Rezumatul tezei de doctorat - USAMV Cluj-Napoca

UNIVERSITATEA DE ŞTIINłE AGRICOLE
ŞI MEDICINĂ VETERINARĂ CLUJ-NAPOCA
ŞCOALA DOCTORALĂ
FACULTATEA DE ZOOTEHNIE ŞI BIOTEHNOLOGII
Med.Vet. Oroian Rareş Gelu
Genotipizarea speciilor de Saprolegnia şi
determinarea patogenităŃii acestora asupra
diferitelor specii de ciprinide în crescătorii din
centrul şi nord-vestul României
-REZUMAT AL TEZEI DE DOCTORAT-
CONDUCĂTOR ŞTIINłIFIC
Prof.univ.dr.ing. AUGUSTIN VLAIC
Cluj-Napoca
2010
1

CUPRINS
INTRODUCERE.................................................................................................................................. 4
CAPITOLUL I ..................................................................................................................................... 4
IPOTEZA EXPERIMENTALĂ, OBIECTIVELE CERCETĂRII, DISPOZITIVUL
EXPERIMENTAL, MATERIAL ŞI METODĂ DE LUCRU............................................................. 4
I.1. IPOTEZA EXPERIMENTALĂ ŞI OBIECTIVELE CERCETĂRII ........................................ 4
I.2. DISPOZITIVUL EXPERIMENTAL......................................................................................... 6
I.3. MATERIAL ŞI METODĂ DE LUCRU ................................................................................... 7
I.3.1. Prelevarea probelor ............................................................................................................. 7
I.3.2. IniŃierea culturii de Saprolegnia în condiŃii de laborator.................................................... 8
I.3.3. Mediile de cultură utilizate ................................................................................................. 9
I.3.3.1. Mediile de cultură solide utilizate în experiment....................................................... 10
I.3.3.2. Mediile de cultură lichide utilizate în experiment ..................................................... 10
I.3.3.3. Antibioticele utilizate în experiment .......................................................................... 11
I.3.4. Caracterizarea morfologică a tulpinilor de Saprolegnia................................................... 11
I.3.5. ExtracŃia şi detectarea ADN-ului din fungi ...................................................................... 12
I.3.5.1. ExtracŃia ADN-ului din fungi utilizând kituri de extracŃie (QIAGEN) ...................... 12
I.3.5.2. ExtracŃia ADN-ului din fungi utilizând soluŃii........................................................... 13
I.3.6. Cuantificarea ADN prin metoda directă de determinare a purităŃii şi concentraŃiei
ADN cu spectofotometrul Nanodrop ND-1000 ......................................................................... 13
I.3.7. Regiunea ITS de la fungi şi primerii utilizaŃi.................................................................... 13
I.3.8. Tehnici moleculare utilizate în experiment....................................................................... 15
I.3.8.1. Amplificarea PCR a probelor de Saprolegnia........................................................... 15
I.3.8.2. Tehnica PCR-RFLP - Restriction Fragment Length Polymorphism ......................... 16
I.3.9. Metode utilizate în stabilirea diversităŃii şi....................................................................... 16
înrudirii filogenetice a speciilor de fungi din familia Saprolegniaceae..................................... 16
I.3.9.1. SecvenŃierea automată............................................................................................... 16
CAPITOLUL II.................................................................................................................................. 17
REZULTATELE CERCETĂRILOR PROPRII ................................................................................ 17
II.1. REZULTATELE CULTURII DE SAPROLEGNIA ÎN
CONDIłII DE LABORATOR ...................................................................................................... 17
II.2. REZULTATE PRIVIND CREŞTERA ŞI DEVZOLTAREA
SAPROLEGNIEI PE MEDIILE DE CULTURĂ.......................................................................... 18
II.2.1. Rezultate comparative privind creşterea coloniilor
de Saprolegnia pe mediile de cultură solide .............................................................................. 18
II.2.2. Rezultate comparative privind dezvoltarea coloniilor
de Saprolegnia pe mediile de cultură lichide............................................................................. 20
II.3. CARACTERIZAREA MORFOLOGICĂ A TULPINILOR DE SAPROLEGNIA................ 20
II.4. REZULTATE PRIVIND EXTRACłIA ŞI CUANTIFICAREA
ADN-ULUI LA SAPROLEGNIA................................................................................................... 21
II.4.1. ExtracŃia ADN ................................................................................................................. 21
II.5. REZULTATELE AMPLIFICĂRII ADN-ULUI LA SPECII
DE FUNGI DIN FAMILIA SAPROLEGNIACEAE ...................................................................... 22
II.5.1. Amplificarea ADN prin PCR .......................................................................................... 22
2

II.6. REZULTATELE RESTRICłIEI ENZIMATICE A ADN-ULUI DE LA SPECII DE
FUNGI DIN FAMILIA SAPROLEGNIACEAE PRIN METODA PCR-RFLP............................. 23
II.7. REZULTATE PRIVIND STUDIUL ÎNRUDIRII GENETICE A
FUNGILOR DIN FAMILIA SAPROLEGNIACEAE..................................................................... 27
II.8. REZULTATELE SECVENłIERII SPECIILOR DE FUNGI DIN FAMILIA
SAPROLEGNIACEAE ÎN LOCAłIILE STUDIATE.................................................................... 29
II.9. INCIDENłA SAPROLEGNIOZEI ÎN AREALUL STUDIAT
DIN CENTRUL ŞI NORD-VESTUL ROMÂNIEI....................................................................... 29
CAPITOLUL III................................................................................................................................. 33
CONCLUZII ŞI RECOMANDĂRI................................................................................................... 33
BIBLIOGRAFIE SELECTIVĂ ......................................................................................................... 37
3

INTRODUCERE
Saprolegnioza constituie una din cele mai importante cauze ale pierderilor economice
din acvacultură, infecŃiile cu fungi secondând doar bolile bacteriene ca importanŃă
economică. InfecŃiile fungice sunt în general cronice, provocând pierderi constante.
Saprolegnia afectează un număr mare de peşti teleostei, cum sunt: somnul, ştiuca, bibanul,
babuşca, crapul, salmonidele, sturionii, barramundi, tilapia; fiind implicată în infestaŃii şi la
specii de peşti tropicali: gurami, guppy, platy.
În Japonia rata anuală de mortalitate la somonul Coho (Oncorhynchus kisuth) cauzată
de Saprolegnia parasitica Coker este de 50%. Acelaşi procent se înregistrează şi la anghilă
(Anguilla anguilla), tot în Japonia. În ScoŃia, saprolegnioza provoacă pierderi economice
importante îndeosebi în crescătoriile de somoni. În sudul Statelor Unite ale Americii
pierderile înregistrate la somn au fost de 50%, iar pierderea economică de 40 milioane de
dolari.
În România nu există până la ora actuală o evaluare ştiinŃifică a pierderilor din
crescătoriile piscicole generate de saprolegnioză.
CAPITOLUL I
IPOTEZA EXPERIMENTALĂ, OBIECTIVELE CERCETĂRII,
DISPOZITIVUL EXPERIMENTAL, MATERIAL ŞI METODĂ DE LUCRU
I.1. IPOTEZA EXPERIMENTALĂ ŞI OBIECTIVELE CERCETĂRII
Studiul bibliografic asupra saproleniozei la peşti în general, şi ciprinidelor în special,
indică faptul că în lume datorită diferenŃelor generate de diversele tipuri de apă, ca şi de
solul pe care îl străbat sau în care sunt localizate, de temperaturile medii anuale, de gradul de
populare şi speciile piscicole existente, boala este generată de numeroase specii de
Saprolegnia, care au specificitate şi patogenitate diferite, în funcŃie de factorii mai sus
enumeraŃi.
Literatura de specialitate prezintă preocupări actuale privind identificarea şi
clasificarea diverselor specii şi subspecii de Saprolegnia, saprofite şi condiŃionat patogene la
4

diverse specii piscicole. De aici se desprinde faptul că nu este suficientă identificarea strict
morfologică a tulpinilor izolate, ci este necesară şi o caracterizare complementară
moleculară privind structura ADN-ului, care să permită identificarea corectă şi stabilirea
distanŃelor genetice dintre populaŃiile şi subpopulaŃiile de Saprolegnia. Acest lucru este
necesar întrucât pierderile tehnologice în piscicultură raportate atât la nivel mondial, cât şi
naŃional, datorită saprolegniozei, care afectează dezvoltarea peştilor de la faza de icră, larvă,
alevin, tineret, adult ating până la 50% din producŃie, ceea ce se repercutează negativ asupra
situaŃiei economico-financiare a crescătoriilor.
Pornind de la aceste considerente, prin ipoteza cercetării ne-am propus identificarea şi
caracterizarea morfologică şi moleculară, prin analize de ADN, a speciilor şi subspeciilor de
Saprolegnia, care afectează populaŃiile de ciprinide din crescătoriile din centrul şi nordvestul
României. În România nu s-au mai efectuat studii genetice asupra speciilor şi
subspeciilor de Saprolegnia, care afectează speciile de ciprinide, şi care într-un viitor mai
mult sau mai puŃin îndepărtat ar putea constitui baza de plecare pentru crearea de vaccinuri
de ADN, care să fie utilizate la efectivele de reproducŃie. Studiul izolatelor locale de
Saprolegnia vor contribui în mod evident la dezvoltarea strategiilor de control a bolii.
Obiective urmărite în cercetare:
1. Stabilirea planului şi protocolului experimental;
2. Optimizarea metodelor de cultură a Saprolegniei;
3. Optimizarea metodelor de extracŃie şi amplificare a ADN-ului la Saprolegnia;
4. Testarea diferitelor enzime de restricŃie prin tehnica PCR-RFLP;
5. Stabilirea distanŃelor genetice dintre speciile familiei Saprolegniaceae identificate;
6. Monitorizarea incidenŃei saprolegniozei la ciprinide din centrul si nord-vestul
României.
5

I.2. DISPOZITIVUL EXPERIMENTAL
Dispozitivul experimental a fost localizat în zona de centru şi nord-vest a României,
fiind cuprinse în control bazine piscicole localizate după cum urmează:
Complexul Piscicol Ariniş, judeŃul Maramureş, cu 9 bazine;
C.P.Motiş, judeŃul Sălaj, cu 7 bazine;
C.P.Adrian, judeŃul Satu Mare, cu 10 bazine;
Ferma Piscicolă łaga, judeŃul Cluj, cu 5 bazine;
Ferma Piscicolă Ciurila, judeŃul Cluj, cu 6 bazine;
Ferma Piscicolă Chiochiş, judeŃul BistriŃa-Năsăud, cu 5 bazine;
Ferma Piscicolă Daia, judeŃul Alba, cu 5 bazine;
Ferma Piscicolă Iernut, judeŃul Mureş, cu 5 bazine;
Complexul Piscicol Cefa, judeŃul Bihor, cu 10 bazine;
Ferma Piscicolă Ineu, judeŃul Arad, cu 7 bazine;
În acest dispozitiv experimental, reprezentativ ca distribuŃie zonală, cuprinzând toată
diversitatea de tipuri de apă şi sol existente, s-au organizat mai multe experimente.
Prezentăm în continuare spre vizualizare repartizarea locaŃiilor marcate prin puncte
albe pe harta Romaniei (fig.1).
6

Fig.1. LocaŃiile în care s-au efectuat cercetările
I.3. MATERIAL ŞI METODĂ DE LUCRU
I.3.1. Prelevarea probelor
Prelevarea probelor de apă s-a făcut prin organizarea unui plan experimental complet
randomizat, pentru ca probele să fie reprezentative pentru crescătoriile piscicole din zona
analizată.
Au fost nominalizate bazinele din fiecare fermă, fiind monitorizate: suprafaŃa de luciu
de apă, cu adâncimea şi caracteristicile biologice ale apei, precum şi structura fito- şi
zooplanctonului şi speciile de peşti care le populează. Pentru acurateŃea rezultatelor, în
identificarea speciilor din familia Saprolegniaceae, pe lîngă observaŃiile curente efectuate pe
7

perioada experimentală, s-a procedat la prelevarea de probe de apă din fiecare bazin luat în
studiu, în trei luni diferite ale anului (decembrie, martie, iunie), indiferent de suprafaŃa
bazinului, care a fost cuprinsă între 0,5 şi 30 Ha. Modelul experimental utilizat a prevăzut
prelevarea a 5 probe de apă din fiecare bazin, din cele patru laturi şi centru, de la adâncimi
medii de 50 cm. Din cele 5 probe s-a făcut o singură probă de apă, care a fost ulterior
analizată în condiŃii de laborator.
Pentru identificarea diferitelor specii din familia Saprolegniaceae s-au prelevat şi
analizat probe de apă, specii de ciprinide şi icre afectate de boală din bazinele piscicole din
Transilvania, luate în studiu. Probele de apă s-au prelevat în peturi de 2 litri, din cele 5
puncte ale fiecărui bazin, după care cele 5 probe s-au amestecat într-un vas de 15 litri,
prelevându-se pentru analiză o singură probă de amestec din fiecare bazin, într-o sticlă de 2
litri. Transportul s-a efectuat în primele 12 până la 24 ore de la recoltare, procesele de
analiză şi experimentele fiind derulate în ziua următoare.
I.3.2. IniŃierea culturii de Saprolegnia în condiŃii de laborator
Pentru ca eventualele diferenŃe, care se pot constata între speciile de fungi din familia
Saprolegniaceae existente în ape, să poată fi atribuite strict diferenŃelor date de natura apei şi
de speciile care o populează, s-a procedat în felul următor: din fiecare probă de apă, în
cantitate de 2 litri, s-au constituit câte 3 probe a 100 ml de apă în recipiente de plastic sterile.
În fiecare recipient au fost introduse 10-15 icre provenite de la aceeaşi femelă de crap.
Pentru că literatura de specialitate oferă date contradictorii privind temperatura de dezvoltare
a Saprolegniei în diferite zone ale lumii, noi ne-am propus testarea modului de creştere şi
dezvoltare a fungului la 3 nivele de temperatură: 10°C, 15°C şi 22°C.
Probele de apă în care au fost introduse spre infestare artificială cele 10-15 bucăŃi de
icre au fost introduse în incubator la temperaturile mai sus menŃionate, între 3-7 zile. În
această perioadă s-au făcut observaŃii zilnice asupra fiecărei probe pentru a se constata
momentul de debut al atacului fungului asupra icrelor şi a intensităŃii dezvoltării la
temperatura respectivă.
8

A fost constituit un număr de 207 probe pentru fiecare lună de recoltare, câte 3 probe
pe fiecare bazin, care au fost urmărite la cele 3 temperaturi vizate, facându-se o apreciere a
gradului de infestare a icrelor cu puncte de la 0 la 4, la 48, 96 şi 144 ore. Interpretarea
datelor s-a făcut prin estimarea punctajului mediu a tuturor probelor de la acelaşi gradient
termic, diferenŃele s-au exprimat procentual. Punctajele utilizate au următoarele semnificaŃii:
0 - neevidenŃiat
1 - foarte slab infestat
2 - slab infestat
3 - mediu infestat
4 - bine infestat
I.3.3. Mediile de cultură utilizate
Literatura de specialitate evidenŃiază faptul că în general în dezvoltarea culturilor de
fungi pot fi utilizate atât medii solide, cât şi lichide. Mediile lichide permit dezvoltarea
miceliului fungic în cantitate mare, încât să poată fi utilizat prin tehnici ulterioare la extracŃia
de ADN (Dieguez-Uribeondo şi col., 2007; Fernandez-Benitez şi col., 2008).
În această cercetare am utilizat comparativ două medii solide: Potato Dextrose Agar
(PDA-agar cu cartof-dextroză) şi Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu
glucoză) şi două medii lichide: Potato Dextrose Broth (PDB-bulion cu cartof-dextroză) şi
Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroză).
Icrele infestate au fost prelevate steril în plăci Petri şi spălate cu apă distilată
conŃinând 100 mg L -1 Penicilină G cu sare de potasiu. Apoi au fost însămânŃate pe două
medii solide: Potato Dextrose Agar (PDA-agar cu cartof-dextroză) şi Sabouraud 2% Glucose
Agar (SGA-agar Sabouraud cu glucoză), iar pentru a preîntâmpina creşterea bacteriană s-a
adăugat acelaşi antibiotic, în concentraŃia recomandată. Coloniile au fost menŃinute apoi pe
mediile PDA şi SGA timp de 3 zile la incubator, la temperaturile menŃionate (10, 15 şi
22°C). În această perioadă s-a urmărit viteza de creştere şi diametrul coloniilor de
Saprolegnia (adaptat după Fernandez-Benitez şi col., 2008). ContribuŃia originală a constat
9

în faptul că s-au utilizat două medii de cultură solide comparative şi trei gradiente de
temperatură pentru fiecare mediu.
I.3.3.1. Mediile de cultură solide utilizate în experiment
Cele două medii de cultură solide utilizate în experiment au fost următoarele
(conform http://www.sigmaaldrich.com):
Potato Dextrose Agar (PDA-agar cu cartof-dextroză) (Fluka)
Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoză) (Fluka)
Din fiecare bazin s-a făcut însămânŃare în cele două medii de cultură solide utilizate
(PDA, SGA), din cea mai bine dezvoltată probă, pentru a putea fi făcute observaŃii
comparative privind modul de dezvoltare al speciilor de fungi din familia Saprolegniaceae.
Pentru testarea ratei de creştere pe mediul solid cu agar, în plăcile Petri conŃinând
cele două medii de cultură solide (PDA, SGA) şi incubate la 22°C ± 2°C timp de 72 ore s-a
urmărit rata de creştere a hifelor de Saprolegnia. Creşterea radială în diametru a fost
măsurată tot la 24 ore. S-a considerat că hifele şi-au epuizat creşterea radială atunci când
acestea au atins marginea plăcilor Petri (>40 mm) (prelucrare după Stueland şi col., 2005).
La 72 ore de dezvoltare pe mediile solide, coloniile fungice au fost pasate pe cele
lichide, în următorul mod: coloniile de pe mediul solid Potato Dextrose Agar (PDA-agar cu
cartof-dextroză) au fost transferate pe mediul lichid Potato Dextrose Broth (PDB-bulion cu
cartof-dextroză), iar coloniile de pe mediul solid Sabouraud 2% Glucose Agar (SGA-agar
Sabouraud cu glucoză) pe mediul lichid Sabouraud Dextrose Broth (SDB-bulion Sabouraud
cu dextroză). Acest experiment s-a efectuat pentru a putea observa şi recomanda cea mai
bună combinaŃie de transfer de la mediul solid la mediul lichid.
I.3.3.2. Mediile de cultură lichide utilizate în experiment
Mediile lichide utilizate în experiment au fost următoarele (conform
http://www.sigmaaldrich.com):
Potato Dextrose Broth (PDB-bulion cu cartof-dextroză) (Fluka):
10

