Author's personal copy - Fakulta chemická - Vysoké učení technické ...

VYSOKÉ UČENÍ TECHNICKÉ V BRNĚ 

FAKULTA CHEMICKÁ 

PODKLADY PRO JMENOVACÍ ŘÍZENÍ 

v oboru Chemie, technologie a vlastnosti materiálů 

2012 DOC. ING. MARTIN WEITER, PH.D.

Obsah 

Tento dokument obsahuje Doklady předkládané uchazečem s návrhem na zahájení 

jmenovacího řízení profesorem. Jmenovací řízení bude zahájeno v oboru Chemie, 

technologie a vlastnosti materiálů na základě návrhu děkana Fakulty chemické VUT 

v Brně prof. Ing. Jaromíra Havlicy, DrSc. 

Všechny doklady byly zpracována na základě platné Směrnice rektora VUT v Brně 

1/2006 v úplném znění z 1.9.2008 (dále Směrnice). Níže předkládané materiály 

obsahují zejména životopis uchazeče, vlastní hodnocení uchazeče, které sestává z 

tabulky dosažených kvantifikovaných hodnotících kritérií podle odst. 2, Směrnice a se 

souhrnného vlastního vyjádření k bodovému hodnocení. Dále je přiložen seznam 35 

nejvýznamnějších publikovaných prací a kopie těchto publikací. Na závěr dokumentu 

jsou přiloženy další doklady dokládající kvalifikaci, způsobilost a kompetence žadatele. 

Životopis .................................................................................................................................................................3 

Autoevaluační kritéria......................................................................................................................................7 

Upřesnění jednotlivých položek autoevaluačních kritérií............................................................9 

Souhrnné vyjádření uchazeče k bodovému hodnocení..................................................................31 

Vědecká a odborná činnost .....................................................................................................................31 

Pedagogická činnost...................................................................................................................................33 

Přehled a kopie nejvýznamnějších publikací: .....................................................................................37 

Příloha č. 1 – přiložené publikace 

Příloha č. 2 – doklady 

1

Živootopis 

doc. Inng. 

Martiin 

Weiter r, Ph.D. 

OSOBNÍÍ 

ÚDAJE 

Datumm 

a místo naarození: 

Národnnost: 

Stav: 

Zaměsttnavatel: 

Kontakkt: 

VZDĚLÁÁNÍ 

1994 

2002 

2006 

ZAMĚSTTNÁNÍ 

1998 – dosud 

Ing. VVysoké 

učení 

technnické 

v Brně, B Faku ulta elektrrotechnická 

á, obor 

MMikroelektr 

ronika 

doc. ddocent 

v oboru 

Fyzikáální 

chemie, , FCH VUT v Brně 

od 20006 

– 2012 

od 20110 

– dosud 

od – 20012 

dosud 

3.3.19971, 

Ostrav va 

českáá 

ženattý, 

2 děti 

Vysokké 

učení tec chnické v Brně B 

Antonnínská 

548/1, 

Brno 60 01 90 

weiteer@fch.vutb 

br.cz 

Ph.D. VVysoké 

uče ení techniccké 

v Brně ě, Fakulta chemická, 

innženýrství 

obor Materiálové 

asisten nt/odbornýý 

asistent/ docent, Úst tav fyzikálnní 

a spotřeb bní 

chemie, 

Fakulta cchemická 

VUT V v Brně 

proděkan 

pro vnnější 

vztahy y a IT, Fakulta 

chemickká 

VUT v Brně 

vedou ucí výzkummného 

prog gramu Pokr ročilé orgaanické 

mat teriály a 

bioma ateriály Cenntra 

materi iálové výzk kumu FCH VVUT 

v Brně ě 

proděkan 

pro vzdělávací 

činnost 

a IT, FCH VUT v Brně 

ZAHRANNIČNÍ 

PRACCOVNÍ 

POBY YTY A STÁŽEE 

2002 

Institu ut Fyzikálnní 

chemie, Phillips Un niversity MMarburg, 

Německo N 

(roční í pobyt), 

2003 – 2005 krátko odobé pobyyty 

na zah hraničních pracovištíc p ch (Laboratory 

for 

Chemi istry of Novvel 

Materia als, University 

of Monns‐Hainaut 

t, Belgie; 

Philips s, Eindhovven, 

Nizoz zemí; Ph hillips Uniiversity 

Marburg, M 

2007 

Němec cko a další) ) 

absolu utorium měěsíčního 

ce ertifikované ého kurzu EEuropean 

Funding F 

Academy 

– 7th FFramework 

k programe 

3

ODBORNÉ AKTIVITY 

odborné zaměření nové materiály pro organickou elektroniku; příprava a 

charakterizace organických polovodičů; optické a elektrické 

vlastnosti organických polovodičů; charakterizace 

elementárních elektronových jevů a procesů spojených 

s fotogenerací a transportem náboje v organických polovodičích; 

numerické metody a modelování fotogenerace a transportu 

náboje; aplikační využití organických a biologických materiálů v 

optických, elektronických a senzorických zařízeních; 

publikační činnost autor a spoluautor více než 80 původních vědeckých prací, 

z toho 

� 35 prací v impaktovaných odborných časopisech, 

� 7 prací v recenzovaných odborných časopisech, 

� 42 příspěvků uveřejněných ve sbornících na mezinárodních 

a národních konferencích konferencích. 

Celkem 150 citací uveřejněných článků, h‐index: 7. 

grantová činnost spoluřešitel mezinárodního projektu 7. rámcového programu 

DEPHOTEX; účast v evropské výzkumné síti ORGANISOLAR; 

jeden z řešitelů projektu Centra materiálového výzkumu na 

Fakultě chemické VUT v Brně (MŠMT ČR, OP VaVpI); odpovědný 

řešitelněkolikagrantůGAČR, GAAV, projektuAVČRvrámci programu Nanotechnologie a společnost, spoluřešitel dvou 

aplikačních projektů Ministerstva průmyslu a obchodu. Celková 

dotace získaných projektů je 44,5 mil. Kč bez započítání 

zahraničních projektů a projektu VaVpI. 

PEDAGOGICKÉ AKTIVITY 

odborné aktivity e‐learning a jeho využití v distanční a kombinované formě studia, 

implementace LCMS systémů pro řízení vzdělávání, 

zpřístupnění vzdělávacího obsahu a podporu výuky; ICT 

publikační činnost 

podpora výuky 

autor a spoluautor 12 původních pedagogických prací, 2 skripta, 

multimediální učební opory pro výuku 

grantová činnost hlavní manažer a ideový tvůrce dvou projektů OP VK cílených na 

zvýšení úspěšnosti studentů kombinovaného studia v 

bakalářských a navazujících studijních programech v celkové 

hodnotě přes 20 miliónů korun; úspěšný řešitel pěti grantů 

FRVŠ; řešitel rozvojových projektů MŠMT v oblasti mobility, 

internacionalizace výuky a spolupráce s průmyslem 

garant předmětů Pokročilé aplikace molekulárních materiálů, Chemická 

informatika I, Chemická informatika II, Praktikum z fyziky, 

Měřící technika, 

vedení studentských prací vedoucí úspěšně obhájených 5 bakalářských, 12 

diplomových a 1 dizertační práce; školitel 10 studentů 

doktorského studia 

4

APLIKOOVANÝ 

VÝZKKUM 

A DALŠ ŠÍ PROFESNNÍ 

ZKUŠENOSTI 

Součassná 

spoluppráce 

s pod dniky a insstitucemi: 

�� 

Indian n Institute of Techn nology Mad dras, Indiee 

– vývoj nových 

ruthen niových kommplexů 

pro o aplikace v senzorechh 

a fotovolt taice 

�� 

Centru um organických 

syn ntéz, s.r.o., Rybitví, ČČeská 

repu ublika – 

vývoj multikommponentníc 

ch elektro onických ssystémů 

na n bázi 

�� 

organi ických slouučenin 

pro aplikaci v senzorech s a fotovoltai ice 

Výzku umný ústavv 

organický ých syntéz a. s., Rybittví 

– vývojnových 

nanom materiálů a funkcionál l. systémů pro p elektroonické 

příst troje 

�� 

GENER RI BIOTECH 

s.r.o., Hr radec Králo ové, Česká republika ‐ vývoj 

metod dy na elektrronickou 

de etekci hybr ridizace DNNA 

pro bios senzory 

Další pprofesní 

zkkušenosti 

OSTATNNÍ 

AKTIVITYY 

A ČLENSTVÍ 

od 20004 

dosud 

2005 ‐ 2006 

od 20005 

od 20007 

od 20110 

od 20112 

od 20112 

JAZYKOOVÉ 

ZNALOSSTI 

angličttina 

aktivnně, 

ruština aktivně, něěmčina 

pasivně 

ZÍSKANNÁ 

OCENĚNÍ 

2003 

V Brně dne 1.září 2012 

�� 

od 20 006 dosudd 

‐ proděkan 

Fakulty y chemickééVUTvBrně 

pro 

vnější vztahy zahhrnující 

rov vněž spolup práci s průmmyslem 

�� 

od 2009: 

hodnottitel 

evrops ských proje ektů 7. rámmcového 

pr rogramu 

pro ob blast Nanottechnologií 

í a ICT – fot tonika (EC, Brusel) 

�� 

od 20 004: hodnootitel 

proje ektů v obla asti vědy vvýzkumu 

a inovací 

pro do omácí granttové 

agentury 

GAČR, GAAV, OP VVK 

a další, 

�� 

2002‐ ‐ 2003: úččast 

na kurzechvrá 

ámci evroppské 

sítě Research R 

Trainig 

Networkk 

(Cambrid dge Univer rsity, Univv. 

Linköping, 

Univ. 

Bologn na, Technnical 

Univ v. Eindho oven, Uniiv. 

M. Hainaut) H 

zaměř řeného i naa 

aplikaci a komercion nalizaci výsledků 

VaV 

zaklád dající člen ttýmu 

pro ro ozvoj elearningu 

na VVUT 

předse eda komoryy 

akademic ckých pracovníků 

Akaademického 

senátu u FCH VUT v Brně 

člen Americké A chhemické 

společnosti 

( ACS) 

člen vě ědecké raddy 

Fakulty chemické c VUT V 

člen ob borové raddy 

doktorsk kého stud. programu p CChemie, 

techno ologie a vlaastnosti 

ma ateriálů (FC CH VUT v Brrně) 

člen ob borové raddy 

Pokročilé 

materiály y doktorskéého 

stud. 

progra amu Pokročilé 

materi iály a nanov vědy (MU, CEITEC VU UT) 

člen hodnotícíhoo 

panelu P2 205 Grantov vé agenturyy 

ČR 

cena rektora r VUTT 

za vynik kající výsled dky v pedaagogické 

a vědecké v 

práci 

5

Autoevaluační kritéria 

podle čl. 2 odst. 2 písm. c) Směrnice VUT v Brně pro habilitační řízení 

Uchazeč: doc. Ing. Martin Weiter, Ph.D. 

Datum narození: 3. března 1971 

Bydliště: Lipská 1, Brno – Žabovřesky 

Podklad k návrhu na jmenování: profesorem 

Souhrn 

Kategorie A1‐A6 A7‐A14 A ostatní A celkem B celkem Celkem 

A+B 

Požadováno 120 80 120 320 80 400 

Skutečnost 585 180 434 1199 256 1455 

A. Vědecká a odborná činnost 

Položka Body 

2 

Původní vědecká práce ve vědeckém časopisu 

s impakt faktorem větším než 0,5 

3 Původní vědecká práce ve vědeckém časopisu s IF 0,1– 0,5 45 

4 

Původní vědecká práce ve vědeckém časopisu s IF menším než 0,100 

nebo ve vědeckém časopisu bez IF 

6 Citace jiným autorem podle Science Citation Index 225 

9 

10 

11 

13 

Příspěvek ve sborníku světového nebo evropského kongresu, 

sympózia, vědecké konference 

Abstrakt ve sborníku světového nebo evropského kongresu, 


Příspěvek ve sborníku národního nebo mezinárodního kongresu, 


Abstrakt ve sborníku národního nebo mezinárodního kongresu, 


20 Členství ve vědecké radě (1 období) 6 

22 Členství v programovém výboru národního nebo mezinárodního 20 

270 

45 

45 

42 

70 

23 

7

kongresu, sympózia, vědecké konference 

23 Získání zahraničního grantu (řešitel, spoluřešitel) 20 

24 Získání externího grantu (řešitel, spoluřešitel) 90 

26 Členství v grantových komisích, radách výzkumných programů 6 

27 

Posudek zahraniční publikace nebo projektu, znalecký posudek, 

expertíza 

29 Posudek domácí publikace nebo projektu 148 

Celkem bodů za položky 

B. Pedagogická činnost 

144 

1199 

Poř. č Body 

1 Pedagogický úvazek 28 

3 Zavedení předmětu, který byl vyučován v posledních pěti letech 75 

4 Vedoucí obhájené bakalářské/diplomové práce 29 

5 Školitel/školitel specialista studenta, který získal Ph.D. 15 

8 Skripta 18 

9 Vytvoření významné výukové pomůcky (film, video, software) 80 

11 Členství v oborové radě doktorského studijního programu 4 

12 

Členství v komisi pro státní doktorskou zkoušku nebo obhajobu 

disertační práce 

13 Členství v komisi pro státní závěrečné zkoušky v jednom roce 3 

Celkem bodů za položky 

4 

256 

8

Upřesnění jednotlivých položek autoevaluačních kritérií 

A. Vědecká a odborná činnost 

2. Původní vědecká práce ve vědeckém časopisu 

s impakt faktorem větším než 0,5 

Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

9 

10 

KUČERÍK, J.; DAVID, J.; WEITER, M.; VALA, M.; VYŇUCHAL, J.; OUZZANE, I.; 

SALYK, O. Stability and physical structure tests of piperidyl and morpholinyl 

derivatives of diphenyl‐diketo‐pyrrolopyrroles (DPP). Journal of Thermal 

Analysis and Calorimetry, 2012, roč. 108, č. 2, s. 467‐473. ISSN 1388‐ 6150. 

IF(2011)=1,604. 

LUŇÁK, S.; VALA, M.; VYŇUCHAL, J.; OUZZANE, I.; HORÁKOVÁ, P.; 

MOŽÍŠKOVÁ, P.; WEITER, M. Absorption and fluorescence of soluble polar 

diketo‐pyrrolo‐pyrroles. Dyes and Pigments, 2011, 91(1), p. 269 ‐ 278. ISSN 

0143‐7208. IF(2010)=2,635. 

DAVID, J.; WEITER, M.; VALA, M.; VYŇUCHAL, J.; KUČERÍK, J. Stability and 

structural aspects of diketopyrrolopyrrole pigment and its N‐alkyl derivatives. 

Dyes and Pigments, 2011, 89(1), p. 137 ‐ 144. ISSN 0143‐7208. 

IF(2010)=2,635. 

LUŇÁK, S.; HAVEL, L.; VYŇUCHAL, J.; HORÁKOVÁ, P.; KUČERÍK, J.; WEITER, M.; 

HRDINA, R. The geometry and absorption of diketo‐pyrrolo‐ pyrroles 

substituted with various aryls. Dyes and Pigments, 2010, roč. 85, č. 1‐ 2, s. 27‐ 

36. ISSN 0143‐ 7208. IF(2010)=2.635. 

VALA, M.; VYŇUCHAL, J.; WEITER, M.; TOMAN, P.; LUŇÁK, S. Novel, soluble 

diphenyl‐diketo‐pyrrolopyrroles: Experimental and theoretical study. Dyes and 

Pigments, 2010, roč. 84, č. 8, s. 176‐182. ISSN: 0143‐ 7208. IF(2010)=2.635. 

WEITER, M.; SALYK, O.; BEDNÁŘ, P.; VALA, M.; NAVRÁTIL, J.; ZMEŠKAL, O. 

Morphology and properties of thin films of diketopyrrolopyrrole derivatives. 

Materials Science and Engineering A, 2009, 165(3), p. 148 ‐ 152. ISSN 0921‐ 

5093. IF(2009)=1.901. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; BARTKOWIAK, W.; MENŠÍK, 

M. Model of the influence of energetic disorder on inter‐chain charge carrier 

mobility in poly[2‐methoxy‐5‐(2 ‐ethylhexyloxy)‐p‐phenylene vinylene]. 

Polymers for Advanced Technologies, 2009, 20(3), p. 263 ‐ 267. ISSN 1042‐ 

7147. IF(2009)=1.532. 

WEITER, M.; NAVRÁTIL, J.; VALA, M.; TOMAN, P. Photoinduced reversible 

switching of charge carrier mobility in conjugated polymers. European Physical 

Journal‐Applied Physics, 2009, 48(1), p. 10401 ‐ 10406. ISSN 1286‐0042. 

IF(2009)=0.756. 

ZMEŠKAL, O.; VALA, M.; WEITER, M.; ŠTEFKOVÁ, P. Fractal‐cantorian 

geometry of space‐time. Chaos, Solitons & Fractals, 2009, 42(3), p. 1878 ‐ 

1892. ISSN 0960‐0779. IF(2009)=3.315. 

ZMEŠKAL, O.; WEITER, M.; VALA, M. Notes to "An irreducibly simple derivation 

of the Hausdorff dimension of spacetime" by M.S. El Naschie. Chaos, Solitons & 

Fractals. 2009, 42(10), p. 532 ‐ 533. ISSN 0960‐0779. IF(2009)=3.315. 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10 

9

11 

12 

13 

14 

15 

16 

17 

18 

19 

20 

21 

22 

23 

VALA, M.; WEITER, M.; VYŇUCHAL, J.; TOMAN, P.; LUŇÁK, S. Comparative 

Studies of Diphenyl‐Diketo‐Pyrrolopyrrole Derivatives for Electroluminescence 

Applications. Journal of Fluorescence, 2008, 18(6), p. 1181 ‐ 1185. ISSN 1053‐ 

0509. IF(2008)=1.880. 

VALA, M.; WEITER, M.; VYŇUCHAL, J.; TOMAN, P.; LUŇÁK, S. Experimental and 

theoretical study of novel pyrrolopyrroles for luminescence applications. 

Luminescence, 2008, 23(4), p. 276. ISSN 1522‐7235. IF(2008)=1.183. 

KRATOCHVÍLOVÁ, I.; KRÁL, K.; BUNČEK, M.; VÍŠKOVÁ, A.; NEŠPŮREK, S.; 

KOCHALSKA, A.; TODORCIUC, T.; WEITER, M.; SCHNEIDER, B. Conductivity of 

natural and modified DNA measured by Scanning Tunneling Microscopy. The 

effect of sequence, charge and stacking. Biophysical Chemistry, 2008, roč. 

2008, č. 11, s. 3‐10. ISSN: 0301‐ 4622. IF (2008)= 2.276 

KRATOCHVÍLOVÁ, I.; KRÁL, K.; BUNČEK, M.; NEŠPŮREK, S.; TODORCIUC, T.; 

WEITER, M.; NAVRÁTIL, J.; SCHNEIDER, B.; PAVLUCH, J. Scanning Tunneling 

Spectroscopy Study of DNA Conductivity. Central European Journal of Physics, 

2008, roč. 6, č. 3, s. 422‐426. ISSN: 1895‐ 1082. IF (2008)= 0,909. 

VALA, M.; WEITER, M. Molecular electronics: advances and limitations, 

strategies, materials, methods and applications. Chemické listy, 2008, 102(15), 

p. s1120 (6 p.). ISSN 1213‐7103. IF(2008)=0.593. 

ZMEŠKAL, O.; WEITER, M.; VALA, M.; BŽATEK, T. Mutual relation between 

fractal and statistical (random, thermodynamic) phenomena in nature. 

Chemické listy, 2008, 102(S), p. s1127 (4 p.). ISSN 1213‐7103. 

IF(2008)=0.593. 

ZMEŠKAL, O.; NEŠPŮREK, S.; WEITER, M. Space‐charge‐limited currents: An E‐ 

infinity Cantorian approach. Chaos, Solitons & Fractals, 2007, roč. 34, č. 2, s. 

143‐158. ISSN: 0960‐ 0779. IF(2007)=2,980. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; SWORAKOWSKI, J.; 

BARTKOWIAK, W.; MENŠÍK, M. Influence of dipolar species on charge transport 

in poly[2‐methoxy‐5‐(2 '‐ethylhexyloxy)‐p‐phenylene vinylene]. Polymers for 

Advanced Technologies, 2006, 17(9‐10), p. 673 ‐ 678. ISSN 1042‐7147. 

IF(2006)=1.406. 

WEITER, M.; BAESSLER, H. Transient photoconductivity and charge generation 

in thin films of pi‐ conjugated polymers. Journal of Luminescence, 2005, roč. 

112, č. 1‐ 4, s. 363‐367. ISSN: 0022‐ 2313. IF(2005)=1.314. 

SALYK, O.; BROŽA, P.; DOKOUPIL, N.; HERRMANN, R.; KUŘITKA, I.; PRYČEK, J.; 

WEITER, M. Plasma polymerisation of methylphenylsilane. Surface and 

Coatings Technology, 2005, roč. 200, č. 1‐ 4, s. 486‐489. ISSN: 0257‐ 8972. 

IF(2004)=1.432. 

MARKHAM, J.; SAMUEL, I.; BURN, S.; WEITER, M.; BAESSLER, H. Charge 

transport in highly efficient iridium cored electrophosphorescent dendrimers. 

Journal of Aplied Physics, 2004, roč. 95, č. 2, s. 438 ( s.)ISSN: 0021‐ 8979. 

IF(2004)=2.171. 

NEŠPŮREK, S., SWORAKOWSKI, J., COMBELLAS, C., WANG, G., WEITER, M. A 

molecular device based on light controlled charge carrier mobility. Applied 

Surface Science, 2004, roč. 234, č. 1–4, s. 395–402. ISSN 0169‐4332. IF (2004) 

= 1,284 

WEITER, M.; ARKHIPOV, V.; BAESSLER, H. Transient photoconductivity in a 

thin film of a polyphenylenevinylene type conjugated polymer. Synthetic Metals, 

2004, roč. 141, č. 1‐ 2, s. 165 ( s.)ISSN: 0379‐ 6779. IF(2004)=1.303. 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10 

10

24 

25 

26 

27 

WEITER, M., BAESSLER, H.; GULBINAS, V;, SCHERF, U. Transient photoconductivity 

in a film of ladder‐type poly‐phenylene: Failure of the Onsager approach. 

Chemical Physics Letters, 2003, roč. 379, č. 1, s. 117 ( s.)ISSN: 0009‐ 2614. 

IF(2003)=2.438. 

HORVÁTH, P., SCHAUER, F., WEITER, M., KUŘITKA, I., SALYK, O., DOKOUPIL, 

N., NEŠPŮREK, S., FIDLER, V. Luminescence in organic silicons prepared from 

organic precursors in plasma discharges. Chemical Monthly, roč. 132, č. 2001, 

s. 177‐ 185 ( s.) IF(2008)=1.183. 

