 193
Maziero, RRD...................................... 52
McCorkell, R........................................ 91
McDougall, S..................................... 218
McGowan, M ................................... 6, 53
McMillan, W......................................... 14
McNatty, KP ........................................ 88
Medeiros, ASL....................... 36, 98, 109
Medeiros, LRD .................................. 162
Medeiros, MG.................................... 155
Medina, M ..................................... 84, 87
Medina, V ............................................ 70
Medrano, A........................................ 137
Medrano, J .......................................... 83
Mee, JF ............................................... 54
Meidan, R.......................................... 207
Meikle, A ......... 28, 34, 93, 146, 149, 152
Meinecke, B ...................................... 141
Meinecke-Tillmann, S ............... 141, 187
Meira, C............................................... 52
Mejia, M............................................... 51
Melo, CM........... 102, 107, 109, 113, 129
Mendoza, N......................................... 84
Menezes, GCC............................ 33, 214
Meng, QG.......................................... 187
Menichelli, M ....................................... 57
Merbach, S.................................. 54, 154
Mercado, J......................................... 188
Merlo, B..................................... 179, 193
Mermillod, P ...................................... 200
Mesa, C......................................... 29, 54
Messripour, M ................................... 144
Metwally, AASM ................................ 176
Meyer E............................................. 185
Meyer, W........................................... 141
Meyerk, HHD....................................... 63
Meyers, M ........................................... 29
Miceli, DC.................................... 96, 149
Micera, E ..................................... 97, 140
Micke, G .............................................. 58
Mikaeili, E.......................................... 215
Milanovic, V....................................... 120
Milazzotto, MP................................... 208
Milenkovic, M .................................... 120

16 t h International Congress on Animal Reproduction
Author Index 227
Millar, R .......................................21, 133
Milton, JTB...........................................88
Minami, N...........................149, 194, 217
Minervini, F ........................................212
Mingoti, G ....................................34, 186
Minoia, G .............................60, 108, 206
Minoia, R ...............................90, 91, 196
Minto, BW ..........................................193
Miragaya, M.........................................94
Miralles, M .........................................209
Miranda, PV.......................................115
Mircea. C ...............................................9
Mirmahmoodi, R ..................................82
Mirshokraei, P......................................82
Mirzaei, A.............................................45
Misztal, T .....................................89, 144
Mitani, T.....................................191, 194
Miyake, YI......................................53, 55
Miyamoto, A.......................35, 44, 46, 53
Miyamoto, K.......................................194
Miyata, Y....................................190, 194
Mlodawska, W ...................................195
Moallem, U ........................................207
Modaresi, M.......................................144
Moeini, MM ........................................215
Moestl, E......................................21, 109
Mogas, T....................................114, 195
Moghadamnia, D ...............................137
Moghaddam, A ....................................82
Moghiseh, A.................................95, 216
Mohamadi roshandeh, A ...................135
Mohammadi, HR..................................79
Mokhtari, M........................................137
Molejón, MI ........................................115
Molik, E........................................89, 144
Molina, M ...........................................136
Molnár, M...........................................119
Momtaz, F..........................................199
Monaci, M ............................................57
Monniaux, D ........................................81
Montazer-Torbati, F ...........................145
Monteiro, C ........................................115
Montejo, M...........................................99
Montiel, F.......................................48, 55
Montiel, JL .........................................137
Morato, R...................................114, 195
Moreira, MB .......................................154
Moreira, N..........................................123
Moreira, R............................................59
Morello, H ............................................70
Moreno, H............................................77
Morgades, D ......................................127
Moriki, K.............................................194
Morimoto, A .......................................208
Morimoto, Y ...............................190, 194
Morini, G ....................................122, 157
Morita, M............................................194
Moriyama, C ........................................55
Morrell, JM.................................108, 184
Morris, DG ...........................................36
Morris, L.............................................104
Mortara, RA .......................................147
Morvayova, H ......................................56
Mosafery, S .......................................177
Mossa, F..............................................55
Mostafaee, M.....................................216
Mostafaei, A.......................................215
Mota, VR............................................110
Motheo, TF ........................................155
Motlík, J ...............................................23
Moura, A ..............................................53
Moussa, M .........................................172
Moya, CF .....................................91, 158
Mphaphathi, ML...........................56, 140
Mucci, N.............................................204
Mugnier, S .........................................184
Muhammad, MD ................................205
Muiño, R ....................................173, 181
Muiño-Blanco, T ............................72, 84
Mulhall, S...........................................132
Mullen, S............................................187