Sabouraud Dextrose Broth (SDB-bulion Sabouraud cu dextroză) (Fluka)
Toate coloniile de fungi saprolegnieni de pe mediile solide au fost pasate în pahare
Erlenmeyer cu 100 ml mediu lichid cu adaos de antibiotic şi menŃinute într-un incubator cu
agitator, la temperatura de 22°C ± 2°C, timp de 5-7 zile, în funcŃie de gradul de dezvoltare.
Peletele miceliale au fost apoi filtrate, spălate cu apă distilată şi menŃinute la temperatura de
-20°C până la extracŃia ADN (metodă adaptată după Leclerc şi col., 2000).
MenŃionez faptul că la această procedură au fost supuse probele de fungi obŃinuŃi din
apa recoltată în cursul lunii iunie 2009, un număr total de 138 probe, din care 69 probe pe
combinaŃia de mediu solid-lichid Potato Dextrose Agar (PDA-agar cu cartof-dextroză)-
Potato Dextrose Broth (PDB-bulion cu cartof-dextroză) şi 69 probe combinaŃia de mediu
solid-lichid Sabouraud 2% Glucose Agar (SGA-agar Sabouraud cu glucoză) - Sabouraud
Dextrose Broth (SDB-bulion Sabouraud cu dextroză).
I.3.3.3. Antibioticele utilizate în experiment
Pentru a preîntâmpina dezvoltarea şi contaminarea bacteriană, în mediile de cultură
pentru fungi se utilizează mai multe tipuri de antibiotice (Lategan şi col., 2003, 2004). În
experienŃa noastră, am optat pentru: Penicillin G potassium salt (sare de potasiu cu
penicilină G) (Sigma). ConcentraŃia de lucru utilizată de noi pe mediile solide, cât şi lichide
a fost de 100 mg L -1 Penicilină G cu sare de potasiu.
I.3.4. Caracterizarea morfologică a tulpinilor de Saprolegnia
Pentru caracterizarea mofologică a tulpinilor de Saprolegnia dezvoltate pe mediile de
cultură, s-a urmărit pe cele 69 probe următoarele aspecte: tipurile de hife caracteristice
genului Saprolegnia, reproducerea asexuată (prezenŃa flagelilor pe zoosporii primari) şi
formarea structurilor sexuale (anteridiile şi oogoanele).
Tulpinile fungice din fiecare bazin, la 72 ore de creştere pe mediul solid PDA, au fost
reînsămânŃate în plăci Petri de plastic cu diamentrul de 9 cm, pe acelaşi mediu PDA, la
temperatura de 22ºC, pH 5,5. Creşterea Saprolegniei a fost examinată periodic la microscop
11

timp de 2-3 săptămâni, pentru a verifica dezvoltarea structurilor sexuale. Toate tulpinile au
fost caracterizate şi identificate conform cheilor de identificare comunicate de Johnson Jr. şi
col., 2002 (Dieguez-Uribeondo şi col., 2007).
ObservaŃiile microscopice s-au efectuat pentru fiecare probă din fiecare bazin,
procedându-se în felul următor: s-a prelevat cu o ansă microbiologică o porŃiune din colonia
dezvoltată pe mediul PDA, s-a pus pe o lamă histologică, s-a mărunŃit cu o lamă de bisturiu,
s-a adăugat o picătură de soluŃie Lugol pentru colorare, s-a omogenizat, iar la final
preparatul a fost acoperit cu o lamelă histologică. ObservaŃiile s-au efectuat cu microscopul
cu contrast de fază, imaginile preluându-se cu o camera digitală adaptată la microscop.
I.3.5. ExtracŃia şi detectarea ADN-ului din fungi
ExtracŃia ADN s-a făcut după protocolul liu Colao Maria Chiara (1999). ExtracŃia
ADN a fost efectuată din miceliumul fungic dezvoltat în cultură pură pe mediul lichid PDB
(Potato dextrose broth). S-au utilizat kitul de extracŃie de la Qiagen, Dneasy Plant Minikit
(conform http://www.qiagen.com) şi extracŃia rapidă a ADN prin soluŃie PBS (tampon fosfat
salin). ExtracŃia de ADN s-a efectuat pe 69 de probe, obŃinute pe combinaŃia de mediu solidlichid
Potato Dextrose Agar (PDA-agar cu cartof-dextroză)- Potato Dextrose Broth (PDBbulion
cu cartof-dextroză). Fiecare probă realizată pe fiecare bazin a fost divizată în două
părŃi egale, fiind realizate în total 138 probe, pentru a se putea efectua extracŃia comparativă
prin cele două metode utilizate.
I.3.5.1. ExtracŃia ADN-ului din fungi utilizând kituri de extracŃie (QIAGEN)
DNeasy Plant minikit este o procedură bazată pe coloane “spin”, care încorporează:
liza probelor, îndepărtarea ARN-ului, îndepărtarea proteinelor şi a polizaharidelor,
precipitarea ADN-ului, şi legarea acestuia de membranele coloanelor “spin”. Sunt efectuate
multiple spălări pentru a îndepărta contaminanŃii, apoi ADN-ul este îndepărtat de pe
membrană.
12

Echipament, materiale şi reactivi utilizate în experiment:
- Colonii fungice în fază staŃionară (aproximativ 1 x 10 9 ), în număr de 69 pe probe, pe
bazine de provenienŃă; Kitul de la Qiagen.
I.3.5.2. ExtracŃia ADN-ului din fungi utilizând soluŃii
La extracŃia rapidă a ADN utilizând soluŃie de PBS (fosfat tampon salin),
efectuată pe un număr de 69 probe, s-a procedat în felul următor: într-un tub Eppendorf se
cântăresc 120 mg Ńesut fungic, peste care se adaugă 200 µl soluŃie PBS. Probele se
centrifughează la 3000 rpm timp de 20 minute, apoi se elimină supernatantul. OperaŃiunea a
fost repetată de 5 ori, până la curăŃarea peletei de ADN fungic. Apoi probele s-au pus în baie
de apă, la 95°C pentru spargerea peretelui celular, timp de 15 minute. Se uscă probele la
etuvă 30 minute, după care se adaugă soluŃie TE (Tris-EDTA) de rehidratare a ADN-ului.
Pentru metoda rapidă de extracŃie a ADN cu soluŃie NE se folosesc anumite
materiale chimice, soluŃiile trebuind preparate în laborator. Materialele şi consumabilele au
fost următoarele: pipete Eppendorf, cu volume reglabile; tuburi (Eppendorf); vârfuri de
pipete de dimensiuni diferite (dimensiuni mari, medii şi mici); apă sterilă.
I.3.6. Cuantificarea ADN prin metoda directă de determinare a purităŃii şi
concentraŃiei ADN cu spectofotometrul Nanodrop ND-1000
Pentru determinarea purităŃii şi concentraŃiei ADN s-a utilizat spectofotometrul
Nanodrop ND – 1000. Pentru a se putea afla concentraŃia ADN extras din probele de fungi s-
a utilizat metoda directă de determinare, care presupune măsurarea densităŃii optice a probei
de ADN, la lungimea de undă 260/280 nm, pe un spectrofotometru, în domeniul UV/VIS.
I.3.7. Regiunea ITS de la fungi şi primerii utilizaŃi
La fungi şi alte eucariote, există două locaŃii pentru ADNr: genomul nuclear şi
genomul mitocondrial. Cel din urmă conŃine două gene care codifică genele mitocondriale
mici şi mari ale ARNr. ADNr nuclear la fungi este organizat, în general, într-o unitate
13

nucleară care se repetă în tandem. O unitate ADNr, ilustrată în fig.2, include 3 gene ARNr:
gena nucleară mică-small nuclear (18S) ARNr, 5,8S ARNr şi gena nucleară mare-large
nuclear (28S) ARNr. Într-o unitate, genele sunt separate de două spaŃii transcrise interninternal
transcribed spacers (ITS1 şi ITS2), şi două unităŃi ADNr separate de spaŃiul
intergenic-intergenic spacer (IGS). Ultima genă ARNr (5S) poate fi sau nu în interiorul
unităŃii repetate (Kamoun, 2003).
Fig.2. Diagrama unităŃilor repetitive ale ADN ribozomal nuclear
(Frisvad şi col., 1998)
Cu excepŃia unor domenii variabile ale genelor ARNr, regiunile codificatoare sunt
înalt conservate în cazul organismelor, acest lucru permiŃând comparaŃii între fungi înrudiŃi
îndepărtat. În contrast, deoarece aceştia evoluează repede, regiunile necodificatoare au o
variabilitate mai mare faŃă de regiunile codificatoare. SpaŃierile transcrise intern (ITS1 şi
ITS2) necodificatoare pot fi utilizate în diferenŃierea speciilor înrudite strâns din interiorul
unui gen fungic. Regiunea ITS, incluzând aici ITS1, gena 5,8S ARNr şi ITS2, este de
aproximativ 600 până la 1000 perechi de baze şi poate fi amplificată atât total, cât şi parŃial
folosind primerii “universali” descrişi de White şi col., în 1990.
Regiunea ITS este acum poate cea mai secvenŃiată regiune a ADN la fungi. Aceasta
este folosită în elaborarea studiilor de sistematică moleculară între specii şi chiar în interiorul
speciilor (de exemplu, pentru a identifica geografic rasele). Din cauza gradului mare de
variaŃie faŃă de alte regiuni genice ale ADNr (SSU şi LSU), variaŃia în interiorul unităŃilor
repetitive individuale ale ADNr uneori poate fi observată atât în interiorul regiunii ITS, cât şi
IGS. Pe lângă primerii standard utilizaŃi de majoritatea laboratoarelor (ITS1 şi ITS4), mai
pot fi folosiŃi alŃi câŃiva primeri în amplificarea selectivă a secvenŃelor ITS a fungilor.
14

Primerii folosiŃi de către noi în reacŃia PCR au fost următorii (standardizaŃi de White
şi col., 1990):
- ITS1, cu secvenŃa 5’-3’: TCCGTAGGTGAACCTGCGG;
- ITS4, cu secvenŃa 5’-3’: TCCTCCGCTTATTGATATGC;
- ITS5, cu secvenŃa 5’-3’: GGAAGTAAAAGTCGTAACAAGG;
Am folosit comparativ un amestec de perechi de primeri, în următoarea combinaŃie:
ITS1 cu ITS4 şi ITS4 cu ITS5. Primerul ITS1 se ataşează la capătul 3’al genei 18S ADNr şi
primerul ITS4 la capătul 5’ al genei 28S ADNr (după Paul B. şi col., 2004). Ultima
combinaŃie de primeri se utilizează în amplificarea regiunii unităŃii repetitive a ADNr, care
include două regiuni necodificatoare, denumite ITS1 şi ITS2, şi gena 5,8S ARNr (Llanos
Frutos şi col., 2004).
I.3.8. Tehnici moleculare utilizate în experiment
I.3.8.1. Amplificarea PCR a probelor de Saprolegnia
În experienŃa efectuată de noi am utilizat combinaŃiile de perechi de primeri ITS1 şi
ITS4, ITS4 şi ITS5 (White şi col., 1990), care amplifică regiunea ITS1, gena 5,8S rRNA şi
ITS2. ReacŃiile de amplificare au fost efectuate individual, într-un volum final de 25 µl, cu
un termocycler Eppendorf.
Parametrii ciclului de amplificare utilizat au fost următorii: denaturarea iniŃială la
95°C timp de 3 minute, urmată de 35 cicluri de denaturare la 94°C timp de 1 minut,
annealing la 55°C timp de 1 minut şi extensia la 72°C timp de 1 minut, şi extensia finală la
72°C timp 7 minute. Produşii de amplificare au fost separaŃi prin electoforeză pe gel de
agaroză 1,5%, cu buffer TBE 1x, timp de 60 minute la 70V. ADN a fost apoi colorat cu Sybr
Safe (Invitrogen) şi vizualizat la lumină UV. Se fotografiază gelul şi se salvează imaginea pe
aparat (Biorad). Lungimile produşilor de amplificare au fost estimate în comparaŃie cu un
Ladder ADN Low Range (700 pb) sau de 50 pb (Fermentas) (adaptată după Ristaino şi col.,
1998).
15

Am mai testat o altă metodă de amplificare, care s-a efectuat într-un termocycler
Eppendorf, după următorul protocol de lucru, cu etapele:
- predenaturare: 5 minute la 95°C
- 35 cicluri: - denaturare 30 secunde la 95°C
- annealing 30 secunde la 48°C
- extensie 90 secunde la 68°C
- extensie finală: 7 minute la 68°C (după Coalo Maria Chiara, 1999).
Amplificarea s-a efectuat pe un număr de 69 probe, dezvoltate pe mediul Potato
Dextrose Broth (PDB-bulion cu cartof-dextroză), utilizând tehnica adaptată a lui Ristaino şi
col., 1998.
I.3.8.2. Tehnica PCR-RFLP - Restriction Fragment Length Polymorphism
Fragmentele amlificate au fost digerate de noi cu 3 enzime de restricŃie de la
Fermentas: RsaI, HindIII şi AluI. Protocolul de digestie a fost conform cu a
manufacturierului (http://www.fermentas.com).
Produşii PCR au fost incubaŃi peste noapte, la 37ºC, iar la final la 65ºC timp de 10
minute. Produşii de digestie au fost apoi supuşi electroforezei, într-un gel de agaroză de 3%
cu buffer TBE, la 60V, timp de 2 ore. ADN-ul a fost colorat cu Sybr Safe (Invitrogen),
pentru a vizualiza polimorfismele fragmentelor amplificate, la lumină ultravioletă (Biorad).
S-a utilizat un ladder ADN de 700 pb pentru compararea fragmentelor (Fermentas).
I.3.9. Metode utilizate în stabilirea diversităŃii şi
înrudirii filogenetice a speciilor de fungi din familia Saprolegniaceae
I.3.9.1. SecvenŃierea automată
Catena de ADN a fost secvenŃiată cu primerii universali ITS1 (sens) şi ITS4
(antisens) la Mycrosinth (ElveŃia). Rezultatele secvenŃierilor au fost interpretate utilizânduse
un software specific denumit Chromas Lite.
Pentru stabilirea diversităŃii genetice au mai fost utilizate softuri genetice specifice.
16

CAPITOLUL II
REZULTATELE CERCETĂRILOR PROPRII
II.1. REZULTATELE CULTURII DE SAPROLEGNIA ÎN
CONDIłII DE LABORATOR
S-a procedat la exprimarea procentuală din total probe analizate, a fiecărui scor cu
care s-a apreciat gradul de infestare, pe fiecare nivel de temperatură, neŃinându-se cont de
bazine şi ferme (tabelul 1).
Gradul de infestare a icrelor cu Saprolegnia în funcŃie de temperatură
exprimat procentual din numărul total de probe (207)
Temperatura
Scor de infestare
Tabelul 1
0 1 2 3 4
10°C 4,34 38,64 54,58 2,41 0
15°C 0,96 11,11 32,36 51,20 4,34
22°C 0,96 0,96 12,56 45,41 40,09
Legendă: 0 – infestaŃie neevidenŃiată; 1 - foarte slab infestat; 2 - slab infestat; 3 – mediu
infestat; 4 – bine infestat.
Din datele tabelare se evidenŃiază faptul că dezvoltarea saprolegniozei este diferită de
la o temperatură de incubaŃie la alta. La 10°C, 38,64% dintre probe au fost punctate cu
scorul de 1, ceea ce denotă o infestare foarte slabă la 144 ore de la incubaŃie. 54,58%, deci
mai mult din jumătatea probelor analizate dezvoltă slab fungul, doar 2,41% fiind mediu
infestate.
La temperatura de 15°C doar 0,96% din probe nu manifestă semne de infestare,
comparativ cu 4,34% procent de neinfestare la 10°C. Un prag de infestare slab de 32,36%
din probe este atins la temperatura de 15°C, iar nivelul mediu de infestare la 51,20% din ele.
Spre deosebire de gradientul de temperatură de 10ºC, la cel de 15°C apare un procent de
4,34% din probe bine infestate.
17

La temperatura de incubaŃie de 22ºC, 40,09% din probe prezintă un nivel bun de
infestare, 45,41% nivel mediu, şi doar 0,96% sunt neinfestate sau cu nivel foarte slab de
infestare. Aceste date evidenŃiază faptul că indiferent de bazinul de recoltare, de zonă şi de
momentul anului, saprolegnioza ca boală se manifestă cu intensitate ridicată şi cu o durată
mai scurtă de manifestare în timp la temperaturi de 20°C. Acest lucru vine să confirme
datele de pierderi la icrele şi larvele de ciprinide comunicate de crescători, ca şi de
cercetătorii din domeniu, care au loc în lunile mai-iunie, perioadă de reproducŃie, când se
constată un puseu de saprolegnioză. La temperaturi mai scăzute, fungul este prezent chiar
dacă pentru a afecta populaŃiile de peşti este necesară o perioadă mai lungă de incubaŃie a
acestuia. La populaŃii de ciprinide, care iernează sub gheaŃă şi care realizează mişcări mai
reduse, incidenŃa este mai redusă decât la alte specii, afectaŃi fiind doar indivizi care au intrat
slăbiŃi la iernare sau prezintă răniri generate de manipulare.
II.2. REZULTATE PRIVIND CREŞTERA ŞI DEVZOLTAREA
SAPROLEGNIEI PE MEDIILE DE CULTURĂ
II.2.1. Rezultate comparative privind creşterea coloniilor
de Saprolegnia pe mediile de cultură solide
S-au utilizat cele două medii solide pentru a putea fi urmărit comparativ modul de
creştere al coloniilor la 24, 48 şi 72 ore. Din fiecare bazin al fiecărei locaŃii s-au constituit 2
probe, câte una pentru fiecare mediu. Întrucât cele două probe de pe cele două medii, din
fiecare bazin provin din aceeaşi cultură, însămânŃată la 6 zile pe aceste medii, considerăm că
diferenŃele de dezvoltare la acelaşi gradient de temperatură de 22°C, se pot atribui
diferenŃelor de specii şi cerinŃelor de mediu.
Pentru a se putea interpreta corect statistic diferenŃele de creştere a coloniilor pe cele
2 medii şi la cele 3 gradiente de temperatură, în tabelul 2, prezentăm valorile medii de
dezvoltare a coloniilor în mm.
18