SCHAUER, F., WEITER, M. Rigorous Modelling of Recombination Under Double 

Injection in Amorphous Films ‐ An Example of the Stiff Problem. Journal of 

Imaging Science and Technology, 1999, roč. 1999, č. 43, s. 413 ( s.)ISSN: 1062‐ 

3701. IF(1999)=0.582. 

HANDLÍŘ, R., NEŠPŮREK, S., SCHAUER, F., WEITER, M., KUŘITKA, I. 

Metastability in poly(methylsilylene) induced by UV radiation and electron 

beam. Journal of Non‐ Crystaline Solids, roč. 1998, č. 227‐ 230, s. 669 ( s.)ISSN: 

0022‐ 3093. IF(1998)=1.563. 

Celkem bodů za položku 270 

3. Původní vědecká práce ve vědeckém časopisu s IF 0,1– 0,5 

Poř. č Body 

1 

2 

3 

4 

5 

6 

ČERNÁ, K.; WEITER, M. Organic materials for photovoltaic solar cells. 

Chemické listy, 2005, roč. 99, č. 1, s. 562‐564. ISSN: 0009‐ 2770. 

IF(2005)=0.445. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Pi‐conjugated Polymers 

Influenced by Permanent Dipole Moment Formation. Chemické listy, 2005, 

99(S), p. s627 (2 p.). ISSN 0009‐2770. IF(2005)=0.445. 

WEITER, M.; VALA, M.; NEŠPŮREK, S. Pi‐conjugated polymers based electronic 

devices. Chemické listy, 2005, 99(1), p. 544 ‐ 545. ISSN 0009‐2770. 

IF(2005)=0.445. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; SWORAKOVSKI, J.; SALYK, O.; 

ZMEŠKAL, O. Reversible formation of charge carrier traps in 

poly(phenylenevinylene) derivative due to the phototransformation of a 

photochromic additive. Molecular Crystals and Liquid Crystals, 2005, 430(1), 

p. 227 ‐ 233. ISSN 1058‐725X. IF(2005)=0.468. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; SALYK, O. Polymers for Optoelectronic 

Applications: Characterization of the Model System. Chemické listy, 2004, 

98(8), p. 551 ‐ 551. ISSN 0009‐2770. IF(2004)=0.348. 

HANDLÍŘ, R; WEITER, M; SCHAUER, F. Methods of electron structure 

spectroscopy in molecular organic solids based on transient photoconductivity 

with space charge. Chemical Papers, 1996, roč. 50, č. 4, s. 199‐205. ISSN: 0366‐ 

6352 IF(2004)=0.152. 

10 

10 

10 

10 

7,5 

7,5 

7,5 

7,5 

7,5 

7,5 

11


4. Původní vědecká práce ve vědeckém časopisu s IF menším než 0,100 

nebo ve vědeckém časopisu bez IF 

Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

9 

MLADENOVA, D., WEITER, M., STEPANEK, P., OUZZANE, I., VALA, M., 

SINIGERSKY, V., ZHIVKOV, I. Characterization of electrophoretic suspension for 

thin polymer film deposition. Journal of Physics: Conference Series.,2012, roč. 

356, č. 1, s. 012040. ISSN 1742‐6588. 

ŠEDINA, M.; WEITER, M.; VALA, M.; SALYK, O. The role of various transport 

layers type for construction of organic solar cells. Journal of Biochemical 

Technology, 2011, roč. 2, č. 5, s. S40 ISSN: 0974‐ 2328. 

VALA, M.; WEITER, M.; HEINRICHOVÁ, P.; ŠEDINA, M.; OUZZANE, I.; 

MOŽÍŠKOVÁ, P. Tayloring of molecular materials for organic electronics. 

Journal of Biochemical Technology, 2010, roč. 2, č. 5, s. S44 ISSN: 0974‐ 2328 

VALA, M.; WEITER, M.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. Light Induced 

Change of Charge Carrier Mobility in Semiconducting Polymers. 

Macromolecular symposia, 2008, 268(1), p. 125 ‐ 128. ISSN 1521‐3900. 

VALA, M.; WEITER, M.; RAJTROVÁ, G.; NEŠPŮREK, S.; SWORAKOWSKI, J. 

Photochromic properties of spiropyran in polymeric pi‐conjugated matrices. 

Nonlinear Optics, Quantum optics: Concepts in Modern Optics, 2007, 37(1‐3), 

p. 53 ‐ 63. ISSN 1543‐0537. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; SWORAKOWSKI, J. 

Photoswitching in polymers with photochromic dipolar species. Nonlinear 

Optics, Quantum optics: Concepts in Modern Optics, 2007, 37(1‐3), p. 87 ‐ 98. 

ISSN 1543‐0537. 

WEITER, M.; VALA, M.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. A Molecular 

Photosensor Based on Photoswitching of Charge Carrier Mobility. 

Macromolecular Symposia, 2007, 2007(247), p. 318 ‐ 325. ISSN 1022‐1360. 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M.; TOMAN, P. Elecrical devices 

based on organic materials. Acta Metallurgica Slovaca, 2007, 13(6), p. 270 ‐ 

274. ISSN 1335‐1532. 

VALA, M.; WEITER, M.; NEŠPŮREK, S. Molecullar current switch: principles and 

characterization of the model system. CHEMagazín. 2005. XV(3). p. 28 ISSN 

1210‐7409. 


5 

5 

5 

5 

5 

5 

5 

5 

5 

12

Poř. č 

1 ‐ 

150 

6. CCitace 

jiný ým autoreem 

podle Science Citation C Index 

Údaje platnné 

k 1.9.201 12 podle Weeb 

of Science e 

8 Nejcitovaanějších 

pra ací: 

Celkem bbodů 

za položku 

Body 

225 

225 

13

9. Příspěvek ve sborníku světového nebo evropského kongresu, 


Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

ZMEŠKAL, O.; ŠTEFKOVÁ, P.; VALA, M.; WEITER, M. Study of thermal 

properties of sollar cell laminating films by pulse transient method. In 

Thermophysics 2008. Kočovce, STU Bratislava. 2006. p. 163 ‐ 168. ISBN 978‐ 

80‐227‐2968‐0. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; MENŠÍK, M. Influence of 

Energetic Disorder on Charge Carrier Mobility In Conjugated Polymers. In Book 

of Abstract of Conference PAT 2007. Haidelberg. 2007. (4 p.). 

WEITER, M.; VALA, M.; ZMEŠKAL, O.; NAVRÁTIL, J.; TOMAN, P.; NEŠPŮREK, S. 

Photodetector based on switching of charge carrier mobility in polymers. In 

Book of Abstract Conference LOPE‐C. Frankfurt. 2007. p. 1 ‐ 6. 

TOMAN, P.; NEŠPŮREK, S.; MENŠÍK, M.; WEITER, M.; VALA, M.; 

SWORAKOWSKI, J.; BARTKOWIAK, W. Modeling of charge carrier transport in 

conjugated polymers doped by polar species. In Book of Abstracts of 

Conference ICFPAM 2007. Krakow, Polsko. 2007. (5 p.). 

WEITER, M. Latest achievements in organic semiconductors for future 

electronic devices. In Proceedings of IMAPS International Conference. Brno: 

IMAPS, 2006. s. XV (XX s.)ISBN: 80‐214‐3246‐ 2. 

WEITER, M.; BAESSLER, H. Transient Photoconductivity and Charge Generation 

in a Thin Films of Pi‐ Conjugated Polymers. In Proc. of 6th International 

Conference on Excitonic Processes in Condensed Matter. 1. Poland: Krakow 

Univerity, 2004. ISBN: 83‐921060‐0‐ 8. 

SALYK, O.; WEITER, M.; KUŘITKA, I.; DOKOUPIL, N.; OTEVŘEL, M.; BROŽA, P.; 

SCHAUER, F.; LUSTIG, F. Physics Laboratory Experiments Using Data Collection, 

Evaluation and Simulation. In Proceedings of the Proceedings of conference 

Physics Teaching in Engineering Education PTEE 2003. 1. Leuven, Belgie: KU 

Leuven, 2002. s. H5 (H5 s.)ISBN: 90‐5682‐359‐ 0. 

SALYK, O., HORVÁTH, P., WEITER, M., SCHAUER, F. Photo‐ and 

Electroluminescence of Polysilanes Prepared by Vacuum Evaporation and 

Plasma Polymerisation. In Procceedings of 10th International School on 

Condensed Matter. Varna, Bulgaria: 1999. s. 216 ( s.) 


5 

5 

5 

5 

10 

5 

5 

5 

14

10. Abstrakt ve sborníku světového nebo evropského kongresu, 


Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

9 

10 

11 

12 

ZMEŠKAL, O.; NEŠPŮREK, S.; WEITER, M. Charge carrier transport in 

semiconductors: a fractal approach. International Conference on Recend 

Trends in Advanced Materials ICRAM‐ 2012. Vellore, Indie: VIT University, 

2012. s. 16‐16. 

VALA, M.; WEITER, M.; OUZZANE, I. Diketo‐Pyrrolo‐Pyrroles for Organic 

Electronics. Abstract book F‐PI‐10 International Symposium on Functional PI 

electron Systems. Beijing, China. 2011. s. 238. 

WEITER, M.; VALA, M.; ŠEDINA, M.; OUZZANE, I. Tailoring of properties of 

molcular semiconductors for organic electronics and photonics. 10th 

|international symposium on functional pi‐ electron systems. Beijing, China: 

2011. s. 253. 

OUZZANE, I.; WEITER, M.; VALA, M. Optical characterisation of organic diketo‐ 

pyrrolo‐ pyrroles derivatives and their photo processes study. 10th 

International symposium on functional pi‐ electron systems. Beijing, China: 

2011. s. 267. 

VALA, M.; WEITER M.; LUŇÁK S.; VYŇUCHAL, J. Optical and Electrical 

Properties of New Diketo‐pyrrolo‐pyrroles for Organic Electronics. In Book of 

Abstracts 12th International conference ERPOS‐2012. Vilnius, Lithuania, 

2011. p.120. ISBN 978‐9955‐634‐36‐2 

ŠPÉROVÁ, M.; WEITER, M.; KUČERÍK, J. The new materials for organic 

electronics and photovoltaics. Book of Abstracts 2nd International Symposium 

on Flexible Organic Electronics .Řecko, 2011. 

VALA, M.; WEITER M.; LUŇÁK S.; VYŇUCHAL, J. Diketo‐pyrrolo‐pyrroles for 

organic electronics. In Book of abstracts 44th Heyrovský Discussion 

Nanostructures on Electrodes. Třešť, Czech Republic. 2011. p.41‐42. ISBN 

978‐80‐87351‐8 

OUZZANE, I.; HEINRICHOVA P.; SEDINA, M.; VALA, M.; WEITER, M. Optical 

characterisation studies of novel diketo‐pyrrolo‐pyrroles In Book of abstracts 

44th Heyrovský Discussion Nanostructures on Electrodes. Třešť, Czech 

Republic. 2011. Ip.57‐58. ISBN 978‐80‐87351‐8 

VALA, M.; WEITER M.; LUŇÁK S.; VYŇUCHAL, J. Electrooptical properties of 

new diketo‐pyrrolo‐pyrroles. In Book of Abstracts Photonics Prague 2011. 

Prague, Czech Republic. 2011. p.57. ISBN 978‐80‐86742‐30‐4 

VALA, M.; OUZZANE, I.; LUŇÁK, S.; VYŇUCHAL, J.; WEITER, M. Two Photon 

Excited Fluorescence of Novel Diphenyl‐Diketo‐Pyrrolopyrroles. Abstract book 

F‐PI‐09 International Symposium on Functional PI electron Systems, Atlanta, 

USA. 2010. 

WEITER, M.; VALA, M.; SALYK, O.; VYŇUCHAL, J.; LUŇÁK, S. New 

Diketopyrrolopyrrole Derivatives for Organic Electronics. Abstract book ECME 

2009 ‐ European Conference on Molecular Electronics 2009. Dánsko, 

University of Copenhagen. 2009. p. POS1A (1 p.). 

DAVID, J.; WEITER, M.; VALA, M.; VYŇUCHAL, J.; KUČERÍK, J. Stability and 

physical structure tests of DPP‐ based luminiscent derivates. In Medicta 2009, 

Abstracts. France: 2009. s. 92‐92. 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

15

13 

14 

15 

16 

17 

18 

19 

20 

21 

22 

23 

24 

25 

WEITER, M.; VALA, M.; VYŇUCHAL, J. Novel derivatives of 

diketopyrrolopyrroles for organic electronics. Book of Abstracts 2nd 

International Symposium on Flexible Organic Electronics, 8‐10 July 2009. 

Řecko, Galonis. 2009. p. 96 ‐ 96. 

VALA, M.; WEITER, M.; VYŇUCHAL, J.; TOMAN, P. Experimental and theoretical 

study of novel pyrrolopyrroles for luminescence applications. In XIII 

International Symposium on Luminescence Spectrometry. Italy, University of 

Bologna. 2008. p. 148 ‐ 148. 

WEITER, M.; VALA, M.; ZMEŠKAL, O. Optical and optoelectronic properties of 

organic semiconductors for molecular electronic. In XIII International 

Symposium on Luminescence Spectrometry. Italy, University of Bologna. 

2008. p. 10 ‐ 10. 

WEITER, M.; VALA, M.; NAVRÁTIL, J.; TOMAN, P.; NEŠPŮREK, S. Influence of 

photoswitchable traps on charge transport in conjugated polymers. In Book of 

abstracts. Rakousko. 2008. p. 205 ‐ 205. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; BARTKOWIAK, W. Modeling 

of charge carrier transport in conjugated polymers doped by polar additives. In 

Book of Abstracts. Wroclaw, Polsko. 2008. p. 36 ISBN 978‐83‐7493‐399‐5. 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M.; SALYK, O.; TOMAN, P.; 

VYŇUCHAL, J. Influence of side groups substitution on the optical and electrical 

properties of diketopyrrolopyrrole derivatives. In Book of Abstracts. Polsko. 

2008. p. 70 ‐ 70. ISBN 978‐83‐7493‐399‐5. 

WEITER, M.; VALA, M.; NAVRÁTIL, J.; TOMAN, P.; NEŠPŮREK, S. 

Photogeneration and transport of charge carriers in semiconducting polymers 

with polar additives. In Book of Abstracts. Polsko. 2008. p. 111 ‐ 111. ISBN 

978‐83‐7493‐399‐5. 

NAVRÁTIL, J.; WEITER, M.; VALA, M.; ZMEŠKAL, O.; NEŠPŮREK, S. 

Photoinduced Reversible Switching of Charge Carrier Mobility in Conjugated 

Polymers. In Book of Abstract 1st International Symposium on Flexible 

Organic Electronics. Řecko. 2008. p. 90 ‐ 90. 

WEITER, M.; NAVRÁTIL, J.; VALA, M.; SALYK, O.; BEDNÁŘ, P.; ZMEŠKAL, O. 

Structure Property Relationship of Thin Films of Diketopyrrolopyrrole 

Derivatives. In Book of Abstracts 1st International Symposium on Flexible 

Organic Electronics.. Řecko. 2008. p. 92 ‐ 92. 

WEITER, M.; NAVRÁTIL, J.; VALA, M. Photogeneration of Charge Carriers in 

Conjugated Polymers with Polar Additives. In Book of Abstracts. 1st 

International Symposium on Flexible Organic Electronics Řecko. 2008. p. 91 

VALA, M.; WEITER, M.; TOMAN, P. Novel diphenylpyrrolopyrroles for 

electroluminescence applications. In Methods and Applications of 

Fluorescence: Spectroscopy, Imaging and Probes. Regensburg, University of 

Regensburg. 2007. p. 100 ‐ 100. 

NEŠPŮREK, S.; WEITER, M.; TODORCIUC, T.; SCHNEIDER, B.; BUNČEK, M. 

Scanning Tunnelling Spectroscopy Study of Charge Transport Through DNA 

Networks. In Abstracts Booklet of International Conference Nano 07. Brno: 

VUTIUM, 2007. s. 34‐34. ISBN: 978‐80‐214‐3460‐ 8. 

VALA, M.; WEITER, M.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. Light Induced 

Change of Charge Carrier Mobility in Semiconducting Polymers. In Advanced 

Polymer Materials for Photonics and Electronics. Praha, IMC AS CR v.v.i. 2007. 

p. 108 ‐ 108. ISBN 978‐80‐85009‐56‐9. 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

16

26 

27 

28 

29 

30 

31 

32 

33 

34 

35 

36 

37 

38 

VALA, M.; WEITER, M.; ZMEŠKAL, O.; NAVRÁTIL, J.; OUZZANE, I.; NEŠPŮREK, 

S.; TOMAN, P. Photoswitchable Charge Traps in Organic Semiconducting 

Matrix. In International Conference on Organic Electronics. Eindhoven, 

Netherland. 2007. p. 100 ‐ 101 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; MENŠÍK, M. Influence of 

Energetic Disorder on Charge Carrier Mobility In Conjugated Polymers. In In 

Book of Abstract of Conference PAT 2007. Haidelberg: 2007. 

TOMAN, P.; NEŠPŮREK, S.; MENŠÍK, M.; WEITER, M.; VALA, M.; 

SWORAKOWSKI, J.; BARTKOWIAK, W. Modeling of charge carrier transport in 

conjugated polymers doped by polar species. In In Book of Abstracts of 

Conference ICFPAM 2007. Krakow, Polsko: 2007. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; SWORAKOVSKI, J. Influence 

of polar additives on charge transport in MEH‐PPV. In Book of abstracts of 

ECME . Okazaki. 2006. p. P‐24‐b (1 p.). 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; TOMAN, P. The effect of charge carrier 

traps photoswitching on charge transport in molecular materials. In Book of 

abstracts of EOC. Eindhoven, Nizozemí. 2006. p. 87 ‐ 87. 

WEITER, M.; VALA, M.; NAVRÁTIL, J.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. 

Organic semiconductors for future molecular electronic devices. . In Book of 

abstracts of Nanoconference. Brno. 2006. p. 50 ‐ 50. 

TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; SWORAKOVSKI, J. Influence 

of Photochromic Dipolar Species on Electronic Properties of Conjugated 

Polymers. In Book of 8th International Symposium Polymers for Advanced 

Technologies. 2005. 

VALA, M.; WEITER, M.; RAJTROVÁ, G.; NEŠPŮREK, S.; ZMEŠKAL, O. 

Photochromic properties of spiropyranes in polymeric pi‐conjugated matrices. 

In Proceeding of 10 th International conference of Electrical and Related 

Properties of Organic Solids and Polymers. Cargese, France. 2005. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Dopant‐assisted carrier 

photogeneration in conjugated polymers. In 10 th International conference of 

Electrical and Related Properties of Organic Solids and Polymers. Cargese, 

France, Bordeaux University. 2005. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; TOMAN, P. The effect of photochromic 

dipolar species on charge transport in disordered organic materials. In Proc. of 

8th European Conference on Molecular Electronics.Bologna, Italy, CNR Italy. 

2005. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; TOMAN, P.; SWORAKOVSKI, J. A 

molecular device based on light controlled mobility switching: characterization 

of the model system. In Proc. of 6th International Conference on Organic 

Electronics (ICOE).Eindhoven, Netherland, Philips. 2005. 

WEITER, M.; BAESSLER, H. Photoconductivity and Charge Generation in a Thin 

Films of Pi‐ Conjugated Polymers. In Book of Abstracts of 6th International 

Conference on Excitonic Processes in Condensed Matter. 1. Cracow: 

University Cracow, 2005. s. P124 ( s.)ISBN: 83‐921060‐0‐ 8. 

SWORAKOVSKI, J., NEŠPŮREK, S., WANG, G., WEITER, M. Light controlled 

charge carrier mobilities on polymer chain. Towards a molecular switch. In 

Proc. of 7th European Conference on Molecular Electronics ECME‐ 7. Avignon: 

ECME, 2003. s. 89 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

1 

17

39 

40 

41 

42 

NEŠPŮREK, S., WANG, G., WEITER, M., SWORAKOVSKI, J. A Molecular Device 

Based on Light Controlled Charge Carrier mobility. In Proc. of 9th International 

Conference on the Formation of Semiconductror Intrefaces. 1. Madrid: ICFSI, 

2003. s. 15 ( s.)ISBN: 90‐5681‐ 4. 

SWORAKOVSKI, J., NEŠPŮREK, S., WANG, G., WEITER, M. Light controlled 

charge carrier motilities on polymer chain. Towards a molecular switch. In 

Proc. of 7th European Conference on Molecular Electronics ECME. 1. Avignon: 

PTEE, 2003. s. 48 ISBN: 90‐4872‐ 4. 

SALYK, O., KUŘITKA, I., WEITER, M., SCHAUER, F. Oriented Thin Films of 

Polysilylenes and their Properties. In Proceedings of the Workshop Electronic 

Properties of Molecular Materials and Functional Polymers of EU programme 

COST 518 Molecular Materials and Functional Polymers for Advanced 

Devices. Brno: Brno University of Technology, Faculty of Chemistry, 2001. s. 

168 ( s.)ISBN: 80‐214‐1893‐ 1. 

SALYK, O., SCHAUER, F., WEITER, M., HORVÁTH, P. Novel application of 

polysilylenes. In Proceeding of 10th International School on Condensed 

Matters. Varna, 1998. s. 242 


11. Příspěvek ve sborníku národního nebo mezinárodního kongresu, 


Poř. č Body 

1 

2 

3 

4 

5 

6 

VALA, M.; WEITER, M. Materials for Organic Electronics. In Sborník příspěvků 

XI pracovní setkání fyzikálních chemiků a elektrochemiků. Brno, Česká 

republika, 2011. p. 301‐304. ISBN 978‐80‐7375‐514‐0 

OUZZANE, I.; ŠEDINA, M.; HEINRICHOVÁ, P.; VALA, M.; WEITER, M. Optical 

Characterization of Organic Semiconductors. In Sborník příspěvků XI pracovní 

setkání fyzikálních chemiků a elektrochemiků. Brno, Česká republika, 2011. p. 

200‐202. ISBN 978‐80‐7375‐514‐0 

HEINRICHOVÁ, P.; MOŽÍŠKOVÁ, P.; ŠEDINA, M.; WEITER, M. Studium 

fotodegradace organických materiálů pro fotovoltaické aplikace. In Z. Remeš, 

M. Vaněček, A. Poruba Optical characterization methods in the solar cell 

research, Sborník příspěvků z 5. České fotovoltaické konference, 10.‐13. 11. 

2010. Brno: 2011. ISBN: 978‐80‐254‐8906‐ 2. 

ZMEŠKAL, O.; WEITER, M.; VALA, M. Interaktivní multimediální sbírka příkladů 

základního kurzu fyziky. In Sborník příspěvků část 2 ‐ fyzika. Brno, ČR: 

Univerzita obrany, 2011. s. 151‐159. ISBN: 978‐80‐7231‐815‐ 5. 

WEITER, M.; VALA, M.; VYNUCHAL, J.; KUBAC, L. Development of New Organic 

Semiconductors and their Applications in Organic Electronics and Photonnics, 

In 2nd NANOCON International Conference. Česká republika, Olomouc. 2010. 

p. 114‐119. 