Muñoz, M...............................................8
Muñoz-Gutiérrez, M.............................83
Munyai, PH ..................................56, 140
Mura, MC.............................................89
Murata, N...........................................205
Murawski, M ........................................89
Murta, JEJ .........................................180
Mutinati, M .....................60, 67, 108, 206
Mutto, A .............................................204
N
Nagai, T .................................................7
Nagao, JF ..........................................179
Nagashima, S ................................35, 46
Nagy, GM ..........................................143
Nagy, P..........................................12, 95
Nagy, S................................................74
Nagy, Sz ....................................116, 122
Naitana, S..........................................198
Nakai, M ................................................7
Nakao, A............................................191
Nakao, T ..............................................69
Narenhua, N ......................................150
Nauwynck, H .....................................151
Navarrete, L...........................83, 85, 175
Navarro, G .........................................127
Navarro, L..........................................166
Nazarena, T.......................................183
Nedambale, TL ............................56, 140
Nehring, H .........................................178
Neogrády, Zs .....................................153
Neto, GSR .........................................154
Neto, V.......................................209, 211
Nett, T................................................152
Neuhauser, S.....................................109
Neves, AC ...........................................86
Neves, AP............................99, 103, 108
Neves, MM ........................................128
Newcombe, JR ..........................100, 109
Newton, L ............................................66
Niasari-Naslaji, A .........................95, 216
Nicassio, M ............94, 97, 108, 157, 212
Nichi, M......161, 167, 168, 169, 172, 173
Nicolas, M..........................125, 209, 210
Nielsen, JM........................................110
Niemann, H..........................23, 202, 204
Niemeyer, C .......................................160
Nikjou, D...................................... 95, 216
Nikolaidis, E....................................... 207
Nishiwaki, M ..............................191, 194
Nishiyama, Y ..................................... 194
Nitovski, A ......................................... 120
Niu, JT ................................................. 93
Niżański, W ....................................... 167
Noguchi, A........................................... 44
Noguchi, J ............................................. 7
Noguchi, M ........................................ 201
Nogueira, LAG.............63, 168, 180, 186
Noorian, E ......................................... 215
Nordéus, K .......................................... 56
Norrby, M...................................120, 121
Nouri, M............................................. 199
Novotni Dankó, G ................................ 83
Novotny, F ........................................... 56
Nowak, R............................................. 10
Nowotny, N.......................................... 98
Numchaisrika, P ................................ 199
Nunes, PM......................................... 139
Núñez, ME......................................... 161
Nürnberg, G....................................... 178
O
Oba, E ...40, 52, 73, 78, 85, 91, 115, 144
Ochiai, Y.............................................. 57
Oddsdottir, C ....................................... 25
Oei, C .................................................. 86
Öhagen, P ......................................... 101
Oherd, P .............................................. 51
Ohta, Y............................................... 149
Okamura, N ....................................... 147
Oki, AC ................................................ 19
Okolski, A .......................................... 195
Oláh, J ............................................... 179
Oláh, M.............................................. 143
Oliveira Filho, BD .............................. 195
Oliveira, CA ...............................123, 132
Oliveira, E............................................ 40
Oliveira, EB ....................................... 139
Oliveira, TM ....................................... 115
Olivera-Angel, M....................29, 54, 129
Ollero, M.............................................. 72
Olmos, G ............................................. 54
Onodera, Y ........................................ 143
Opsomer, G......................................... 12
Ordoñez, C ........................................ 126
Orkun Demiral, O ................................ 57
Oropeza, M........................................ 204
Orro, T ................................................. 45
Ortega Ferrusola, C...................109, 110
Ortega Ferrusola, E........................... 109
Ortiz, F ............................................... 175
Osawa, T ........................................... 168
Oshima, K............................................ 57
Osman, B .......................................... 147
Osorio, JP.......................................... 165
Ozawa, M ...................................... 7, 208
Ozdas, OB.................................125, 196
Özgümüş, S....................................... 171
Öztürk, ÖA........................................... 35

16 t h International Congress on Animal Reproduction
228 Author Index
P
Pabuccuoglu, S ................. 171, 196, 211
Paci, V ............................................... 159
Padrik, P............................................ 180
Paganoni, B......................................... 88
Pailhoux, E ........................................ 145
Palacín, I ................................... 152, 188
Palacio, LG........................................ 129
Palasz, A ........................................... 175
Palasz, AT ......................................... 210
Palazzi, EG........................................ 187
Pallares, P ................................... 23, 138
Palm, F ........................................ 98, 109
Palmer, CW ......................................... 68
Palmer, MA.......................................... 54
Palomino, J........................................ 127
Pampani, FE........................................ 78
Panarace, M .................................. 84, 87