Mediile diametrului coloniilor de Saprolegnia la 24, 48 şi 72 ore
de dezvoltare pe cele două medii de cultură solide (în mm)
Timp citire 24 48 72
Tabelul 2
n
Medii de cultură
PDA* SGA** PDA SGA PDA SGA
LocaŃia
Ariniş 14,33 9,44 29,00 19,44 56,22 38,11 9+9
Motiş 12,57 7,57 26,57 16,00 51,85 31,57 7+7
Adrian 13,50 10,10 28,10 20,70 53,90 39,50 10+10
łaga 12,00 7,60 24,20 16,20 48,80 32,20 5+5
Ciurila 14,66 9,16 30,33 19,16 57,00 36,50 6+6
Chiochiş 13,60 9,60 28,20 19,20 53,80 36,60 5+5
Daia 11,80 8,00 24,80 16,60 49,40 33,60 5+5
Iernut 11,80 8,20 25,00 17,40 50,80 34,80 5+5
Cefa 12,20 8,00 22,50 16,60 51,30 33,20 10+10
Ineu 13,14 8,28 26,85 17,14 54,00 35,71 7+7
*PDA - Potato Dextrose Agar (agar cu cartof-dextroză)
**SGA - Sabouraud 2% Glucose Agar (agar Sabouraud cu glucoză)
Se constată analizând mediile diametrelor, că la 24 ore (tabelul 2), pe mediul PDA,
coloniile prezintă valori între 11,80 mm (în locaŃiile Daia şi Iernut) şi 14,66 mm (în locaŃia
Ciurila). După aceleaşi 24 ore, coloniile cultivate pe SGA au o medie cuprinsă între 7,57
mm (Motiş) şi 10,10 mm (Adrian).
La 48 ore, cititrea aceloraşi plăci de cultură indică aproape o dublare de la cititrea
anterioară, pe mediul PDA. Diametrul minim, în medie de 22,50 mm, se obŃine pe coloniile
provenite de la Cefa, şi maximul de 30,33 mm pe probele provenite de la Ciurila (tabelul 2).
La acelaşi interval de timp, comparativ cu probele de pe mediul PDA, cele de pe mediul
SGA prezintă valori mult mai reduse, cu un minim de 16,00 mm în diametru (Motiş) şi un
maxim de 20,70 mm (Adrian). După Stueland şi col., 2005, valori a diametrului coloniilor
mai mari de 40 mm indică ajungerea la limita de creştere.
La 72 ore, diametrele medii indică valori mai mari de 40 mm pentru mediul de cultură
cu PDA şi sub această valoare pentru cele cu SGA. Diametrul maxim al coloniilor, de 57,00
mm se realizează pe cele 6 probe însămânŃate de la Ciurila şi valori medii de 48,80 mm pe
19

cele recoltate de la łaga (tabelul 2). Pe mediul SGA, diametrul minim de creştere, de 31,57
mm realizează coloniile însămânŃate din apele de la Motiş, iar diametrul maxim, de 38,11
mm, probele provenite de la Ariniş.
II.2.2. Rezultate comparative privind dezvoltarea coloniilor
de Saprolegnia pe mediile de cultură lichide
Utilizarea mediilor de cultură lichide este necesară pentru a se obŃine cantităŃi mai
mari de masă fungică utilizată pentru extracŃia de ADN.
Acest experiment s-a efectuat pentru a putea observa şi recomanda cea mai bună
combinaŃie de transfer de la mediul solid la mediul lichid, prin aprecierea cantităŃii de masă
fungică exprimată în cm 3 .
Au fost urmărite şi analizate 138 de probe, câte 69 probe pe fiecare combinaŃie de
mediu. ObservaŃiile zilnice efectuate de la ziua de transfer la ziua a şaptea au evidenŃiat un
ritm de dezvoltare aproape dublu în cazul mediului lichid Potato Dextrose Broth (PDBbulion
cu cartof-dextroză), comparativ cu probele din mediul lichid Sabouraud Dextrose
Broth (SDB-bulion Sabouraud cu dextroză). În ziua a şaptea, în toate paharele Erlenmeyer
cu 100 ml, peletele de fungi din mediul lichid Potato Dextrose Broth (PDB-bulion cu cartofdextroză),
aveau între 2,5 şi 4 cm 3 , iar în cele cu mediul lichid Potato Dextrose Broth (PDBbulion
cu cartof-dextroză) valori de 1-2 cm 3 .
II.3. CARACTERIZAREA MORFOLOGICĂ A TULPINILOR DE SAPROLEGNIA
Analiza microscopică evidenŃiază faptul că hifele au un aspect neseptat caracteristic
fungilor inferiori. Nu au fost analizate lungimea şi grosimea acestor hife, doar aspectul
general de morfologie, care a confirmat prezenŃa fungilor saprolegnieni în cultură, fără a fi
efectuate diferenŃieri morfologice între genuri şi specii. ObservaŃiile microscopice pe o
perioadă de 21 de zile au evidenŃiat la nivelul fiecărei probe prezenŃa sau absenŃa organelor
de reproducŃie sexuată, şi a celei asexuate. Putem afirma cu certitudine că în condiŃii de
20

laborator specifice metodologiei descrise de noi, la toate izolatele fungice a fost identificată
prezenŃa flagelilor pe zoosporii primari.
În ceea ce priveşte dezvoltarea organelor de reproducŃie sexuată (anteridiile şi
oogoanele), se constată că există diferenŃe de la un bazin la altul şi de la o locaŃie la alta.
Această prezenŃă sau absenŃă a reproducŃiei sexuate o putem atribui în acest moment al
cercetării faptului că speciile existente în bazine sunt diferite, iar unele dintre ele nu
realizează reproducŃia sexuată in vitro, fapt confirmat şi de alŃi autori (Fregeneda Grandes,
2000; Dieguez Uribeondo, 2007).
O analiză sintetică privind dezvoltarea organelor de reproducŃie sexuată la speciile de
fungi din familia Saprolegniaceae analizate (69 probe), ne permite să afirmăm că la un
număr de 41 de izolate ceea ce reprezintă procentual 59,42%, ele sunt prezente, putând fi
vizualizate microscopic. La 28 de probe, deci la 40,58%, prezenŃa lor nu a putut fi
vizualizată (tabelul 3).
Aspectul
hifelor
Sinteză privind dezvoltarea organelor de reproducŃie
la speciile de fungi din familia Saprolegniaceae analizate (69 probe)
ReproducŃia sexuată
Prezentă
Absentă
ReproducŃia
asexuată
(prezenŃa flagelilor)
Tabelul 3
Nr. probe
Procent
(%)
Nr. probe
Procent
(%)
Nr. probe
Procent
(%)
Neseptat 41 59,42 28 40,58% 69 100%
II.4. REZULTATE PRIVIND EXTRACłIA ŞI CUANTIFICAREA
ADN-ULUI LA SAPROLEGNIA
II.4.1. ExtracŃia ADN
Fiecare probă de material biologic a fost divizată, cele două probe fiind supuse la câte
o metodă de extracŃie, pentru a se putea aprecia pertinent care din cele două este mai
eficientă pentru acest tip de fungi sub aspectul cantităŃii de ADN şi a purităŃii lui.
21

Rezultatele prelucrării celor 69 probe extrase prin fiecare metodă arată că purităŃile şi
cantităŃile de ADN redate de spectrofotomentrul Nanodrop ND 1000, variază de la un bazin
la altul ca şi de la o metodă la alta în cadrul aceluiaşi bazin.
Astfel, purităŃile ADN redate de spectrofotomentru, în urma extracŃiei cu kit pe
microcoloane (Qiagen), oscilează între 1,02 - 1,51, cu o medie a purităŃii probelor de 1,250,
la lungimea de undă 260/280, iar cantităŃile de ADN obŃinute prin aceeaşi metodă între 2,54
– 14,00 ng/µl, cu o medie de 5,543 ng/µl. Analizând purităŃile ADN redate de
spectrofotomentru, în urma extracŃiei cu soluŃie ce conŃine PBS, constatăm că probele au
valori cuprinse între 1,10 – 1,51, cu o medie de 1,394, la lungimea de undă 260/280, iar
cantităŃile de ADN obŃinute prin aceeaşi metodă, între 5,23 ng/µl şi 86,56 ng/µl, cu o medie
de 30,653 ng/µl.
II.5. REZULTATELE AMPLIFICĂRII ADN-ULUI LA SPECII
DE FUNGI DIN FAMILIA SAPROLEGNIACEAE
II.5.1. Amplificarea ADN prin PCR
ReacŃiile de amplificare au fost efectuate individual, într-un volum final de 25 µl, cu
un termocycler Eppendorf. MenŃionăm faptul că procesul de amplificare în fază preliminară
a fost efectuat pe câte 20 probe, din care 10 provenite din extracŃia ADN-ului din fungi
utilizând kituri de extracŃie (QIAGEN) şi 10 probe provenite din extracŃia ADN-ului din
fungi utilizând soluŃia PBS (tampon fosfat salin). Acest test a fost efectuat pentru a se urmări
prin care din cele două metode utilizate se realizează cea mai precisă amplificare a ADNului,
fără obŃinerea de produşi nespecifici.
MenŃionez faptul că al doilea protocol utilizat, descris în material şi metodă, nu a dat
rezultatele scontate la fungi, motiv pentru care s-a renunŃat la el. Prezentăm în continuare, în
fig.3, rezultate comparative privind profilele electroforetice ale fragmentelor amplificate cu
cele două seturi de primeri.
22

Deoarece am utilizat în experimente extracŃiile ADN cu soluŃie PBS şi kit QIAGEN
şi combinaŃia de primeri universali ITS1 şi ITS4, ITS4 şi ITS5, rezultatele electroforezei m-
au determinat să optez pentru extracŃia ADN cu kit (QIAGEN) şi perecherea de primeri
ITS1 şi ITS4.
1 2 3 4 5 6 7 8 9
700pb-
Fig.3. Profilul electroforetic ale unei probe de ADN extras din Saprolegnia şi amplificat cu
perechile de primeri ITS1 şi ITS4, ITS4 şi ITS5 (original)
1-Ladder Low Range de 700 pb (Fermentas); 2-probă ADN extrasă cu kit (primeri ITS1-ITS
4); 3-probă ADN extrasă cu soluŃie PBS (primeri ITS1-ITS4); 4-probă ADN extrasă cu
soluŃie NE (primeri ITS1-ITS4); 5-probă ADN purificată cu kit PCR (primeri ITS1-ITS4);
6-probă ADN purificată cu kit PCR (primeri ITS4-ITS5); 7-probă ADN extrasă cu soluŃie
NE (primeri ITS4-ITS5); 8-probă ADN extrasă cu soluŃie PBS (primeri ITS4-ITS5);
9-probă ADN extrasă cu kit (primeri ITS4-ITS5)
II.6. REZULTATELE RESTRICłIEI ENZIMATICE A ADN-ULUI DE LA SPECII DE
FUNGI DIN FAMILIA SAPROLEGNIACEAE PRIN METODA PCR-RFLP
În cazul restricŃiei cu enzimele AluI şi HindIII, aceasta nu s-a produs, enzimele
nedigerând fragmentul de aproximativ 700 pb amplificat, nerecunoscând situsul de restricŃie.
Pentru acest considerent cea de-a treia enzimă testată (RsaI), care a restricŃionat toate
23

probele testate a fost utilizată în continuare în analiza profilului electroforetic al celor 69 de
probe, aparŃinând bazinelor din cele 10 locaŃii.
În continuare s-au efectuat profilele electroforetice ale analizelor de restricŃie cu
enzima RsaI (Fermentas) a ADN amplificat cu perechile de primeri ITS1 şi ITS4 la specii de
fungi din familia Saprolegniaceae, pe fiecare bazin al fiecărei locaŃii.
În cazul probelor de fungi din familia Saprolegniaceae, provenite din Complexului
Piscicol Ariniş, judeŃul Maramureş, cu 9 bazine, în probele provenite din bazinele 1,2,3,4,5,8
şi 9, se remarcă prezenŃa a 3 fragmente de ADN bine evidenŃiate, primul fragment fiind
cuprins între 350 şi 400 pb, al doilea fragment în jur de 200 pb, iar cel de-al treilea în jur de
150 pb. În probele din bazinele 6 şi 7 se evidenŃiază 4 fragmente: primul este cuprins între
450 şi 500 pb, aldoilea în jur de 300 pb, al treilea în jur de 200 pb, iar al patrulea la 150 pb.
Aceste probe de ADN amplificate prezintă un polimorfism de lungime al fragmentelor, fapt
confirmat de analiza secvenŃierii. Astfel, în urma rezultatelor secvenŃierii s-au identificat
două specii de fungi acvatici, fiecare aparŃinând la câte un alt gen din familia
Saprolegniaceae. Profilele de ADN ilustrate în godeurile 2,3,4,5,6,9 şi 10, aparŃin speciei
Saprolegnia ferax, iar profilele polimorfice de ADN, prezente în godeurile 7 şi 8, aparŃin
speciei Achlya bisexualis.
La probele de fungi din familia Saprolegniaceae, provenite din Complexul Piscicol
Motiş, judeŃul Sălaj, în toate cele 7 bazine analizate se constată acelaşi profil electroforetic al
produşilor PCR, constituit din câte 3 fragmente vizibile. Primul fragment este de
aproximativ 400 pb, al doilea fragment de 200 pb şi al treilea de 150 pb. În probele analizate
din această locaŃie nu se semnalează existenŃa unor polimorfisme, toate fragmentele indicând
prezenŃa unei singure specii de fungi, confirmată în urma secvenŃierii ca Saprolegnia ferax.
La probele de fungi din familia Saprolegniaceae, din Complexul Piscicol Adrian,
judeŃul Satu Mare, cu 10 bazine, în bazinele 1,2,3,4,6,7,8 şi 10, semnalăm prezenŃa a 3 benzi
de migrare, prima la aproximativ 380-400 pb, a doua bandă la 200 pb şi a treia între 100 şi
150 pb. În urma analizelor de secvenŃiere, în bazinele respective s-a identificat specia
Saprolegnia ferax. În bazinul 5 semnalăm prezenŃa a 2 benzi, din care banda 1 la
aproximativ 450 pb, iar a doua bandă la 200 pb. În bazinul 9 pot fi observate clar 4
24

fragmente: primul la aproximativ 450 pb, al doilea la 250 pb, al treilea la 200 pb şi al
patrulea între 100 şi 150 pb. În probele din godeurile 6 şi 10 pot fi observate polimorfisme
de lungime diferite faŃă de restul probelor de ADN fungic, confirmate prin secvenŃiere ca
aparŃinând speciei Achlya bisexualis.
La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicolă łaga,
din judeŃul Cluj, sunt evidenŃiate la fiecare din cele 5 bazine analizate câte 4 fragmente de
restricŃie. Primul fragment este între 380-400 pb, al doilea fragment la 200 pb, al treilea
fragment la 150 pb, iar al patrulea la aproximativ 100 pb. Profilele electroforetice ale
probelor de ADN sunt asemănătoare ca şi lungime de perechi de baze. Datele secvenŃierii au
relevat faptul că toate profilele electroforetice aparŃin speciei Saprolegnia ferax.
La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicolă Ciurila,
judeŃul Cluj, cu 6 bazine, în bazinele 1,2,3,5 şi 6 se constată 3 fragmente de ADN restrictate,
din care primul fragment este de aproximativ 400 pb, al doilea la 200 pb, iar al treilea la
130-150 pb. În bazinul numărul 4, respectiv în godeul 5, sunt evidenŃiate 4 fragmente de
ADN, din care primul la 500 pb, al doilea la 250 pb, al treilea la 200 pb şi al patrulea între
130-150 pb, ceea ce semnalează existenŃa unui polimorfism, confirmat prin secvenŃiere ca
aparŃinând speciei Achlya bisexualis.
La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicolă
Chiochiş, judeŃul BistriŃa-Năsăud, cu 5 bazine, în bazinele 1,2,3 şi 5, apar 3 fragmente cu
următoarele mărimi: primul fragment între 400 şi 500 pb, al doilea fragment între 200 şi 250
pb, iar al treilea fragment între 150-200 pb. Aceste profile electroforetice, corelate cu datele
secvenŃierii şi confruntarea lor în GeneBank, au indicat prezenŃa speciei Saprolegnia ferax.
În bazinul 4, cele 3 fragmente au lungimi diferite, astfel: primul fragment de 500 pb, al
doilea de aproximativ 250 pb, iar al treilea de 150-200 pb. În urma analizei lungimii
fragmentelor de amplificare prin electroforeză, în bazinul 4, se evidenŃiază un polimorfism
diferit faŃă de al celorlalte probe de ADN de la fungi, care pune în evidenŃă prezenŃa unei
alte specii, confirmată ca Achlya bisexualis.
La probele de fungi din familia Saprolegniaceae, provenite din Ferma Piscicolă Daia,
judeŃul Alba, cu 5 bazine, în bazinele 1,2,3,4 se remarcă prezenŃa a 3 benzi de restricŃie, din
25

care prima bandă este la 400 pb, a doua bandă la 200 pb, iar a treia la 130-150 pb, în urma
secvenŃierii identificându-se specia de fungi acvatici Saprolegnia ferax. Se observă un
polimorfism al lungimii fragmentelor la probele de fungi provenite din bazinul 5, confirmat
ca aparŃinând speciei Achlya bisexualis. Primul fragment este de 500 pb, al doilea de
aproximativ 200 pb. Al treilea fragment este slab vizibil.
La probele de fungi din familia Saprolegniaceae, din Ferma Piscicolă Iernut, judeŃul
Mureş, cu 5 bazine, se observă aceleaşi lungimi ale fragmentelor în bazinele 1,2,3 şi 5.
Primul fragment este de 400 pb, al doilea fragment de 200 pb, iar al treilea de 130-150 pb.
Profilele electroforetice aparŃin speciei Saprolegnia ferax, secvenŃiată ulterior. În bazinul 4,
lungimea fragmentelor diferă astfel: primul fragment este de 500 pb, al doilea de
aproximativ 210-220 pb, iar al treilea de 150 pb, fiind vorba de un polimorfism, respectiv de
o altă specie de fungi (Achlya bisexualis).
În cazul probelor de fungi din familia Saprolegniaceae, provenite din Complexul
Piscicol Cefa, judeŃul Bihor, cu 10 bazine, în bazinele 1,2,4,5,6,7 şi 9, cele 3 fragmente au
următoarele lungimi: primul fragment este de 400 pb, al doilea de 200 pb, iar al treilea între
130 şi 150 pb. Aceste polimorfisme aparŃin speciei Saprolegnia ferax. În bazinele 3, 8 şi 10,
fragmentele sunt de mărimi diferite, confirmând în urma secvenŃierii specia Achlya
bisexualis. Primul fragment se vizualizează mai clar, fiind la aproximativ 450 pb. La probele
provenite din bazinele 8 şi 10, se observă prezenŃa unui fragment în plus, al doilea, de 250
pb, al treilea de 200 pb şi al patrulea de aproximativ 130 pb sunt la aceeaşi lungime cu al
doilea şi al treilea fragment de la probele provenite din celelalte bazine.
La Ferma Piscicolă Ineu, judeŃul Arad, fragmentele tuturor probelor de fungi din
familia Saprolegniaceae, din cele 7 bazine analizate au prezentat aceleaşi mărimi: primul de
400 pb, al doilea de 200 pb şi al treilea între 130 şi 150 pb. Analizele ulterioare de
secvenŃiere au confirmat prezenŃa speciei Saprolegnia ferax, în bazinele din locaŃia studiată.
26