ZMEŠKAL, O.; WEITER, M.; VALA, M. The Basics of Fractal Physics, In: 16th 

International Conference on Soft Computing, MENDEL 2010. p. 154‐160 

1 

1 

1 

1 

2 

2 

2 

2 

2 

2 

18

7 

8 

9 

10 

11 

12 

13 

14 

15 

16 

17 

18 

19 

ŠEDINA, M.; HEINRICHOVÁ, P.; WEITER, M.; VALA, M.; SALYK, O. The role of 

various transport layers type for construction of organic solar cells. In X. 

Pracovní setkání fyzikálních chemiků a elektrochemiků. Brno: Mendelova 

univerzita v Brně, 2010. s. 205‐207. ISBN: 978‐80‐7375‐396‐ 2. 

HEINRICHOVÁ, P.; MOŽÍŠKOVÁ, P.; ŠEDINA, M.; WEITER, M. The 

photodegradation of polymers and small molecular materials applied in organic 

optoelectronic devices. In X. Pracovní setkání fyzikálních chemiků a 

elektrochemiků & IV. Letní elektrochemická škola; Sborník příspěvků 23. ‐ 25. 

června 2010. Brno: Mendlova univerzita v Brně, 2010. s. 81‐83. ISBN: 978‐80‐ 

7375‐396‐ 2. 

VALA, M.; NAVRÁTIL, J.; WEITER, M. Podcast učební opory: připravenost 

studentů. In Sborník příspěvků z konference a soutěže eLearning 2009. Česká 

republika, Gaudeamus UHK. 2009. p. 299 ‐ 302. ISBN 978‐80‐7041‐971‐7. 

NAVRÁTIL, J.; VALA, M.; WEITER, M. Podpora výuky formou podcast. In 

Sborník příspěvků z konference a soutěže eLearning 2009. Česká republika, 

Gaudeamus UHK. 2009. p. 299 ‐ 302. ISBN 978‐80‐7041‐971‐7. 

ZMEŠKAL, O.; VALA, M.; CVACHOVEC, F.; KOMÁREK, M. Videopresentace 

demonstračních úloh do přednášek z fyziky. In 6. konference o matematice a 

fyzice na vysokých školách technických. první. Brno, Univerzita obrany. 2009. 

p. 445 ‐ 460. ISBN 978‐80‐7231‐667‐0. 

WEITER, M.; VALA, M.; SALYK, O.; ZMEŠKAL, O.; PŘIKRYL, R.; VYŇUCHAL, J. 

Low Molecular Materials for Possible Application in Organic Solar Cells. In 

Sborník příspěvků. Brno. 2008. p. 111 ‐ 114. ISBN 978‐80‐254‐3528‐1. 

RICHTERA, L.; WEITER, M.; VALA, M.; NAVRÁTIL, J. E‐learningová podpora 

laboratorní výuky praktik z obecné a anorganické chemie a praktik z fyziky. In 

Mezinárodní konference SILESIAN MOODLE MOOT 2008, 5. ročník, sborník 

příspěvků. Ostrava, Vysoká škola báňská ‐ Technická univerzita Ostrava. 

2008. p. 97 ‐ 102 (272 p.). ISBN 978‐80‐248‐1859‐7. 

ZMEŠKAL, O.; VALA, M.; WEITER, M. El Naschie's Golden Field Theory and 

Fractal ‐ Cantorian Physics. In Proceeding of New Trends in Physics 2007. 

Brno, Novotný, Brno. 2007. p. 193 ‐ 198. ISBN 978‐80‐7355‐078‐3. 

WEITER, M.; VALA, M.; ZMEŠKAL, O.; BEDNÁŘ, P.; SALYK, O. Organic Materials 

for Future Optoelectronic Devices. In Proceeding of the conference New Trends 

in Physics 2007. Brno. 2007. p. 286 ‐ 289. ISBN 978‐80‐7355‐078‐3. 

VALA, M.; WEITER, M.; NAVRÁTIL, J. Photoswitchable Devices Based on Organic 

Semiconductors. In Proceeding of the conference New Trends in Physics 2007. 

Brno, Novotný. 2007. p. 282 ‐ 286. ISBN 978‐80‐7355‐078‐3. 

ZMEŠKAL, O.; VESELÝ, M.; VALA, M.; BEDNÁŘ, P.; BŽATEK, T. Image Analysis 

Used to Study Physical Properties of Printed Organic Thin Films. In VIII Seminar 

in Graphic Arts. Conference Proceedings. Pardubice, Universita Pardubice. 

2007. p. 131 ‐ 137. 

ZMEŠKAL, O.; WEITER, M. Koncepce výuky fyziky na Fakultě chemické 

Vysokého učení technického v Brně. In 5. konference o matematice a fyzice na 

vysokých školách technických s mezinárodní účastí. 1. Brno: JČMF, 2007. s. 

523‐532. ISBN: 978‐80‐7231‐274‐ 0. 


Polymer photoelectronic devices based on interaction between pi‐conjugated 

polymer matrices and photochromic molecules. In Book of Abstract. Praha. 

2007. p. 1 ‐ 6. ISBN 80‐214‐3308‐6. 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

19

20 

21 

22 

23 

24 

25 

26 

27 

28 

29 

30 

31 

32 

33 

34 


Polymer optical sensor based on photochromic switching of charge carrier 

mobility. In Book of Abstract. Praha. 2007. p. 1 ‐ 5. ISBN 978‐0‐8194‐6729‐4. 

WEITER, M.; VALA, M.; NAVRÁTIL, J.; ZMEŠKAL, O. Organic semiconductors for 

future molecular electronic devices. In Proceedings of the International 

Conference NANO 2006. Brno. 2006. p. 184 ‐ 189. ISBN 80‐214‐3331‐0. 

WEITER, M.; VALA, M.; ZABADAL, M. Využití IKT v praktických laboratorních 

cvičeních. In Sborník příspěvků. Univerzita Konstantina Filozofa v Nitre. 2006. 

p. 25 ‐ 30. ISBN 80‐8094‐032‐0. 

WEITER, M. Generace náboje v konjugovaných polymerních materiálech 

vhodných pro fotovoltaické aplikace. In Sborník příspěvků 3. České 

fotovoltaické konference. Brno: Czech RE agency, 2006. s. 39‐45. ISBN: 80‐ 

239‐7361‐ 4. 

WEITER, M.; ZDÍLNA, P.; ČERNÁ, K.; KRČMOVÁ, M. Připravenost studentů a 

zavádění e‐ learningu na Fakultě chemické VUT v Brně. In Sborník 2. ročníku 

conference SCO 2005. 1. Brno: MU v Brně, 2005. s. 151‐154. ISBN: 80‐210‐ 

3699‐ 0. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; TOMAN, P. Molecular Current Switch: 

Principles and Characterization of the Model System. In sborník. 2005. p. 95 ‐ 

99. ISBN 80‐214‐3085‐0. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Optical and electrical 

switching in organic semiconductorts. In Juniormat '05. Brno, CZ. 2005. p. 71 ‐ 

74. ISBN 80‐214‐2984‐4. 

WEITER, M.; SALYK, O.; ČERNÁ, K.; BRADA, J.; ZELENÝ, M. Výuka fyzikálního 

praktika s podporou LMS Moodle. In Sborník Konference Belcom 05. 1. Praha: 

ČVUT v Praze, 2005. s. 67‐71. ISBN: 80‐01‐03203‐ 5. 

WEITER, M.; SALYK, O.; VALA, M.; BRADA, J. Utilization of e‐learning in 

experimental physics teaching, In Proceedings of Physics Teaching in 

Engineering Education PTEE 2005. 2005. p. 245 ‐ 249. ISBN 80‐7355‐024‐5. 

SEVEROVÁ, K.; NEŠPŮREK, S.; WEITER, M. Humidity sensors based on organic 

semiconductor. In: Česká společnost chemická, Brno 2005. s. s610 (s612 s.) 

SEVEROVÁ, K.; WEITER, M.; NEŠPŮREK, S. Sensoric properties of soluble 

phtalocyanines. In Juniormat 05. 1. Brno: Vysoké učení technické, fakulta 

strojního inženýrství, 2005. s. 187‐190. ISBN: 80‐214‐2984‐ 4. 

WEITER, M.; VALA, M.; NEŠPŮREK, S. Molecular Current Modulator: Principles 

and Photoelectronic Characterization of the Model System. In Proc. of 

conference New Trends in Physics ‐ NTF 2004. Brno, VUT v Brně. 2004. p. 274 

‐ 277. ISBN 80‐7355‐024‐5. 

SALYK, O.; WEITER, M. Polysilane Luminescent Materials. In Proc. of 11th 

Conference Electronic Device and Systems 2004. 1. Brno: VUT v Brně, 2004. s. 

278‐285. ISBN: 80‐214‐2701‐ 9. 

SALYK, O.; WEITER, M. Využití eLearningových technologií při výuce fyzikálního 

praktika. In sborník konference eLearning ve vysokoškolském vzdělávání 

2004. 1. Zlín: UTB Zlín, 2004. s. 135‐139. ISBN: 80‐7318‐190‐ 8. 

WEITER, M., SALYK, O., VALA, M. Optoelectronic properties of conjugated 

polymers. In Juniormat '03. Brno, Brno University of Technology. 2003. p. 128 

‐ 131. ISBN 80‐214‐2462‐1. 


2 

2 

2 

4 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

2 

20

13. Abstrakt ve sborníku národního nebo mezinárodního kongresu, 


Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

9 

10 

11 

12 

13 

ŠEDINA, M.; OUZZANE, I.; VALA, M.; WEITER, M. Characterization of 

Phthalocyanine Derivates for Application in Organic Photovoltaics. In Book of 

Abstracts 8th International Conference on Nanosciences & Nanotechnologies 

(NN11). Thessaloniki, GREECE. 2011 

VALA, M.; WEITER, M.; HEINRICHOVÁ, P.; OUZZANE, I. Optical Properties of 

Diketo‐pyrrolo‐pyrroles for Organic Electronic Applications. Chemické listy. 

2011. 105(S). p. s.886. ISSN\~0009‐2770. (IF(2010)=0,602). 

MLADENOVA, D.; ZHIVKOV, I.; OUZZANE, I.; VALA, M.; WEITER, M. 

Characterization of Poly[2‐methoxy‐5‐(3',7'‐dimethyloctyloxy)‐1,4‐ 

phenylenevinylene] Electrophoretic Suspensions Used for Thin Film 

Deposition. Chemické listy. 2011. 105(S). p. s.949. ISSN: 0009‐2770. 

(IF(2010)=0,602). 

WEITER, M.; HEINRICHOVÁ, P.; ŠEDINA, M.; OUZZANE, I.; FLIMEL, K.; VALA, 

M. Development and Characterization of Novel Solar Cells for Organic 

Photovoltaics. Chemické listy. 2011. 105(S). p. s.871. ISSN: 0009‐2770. 

(IF(2010)=0,602). 

ZHIVKOV, I.; MLADENOVA, D.; HEINRICHOVÁ, P.; OUZZANE, I.; VALA, M.; 

WEITER, M. Electrophoretic Deposition of Thin Organic Films for Solar Energy 

Conversion Purpose. Chemické listy. 2011. 105(S). p. s884. ISSN\~0009‐2770. 

(IF(2010)=0,602). 

ŠEDINA, M.; OUZZANE, I.; FLIMEL, K.; VALA, M.; WEITER, M. Characterization 

of phthalocyanine derivates for application in organic photovoltaic. Chemické 

listy. 2011. 105(S). p. s902. ISSN\~0009‐2770. 

OUZZANE, I.; WEITER, M.; VALA, M. Novel diketo‐pyrrolo‐ pyrroles organic 

derivatives for optical applications. Chemické listy. 2011. 105(S). s. 802‐802. 

ISSN: 0009‐ 2770 

HEINRICHOVÁ, P.; DZIK, P.; ZHIVKOV, I.; MLADENOVA, D.; WEITER, M. 

Development of Organic Solar Cells Based on Conjugated Polymers. . 

Chemické listy. 2011. 105(S) s895. ISSN: 0009‐ 2770. 

MLADENOVA, D.; WEITER, M.; BUDUROVA, D.; ZHIVKOV, I. Photoelectrical 

properties of electrophoretically‐ deposited thin organic films Chemické listy. 

2011. 105(S) s. 89‐90. ISSN: 0009‐ 2770. 

ŠPÉROVÁ, M.; WEITER, M.; KUČERÍK, J. Optical and electrical properties of 

thin layers of humic substances. Chemické listy. 2011. 105(S). s. s934 (s934 

s.)ISSN: 0009‐ 2770. 

OUZZANE, I.; VALA, M.; WEITER, M. Novel diketo‐pyrrolo‐ pyrroles organic 

derivatives for optical applications. Sborník XI. Pracovní Setkání Fyzikálních 

Chemiků a Elektrochemiků. Brno 2011. 

WEITER, M.; VALA, M.; VYŇUCHAL, J. Molecular design of novel small 

molecular semiconductors for molecular electronics. Praha, European 

Commission. 2009. p. 224 ‐ 224. ISBN 978‐92‐79‐12973‐5. 

WEITER, M.; VALA, M.; SALYK, O.; ZMEŠKAL, O.; PŘIKRYL, R.; VYŇUCHAL, J. 

Polymerní a nízkomolekulární materiály pro aplikaci v organických solárních 

článcích. In Sborník abstraktů. Brno, ČR. 2008. p. 1 ‐ 4. 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

21

14 

15 

16 

17 

18 

19 

20 

21 

22 

23 

24 

25 

26 

27 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M.; VYŇUCHAL, J. Novel 

diketopyrrolopyrroles for molecular optical and electrical devices. Chemické 

listy, 2008, roč. 102, č. S, s. s959 (s960 s.)ISSN: 1213‐ 7103. 

SALYK, O.; WEITER, M.; VYŇUCHAL, J. Structure and morphology of some 

diphenyl‐diketo‐pyrrolo‐ pyrrole derivatives pigments. Chemické listy, 2008, 

roč. 102, č. 00, s. 1183‐1185. ISSN: 1213‐ 7103. 

OUZZANE, I.; HERMANOVÁ, S.; VALA, M.; WEITER, M.; NEŠPŮREK, S. Synthesis 

of Substituted Polysililenes Used as Semiconductive Polymers. Chemické listy. 

2008. 102(15). p. s1259 (2 p.). ISSN 1213‐7103. (IF(2008)=0.593). 

NAVRÁTIL, J.; WEITER, M.; VALA, M. Polymer photoelectronic devices based 

on interaction between Pi‐conjugated polymer matrices and photochromic 

molecules. Chemické listy (S). 2008. 102(15). p. 1250 ‐ 1251. ISSN 1803‐2389. 

(IF(2008)=0.593). 

WEITER, M.; VALA, M.; NEŠPŮREK, S. Polymer semiconductors for future 

molecular electronic devices. Chemické listy (S). 2008. 102(15). p. 1232 ‐ 

1234. ISSN 1803‐2389. (IF(2008)=0.593). 

RICHTERA, L.; WEITER, M.; VALA, M.; NAVRÁTIL, J. E‐Learning Support for 

Laboratory Exercises. In VIRTUAL UNIVERSITY PROCEEDINGS. Huba Mikuláš. 

Bratislava, E‐Academia Slovaca. 2008. p. 471 ‐ 473. ISBN 978‐80‐89316‐10‐6. 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M.; VYŇUCHAL, J. Materals for 

organic electroluminiscence devices. In Sborník příspěvků VIII. pracovního 

setkámí fyzikálních chemiků a elektrochemiků. Brno, Masarykova univerzita. 

2008. p. 14 ‐ 15. ISBN 978‐80‐210‐4525‐5. 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M. Electrical Devices Based on 

Organic Pigments. In Book of Abstracts. Brno. 2007. p. 85 ‐ 85. ISBN 80‐214‐ 

3331‐0. 

WEITER, M.; VALA, M.; ZMEŠKAL, O.; BEDNÁŘ, P.; TOMAN, P.; VYŇUCHAL, J. 

Novel Diketopyrrolopyrroles for Molecular Electronics. In Abstract Booklet of 

the International Conference. Brno, VUTIUM. 2007. p. 39 ‐ 39. ISBN 978‐80‐ 

214‐3460‐8. 

WEITER, M.; VALA, M.; NAVRÁTIL, J.; ZMEŠKAL, O. Molecular semiconductors 

for future electronic devices. In sborník příspěvků VII. pracovního setkámí 

fyzikálních chemiků a elektrochemiků. Brno, Masarykova univerzita. 2007. p. 

138 ‐ 139. ISBN 978‐80‐210‐4235‐3. 

BEDNÁŘ, P.; ZMEŠKAL, O.; WEITER, M.; VALA, M. Utilization of organic 

pigments for molecular electrical device. In sborník příspěvků VII. pracovního 

setkámí fyzikálních chemiků a elektrochemiků. Brno, Masarykova univerzita. 

2007. p. 12 ‐ 13. ISBN 978‐80‐210‐4235‐3. 

VALA, M.; KRČMOVÁ, M.; WEITER, M.; KOZÁKOVÁ, Z.; JEŘÁBKOVÁ, P. Optical 

characterization and fluorescence quantum yields measurement of novel 1,4 ‐ 

dioxo‐3,6‐diphenylpyrrolo‐[3,4/C]‐pyrrole derivatives. In sborník příspěvků 

VII. pracovního setkámí fyzikálních chemiků a elektrochemiků. Brno, 

Masarykova univerzita. 2007. p. 125 ‐ 126. ISBN 978‐80‐210‐4235‐3. 

ZMEŠKAL, O.; ŠTEFKOVÁ, P.; VALA, M.; WEITER, M. Pulse transient method 

used for analysis of temperature modulated space charge limited currents. In 

Thermophysics 2006. Kočovce, STU Bratislava. 2006. p. 1 ‐ 1. ISBN 80‐227‐ 

2536‐6. 

SEVEROVÁ, K.; NEŠPŮREK, S.; WEITER, M.; ZMEŠKAL, O. 

Metallophthalocyanines and their sensoric properties. In sborník příspěvků 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

22

28 

29 

30 

31 

32 

33 

34 

35 

36 

37 

38 

39 

40 

41 

VI. pracovního setkámí fyzikálních chemiků a elektrochemiků. Brno: 

Masarykova univerzita, 2006. s. 98‐99. ISBN: 80‐210‐3943‐ 4. 

WEITER, M.; VALA, M.; ZMEŠKAL, O. Charge carrier photogheneration in 

organic solar cells. In sborník příspěvků VI. pracovního setkání fyzikálních 

chemiků a elektrochemiků. Brno: Masarykova univerzita, 2006. s. 114‐115. 

ISBN: 80‐210‐3943‐ 4.. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Phototrigered Charge 

Traps Formation in Polymer Diodes. In VI. Pracovní setkání fyzikálních 

chemiků a elektrochemiků. Brno, Czech Republic. 2006. p. 110 ‐ 111 

ZMEŠKAL, O.; VALA, M.; HADERKA, J. Determination of the Image's FractalL 

Dimension using Wavelet Transformation. In Mendel 2005. 1. Brno, FSI VUT. 

2005. p. 207 ‐ 210. ISBN 80‐214‐2961‐5. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. The influence of 

photochromic switching on electro‐optical properties of poly(p‐ 

phenylenevinylene) derivative. In V. Pracovní setkání fyzikálních chemiků a 

elektrochemiků. Brno. 2005. p. 94 ‐ 96. ISBN 80‐210‐3637‐0. 

WEITER, M.; VALA, M.; ČERNÁ, K. Optoelectronic properties of conjugated 

polymers studied by impedance spectroscopy. In Proc. of 5th Workshop of 

Phys. Chem. and Electrochem. Brno, MU v Brně. 2005. p. 99 ‐ 100. ISBN 80‐ 

210‐3637‐0. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; TOMAN, P. Molecular Current Switch: 

Principles and Characterization of the Model System. Abstract booklet of 

conference Nano'05. VUT v Brně. 2005. p. 32 ‐ 32. ISBN 80‐214‐3044‐3. 

WEITER, M. Photogeneration and charge transport in conjugated polymers. 

CHEMagazín, 2005, roč. 15, č. 3, s. 32‐32. ISSN: 1210‐ 7409. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Organic semiconductors 

influenced by photochromic transformation of spiropyrane dye. ChemZi. SK. 

2005. 1(1). p. 244 ‐ 244. ISSN 1336‐7242. 

VALA, M.; WEITER, M.; NEŠPŮREK, S.; ZMEŠKAL, O. Kinetika fotochromních 

přeměn spiropyranu dopovaného v tenkých polymerních filmech. In CHLSAC 

98. Symposium. Ostrava, ČSCH. 2004. p. 736 ‐ 736. 

VALA, M.; WEITER, M.; NEŠPŮREK, S. Molecular current switch: principles and 

photoelectronic characterization of the model system. In IV.Pracovní setkání 

fyzikálních chemiků a elektrochemiků. Brno, Masarykova univerzita v Brně. 

2004. p. 43 ‐ 43. ISBN 80‐210‐3319‐3. 

WEITER, M.; VALA, M.; NEŠPŮREK, S.; SALYK, O.; ZMEŠKAL, O. New Functional 

Conjugated Polymers for Optoelectronic Applications. In IV. Pracovní setkání 

fyzikálních chemiků a elektrochemiků. Brno, Masarykova Univerzita v Brně. 

2004. p. 45 ‐ 45. ISBN 80‐210‐3319‐3. 

WEITER, M.; ŠORMOVÁ, H.; SALYK, O.; ZMEŠKAL, O. Využití e‐ learningových 

technologií při výuce fyziky na FCH VUT. In e‐ learning v česke a slovenské 

republice. Praha: ČVUT v Praze, 2004. s. 91 ( s.)ISBN: 80‐01‐02923‐ 9. 

WEITER, M. Transient photoconductivity and charge generation in Pi‐ 

conjugated polymers. Sborník 10. konference Optické vlastnosti pevných látek 

v základním výzkumu a aplikacích. 1. 2003. 

WEITER, M.; NEŠPŮREK, S.; SCHAUER, F. Metastable states in 

poly(methylphenylsilylene). In Proc. 3rd. Seminary on Physics and Chemistry 

of Molecular Systems. Chemical Faculty of the TU, Brno: VUT v Brně, 2000. s. 

43 ( s.)ISBN: 80‐214‐1118‐ X. 

0,5 

0,5 

0,5 

0,5 

0,5 

0,5 

1 

0,5 

0,5 

0,5 

0,5 

0,5 

1 

0,5 

23

42 

43 

44 

WEITER, M., KRČMA, F., ZMEŠKAL, O. The Electric Conductivity of Polymers – 

a General Approach. In Proceedings of Dielectric Analysis of Polymers and 

Composites, and Related Phenomena (Workshop of Physical Chemistry 

Fundamentals). Brno: FCH VUT v Brně, 1999. s. 9 ( s.)ISBN: 80‐214‐1372‐ 7. 

SALYK, O., HORVÁTH, P., WEITER, M., SCHAUER, F. Physical Propertie of 

Plasmatic and Evaporated Polysilylenes. Interantional Workshop on 

Diagnostic of Solid State Surfaces. 1998. Bratislava: Ústav fyziky SAV, 1998. s. 

