Isolation and characterization of 14 polymorphic microsatellite loci in ...

Conservation Genet Resour (2011) 3:49–52
DOI 10.1007/s12686-010-9284-4
TECHNICAL NOTE
Isolation and characterization of 14 polymorphic microsatellite
loci in the leatherback turtle (Dermochelys coriacea) and crossspecies
amplification
Suzanne E. Roden • Peter H. Dutton
Received: 11 July 2010 / Accepted: 13 July 2010 / Published online: 27 July 2010
Ó US Government 2010
Abstract Fourteen microsatellites were isolated and
characterized from a small-insert genomic DNA library
from the leatherback turtle Dermochelys coriacea enriched
for dinucleotide microsatellite motifs. We tested primers
on 207 leatherbacks sampled from St. Croix, US Virgin
Islands. Primer pairs yielded an average of 5.7 alleles per
locus, an average observed heterozygosity of 0.47, and
average polymorphic information content of 0.43. Cross
species amplification of these markers was performed on
the six other extant species of marine turtles: olive ridley
(Lepidochelys olivacea), Kemp’s ridley (Lepidochelys
kempii), hawksbill (Eretmochelys imbricata), loggerhead
(Caretta caretta), green (Chelonia mydas), and flatback
(Natator depressus) turtles. Eleven of the markers worked
in at least one of the species, and seven of these were
polymorphic. These leatherback-specific microsatellite
markers will facilitate population genetic and ecological
studies to aid in the conservation of this divergent species
of marine turtle, and provide additional markers for the
other species of cheloniids.
Keywords Leatherback turtle Microsatellites
Dermochelys coriacea Cross-species amplification
The leatherback turtle, Dermochelys coriacea, the most
divergent of the seven species of marine turtles, is distributed
worldwide in tropical and subtropical waters. This
is a species of great conservation concern. Despite the
S. E. Roden P. H. Dutton (&)
Southwest Fisheries Science Center, National Marine Fisheries
Service, National Oceanic and Atmospheric Administration,
3333 North Torrey Pines Court, La Jolla, CA 92037, USA
e-mail: Peter.Dutton@noaa.gov
efforts of conservations and scientists over the last few
decades, most leatherback populations continue to decline
(Chan and Liew 1996; Spotila et al. 1996). Currently,
D. coriacea is listed as Critically Endangered by the
International Union for the Conservation of Nature (IUCN)
Red List of Threatened Species (Sarti-Martinez 2000).
Major threats include fisheries by-catch mortality, direct
harvest of eggs or turtles, and nesting beach destruction.
Its broad oceanic distribution and highly migratory
nature make the leatherback turtle’s movements and life
cycle difficult to study. Genetic studies of stock structure
using mtDNA control region sequences reveal restricted
dispersal of female leatherback turtles between rookeries
indicating natal homing (Dutton et al.1999, 2007). In order
to define the appropriate conservation units and fully
understand the population genetics, mating strategies, and
connectivity in leatherbacks it will be necessary to use
nDNA markers (microsatellites) to supplement the mtDNA
studies (Bowen and Karl 2007; Lee 2008).
It has been difficult to use primers designed from the
cheloniid turtles with divergent leatherbacks, where null
alleles or reduced polymorphism relative to the source
species have been problematic (FitzSimmons et al. 1995;
Monzón-Argüello et al. 2007; Shamblin et al. 2009). We
address the need to develop an array of leatherback-specific
microsatellite markers and tested these markers on the
other species to further conservation genetics research tools
for marine turtles.
Microsatellite markers were developed from a smallinsert
DNA library of D. coriacea that was subsequently
enriched for dinucleotide motifs as described in Westerman
et al. (2005). Three enriched libraries containing GT : CA,
CT : GA, GATA : CTAT microsatellite loci were produced
by hybridization of single-stranded copies of the library
to streptavidin coated paramagnetic particles preabsorbed
123

50 Conservation Genet Resour (2011) 3:49–52
Table 1 Characteristics of 14 microsatellite loci developed for D. coriacea
Locus Primer sequence (5 0 –3 0 ) H O H E Repeat
motif
T a (8C) Mg 2?
(mM)
A
Size
range
PIC
GenBank
accession no.