II.7. REZULTATE PRIVIND STUDIUL ÎNRUDIRII GENETICE A
FUNGILOR DIN FAMILIA SAPROLEGNIACEAE
Tree Diagram for 12 Variables
Single Linkage
Euclidean distances
Var1
Var7
Var3
Var6
Var2
Var8
Var10
Var11
Var4
Var9
Var5
Var12
0 10 20 30 40 50 60
Linkage Distance
Fig.4. Analiza de filogenie a celor 69 de probe de ADN
de la fungi din familia Saprolegniaceae, provenite din 10 locaŃii
Varianta 1: Ariniş, cu probele din bazinele 1-5, 8,9; Motiş, cu probele din cele 7 bazine;
Varianta 2: Ariniş, cu probele din bazinele 6 şi 7;
Varianta 3: Adrian, cu probele din bazinele 1–4, 6-8, 10;
Varianta 4: Adrian, cu probele din bazinul 5;
Varianta 5:Adrian, cu probele din bazinul 9;
Varianta 6: łaga, cu probele din toate cele 5 bazine;
Varianta 7: Ciurila, cu probele din bazinele 1-3, 5-6; Daia, cu probele din bazinele 1-4;
Iernut, cu probele din bazinele 1-3, 5; Cefa, cu probele din bazinele 1-2, 4-7, 9;
Ineu, cu probele din toate cele 7 bazine;
Varianta 8: Ciurila, cu probele din bazinul 4;
Varianta 9: Chiochiş, cu probele din bazinele 1-3 şi 5;
Varianta 10: Chiochiş, cu probele din bazinul 4;
Varianta 11: Iernut, cu probele din bazinul 4; Daia, cu probele din bazinul 5;
Varianta 12: Cefa, cu probele din bazinele 8 şi 10.
27

Interpretarea dendrogramei efectuate în urma citirii lungimilor fragmentelor de ADN
din toate cele 69 de bazine analizate ne permite să afirmăm următoartele aspecte privind
filiaŃia fungilor din familia Saprolegniaceae identificaŃi (fig.4).
Toate tipurile de fungi identificate au origine ancestrală comună, prima ruptură de
speciaŃie realizându-se la varietatea ancestrală, la o distanŃă de linkage de 58 cM (centi-
Morgani). Una din speciaŃii a evoluat o lungă perioadă de timp, într-o parte a bazinelor
analizate, când din cauza unei mutaŃii punctiforme, localizată la o distanŃă de 20 cM au
apărut alte două speciaŃii. Una din acestea evoluează si în prezent, fiind localizată în bazinele
1-5, 8,9 din locaŃia Ariniş, cele 7 bazine de la locaŃia Motiş (var.1), bazinele 1-3, 5-6 din
Ciurila, bazinele 1-4 din Daia, bazinele 1-3 şi 5 din Iernut, bazinele 1-2, 4-7 şi 9 de la Cefa şi
toate cele 7 bazine din locaŃie Ineu (var.7).
Cealaltă speciaŃie care a evoluat în urma mutaŃiei punctiforme, de la nivelul de 20 cM
a evoluat o perioadă de timp, după care în urma altei mutaŃii punctiforme, la distanŃa de
linkage de 10 cM a generat alte două speciaŃii. Una dintre ele (var.3) evoluează şi a fost
identificată în prezent în bazinele 1-4, 6-8 şi 10 în locaŃia Adrian şi în toate cele 5 bazine din
locaŃia łaga (var.6). Cea de-a doua ramură care s-a desprins din forma ancestrală, la distanŃa
de 58 cM a evoluat în timp până când o mutaŃie punctiformă a determinat crearea a două noi
speciaŃii, la distanŃa de linkage de 42 cM. Una din ramuri a evoluat o perioadă scurtă de
timp, când la o distanŃă de linkage de 35 cM, a realizat o mutaŃie punctiformă care a
determinat crearea a două noi speciaŃii. Una a fost identificată în bazinele 6 şi 7 din locaŃia
Ariniş (var.2). Cealaltă speciaŃie, în urma unei alte mutaŃii punctiforme, la o distanŃă de 30
cM a determinat evoluŃia a două unităŃi taxonomice identificate azi. Una din ele evoluează şi
este foarte activă în bazinul 4 din localitatea Ciurila (var.8) şi bazinul 4 din localitatea
Chiochiş (var.10). Cealaltă ramură desprinsă este identificată şi activează în bazinul 4 din
localitatea Iernut şi bazinul 5 din Daia (var.11).
Cea de-a doua ramură desprinsă la distanŃa de linkage de 42 cM a evoluat o lungă
perioadă de timp într-o parte a bazinelor analizate, după care, la distanŃa de 10 cM, în urma
unei alte mutaŃii, au rezultat 3 speciaŃii, din care două apropiate genetic (var.4 şi 9),
identificate în bazinul 4 din locaŃia Adrian şi bazinele 1-3 şi 5 din Chiochiş. La o distanŃă
28

mai mare genetică, indivizii desprinşi din aceeaşi ramură evoluează în bazinul 9 din ferma
Adrian (var.5) şi cei din bazinele 8 şi 10, localitatea Cefa (var.12).
II.8. REZULTATELE SECVENłIERII SPECIILOR DE FUNGI DIN FAMILIA
SAPROLEGNIACEAE ÎN LOCAłIILE STUDIATE
În urma secvenŃierii automate cu secvenŃiatorul ABI Prism, efectuate la Mycrosinth
(ElveŃia), au fost identificate două specii de fungi acvatici în bazinele studiate, reprezentate
de Saprolegnia ferax şi Achlya bisexualis.
În cazul secvenŃierii speciei Saprolegnia ferax, fragmentul secvenŃiat cu primerii
ITS1 (forward) şi ITS4 (reverse) are o lungime de 743 de perechi de baze, o identitate de
99% şi prezintă două mutaŃii punctiforme faŃă de specia matriŃă din GeneBank. La poziŃia
31, se observă o deleŃie a unei nucleotide C, între nucleotidele A–C şi la poziŃia 368, se
remarcă o substituŃie A cu C.
În cazul secvenŃierii speciei Achlya bisexualis, fragmentul secvenŃiat cu primerii ITS1
(forward) şi ITS4 (reverse) are o lungime de 761 de perechi de baze, o identitate de 99% şi
prezintă 7 mutaŃii punctiforme faŃă de specia matriŃă din GeneBank. La poziŃia 112, se
observă o substituŃie între nucleotidele C cu T; la poziŃia 119, se remarcă o substituŃie G cu
A; la poziŃia 194, o substituŃie T cu G; la poziŃiile 370 şi 371, două substituŃii C cu A; la
poziŃia 416, o substituŃie A cu T şi la poziŃia 633 o substituŃie A cu G.
II.9. INCIDENłA SAPROLEGNIOZEI ÎN AREALUL STUDIAT
DIN CENTRUL ŞI NORD-VESTUL ROMÂNIEI
Aşa cum s-a arătat la începutul acestei teze, saprolegnioza este considerat “ucigaşul
tăcut” al speciilor piscicole, boala producând pierderi extrem de importante în toate
crescătoriile piscicole, îndeosebi la cele ciprinicole.
Saprolegnioza constituie una din cele mai importante cauze ale pierderilor economice
din acvacultură, infecŃiile cu fungi secondând doar bolile bacteriene ca importanŃă
economică. InfecŃiile bacteriene sunt în general cronice, provocând pierderi constante. În
Japonia rata anuală de mortalitate la somonul Coho (Oncorhynchus kisuth) cauzată de
29

Saprolegnia parasitica Coker este de 50%. Acelaşi procent se înregistrează şi la anghilă
(Anguilla anguilla), tot în Japonia. În ScoŃia, saprolegnioza provoacă pierderi economice
importante îndeosebi în crescătoriile de somoni.
În sudul Statelor Unite ale Americii pierderile înregistrate la somn au fost de 50%, iar
pierderea economică de 40 milioane de dolari. În fiecare an crescătorii de somn din S.U.A.
înregistreză pierderi mai mari de 25 milioane de dolari din cauza bolilor acvatice, conform
statisticilor.
În Europa procentul de pierderi la populaŃiile de ciprinide, în zonele în care pe lângă
factorii predispozanŃi reprezentaŃi de suprapopulare, manipularea defectuasă a peştilor,
stresul de reproducŃie determinat de excesul hormonilor corticosteroizi, infecŃiile asociate
(Jeney şi col., 1995), se suprapun şi factorii de poluare a apei şi aerului, procentul de
mortalitate mediu la adulŃi depăşeşte 25%. Pierderi între 50 şi 100% la icre şi de 14 până la
30% la larve şi alevini, între 10 şi 15% la tineret semnalează mai mulŃi autori (Horvath şi
col., 2005). Raportându-ne la situaŃia pe plan mondial şi european, constatăm că în arealul
cuprins în cercetare evidenŃiază şi în cazul nostru pierderi însemnate determinate de
saprolegnioză (tabelul 4).
LocaŃia
Icre în
perioada de
incubaŃie
Procentul de pierderi determinate de saprolegnioză
în locaŃiile studiate la ciprinide (%)
Larve Alevini Tineret
AdulŃi
Tabelul 4
Iarna Primăvara Vara Toamna
Ariniş 70 30 5 3 4 5 5 3
Motiş 40 20 7 5 3 2 3 3
Adrian 58 25 10 5 8 6 6 5
łaga 60 28 10 8 9 5 4 4
Ciurila 30 10 5 5 7 5 4 3
Chiochiş 30 12 10 5 10 6 5 4
Daia 25 15 5 3 5 3 3 3
Iernut 50 25 13 10 10 7 5 5
Cefa 20 5 5 2 3 4 4 4
Ineu 28 7 6 3 4 3 4 3
Media pe
total locaŃii
41,1 16,7 7,6 4,9 6,3 4,6 4,3 4,1
30

MenŃionăm faptul că în toate bazinele piscicole analizate se procedează la dezinfecŃia
anuală a bazinelor în care se practică reproducŃia naturală dirijată, prin golirea şi menŃinerea
lor uscată pe perioada de iarnă. Înainte de umplere bazinele sunt dezinfectate cu var nestins
pe toată suprafaŃa lor. Cu toate acestea, prin modul de manipulare al reproducătorilor şi prin
explozia de tipuri de vegetaŃie, în perioada de reproducŃie se semnalează atacuri masive de
fungi patogeni asupra icrelor, cu pierderi procentuale de până la 70% în locaŃia Ariniş, iar
acolo unde măsurile de igienă sunt extrem de severe, pierderile se ridică la 20% din icre
(locaŃia Cefa). În medie, pe cele 69 bazine din cele 10 locaŃii luate în studiu, pierderile de
icre de ciprinide se ridică la 41,10%. Perioada larvară, mai ales cea cuprinsă în primele 3 zile
de viaŃă, când deplasarea lor este limitată de prezenŃa sacului vitelin, pierderile medii
semnalate pe arealul studiat se ridică la 16,70%, cu un maxim de pierderi de 30% în
Complexul Piscicol Ariniş, şi un minim de 5% în locaŃia Cefa. Perioada de alevini, extrem
de pretenŃioasă ca nivel a oxigenului din apă şi a calităŃii hranei, este puternic afectată de
saprolegnioză. Pierderile medii sunt ceva mai reduse faŃă de perioada larvară, fiind de
7,60%. Cel mai mare procent de pierderi la această categorie, de 13% se semnalează în
locaŃia Iernut, şi un minim de 5% în locaŃiile Ariniş, Ciurila, Daia, Cefa.
Pe perioada de tineret, căreia i se acordă o deosebită atenŃie, în ceea ce priveşte
calitatea apei şi a furajului, când se asigură o densitate optimă de indivizi şi când
manipulările sunt interzise, pierderile determinate de saprolegnioză sunt mult mai reduse, în
medie în arealul studiat fiind de 4,90%.
Perioada de adult nu este ferită de atacul cu Saprolegnia. În majoritatea pescăriilor
luate în studiu se practică pescuitul de toamnă şi mutarea peştilor reŃinuŃi pentru anul
următor în bazinele de iernare. OperaŃiunea de prindere, transport şi repopulare în alt bazin
produc inerente răniri la nivelul cutanat şi al înotătoarelor. Pe perioada de iernare peştii nu
consumă furaj, organismul fiind uşor slăbit şi pe acest fond, sub influenŃa schimbărilor
bruşte de temperatură şi a stratului de gheaŃă, pierderile sunt în medie de 6,30%. În perioada
de primăvară, atât reproducătorii, cât şi peştii reŃinuŃi pentru creştere sunt verificaŃi privind
starea lor de întreŃinere şi sănătate, prin pescuit de control cu plase. Manipularea produce
răniri, care duc la creşterea incidenŃei saprolegniozei, în medie pierderile semnalate în areal
31

fiind de 4,60%. Sfârşitul primăverii şi începutul verii coincide la ciprinide cu perioada de
reproducŃie, când manipularea reproducătorilor, ca şi stresul dat de hormonii corticosteroizi
determină la exemplarele slăbite şi în asociere cu alte boli apariŃia saprolegniozei. Procentul
mediu de pierderi pe toate cele 69 de bazine studiate este de 4,30%.
Un procent mai redus, de 4,10% se înregistrează pe perioada de toamnă, când toate
efectivele de peşti prezintă în general o foarte bună stare de întreŃinere, fiind pregătiŃi de
iernare.
32

CAPITOLUL III
CONCLUZII ŞI RECOMANDĂRI
1. PrezenŃa Saprolegniei în apă, dovedită prin infestarea icrelor, este semnalată indiferent
de luna de recoltare a apei.
2. Cel mai mare grad de infestare al icrelor de ciprinide cu Saprolegnia s-a semnalat la
temperatura apei de 22ºC, când procentul de infestare mediu şi puternic atinge
85,41%, indiferent de lunile calendaristice în care se prelevează probele.
3. Indiferent de mediul de cultură solid utilizat (PDA şi SGA) şi timpul de citire (24, 48
şi 72 ore) se semnalează diferenŃe de la un bazin la altul şi de la o locaŃie la alta a
coloniilor de Saprolegnia analizate.
4. Dezvoltarea coloniilor de Saprolegnia în mediul lichid Potato Dextrose Broth (PDBbulion
cu cartof-dextroză) este superioară celei realizate în mediul lichid Sabouraud
Dextrose Broth (SDB-bulion Sabouraud cu dextroză).
5. Caracterizarea morfologică a tulpinilor de Saprolegnia din coloniile obŃinute,
evidenŃiază hife cu aspect neseptat specifice fungilor inferiori, fiind semnalate
diferenŃe privind prezenŃa reproducŃiei sexuate (la 59,42%) şi absenŃa acesteia (la
40,58%).
6. La toate izolatele de Saprolegnia a fost identificată prezenŃa flagelilor la zoosporii
primari.
7. PurităŃile ADN redate de spectrofotomentrul Nanodrop ND 1000 în urma extracŃiei cu
kit pe microcoloane (Qiagen), oscilează între 1,02 - 1,51, cu o medie a purităŃii
probelor de 1,250, la lungimea de undă 260/280 nm, iar cantităŃile de ADN obŃinute
prin aceeaşi metodă între 2,54 – 14,00 ng/µl, cu o medie de 5,543 ng/µl, iar purităŃile
ADN redate de spectrofotomentru, în urma extracŃiei cu soluŃie ce conŃine PBS, au
valori cuprinse între 1,10 – 1,51, cu o medie de 1,394 la lungimea de undă 260/280
nm, iar cantităŃile de ADN obŃinute prin aceeaşi metodă între 5,23 – 86,56 ng/µl, cu o
medie de 30,653 ng/µl.
33

8. În cazul probelor ADN extrase cu kit QIAGEN, în toate cazurile s-a produs
amplificarea cu ambele perechi de primeri utilizate, cu evidenŃierea fragmentelor de
743 pb la Saprolegnia ferax, respectiv 761 pb la Achlya bisexualis.
9. În cazul probelor ADN extrase cu soluŃii PBS, cu toate că purităŃile şi cantităŃile de
ADN au fost în limite normale, amplificarea probelor de ADN provenite de la
Saprolegnia cu cele două perechi de primeri s-a produs diferit, din cauza prezenŃei în
probe a unor posibili inhibitori fungici, care nu permit ataşarea perechii de primeri
ITS1 şi ITS4, iar în cazul utilizării unui kit de purificare PCR, amplificarea s-a
produs.
10. În cazul probelor extrase cu soluŃii NE, cu toate că purităŃile şi cantităŃile de ADN au
fost în limite normale, amplificarea probelor de ADN provenite de la Saprolegnia cu
cele două perechi de primeri nu s-a produs.
11. Enzima RsaI are specificitate foarte bună pentru situsurile de restricŃie de la
Saprolegnia şi Achlya, motiv pentru care s-a optat pentru utilizarea acesteia în toate
restricŃiile de fragmente efectuate.
12. Enzimele AluI şi HindIII testate de noi în experiment nu au specificitate pentru
situsul de restricŃie de la probele provenite de la Saprolegnia şi Achlya, acestea
nerealizând restricŃia fragmentelor de ADN.
13. În cazul celor 10 locaŃii piscicole analizate şi în cele 69 de probe recoltate, se
semnalează prezenŃa a două polimorfisme de lungime a ADN-ului, în gelurile
analizate.
14. Studiul arborelui filogenetic, pe baza distanŃelor de linkage şi a celor Euclidiene ne
permite să afirmăm faptul că în locaŃiile şi bazinele studiate există diferite genuri din
familia Saprolegniaceae, care manifestă patogenitate diferită faŃă de speciile de
ciprinide.
15. În urma secvenŃierii ADN au fost identificate două specii de fungi acvatici în
bazinele studiate, reprezentate de Saprolegnia ferax (743 pb, o identitate de 99% şi
prezintă două mutaŃii punctiforme faŃă de specia matriŃă din GeneBank) şi Achlya
34

isexualis (761 pb, o identitate de 99% şi prezintă 7 mutaŃii punctiforme faŃă de
specia matriŃă din GeneBank).
16. Cele mai mari pierderi determinate de speciile identificate de noi (Saprolegnia ferax
şi Achlya bisexualis), la speciile de ciprinide din România, sunt semnalate în perioada
de reproducŃie, când procentul de pierderi mediu al icrelor este de 41,10%, iar în
perioada larvară, cu pierderi medii de 16,70%.
17. Speciile identificate produc pierderi în bazinele de creştere ale ciprinidelor din
România, şi la categoriile de tineret (4,90%) şi adult (cu o medie de 6,30% pe
perioada de iernare, 4,60% primăvara, 4,30% vara şi 4,10% toamna).
18. Pierderile semnalate din cauza saprolegniozei variază de la un sezon la altul, de la o
crescătorie la alta în funcŃie de condiŃiile fizico-chimice şi biologice ale apei, de
acurateŃea tehnologiei de creştere aplicate şi de condiŃiile meteorologice generale.
Pe baza rezultatelor obŃinute recomandăm:
1. Recomandăm ca pentru analiza prezenŃei Saprolegniei în bazinele piscicole, probele
de apă să fie prelevate din 4 laturi şi centrul bazinului, la adâncimea de aproximativ
50 cm.
2. Pentru creşterea diferitelor tulpini de Saprolegnia se pretează mediile solide (PDA şi
SGA), dar prin timpul de creştere mai rapid al coloniilor recomandăm mediul PDA.
3. Întrucât în analiza de ADN sunt necesare cantităŃi mai mari de fungi şi Ńinând cont de
modul de dezvoltare a Saprolegniei în cele două medii lichide, recomandăm utilizarea
mediului lichid Potato Dextrose Broth (PDB-bulion cu cartof-dextroză) în
experimentele pe speciile genului.
4. Recomandăm extracŃia ADN-ului fungic cu kituri (QIAGEN) şi neutilizarea extracŃiei
cu soluŃii (PBS şi NE), care cu toate că realizează purităŃi şi cantităŃi de ADN în
limite normale, realizează parŃial sau nu realizează amplificarea probelor de ADN
provenite de la Saprolegnia.
35