24 ( s.) 

HANDLÍŘ, R., SCHAUER, F., WEITER, M. Metastabilní stavy 

polymetylfenylsilylsilylenu. In Proceding of 3rd. Seminary on Physics na d 

Chemistry Systems. 1998. Brno: FCH VUT, s. 43 ( s.)ISBN: 80‐214‐ 111. 

Celkem bodů za položku 

20. Členství ve vědecké radě (1 období) 

Poř. č Body 

1 člen vědecké rady Fakulty chemické VUT v Brně v období 2007 ‐ 2010 3 

2 člen vědecké rady Fakulty chemické VUT v Brně v období 2010 ‐ dosud 3 


22. Členství v programovém výboru národního nebo mezinárodního 

kongresu, sympózia, vědecké konference 

Poř. č Body 

1 

2 

člen výboru konference Electronic Properties of Molecular Materilas and 

Functional polymers, Brno, 2000 

člen programového výboru Electronic Properties of Molecular Materilas and 

Functional polymers, Brno, 2001 

3 člen programového výboru konference Chemistry and Life 2008, Brno 5 

4 člen programového výboru konference MoodleMoot 2011, Brno 5 


0,5 

0,5 

0,5 

23 

6 

5 

5 

20 

24

23. Získání zahraničního grantu (řešitel, spoluřešitel) 

Poř. č Body 

1 

2 

Project No 214459 DEPHOTEX ‐ Development of Photovoltaic Textiles 

Based on Novel Fibres, 2008‐2011, spoluřešitel mezinárodního projektu 7. 

rámcového programu v rámci výzvy FP7‐NMP‐2007‐SME‐1 

SIGA885 ‐ OPTIMOLEL – Optimisation of thin film deposition for the 

molecular electronic devices, 2010‐2011, projekt FP7 COFUND – MCurie / 

SOMOPRO 


24. Získání externího grantu (řešitel, spoluřešitel) 

Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

9 

10 

P205/10/2280, Grantová agentura ČR, 1.1 2010‐31.12 2013, Fotogenerace 

a transport náboje v molekulárních polovodičích pro organickou fotovoltaiku 

CZ.1.05/2.1.00/01.0012, MŠMT, OP VaVpI, Centra materiálového výzkumu 

na Fakultě chemické VUT v Brně, MŠMT ČR, :, 2008‐2013, vedoucí 

výzkumného programu 

KAN401770651, AV ČR, Program Nanotechnologie a společnost, 1.6.2006 – 

31.12.2010, Molekulární nanosystémy a materiály pro nanoelektroniku, 

hlavní řešitel 

CZ.1.07/2.2.00/15.0154, MŠMT, OP VK, 1.11.2010 – 30.8.2013, 

ChemLearning ‐ zvýšení úspěšnosti studentů kombinovaného studia, hlavní 

řešitel 

CZ.1.07/2.2.00/28.0330, MŠMT, OP VK, 1.9.2012 – 30.6.2015, IngLearning ‐ 

zvýšení úspěšnosti studentů magisterského kombinovaného studia, hlavní 

řešitel 

Centralizovaný rozvojový projekt MŠMT, 1.1. 2011 – 31.12.2011 Pracoviště 

pro zpracování historie chemického průmyslu a aplikované chemie s cílem 

prohloubení technického vzdělávání studentů vysokých škol technického a 

přírodovědného typu, včetně oborů pro přípravu učitelů, spoluřešitel 

Centralizovaný rozvojový projekt MŠMT, 1.1. 2010 – 31.12.2010 Pracoviště 

pro zpracování historie chemického průmyslu a aplikované chemie, včetně oborů pro 

přípravu učitelů, spoluřešitel 

1042/Aa/2009, FRVŠ, 1.1.2009 – 31.12.2009, Rozvoj a inovace laboratoří 

pro praktickou výuku studentů v základních povinných předmětech, hlavní 

řešitel 

203/06/0285, Grantová agentura ČR, 1.1 2006‐31.12 2009, Fotoaktivní 

molekulární elektronické prvky, spoluřešitel 

IAA401770601, GAAV, 1.1.2006 — 31.12.2009 Elektronové procesy na 

molekulární úrovni v látkách vhodných pro organické fotocitlivé součástky, 

hlavní řešitel 

10 

10 

20 

6 

6 

6 

6 

6 

6 

6 

6 

6 

6 

25

11 

12 

13 

14 

15 

2006/2999/F1d, FRVŠ ,Tvorba interaktivních učebních opor pro výuku 

matematiky, fyziky a fyzikální chemie, hlavní řešitel 

GA203/03/63D133, Grantová agentura ČR, 1.9 2003‐31.8 2006, Název: 

Světlem řízený molekulární proudový spínač, hlavní řešitel 

1662/F1 d/2004, FRVŠ, 1.1.2004 – 31.12.2004, Internetový multimediální 

učební text pro výuku fyziky, hlavní řešitel 

01301/A/2001, FRVŠ, 1.1.2001 – 31.12.2001,Vybudování pracoviště 

informačních technologií pro výuku fyziky, hlavní řešitel 

0132/F1/2001, FRVŠ, 1.1.2001 – 31.12.2001, Inovace fyzikálního praktika 

pro potřeby fakuty chemické, spoluřešitel 


26. Členství v grantových komisích, radách výzkumných programů 

Poř. č Body 

1 Člen hodnotícího panelu P205 Grantové agentury ČR 2 

2 

Vedoucí výzkumného programu Pokročilé organické materiály a biomateriály 

Centra materiálového výzkumu FCH VUT v Brně 

3 Člen grantové komise Interní grantové agentury VUT 2 


27. Posudek zahraniční publikace nebo projektu, znalecký posudek, 

expertíza 

Poř. č Body 

1 

2 

3 

Evropská komise, Brusel: od roku 2009 působím jako hodnotitel 

evropských projektů 7. rámcového programu pro oblast Nanotechnologií a 

ICT – fotonika (EC, Brusel), v rámco hodnocení jsem doposud vypracoval 

odborné posudky a expertízy pro 25 projektů 7. rámcového programu 

posudky zahraničních publikací pro mezinárodní časopisy Sensors (ISSN: 

1424‐8220), Chemical Papers (ISSN: 0336‐6352), Nanoformulation 2011, 

Chemical Physics (ISSN: 0301‐0104), celkem minimálně 20 posudků 

Agentúra na podporu výskumu a vývoja : externí posuzovatel projektů, 

celkem hodnoceny 3 projekty 


6 

6 

6 

6 

6 

90 

2 

6 

75 

60 

9 

144 

26

29. Posudek domácí publikace nebo projektu 

Poř. č Body 

1 

Člen hodnotícího panelu P205 Grantové agentury ČR, vrámci panelu jsem 

zpracoval posudky na 12 projektů, dalších 

2 Externí posuzovatel GA ČR, GAAV: celkem hodnoceno 9 projektů 18 

3 Hodnotitel TAČR: celkem zpracováno 10 posudků 20 

4 

Hodnotitel projektů OPVK v oblasti vědy, výzkumu a vzdělávání (prioritní 

osy 2.2, 2.3, 2.4), celkem zpracováno 24 posudků projektů 

5 Grantová agentura Univerzity Karlovy: celkem zpracovány 3 posudky 6 

6 Interní grantová agentura VUT v Brně: celkem zpracovány 4 posudky 8 

7 Posuzovatel projektů FRVŠ, celkem zpracováno 12 posudků 24 


B. Pedagogická činnost 

1. Pedagogický úvazek 

Poř. č Body 

1 

Na FCH VUT v Brně působím jako odborný asistent(později docent) na plný 

úvazek od 16.2.1998. 


3. Zavedení předmětu, který byl vyučován v posledních pěti letech 

Poř. č Body 

1 

2 

3 

Pokročilé materiálové technologie: přednášky, vyučován od roku 2007/08 

v navazujícím studijním programu Spotřební chemie. 

Advanced Applications of Molecular Materials : přednášky, předmět 

s výukou v angličtině, vyučován od roku 2009/10 v navazujícím studijním 

programu Spotřební chemie. 

Měřící technika: přenášky a cvičení, vyučován od roku 2006/07 ve všech 

bakalářských studijních programech FCH. 

4 Chemická informatika I: předmět byl zaveden a je vyučován od školního 15 

24 

48 

148 

28 

28 

15 

15 

15 

27

5 

roku 2005/06 ve všech bakalářských studijních programech FCH.. 

Chemická informatika II: předmět byl zaveden a je vyučován od školního 

roku 2005/06 ve všech bakalářských studijních programech FCH.. 


4. Vedoucí obhájené bakalářské/diplomové práce 

Poř. č Body 

1 vedoucí úspěšně obhájených 5 bakalářských prací 5 

2 vedoucí úspěšně obhájených 12 diplomových prací 24 


5. Školitel/školitel specialista studenta, který získal Ph.D. 

Poř. č Body 

1 

Školitel 1 studenta, který obhájil Ph.D. (v současné době další 3 studenti před 

obhajobou) 


8. Skripta 

Poř. č Body 

1 

2 

Salyk O., Weiter M., FYZIKA ‐ Laboratorní cvičení, skripta FCH VUT v Brně, 

2003 ISBN 80‐214‐2467‐2 – 7 autorských archů 

Weiter, M., Elektronika a měřící technika návody pro laboratorní cvičení. 1. 

vydání, FCH VUT, Brno, 2000 – 2 autorské archy 


15 

75 

29 

15 

15 

14 

4 

18 

28

9. Vytvoření významné výukové pomůcky (film, video, software) 

Poř. č Body 

1 

2 

3 

4 

5 

6 

7 

8 

Chemická informatika I: Vytvoření komplexních učebních opor pokrývající 

výuku celého tematického obsahu předmětu včetně elearningového kurzu pro 

podporu zejména kombinované ale i prezenční formy studia. Kromě 

studijních m,ateriálů opory zahrnují testy a autotesty, zpětnovazebné a 

komunikační prvky, a multimediální návody pro řešení vybraných úloh. 

Chemická informatika II: Vytvoření komplexních učebních opor pokrývající 

výuku celého tematického obsahu předmětu včetně elearningového kurzu pro 

podporu zejména kombinované ale i prezenční formy studia. Kromě 

studijních m,ateriálů opory zahrnují testy a autotesty, zpětnovazebné a 

komunikační prvky, a multimediální návody pro řešení vybraných úloh. 

Praktikum z fyziky: Vytvoření komplexních učebních opor pokrývající výuku 

celého tematického obsahu předmětu včetně elearningového kurzu pro 

podporu prezenční formy studia. Kromě standardních materiálů k úlohám 

materiály zahrnují i multimediální návody k jednotliovým úlohám a 

k metodice zpracování a vyhodnocení experimentálních dat. Podpora výuky 

zahrnuje rovněž implementaci systému LabView využívaného pro řízení 

experimentu, sběr a vyhodnocení dat. 

Pokročilé materiálové technologie: Vytvoření komplexních učebních opor 

pokrývající výuku celého tematického obsahu předmětu včetně 

elearningového kurzu pro podporu zejména kombinované ale i prezenční 

formy studia. 

Advanced Applications of Molecular Materials : Vytvoření komplexních 

učebních opor pokrývající výuku celého tematického obsahu předmětu včetně 

elearningového kurzu pro podporu zejména kombinované ale i prezenční 

formy studia. 

Měřící technika: Vytvoření komplexních učebních opor pokrývající výuku 

celého tematického obsahu předmětu včetně elearningového kurzu pro 

podporu zejména kombinované ale i prezenční formy studia. 

Podíl na implementaci vzdělávacího systému Moodle pro podporu výuky 

na celém VUT vBrně, metodická podpora jeho využívání (od roku 2005 do 

současnosti). 

Návrh a implementace LCMS (Learning content management system) 

systému MOODLE pro e‐learningovou podporu výuky na Fakultě chemické, 

metodická a jiná podpora jeho využívání (od roku 2005 do současnosti). 


10 

10 

10 

10 

10 

10 

10 

10 

80 

29

Poř. č 

1 

2 

Poř. č 

1 

Poř. č 

1 

11. Člen 

člen oboroové 

rady do oktorského sstudijního 

programu p Chemie, C techhnologie 

a 

vlastnosti mmateriálů 

FC CH VUT v Brrně, 

od 2010 0 doposud 

člen oboroové 

rady Pokročilé P mmateriály 

do oktorského studijního programu 

Pokročilé mmateriály 

a nanovědy n (MMU, 

CEITEC VUT), od 20 012 doposudd 

Celkem bbodů 

za položku 

122. 

Členstv 

V létech 20010‐2012 

čle en 4 komisí pro SDZ a obhajoby o diz zertační prááce 

Celkem bbodů 

za položku 

113. 

Členst 

V létech 20006 

‐ 2012 člen č 3 komissí 

pro SZZ 

Celkem bbodů 

za položku 

V Brně ddne 

1.září. 22012 

nství v obo orové raddě 

doktors ského stu udijního pprogramu 

u 

ví v komis si pro státtní 

doktor rskou zko oušku nebbo 

obhajo obu 

diseertační 

pr ráce 

tví v komisi 

pro stáátní 

závěr rečné zko oušky v jeddnom 

roc ce 

Body 

doc. Ing. Martin Weiter, 

PhD. 

2 

2 

4 

Body 

4 

4 

Body 

3 

3 

30

Souhrnné vyjádření uchazeče 

k bodovému hodnocení 

podle čl. 3 odst.1 písm. b) Směrnice rektoraVUT v Brně 1/2006 

(v úplném, znění z 1.9.2008) 

V předchozích tabulkách autoevaluačních kritérií jsou sumarizovány výsledky a výstupy 

mého 14‐letého působení na Fakultě chemické v roli akademického pracovníka. 

Sumárně lze konstatovat, že všechny kritéria byly spolehlivě naplněny, přičemž jejich 

stanovená minimální hodnota byla vždy několikanásobně překročena. Jak vyplývá 

z uvedeného bodového hodnocení, byly dominantními faktory, které nejvíce přispěly 

k dosaženému bodovému hodnocení následující výstupy: 

a) Publikace v impaktovaných časopisech (kategorie A2+A3, celkem 315 bodů tj 

22% z celkového počtu), 

b) Citace jiným autorem (kategorie A6, celkem 225 bodů tj .16% z celkového počtu), 

c) Výstupy pedagogické činnosti (kategorie B, celkem 220 bodů tj .18% z celkového 

počtu), 

d) Výstupy z grantové činnosti včetně posudků projektů a publikací (kategorie A23 ‐ 

29, celkem 402 bodů, tj .28% z celkového počtu). 

V následujících odstavcích jsou výsledky bodového hodnocení uchazeče v souladu se 

Směrnicí blíže komentovány. 

Vědecká a odborná činnost 

Výsledky zahrnuté v hodnocení odborné činnosti vychází především z mého odborného 

působení na Fakultě chemické VUT v Brně, základem části publikovaných výsledků byly 

také zkušenosti a výstupy získané během mého 9‐měsíčního pracovního 

postdoktorandského pobytu na Institutu Fyzikální, Makromolekulární a Nukleární 

Chemie, Philipps University Marburg v Německu v pracovní skupině prof. Bässlera. 

Publikované výsledky z poslední doby byly příznivě ovlivněny vybudováním Centra 

materiálového výzkumu FCH VUT v Brně (podpořené projektem OP VaVpI), v rámci 

kterého působím jako Vedoucí výzkumného programu Pokročilé organické materiály a 

biomateriály, do kterého je zapojeno více než 30 pracovníků. 

Většina výsledků publikovaných v impaktovaných časopisech byly vytvořena na základě 

rozsáhlé spolupráce s předními domácím i zahraničními výzkumnými pracovišti a 

firmami, mezi které patří například The Dyson Perrins Laboratory na Oxford University, 

IMEC v Belgii, Ústav makromolekulární chemie AV ČR, Fyzikální ústav AV ČR, Bergishe 

Universitat Wuppertal v Německu, Univerzita ve Vilniusu v Litvě, Institute of Physical 

31

and Theeoretical 

Chhemistry, 

Wroclaw W Unniversity 

of 

Technology, 

firma GGENERI 

BIO OTECH a 

dalších celkem vícce 

než 25 pracovišť, 

kkteré 

participovaly 

na publikovanných 

pracíc ch 

uvedenných 

v autoevaluačních 

kritériíchh. 

Za klíčoové 

doložiteelné 

výsled dky ve vědeecké 

a odbo orné oblast ti, které se nnásledně 

odrazily o 

na výši jednotlivých 

hodnotí ících kritériií, 

považuji i zejména: 

Vytvoření 

nové pracovní 

skuppiny 

•sezaměřřením 

výzk kumu na Pookročilé 

materiály m pro 

organicckou 

elektronniku 

a foto oniku včetnně 

jejího od dborného vedení, v perssonálního 

a 

experimmentálního 

zabezpečen z ní. 

Nové matteriály 

a no ové poznattky 

•voblastiistudia 

elementárníchh 

elektrono ových jevů a procesů sspojených 

předevšíím 

s fotoge enerací a traansportem 

m náboje v organických 

o h 

polovodičích. 

Aplikovanné 

výsledk ky výzkummu 

•dosažennézejména 

vrámciřeššení 

projek ktů 7. rámco ového proggramu 

a 

MPO. 

Zapojení do meziná árodního vvýzkumu, 

•participaace 

v evrop pských koopperativních 

h projektec ch a platforrmách 

(např. 

FP7 – Deephotex, 

Or rganisolar, Organic Ele ectronic As ssociation a další). 

Podíl na zzaložení 

a stabilizacci 

Centra materiálové 

m ého 

výzkumuu 

FCH VUT v Brně, 

• vrámcikterého 

pů ůsobím jakoo 

Vedoucí výzkumnéh v ho programmu 

Pokročil lé 

organickké 

materiály 

a biomatteriály, 

do kterého k je zapojeno 

vííce 

než 30 

pracovníků. 

Naprostá 

většina ppublikovan 

ných obornných 

prací vznikala v ve vynikající tvůrčí atmosféře 

mé praccovní 

skuppiny 

zaměře ené na Pokkročilé 

mat teriály pro o organickkou 

elektro oniku a 

fotonikku. 

Tuto zppočátku 

nef formální prracovní 

sku upinu jsem založil po ssvém 

návra atu ze 

zahraniičního 

pobyytu 

v roce 2003. 2 Skuppina 

se pers sonálně sta abilizovala a rozrůstal la 

předevšším 

na základě 

granto ových a dallších 

výzku umných pro ojektů a úkoolů, 

do kter rých 

bylo zappojováno 

sstále 

více sp polupracovvníků 

a stud dentů. (Celkem 

bylo v rámci sku upiny 

řešeno v létech 20003 

‐2012 cca 17 projjektů 

s celk kovým rozp počtem (přřipadajícím 

m na 

pracoviiště) 

převyyšujícím 

30 miliónů Kčč.. 

V souvislosti 

se vzn nikem Centtra 

materiálového 

výzkummu 

FCH VUTT 

v Brně (d dále jen CMMV) 

se potom m tato prac covní skupiina 

etablov val i po 

formálnní 

stránce a je pevnou u součástí vvýzkumnéh 

ho programu 

CMV Pokkročilé 

orga anické 

32

materiály a biomateriály, za jehož vedení jsem odpovědný. Odborné kompetence, 

erudice a profesionální přístup mých spolupracovníků (včetně studentů a doktorandů) 

jakožto spoluautorů publikací tak výrazně přispěly k naplnění odborných hodnotících 

kritérií1 . 

Vznik publikací podpořila i řada a výzkumných grantových projektů, jejichž výčet je 

uveden v rámci hodnotících kritérií. Jednalo se o projekty různých poskytovatelů. 

V první fázi se jednalo především o projekty základního výzkumu zaměřené na 

charakterizaci elementárních elektronových jevů a procesů v organických polovodičích 

s důrazem fotogenerací a transportem náboje v organických polovodičích. 

V posledních zhruba 6 letech na tento základní výzkum, kterému je stále v naší skupině 

věnována velká pozornost, navazuje výzkum aplikovaný, zaměřený do oblasti vývoje 

nových materiálů a jejich aplikace v organické elektronice a fotonice. Toto je spojeno i 

s vývojem nových technologií pro depozice organických materiálů. V současné době je 

připravována průmyslová právní ochrana dvou nových technologií pro 

elektroforetickou depozici a sprejové nanášení organických materiálů pro organickou 

elektroniku. 

Příkladem úspěšně řešeného komplexního projektu může být projekt 7. Rámcového 

programu DEPHOTEX ‐ Development of Photovoltaic Textiles based on novel Fibres , 

který byl zaměřen na vývoj fotovoltaických textilií za použití materiálů a technologií, 

které by byly snadno průmyslově realizovatelné. Výsledkem projektu potom byly vzorky 

fotovoltaických textilií, z nichž některé byly připraveny i na našem pracovišti. Na řešení 

se podílelo 15 partnerů, kteří byli převážně SME nebo technologické firmy a centra. Ze 

zajímavých partnerů stojí za zmínku výzkumné centrum FIAT nebo textilky GRADO 

ZERO ESPACE a TÊXTEIS PENEDO, které mají zájem aplikovat fotovoltaické textilie ve 

výrobcích pro domácí a hotelový sektor (záclony, závěsy, apod.) respektive ve výrobcích 

pro sport a zábavu (bundy, batohy, kabelky apod.). 

Pedagogická činnost 

Pedagogické hodnocení vychází především z mé 14‐leté pedagogické činnosti na Fakultě 

chemické VUT v Brně. Do výuky jsem byl zapojen jako asistent/odborný asistent 

v předmětech bakalářských studijních programů FCH VUT, od akademického roku 

2006/07 potom také jako docent a garant předmětů v navazujícím studijním programu 

Spotřební chemie. Do tohoto období spadá přechod na třístupňový vzdělávací systém a 

s ním spojená restrukturalizace a inovace studijních programů na FCH VUT v Brně, na 

které jsem se významně podílel. Od září 2012 působím rovněž jako proděkan pro 

1 

V souladu se Směrnicí je tento faktor v hodnocení reflektován tím, že publikace jsou 

hodnoceny pouze polovičním počtem bodů. 

33

pedagoogickou 

činnnost. 

Pro účely ú vyjádřření 

k bodo ovému hod dnocení jsemm 

výstupy své 

pedagoogické 

činnoosti 

rozděli il do dvou kkategorií 

so ouvisejících h se zabezppečením 

výuky v a 

rozvojeem 

výuky. 

Z hledisska 

mého zzapojení 

do o výuky a zabezpeče ení výuky jsou j výše uuvedené 

hodnoty 

autoevaaluačních 

kkritérií 

dané 

předevšímm 

těmito fa aktory: 

Zavedeníí 

nových př ředmětů vvčetně 

přípr ravy učebn ních 

opor pro ttyto 

předm měty, garantt 

předmětů ů s pravideln nou 

výukou v těchto před dmětech: 

• Měřící ttechnika: 

přenášky p a cvičení, vy yučován od d roku 20077 

ve všech 

bakalářsských 

studi ijních proggramech 

FC CH. 