LB99 F: CACCCATTTTTTCCCATTG 0.599 0.599 (TG) 11 55 2.0 7 113–133 0.554 HM217007
R: ATTTGAGCATAAGTTTTCGTGG
14-5 F: GTTTGCTGATTACACGTCC 0.636 0.624 (GT) 18 53 2.0 8 196–230 0.587 HM217006
R: CTATGTTGAGTTGTTTATAAAGC
LB106 F: GGAGGAGGTTTAGGTTCCAGG 0.824 0.791 (TG) 13 57 1.5 10 138–162 0.759 HM217008
R: AACCAAGCTTCACAATCATTGC
LB110 F: TAGCAACTGCAGGAGC 0.302 0.290 (CT) 15 47 2.0 3 182–198 0.253 HM217009
R: CATTCCCTAAGATTATCACC
LB128 F: AAGCATGGAGGAGAAGG 0.488 0.483 (GT) 11 55 2.0 4 157–165 0.396 HM217012
R: GGTTCTTTGCCCCAGTA
LB141 F: CATCCTCATGTTCCCATC 0.729 0.704 (TC) 20 (AC) 9 55 2.0 6 166–192 0.663 HM217014
R: CATTGCCTCATAATAAGAGAAA
LB142 F: GGCCAACTTTCCTTTCTTATTA 0.578 0.555 (CA) 16 55 2.0 6 219–237 0.522 HM217015
R: CTGTGTGTATCTGCACCCA
LB145 F: GGCCTCCACACAAATAAATAAA 0.620 0.668 (AC) 28 55 2.0 7 121–197 0.634 HM217017
R: CATTCACCTTACGCAGAAGAA
LB143 F: CCTATGGGCCACTGCAATGACA 0.231 0.214 (GT) 10 Tdown 2.0 4 181–197 0.205 HM217016
(60–45, 55)
R: CAGCTGGAGGGATGCAAGATGT
LB133 F: AGAGGCAGCAGAGCAAGG 0.660 0.677 (AC) 13 55 1.5 11 156–200 0.625 HM217013
R: GGCTGAGGGTGGTGAGG
LB123 F: TGTAGTCaGGTGTCCAATG 0.398 0.435 (GT) 12 51 2.0 4 170–186 0.357 HM217010
R: CCAAGCCAAAGAAAGAA
LB125 F: AACTAATGCCTTACAGAG 0.296 0.345 (AC) 13 Tdown 2.0 3 182–196 0.303 HM217011
(60–45, 55)
R: CCTTAGAGGGAGAATCT
LB157 F: GGCATGAGTGTGAGTGA 0.168 0.163 (AC) 13 50 2.0 4 72–102 0.151 HM217018
R: CCTGGTTAAAGCTGTCTC
LB158 F: AGGACAAGGCATTCTAGC 0.018 0.03 (CA) 12 55 2.0 3 162–178 0.030 HM217019
R: ATGTACTTGCCCATCTGC
Locus name; forward (F) and reverse (R) primer sequence (5 0 –3 0 ), H O and H E observed and expected heterozygosity; T a annealing temperature;
A, number of alleles
with 5 0 biotinylated oligonucletides ([GT] 10 , [CT] 10 , or
[GATA] 10 .
A total of 178 putative microsatellite clones were
screened using 48-well slot blots and autoradiography with
32 P-labelled oligonucleotides specific to the repeat motif
design. Microsatellites were indicated in approximately
71% [(GT) n ], 13% [(CT) n ], and 0% [(GATA) n ] of the
colonies screened based on autoradiographic analyses.
Colonies positive for microsatellites were sequenced in
both directions using dye-terminator fluorescent chemistry
with T3/T7 primers as described in Westerman et al. (2005).
Sequence data were used to design primers based on flanking
sequence for 73% [(GT) n ] and 60% [(CT) n ] colonies using
Oligo 6 (Molecular Biology Insights, CO, USA).
Following PCR optimization, two [(CT) n ] and twelve
[(GT) n ] microsatellite loci were found to be polymorphic
across a screening panel of eight Pacific and eight Atlantic
nesting leatherbacks representing the geographic range of
this species.