5. În cercetările pe fungi acvatici recomandăm utilizarea enzimei RsaI, care are o
specificitate foarte bună pentru situsurile de restricŃie de la Saprolegnia şi Achlya, şi
neutilizarea enzimelor AluI şi HindIII, care nu au specificitate pentru situsul de
restricŃie.
6. Pentru caracterizarea genetică a fungilor acvatici din familia Saprolegniaceae,
recomandăm utilizarea metodei PCR-RFLP descrisă de Ristaino şi col., 1998,
adaptată de noi.
7. Pentru identificarea precisă a genurilor şi speciilor din familia Saprolegniaceae,
recomandăm utilizarea secvenŃierii ADN şi compararea rezultatelor cu cele din
GeneBank.
8. Pentru evitarea pierderilor datorate saprolegniozei, în bazinele de ciprinide din centrul
şi nord-vestul României, recomandăm o deosebită vigilenŃă a crescătorilor
concretizată în: controlul permanent al calităŃii apei, controlul tipurilor de vegetaŃie
existentă în bazine, evitarea traumatizării peştilor prin manipulări, evitarea stresului
prin oscilaŃiile nivelului apei, ca şi a tipului de furaj utilizat.
36

BIBLIOGRAFIE SELECTIVĂ
1. Colao Maria Chiara, 1999, Proprieta cinetiche e molecolari di laccasi fungine,
Universita degli Studi della Tuscia, Viterbo, 99 pg.;
2. Coşier Viorica, 2007, Inginerie genetică, Ed. Risoprint, Cluj-Napoca;
3. Dick, M.W., 1969, Morphology and taxonomy of the Oomycetes, with special
reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. I. Sexual reproduction,
New Phytol., 68, 751–775;
4. Dick, M.W., 1972, Morphology and taxonomy of the Oomycetes, with special
reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. II. Cytogenetic
systems, New Phytol., 71, 1151–1159;
5. Dieguez-Uribeondo, J., Fregeneda-Grandes, J.M., Cerenius, L., Elena Perez-
Iniesta, Aller-Gancedo, J.M., Teresa M. Telleri, Soderhall, K., Maria P. Martin,
2007, Re-evaluation of the enigmatic species complex Saprolegnia diclina–
Saprolegnia parasitica based on morphological, physiological and molecular data,
Fungal Genetics and Biology, 44, 585–601;
6. Fernandez-Benitez Maria Jose, Ortiz-Santaliestra, M.E., Lizana, M., Dieguez-
Uribeondo, J., 2008, Saprolegnia diclina: another species responsible for the
emergent disease‘Saprolegnia infections’ in amphibians, FEMS Microbiol. Lett., 279,
23–29;
7. Francesconi, A., Kasai, M., Susan M. Harrington, Mara G. Beveridge, Ruta
Petraitiene, Petraitis, V., Schaufele, R. L., Walsh, T J., 2008, Automated and
manual methods of DNA extraction for Aspergillus fumigatus and Rhizopus oryzae
analyzed by Quantitative Real-Time PCR, Journal of Clinical Microbiology, 46:6,
1978–1984;
8. Fregeneda Grandes, J.M., Fernandez Diez, M., Aller Gancedo, J.M., 2000,
Ultrastructural analysis of Saprolegnia secondary zoospore cyst ornamentation from
infected wild brown trout, Salmo trutta L., and river water indicates two distinct
morphotypes amongst long-spined isolates, Journal of Fish Diseases, 23, 147–160;
37

9. Frisvad, J.C., Bridge, P.D., Arora, D.K., 1998, Chemical fungal taxonomy, Marcel
Dekker Inc., New York, 398 pg.;
10. Heath, I.B., Karen Rethoret, 1981, Nuclear cycle of Saprolegnia ferax, J. Cell Set.,
49, 353-367;
11. Johnson Jr., T.W., Seymour, R.L., Padgett, D.E., 2002, Biology and systematics of
the Saprolegniaceae, on-line publication: http://www.ilumina-dlib.org., 1028 pg.;
12. Kamoun Sophien, 2003, Molecular genetics of pathogenic oomycetes, Eukaryotic
Cell, 2:2, 191–199;
13. Lategan, M.J., Gibson, L.F., 2003, Antagonistic activity of Aeromonas media strain
A199 against Saprolegnia sp., an opportunistic pathogen of the eel, Anguilla australis
Richardson, Journal of Fish Diseases, 26, 147-153;
14. Lategan, M.J., Torpy, F.R., Gibson, L.F., 2004, Biocontrol of saprolegniosis in
silver perch Bidyanus bidyanus (Mitchell) by Aeromonas media strain A199,
Aquaculture, 235, 77-88;
15. Leclerc, M.C., Guillot, J., Devilla, M., 2000, Taxonomic and phylogenetic analysis
of Saprolegniaceae (Oomycetes) inferred from LSU rDNA and ITS sequence
comparisons, Antonie van Leeuwenhoek, 77, 369–377;
16. Llanos Frutos, R., M. Teresa Fernández-Espinar, Querol, A., 2004, Identification
of species of the genus Candida by analysis of the 5.8S rRNA gene and the two
ribosomal internal transcribed spacers, Antonie van Leeuwenhoek, 85, 175–185;
17. Oroian, R.G., Oroian, T.E., Crina Teodora Carşai, Viorica Coşier, L. Sasca,
2009, RAPD technique used in analyzing the genetic structure of Cyprinus carpio
species – Galitian and Lausitz varieties, International symposium “Modern animal
husbandry-science, creativity and innovation”, Lucrări ştiinŃifice seria Zootehnie,
USAMV Iaşi, cotaŃie CNCSIS B+, 52:14, 444-449;
18. Oroian, R.G., Vlaic, A., Oroian, T.E., 2008, PCR technique used in Saprolegnia sp.
genetical characterization, Lucrări ŞtiinŃifice - Universitatea de Ştiinte Agricole şi
Medicină Veterinară Iaşi, Seria Zootehnie, vol. 51, 631-634;
38

19. Oroian, T.E., 2006, SelecŃia asistată de markeri la crap, Ed. Risoprint, Cluj-Napoca,
180 pg.;
20. Oroian, T.E., Oroian, R.G., Cristina Hegeduş, Cighi, V., Dronca, D., 2009, The
monitoring of phytoplankton evolution by biological year within Arinis-Maramures
fishery complex, International symposium “Modern animal husbandry-science,
creativity and innovation”, Lucrări ştiinŃifice seria Zootehnie, USAMV Iaşi, cotaŃie
CNCSIS B+, 52:14, 456-461;
21. Paul, B., Monica M. Steciow, 2004, Saprolegnia multispora, a new oomycete
isolated from water samples taken in a river in the Burgundian region of France,
FEMS Microbiology Letters, 237, 393–398;
22. Ristaino, J.B., Madritch, M., Trout, C.L., Parra, G., 1998, PCR amplification of
ribosomal DNA for species identification in the plant pathogen genus Phytophthora,
Applied and Environmental Microbiology, 64:3, 948-954;
23. Stueland, S., Hatai, K., Skaar, I., 2005, Morphological and physiological
characteristics of Saprolegnia spp. strains pathogenic to Atlantic salmon, Salmo salar
L., Journal of Fish Diseases, 28, 445-453;
24. Vlaic, A., 2007, Genetica peştilor, Ed. Risoprint, Cluj-Napoca, 150 pg.;
25. White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Beatriz
L. Gomez, Carr, M.J., Kimmitt, P.T., Shila Seaton, Rajakumar, K., Tessa
Holyoake, Chris C. Kibbler, Elizabeth Johnson, Hobson, R.P., Jones, B.,
Rosemary A. Barnes, 2006, A consensus on fungal Polymerase Chain Reaction
diagnosis, Journal of Molecular Diagnostics, 8:3, 376-384;
26. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990, Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand,
D.H., Sninsky, J., White, T.J. (Eds) PCR protocols (pg 315–322), Academic Press,
San Diego;
27. *** http://www.fermentas.com
28. *** http://www.ncbi.nlm.nih.gov
29. *** http://www.qiagen.com
39

30. *** http://www.sigmaaldrich.com
31. *** http://www.tnfish.org/FishDiseasesParasites_TWRA/files/Saprolegnia.pdf
40

UNIVERSITY OF AGRICULTURAL SCIENCES
AND VETERINARY MEDICINE CLUJ-NAPOCA
DOCTORAL SCHOOL
FACULTY OF ANIMAL PRODUCTION
AND BIOTECHNOLOGIES
Vet. Oroian Rareş Gelu
The genotypization of Saprolegnia species and the
establishing of their pathogenicity upon different
carp species from centern and north-western
Romanian fisheries
-SUMMARY OF THE PhD. THESIS-
SCIENTIFIC COORDINATOR
Prof.univ.dr.eng. AUGUSTIN VLAIC
Cluj-Napoca
41

2010
CONTENTS
CHAPTER I ........................................................................................................................................... 4
EXPERIMENTAL HYPOTHESIS, RESEARCH OBJECTIVES,
EXPERIMENTAL DISPOSAL, MATERIAL AND METHOD........................................................... 4
I.1. EXPERIMENTAL HYPOTHESIS AND RESEARCH OBJECTIVES ..................................... 4
I.2. EXPERIMENTAL DISPOSAL................................................................................................... 5
I.3. MATERIAL AND METHOD ..................................................................................................... 7
I.3.1. Sample collecting.................................................................................................................. 7
I.3.2. The initiation of Saprolegnia culture in laboratory conditions............................................. 7
I.3.3. Culture media used ............................................................................................................... 8
I.3.3.1. Solid culture media used in the experiment ................................................................... 9
I.3.3.2. Liquid culture media used in the experiment............................................................... 50
I.3.3.3. Antibiotics used in the experiment ............................................................................... 51
I.3.4. Morphological characterization of Saprolegnia strains...................................................... 51
I.3.5. Fungal DNA extraction and detection ................................................................................ 52
I.3.5.1. Fungal DNA extraction using extraction kits (QIAGEN) ............................................ 52
I.3.5.2. Fungal DNA extraction using solutions....................................................................... 52
I.3.6. DNA quantification using direct method of DNA purity and concentration with
Nanodrop ND-1000 spectrophotometer ....................................................................................... 53
I.3.7. ITS region from fungi and primers used............................................................................. 53
I.3.8. Molecular techniques used in the experiment..................................................................... 55
I.3.8.1. PCR amplification of Saprolegnia samples ................................................................. 55
I.3.8.2. PCR-RFLP techique - Restriction Fragment Length Polymorphism .......................... 56
I.3.9. Methods used in establishing the phylogenetic diversity
and relationship of Saprolegniaceae family fungi species........................................................... 56
I.3.9.1. Automatic sequencing .................................................................................................. 56
CHAPTER II........................................................................................................................................ 56
PERSONAL RESEARCH RESULTS................................................................................................. 56
II.1. THE RESULTS OF SAPROLEGNIA CULTURE IN
LABORATORY CONDITIONS ..................................................................................................... 57
II.2. RESULTS REGARDING SAPROLEGNIA’S GROWTH AND
DEVELOPMENT ON THE CULTURE MEDIA ........................................................................... 58
II.2.1. Comparative results regarding the growth
of Saprolegnia colonies on solid culture media ........................................................................... 58
II.2.2. Comparative results regarding the development
of Saprolegnia colonies on the liquid culture media.................................................................... 19
II.3. THE MORPHOLOGICAL DESCRIPTION OF SAPROLEGNIA STRAINS......................... 19
II.4. RESULTS REGARDING SAPROLEGNIA’S DNA
EXTRACTION AND QUANTIFICATION.................................................................................... 61
II.4.1. DNA extraction.................................................................................................................. 61
II.5. THE DNA AMPLIFICATION RESULTS OF FUNGAL SPECIES
FROM SAPROLEGNIACEAE FAMILY ......................................................................................... 62
II.5.1. DNA amplification using PCR .......................................................................................... 62
II.6. THE DNA ENZYMATIC RESTRICTION RESULTS OF FUNGAL
42

SPECIES FROM SAPROLEGNIACEAE FAMILY USING PCR-RFLP METHOD...................... 63
II.7. RESULTS REGARDING THE GENETIC PHYLOGENY
STUDY OF SAPROLEGNIACEAE FAMILY FUNGI.................................................................... 67
II.8. SEQUENCING RESULTS OF THE SAPROLEGNIACEAE FAMILY
FUNGAL SPECIES FROM THE STUDIED LOCATIONS .......................................................... 28
II.9. THE INCIDENCE OF SAPROLEGNIASIS IN THE CENTRAL
AND NORTH-WESTERN ROMANIAN AREAL......................................................................... 28
CHAPTER III....................................................................................................................................... 72
CONCLUSIONS AND RECOMMENDATIONS............................................................................... 72
SELECTIVE BIBLIOGRAPHY.......................................................................................................... 76
43

INTRODUCTION
Saprolegniasis is one of the most important causes of economic losses in aquaculture,
fungal infections are second only to bacterial diseases in economic importance. Fungal
infections are generally restricted to chronic, steady losses. Saprolegnia infests a large
number of teleosts, as: channel catfish, pike, bass, roach, carp, salmonids, sturgeon,
barramundi, tilapia; being associated with tropical fish: gourami, guppy, platyfish.
In Japan, there is an annual mortality rate of 50% in coho salmon (Oncorhynchus
kisutch) due to Saprolegnia parasitica Coker. Fifty percent per year losses have also been
reported in elver (Anguilla anguilla) culture in Japan. In Scotland, saprolegniasis causes
important economic losses especially in salmon fisheries. In the southeastern of United
States, major losses of 50% occur in channel catfish farming, and the economic loss of 40
million dollars.
In Romania, until now, there is not a scientific estimation of the fisheries losses due
to saprolegniasis.
CHAPTER I
EXPERIMENTAL HYPOTHESIS, RESEARCH OBJECTIVES,
EXPERIMENTAL DISPOSAL, MATERIAL AND METHOD
I.1. EXPERIMENTAL HYPOTHESIS AND RESEARCH OBJECTIVES
The bibliographic study on fish saprolegniasis in general, and particularly on carp
species, indicates the fact that in the world, because of the differences generated by the
diversity of water and soil types, by the medium annual temperatures, by the habitation
degree and by the existent fish species, the disease is generated by many species of
Saprolegnia, which have different specificity and pathogenicity, depending on the factors
listed above.
44

The specific literature presents updated preoccupations regarding the identificationd
and classification of different Saprolegnia species and subspecies, saprophytic and
conditioned pathogenic at different fish species. This fact indicates that there is not sufficient
the strain morphologic strict identification, but there is needed a molecular additional
characterization regarding DNA structure, which could permit a correct identification and
the establishing of genetic distances between Saprolegnia populations and subpopulations.
This fact is necessary because the technological losses in fish industry, raported at
international and national level, caused by saprolegniasis, which are affecting the fish
development from spawn, larva, alevin, young fish and adults, are reaching up to 50% from
production, which has a negative impact on the fisheries economical and financial situation.
Starting from those considerations, by the research hypothesis we proposed the
morphologic and molecular identification and description, using DNA samples, of
Saprolegnia species and subspecies, which are affecting carp species populations from
centern and north-western romanian fisheries. In Romania there haven’t been made any
genetic studies on Saprolegnia species and subspecies, which affect carp species, and which
could be the starting point in the future for DNA vaccination technology, at reproduction
individuals. The study of Saprolegnia local isolates will have an obvious contribution at the
development of the disease control strategies.
The research objectives were the following:
1. The establishing of experimental plan and protocole;
2. The optimization of Saprolegnia culture methods;
3. The optimization of Saprolegnia DNA extraction and amplification methods;
4. The testing of different restriction enzymes using PCR-RFLP technique;
5. The establishing of genetic distances between identified species from Saprolegniaceae
family;
6. The monitor of saprolegniasis incidence at carp species from centern and northwestern
part of Romania.
45

I.2. EXPERIMENTAL DISPOSAL
The experimental disposal was placed in the centern and north-western part of
Romania, including in the control, fishponds localized as it follows:
Ariniş Fishery Complex, Maramureş county, with 9 fishponds;
Motiş Fishery Complex, Sălaj county, with 7 fishponds;
Adrian Fishery Complex, Satu Mare county, with 10 fishponds;
łaga Fishery, Cluj county, with 5 fishponds;
Ciurila Fishery, Cluj county, with 6 fishponds;
Chiochiş Fishery, BistriŃa-Năsăud county, with 5 fishpons;
Daia Fishery, Alba county, with 5 fishponds;
Iernut Fishery, Mureş county, with 5 fishponds;
Cefa Fishery Complex, Bihor county, with 10 fishponds;
Ineu Fishery, Arad county, with 7 fishponds;
In this experimental disposal, representative as areal distribution, including all types
of water and soil existing, we have organized more experiments.
We are presenting the repartition of the locations, marked with white points on the
map of Romania (fig.1).
46