• Pokročiilé 

materiá álové technnologie: 

př řednášky, vyučován v odd 

roku 200 08 

v navazuujícím 

studijním 

progrramu 

Spotř řební chem mie. 

• Advanceed 

Applica ations of MMolecular 

Materials M : přednáškyy, 

předmět 

s výukouu 

v angličtin ně, vyučováán 

od roku 2010 v nav vazujícím sstudijním 

programmu 

Spotřebn ní chemie. 

• Chemickká 

informa atika I a III: 

předměty y byl zavede eny a jsou vvyučovány 

od školnního 

roku 2005/06. 

• Praktikuum 

změří ící technikky: 

vyučová án 1999‐2000 

ve všechh 

bakalářsských 

studi ijních proggramech 

FC CH, s reorga anizací studia 

zrušen. 

Podstatnná 

inovace stávajícíchh 

předmět tů včetně 

inovace uučebních 

op por, garant ppředmětů 

s pravideln nou 

výukou v těchto předmětech:: 


informa atika I: v ppodstatně 

inovované i formě f vyuččován 

od 

roku 20110/11 

ve všech 

bakaláářských 

stu udijních pr rogramech FCH. 


informa atika II: v ppodstatně 

inovované formě vyuučován 

od 

roku 20110/11 

ve všech 

bakaláářských 

stu udijních pr rogramech FCH. 

• Praktikuum 

zfyzik ky: v inovovvané 

formě ě vyučován od roku 20006/07 

ve 

všech baakalářských 

h studijníchh 

programech 

FCH. 

Vedení sttudentskýc 

ch kvalifikkačních 

pra ací: 

• Bakalářřské 

práce: 

vedoucí 5 obhájenýc ch prací. 

• Diplomoové 

práce: vedoucí 122 

obhájený ých prací, 2 práce v řeššení. 

• Dizertačční 

práce: vedoucí 1 oobhájené 

práce, p 3 dok ktorandi přřed 

obhajobou, 

7 prací í v řešení. 

34

Rozvoj výuky 

Roli vysokoškolského pedagoga nespatřuji pouze v předávání a rozvíjení poznatků 

v daném oboru, ale jsem přesvědčen, že velkou pozornost je nutno věnovat rovněž 

samotnému pedagogickému procesu, který musí reagovat na zásadní změny v oblasti 

vysokoškolského vzdělávání v posledních létech. Kromě samotného přechodu 

k Boloňskému systému a s tím související modifikaci studijních programů nelze 

pominout ani rapidně vzrůstající počtem VŠ studentů, významné zvyšování podílu 

studentů v kombinované formě studia, dominantní roli informačních technologií 

v oblasti zpřístupňování vzdělávacího obsahu studentům, měnící se profil současné 

generace (tzv. generace Y) a další faktory, které musí současná VŠ pedagogika 

reflektovat. 

Osobně jsem se k tomuto snažil přispět tím, že jsem již od počátku své pedagogické 

kariéry snažil vysokoškolské pedagogice a didaktice porozumět (prostřednictvím 2‐ 

letého doplňujícího pedagogického studia a samovzděláváním v oblasti VŠ pedagogiky, 

didaktiky a andragogiky) a následně využívat v praxi. V roce 2002 jsem na naší fakultě 

implementovat a začal používat ve výuce elearningový LCMS systém (Learning contents 

management system), který nejen umožnil nahradit nepřehledné a málo efektivní 

ukládání a předávání studijních podkladů pro studenty na různých discích a disketách, 

ale zároveň je možno nástroje tohoto systému (nástroje pro testy a autoevaluační testy, 

příklady s průvodcem řešení, multimediální prvky a mnoho dalších) využít pro podporu 

výuky. Na základě našich zkušeností byl potom tento systém v roce 2005 

implementován v rámci celého VUT v Brně, na čemž jsem se rovněž podílel 

nezanedbatelnou měrou. VUT se tak stalo první univerzitou v ČR, která měla jednotný 

elearningový systém a dodnes patří ve světovém měřítku k provozovatelům tohoto 

systému s největším počtem uživatelů – více než 22 000 studentů VUT v Brně. 

Výše uvedená opatření technologického charakteru by byla samoúčelná a neefektivní 

bez souběžné metodické podpory. Za tímto účelem jsou pravidelně pořádány semináře a 

školení s cílem vyzvednout a ozřejmit pedagogické aspekty využívání elarningového 

systému. V této oblasti intenzivně spolupracuji s našimi předními odborníky 

z pedagogických dalších fakult (např. doc. Hrbáček, PedF MU; doc. Bauerová, VŠB TU 

Ostrava, dr. Vejvodová ZČU Plzeň a mnoho dalších). Od roku 2009 (respektive 2012) je 

tato činnost realizována v rámci dvou projektů OP VK mířených na zvýšení úspěšnosti 

studentů kombinovaného studia v bakalářských (respektive navazujících) studijních 

programech. U obou projektů v celkové hodnotě přes 20 miliónů korun jsem jejich 

ideovým tvůrcem a zároveň i hlavním řešitelem. 

35

Za klíčoové 

doložiteelné 

výsled dky v této ooblasti, 

kter ré se násled dně odrazilly 

na výši 

jednotliivých 

autoeevaluačních 

h kritérií (zzejména 

př říspěvky na a konferenccích 

a významné 

výukovvé 

pomůckyy), 

považuji i zejména: 

Implemenntace 

vzdě ělávacího pprostředí 

na n FCH VU UT 

(systém MMoodle) 

a jeho rozvooj, 

• včetněppedagogick 

ké podporyy 

jeho využí ívání (meto odické mateeriály, 

seminářře, 

školení a další). V současné 

do obě je systé ém využíváán 

ve výuce e 

více než 100 předm mětů a kurzzů. 

Participaace 

na impl lementaci vzdělávac cího prostř ředí 

na VUT v Brně ( sys stém Mooddle), 

•včetněppedagogické 

é podpory jjeho 

využív vání. V souč časné doběě 

je systém 

využívánn 

ve výuce více v než 4000 

předmět tů, kterých se účastní více než 

15 000 sstudentů. 

Zabezpeččení 

ICT, te echnologiccké 

a metodické 

(pedagoggické) 

podp pory výukky 

na FCH VUT V v Brně ě, 

•vybudovvání 

pracov viště pro tvoorbu 

multimediálních 

h vzdělávaccích 

opor, 

technoloogická 

a ICT T podpora vvýuky 

(pod dcasty, zázn namy přednnášek 

a 

cvičení, mmultimediá 

ální návodyy 

do praktik k, interakti ivní výuka a další). 

36

Přehled a kopie nejvýznamnějších publikací: 

Jako příloha této práce jsou uvedeno celkem 30 odborných recenzovaných publikací 

publikovaných v časopisech s impakt faktorem zahrnutých v rámci databází Web of 

Science, Scopus a dalších. 

Seznam přiložených publikací: 

1. LUŇÁK, S.; VALA, M.; VYŇUCHAL, J.; OUZZANE, I.; HORÁKOVÁ, P.; MOŽÍŠKOVÁ, P.; 

WEITER, M. Absorption and fluorescence of soluble polar diketo‐pyrrolo‐pyrroles. Dyes and 

Pigments, 2011, 91(1), p. 269 ‐ 278. 

2. DAVID, J.; WEITER, M.; VALA, M.; VYŇUCHAL, J.; KUČERÍK, J. Stability and structural 

aspects of diketopyrrolopyrrole pigment and its N‐alkyl derivatives. Dyes and Pigments, 

2011, 89(1), p. 137 ‐ 144. 

3. LUŇÁK, S.; HAVEL, L.; VYŇUCHAL, J.; HORÁKOVÁ, P.; KUČERÍK, J.; WEITER, M.; HRDINA, 

R. The geometry and absorption of diketo‐pyrrolo‐ pyrroles substituted with various aryls. 

Dyes and Pigments, 2010, roč. 85, č. 1‐ 2, s. 27‐36. 

4. VALA, M.; VYŇUCHAL, J.; WEITER, M.; TOMAN, P.; LUŇÁK, S. Novel, soluble diphenyl‐ 

diketo‐pyrrolopyrroles: Experimental and theoretical study. Dyes and Pigments, 2010, roč. 

84, č. 8, s. 176‐182. 

5. KUČERÍK, J.; DAVID, J.; WEITER, M.; VALA, M.; VYŇUCHAL, J.; OUZZANE, I.; SALYK, O. 

Stability and physical structure tests of piperidyl and morpholinyl derivatives of diphenyl‐ 

diketo‐pyrrolopyrroles (DPP). Journal of Thermal Analysis and Calorimetry, 2012, roč. 

108, č. 2, s. 467‐473. 

6. MLADENOVA, D., WEITER, M., STEPANEK, P., OUZZANE, I., VALA, M., SINIGERSKY, V., 

ZHIVKOV, I. Thin polyphenylene vinylene electrophoretically and spin‐coated films – 

photoelectrical properties. Surface and Coatings Technology, 2012, accepted. 

7. MLADENOVA, D., WEITER, M., STEPANEK, P., OUZZANE, I., VALA, M., SINIGERSKY, V., 

ZHIVKOV, I. Characterization of electrophoretic suspension for thin polymer film 

deposition. Journal ofPhysics:Conference Series, 2012, roč. 356, s. 012040. 

8. WEITER, M.; SALYK, O.; BEDNÁŘ, P.; VALA, M.; NAVRÁTIL, J.; ZMEŠKAL, O. Morphology 

and properties of thin films of diketopyrrolopyrrole derivatives. Materials Science and 

Engineering A, 2009, 165(3), p. 148 ‐ 152. 

9. TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; BARTKOWIAK, W.; MENŠÍK, M. Model 

of the influence of energetic disorder on inter‐chain charge carrier mobility in poly[2‐ 

methoxy‐5‐(2 ‐ethylhexyloxy)‐p‐phenylene vinylene]. Polymers for Advanced Technologies, 

2009, 20(3), p. 263 – 267. 

10. WEITER, M.; NAVRÁTIL, J.; VALA, M.; TOMAN, P. Photoinduced reversible switching of 

charge carrier mobility in conjugated polymers. European Physical Journal‐Applied 

Physics, 2009, 48(1), p. 10401 ‐ 10406. ISSN 1286‐0042. 

11. ZMEŠKAL, O.; VALA, M.; WEITER, M.; ŠTEFKOVÁ, P. Fractal‐cantorian geometry of space‐ 

time. Chaos, Solitons & Fractals, 2009, 42(3), p. 1878 ‐ 1892. 

37

12. ZMEŠKAL, O.; WEITER, M.; VALA, M. Notes to "An irreducibly simple derivation of the 

Hausdorff dimension of spacetime" by M.S. El Naschie. Chaos, Solitons & Fractals. 2009, 

42(10), p. 532 ‐ 533. 

13. VALA, M.; WEITER, M.; VYŇUCHAL, J.; TOMAN, P.; LUŇÁK, S. Comparative Studies of 

Diphenyl‐Diketo‐Pyrrolopyrrole Derivatives for Electroluminescence Applications. Journal 

of Fluorescence, 2008, 18(6), p. 1181 ‐ 1185. 

14. KRATOCHVÍLOVÁ, I.; KRÁL, K.; BUNČEK, M.; VÍŠKOVÁ, A.; NEŠPŮREK, S.; KOCHALSKA, A.; 

TODORCIUC, T.; WEITER, M.; SCHNEIDER, B. Conductivity of natural and modified DNA 

measured by Scanning Tunneling Microscopy. The effect of sequence, charge and stacking. 

Biophysical Chemistry, 2008, roč. 2008, č. 11, s. 3‐10. 

15. KRATOCHVÍLOVÁ, I.; KRÁL, K.; BUNČEK, M.; NEŠPŮREK, S.; TODORCIUC, T.; WEITER, M.; 

NAVRÁTIL, J.; SCHNEIDER, B.; PAVLUCH, J. Scanning Tunneling Spectroscopy Study of 

DNA Conductivity. Central European Journal of Physics, 2008, roč. 6, č. 3, s. 422‐426. 

16. VALA, M.; WEITER, M.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. Light Induced Change of 

Charge Carrier Mobility in Semiconducting Polymers. Macromolecular symposia, 2008, 

268(1), p. 125 ‐ 128. 

17. VALA, M.; WEITER, M.; RAJTROVÁ, G.; NEŠPŮREK, S.; SWORAKOWSKI, J. Photochromic 

properties of spiropyran in polymeric pi‐conjugated matrices. Nonlinear Optics, Quantum 

optics: Concepts in Modern Optics, 2007, 37(1‐3), p. 53 ‐ 63. 

18. WEITER, M.; VALA, M.; ZMEŠKAL, O.; NEŠPŮREK, S.; TOMAN, P. A Molecular Photosensor 

Based on Photoswitching of Charge Carrier Mobility. Macromolecular Symposia, 2007, 

2007(247), p. 318 ‐ 325. 

19. WEITER, M.; VALA, M.; ZMEŠKAL, O.; NAVRÁTIL, J., TOMAN, P. NEŠPŮREK, S.;. Polymer 

optical sensor based on photochromic switching of charge carrier mobility. Optical Sensing 

Technology and Applications, 2007, č. 6585, s. 658519. 

20. ZMEŠKAL, O.; NEŠPŮREK, S.; WEITER, M. Space‐charge‐limited currents: An E‐ infinity 

Cantorian approach. Chaos, Solitons & Fractals, 2007, roč. 34, č. 2, s. 143‐158. 

21. TOMAN, P.; NEŠPŮREK, S.; WEITER, M.; VALA, M.; SWORAKOWSKI, J.; BARTKOWIAK, W.; 

MENŠÍK, M. Influence of dipolar species on charge transport in poly[2‐methoxy‐5‐(2 '‐ 

ethylhexyloxy)‐p‐phenylene vinylene]. Polymers for Advanced Technologies, 2006, 17(9‐ 

10), p. 673 ‐ 678. 

22. WEITER, M.; BAESSLER, H. Transient photoconductivity and charge generation in thin 

films of pi‐ conjugated polymers. Journal of Luminescence, 2005, roč. 112, č. 1‐ 4, s. 363‐ 

367. 

23. WEITER, M.; VALA, M.; NEŠPŮREK, S.; SWORAKOVSKI, J.; SALYK, O.; ZMEŠKAL, O. 

Reversible formation of charge carrier traps in poly(phenylenevinylene) derivative due to 

the phototransformation of a photochromic additive. Molecular Crystals and Liquid 

Crystals, 2005, 430(1), p. 227 ‐ 233.. 

24. SALYK, O.; BROŽA, P.; DOKOUPIL, N.; HERRMANN, R.; KUŘITKA, I.; PRYČEK, J.; WEITER, 

M. Plasma polymerisation of methylphenylsilane. Surface and Coatings Technology, 2005, 

roč. 200, č. 1‐ 4, s. 486‐489. 

38

25. MARKHAM, J.; SAMUEL, I.; BURN, S.; WEITER, M.; BAESSLER, H. Charge transport in 

highly efficient iridium cored electrophosphorescent dendrimers. Journal of Aplied Physics, 

2004, roč. 95, č. 2, s. 438 ( s.) 

26. NEŠPŮREK, S., SWORAKOWSKI, J., COMBELLAS, C., WANG, G., WEITER, M. A molecular 

device based on light controlled charge carrier mobility. Applied Surface Science, 2004, 

roč. 234, č. 1–4, s. 395–402. 

27. WEITER, M.; ARKHIPOV, V.; BAESSLER, H. Transient photoconductivity in a thin film of a 

polyphenylenevinylene type conjugated polymer. Synthetic Metals, 2004, roč. 141, č. 1‐ 2, s. 

165 ( s.) 

28. WEITER, M. BAESSLER, H.; GULBINAS, V;, SCHERF, U. Transient photoconductivity in a 

film of ladder‐type poly‐phenylene: Failure of the Onsager approach. Chemical Physics 

Letters, 2003, roč. 379, č. 1, s. 117 ( s.). 

29. HORVÁTH, P., SCHAUER, F., WEITER, M., KUŘITKA, I., SALYK, O., DOKOUPIL, N., 

NEŠPŮREK, S., FIDLER, V. Luminescence in organic silicons prepared from organic 

precursors in plasma discharges. Chemical Monthly, roč. 132, č. 2001, s. 177‐ 185 ( s.) 

30. HANDLÍŘ, R., NEŠPŮREK, S., SCHAUER, F., WEITER, M., KUŘITKA, I. Metastability in 

poly(methylsilylene) induced by UV radiation and electron beam. Journal of Non‐ Crystaline 

Solids, roč. 1998, č. 227‐ 230, s. 669 ( s.). 

39

Příloha č. 1 – přiložené publikace 

41

Author's personal copy 

Absorption and fluorescence of soluble polar diketo-pyrrolo-pyrroles 

Stanislav Lunák Jr. a , Martin Vala b, *, Jan Vynuchal a,c,d , Imad Ouzzane b , Petra Horáková a , 

Petra Mozísková b , Zdenek Eliás a , Martin Weiter b 

a Faculty of Chemical Technology, University of Pardubice, Studentská 95, CZ-530 09 Pardubice, Czech Republic 

b Faculty of Chemistry, Centre for Materials Research, Brno University of Technology, Purkynova 464/118, CZ-612 00 Brno, Czech Republic 

c Research Institute of Organic Syntheses, Rybitví 296, CZ-533 54 Rybitví, Czech Republic 

d Synthesia a.s., Pardubice, Semtín 103, CZ-532 17 Pardubice, Czech Republic 

article info 

Article history: 

Received 26 October 2010 

Received in revised form 

29 April 2011 

Accepted 4 May 2011 

Available online 19 May 2011 

Keywords: 

Diketo-pyrrolo-pyrrole 

Fluorescence 

Solvatochromism 

Solid-state fluorescence 

Twisted intramolecular charge transfer 

Organic electronics 

1. Introduction 

abstract 

Although originally developed as high performance organic 

pigments [1,2,3], various structural modifications made diketopyrrolo-pyrroles 

(DPPs) interesting as advanced materials for 

modern optical and electronic technologies. The devices based on 

DPPs copolymerized with e.g. carbazoles [4] and especially with 

oligothiophenes [5,6] reached the promising efficiencies as organic 

field-effect transistors (OFET) [5] and bulk heterojunction (BHJ) 

photovoltaic solar cells (OPV) [4,6]. Aside from DPP copolymers, 

which form rather specific area with dramatically increasing 

number of references, DPP monomers have been recently found 

also to be perspective in photovoltaics, either in the BHJ OPV [7],or 

in dye-sensitized solar cells (DSSC) [8] type. The common structural 

features of DPP derivatives designed for these purposes are: 

The substituted (usually alkylated, in some cases acylated [9]) 

pyrrolinone nitrogens, changing the insoluble pigments to 

molecules enabling wet solution based processing, and the 

presence of electron-donating groups as a counterpart to diketopyrrolo-pyrrole 

core with an electron-accepting character. 

* Corresponding author. Tel.: þ420 541 149 411; fax: þ420 541 149 398. 

E-mail address: vala@fch.vutbr.cz (M. Vala). 

0143-7208/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.dyepig.2011.05.004 

Dyes and Pigments 91 (2011) 269e278 

Contents lists available at ScienceDirect 

Dyes and Pigments 

journal homepage: www.elsevier.com/locate/dyepig 

Six soluble derivatives of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione N-alkylated on 

pyrrolinone ring with polar substituents in para positions of pendant phenyl rings were synthesized; five 

of them are reported for the first time. Absorption and fluorescence spectra were studied in solvents of 

different polarity. The compounds show small solvatochromism of absorption and a moderate positive 

solvatochromism of fluorescence, especially when substituted by strong electron-donating piperidino 

substituent. A significant decrease of fluorescence quantum yields and its biexponential decay for dipolar 

derivatives in polar solvents was tentatively ascribed to the formation of twisted intramolecular charge 

transfer (TICT) excited state. All six compounds show fluorescence in polycrystalline solid-state with the 

maxima covering a range over 200 nm in visible and near infrared region. 

Ó 2011 Elsevier Ltd. All rights reserved. 

We have recently published the syntheses and spectral properties 

of parent DPP chromophore 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

(I) and its electron-donor (piperidino) 

and electron-acceptor (cyano) symmetrically and unsymmetrically 

substituted derivatives (IIeVI, Fig. 1) [10]. The derivatives have 

shown bathochromic and hyperchromic shift of absorption and 

bathofluoric shift of fluorescence with respect to parent compound 

I invoked above all by piperidino electron-donating substituent. 

Dimethyl sulfoxide (DMSO) was found to be the only common 

solvent able to dissolve all these pigments. In order to make these 

compounds better treatable we have decided to substitute them 

on pyrrolinone nitrogens and so eliminate the intermolecular 

hydrogen bonding [1]. On the contrary to more usual N-alkylation 

by alkylhalogen, used in our previous studies [11,12], we applied 

ethyl bromoacetate in this case (Fig. 1). Such substitution was reported 

only once resulting in compound VII with highly distorted 

structure in crystal according to X-ray diffraction [13] giving thus 

a good chance to be highly soluble because of the absence of pep 

stacking, another insolubility implicating phenomenon aside from 

COeNH hydrogen bonding [14]. Compounds VIIIeXII were never 

reported, thus they are fully characterized in Experimental. This is 

the first case, to the best of our knowledge, when simple push-pull 

substituted well soluble DPP derivative (XII) is studied.

270 

DPP derivatives are known for a long time to be strongly fluorescent 

in solution [15]. The only reported exceptions to the best 

of our knowledge are the compounds, in which the pyrrolinone 

carbonyl group underwent a nucleophilic substitution by heteroarylacetonitrile 

[16] or bis(trimethylsilyl)carbodiimide [17] forming 

the products loosing the true DPP character. The aim of this study 

was thus first to investigate in detail the dependence of absorption 

and fluorescence spectra and fluorescence efficiencies in solution 

on the character of pendant phenyl substitution in VIIIeXII 

with respect to on-phenyl unsubstituted VII and N-unsubstituted 

precursors IeVI. Contrary to hardly soluble pigments IeVI, itwas 

possible also to measure a solvatochromism on VIIeXII, which was 

never studied in detail before. 

As we observed the luminescence of some of these N,N 0 - 

dialkylated DPPs in solid-state just by naked eye during the 

samples handling (opposite to totally non-luminescent precursors 

IeVI), we studied also this not particularly common behaviour but 

being of growing interest [18,19,20]. Since the pioneering work 

of Langhals [21], the solid-state fluorescence of several DPP derivatives 

was mentioned in literature [9,22,23], but the full understanding 

of this phenomenon requires more systematic studies on 

the representative series of derivatives. 

2. Experimental 

2.1. Syntheses and analyses 

HN 

O 

R1 

The synthesis of the starting derivatives IeVI was described in 

Ref. [10]. Compound VII was synthesized from compound I in 

R2 

O 

NH 

Symbol R1 R2 

I H H 

II CN H 

III CN CN 

IV H N 

V N N 

VI CN N 


S. Lunák Jr. et al. / Dyes and Pigments 91 (2011) 269e278 

BrCH 2 COOCH 2 CH 3 

K 2 CO 3 ,NMP 

CH 3 CH 2 OOCCH 2 

O 

N 

R1 

R2 

N 

O 

Symbol R1 R2 

VII H H 

VIII CN H 

IX CN CN 

X H N 

XI N N 

XII CN N 

Fig. 1. General synthetic route and notation of the compounds under study. 