Panasopolkul, S ................................ 198
Pancarci, SM ....................................... 57
Pang, CY ............................................. 90
Pangestu, M ...................................... 199
Pannetier, M ...................................... 145
Panzani, D......................................... 157
Paolucci, M.......................................... 57
Papa, FO 36, 73, 98, 102, 107, 109, 113,
129
Papaioannou, DS. ............................. 121
Papaioannou, N................................. 119
Papatsiros, VG .......................... 119, 121
Papillier, P ......................................... 200
Paraizo, RM......................................... 85
Paramio, MT...................................... 195
Pardhi.SM............................................ 62
Parillo, F .............................................. 95
Paris, D................................................ 20
Paris, M ....................................... 21, 133
Park, CS .................................... 196, 201
Park, SK ............................................ 197
Parmigiani, E ..................... 122, 141, 157
Parra, VM ............................................ 77
Parraguez, VH................................... 159
Partyka, A.......................................... 167
Pascal, O........................................... 174
Patel, D.............................................. 199
Patrício, FAC ....................................... 58
Pattharanukulkit, K ............................ 178
Patton, J .............................................. 68
Pau, S................................................ 186
Paula-Lopes, FF................................ 208
Pavão, DL.......................................... 187
Pavão, G ....................................... 78, 91
Pavone, L .......................................... 196
Pawliński, B ....................................... 117
Payan-Carreira, RM .................. 110, 111
Paz, R................................................ 207
Pazzola, M................................... 89, 218
Pécsi, A ................................... 5, 58, 153
Peelman, LJ ........................................ 42
Pegoraro, LM..................................... 102
Peixer, M ........................................... 197
Pelufo, V.............................................. 70
Peña, AI..................................... 173, 181
Pena, FJ ........................17, 24, 109, 110
Peng, N ............................................. 156
Penno, Y ............................................. 32
Pepin, M .............................................. 75
Pereira, JCC...................................... 180
Pereira, ML........................................ 155
Pereira, MM......................................... 59
Pereira, O.......................................... 127
Perera, R........................................... 151
Perez, EGA ............... 161, 168, 169, 173
Pérez, M............................................ 213
Perez, R .................................. 38, 52, 62
Pérez-Clariget, R ................................. 84
Pérez-Garnelo, SS ............................ 210
Pérez-Guzman, MD .......................... 210
Pérez-Pé, R................................... 72, 84
Perkins, N............................................ 58
Perozo, D ............................................ 38
Perozo, E .......................................... 136
Perreau, C......................................... 200
Perri, S ........................................ 34, 128
Perry, V ............................................... 58
Persson, EM.............................. 117, 122
Peruca Baldini, L.................................. 85
Petersen, B ................................. 23, 204
Petersen, KM .................................... 197
Petersen, MM.................................... 110
Petralia, P............................................ 75
Petro, EML ........................................ 213
Petrucci, BPL ...................... 99, 103, 108
Philips, S ........................................... 199
Phillips, N .............................................. 6
Phillips, T........................................... 168
Piagentini, M ............................... 31, 158
Picabea, N..................................... 9, 161
Piccinato, C ......................................... 20
Piccolomini, MM ................................ 187
Piehl, LL ............................................ 115
Pienkawa, M........................................ 64
Pierce, K.............................................. 68
Pierson, RA ..................................... 9, 87
Pilmane, M .......................................... 64
Pimentel, CA ..................................... 101
Piña, R................................................. 85
Pinart, E ............................................ 219
Ping, ZHOU....................................... 148
Pinheiro, VG........................................ 31
Pinho, JPD ........................................ 175
Pinho, RO...................................... 76, 85
Pinho, T............................................. 169
Pinto, CRF................................. 111, 165
Pinto, L ................................................ 62
Pinto-Santini, L........................ 38, 52, 59
Pires, RML ........................................ 184
Pizzutto, CS ...................................... 132
Ploentzke, J......................................... 51
Poehland, R ...................................... 185
Poindron, P ......................................... 10
Polgar, Z............................................ 138
Polgar, Zs.......................................... 145
Polisseni, J .................................. 59, 151
Pombo, C .......................................... 161
Ponglowhapan, S .............................. 128
Ponthier, J ......................................... 111
Poo, T ................................................ 175
Pope, CE........................................... 142
Portas, TJ............................................ 22
Posivak, J............................................ 56
Poumerol, E ...................................... 145
Pradhan, R .......................................... 57
Prestes, NC....................................... 158
Pretheeben, T ................................... 151
Pribenszky, Cs .......................... 119, 145
Procópio, OCS .................................. 162
Proctor, LE .......................................... 79
Ptaszinska, M...................................... 39
Pugliesi, G........................................... 33
Puigmulé, M ...................................... 219
Q
