Haematologica 2003 - Supplements

terminal kinase (JNK) pathway which controls osteoclast
proliferation. The important function of TRAF6 in signal
transduction provides us an ideal target for enhancing the cell
killing of MM cells and inhibiting bone turnover initiated by
osteoclast activity. We have generated two human TRAF6
dsRNA by construction in vitro for Target 1 TRAF6 mRNA
sequence 5’-AAACTGTGAAA ACAGCTGTGG-3’ and Target 2
TRAF6 mRNA Sequence 5’- AGTATGAATGCCCCATCTGC -
3’, The apoptosis and cell proliferation assays showed that
Target-1 dsRNA inhibited MM cell proliferation in a dosedependent
manner. The Target-2 dsRNA did not produce
detectable inhibition of MM cell proliferation. Only the Target-1
dsRNA induced MM cell apoptosis. In contrast, the Target-2
dsRNA and the transfection reagent control vector did not induce
cell apoptosis. We tested that whether silence Target-1 TRAF6
mRNA could inhibit NF-kB gene expression induced by IL-1.
The 8226 MM cells were transduced of either 100nM TRAF6 or
100nM GAPDH dsRNA for 72 hours and then the cells were
incubated with IL-1 for 0, 15, 30, and 60min. The cells were
lysates and the total RNA or protein was detected by RT-PCR or
western blot. The result showed that amount of NF-kB mRNA or
activated NF-kB was significantly increased after 30 minute IL-1
stimulation while NF-kB dropped to normal level after 60
minutes. In contrast, in cells that received TRAF6 dsRNA, the
amount of phosphor-NF-kB is no changed It has been clear that
NF-kB specific response to TRAF6 knocked down by silence
TRAF6 mRNA. We sought further to determine whether TRAF6
RNAi could inhibit NF-kB trigger function on luciferase activity.
Using luciferase vector to monitor the activation of NF-kB signal
transduction pathway. PNF-kB-Luc is designed to measure the
binding of NF-kB to k enhancer, providing a direct measurement
of activation this pathway. PTAL-Luc is ideal for use as a
negative control vector. In view of the results showed that IL-1
stimulation of the double transfected cells at 30 minute result in a
significant induction of luciferase by NF-kB releasing.
Furthermore, this induction was abolished when TRAF6 mRNA
was silenced by dsRNA. Multiple nuclear cells (pre-osteoclast)
were decreased after silence TRAF6 when monocytes stimulated
with RANKL and m-SCF. For future studies, we would like to
use SCID-hu murine models of human myeloma to further
develop this therapeutic strategy in relevant pre-clinical in vivo
models. The in vitro studies outlined in this proposal will
certainly significantly advance the understanding of this adapter
protein in the pathogenesis and give us more impetus to target
this protein for future therapeutic manipulation for patients with
multiple myeloma.
12. Vaccination strategies in multiple
myeloma
402
NY-ESO-1 AND MAGE-A3 ARE HIGHLY EXPRESSED IN
MYELOMA PATIENTS WITH ABNORMAL
CYTOGENETICS AND/OR RELAPSE
Sushil K. Gupta, Fenghuang Zhan, Pei Lin, Jan V.
Droogenbroeck*, Ramesh B. Batchu, Friedel Nollet*,
Susann M Szmania, Amberly Moreno, Nancy Rosen, Guilio
Spagnoli†,Bart Barlogie, Guido Tricot, John Shaughnessy
and Frits van Rhee
Myeloma Institute for Research and Therapy, University of
Arkansas for Medical Sciences, Little Rock, AR U.S.A. *AZ Sint
Jan, Department of Hematology, Brugge, Belgium. †Department of
Surgery, University of Basel, Switzerland.
Despite recent successes with chemotherapy and tandem
autologous PBSCT, myeloma remains largely incurable. This
highlights the need for novel, synergistic therapies, such as
immunotherapy, which may reduce myeloma relapse. Using
micro-array and immunohistochemical (IHC) staining, we have
examined the expression of two potential targets for
immunotherapy, NY-ESO-1 and MAGE-3. Purified myeloma
cells were studied by micro-array (n=335), micro-array and IHC
on corresponding biopsy (n=20), or IHC alone (n=19, 35
biopsies). Micro-array analysis of 335 patients revealed that
expression of NY-ESO-1 and MAGE-A3 is related to the stage of
myeloma. The frequency of expression of NY-ESO-1 and
MAGE-A3 in MGUS, smoldering myeloma and newly diagnosed
myeloma patients eligible for Total Therapy II (TT II) was 4.5%,
5.9% and 20.5% (NY-ESO-1) and 9.1%, 11.8% and 26.2%
respectively (MAGE-A3). The presence of abnormal cytogenetics
influenced the expression of both antigens. Newly diagnosed TT
II trial patients with abnormal cytogenetics were more likely to
express NY-ESO-1 and MAGE-A3 cRNA (NY-ESO-1 60% vs.
30.9%, p=0.004; MAGE-A3 65.8% vs. 27.5%, p=1.16x10-6).
The percentage NY-ESO-1/MAGE-3 positive plasma cells at the
protein level (IHC) was similarly correlated with abnormal
cytogenetics. Both antigens (micro-array) were expressed in
>50% of relapsed patients (NY-ESO-1 50%, p=8.8x10-9 and
MAGE-A3 58.3%, p= 4.5x10-9). Strikingly, 100% patients with
abnormal cytogenetics at relapse expressed NY-ESO-1 and
MAGE-A3 (p=6.09x10-6 & 3.25x10-6). All these biopsies also
stained positive by IHC for NY-ESO-1 and MAGE-A3. 13
patients were studied at diagnosis and at relapse. All biopsies
positive at diagnosis by IHC for NY-ESO-1 or MAGE-A3 were
positive for both antigens at relapse. The percentage NY-ESO-1
and MAGE-A3 positive myeloma cells in the biopsies was high
(>50-90% positive plasma cells; 89% biopsies for NY-ESO-1 and
87% MAGE-A3). Double staining experiments are in progress to
test whether the same myeloma cells are positive for both NY-
ESO-1 and MAGE-A3. Expression of NY-ESO-1 and MAGE-A3
could be upregulated in myeloma cell-lines by incubating with
the hypomethylating agent, decitabine. There was a significant
increase in expression of NY-ESO-1 and MAGE-A3 after
incubation with decitabine of the NY-ESO-1 and MAGE-A3
negative myeloma cell line U-937 by real-time PCR. In
conclusion, NY-ESO-1 and MAGE-A3 are highly expressed in
myeloma with abnormal cytogenetics and relapsed myeloma.
These antigens can therefore be used as immunotherapy for
myeloma with abnormal cytogenetics. Alternatively, NY-ESO-
S267