CH 2 COOCH 2 CH 3 

a similar way as described earlier and confirmed by melting point 

210e212 C (lit. [13]. 207e208 C). N-methyl-2-pyrrolidone (NMP), 

ethyl bromoacetate and potassium carbonate were purchased from 

Sigma-Aldrich, so as the three solvents used in the spectral studies. 

2.1.1. Preparation of diethyl-3-(phenyl)-6-(4-cyanophenyl)-2,5dihydropyrrolo[3,4-c]pyrrole-1,4-dione-diacetate 

(VIII) 

Compound II (8 g, 0.0256 mol), potassium carbonate (35.4 g, 

0.256 mol) and NMP (480 ml) were charged to a three-necked flask. 

Reaction mixture was heated to 120 C. Ethyl bromoacetate (42.8 g, 

0.256 mol) in NMP (185 ml) was added to the reactor dropwise 

during 40 min. Then the reaction was stirred and heated to 120 C 

for 2 h. After cooling, the reaction was slowly poured onto ice-cold 

water (1400 ml). The obtained precipitate was filtered off and 

washed with water until neutral washings. The crude product was 

recrystallized from a mixture of methanol and water (2:1). Yield: 

2.02 g (16.29%) of compound VIII. m.p. 139e141 C. 

Calculated: C (66.90), H (4.78), N (8.66), Found: C (66.84), H 

(4.73), N (8.46) 

MW ¼ 485 Da; Positive-ion APCI-MS: m/z 486 [M þ H] þ , (100%) 

1 H chemical shifts: 8.12 (2H, m, ArH); 7.99 (2H, m, ArH); 7.84 (2H, 

m, ArH); 7.66 (3H, m, ArH); 4.64 (2H, s, eNCH2,); 4.63 (2H, s, eNCH2,); 

4.115 (2H, q, J ¼ 7.1 Hz, eOCH2); 4.110 (2H, q, J ¼ 7.1 Hz, eOCH2); 1.142 

(3H, t, J ¼ 7.1 Hz, eCH2CH3); 1.140 (3H, t, J ¼ 7.1 Hz, eCH2CH3) 

13 C chemical shifts: 168.37 (1C, >C]O); 168.29 (1C, >C]O); 

161.30 (1C, >C]O); 161.03 (1C, >C]O); 149.52 (1C, ArC); 145.37 

(1C, ArC); 133.02 (2C, ArC); 132.09 (1C, ArC); 131.33 (1C, ArC); 

129.26 (2C, ArC); 129.21 (2C, ArC); 128.68 (2C, ArC); 126.88 (1C, 

ArC); 118.26 (1C, eC^N); 113.52 (1C, ArC); 109.90 (1C, ArC); 108.47

(1C, ArC); 61.41 (1C, NeCH2); 61.38 (1C, NeCH2); 43.38 (1C, eOCH2); 

43.26 (1C, eOCH2); 13.92 (2C, eCH2CH3) 

2.1.2. Preparation of diethyl-3,6-di-(4-cyanophenyl)-2,5dihydropyrrolo[3,4-c]pyrrole-1,4-dione-diacetate 

(IX) 

Compound III (5 g, 0.0148 mol), potassium carbonate (20.42 g, 

0.148 mol) and NMP (272 ml) were charged into a three-necked 

flask. Reaction mixture was heated to 120 C and ethyl bromoacetate 

(24.7 g, 0.148 mol) in NMP (116 ml) was added dropwise to the 

reactor during 40 min. Then the reaction was stirred and heated to 

120 C for 2 h. After cooling, the reaction was slowly poured onto 

ice-cold water (760 ml). The obtained precipitate was filtered off 

and washed with water until neutral washings. The crude product 

was recrystallized from methanol. Yield: 0.81 g (10.7%) of orange 

compound IX, m.p. 177e179 C. 


(6.04), N (7.63) 

1 H chemical shifts: 8.14 (4H, m, ArH); 8.01 (4H, m, ArH); 4.64 

(4H, s, eNCH2); 4.10 (4H, q, J ¼ 7.1 Hz, eOCH2); 1.13 (6H, t, J ¼ 7.1 Hz, 

eCH2CH3) 


146.92 (2C, ArC); 133.05 (4C, ArC); 131.06 (2C, ArC); 129.33 (4C, 

ArC); 118.36 (2C, eC^N); 113.82 (2C, ArC); 109.82 (2C, ArC); 61.45 

(2C, NeCH2); 43.40 (2C, eOCH2); 13.90 (2C, eCH2CH3) 

2.1.3. Preparation of diethyl-3-(phenyl)-6-(4-piperidinophenyl)- 

2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione-diacetate (X) 

Dry and pure NMP (150 ml), compound IV (3.7 g, 0.01 mol) and 

potassium carbonate (15.2 g, 0.11 mol) were charged to a threenecked 

flask. Reaction mixture was heated to 120 C. Ethyl bromoacetate 

(18.4 g, 0.11 mol) in NMP (80 ml) was added dropwise to 

the reactor during 40 min. Then the reaction mixture was stirred 

and heated to 120 C for 2 h. After cooling, the reaction was slowly 

poured onto ice-cold water (500 ml). The obtained precipitate 

was filtered off and washed with water until neutral washings. The 

crude product was recrystallized from methanol. Yield: 3.2 g (59%) 

of compound X, m.p. 207e214 C. 


(4.44), N (10.82) 

MW ¼ 510 Da; Positive-ion APCI-MS: m/z 511 [M þ H] þ (100%) 


(3H, m, ArH); 7.1 (2H, m, ArH); 4.66 (2H, s, eNCH2); 4.61 (2H, s, 

eNCH2); 4.17 (2H, q, J ¼ 7.1 Hz, eOCH2); 4.12 (2H, q, J ¼ 7.1 Hz, 

eOCH2); 3.48 (4H, m, eCH2CH2CH2N); 1.64 (6H, m, eCH2CH2CH2N 

and eCH2CH2CH2N); 1.19 (6H, t, J ¼ 7.1 Hz, eCH2CH3); 1.15 (6H, t, 

J ¼ 7.1 Hz, eCH2CH3) 


161.99 (1C, >C]O); 161.06 (1C, >C]O); 152.74 (1C, ArC); 149.20 (1C, 

ArC); 144.33 (1C, ArC); 131.05 (1C, ArC); 130.70 (2C, ArC); 129.03 (2C, 

ArC); 128.45 (2C, ArC); 127.59 (1C, ArC); 114.51 (1C, ArC); 113.47 (2C, 

ArC); 108.75 (1C, ArC); 105.91 (1C, ArC); 61.29 (1C, NeCH2); 61.21 

(1C, NeCH2); 47.69 (2C, eCH2CH2CH2N); 43.88 (1C, eOCH2); 43.34 

(1C, eOCH2); 25.00 (2C, eCH2CH2CH2N); 24.07 (1C, eCH2CH2CH2N); 

14.02 (1C, eCH2CH3); 13.97 (1C, eCH2CH3) 

2.1.4. Preparation of diethyl-3,6-di-(4-piperidinophenyl)-2,5dihydropyrrolo[3,4-c]pyrrole-1,4-dione-diacetate 

(XI) 

Compound V (5 g, 0.011 mol), potassium carbonate (15.2 g, 

0.11 mol) and NMP (205 ml) were charged into three-necked flask. 

Reaction mixture was heated to 120 C and ethyl bromoacetate 

(18.38 g, 0.11 mol) in NMP (80 ml) was added dropwise to the 

reactor during 40 min. Then the reaction was stirred and heated to 

120 C for 2 h. After cooling, the reaction was slowly poured onto 




S. Lunák Jr. et al. / Dyes and Pigments 91 (2011) 269e278 271 

was recrystallized from methanol. Yield: 3.57 g (54.3%) compound 

XI, m.p. 213e217 C. 


(6.85), N (8.78) 



(4H, s, eNCH2); 4.16 (4H, q, J ¼ 7.2 Hz, eOCH2); 3.41 (8H, m, 

eCH2CH2CH2N); 1.64 (12H, m, eCH2CH2CH2N and eCH2CH2CH2N); 

1.18 (6H, t, J ¼ 7.2 Hz, eCH2CH3) 

13 C chemical shifts: 130.27 (4C, ArC); 113.67 (4C, ArC); 61.19 (2C, 

NeCH2); 47.83 (4C, eCH2CH2CH2N); 43.80 (2C, eOCH2); 24.97 (4C, 

eCH2CH2CH2N); 14.04 (2C, eCH2CH3); Remaining signals were not 

detected due to low solubility of the sample. 

2.1.5. Preparation of diethyl-3-(4-cyanophenyl)-6-(4piperidinophenyl)-2,5-dihydropyrrolo[3,4-c]pyrrole- 

1,4-dione-diacetate (XII) 

Compound VI (3 g, 0.0076 mol), potassium carbonate (10.5 g, 

0.076 mol) and NMP (140 ml) were charged into three-necked flask 

(500 ml). Reaction mixture was heated to 120 C and ethyl bromoacetate 

(14 g, 0.082 mol) in NMP (60 ml) was added dropwise to 

the reactor during 40 min. Then the reaction was stirred and heated 

to 120 C for 2 h. After cooling, the reaction was slowly poured onto 



was recrystallized from the mixture of n-hexan and methanol (7:3). 

Yield: 2.26 g (70.4%) of compound XII, m.p. 192e195 C. 


(5.72), N (9.65) 



(2H, m, ArH); 7.10 (2H, m, ArH); 4.69 (2H, s, eNCH2); 4.65 (2H, s, 

eNCH2); 4.17 (2H, q, J ¼ 7.0 Hz, eOCH2); 4.11 (2H, q, J ¼ 7.1 Hz, 

eOCH2); 3.50 (4H, s, eCH2CH2CH2N); 1.65 (6H, s, eCH2CH2CH2N 

and eCH2CH2CH2N); 1.19 (3H, t, J ¼ 7.1 Hz, eCH2CH3); 1.15 (3H, t, 

J ¼ 7.0 Hz, eCH2CH3) 


162.07 (1C, >C]O); 160.80 (1C, >C]O); 152.95 (1C, ArC); 150.68 

(1C, ArC); 141.33 (1C, ArC); 132.92 (2C, ArC); 131.85 (1C, ArC); 

131.07 (2C, ArC); 129.04 (2C, ArC); 118.44 (1C, eC^N); 114.04 (1C, 

ArC); 113.36 (2C, ArC); 112.73 (1C, ArC); 110.35 (1C, ArC); 105.81 

(1C, ArC); 61.39 (1C, NeCH2); 61.32 (1C, NeCH2); 47.63 (2C, 

eCH2CH2CH2N); 44.05 (1C, eOCH2); 43.37 (1C, eOCH2); 25.05 (2C, 

eCH2CH2CH2N); 24.10 (1C, eCH2CH2CH2N); 14.04 (1C, eCH2CH3); 

13.97 (1C, eCH2CH3) 

2.2. Structure and purity characterization 

2.2.1. Mass spectrometry 

The ion trap mass spectrometer MSD TRAP XCT Plus system 

(Agilent Technologies, USA) equipped with APCI probe was used. 

Positive-ion and negative-ion APCI mass spectra were measured in 

the mass range of 50e1000 Da in all the experiments. The ion trap 

analyzer was tuned to obtain the optimum response in the range of 

the expected m/z values (the target mass was set from m/z 289 

to m/z 454). The other APCI ion source parameters: drying gas 

flow rate 7 dm 3 min 1 , nebulizer gas pressure 60 psi, drying gas 

temperature 350 C, nebulizer gas temperature 350 C. The samples 

were dissolved in a mixture of DMSO/acetonitrile and methanol in 

various ratios. All the samples were analyzed by means of direct 

infusion into LC/MS. 

2.2.2. Elemental analysis 

Perkin-Elmer PE 2400 SERIES II CHNS/O and EA 1108 FISONS 

instruments were used for elemental analyses.

272 

2.2.3. Nuclear magnetic resonance 

Bruker AVANCE 500 NMR spectrometer operating at 

500.13 MHz for 1 H was used for measurements of the 1 H NMR 

spectra. The compounds were dissolved in hexadeuteriodimethyl 

sulfoxide used as deutered standard. The 1 H chemical shifts were 

referred to the central signal of the solvent (d ¼ 2.55). 

2.3. Optical characterization 

2.3.1. UVeVIS absorption and fluorescence spectroscopy 

The referred UVeVIS absorption spectra in solution were 

recorded using Varian Carry 50 UVeVIS spectrometer. The fluorescence 

spectra in solution were measured in 90 configuration at 

Aminco Bowmann S2 fluorimeter. The solid-state luminescence 

spectra were recorded on Perkin-Elmer LS 55 equipped with an 

accessory for solid-state measurements from the same producer. 

Polycrystalline samples were placed under quartz plate and the 

emission spectra were recorded using front face geometry. 

2.3.2. Fluorescence quantum yields 

The fluorescence quantum yields (4F) in solution were calculated 

according to the comparative method [24], where for each 

test sample gradient of integrated fluorescence intensity versus 

absorbance F ¼ f(A) is used to calculate the 4F using two known 

standards. The standards were previously cross-calibrated to verify 

the method. This calibration revealed accuracy about 5%. As the 

reference we used Rhodamine B and Rhodamine 6G with 4Fl 0.49 

[25] and 0.950 0.005 [26], respectively. The excitation wavelength 

was chosen to be the same as for the laser excited experiments 

i.e. 532 nm. Since the VII has very low absorption coefficient 

at this exciting wavelength, we used Fluorescein (0.91 0.02) [20] 

and Coumarin 6 (0.78) [27] because of the better spectral overlap. 

The excitation wavelength in this case was 460 nm. 

2.3.3. Fluorescence lifetimes 

The fluorescence lifetime sF was measured using Andor Shamrock 

SR-303i spectrograph and Andor iStar ICCD camera. The 

samples were excited by third harmonic of EKSPLA PG400 

Nd:YAG laser (355 nm) with light pulse time duration of w30 ps. 

The temporal resolution of the system is approximately 25 ps. In 

order to avoid chromatic aberrations, the emitted light from the 

sample was collected by two off-axis mirrors. 

2.4. Computational procedures 

All theoretical calculations for compounds VIIeXII were carried 

out on exactly same level as for previously reported precursors IeVI 

[10], in order to be directly comparable. The ground state (S0) 

geometry was optimized using quantum chemical calculations 

based on DFT. Hybrid three-parameter B3LYP functional in combination 

with 6-311G(d,p) basis was used. No constraints were 

preliminary employed, but, as the nonconstrainted computations 

converged to symmetrical structures for compounds VII, IX and 

XI, the final computations were carried out with Ci symmetry 

constraint. No imaginary frequencies were found by vibrational 

analysis, confirming that the computed geometries were real 

minima on the ground state hypersurfaces. 

TD DFT computations of the vertical excitation energies were 

carried out on the computed S0 geometries. The same exchangecorrelation 

functional (B3LYP) was used in TD DFT calculations with 

rather broader basis set (6-311þG(2d,p)). Solvent effect of DMSO 

was involved by non-equilibrium PCM. 

All methods were taken from Gaussian09W program suite [28], 

and the default values of computational parameters were used. The 

results were analyzed using GaussViewW from Gaussian Inc, too. 



3. Results and discussion 

3.1. Syntheses 

Although looking quite simple (Fig. 1), N,N-dialkylation of DPPs 

is a two-step process complicated by extremely low solubility 

of starting pigments, which sometimes leads to the presence of 

mono-alkylated intermediate in reaction mixture, even if an excess 

of both alkylating agent and HBr neutralizing potassium carbonate 

is used [11]. In-depth study of this reaction was recently carried out 

[29]. The reports on the syntheses targeted directly on N-monoalkylated 

DPPs are relatively rare, but there was recently shown, 

that these compounds can be highly sensitive and selective 

fluorescent sensors for fluoride anions [30]. All six DPP derivatives 

VIIeXII in the presented study were prepared with moderate to 

high yields and the special purification procedures like chromatography 

or fractional crystallization were not necessary in order 

to obtain the product of the desired quality. We ascribe this fact to 

higher reactivity of bromine on ethyl bromoacetate as compared 

to e.g. n-butyl bromide. The compounds show good solubility over 

a wide range of solvents, so we have carried out the spectral 

measurements in highly polar DMSO, in order to have direct 

comparison with our previous results obtained for N-non-alkylated 

pigment precursors IeVI [10] or N-butylated analogues of VII and 

XI [11,12], in acetonitrile, as a representative of less polar solvents, 

and in almost non-polar but easily polarizable toluene. 

3.2. DFT computed structure 

As expected, DFT optimized geometries of VIIeXII predict 

non-zero dihedral angles, describing phenyl-pyrrolinone rotation 

(Table 1), on the contrary to strictly planar precursors IeVI [10]. The 

computed values of dihedral angles are the result of a compromise 

between sterical effect of methylene and ortho phenyl hydrogens 

(more or less the same for all six derivatives), invoking nonplanarity, 

and conjugation effect (dependent primarily on para phenyl 

substituent of each derivative), maximal for planar arrangement. 

The effect of the substituent on opposite pendant phenyl is marginal 

(less than 1 ). Average values are thus 26 ,36 and 38 for piperidino, 

cyano and unsubstituted phenyls, respectively. 

As these dihedral angles are crucial for the interpretation of 

absorption spectra, they should be verified by comparison with 

the experiment. The only known X-ray diffraction structure of 

compound VII [13] is a bit problematic from this point of view. 

The molecule is highly unsymmetrical in crystal with a ¼ 36.5 , i.e. 

quite close to the computed value 38.2 , and b ¼ 68.8 , i.e. totally 

out of a reasonable agreement. These results show a dramatic role 

of packing forces in DPP crystal. As discussed earlier [31], there are 

always some perturbation of planarity even for theoretically planar 

DPP pigments, bearing evidence of relatively flat minima of ground 

state geometry with respect to phenyl-pyrrolinone rotation. One 

can expect, that the equilibrium between sterical and conjugation 

Table 1 

DFT computed phenylepyrrolinone dihedral angles and PCM (DMSO) TD DFT 

computed excitation energies converted to wavelengths. 

Compound a [ ] b [ ] l00 [nm] fosc 

VII 38.2 38.2 465 0.512 

VIII 34.7 38.2 495 0.563 

IX 36.3 36.3 509 0.615 

X 38.0 26.1 518 0.835 

XI 26.6 26.6 546 1.138 

XII 35.2 25.5 561 0.923 

a [ ] ¼ R1-phenyl-pyrrolinone dihedral angle; b [ ] ¼ R2-phenyl-pyrrolinone dihedral 

angle; l00 [nm] ¼ theoretical excitation energy; fosc ¼ oscillator strength.

effects may be even more fragile for N-alkylated derivatives and 

thus the effect of packing forces may be more dramatic. That is 

probably the case of the X-ray structure of VII. Unfortunately, such 

distorted molecular structure can give only limited evidence on the 

accuracy of the computed structures. We have tested the relevance 

of DFT method to predict the dihedral angles of N,N-disubstituted 

compound I on another two known X-ray structures, in which 

Ci molecular symmetry in crystal is retained. The results were quite 

encouraging. The computed value for N,N-dimethyl I (30.3 ) 

matches well the experimental one (30.4 [32]), and an agreement 

for N,N-diallyl I (theor. 31.2 , exp. 35.8 [13]) is also acceptable. 

There are no X-ray data for N,N-di-n-butyl I available, but a lot of 

them exist, for its derivatives (see bellow), so we computed also the 

dihedral angle for this compound. Its value (26.4 ) is considerably 

lower, than for compound VII (38.2 ). 

We searched the Cambridge structural database (CSD) using 

ConQuest procedure [33] in order to find the structures similar to the 

derivatives VIIeXII. There were found four files with X-ray structures 

of DPP derivatives with both pyrrolinone nitrogen substituted 

by n-butyl and at least one pendant phenyl either unsubstituted, 

or substituted with amino or cyano groups in para position: KAKMAL 

(R1 ¼ CN, R2 ¼ H, a ¼ 45.2 , b ¼ 32.6 ) [34], XATKIN(R1 ¼ R2 ¼ CN, 

a ¼ b ¼ 43.1 ), NAWREJ (R1 ¼ H, R2 ¼ diphenylamino, a ¼ 32.8 , 

b ¼ 30.5 ) and XATKEJ (R1 ¼ H, R2 ¼ 4-MeO-phenyl, a ¼ 41.0 , 

b ¼ 42.3 ) [35]. Another relevant data come from recently published 

N,N-dibenzylated DPPs. Such group recall probably similar steric 

hindrance with respect to phenyl, as dihedral angles of chlorinated 

derivative (R1 ¼ R2 ¼ Cl, a ¼ 41.6 , b ¼ 43.9 ) [23] are very similar to 

N,N-dibutylated dibromo derivative found in CSD in XATJAE file 

(R1 ¼ R2 ¼ Br, a ¼ b ¼ 45.0 ) [35]. So the results for N,N-dibenzylated 

dimorfolino derivative (R1 ¼ R2 ¼ morfolino, a ¼ b ¼ 28.1 ) [23] are 

close to those obtained for diphenylamino substituent (file NAWREJ) 

in accordance with an interpretation based of a mixing of two 

resonance structures for dimorfolino (and generally diamino) DPP 

derivatives [23]. 

Finally, DFT predicted decrease of the phenyl-pyrrolinone 

dihedral angle accompanying p-piperidino substitution is in 

accordance with the relevant experimental data, at least qualitatively. 

On the other hand, small lowering of this dihedral angle 

connected with p-cyano substituent is inconsistent not only with 

the data coming from both above mentioned p-cyano substituted 

derivatives, but even with a general trend represented by other 

electron-accepting substituents, i.e. halogens. 

In order to test the sensitivity of dihedral angles of CN 

substituted derivatives on a quantum chemical method, we carried 

out the calculations on HartreeeFock (HF) level with the same 

6-311G(d,p) basis set. We obtained the dihedral angles considerably 

higher (a ¼ 52.4 , b ¼ 52.1 for VIII, a ¼ b ¼ 52.4 for IX and, 

a ¼ 52.5 , b ¼ 47.9 for XII) compared to those ones coming from 

DFT calculations (Table 1). But these computations also do not 

considerably distinguish 4eCNephenyl-pyrrolinone and phenylpyrrolinone 

dihedral angles. 

3.3. Absorption and fluorescence spectra in DMSO 

The absorption maxima of VIIeXII in DMSO show hypsochromic 

and hypochromic shifts (Table 2a, Fig. 2) with respect to corresponding 

precursors IeVI [10]. Hypsochromic shift is in fact a net 

effect of three contributions: 1) An increase of excitation energy 

due the less efficient conjugation because of the loss of molecular 

planartity, 2) the redistribution of the intensities of vibronic 

sub-bands from 0e0 maximum of IeVI in favour of 0e1inVIIeXII, 

as shown by a successive N-alkylation of I and V [11,12] and 3) the 

opposite effect e the decrease of excitation energy due to the 

increase of electron-donating strength of a pyrrolinone nitrogens in 



Table 2 

The spectroscopic properties of VIIeXII in a) DMSO, b) acetonitrile and c) toluene. 