Qin, WS............................................... 93
Quaresma, M ............................ 110, 111
Queiroz, LM....................................... 197
Queisser, AL ..................................... 204
Quintal, J ............................... 70, 85, 175
Quintans, G ......................................... 59
Quintao Lana, AM........................ 66, 170
R
Rabelo, GF........................................ 161
Raddatz, S .......................................... 60
Radovic, B......................................... 120
Raggi, LA .......................................... 159
Raito, MB .................................... 56, 140
Rajamahendran, R............................ 151
Rajão, D .................................... 159, 207
Ramio, L............................................ 114
Ramió-Lluch, L .................................. 150
Ramírez, A ........................................ 116
Ramírez, S ........................................ 159
Ramón, J......................... 70, 83, 85, 175
Ramos, A .......................................... 126
Ramos, M...................................... 52, 61
Randel, R .................................. 152, 155
Raney, A ................................... 152, 155
Ras, M................................................. 70
Rascado, TS ..................................... 106
Rastegarnia, A .................................... 60
Rath, D .......................... 21, 44, 123, 131
Rátky, J ..................................... 116, 122
Ratto, M......................................... 11, 94
Rauch, MC ........................................ 116
Rausa, F............................................ 139
Rawlings, NC ...................................... 87
Razavi, K..................................... 95, 216
Razijalali, M......................................... 42
Razmi, N ............................................. 79
Reames, PS ........................................ 20
Rebollar, PG...................................... 135
Ree, T ................................................. 35
Refsdal, AO......................................... 65
Regueiro, M ......................................... 84
Reiczigel, J.......................................... 11
Reid, C ...................................... 100, 148
Reijneveld, NJ ..................................... 92
Reilas, T ...................................... 25, 112
Reine, E ............................................ 112
Reis, JDC ............................................ 86

16 t h International Congress on Animal Reproduction
Author Index 229
Reis, SR ............................................180
Reiser, J ............................................142
Reksen, O......................................41, 51
Ren, ZL................................................93
Renault, L ..........................................145
Repolês, SLC ....................................154
Retana-Márquez, MS ..........................83
Reuss, W ...........................................187
Révay, T ............................................179
Revuelta, L ........................................135
Reyes, Y ............................................136
Ribeiro Junior, M ...............................175
Ribeiro, A...........................................159
Ribeiro, HFL ........................................92
Ricci, A ................................................41
Ricks, DM ..........................................142
Ridderstråle, Y.....................................74
Rigau, T .............................................173
Rijsselaere, T...............................17, 167
Riley, SC..............................................25
Rincón, OM........................................169
Risco, C ...............................................49
Risvanli, A..........................................129
Rivera Del Alamo, M..........................112
Rivera, MM ........................................173
Riveros, J.............................................96
Rivulgo, M............................................97
Rivulgo, V ..........................................189
Rizzato, G..........................................179
Rizzo, A ...............................60, 108, 206
Rizzo, H ...............................................77
Rodello, L ............................................70
Rodenbusch, S ....................................61
Rodrigues, B......................................197
Rodrigues, JA.....................................160
Rodrigues, JL ............................107, 197
Rodrigues, L ..................................32, 34
Rodrigues, MP...........161, 168, 169, 173
Rodrigues, RF ...................................101
Rodríguez Aguilar, S .........................183
Rodríguez, A..........................8, 188, 210
Rodriguez, E......................................189
Rodriguez-Gil, JE .....114, 116, 150, 173,
203
Rodriguez-Martinez, H......105, 108, 109,
110, 184
Rodríguez-Martinez, H ......................181
Rodríguez-Sallaberry, C .....................188
Roe, WD ............................................126
Roelen, BAJ.........................................86
Roellig, K ...........................................134
Roelofs, J.............................................19
Rogan, D .........................52, 61, 97, 189
Roh, S................................................197
Rojas, J................................................62
Roldán Olarte, EM ...............................96
Rolim Filho, TS ....................................92
Röllig, K .................................................8
Romagnoli, S .......................................92
Romanowicz, K............................89, 144
Romek, M ..........................................116
Ropstad, E...............................41, 51, 81
Rosati, I .............................................186
Roscino, MT ......................................206
Roser, J .....................................106, 113
Rossi, RODS .............................154, 161
Rossini, M......................................38, 59
Rota, A.......................................157, 159
Roy, R........................................150, 206
Roy, TJ ..............................................213
Ruas, JRM...................................33, 214
Rubin de Celis, E.................................94
Ruiz, A ...............................38, 52, 59, 62
Ruiz, CG ..............................................62
Ruiz, ZT .................................29, 54, 129
Rungarunlert, S .................................198
Rungsiwiwut, R..........................198, 199
Rupp, G .............................................217
Russo, P ..............................................75