Fig.1. The locations where the researches took place
I.3. MATERIAL AND METHOD
I.3.1. Sample collecting
For the sample representativeness of the analyzed fisheries, the collecting of water
samples included a completely randomized experimental plan. There were established the
fishponds from each fishery, being monitored: the water surface area, with the depth and
biological characteristics, as well as the structure of phytoplankton and zooplankton, and the
fish species which populate them. For the results accuracy in Saprolegniaceae family species
identification, beside the current observations made in the experimental period, we took
water samples from each fishpond studied, in 3 different months of the year (December,
March, June), irrespective of the fishpond surface area, comprised between 0,5 and 30 Ha.
47

The experimental model used, included the collecting of 5 water samples from each
fishpond, from the 4 lake sides and from centre, and 50 cm medium depth. From the 5
samples we made a single water sample, which was subsequent analyzed in laboratory
conditions.
For the identification of different species from Saprolegniaceae family, we collected
and analyzed water samples, carp species and spawns affected by disease, from Transylvania
monitored fishponds. The water samples were collected in 2 litres recipients, from the 5
areas of each fishpond, then the 5 samples were mixed in a 15 litres tank, collecting for the
analyze a single blended sample from each fishpond, in a 2 litres recipient. The transport
was made in the first 12-24 hours from the collection and the analysis were performed in the
next day.
I.3.2. The initiation of Saprolegnia culture in laboratory conditions
To ensure that the possible differences, which could appear between the fungal
species from Saprolegniaceae family present in the water, could be strict attributed to the
differences given by water nature and the species which populates it, we performed as it
follows: from each water sample, in a quantity of 2 litres, we made up 3 samples of 100 ml,
in plastic sterile recipients. In each recipient there were introduced 10-15 spawns from the
same carp female. Because the literature offers contradictory data respecting Saprolegnia’s
development temperature in different world areals, we suggested the testing of the fungus
growing and development mode, at 3 levels of temperature: 10°C, 15°C and 22°C.
Water samples, containing 10-15 spawns for artificial infestation, were introduced in
a incubator, following the temperatures mentioned, between 3-7 days. In this period we
made daily observations on each sample, to find out the starting moment of fungus
infestation upon spawns and the intensity of its development at that temperature.
There was constituted a number of 207 samples for each collecting month, 3 samples
for each fishpond, which were monitored at the 3 temperature levels, and making an
48

estimation of the spawns infestation degree, with marks from 0 to 4, at 48, 96 and 144 hours.
The data interpretation was made by estimating the medium score of all the samples from
the same thermal gradient, the differences being percentual expressed.
The marks used have the following significations:
0 – uninfested
1 – very weak infested
2 – weak infested
3 – medium infested
4 –strong infested
I.3.3. Culture media used
The scientific literature underlines the fact that, generally, in the fungi cultures
development could be used either solid media, or liquid ones. Liquid media allow the
development of fungal mycelium in a large quantity, that could be used in techniques for
DNA extraction (Dieguez-Uribeondo and al., 2007; Fernandez-Benitez and al., 2008).
In this research we utilized comparatively 2 solid media: Potato Dextrose Agar (PDA)
and Sabouraud 2% Glucose Agar (SGA), and 2 liquid media: Potato Dextrose Broth (PDB)
and Sabouraud Dextrose Broth (SDB).
The spawns were sterile collected in Petri dishes and washed with distilled water
containing 100 mg L -1 Penicillin G potassium salt. Then, were inoculated in two solid
media: Potato Dextrose Agar (PDA) and Sabouraud 2% Glucose Agar (SGA), and for
preventing the bacterial growing, we added the same antibiotic, in the recommended
concentration. The colonies were preserved then on PDA and SGA media, in the incubator
for 3 days, at the mentioned temperatures (10, 15 and 22°C). In this period we observed
Saprolegnia colonies growing speed and their diameter (adapted after Fernandez-Benitez
and al., 2008). The original contribution consisted in the fact that we used two comparative
solid culture media and three temperature gradients for each medium.
49

I.3.3.1. Solid culture media used in the experiment
The two solid culture media used in the experiment were the following (according to
http://www.sigmaaldrich.com):
Potato Dextrose Agar (PDA) (Fluka)
Sabouraud 2% Glucose Agar (SGA) (Fluka)
From each fishpond, we made an inoculation in the two solid culture media used
(PDA, SGA), from the most developed sample, for making comparative observations
respecting the developing mode of fungal species from Saprolegniaceae family.
For testing the growing rate on agar solid medium, in Petri dishes containing the two
solid culture media (PDA, SGA) and incubated at 22°C ± 2°C for 72 hours, we observed
Saprolegnia’s hyphae growing rate. The radial diameter growth was measured at every 24
hours. The hyphae reached the maximum capacity of radial growth, when those have get
until the edge of Petri dises (>40 mm) (adapted after Stueland and al., 2005).
At 72 hours of development on the solid media, fungal colonies were moved on the
liquid ones, in the following procedure: the colonies from Potato Dextrose Agar (PDA) solid
medium were transfered on Potato Dextrose Broth (PDB) liquid medium, and the colonies
from Sabouraud 2% Glucose Agar (SGA) solid medium, on Sabouraud Dextrose Broth
(SDB) liquid medium. This experiment was performed to be able to observe and recommend
the best transfer procedure from a solid medium to a liquid one.
I.3.3.2. Liquid culture media used in the experiment
The liquid media used in the experiment were the following (according to
http://www.sigmaaldrich.com):
Potato Dextrose Broth (PDB) (Fluka)
Sabouraud Dextrose Broth (SDB) (Fluka)
All the saprolegnian colonies from the solid media were moved in Erlenmeyer
glasses, with 100 ml antibiotic liquid medium and kept in an rotary shaker incubator, at the
temperature of 22°C ± 2°C, for 5-7 days, depending on the developing degree. The mycelial
50

pellets were filtred, washed with distilled water and maintained at -20°C until DNA was
extracted (adapted method after Leclerc and al., 2000).
We mention the fact that this procedure was applied to fungi samples obtained from
the water collected in June 2009, including 138 samples, whereby 69 samples on solid-liquid
medium combination, Potato Dextrose Agar (PDA)- Potato Dextrose Broth (PDB), and the
other 69 samples on solid-liquid Sabouraud 2% Glucose Agar (SGA) - Sabouraud Dextrose
Broth (SDB).
I.3.3.3. Antibiotics used in the experiment
For preventing the bacterial development and contamination, in the fungi culture
media there are used more types of antibiotics (Lategan and al., 2003, 2004). In our
experience, we opted for Penicillin G potassium salt (Sigma). We used the working
concentration of de 100 mg L - Penicillin G potassium salt, on both solid and liquid media.
I.3.4. Morphological characterization of Saprolegnia strains
For the morphological characterization of Saprolegnia strains, developed on culture
media, we analyzed the 69 samples with the following aspects: the hyphal type specific to
Saprolegnia genus, the asexual reproduction (flagella presence on primary zoospores) and
the formation of sexual structures (antheridia and oogonia).
Fungal strains collected from each fishpond, at 72 hours of growing on PDA solid
medium, were inoculated in 9 cm diameter plastic Petri dishes, on the same PDA medium, at
22ºC, 5,5 pH. Saprolegnia’s growing was periodically examined at the microscope, for 2-3
weeks, to check the developing of sexual structures. All the strains were characterized and
identified pursuant to the control keys communicated by Johnson Jr. and al., 2002 (Dieguez-
Uribeondo and al., 2007).
The microscope observations were performed for each sample from each fishpond,
after the following procedure: we isolated with a microbiological dowser a part of the colony
51

developed on PDA medium, then was placed on a histological slide, minced with a scalpel,
was added a droplet of Lugol solution for coloring, homogenized, and in the end the sample
was covered with a histological slide. The observations were performed with the phase
contrast microsope and the images were analyzed with a adapted digital camera.
I.3.5. Fungal DNA extraction and detection
DNA extraction was made pursuant to the protocol of Colao Maria Chiara (1999).
DNA was extracted from fungal mycellium developed in pure culture on PDB (Potato
dextrose broth) liquid medium. We used Qiagen extraction kit Dneasy Plant Minikit
(pursuant to http://www.qiagen.com) and DNA rapid extraction using PBS (phosphate saline
buffer) solution. The DNA extraction was applied to 69 samples, obtained on Potato
Dextrose Agar (PDA) solid medium-Potato Dextrose Broth (PDB) liquid medium
combination. Each sample from each fishpond was divided in two equal parts, being realized
a total number of 138 samples, performing a comparative extraction for the two methods
used.
I.3.5.1. Fungal DNA extraction using extraction kits (QIAGEN)
The DNeasy Plant minikit is a spin column procedure that incorporates sample lysis,
removal of RNA, removal of proteins and polysaccharides, DNA precipitation, and binding
to the spin column membrane. Multiple washes are performed to remove contaminants, and
DNA is then eluted from the membrane.
Equipment, materials and reactives used:
- Stationary phase fungal colonies (approximate 1 x 10 9 ), 69 samples, on fishponds
provenance; Qiagen kit.
I.3.5.2. Fungal DNA extraction using solutions
52

The DNA rapid extraction using PBS solution, applied on 69 samples, performed
in the following way: there was weighted 120 mg of fungal tissue in an Eppendorf tube and
added 200 µl PBS solution. The samples were centrifuged at 3000 rpm, for 20 minutes, then
the supernatant was removed. This operation repeated five times, until the fungal DNA
pellet was clean. Then, the samples were introduced in a marine bath, at 95°C for 15
minutes, to disrupt the cell wall. The samples were dried for 30 minutes, and then was addes
TE (Tris-EDTA) solution for DNA rehydrating.
For the DNA rapid extraction method with NE solution are used some chemical
substances, the solutions being made in a laboratory. The materials and expendables were
the following: Eppendorf pipettes, with adjustable volumes; Eppendorf tubes; pipette tips of
different dimensions (large, medium and small); sterile water.
I.3.6. DNA quantification using direct method of DNA purity and concentration with
Nanodrop ND-1000 spectrophotometer
For the establishing of DNA purity and concentration, there was used Nanodrop ND-
1000 spectrophotometer. To be able to find the DNA concentration extracted from fungal
samples, we used the direct method, which involves the optical density measurement of
DNA sample, at 260/280 nm ripple length on a spectrophotometer, in UV/VIS domain.
I.3.7. ITS region from fungi and primers used
At the fungi and other eukaryotes, there are two locations for rDNA: the nuclear and
the mitochondrial genome. The last one contains two genes which are coding the small and
large mitochondrial genes of rDNA. Fungal nuclear rDNA is generally structured in a
tandem repeated nuclear unit. A rDNA unit, illustrated in fig.2, includes 3 rRNA genes:
small nuclear (18S) rRNA, 5,8S rRNA and large nuclear (28S) rRNA gene. In a unit, the
53

genes are separated by two internal transcribed spacers (ITS1 and ITS2), and two rDNA
units separated by intergenic spacer (IGS). The last rRNA gene (5S) can or can’t be in the
interior of repeated unit (Kamoun, 2003).
Fig.2. Diagram of nuclear ribosomal DNA repeat unit
(Frisvad and al., 1998)
With the exception of some variable domains of the rRNA genes, the coding regions
are highly conserved among organisms, thus allowing comparisons between distantly related
fungi. In contrast, because they evolve rapidly, noncoding regions have more variability than
coding regions. The noncoding internal transcribed spacers (ITS1 and ITS2) can be used to
discriminate between closely related species within a fungal genus. The ITS region,
including the ITS1, the 5,8S rRNA gene, and the ITS2, is about 600 to 1000 base pairs and
can be amplified either fully or partly, using “universal” primers described by White and al.,
in 1990.
The ITS region is now perhaps the most widely sequenced DNA region in fungi. It
has typically been most useful for molecular systematics at the species level, and even
within species (e.g., to identify geographic races). Because of its higher degree of variation
than other genic regions of rDNA (SSU and LSU), variation among individual rDNA repeats
can sometimes be observed within both the ITS and IGS regions. In addition to the standard
primers used by most labs (ITS1 and ITS4), everal taxon-specific primers have been
described that allow selective amplification of fungal ITS sequences.
The primers used in PCR reaction were the following (standardized by White and al.,
1990):
- ITS1, with 5’-3’ sequence: TCCGTAGGTGAACCTGCGG;
- ITS4, with 5’-3’ sequence: TCCTCCGCTTATTGATATGC;
- ITS5, with 5’-3’ sequence: GGAAGTAAAAGTCGTAACAAGG;
54

We used a comparatively mixture of two primer pairs, in the following combination:
ITS1 with ITS4 and ITS4 with ITS5. ITS1 primer is attaching at the 3’ end of the 18S rDNA
gene and ITS4 primer is at the 5’end of the 28S rDNA gene (after Paul B. And al., 2004).
The last combination of primers is used to amplify the region of the rDNA repeat unit that
includes the two non-coding regions designated as the internal transcribed spacers ITS1 and
ITS2, and the 5,8S rDNA gene (Llanos Frutos and al., 2004).
I.3.8. Molecular techniques used in the experiment
I.3.8.1. PCR amplification of Saprolegnia samples
In our experience we used ITS1 and ITS4, ITS4 and ITS5 primer pair combinations
(White and al., 1990), which amplify ITS1 region, 5,8S rRNA gene and ITS2. The
amplification reactions were individually performed, in a final volume of 25 µl, with an
Eppendorf thermocycler.
The amplification cycling parameters were: initial denaturation at 95°C for 3 minutes,
followed by 35 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute,
and extension at 72°C for 1 minute, with a final extension at 72°C for 7 minutes. The
amplification products were separated by electrophoresis in 1,5% agarose gels, in 1x TBE
buffer, for 60 minutes at 70V. The DNA was stained with Sybr Safe (Invitrogen) and
visualized under UV light. The gel was photographed and the image recorded on the
machine (Biorad).
The lengths of amplification products were estimated by comparison to a DNA
Ladder Low Range (700 bp) or 50 bp (Fermentas) (adapted after Ristaino and al., 1998).
We tested another amplification method, which was performed in an Eppendorf
thermocycler, after the following protocol:
- initial denaturation: 5 minutes at 95°C
- 35 cycles: - denaturation 30 seconds at 95°C
- annealing 30 seconds at 48°C
55

- extension 90 seconds at 68°C
- final extension: 7 minutes at 68°C (after Coalo Maria Chiara, 1999).
The amplification performed on 69 samples, developed on Potato Dextrose Broth
(PDB) medium, using an adapted method after Ristaino and al., 1998.
I.3.8.2. PCR-RFLP techique - Restriction Fragment Length Polymorphism
The amplified fragments were digested with 3 restriction enzymes from Fermentas:
RsaI, HindIII and AluI. The digestion protocol was pursuant to the manufacturer
(http://www.fermentas.com).
The PCR products were overnight incubated, at 37ºC, and at the end at 65ºC for 10
minutes. The digestion products were then separated by electrophoresis, in a 3% agarose gel,
in 1x TBE buffer, for 2 hours at 60V. The DNA was stained with Sybr Safe (Invitrogen), for
the observation of amplified fragments polymorphism, under UV light (Biorad). There was
used a DNA Ladder Low Range (700 bp), for the fragment comparison (Fermentas).
I.3.9. Methods used in establishing the phylogenetic diversity
and relationship of Saprolegniaceae family fungi species
I.3.9.1. Automatic sequencing
The DNA strand was sequenced with universal primers ITS1 (forward) and ITS4
(reverse), by Mycrosinth (Switzerland). The sequencing results were interpreted using a
specific software called Chromas Lite.
For the establishing of genetic diversity there were used specific genetical software.
CHAPTER II
PERSONAL RESEARCH RESULTS
56

II.1. THE RESULTS OF SAPROLEGNIA CULTURE IN
LABORATORY CONDITIONS
We expressed in percentage from the total number of analyzed samples, every
infestational score from each temperature level, regardless the fishponds and fisheries (table
1).
Spawns infestation degree with Saprolegnia based on temperature
percentage estimated from the total number of samples (207)
Temperature
Infestational degree
Table 1
0 1 2 3 4
10°C 4,34 38,64 54,58 2,41 0
15°C 0,96 11,11 32,36 51,20 4,34
22°C 0,96 0,96 12,56 45,41 40,09
Legend: 0 – uninfested; 1 - very weak infested; 2 - weak infested; 3 – medium infested; 4 –
strong infested.
From the table data results the fact that saprolegniasis development is different from
one incubation temperature to another. At 10°C, 38,64% from the samples had the score of
1, which indicates a very weak infestation at 144 hours of incubation. A percentage of
54,58%, more than half of the analyzed samples, are weak infested, and only 2,41% are
medium infested.
At 15°C, only 0,96% from the samples do not manifest any infestation sign,
comparative to 4,34% uninfested samples at 10°C. A weak infestation degree, of 32,36%
from samples is reached at 15°C, and the infestation medium level at 51,20%. Compared to
the temperature gradient of 10ºC, at 15°C there is a percentage of 4,34% with strong
infestation.
At 22ºC, 40,09% from the samples have a strong infestation degree, 45,41% have a
medium infestation, and only 0,96% are uninfested. Those data indicate the fact that
regardless the fishpond, the area and the time of the year, saprolegniasis as disease spreads
with a high intensity and a shorter period at 20°C. This result confirms the literature data
regarding the carp spawns and larvae losses, communicated by fishery owners and
57

esearchers, which take place in May-June months, the reproduction period, when there is
observed a high incidence of saprolegniasis. At lower temperatures, the fungus is present
even if to infest the fish populations it needs a longer incubation period. At carp populations,
which are wintering under the ice and have reduced movements, the incidence is lower
compared to the other species, being infested only the individuals which were weak in
winter period or had wounds generated by manipulation procedures.
II.2. RESULTS REGARDING SAPROLEGNIA’S GROWTH AND
DEVELOPMENT ON THE CULTURE MEDIA
II.2.1. Comparative results regarding the growth
of Saprolegnia colonies on solid culture media
We used two solid media to be able to test comparatively the growth type of the
colonies, at 24, 48 and 72 hours. From each fishpond of each fishery, there were constituted
2 samples, one for each medium. Because the two samples from the two media, are
originating from the same culture, inoculated at 6 days, we consider that the growing
differences at the same temperature gradient, of 22°C, are assigned to the differences
between species and to the culture requests.
To interpret statistical correctly the colonies growth differences on the two culture
media and at the three temperature gradients, we present in table 2 the average values of
colonies development in mm.
The diameter averages of Saprolegnia colonies at 24, 48 and 72 hours
of development on the two solid culture media (in mm)
Table 2
58