Compound lA (nm) 3 (lA) 

(l mol 1 cm 1 ) 

lF(nm) 4F DlStokes 

(cm 1 ) 

sF (ns) 

a) DMSO 

VII 460 15,800 519 0.56 2470 7.34 0.08 

VIII 471 16,000 547 0.51 2950 7.07 0.03 

IX 480 13,300 557 0.72 2880 6.50 0.04 

X 516 32,200 601 0.12 2740 1.17 0.02 

6.7 1.2 

XI 540 45,100 603 0.45 1940 3.45 0.02 

XII 541 42,300 654

274 

Relative intensity 

1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

substituted IX and XI. Although soluteesolvent interaction may 

play some role, we relate this behaviour mainly to the dependence 

of the dihedral angle describing the phenyl-pyrrolinone rotation on 

a nature of para substituent of this pendant phenyl. The conclusion 

is thus clear: piperidino substitution dramatically decreases 

the phenyl-pyrrolinone dihedral angles in accordance with DFT 

predictions, while cyano substitution increases these angles 

considerably, contrary to theory. 

PCM TD DFT computed data relate to the experimental maxima 

only qualitatively. More precisely, the series can be divided into two 

groups of derivatives. The first one (VII, X and XI) show the deviation 

between computed l00 (Table 1) and experimental lA (Table 2a) 

2e6 nm, while the difference for cyano substituted derivatives 

is significantly bigger (20e22 nm for mono-cyano substituted 

VIII and XII and even 29 nm for di-cyano IX). As there were no such 

discrepancies between theory and experiment for planar derivatives 

IeVI [10], we ascribe this inconsistency also to underestimated 

dihedral angles in DFT calculated geometries. 

Finally, the suspicion revealed in part 3.2. filled up and the 

absorption spectra clearly show, that the dihedral angle between 

p-cyano-phenyl and pyrrolinone rings should be relatively higher 

than for unsubsubstituted phenyl-pyrrolinone case, contrary 

for the DFT prediction. PCM (DMSO) TD DFT 6-311 þ G(2d,p) 

calculations carried out on the above mentioned more distorted HF 

geometry resulted in a considerable blue shift (l00 ¼ 426.nm for 

VIII, 435 nm for IX and 477 nm for XII), compared the values obtained 

on DFT geometry (Table 1), i.e. the values of l00 are in this 

case much lower compared to the experimental lA (Table 2a) 

showing an evidence on nonrealistic distortion coming from HF 

geometries. 

The hypsochromic shift of VII with respect to N,N-dibutylated 

I (7 nm) [12] and opposite bathochromic shift of XI with respect 

to N,N-dibutylated V ( 4 nm) [12] do not support, that 

eCH2COOCH2CH3 grouping is sterically significantly more efficient 

than eCH2CH2CH2CH3 as it would relate to the computed difference 

of phenyl rotation in VII (38.2 ) and N,N-dibutylated I (26.4 ). 

The absorption spectra do not corfirm that unsymmetrical highly 

distorted X-ray structure of VII [13] is retained in solution. 

The relation between fluorescence maxima of corresponding 

members of N-alkylated and non-alkylated sets is different from 

absorption and much less clear on the first view (Table 2a, Fig. 3). 

The maxima of unsubstituted I with respect to VII are almost the 

same (þ2 nm on behalf of VII), while IX shows hypsofluoric 

shift with respect to III ( 8 nm). The fluorescence maximum of 

compound VIII shows also a hypsofluoric shift with respect to II 

( 3 nm, i.e. exactly between þ2 nm and 8 nm for symmetrical 



a b 

400 500 600 

Wavelength (nm) 

VII 

VIII 

IX 

X 

XI 

XII 


1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

pairs I/VII and III/IX). N,N-dialkylated electron-donor substituted 

derivatives X (þ14 nm) and XI (þ15 nm) show moderate 

bathofluoric shifts as compared to IV and V, respectively. Push-pull 

derivative XII shows almost identical maximum as VI (the difference 

is þ1 nm), i.e. its value lies between III/IX and V/XI pairs as in 

absorption. As a consequence the Stokes shift of compound XII is 

absolutely the highest one (3190 cm 1 ), i.e. significantly higher 

than for non-alkylated compound VI (2060 cm 1 ). An increment 

of a Stokes shift increase connected with N,N-disubstitution is 

relatively similar (1090e1270 cm 1 ) for all three pairs of piperidino 

substituted compounds and rather higher (1930e2070 cm 1 ) for 

unsubstituted or only cyano substituted pairs. 

The main reason for the general increase of the Stokes shift 

due to N-alkylation is caused by the fact, that it is considered as 

a difference between absorption and fluorescence maxima. The 

maxima correspond to 0e0 vibronic transition in fluorescence 

spectra for all twelve compounds, to 0e0 vibronic transition in 

absorption for IeVI [10] and to 0e1 transition for VIIeXII (Fig. 3). An 

increase of Stokes shift caused by a redistribution of vibronic bands 

intensities in absorption may not be strictly constant, but probably 

quite similar for all six pairs. The rest of the changes in Stokes shift 

goes on account of the differences in internal (geometrical) and 

external (solvent) relaxation, when going from vertical Franck- 

Condon (FC) state to relaxed excited state. Internal relaxation is 

probably mainly connected with the changes of above discussed 

dihedral angles. In order to have a better view on external contribution, 

it was necessary to carry out the spectral measurements in 

other solvents with different (lower) polarity. 

3.4. Solvatochromism 

500 600 700 


Fig. 3. Normalized absorption (a) and fluorescence (b) spectra of VIIeXII in DMSO. 

VII 

VIII 

IX 

X 

XI 

XII 

It was impossible to measure the absorption and fluorescence 

solvatochromism of IeVI because of their insolubility in other than 

highly polar solvents able to form H-complexes with solute. The 

spectral data for N-alkylated derivatives in toluene and acetonitrile 

are summarized in Table 2b, c and the spectra are shown on Figs. 4 

and 5. The shape of the absorption spectra is the same in all three 

solvents, i.e. the vibronic structure is completely unresolved even in 

toluene, while the vibronic structure of fluorescence spectra is 

best resolved for all compounds in toluene, in which clearly 0e0 

vibronic transition is the absolute maximum, and its resolution 

decreases in acetonitrile and is almost lost in DMSO. 

Compound VII shows small negative solvatochromism, when 

going from toluene to acetonitrile ( 8 nm) and almost the same 

positive shift from acetonitrile to DMSO (þ6 nm). The shifts of its 

fluorescence maxima are almost identical, thus Stokes shift is the

same in all three solvents. The solvent induced shifts of IX are 

nearly the same within 1 nm. The spectral shifts when going from 

toluene to acetonitrile markedly evoke the situation found for 

BODIPY dyes [36] and the interpretation is the same. While the 

absorption maximum of their hybrid VIII lies exactly between VII 

and IX in all solvents, the fluorescence maximum is generally closer 

to IX and a small growth of Stokes shift with solvent polarity from 

toluene (2800 cm 1 ) to acetonitrile (2960 cm 1 ) is observed. Thus 

VIII is only a bit more polar in relaxed than in FC excited state. 

The introduction of piperidino group brings two general trends 

with respect to excited state relaxation in compounds XeXII: The 

contribution of internal relaxation is decreased, which well relates 

with lower rotation of p-piperidino-phenyl in FC state, while the 

external contribution is increased, as the electron-donating 

substitution changes the intramolecular charge distribution. The 

former statement can be documented by lower Stokes shift of XI 

(1840 cm 1 ) with respect to VII (2410 cm 1 ) in non-polar toluene. 

The latter sentence is generally proved by a dependence of Stokes 

shift on a solvent polarity, i.e. its increase is less than 160 cm 1 for 

VIIeIX and notably higher for XI (330 cm 1 ), X (680 cm 1 ) and 

especially XII (1020 cm 1 ) when going from toluene to acetonitrile. 

Thus, the largest observed Stokes shift of XII (3190 cm 1 in DMSO) 

is in fact mainly done by donor-acceptor substitution (2060 cm 1 in 

DMSO for VI [10]) and the additional effect of N-alkylation goes 

mainly on account of a redistribution of vibronic intensities in 

absorption spectrum of XII. 


a b 



1.0 

0.8 

0.6 

0.4 

0.2 

VII 

VIII 

IX 

X 

XI 

XII 

0.0 

300 400 500 600 

1.0 

0.8 

0.6 

0.4 

0.2 



1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

500 600 700 


Fig. 4. Normalized absorption (a) and fluorescence (b) spectra in acetonitrile. 

VII 

VIII 

IX 

X 

XI 

XII 

0.0 

300 400 500 600 


a b 


VII 

VIII 

IX 

X 

XI 

XII 

The solvent induced shifts in absorption of XeXII are less than 

4 nm when going from toluene to acetonitrile, reflecting very 

similar polarity of the ground and excited FC states. Positive 

solvatochromism of fluorescence is moderate: 15 nm for symmetrical 

XI, and 24 and 35 nm for asymmetrical IX and XII, respectively, 

that can be ascribed to relaxed excited state solvent stabilization. 

The positive solvatochromism in absorption of XeXII when going 

from acetonitrile to DMSO is almost constant (16e17 nm), very 

similar to the corresponding shift in fluorescence (13e16 nm) and 

a bit higher than for VIIeIX (6e7 nm in absorption and 7e9 nmin 

fluorescence). It means, that further increase of solvent polarity 

does not lead to additional excited state relaxation and the 

energy of the excited FC and relaxed states is lower only because 

the excited state charge distribution interacts more favourably than 

the ground state itself with the reaction field of more polar solvent 

(induced by ground state distribution) [37]. 

The highest solvent induced rise of Stokes shift, i.e. for compound 

XII between toluene and acetonitrile (þ1020 cm 1 ), is significantly 

lower than for 4-(dimethylamino)-4 0 -cyano-1,4-diphenylbutadiene 

(DCB, þ4640 cm 1 between n-hexane and acetonitrile [38]), in 

which only central 1,4-diphenyl-butadiene backbone of XII is pushpull 

substituted. This difference goes exclusively on account of much 

lower value of positive fluorescence solvatochromism of compound 

XII (þ35 nm) with respect to DCB (þ129 nm), while the solvatochromism 

of absorption is almost the same ( 3nmforXII 

and þ2 nm for DCB), i.e. negligible between above mentioned 


1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

500 600 700 


Fig. 5. Normalized absorption (a) and fluorescence (b) spectra in toluene. 

VII 

VIII 

IX 

X 

XI 

XII

276 


1.0 

0.8 

0.6 

0.4 

0.2 

0.0 

VII 

VIII 

IX 

X 

XI 

XII 

500 600 700 800 900 


Fig. 6. Solid-state fluorescence spectra of DPP derivatives. 

non-polar and polar solvents. Thus, although compounds X and XII 

behave qualitatively like push-pull like chromophores, quantitatively 

their fluorescence solvatochromism is quite limited. 

Compound XI is formally a quadrupolar molecule with D-p-A-p- 

D character. Such compounds may or may not undergo an excited 

state symmetry-breaking in highly polar solvents [39]. The shifts of 

absorption (3 nm) and fluorescence (15 nm) maxima of XI, when 

going from toluene to acetonitrile, is relatively small (although not as 

small as for e.g. squaraines [39]), indicating very small (if any) excited 

state perturbation. Compound XI is thus an intermediate quadrupolar 

chromophor with expected high two-photon absorption 

cross-section. Their relatively high values estimated for N-octylated 

p-diphenylamino substituted DPPs confirm this idea [40]. 



3.5. Photophysical behaviour 

Fluorescence quantum yields (4F) and lifetimes (sF) for VIIeXII 

in all three solvents are summarized in Table 2. Corresponding 

photophysical data for non-alkylated precursors I (4F ¼ 0.74, 

sF ¼ 6.21 ns) and V (4F ¼ 0.58, sF ¼ 3.66 ns) in DMSO were reported 

previously [12] and we now supply them by 4F and sF for further 

two piperidino substituted precursors IV (4F ¼ 0.48, sF ¼ 3.49 ns) 

and VI (4F ¼ 0.14, sF ¼ 3.90 ns) also in DMSO and not published in 

Ref. [10]. Both these compounds show monoexponential fluorescence 

decay. 

All six compounds VIIeXII also show a relatively high 4F in 

toluene and the fluorescence decay is strictly monoexponential 

with lifetimes similar to corresponding non-alkylated precursors 

in DMSO. However, there is a dramatic change for compounds 

X and XII when going to polar solvents. The quantum yields 

of fluorescence are significantly decreased, especially for XII 

(Table 2b, c), and the decay is biexponential. It implies, that some 

specific process connected with the excited state intramolecular 

charge transfer (ICT) must be present. Such behaviour may be 

connected with a conformational change in excited state known 

as twisted intramolecular charge transfer (TICT). 4-piperidinobenzonitrile 

is known to undergo such process even more willingly 

than 4-dimethylamino-benzonitrile, a prototype molecule 

with respect to TICT [41]. Nevertheless, it is generally very difficult 

to prove this idea, if not supported by two emission bands in 

steady-state fluorescence. According to our opinion, the observable 

fluorescence of XII in polar solvents comes from the minor 

portion of excited molecules, for which the charge separating 

twist did not pass. Nevertheless this explanation is only speculative 

and the final solution of this problem would require further 

sophisticated photophysical experiments that are out of the scope 

of this article. 

Fig. 7. Polycrystalline samples of IeXII under daylight (top) and fluorescence of the samples of VIIeXII under UV irradiation (365 nm) with the same settings of Panasonic DMC-FZ7 

camera (bottom).

3.6. Solid-state fluorescence 

All six studied DPP derivatives show pronounced solid-state 

fluorescence, on the contrary to any of their non-alkylated 

precursors IeVI. The spectra are shown on Fig. 6. The fluorescence 

of symmetrical VII, IX and XI is strong, easily observable by 

naked eye under UV irradiation (Fig. 7). The fluorescence of 

unsymmetrical VIII and X is less intense, but observable. Solid-state 

fluorescence of push-pull derivative XII is almost not observable 

(and totally undetectable by a camera e Fig. 7) partly because of its 

significantly lower intensity and also as it falls almost fully into the 

infrared region. The values of emission maxima in polycrystalline 

phase are 568 nm (VII), 639 nm (VIII), 648 nm (IX), 708 nm (X), 

670 nm (XI) and 784 nm (XII), and hence, their sequence corresponds 

to that one in polar solvent (Table 2a) except the changeover 

of X and XI pair. The corresponding changeover of dipolar VIII 

and formally quadrupolar IX did nor occur, but the fluorescence 

maximum of hybrid VIII in solid state is significantly closer to 

parent IX than to VII. The spectral maxima are shifted bathochromically 

with respect to even the most polar solvent (DMSO). 

The smallest shift was found for compound VII (49 nm) without 

any polar substituent, the moderate one for centrosymmetric 

compounds XI (67 nm) and IX (91 nm), and the highest one for 

polar VIII (92 nm) and X (107 nm) and, especially, for push-pull 

substituted XII (130 nm). 

Although the intermolecular interactions in highly organized 

crystal phase cannot be in principle described by simple soluteesolvent 

terminology, the red shifts probably predicate about the 

polarity inside the crystal environment, i.e. 1) it is effectively more 

polar than DMSO in all cases and 2) the highest effect is of course 

in crystals composed from the molecules with non-zero dipole 

moment. The changeover of solid-state fluorescence maxima of X 

and XI is thus a logical continuation of the trend observed in solvents 

with increasing polarity (Table 2aec). Although the crystal of XII has 

evidently more polar environment than in DMSO solution, the 

fluorescence of XII does not definitely diminishes in it. We consider 

this phenomenon as further support of TICT role in the deactivation 

cascade of XII in DMSO, while the excited state twisting is disabled 

in rigid crystal environment. Almost identical behaviour and interpretation 

was reported for push-pull substituted 1,6-diphenyl-1,3,5hexatriene 

[42]. 

Generally, the solid-state fluorescence of organic pigments is 

considered as a property of individual molecule conserved in crystal 

phase [43]. In other words, the quenching process connected 

with electron-phonon coupling in crystals of IeVI, eliminated by 

N,N-dialkylation in their derivatives VIIeXII, relate very probably to 

impossibility of pep stacking in crystal [21]. Such disabled stacking 

may come either from intramolecular sterical hindrance, i.e. 

molecular nonplanarity, or the intermolecular one, e.g. disabled 

proximity of molecular planes due to large volume side chains. We 

consider the former contribution as crucial in this case. 

4. Conclusions 

Six N-alkylated soluble DPP derivatives with polar substituents 

in para positions of pendant phenyls were synthesized, in order to 

make original non-alkylated pigment precursors better treatable. 

The compounds are non-planar with phenyl rings rotated 

out of diketo-pyrrolo-pyrrole plane. The degree of this rotation is 

decreased by the electron-donating substituents, while increased 

by the electron-withdrawing substituents, contrary to the DFT 

predictions. The compounds show small solvatochromism of 

absorption and a moderate positive solvatochromism of fluorescence, 

if substituted by strong electron-donating substituent. 

The significant decrease of fluorescence quantum yields and its 



biexponential decay for dipolar derivatives in polar solvents was 

tentatively ascribed to the formation of non-fluorescent TICT 

excited state. All compounds show fluorescence in polycrystalline 

solid-state with the maxima covering a range over 200 nm in visible 

and near infrared region, where the solid-state fluorescence is quite 

rare [18]. 

Acknowledgement 

The research was supported by the Academy of Sciences of the 

Czech Republic via project KAN401770651, by the Ministry of 

Industry and Trade of the Czech Republic via 2A-1TP1/041 project, 

by the Czech Science Foundation via P205/10/2280 project and by 

the project “Centre for Materials Research at FCH BUT” No. CZ.1.05/ 

2.1.00/01.0012 from ERDF. 

References 

[1] Iqbal A, Jost M, Kirchmayer R, Pfenninger J, Rochat AC, Wallquist O. Synthesis 

and properties of 1,4-diketopyrrolo[3,4-c]pyrroles. Bulletin des Societes 

Chimiques Belges 1988;97(8e9):615e43. 

[2] Wallquist O. Diketopyrrolopyrrole (DPP) pigments. In: Smith HM, editor. High 

performance pigments. Weinheim: Wiley-VCH; 2002. p. 159e84. 

[3] Herbst M, Hunger K. Industrial organic pigments. Weinheim: Wiley-VCH; 

2004. pp. 487e494. 

[4] Aïch RB, Zou Y, Leclerc M, Tao Y. Solvent effect and device optimization of 

diketopyrrolopyrrole and carbazole copolymer based solar cells. Org Electron 

2010;11(6):1053e8. 

[5] Bürgi L, Turbiez M, Pfeiffer R, Bienewald F, Kirner HJ, Winnewisser C. Highmobility 

ambipolar near-infrared light-emitting polymer field-effect 

transistors. Adv Mater 2008;20(11):2217e24. 

[6] Bijleveld JC, Zoombelt AP, Mathijssen SGJ, Wienk MM, Turbiez M, De 

Leeuw DM, et al. Poly(diketopyrrolopyrroleterthiophene) for ambipolar logic 

and photovoltaics. J Am Chem Soc 2009;131(46):16616e7. 

[7] Walker B, Tamayo AB, Dang XD, Zalar P, Seo JH, Garcia A, et al. Nanoscale 

phase separation and high photovoltaic efficiency in solution-processed, 

small-molecule bulk heterojunction solar cells. Adv Funct Mater 2009; 

19(19):3063e9. 

[8] Qu S, Wu W, Hua J, Kong C, Long Y, Tian H. New diketopyrrolopyrrole (DPP) 

dyes for efficient dye-sensitized solar cells. J Phys Chem C 2010;114(2): 

1343e9. 

[9] Tamayo AB, Walker B, Nguyen TQ. A low band gap, solution processable oligothiophene 

with a diketopyrrolopyrrole core for use in organic solar cells. 

J Phys Chem C 2008;112(30):11545e51. 

[10] Lunák Jr S, Vynuchal J, Vala M, Havel L, Hrdina R. The synthesis, absorption 

and fluorescence of polar diketo-pyrrolo-pyroles. Dyes Pigm 2009;82(2): 

102e8. 

[11] Vala M, Weiter M, Vynuchal J, Toman P, Lunák Jr S. Comparative studies 

of diphenyl-diketo-pyrrolopyrrole derivatives for electroluminescence 

applications. J Fluoresc 2008;18(6):1181e6. 

[12] Vala M, Vynuchal J, Toman P, Weiter M, Lunák Jr S. Novel, soluble diphenyldiketo-pyrrolopyrroles: 

experimental and theoretical study. Dyes Pigm 

2010;84(2):176e82. 

[13] Colonna G, Pilati T, Rusconi F, Zecchi G. Synthesis and properties of some new 

N, N 0 -disubstituted 2,5-dihydro-1,4-dioxo-3,6-diphenylpyrrolo[3,4-c]pyrroles. 

Dyes Pigm 2007;75(1):125e9. 

[14] Thetford D, Cherryman J, Chorlton AP, Docherty R. Theoretical molecular 

modelling calculations on the solid state structure of some organic pigments. 

Dyes Pigm 2004;63(3):259e76. 

[15] Potrawa T, Langhals H. Fluorescent dyes with large stokes shifts-soluble 

dihydropyrrolopyrrolediones. Chem Ber 1987;120(7):1075e8. 

[16] Fischer GM, Ehlers AP, Zumbusch A, Daltrozzo E. Near-infrared dyes and 

fluorophores based on diketopyrrolopyrroles. Angew Chem Int Ed 2007; 

46(4):3750e3. 

[17] Imoda T, Mizuguchi J. Strikingly different luminescent properties arising from 

single crystals grown from solution or from the vapor phase in a diketopyrrolo-pyrrole 

analog. J Appl Phys 2007;102(7):073529(1)e073529(7). 

[18] Park SY, Kubota Y, Funabiki K, Shiro M, Matsui M. Near-infrared solid-state 

fluorescent naphtooxazine dyes attached with bulky dibutylamino and perfluoroalkenyloxy 

groups at 6- and 9-positions. Tetrahedron Lett 2009;50(10): 

1131e5. 

[19] Matsui M, Ikeda R, Kubota Y, Funabiki K. Red solid-state fluorescent aminoperfluorophenazines. 

Tetrahedron Lett 2009;50(35):5047e9. 

[20] Park SY, Ebihara M, Kubota Y, Funabiki K, Matsui M. The relationship between 

solid-state fluorescence intensity and molecular packing of coumarin dyes. 

Dyes Pigm 2009;82(3):258e67. 

[21] Langhals H, Potrawa T, Nöth H, Linti G. The influence of packing effects on the 

solid-state fluorescence of diketopyrrolopyrroles. Angew Chem Int Ed 1989; 

28(4):478e80.