Rutz, F ...............................................139
Rynska, B ..........................................201
S
Sá Filho, MF ..........................................6
Sá, WF.........................59, 151, 163, 186
Saarela, S............................................81
Saavedra, MJ ....................................110
Saberi, Z ..............................................79
Sabino, D.............................................92
Sabuncu, A ........................................125
Sadjadian, R ........................................47
Saeki, K .............................191, 202, 205
Saey, V ..............................................105
Sahatpure,SK ......................................62
Sahin, E .............................................211
Sahlin, L...............................................93
Sakaguchi, M.......................................62
Sakamoto, N......................................208
Salamanca, E ....................168, 169, 170
Salazar, E ............................................34
Salazar-Ortiz, J..................................104
Saldiva, PHN .............................212, 213
Salehi, S ............................................138
Sales, JNS.....................6, 173, 175, 181
Salla Cardoso, PB .............................169
Salmon, F ............................................29
Salvador, D........................................170
Salvador, DF................................63, 163
Salvador, I .................................189, 198
Salvador, RRS.....................................63
Salvetti, P ..........................................211
Samartzi, F ........................................192
Sanches, B ........................................195
Sánchez Bruni S................................189
Sanchez, A ..........................................34
Sanchez, B ....................................81, 86
Sanchez, E ..................................88, 204
Sánchez, H ........................................159
Sánchez, L.........................................165
Sanchez, MA .................................81, 86
Sancho, S ..........................................219
Sandor, CS ..........................................31
Sangsritavong, S .................................20
Sanguinetti, C ....................................149
Santa-Catalina, MO...........................217
Santana, G ........................................197
Santiago, R........................................159
Santiago-Moreno, J ...........................142
Santolaria, P................................ 32, 184
Santoro, MM........................................ 63
Santos Filho, A .................................... 86
Santos, AJ ......................................... 177
Santos, BFS ........................................ 77
Santos, F ........................................... 195
Santos, NR .......................................... 63
Santos, RR .......................................... 86
Saragusty, J ...................................... 134
Saraiva, NS ....................................... 106
Saratsis, F ......................................... 192
Saravia, F ..................................181, 184
Saribaym MK....................................... 74
Sarlós, P............................116, 122, 179
Sarramone, C ...................................... 37
Sartore, I............................................ 152
Sartori, R ............................................. 20
Sasaki, J............................................ 168
Sasser, RG.......................................... 41
Sassone, FA........................................ 91
Satake, N...................................125, 178
Sato, S............................................... 168
Satoh, E............................................. 147
Satrapa, RA......................................... 31
Satta, V.............................................. 198
Satué, K............................................. 112
Sauri, I ................................................. 85
Sauveroche, B..................................... 18
Savela, H............................................. 81
Savignone, CA .................................. 208
Sawada, K ........................................... 46
Sawai, E ............................................ 143
Sawalha, M.......................................... 80
Scanlan, V ......................................... 143
Scaramelli, A ..................................... 158
Scaramuzzi, RJ .......................72, 80, 83
Scarcelli, E .......................................... 77
Scarsi, A .............................................. 59
Schamsk, D ......................................... 63
Schmidt, M ................................197, 205
Schmidt, T ......................................... 187
Schmitt, DL........................................ 134
Schmitz, W ........................................ 182
Schnorrenberg, A ................................ 21
Schoen, J ............................................ 15
Schoevers,E ........................................ 12
Schoon, D............................................ 54
Schoon, HA .....................25, 54, 61, 154
Schuberth, HJ.............................. 60, 123
Schuh, A............................................ 209
Schuler, G ........................................... 96
Schulman, ML ................................... 112
Schult, J....................................... 54, 154
Schwalbach, LM .................................. 56
Schwarzenberger, F .................... 21, 133
Schweigert, FJ..................................... 46
Sciorsci, RL .........................60, 108, 206
Scoccia, I............................................. 95
Scoriza, JN ................................212, 213
Sechman, A......................................... 80
Sedik, MM ..................................... 93, 94
Seeger, J. .......................................... 214
Seekallu, SV........................................ 87
Selstam, G........................................... 74
Sematovica, I....................................... 64

16 t h International Congress on Animal Reproduction
230 Author Index
Senger, PL .......................................... 19
Senunver, A....................................... 104
Serafin, N .......................................... 159
Serapião, RV ....................... 59, 151, 186
Seren, E .................................... 179, 182
Serrano, B ........................................... 32
Severino, V.......................................... 55
Seyfert, HM ....................................... 123
Sgorbini, M ................................ 157, 159
Shaohua, Y........................................ 217
Shariati, M ......................................... 138
