Rezumatul tezei de doctorat - USAMV Cluj-Napoca

genes are separated by two internal transcribed spacers (ITS1 and ITS2), and two rDNA
units separated by intergenic spacer (IGS). The last rRNA gene (5S) can or can’t be in the
interior of repeated unit (Kamoun, 2003).
Fig.2. Diagram of nuclear ribosomal DNA repeat unit
(Frisvad and al., 1998)
With the exception of some variable domains of the rRNA genes, the coding regions
are highly conserved among organisms, thus allowing comparisons between distantly related
fungi. In contrast, because they evolve rapidly, noncoding regions have more variability than
coding regions. The noncoding internal transcribed spacers (ITS1 and ITS2) can be used to
discriminate between closely related species within a fungal genus. The ITS region,
including the ITS1, the 5,8S rRNA gene, and the ITS2, is about 600 to 1000 base pairs and
can be amplified either fully or partly, using “universal” primers described by White and al.,
in 1990.
The ITS region is now perhaps the most widely sequenced DNA region in fungi. It
has typically been most useful for molecular systematics at the species level, and even
within species (e.g., to identify geographic races). Because of its higher degree of variation
than other genic regions of rDNA (SSU and LSU), variation among individual rDNA repeats
can sometimes be observed within both the ITS and IGS regions. In addition to the standard
primers used by most labs (ITS1 and ITS4), everal taxon-specific primers have been
described that allow selective amplification of fungal ITS sequences.
The primers used in PCR reaction were the following (standardized by White and al.,
1990):
- ITS1, with 5’-3’ sequence: TCCGTAGGTGAACCTGCGG;
- ITS4, with 5’-3’ sequence: TCCTCCGCTTATTGATATGC;
- ITS5, with 5’-3’ sequence: GGAAGTAAAAGTCGTAACAAGG;
54