A total of 207 D. coriacea samples from nesting females
in St. Croix, USVI were genotyped with fourteen polymorphic
microsatellite loci. PCR was performed in 25 ll
total reaction volume. Reaction conditions per sample
contained 2.5 ll 109 buffer [500 mM KCl, 200 mM Tris–
HCl (pH = 8.4)] (Invitrogen, CA, USA) 2.0 mM MgCl 2
(Invitrogen, CA, USA) 0.6 mM of dNTP mixture (100 lM
each), and 0.3 lM each of forward (5 0 fluorescent label)
and reverse primers per sample, and 1.5 units of Taq
polymerase (New England Biolabs, MA, USA). Microsatellite
loci were amplified using approximately 100 ng
template DNA. Thermocycling conditions (for LB158,
LB128, LB133, LB99, 14-5, LB123, LB141, LB145,
123

Conservation Genet Resour (2011) 3:49–52 51
Table 2 Cross-species
amplification success and allele
size (bp) for 14 microsatellite
loci in six marine turtle species
NA no amplification
Locus L. olivacea E. imbricata L. kempii C. carretta C. mydas N. depressus
LB99 NA NA 119 121 133 125–131
14-5 NA 183–187 190 NA NA 150
LB106 NA NA NA NA NA NA
LB110 167 169 167 170 171 165
LB128 NA NA 167 167 NA NA
LB141 NA NA NA NA 158–168 152
LB142 213 213–241 213 213 229–247 233
LB145 121 121 121 123–125 NA NA
LB143 178 180 178 186–188 178 NA
LB133 NA NA NA NA NA NA
LB123 NA NA NA NA NA 179–189
LB125 NA NA 180–186 198 200 NA
LB157 NA NA NA NA 76 NA
LB158 NA NA NA 182 168 NA
LB106, and LB142) were denaturation for 2 min at 94°C
followed by 50 cycles for 10 s at 94°C, 10 s at annealing
temperature, and 10 s at 72°C. A final extension was
carried out for 5 min at 72°C. A touchdown cycling program
was used for loci LB125, LB157 and LB143: 94°C
for 2 min; 60 cycles of 94°C for 30 s, annealing for 30 s,
and 72°C for 30 s; and a final extension step of 72°C for
5 min. The annealing step in the touchdown program
decreased 0.5°C per cycle from 60 to 45°C for 30 cycles
and the remaining 30 cycles continued with a 55°C
annealing temperature. LB110 cycling conditions consisted
of a 2 min denaturation at 94°C, followed by 10 cycles for
10 s at 94°C, 10 s at 47°C, and 10 s at 72°C, followed by
45 cycles, 10 s per step with an annealing temperature of
52°C. Microsatellite products were diluted 1:5 and electrophoresed
on an ABI Prism 3100 Genetic Analyzer
(Applied Biosystems, Foster City, CA, USA) with ROX
molecular weight size standard. Microsatellite sizes were
determined using an ABI 3730 Genetic Analyzer and
scored with GenemapperÒ 4.0 software (Applied Biosystems,
Foster City, CA, USA). Microsatellite alleles were
characterized by a mean number of alleles value of 5.7
(range 3–11), an average observed heterozygosity of 0.47
(range 0.02–0.89), and average polymorphic information
content (PIC) of 0.43 (range 0.03–0.86) (Table 1). We
tested for Hardy–Weinberg equilibrium (HWE) and pairwise
linkage disequilibrium (LD) using Arlequin 3.11
(Excoffier et al. 2005). After a sequential Bonferroni correction
for multiple comparisons, all loci showed HWE and
nine locus pairs (10%) showed significant pairwise LD at
P \ 0.0005. MICRO-CHECKER (Van Oosterhout et al.
2004) analysis revealed no evidence for null alleles in any
loci, except in locus LB158.