Sharifi, S............................................ 137
Sharma, B ......................................... 164
Sheldon, IM ........................................... 5
Shen, Z.............................................. 153
Shida, R............................................. 143
Shimada A........................................... 53
Shimizu, T ........................................... 35
Shishova, NV..................................... 133
Sicherle, CC .......................... 70, 77, 170
Sieg, B......................................... 21, 131
Siemieniuch, M.................... 64, 130, 156
Sierra, A ........................................ 83, 85
Silva Filho, NM .................................... 90
Silva, AEF.......................................... 107
Silva, DS............................................ 107
Silva, E .................................. 53, 65, 103
Silva, LCG.......................................... 160
Silva, MA ........................... 160, 176, 214
Silva, MR ............................................. 32
Silva, PAR ......................................... 170
Silva, RCP ......................................... 175
Silva, SGB ........................................... 33
Silva, SV............................................ 162
Silva, TF ............................................ 154
Silvano, JO .......................................... 63
Silvestre, MA ............................. 189, 198
Silvia, WJ............................................. 20
Sinclair, KD......................................... 188
Singh, J ..................................... 9, 30, 37
Singh, R............................................. 151
Siqueira Filho, E .................................. 36
Siqueira, LGB ................................ 30, 68
Siriaroonrat, B ................................... 199
Sirivaidyapong, S ................................ 92
Skarzynski, DJ.......48, 64, 103, 130, 156
Skidmore, JA ................................. 12, 97
Skuja, S ............................................... 65
Slezakova, M..................................... 191
Smetana, K Jr...................................... 23
Smith, GD.......................................... 178
Smith, J ............................................... 55
Smorag, Z.................................. 116, 175
Snoeck, PPN ..................................... 134
Sobiraj, A....................................... 54, 61
Söderquist, L ....................................... 56
Soede, N ............................. 19, 117, 123
Soleimani rad, J................................. 135
Soler, AJ.................................... 131, 210
Soler, F.............................................. 213
Soler, TBS ......................................... 172
Somfai, T ............................................... 7
Song, ES ................................... 196, 201
Sontas, BH ........................................ 130
Sosa, C.............................. 146, 152, 188
Sostaric, E......................................... 113
Soto, R .............................................. 159
Souri, M............................................... 82
Sousa, DB ........................................... 70
Souza, AH ........................................... 20
Souza, FA ........................... 58, 160, 168
Souza, MIL .......................................... 78
Spang, A ........................................... 163
Spedicato, M ....................... 60, 108, 206
Sper, R ................................................ 41
Spessatto, DD ................................... 123
Spicer, LJ .......................................... 155
Spinaci, M ................................. 179, 182
Spizziri, B ............................................ 29
Srisuwatanasagul, K ......................... 122
Srisuwatanasagul, S ................. 122, 126
Stelletta, C........................................... 92
Stornelli, MA...................................... 208
Stornelli, MC...................................... 208
Stout, TAE................................... 12, 113
Stradaioli, G ...................................... 170
Su Young, H...................................... 164
Suarez, G ...................................... 84, 87
Succu, S.................................... 147, 198
Suddaby, P.......................................... 29
Sudo, N ............................................... 44
Sugawara, M ..................................... 168
Sullivan, T ........................................... 58
Sunde, J .............................................. 65
Sung, J .............................................. 197
Suphankong, S.................................. 198
Surdo, N .............................................. 97
Suzette, F.......................................... 140
Suzuki, C........................................... 201
Suzuki, I ............................................ 205
Sveberg, G .......................................... 51
Svecova, D........................................ 118
Swangchan-Uthai, T............................ 92
Sylla, L................................................. 57
Synnestvedt, B .................................. 205
Szabó, J ................................................ 5
Szczęsna, M.................................. 80, 89
Szenci, O....................................... 47, 74
T
Taborda, N ........................................ 129
Tai, C................................................. 113
Tainturier, D ........................ 67, 172, 174
Taitzoglou, I....................................... 207
Tajik, P ........................................ 82, 135
Takada, L .......................................... 186
Takahira, RK ..................................... 158
Takashima, M.................................... 147
Takayama, S ..................................... 178
Takehara, T....................................... 202
Takenoshita, M.................................. 202
Talebi, J............................................... 82
Talmac, M ........................................... 43
Tamanini, C............................... 179, 182
Tamargo, C ............................... 181, 210
Tamayo, J ......................................... 125
Taniguchi, S ...................................... 191
Tantasuparuk, W............................... 124
Tapia, B......................................... 62, 73
Tapia, JA ................................... 109, 110
Taponen, J ........................................ 114
Taş, M ............................................... 171
Tasende, C.............................. 77, 87, 97
Tassielli, V......................................... 170
Tatemizo, A ....................................... 205