Reading time 24 48 72
n
Culture media
PDA* SGA** PDA SGA PDA SGA
Location
Ariniş 14,33 9,44 29,00 19,44 56,22 38,11 9+9
Motiş 12,57 7,57 26,57 16,00 51,85 31,57 7+7
Adrian 13,50 10,10 28,10 20,70 53,90 39,50 10+10
łaga 12,00 7,60 24,20 16,20 48,80 32,20 5+5
Ciurila 14,66 9,16 30,33 19,16 57,00 36,50 6+6
Chiochiş 13,60 9,60 28,20 19,20 53,80 36,60 5+5
Daia 11,80 8,00 24,80 16,60 49,40 33,60 5+5
Iernut 11,80 8,20 25,00 17,40 50,80 34,80 5+5
Cefa 12,20 8,00 22,50 16,60 51,30 33,20 10+10
Ineu 13,14 8,28 26,85 17,14 54,00 35,71 7+7
*PDA - Potato Dextrose Agar
**SGA - Sabouraud 2% Glucose Agar
Analyzing the diameter averages at 24 hours (table 2), on PDA culture medium, the
colonies had values between 11,80 mm (Daia and Iernut) and 14,66 mm (Ciurila). The
colonies inoculated on SGA culture medium had an average between 7,57 mm (Motiş) and
10,10 mm (Adrian).
At 48 hours, the reading of the same culture Petri dishes indicated almost a doubling
from the first reading, on PDA culture medium. The minimum diameter, in average of 22,50
mm, was observed in the colonies from Cefa, and the maximum of 30,33 mm in the colonies
from Ciurila (table 2). At the same time interval, compared to the samples from PDA culture
medium, the samples from SGA medium had lower values, with a minimum of 16,00 mm in
diameter (Motiş) and a maximum of 20,70 mm (Adrian). After Stueland and al., 2005,
values of the colonies diameter bigger than 40 mm are indicating the reaching at the growing
edge.
At 72 hours, the diameter averages indicated values bigger than 40 mm on PDA
culture medium, and under this value for SGA medium. The maximum diameter of the
colonies, 57,00 mm, was observed on the 6 samples inoculated from Ciurila, and medium
values of 48,80 mm on the samples collected from łaga (table 2). On SGA culture medium,
59

the minimum growing diameter, of 31,57 mm, was realized by the colonies inoculated from
Motiş water samples, and the maximum diameter, of 38,11 mm, the water samples from
Ariniş.
II.2.2. Comparative results regarding the development
of Saprolegnia colonies on the liquid culture media
The usage of liquid culture media is necessary to obtain bigger quantities of fungal
mass, for DNA extraction.
This experiment was performed to observe and recommend the best transfer
combination from solid culture medium to the liquid one, estimating the fungal mass
quantity, in cm 3 .
There were observed and analyzed 138 samples, 69 samples on each culture medium
combination. Daily observations made from the transfer day up to the seventh day indicated
almost a double rhythm of development in Potato Dextrose Broth (PDB) liquid medium
compared to the samples in Sabouraud Dextrose Broth (SDB) liquid medium. In day seven,
in all 100 ml Erlenmeyer glasses, the fungal pellets from Potato Dextrose Broth (PDB)
liquid medium had between 2,5 and 4 cm 3 , compared to the colonies developed in Potato
Dextrose Broth (PDB) liquid medium, with values of 1-2 cm 3 .
Further to the results, only the fungal samples obtained in bigger quantities on Potato
Dextrose Broth (PDB) liquid medium were analyzed.
II.3. THE MORPHOLOGICAL DESCRIPTION OF SAPROLEGNIA STRAINS
The microscope observations indicated the fact that the hyphae have a characteristic
unsegmented aspect of lower fungi. There were not analyzed the hyphal length and
thickness, only the morphological general aspect, which confirmed the presence of
saprolegnian fungi in the culture, without any morphological differentiation between genera
and species. The microscope observations performed on a period of 21 days evaluated at
every sample the presence or the absence of sexual reproduction organs, as well as the
60

asexual one. We can precisely conclude that in specific laboratory conditions, all fungal
isolates had flagella on primary zoospores.
Regarding the development of sexual reproduction organs (antheridia and oogonia),
there are differences from on fishpond and location to another. This presence or absence of
the sexual reproduction can be attributed to the fact that the existent species are different,
and some of them do not realyze the sexual reproduction in vitro (Fregeneda Grandes, 2000;
Dieguez Uribeondo, 2007).
A statistical analysis regarding the development of sexual reproduction organs at the
analyzed fungal species from Saprolegniaceae family (69 samples), allows us to conclude
that 41 isolates (59,42%) have sexual reproduction organs, observed at the microscope. At
28 samples (40,58%), their presence was not visualized (table 3).
Hyphal
aspect
Table 3
Synthesis regarding the development of reproduction organs
at analyzed fungal species from Saprolegniaceae family
Sexual reproduction
Asexual
Present
Absent
reproduction
(Flagella presence)
No.of
samples
Percent
(%)
No.of
samples
Percent
(%)
No.of
samples
Percent
(%)
Unsegmented 41 59,42 28 40,58% 69 100%
II.4. RESULTS REGARDING SAPROLEGNIA’S DNA
EXTRACTION AND QUANTIFICATION
II.4.1. DNA extraction
Each sample of biologic material was divided, the two samples being tested by an
extraction method, to conclude which one of the two methods is more efficient for this type
of fungi, respecting the DNA quantity and purity.
The results of the 69 samples extracted by each method, are indicating that DNA
purities and quantities performed by Nanodrop ND 1000 spectrophotometer differ from one
fishpond and method to another.
61

So, DNA purities obtained after kit extraction (Qiagen) varied between 1,02 and 1,51,
with an average of 1,250, at 260/280 nm, and the DNA quantity obtained was between 2,54
and 14,00 ng/µl, with an average of 5,543 ng/µl. Analyzing the DNA purities after the
extraction with PBS solution, we observate that the samples have values between 1,10 and
1,51, with an average of 1,394, at 260/280 nm, and DNA quantities varied between 5,23
ng/µl and 86,56 ng/µl, with an average of 30,653 ng/µl.
II.5. THE DNA AMPLIFICATION RESULTS OF FUNGAL SPECIES
FROM SAPROLEGNIACEAE FAMILY
II.5.1. DNA amplification using PCR
The amplification reactions were individually performed, in a final volume of 25 µl,
with a thermocycler Eppendorf. In a preliminary phase, the amplification process was
applied on 20 samples, 10 of the fungal DNA being extracted with kits (QIAGEN) and 10
extracted with PBS solution. This test was done to observe which of the two methods used,
realizes a more precisely DNA amplification, without any unspecific product.
The second protocol used, described in material and method, didn’t give the expected
results at fungi, so we abandoned it. In the figure 3, we present the comparative results
regarding the electrophoretic profiles of the fragments amplified with the two primer pairs.
Because we used in the DNA extractions, PBS solution and QIAGEN kit, and the
universal primers, the electrophoresis results convinced me to continue with the DNA kit
extraction (QIAGEN), and ITS1 - ITS4 primer pair.
62

1 2 3 4 5 6 7 8 9
700pb-
Fig.3. Electrophoretic profile of a DNA sample extracted from Saprolegnia and amplified
with ITS1 and ITS4, ITS4 and ITS5 primer pairs
1-Ladder Low Range of 700 bp (Fermentas); 2-DNA sample extracted with kit (ITS1-ITS4
primers); 3-DNA sample extracted with PBS solution (ITS1-ITS4 primers); 4-DNA sample
extracted with NE solution (ITS1-ITS4 primers); 5-DNA sample purified with PCR kit
(ITS1-ITS4 primers); 6-DNA sample purified with PCR kit (ITS4-ITS5 primers); 7-DNA
sample extracted with NE solution (ITS4-ITS5 primers); 8-DNA sample extracted with PBS
solution (ITS4-ITS5 primers); 9-DNA sample extracted with kit (ITS4-ITS5 primers)
II.6. THE DNA ENZYMATIC RESTRICTION RESULTS OF FUNGAL
SPECIES FROM SAPROLEGNIACEAE FAMILY USING PCR-RFLP METHOD
When we used AluI and HindIII restriction enzymes, the restriction didn’t perform.
The enzymes couldn’t digest the amplified fragment of 700 bp, because of the restriction
site. Only the third enzyme tested (RsaI), which restricted all the samples, was used in the
experiment to analyze the electrophoretic profile of the 69 samples, from the 10 locations.
Then were performed the electrophoretic profiles of the restriction analyses, with
RsaI (Fermentas) enzyme, of the DNA amplified with ITS1 and ITS4 primer pairs, at
Saprolegniaceae family fungal species.
The samples of fungal species from Saprolegniaceae family, from Ariniş fishery,
Maramureş county, with 9 fishponds, collected from the fishponds 1,2,3,4,5,8 and 9, had 3
63

DNA fragments, the first one between 350 and 400 bp, the second one around 200 bp, and
the third one around 150 bp. In the samples collected from 6 and 7 fishponds, there are
visualized 4 fragments: the first one between 450 bp and 500 bp, the second one around 300
bp, the third one around 200 bp, and the fourth one at 150 pb. Those samples of amplified
DNA are presenting a fragment length polymorphism, confirmed by the sequencing
analyses. The results indicated the presence of two aquatic fungal species, each one
belonging to another genera of Saprolegniaceae family. The DNA profiles, observed in
2,3,4,5,6,9 and 10 lanes, are belonging to Saprolegnia ferax species, and the DNA
polymorphic profiles, from 7 an 8 lanes, to Achlya bisexualis species.
At the fungal samples from Saprolegniaceae family, collected from Motiş fishery,
Sălaj county, in all the 7 analyzed fishponds, there is observed the same electrophoretic
profile of the PCR products, with 3 visible fragments. The first fragment has about 400 bp,
the second one 200 bp and the third one 150 bp. In all the analyzed samples, the
polymorphisms were the same, all the fragments indicating the presence of a single fungal
species, confirmed by sequencing as Saprolegnia ferax.
At the fungal species from Saprolegniaceae family, collected from Adrian fishery,
Satu Mare county, with 10 fishponds, in the 1,2,3,4,6,7,8 and 10 fishponds, there can be
visualized 3 migration lanes, the first one at about 380-400 bp, the second one at 200 bp and
the third one between 100 and 150 bp. After the sequence analyses performing, in the
respective fishponds was identified Saprolegnia ferax species. In the fishpond 5, there are
present 2 lanes, the first one at about 450 bp, and the second one at 200 bp. In the fishpond 9
can be observed precisely 4 fragments: the first one at about 450 bp, the second one at 250
bp, the third one at 200 bp and the fourth one between 100 and 150 bp. At the samples from
6 and 10 lanes, can be observed length polymorphisns, different from the rest of fungal DNA
samples, confirmed by sequencing as belonging to Achlya bisexualis species.
At the fungal species from Saprolegniaceae family, collected from łaga fishery, Cluj
county, there are present 4 restriction fragments, in all 5 analyzed fishponds. The first
fragment has 380-400 bp, the second one has 200 bp, the third one has 150 bp, and the fouth
one has around 100 bp. The electrophoretic profiles of DNA samples are similar as base
64

pairs length. The sequencing results indicated the fact that all the electrophoretic profiles
belonged to Saprolegnia ferax species.
At the fungal species from Saprolegniaceae family, collected from Ciurila fishery,
Cluj county, with 6 fishponds, in the fishponds 1,2,3,5 and 6 there can be observed 3
fragments of restricted DNA, the first one is about 400 bp, the second one has 200 bp, and
the third one has 130-150 bp. In the fishpond 4 there can be seen 4 DNA fragments, the first
one at 500 bp, the second one at 250 bp, the third one at 200 bp and the fouth one between
130-150 bp, which indicate the presence of a polymorphism, confirmed by sequencing as
belonging to Achlya bisexualis species.
At the fungal species from Saprolegniaceae family, collected from Chiochiş fishery,
BistriŃa-Năsăud county, with 5 fishponds, in the 1,2,3 and 5 fishponds, can be observed 3
fragments, with the following lengths: the first one between 400 bp and 500 bp, the second
fragment between 200 bp and 250 bp, and the third one between 150-200 bp. Those
electrophoretic profiles, correlated with the sequencing data and the GeneBank comparison,
indicated the presence of Saprolegnia ferax species. In the fishpond 4, the 3 fragments have
different lengths: the first fragment has 500 bp, the second one has about 250 bp and the
third one has 150-200 bp. After the fragment length analyses by electrophoresis, in the
fishpond 4 there is observed a different polymorphism compared to the other fungal DNA
samples, which indicates the presence of another species, confirmed as Achlya bisexualis.
At the fungal species from Saprolegniaceae family, collected from Daia fishery, Alba
county, with 5 fishponds, in the 1,2,3,4 fishponds there is remarked the presence of 3
restriction lanes, the first one having 400 bp, the second one 200 bp, and the third one 130-
150 bp, after the sequencing analyses being identified the aquatic fungal species named
Saprolegnia ferax. It can be seen a fragment length polymorphism at the fungal species
collected from fishpond 5, confirmed as belonging to Achlya bisexualis species. The first
fragment has 500 bp, the second one has about 200 bp. The third fragment is low visible.
At the fungal species from Saprolegniaceae family, collected from Iernut fishery,
Mureş county, with 5 fishponds, can be observed the same fragment lengths, in 1,2,3 and 5
fishponds. The first fragment has 400 bp, the second one had 200 bp, and the third one 130-
65

150 bp. The electrophoretic profiles are belonging to Saprolegnia ferax species, ulterior
sequenced. In the fishpond 4, the fragment length differs as it follows: the first fragment has
500 bp, the second one has about 210-220 bp, and the third one has 150 bp, involving a
polymorphism of another fungal species (Achlya bisexualis).
In the case of the fungal species from Saprolegniaceae family, collected from Cefa
fishery, Bihor county, with 10 fishponds, in the fishponds 1,2,4,5,6,7 and 9 , the 3 fragments
have the following lengths: the first fragment 400 bp, the second fragment 200 bp and the
third fragment between 130 and 150 bp. Those polymorphisms are belonging to Saprolegnia
ferax species. In the fishponds 3,8 and 10, the fragments have different lengths, the
sequencing confirming the presence of Achlya bisexualis species. The first fragment is
visualized more clearly, having about 450 bp. At the samples originating from the fishponds
8 and 10, it is observed an extra fragment the second one, of 250 bp, the third one having
200 bp and the fourth one about 130 bp, have the same length with the second and third
fragments from the other fishpond samples.
At Ineu fishery, Arad county, the fragments of all the fungal samples from
Saprolegniaceae family, collected from 7 fishponds analyzed, had the same lengths: the first
one had 400 bp, the second one 200 bp, and the third one between 130 and 150 bp. The
ulterior sequencing analyses confirmed the presence of Saprolegnia ferax species, in this
location fishponds.
66

II.7. RESULTS REGARDING THE GENETIC PHYLOGENY
STUDY OF SAPROLEGNIACEAE FAMILY FUNGI
Tree Diagram for 12 Variables
Single Linkage
Euclidean distances
Var1
Var7
Var3
Var6
Var2
Var8
Var10
Var11
Var4
Var9
Var5
Var12
0 10 20 30 40 50 60
Linkage Distance
Fig.4. Phylogenetic analysis of 69 DNA samples
from Saprolegniaceae family fungi, isolated from 10 locations
Variant 1: Ariniş, with the samples from 1-5, 8,9 fishponds; Motiş, with the samples from the 7 fishponds;
Variant 2: Ariniş, with the samples from 6 şi 7 fishponds;
Variant 3: Adrian, with the samples from 1–4, 6-8, 10 fishponds;
Variant 4: Adrian, with the samples from fishpond 5;
Variant 5:Adrian, with the samples from fishpond 9;
Variant 6: łaga, with the samples from all the 5 fishponds;
Variant 7: Ciurila, with the samples from 1-3, 5-6 fishponds; Daia, with the samples from 1-4 fishponds; Iernut, with
the samples from 1-3, 5 fishponds; Cefa, with the samples from 1-2, 4-7, 9 fishponds; Ineu, with the
samples from all the 7 fishponds;
Variant 8: Ciurila, with the samples from fishpond 4;
Variant 9: Chiochiş, with the samples from 1-3 and 5 fishponds;
Variant 10: Chiochiş, with the samples from fishpond 4;
Variant 11: Iernut, with the samples from fishpond 4; Daia, with the samples from fishpond 5;
Variant 12: Cefa, with the samples from 8 and 10 fishponds.
67

The dendrogram interpretation, performed after the reading of DNA fragment lengths,
from the 69 analyzed fishponds, allows us to conclude the following aspects regarding the
Saprolegniaceae family fungi phylogeny (fig.4).
All the identified fungal types have an common ancestral origin, the first speciation
being realized at the ancestral variety, at a linkage distance of 58 cM (centiMorgans). One of
the speciations evolved for a longer period of time, in a part of the analyzed fishponds, when
caused by a point mutation, placed on a distance of 20 cM, appeared another 2 speciations.
One of them evolves until today, being localized in the fishponds 1-5, 8,9 from Ariniş
fishery, in the 7 fishponds from Motiş fishery (var.1), in the fishponds 1-3, 5-6 from Ciurila,
Daia fishponds 1-4, Iernut fishponds 1-3 and 5, Cefa fishponds 1-2, 4-7 and 9, and all the 7
fishponds from Ineu fishery (var.7).
The other speciation, which evolved from a point mutation, at the level of 20 cM, for
a period of time, suffered another point mutation, at the linkage distance of 10 cM,
generating another two speciations. One of them (var.3) still evolves and was identified in
the fishponds 1-4, 6-8 and 10 from Adrian fishery and in all the 5 fishponds from łaga
fishery (var.6). The second branch which broked from the ancestral form, at the distance of
58 cM evolved until a point mutation caused the creation of two new speciations, at the
linkage distance of 42cM. One of the branches evolved for a shorter period of time, when at
the linkage distance of 35 cM realized a point mutation, which caused the appearance of
another two new speciations. One of them was identified in the fishponds 6 and 7 from
Ariniş fishery (var.2). The other speciation, after a point mutation, at a linkage distance of 30
cM, caused the evolution of two taxonomical units, identified today. One of them evolves
and it is very active in the fishpond 4 from Ciurila fishery (var.8), and in the fishpond 4 from
Chiochiş fishery (var.10). The other broked branch is identified and present today in the
fishpond 4 from Iernut fishery and fishpond 5 from Daia (var.11).
The second branch, broked at a linkage distance of 42 cM, evolved for a longer
period of time, in a part of the analyzed fishponds, then, at a distance of 10 cM, after another
mutation, resulted 3 speciations, two of them genetic related (var.4 and 9), identified in the
fishpond 4 from Adrian fishery and in fishponds 1-3 and 5 from Chiochiş fishery. At a
68

higher genetic distance, the individuals broked from the same branch, are evolving today in
the fishpond 9 from Adrian fishery (var.5) and in the fishponds 8 and 10, from Cefa fishery
(var.12).
II.8. SEQUENCING RESULTS OF THE SAPROLEGNIACEAE FAMILY
FUNGAL SPECIES FROM THE STUDIED LOCATIONS
After the automatic sequencing, performed with ABI Prism sequencer, by
Mycrosinth (Switzerland), there were identified two aquatic fungal species, in the studied
fishponds, represented by Saprolegnia ferax and Achlya bisexualis.
In the case of Saprolegnia ferax species sequencing, the fragment sequenced with
the primers ITS1(forward) and ITS4 (reverse), has a length of 743 bp, a identity of 99% and
has two point mutations compared to the matrix species from GeneBank. At 31 position,
there is observed a deletion between A-C nucleotides, of a C nucleotide, and at 368 position,
there is a substitution of A with C.
After sequencing Achlya bisexualis species, the fragment sequenced with the
primers ITS1(forward) and ITS4 (reverse), has a length of 761 bp, a identity of 99% and has
7 point mutations compared to the matrix species from GeneBank. At 112 position, there is
rematked a substitution of C with T; at 119 position, a substitution of G with A; at 194
position, a substitution of T with G; at 370 and 371 positions, two substitutions of C with A;
at 416 position, a substitution of A with T, and at 633 position, a substitution of A with G.
II.9. THE INCIDENCE OF SAPROLEGNIASIS IN THE CENTRAL
AND NORTH-WESTERN ROMANIAN AREAL
Saprolegniasis is the ”silent killer” of the aquatic species, the disease producing
extremely important losses in the fisheries, particularly in the cyprinid ones.
Saprolegniasis is one of the most important causes of economic losses in aquaculture,
fungal infections are second only to bacterial diseases in economic importance. Fungal
infections are generally restricted to chronic, steady losses. In Japan, there is an annual
mortality rate of 50% in coho salmon (Oncorhynchus kisutch) due to Saprolegnia parasitica
69