Fourteen primer pairs were tested on L.olivacea
(n = 32), E. imbricata (n = 32), L. kempii (n = 31),
C. caretta (n = 29), C. mydas (n = 32) and N. depressus
(n = 29) using Batched Analysis of Genotypes (BAGS)
(LeDuc et al. 1995). Thermocycling conditions consisted of
a touchdown program: 94°C for 2 min; 60 cycles of 94°C
for 30 s, annealing for 30 s, and 72°C for 30 s; and a final
extension step of 72°C for 5 min. The annealing step in the
touchdown program decreased 0.5°C per cycle from 60°C
to 45°C for 30 cycles and the remaining 30 cycles continued
with a 55°C annealing temperature. Loci were tested for
species compatibility by assessing their PCR amplification
success. Batched sample analysis either did not amplify or
exhibited monomorphic or polymorphic characteristics
depending on the locus/species combination. Of the 84
amplification tests, 39 markers amplified successfully while
nine were found to be polymorphic (Table 2).
Acknowledgments This research was funded by NOAA—National
Marine Fisheries Service-Southwest Fisheries Science Center. We
would like to thank Lara Asato, Luana Galver, Lauren Hansen, Nicole
Hedrick, Amy Jue, Carrie LeDuc, Janet Lowther and Mark
Westerman for their technical assistance in the laboratory. We are
grateful to the U.S. Fish and Wildlife Service at Sandy Point National
Wildlife Refuge, the West Indies Marine Animal Research and
Conservation Service (WIMARCS) and the USVI Department of
Planning and Natural Resources for facilitating collection of samples.
References
Bowen BW, Karl SA (2007) Population genetics and phylogeography
of sea turtles. Mol Ecol 16:4886–4907
Chan EH, Liew HC (1996) Decline of the leatherback populations in
Terengganu, Malaysia, 1956–1995. Chelonian Conserv Biol 2:
196–203
Dutton PH, Bowen BW, Owens DW, Barragan A, Davis SK (1999)
Global phylogeography of the leatherback turtle (Dermochelys
coriacea). J Zool 248:397–409
Dutton PH, Hitipeuw C, Zein M, Benson SR, Petro G, Pita J, Rei V,
Ambio L, Bakarbessy J (2007) Status and genetic structure of
123

52 Conservation Genet Resour (2011) 3:49–52
nesting populations of leatherback turtles (Dermochelys cariacea)
in the western Pacific. Chelonian Conserv Biol 6:47–53
Excoffier L, Laval G, Schneider S (2005) Arelquin ver. 3.0: an
integrated software package for population genetics data analysis.
Evol Bioinform Online 1:47–50
FitzSimmons NN, Moritz C, Moore SS (1995) Conservation and
dynamics of microsatellite loci over 300 million years of marine
turtle evolution. Mol Biol Evol 12:432–440
LeDuc C, Miller P, Lichter J, Parry P (1995) Batched analysis of
genotypes. PCR Meth Appl 4:331–336
Lee PLM (2008) Molecular ecology of marine turtles: new
approaches and future directions. J Exp Mar Biol Ecol 356:
25–42
Monzón-Argüello C, Muñoz J, Marco A, Lopez-Jurado LF, Rico C
(2007) Twelve new polymorphic markers from the loggerhead
sea turtle (Caretta caretta) and cross-species amplification on
other marine turtle species. Conserv Genet 9:1045–1049
Sarti-Martinez AL (2000) Dermochelys coriacea. In: IUCN 2006.
2006 IUCN Red List of Threatened Species. www.iucnredlist.org.
Accessed 14 June 2010
Shamblin BM, Faircloth BC, Dodd MG, Bagley DA, Ehrhart LM,
Dutton PH, Frey A, Nairn CJ (2009) Tetranucleotide markers
from the loggerhead sea turtle (Caretta caretta) and their crossamplification
in other marine turtle species. Conserv Genet 10:
577–580
Spotila JR, Dunham AE, Leslie AJ, Steyermark AC, Plotkin PT,
Paladino FV (1996) Worldwide population decline of
Dermocheleys coriacea: are leatherback turtles going extinct?
Chelonian Conserv Biol 2:209–222
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)
MICRO-CHECKER: software for identifying and correcting
genotyping errors in microsatellite data. Mol Ecol Notes 4:
535–538
Westerman ME, Buonaccorsi VP, Stannard JA, Galver L, Taylor C,
Lynn EA, Kimbrell CA, Vetter RD (2005) Cloning and
characterization of novel microsatellite DNA markers for the
grass rockfish, Sebastes rastrelliger, and cross-species amplification
in 10 related Sebastes spp. Mol Ecol Notes 5:74–76
123