Tauson, A-H ...................................... 215
Taverne, MAM................................... 158
Taylor, U............................................ 123
Tayyebi, D ......................................... 138
Techakumphu, M .............. 124, 198, 199
Tek, Ç................................................ 125
Tekeli, T .............................................. 74
Temple-Smith, P ............................... 199
Teramura, T ...................................... 202
Terletski, S .......................................... 29
Terrazas, A........................................ 159
Tharasanit, T ....................................... 92
Tharasinit, T ...................................... 198
Thatcher, M ......................................... 49
Thatcher, WW ............................... 49, 57
Thélie, A ............................................ 200
Theodosiadou, E ....................... 192, 212
Thibier, M ............................................ 17
Thomas, DG...................................... 126
Thomas, R......................................... 133
Thompson, AN .................................... 88
Thomsen, PD .................................... 215
Thomson, PC .................................... 114
Thongphakdee, A...................... 198, 199
Thundathil, J................................ 66, 166
Thys, M ............................................. 151
Tipold, A .............................................. 18
Tirado, MA......................................... 158
Tirocchi, F ......................................... 193
Tittarelli, C ......................................... 208
Tol, EV .............................................. 123
Tomaszewska-Zaremba, D............... 144
Toniollo, GH ...................................... 155
Toosi, BM ............................................ 87
Torner, H ........................................... 185
Torres Artunduaga, MA........................ 66
Torres, CAA .............. 29, 68, 76, 85, 124
Toth, F................................................. 41
Tóth, P....................................... 116, 122
Towhidi, A ......................................... 199
Toydemir, TSF .................................. 130
Traverso, JM ..................................... 200
Trejo-González, A ............................... 83
Trevisan, MS ....................................... 19
Tribulo, HE .................................. 66, 180
Trigg, TE ........................................... 132
Trinca, LA.......................................... 129
Trinque, C ......................................... 109
Trisolini, C ........................................... 60
Truhe, M............................................ 142
Tsantarliotou, M ................................ 207
Tsukamoto, S..................................... 149
Tsukiyama, T..................................... 194
Tucker, LA......................................... 126
Tummaruk, P..................................... 124
Turi, E.................................................. 31
Tusell, L............................................. 182

16 t h International Congress on Animal Reproduction
Author Index 231
U
Uchima, T ..................................152, 155
Ugalde, R...........................................204
Ugarte, CE.........................................126
Ugaz, C..............................................135
Uhm, SJ.............................164, 190, 192
Uijttewaal, MJ ......................................47
Ukar, IA..............................................137
Underwood, SL....................................67
Urquieta, B...................................96, 159
Ushitani, A .........................................208
Uysal, O.............................................171
Uzbekova, S ......................................200
V
Vacca, GM...................................89, 218
Vahtiala, S ...........................................81
Vainas, E ...........................................192
Valdecantos, PA ................................149
Vale Filho, VR.......58, 63, 160, 163, 168,
169, 170, 176, 180, 183
Vale, WG .............................................92
Valencakova, A....................................56
Valente, DB .......................................214
Valentini, L.........................................127
Valiente, C .........................................127
Valocky, I .............................................56
Valz Gianinet, JN.................................96
Van de Weerdt, M-L ..........................111
van den Hurk, R.............................47, 86
van der Hoorn, F..................................66
Van Dijk, J ...................................26, 158
Van Lier, E...........................................88
Van Loon, TPAM ...............................158
Van Soom, A 17, 42, 151, 167, 185, 190,
200
Van Wilpe, E........................................44
Van Zeveren, A....................................42
Vandaele, L .......................................200
VanDyke, R .......................................113
Vanni, R.............................................102
Vannucchi, CI.....................................160
Vantini, R .............................................32
Váradi, É............................................140
Varga, E.............................................138
Varışlı, Ö............................................171
Vasconcelos, GSC ..............................85
Vasquez, B ..........................................73
Vásquez, L...........................................67
Vass, N ..............................................179
Vater, A..............................................183
Vázquez, MI...............................152, 188
Vecchi, I.....................................122, 157
Veeramachaneni, KNR......................213
Végi, B .......................................139, 140
Veiga, GAL.........................................160
Veksler Hess, J..................................209
Velazquez, MA ..................................202
Venter, EH ...........................................44
Ventriglia, G...........................67, 93, 160
Venturino, A.........................................70
Vera, T.................................................88
Vera-Munoz, O ....................................67
Veras, MM .................................212, 213
Verellen, M ..........................................37
Verstegen, JP ....................................168
Veznik, Z............................................118
Viana, CHC........................161, 168, 169
Viana, J................................................40
Viana, JHM ....................59, 68, 151, 186
Vicario, E .............................................99