Coker. Fifty percent per year losses have also been reported in elver (Anguilla anguilla)
culture in Japan. In Scotland, saprolegniasis causes important economic losses especially in
salmon fisheries.
In the southeastern of United States, major losses of 50% occur in channel catfish
farming, and the economic loss of 40 million dollars. Every year, the channel catfish
farmers, from United States, have losses of more than 25 million dollars caused by aquatic
diseases.
In Europe, the cyprinid species losses percentage is more than 25%, in the areals
where over the predisposing factors, represented by overpopulation, bad manipulation of the
fish, reproduction stress caused by corticosteroid hormone excess, associated infection
(Jeney and al., 1995), there are cumulating the water and air pollution factors. Losses
between 50 and 100% at spawns, and between 14% up to 30% at larvae and alevins,
between 10 and 15% at young fish are signaled by different authors (Horvath and al., 2005).
Taking in consideration the International and European situation, we observed in our
research areal important losses caused by saprolegniasis (table 4).
Location
Spawns in
hatching
period
The percentage of losses caused by saprolegniasis
at carp species in the studied locations (%)
Larvae Alevins Young
fish
Adults
Table 4
Winter Spring Summer Autumn
Ariniş 70 30 5 3 4 5 5 3
Motiş 40 20 7 5 3 2 3 3
Adrian 58 25 10 5 8 6 6 5
łaga 60 28 10 8 9 5 4 4
Ciurila 30 10 5 5 7 5 4 3
Chiochiş 30 12 10 5 10 6 5 4
Daia 25 15 5 3 5 3 3 3
Iernut 50 25 13 10 10 7 5 5
Cefa 20 5 5 2 3 4 4 4
Ineu 28 7 6 3 4 3 4 3
Average on
total
locations
41,1 16,7 7,6 4,9 6,3 4,6 4,3 4,1
70

We mention the fact that in al the analyzed fisheries there is applied the annual
disinfection, in the fishponds where the natural supervised reproduction takes place,
emptying and keeping them dry on the winter period. Before the filling, the fishponds are
disinfected with lime at all of their surface. With all this, because of the reproduction
individuals manipulation and of the vegetation massive development, in the reproduction
period there are described strong attacks of pathogenic fungi upon spawns, with losses up to
70% in Ariniş fishery, and in the fisheries where the hygienic measures are very severe, the
losses are up to 20% from affected spawns (Cefa location). In average, in the 69 fishponds
from the 10 locations studied, the cyprinid spawn losses raise up to 41,10%. The larval
period, specially the first 3 days of life one, when their movements are limited by the
presence of vitelline membrane, the average losses raise up to 16,70%, with a 30%
maximum of losses, in Ariniş fishery, and a 5% minimum of losses in Cefa fishery. The
alevin period, extremely difficult as needs of water oxygen level and food quality, is strong
affected by saprolegniasis. The average losses of 7,60%, are more reduced compared to the
larval period. The biggest losses percentage at this category of age, is encountered in Iernut
fishery (13%), and a minimum of 5% in Ariniş, Ciurila, Daia, Cefa fishries.
In the young fish period, with its particular attention gived by the fishery owners
regarding the water and food quality, when there is assured an optimal density of the
individuals and the manipulations restricted, the losses caused by saprolegniasis are more
reduced, being in average of 4,90%.
The adult period is not safe from Saprolegnia attack. In the majority of the studied
fisheries, there is practiced the autumn fishing and the transfer of the kept fish for the next
year, in the wintering fishponds. The manual labor of catching, transportation and
repopulation in another fishpond causes body and fishfins inherent wounds. On the winter
period, the fish do not eat any food, their organism being weakened, and under the
influences of sudden temperature changes and ice layer, the losses are in average of 6,30%.
In springtime, the reproducers, as well as the fish kept for breeding, are verified regarding
their state maintenance and health, using fishing nets. The manipulation produces wounds,
which are causing the increase of saprolegniasis incidence, the average of the losses being of
71

4,60%. The springtime end and the begining of the summer are overlapping with the
cyprinid reproduction period, when the manipulations, as well as the stress caused by
corticosteroid hormones are the factors of saprolegniasis incidence, at the weakened
individuals. The average losses on the 69 samples studied is 4,30%.
A lower percentage, of 4,10%, is remarked in the autumn period, when generally all
the fish populations have a very good immune status, being prepared for wintering.
CHAPTER III
CONCLUSIONS AND RECOMMENDATIONS
1. The water presence of Saprolegnia, prooved by the spawns infestation, is observed
irrespective of the water collecting month.
2. The higher infestation degree of the cyprinid spawns with Saprolegnia was remarked
at the water temperature of 22ºC, when the medium and strong infestation percentage
reaches 85,41%, irrespective of sample collecting months.
3. Irrespective of the solid culture media used (PDA and SGA), and of the reading
interval (24, 48 and 72 hours), there are differences between the analyzed
Saprolegnia colonies, from one fishpond and location to another.
4. The growing of Saprolegnia colonies on Potato Dextrose Broth (PDB) liquid culture
medium is superior to the one realized on Sabouraud Dextrose Broth (SDB) liquid
medium.
5. The morphologic characterization of Saprolegnia strains, from the obtained colonies,
reveals unsegmented hyphae specific to the inferior fungi, and differences regarding
the presence of sexual reproduction (at 59,42%) and its absence (at 40,58%).
6. At all Saprolegnia isolates it was identified the presence of flagella on the primary
zoospores.
7. DNA purities illustrated by Nanodrop ND 1000 spectrophotometer, after the kit
extraction (Qiagen), varies between 1,02 - 1,51, with a sample purity average of
1,250, at 260/280 nm ripple length, and the DNA quantities between 2,54 – 14,00
ng/µl, with an average of 5,543 ng/µl, and the DNA purities after PBS solution
72

extraction have values between 1,10 – 1,51, with an average of 1,394, at 260/280 nm
ripple length, and the DNA quantities obtained by the same method, varied between
5,23 – 86,56 ng/µl, with an average of 30,653 ng/µl.
8. In the case of DNA samples extracted with kit QIAGEN, in all the situations the
amplification produced with both primer pairs used, with the visualization of 743 bp
fragments at Saprolegnia ferax, and of 761 bp at Achlya bisexualis.
9. In the case of the DNA samples extracted with PBS solutions, in spite of the normal
DNA purities and quantities, the amplification of Saprolegnia DNA samples, with the
two primer pairs, produced differently, because of the presence of possible fungal
inhibitors, which do not allow the attachment of ITS1 and ITS4 primer pair, and in
the case of using a PCR purification kit, the amplification performed.
10. In the case of the samples extracted with NE solutions, in spite of the normal purities
and quantities, the amplification of Saprolegnia DNA samples, with the two primer
pairs didn’t produced.
11. RsaI enzyme has a very good specificity for Saprolegnia and Achlya restriction sites,
so we opted for its usage in all the fragment restriction tests.
12. AluI and HindIII enzymes, tested by us in the experiment, do not have any specificity
for Saprolegnia and Achlya restriction sites, failing to produce any restricion of the
DNA fragments.
13. In the case of the 10 fisheries and 69 samples analyzed, there are visualized two DNA
length polymorphisms, in the gels.
14. The study of phylogenetic tree, using linkage and Euclidean distances, allows us to
conclude the fact that in the studied fisheries and fishponds, there are different genera
of fungi from Saprolegniaceae family, which have different pathogenicity upon
cyprinid species.
15. After the DNA sequencing, there were identified two species of aquatic fungi, in the
studied fishponds, represented by Saprolegnia ferax (743 bp, a identity of 99% and
has two point mutations compared to the matrix species from GeneBank) and Achlya
73

isexualis (761 bp, a identity of 99% and has 7 point mutations compared to the
matrix species from GeneBank).
16. The bigger losses caused by identified species (Saprolegnia ferax and Achlya
bisexualis), at the cyprinid species from Romania, are observed in the reproduction
period, when the percentage of average losses at spawns reaches 41,10%, and 16,70%
at larval period.
17. The identified species are causing losses in the cyprinid breeding fishponds from
Romania, and at the young fish (4,90%) and adults (with an average of 6,30% in
wintertime, 4,60% in springtime, 4,30% in summertime and 4,10% in autumn).
18. The losses caused by saprolegniasis differ from one season and fishery to another,
depending on the water physical, chemical and biological conditions, on the breeding
technology severity and on the general meteorological conditions.
Based on the obtained results, we recommend:
9. We recommend for the analyses of Saprolegnia presence in fishponds, that the water
samples should be collected from the 4 lake sides and centre, and from the depth of
about 50 cm.
10. For the growth of different Saprolegnia strains, can be used solid culture media (PDA
and SGA), but we recommend PDA culture medium for the colonies more rapid
growing time.
11. Because, in the DNA analyses there are needed big quantities of fungi, and making
allowance for Saprolegnia development mode in the two culture liquid media, we
recommend the use of Potato Dextrose Broth (PDB) liquid medium, in the
experiments on the genus species.
12. We recommend the fungal DNA extraction with kits (QIAGEN) and avoiding the
solutions extraction (PBS and NE), which in spite of the fact that realizes normal
DNA purities and quantities, the amplification of Saprolegnia DNA samples
produces partialy or was absent.
74

13. In researches on the aquatic fungi we recommend the use of RsaI enzyme, which has
a very good specificity for Saprolegnia and Achlya restriction sites, and to avoid AluI
and HindIII enzymes, which do not have any specificity for the restriction sites.
14. For the genetic characterization of Saprolegniaceae family aquatic fungi, we
recommend the use of PCR-RFLP method, described by Ristaino and al., 1998,
adapted by us.
15. To be able to identify precisely the genera and species from Saprolegniaceae family,
we recommend the use of DNA sequencing and the results comparison with the ones
from GeneBank.
16. To avoid the losses caused by saprolegniasis, in the cyprinid fisheries from centern
and north-western part of Romania, we recommend a special attention of the fishery
owners in: the permanent water quality control, the vegetation type control, avoiding
the fish traumatisms during manipulations, avoiding the stress caused by water level
oscillations, and by the forage type used.
75

SELECTIVE BIBLIOGRAPHY
32. Colao Maria Chiara, 1999, Proprieta cinetiche e molecolari di laccasi fungine,
Universita degli Studi della Tuscia, Viterbo, 99 pg.;
33. Coşier Viorica, 2007, Inginerie genetică, Ed. Risoprint, Cluj-Napoca;
34. Dick, M.W., 1969, Morphology and taxonomy of the Oomycetes, with special
reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. I. Sexual reproduction,
New Phytol., 68, 751–775;
35. Dick, M.W., 1972, Morphology and taxonomy of the Oomycetes, with special
reference to Saprolegniaceae, Leptomitaceae and Pithyaceae. II. Cytogenetic
systems, New Phytol., 71, 1151–1159;
36. Dieguez-Uribeondo, J., Fregeneda-Grandes, J.M., Cerenius, L., Elena Perez-
Iniesta, Aller-Gancedo, J.M., Teresa M. Telleri, Soderhall, K., Maria P. Martin,
2007, Re-evaluation of the enigmatic species complex Saprolegnia diclina–
Saprolegnia parasitica based on morphological, physiological and molecular data,
Fungal Genetics and Biology, 44, 585–601;
37. Fernandez-Benitez Maria Jose, Ortiz-Santaliestra, M.E., Lizana, M., Dieguez-
Uribeondo, J., 2008, Saprolegnia diclina: another species responsible for the
emergent disease‘Saprolegnia infections’ in amphibians, FEMS Microbiol. Lett., 279,
23–29;
38. Francesconi, A., Kasai, M., Susan M. Harrington, Mara G. Beveridge, Ruta
Petraitiene, Petraitis, V., Schaufele, R. L., Walsh, T J., 2008, Automated and
manual methods of DNA extraction for Aspergillus fumigatus and Rhizopus oryzae
analyzed by Quantitative Real-Time PCR, Journal of Clinical Microbiology, 46:6,
1978–1984;
39. Fregeneda Grandes, J.M., Fernandez Diez, M., Aller Gancedo, J.M., 2000,
Ultrastructural analysis of Saprolegnia secondary zoospore cyst ornamentation from
infected wild brown trout, Salmo trutta L., and river water indicates two distinct
morphotypes amongst long-spined isolates, Journal of Fish Diseases, 23, 147–160;
76

40. Frisvad, J.C., Bridge, P.D., Arora, D.K., 1998, Chemical fungal taxonomy, Marcel
Dekker Inc., New York, 398 pg.;
41. Heath, I.B., Karen Rethoret, 1981, Nuclear cycle of Saprolegnia ferax, J. Cell Set.,
49, 353-367;
42. Johnson Jr., T.W., Seymour, R.L., Padgett, D.E., 2002, Biology and systematics of
the Saprolegniaceae, on-line publication: http://www.ilumina-dlib.org., 1028 pg.;
43. Kamoun Sophien, 2003, Molecular genetics of pathogenic oomycetes, Eukaryotic
Cell, 2:2, 191–199;
44. Lategan, M.J., Gibson, L.F., 2003, Antagonistic activity of Aeromonas media strain
A199 against Saprolegnia sp., an opportunistic pathogen of the eel, Anguilla australis
Richardson, Journal of Fish Diseases, 26, 147-153;
45. Lategan, M.J., Torpy, F.R., Gibson, L.F., 2004, Biocontrol of saprolegniosis in
silver perch Bidyanus bidyanus (Mitchell) by Aeromonas media strain A199,
Aquaculture, 235, 77-88;
46. Leclerc, M.C., Guillot, J., Devilla, M., 2000, Taxonomic and phylogenetic analysis
of Saprolegniaceae (Oomycetes) inferred from LSU rDNA and ITS sequence
comparisons, Antonie van Leeuwenhoek, 77, 369–377;
47. Llanos Frutos, R., M. Teresa Fernández-Espinar, Querol, A., 2004, Identification
of species of the genus Candida by analysis of the 5.8S rRNA gene and the two
ribosomal internal transcribed spacers, Antonie van Leeuwenhoek, 85, 175–185;
48. Oroian, R.G., Oroian, T.E., Crina Teodora Carşai, Viorica Coşier, L. Sasca,
2009, RAPD technique used in analyzing the genetic structure of Cyprinus carpio
species – Galitian and Lausitz varieties, International symposium “Modern animal
husbandry-science, creativity and innovation”, Lucrări ştiinŃifice seria Zootehnie,
USAMV Iaşi, cotaŃie CNCSIS B+, 52:14, 444-449;
49. Oroian, R.G., Vlaic, A., Oroian, T.E., 2008, PCR technique used in Saprolegnia sp.
genetical characterization, Lucrări ŞtiinŃifice - Universitatea de Ştiinte Agricole şi
Medicină Veterinară Iaşi, Seria Zootehnie, vol. 51, 631-634;
77

50. Oroian, T.E., 2006, SelecŃia asistată de markeri la crap, Ed. Risoprint, Cluj-Napoca,
180 pg.;
51. Oroian, T.E., Oroian, R.G., Cristina Hegeduş, Cighi, V., Dronca, D., 2009, The
monitoring of phytoplankton evolution by biological year within Arinis-Maramures
fishery complex, International symposium “Modern animal husbandry-science,
creativity and innovation”, Lucrări ştiinŃifice seria Zootehnie, USAMV Iaşi, cotaŃie
CNCSIS B+, 52:14, 456-461;
52. Paul, B., Monica M. Steciow, 2004, Saprolegnia multispora, a new oomycete
isolated from water samples taken in a river in the Burgundian region of France,
FEMS Microbiology Letters, 237, 393–398;
53. Ristaino, J.B., Madritch, M., Trout, C.L., Parra, G., 1998, PCR amplification of
ribosomal DNA for species identification in the plant pathogen genus Phytophthora,
Applied and Environmental Microbiology, 64:3, 948-954;
54. Stueland, S., Hatai, K., Skaar, I., 2005, Morphological and physiological
characteristics of Saprolegnia spp. strains pathogenic to Atlantic salmon, Salmo salar
L., Journal of Fish Diseases, 28, 445-453;
55. Vlaic, A., 2007, Genetica peştilor, Ed. Risoprint, Cluj-Napoca, 150 pg.;
56. White, P.L., Barton, R., Guiver, M., Linton, C.J., Wilson, S., Smith, M., Beatriz
L. Gomez, Carr, M.J., Kimmitt, P.T., Shila Seaton, Rajakumar, K., Tessa
Holyoake, Chris C. Kibbler, Elizabeth Johnson, Hobson, R.P., Jones, B.,
Rosemary A. Barnes, 2006, A consensus on fungal Polymerase Chain Reaction
diagnosis, Journal of Molecular Diagnostics, 8:3, 376-384;
57. White, T.J., Bruns, T., Lee, S., Taylor, J., 1990, Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M., Gelfand,
D.H., Sninsky, J., White, T.J. (Eds) PCR protocols (pg 315–322), Academic Press,
San Diego;
58. *** http://www.fermentas.com
59. *** http://www.ncbi.nlm.nih.gov
60. *** http://www.qiagen.com
78

61. *** http://www.sigmaaldrich.com
62. ***http://www.tnfish.org/FishDiseasesParasites_TWRA/files/Saprolegnia.pdf
79