Vicente, WRR ....................................155
Videla Dorna, I...................176, 183, 208
Vilanova, LT.......................................171
Vilela, C ...............................................65
Villaverde, AISB.........................102, 129
Villumsen, MH ...................................110
Vinoles, C ........................................9, 88
Visconti, A..........................................212
Visintin, JA.........................................208
Vivas, I...............................................136
Vojgani, M............................................39
Voorwald, FA .....................................155
Vos, PLAM.....................................47, 86
Voskamp-Harkema W .........................19
Voss, C ................................................44
W
Wade, J .............................................189
Wakayama, T ....................................191
Waldmann, A .................................41, 51
Wallgren, M ...............................181, 184
Walsh, S ..............................................68
Walter, I .............................................106
Wang, C.................................................7
Wang, LQ ....................................69, 216
Wang, N.............................................156
Wang, QL ..........................................153
Wang, X.............................................199
Wani, NA .............................................97
Warnick, AC.........................................69
Wasielak, M ...............................118, 124
Watson, ED .........................................25
Watson, PF................................125, 178
Webb, R.......................................13, 188
Weems, C..................................152, 155
Weems, Y ..................................152, 155
Wen, QY ....................................153, 205
Wenzhang, M ....................................217
Wheeler-Jones, C................................72
Wie, H....................................................7
Wieczorek, J ......................................201
Wilde, R .............................................166
Williams, J ...........................................19
Wiltbank, MC ...........................20, 30, 40
Witschi, U ............................................18
Witte, T ..............................................106
Woclawek-Potocka, I.............48, 64, 156
Wohlres-Viana, S...............................186
Wolf, C...............................................146
Wolfenson, D .....................................207
Wolfsdorf, K .......................................113
Wolgast, T .........................................187
Wong, B...............................................66
X
Xavier, M ........................................... 197
Xin, CAO ........................................... 148
Xing, X................................................... 7
Xiping, Y ............................................ 217
Xu, D ................................................. 156
Xue, L ................................................ 156
Y
Yagi, K................................................. 53
Yamada, M ................................194, 217
Yamagishi, N ..................................... 168
Yamamoto, N ...................................... 57
Yamanaka, M .................................... 190
Yang, H ............................................. 120
Yang, LG ...................................153, 205
Yang, S.................................................. 8
Yániz, JL...................................... 32, 184
Yavari, M ............................................. 28
Yavaş, İ ............................................. 171
Yehua, S............................................ 217
Yeste, M ............................................ 219
Yi, YJ .........................................196, 201
Yılmazbas, G....................................... 43
Yokotani-Tomita, K............................ 208
Yoshida, C........................................... 69
Yoshioka, K ....................................... 201
Youzhang, ZHAO .............................. 148
Yuan, A.............................................. 156
Yukio, K ............................................. 208
Z
Zaaijer, D............................................. 47
Zabielski, R........................................ 117
Zahedi Abdi, A................................... 131
Zahn, FS................................36, 73, 113
Zajicova, A......................................... 118
Zambelli, D ........................................ 193
Zamiri, MJ............................................ 39
Zamparini, M ..................................... 170
Zampini, MC ...................................... 115
Zan, LS........................................ 69, 219
Zanh, FS............................................ 107
Zarabanda, YP .................................. 107
Zarazaga, LA....................................... 89
Zargarzadeh, M ................................. 177
Zarrilli, A .............................................. 97
Zdunczyk, S................................. 70, 143
Zedda, MT ......................................... 186
Zent, W.............................................. 113
Zerani , M .......................................... 154
Zerbe, H ............................................ 123
Zervos, I ............................................ 207
Zhang, K................................................ 7
Zhang, M ....................................... 90, 93
Zhang, XF............................................ 90
Zhang, Y................................................ 7
Zhang, YH ......................................... 201
Zhang, ZR ......................................... 153
Zhanxing, H ....................................... 217
Zhao, HW .......................................... 120

16 t h International Congress on Animal Reproduction
232 Author Index
Zhao, J .............................................. 202
Zhao, XL............................................ 219
Zhen, YH ........................................... 153
Zhirkov , I........................................... 219
Zhou, MH........................................... 202
Zhu, DN ............................... 69, 216, 219
Zięba, DA ...................................... 80, 89
Ziecik, AJ................................... 117, 118
Ziliang, L............................................ 217
Zivkovic, B......................................... 120
Zizza, S ................................. 67, 93, 160
Zsolnai, A ............................................ 31
Zugak, K............................................ 127
Zuge, RM .......................................... 172