278 

[22] Tamayo AB, Tantiwiwat M, Walker B, Nguyen TQ. Design, syntheses, and selfassembly 

of oligothiophene derivatives with a diketopyrrolopyrrole core. 

J Phys Chem C 2008;112(39):15543e52. 

[23] Kuwabara J, Yamagata T, Kanbara T. Solid-state structure and optical properties 

of highly fluorescent diketopyrrolopyrrole derivatives synthesized by 

cross-coupling reaction. Tetrahedron 2010;66(21):3736e41. 

[24] Williams ATR, Winfield SA, Miller JN. Relative fluorescence quantum yields 

using a computer-controlled luminescence spectrometer. Analyst (Cambridge, 

United Kingdom) 1983;108(1290):1067e71. 

[25] Casey KG, Quitevis EL. Effect of solvent polarity on nonradiative processes in 

xanthene dyes: rhodamine B in normal alcohols. J Phys Chem 1988;92(23): 

6590e4. 

[26] Magde D, Wong R, Seybold PG. Fluorescence quantum yields and their relation 

to lifetimes of rhodamine 6G and fluorescein in nine solvents: improved 

absolute standards for quantum yields. Photochem Photobiol 2002;75(4): 

327e34. 

[27] Reynolds GA, Drexhage KH. New coumarin dyes with rigidized structure for 

flashlamp-pumped dye lasers. Opt Commun 1975;13:222e5. 

[28] Gaussian 09, Revision A.1, Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, 

Robb MA, Cheeseman JR, et al., 2009. 

[29] Stas S, Sergeyev S, Geerts Y. Synthesis of diketopyrrolopyrrole (DPP) derivatives 

compridsing bithiophene moieties. Tetrahedron 2010;66(10):1837e45. 

[30] Qu Y, Hua J, Tian H. Colorimetric and ratiometric red fluorescent chemosensor 

for fluoride ion based on diketopyrrolopyrrole. Org Lett 2010;12(15):3320e3. 

[31] Lunák Jr S, Vynuchal J, Hrdina R. Geometry and absorption of diketo-pyrrolopyrrole 

isomers and their p-isoelectronic furo-furanone analogues. J Mol 

Struct 2009;919(1e3):239e45. 

[32] Mizuguchi J, Grubenmann A, Wooden G, Rihs G. Structures of 3,6diphenylpyrrolo[3,4-c]pyrrole-1,4-dione 

and 2,5-dimethyl-3,6-diphenylpyrrolo 

[3,4-c]pyrrole-1,4-dione. Acta Crystallogr B 1992;48(5):696e700 (The value in 

the text was taken from file KUHKUT in CSD). 



[33] Bruno IJ, Cole JC, Edgington PR, Kessler M, Macrae CF, McCabe P, et al. New 

software for searching the Cambridge Structural Database and visualizing 

crystal structures. Acta Crystallogr B 2002;58(3e1):389e97. 

[34] File KAKMAL cited in CSD as: Poppe M, Gompper R, Polborn K. 2005, Private 

Communication. 

[35] Files XATKIN, NAWREJ, XATKEJ and XATJAE cited in CSD as: Ostermann D, 

Gompper R, Polborn K. 2005, Private Communication. 

[36] Qin W, Rohand T, Baruah M, Stefan A, Van der Auweraer M, Dehaen W, et al. 

Solvent-dependent photophysical properties of borondipyrromethene dyes in 

solution. Chem Phys Lett 2006;420(4e6):562e8. 

[37] Zoon PD, Brouwer AM. A push-pull aromatic chromophore with a touch of 

merocyanine. Photochem Photobiol Sci 2009;8(3):345e53. 

[38] El-Gezawy H, Rettig W, Lapouyade R. Solvatochromic behaviour of donoracceptor-polyenes: 

dimethylamino-cyano-diphenylbutadiene. J Phys Chem 

A 2006;110(1):67e75. 

[39] Terenziani F, Painelli A, Katan C, Charlot M, Blanchard-Desce M. Charge 

instability in quadrupolar chromophores: symmetry breaking and solvatochromism. 

J Am Chem Soc 2006;128(49):15742e55. 

[40] Guo EQ, Ren PH, Zhang YL, Zhang HC, Yang WJ. Diphenylamine end-capped 

1,4-diketo-3,6-diphenylpyrrolo[3,4-c]pyrrole (DPP) derivatives with large 

two-photon absorption cross-sections and strong two-photon excitation red 

fluorescence. Chem Commun 2009;39:5859e61. 

[41] Grabowski ZR, Rotkiewicz K, Rettig W. Structural changes accompanying 

intramolecular electron transfer: focus on twisted intramolecular chargetransfer 

states and structures. Chem. Rev. 2003;103(10):3899e4031. 

[42] Sonoda Y, Goto M, Tsuzuki S, Tamaoki N. Fluorescence spectroscopic properties 

and crystal structure of a series of donoreacceptor diphenylpolyenes. 

J Phys Chem A 2006;110(50):13379e87. 

[43] Plötner J, Dreuw A. Solid state fluorescence of pigment yellow 101 and 

derivatives: a conserved property of the individual molecules. Phys Chem 

Chem Phys 2006;8(10):1197e204.


Stability and structural aspects of diketopyrrolopyrrole pigment 

and its N-alkyl derivatives 

Jan David a , Martin Weiter a , Martin Vala a , Jan Vynuchal b ,Jirí Kucerík a, * 

a Faculty of Chemistry, Brno University of Technology, Purkynova 118, CZ-612 00 Brno, Czech Republic 

b Research Institute of Organic Syntheses, VUOS, Rybitví 296, CZ-533 54 Rybitví, Czech Republic 

article info 


Received 29 September 2009 


29 September 2010 

Accepted 3 October 2010 

Available online 12 October 2010 

Keywords: 

Diphenyl-diketo-pyrrolo-pyrroles (DPPs) 

Pigments 

Organic electronics 

Thermal stability 

Thermogravimetry 

Calorimetry 


abstract 

Nowadays, a strong effort can be seen in seeking for highperformance 

and simultaneously photo- and oxidative-thermally 

stable materials used in organic electronics. Printing technology 

seems to be a leading technique for cheap large scale production of 

such devices. Using this technique, the layers of electronic devices 

are printed employing solutions containing the active materials. 

However, the increase in solubility can reversibly act on the 

stability of the materials. Derivatives of 3,6-diphenyl-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione, 

commonly referred as DPPs, are 

potentially attractive materials for organic electronics. They belong 

to important industrial high-performance pigments [1] showing 

significantly high melting points with respect to other low molecular 

pigment standards. They also exhibit remarkable resistance 

against chemical, heat, light and climate influences. There is a wide 

range of possible applications which have been already investigated 

covering e.g. latent pigments [2], solid state dye lasers [3], gas 

detectors [4,5] or electroluminescent devices [6,7]. 

The DPPs are usually insoluble in common solvents [8]. One of 

the reason for their low solubility is the existence of hydrogen 

* Corresponding author. Tel.: þ420 5 41 14 94 85; fax: þ420 5 41 21 16 97. 

E-mail address: kucerik@fch.vutbr.cz (J. Kucerík). 

URL: http://www.fch.vutbr.cz/home/kucerik 

0143-7208/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.dyepig.2010.10.001 

Dyes and Pigments 89 (2011) 137e143 




An unsubstituted sample, three symmetrically N-substituted samples (methyl, butyl and heptyl) and two 

asymmetrically N-substituted samples (butyl and heptyl) of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c] 

pyrrole-1,4-dione (DPP) were investigated using thermogravimetry and differential scanning calorimetry 

to reveal the influence on physical-chemical properties of different alkyl chains and symmetry of Nsubstitution. 

Stability tests revealed that in all cases the substitution brought significant destabilization 

of the structure in comparison with the unsubstituted DPP molecule. It was demonstrated that the length 

of the substituting alkyl chain is a crucial factor in the stability of N-alkyl derivatives; the shorter the 

alkyl chain was, the less stable was the derivative. Further, the symmetrical derivates were less stable 

than the asymmetrical ones. Unlike the unsubstituted DPP molecule, all the derivatives showed 

remarkable sensitivity to different cooling regimes which lead to the revealing of monotropical polymorphism 

in the symmetrical butyl and heptyl derivatives crystalline structure. 


bondings between the H atom of the nitrogen functional group and 

oxygen. The unsubstituted DPP is perfectly planar, the pep electrons 

stacking occurs in solid state and also contributes to their 

insolubility. In order to modify the solubility, it is necessary to carry 

out either the N-substitution and/or the breaking of the molecule 

planarity [8]. In our previous work [7], we discussed the influence 

of N-alkylation on optical properties, and the results were correlated 

with molecule geometry calculated by quantum chemical 

methods. It was found that while the parent DPP molecule 

(abbreviated as DPP in this work) is perfectly planar, the Nsubstitution 

causes rotation of the adjacent phenyl rings (see Fig. 1) 

and thus reducing the effective conjugation extent. This, in turn, 

causes hypsochromic shift of the absorption spectrum. Simultaneously, 

the fluorescence spectra move to the longer wavelength 

region increasing Stokes shifts. The effect is more pronounced for 

the double N-alkylated derivatives. Since the angle of distortion is 

not dependent on the length of the substituent, no differences 

between butyl substituted (DPP-B, DPP-BB) and heptyl substituted 

derivatives (DPP-H, DPP-HH) were found [7]. 

The stability and behavior of physical structure of photo-sensitive 

materials which were exposed to different thermal history is 

very important. In order to produce high quality devices in 

a controlled way, knowledge about the crystallinity, and polymorphism 

seems to be crucial. Since physical properties of 

polymorphs can significantly differ, polymorphism can cause

138 

Fig. 1. The basic structure of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

(DPP), also known as DPP and the respective derivatives used in this study. The definition 

of calculated torsion angles a and b can be found in [7]. 

troubles in technological applications [15]. Essentially, the difference 

in crystal structure leads to different optical properties, 

structural stability, solubility, melting temperature, enthalpy etc. 

Since the crystallization of one specific polymorph is controlled by 

a combination of thermodynamic and kinetic factors [9], it is 

important to determine the relationship between such fraction and 

the others in the polymorphs mixture. 

In this study, using thermogravimetrical analysis (TGA), our 

research was extended by the thermal and thermo-oxidative 

stability tests and by distinguishing between processes of evaporation 

or degradation. In fact, materials DPP and DPP-MM have 

already been investigated by TGA [10]; however, the large set of 

DPP materials and comparison of their properties can bring deeper 

insight into the physical chemistry of such interesting pigments. 

Furthermore, employing differential scanning calorimetry (DSC) 

we would like to shed light on the structural variability of investigated 

samples after different thermal history. The obtained results 

are discussed with respect to the chemical structure of the studied 

molecules. 


2.1. Materials 

Samples of the studied derivatives were synthesized in VUOS, 

a.s. (Research Institute of Organic Syntheses, Inc., Rybitvi, Czech 

Republic) according to the procedures described in [7,8]. One 

unsubstituted sample (DPP), three symmetrically N-substituted 

samples (DPP-MM e methyl group substituted, DPP-BB e butyl 

group substituted and DPP-HH e heptyl group substituted) and two 

asymmetrically substituted samples (DPP-B with butyl group and 

DPP-H with heptyl group) were investigated in this study. Molecular 

structures of investigated samples are depicted in the Fig. 1. 

Before all the experiments had been performed, the compounds 

were carefully milled in the agate mortar in order to maintain 

uniform heat flow to the whole dosing of sample in both thermal 

analysis methods. 

2.2. Methods 

2.2.1. Thermogravimetric analysis 

Thermogravimetric studies were performed using TA Instruments 

TGA Q5000 (New Castle, DE, U.S.A.) device in 100 mL open 

platinum pans. The samples, typically 5 mg, were heated by using 

thermal ramp of 10 C min 1 from 40 C to 650 C in either dynamic 

atmosphere of nitrogen (thermal stability) or air (thermo-oxidative 

stability). Flow rate of both gases was 25 mL min 1 . 

2.2.2. Differential scanning calorimetry 

Calorimetric analyses were carried out employing TA Instruments 

DSC Q200 equipped with an external cooler RCS90 allowing 


J. David et al. / Dyes and Pigments 89 (2011) 137e143 

experimental temperature range from 90 to 400 C. Experiments 

were conducted in open TA TzeroÔ aluminum pans. The first 

heating run was conducted at 10 C min 1 from 40 C to the 

temperature 5 C lower than the degradation temperature onset 

(Tonset) previously determined by using thermogravimetry under 

nitrogen. In order to simulate the moderate temperature decrease, 

cooling ramp of 0.5 C min 1 was applied to reach 90 C, followed 

by 1 min of isothermal stage. The first calorimetric measurement 

was performed using heating ramp of 10 C min 1 from 90 Cto 

the temperature (Tonset 5) C. The second experiment was performed 

using the same heating ramp after the rapid equilibration of 

the sample down to 90 C and 1 min of isothermal stage. It is 

necessary to point out that in this case, the averaged temperature of 

cooling exceeded 20 C min 1 . All DSC experiments were made 

under 50 mL min 1 of nitrogen purge. The device was calibrated for 

temperature and enthalpy using indium, tin and zinc standards 

(Perkin Elmer). Additional measurement of sample DPP was carried 

out also by the TA Instruments Q600 (simultaneous DSC and TGA) 

under the same conditions as described above. All the records were 

assessed by TA Universal Analysis 2000 software version 4.4A. 

3. Results 

3.1. Stability tests e thermogravimetric analysis (TGA) 

TGA measurements were conducted to test the temperatures of 

mass loss occurrence. These temperatures correspond either to the 

temperature of degradation (TD), evaporation (Tev) or sublimation 

(Ts). The character of two latter phenomenons was revealed by DSC. 

In principle, if the sample shows an endotherm on DSC record, the 

sample is melted and therefore, the temperature can be associated 

to evaporation. On the contrary, if DSC record does not show any 

melting, the sample is solid and the process can be attributed to the 

sublimation. 

In order to distinguish between Ts and Tev or Ts, the mass loss and 

its first (DTG) and second temperature derivative curves were used. 

The clarification of such an approach is explained further in the 

text. The typical TGA record and its DTG curve were obtained by 

using conditions described in Experimental part for sample DPP- 

MM and is reported in Fig. 2. In this work, the DTG is plotted in an 

inverse mode to improve the illustrative quality of Figures. Since 

the TGA record provides an integral piece of information regarding 

the mass loss, DTG or potential second derivation allows a closer 

look into the dynamics of the processes and frequently helps to 

distinguish the change in mass loss mechanism. 

Sample DPP showed no event on the DSC curve when we used 

the temperature program reported in Experimental section. 

Therefore, in order to discover potential melting at temperatures 

above sublimation, the simultaneous DSC and TGA was carried out 

(Fig. 3). As it can be seen on the DSC curve, no overlapping of 

enthalpy processes occurred, and thus the sample cannot be melted 

under conditions used in this work. The respective 1st and 2nd 

derivative curves of TGA of DPP are reported in Fig. 4. 

The results obtained from DTG records are summarized in 

Table 1. All of the samples in both atmospheres showed one or two 

degradation steps. If occurred, the second degradation step was 

only minor and was not taken for further assessment. The onset of 

a process in DTG is traditionally determined from the 1st derivative 

mass loss curve. However, it is clear that the determined temperature 

does not indicate whether the temperature corresponds to 

the degradation or to the evaporation. The determined onset only 

indicates the beginning of mass changes which can be attributed to 

both above-mentioned processes. Therefore, the 2nd derivative was 

carried out in order to enable the separation of possible overlapping 

processes. An example of such a separation for sample DPP is

Fig. 2. TGA heating run for the DPP-alkyl derivate DPP-MM in the atmosphere of 

nitrogen. Onset temperatures are summarized in Table 1. 

reported in Fig. 4. Therefore, Table 1 reports the two temperatures, 

i.e. Tev (mass loss without degradation) and TD (mass loss connected 

with degradation). The only exception is the sample DPP, which 

showed no melting, and therefore, had no Tev but a temperature of 

sublimation Ts. All Tev and Ts occurred in the temperature range from 

238 C to 383 C. As it can be seen in Table 1, thermal-oxidative 

stability results (experiments in air) are similar to the thermal 

stability results (experiments in N2), but generally shows a slight 

shift to lower temperatures. As expected, the thermal stability of 

investigated materials is slightly higher than the thermal-oxidative 

Fig. 3. Simultaneous DSC and TGA record of sample parental sample DPP. 


J. David et al. / Dyes and Pigments 89 (2011) 137e143 139 

Fig. 4. Determination of the onset1 and the onset2, i.e., distinguishing between 

sublimation and degradation of sample DPP. Other samples exhibited melting and 

therefore, the onset1 stands for evaporation temperature in this case. 

stability. Comparison of TD showed the thermal stability of samples 

in order of DPP > DPP-HH > DPP-B > DPP-MM > DPP-BB; sample 

DPP-H could not be taken into account since the whole sample was 

completely evaporated at 350 C. In dynamic air atmosphere, the 

thermo-oxidative stability showed following order of DPP > DPP- 

HH > DPP-B ¼ DPP-H > DPP-MM > DPP-BB. DPP-H sample was 

included in this order since the thermo-oxidative stability showed 

lower temperature than the Tev, which suggests that the degradation 

under air occurs earlier than the evaporation. As stated in the 

Experimental part, the temperatures of Tev and onsets1 (see Fig. 4) 

were used to design the DSC experiments (to suggest upper 

temperature limit). The Ts and Tev, indicating the temperature at 

which the molecular vibrations overcame the weak intermolecular 

interactions stabilizing structures either in solid state (DPP4) or in 

melted (the rest), are ordered as follows: DPP4 > DPP-H > DPP- 

HH > DPP-B > DPP-BB > DPP-MM. 

3.2. Phase transitions e differential scanning calorimetry (DSC) 

DSC experiments revealed additional differences in physical 

structure of investigated materials. Most of the derivatives, when 

heated from 90 C expressed several phase transitions which 

varied depending on the chemical structure and thermal history of 

the respective samples. DSC records of selected samples are given in 

Figs. 5 and 6, for samples DPP-BB and DPP-HH, respectively. Table 2 

summarizes main phase transitions such as melting, crystallization 

and glass transition of measured samples. Minor transitions, which 

Table 1 

Thermogravimetric analyses results. The onset1 suggests the temperature of evaporation, 

the onset2 indicates possible beginning of degradation. 

Sample Purge gas Onset1 [ C] Onset2 [ C] Char [%wt] Steps 

DPP N2 383 396 0.4 1 

DPP air 356 0 1 

DPP-MM N2 238 262 3.8 2 

DPP-MM air 237 0 2 

DPP-B N2 269 281 0.1 1 

DPP-B air 267 0 2 

DPP-BB N2 241 246 0 1 

DPP-BB air 234 0 2 

DPP-H N2 290 E 0 1 

DPP-H air 267 0 2 

DPP-HH N2 282 290 0 1 

DPP-HH air 271 0 1 

E e sample was completely evaporated, no degradation was observed.

140 

Fig. 5. Comparison of DSC records for sample DPP-BB after different cooling regime. 

Moderate cooling regime was 0.5 C per min from 200 to 90 C, heating 10 C per 

min. 

are not important for further discussion, are only described in the 

next paragraphs. 

DSC record of DPP sample after both moderate and rapid cooling 

did not show any event at lower temperatures (Fig. 3). In contrast, 

at elevated temperatures the simultaneous DSC/TGA record 

showed an intensive endothermal peak with no shoulder accompanied 

by a massive mass loss which can be attributed to the 

sublimation of the sample followed by degradation (cf. Table 1). 

After moderate and rapid cooling DSC record of DPP-MM sample 

showed endothermal melting peaks around 234 C with melting 

enthalpy around 112 J g 1 , which indicates no influence on the 

sample thermal history. 

Moderate cooling ramp caused a tiny exotherm probably corresponding 

to the cold crystallization of DPP-B with onset at 19 C 

(enthalpy 0.43 J g 1 ) and followed by an endotherm corresponding 

to the melting at 8 C (peak temperature 5 C, melting enthalpy 

0.26 J g 1 ). Further, at 10.7 C an endotherm appeared again indicating 

the structure melting (peak temperature 17 C, melting 

enthalpy 0.18 J g 1 ). A glass transition with midpoint at e18 Cwas 

observed in the record after rapid cooling ramp. 

Fig. 6. Comparison of DSC records for sample DPP-HH after different cooling regime. 

Moderate cooling regime was 0.5 C per min from 200 to 90 C, heating 10 C per 

min. 



One of the most complex calorimetric results was given by the 

measurement of the sample DPP-BB. DSC records after the 

moderate cooling ramp resulted in three consecutive and intensive 

phase transitions; melting at 120 C (melting enthalpy 72.3 J g 1 ), 

followed by cold crystallization at 124 C (peak temperature 125 C, 

enthalpy of crystallization 38.5 J g 1 ) and subsequent second 

melting peak at 135.2 C (melting enthalpy 70.9 J g 1 ). Calorimetric 

results from the experiment after the rapid cooling ramp showed 

a glass transition with midpoint of 5 C, a cold crystallization at 

56 C (enthalpy of crystallization 69 J g 1 ). After that, a slight 

melting peak at 108 C was detected (melting enthalpy 6.1 J g 1 ) 

followed by intensive melting at 136 C (melting enthalpy 84 J g 1 ), 

which was observed in the experiment after moderate cooling rate 

as well. 

Heating run after moderate cooling of sample DPP-H resulted in 

a cold crystallization at 41 C with peak temperature of 26 C 

and crystallization enthalpy of 1.85 J g 1 followed by melting at 0 C 

and peak temperature at 2 C and melting enthalpy of 1.09 J g 1 . 

After rapid cooling, the DPP-H sample showed two consequent 

melting peaks at 19 C (peak temperature at 16 C, melting 

enthalpy of 0.04 J g 1 ) and at 12 C (melting enthalpy of 

0.24 J g 1 ), respectively. Both temperature regimes performed 

similar melting peaks around 212 C (enthalpies around 100 J g 1 ). 

Complicated results were obtained from calorimetric experiments 

in the sample DPP-HH as well. After moderate cooling, 

significant melting at 115 C with peak temperature of 116 C and 

melting enthalpy of 96.3 J g 1 was detected. After a rapid cooling, 

a glass transition with midpoint at 22 C was observed followed 

by two cold crystallization peaks. The first crystallization peak 

occurred at 25 C, with temperature of the peak at 31 C and 

crystallization enthalpy of 37.4 J g 1 . The second cold crystallization 

event was less prominent and appeared at 62 C with peak 

temperature of 71 C and crystallization enthalpy of 30.7 J g 1 . The 

same melting peak, as observed in the experiment after moderate 

cooling, was detected also after rapid cooling, i.e., the onset at 

115 C, peak temperature at 116 C and melting enthalpy of 

95.4 J g 1 . 

In contrast to the order of Tev, the temperatures of crystal 

melting followed reverse order, i.e., DPP-MM > DPP-BB > DPP- 

HH > (DPP). Similar order can be seen for asymmetrical samples 

onsets DPP-B < DPP-H and for melting temperatures of DPP- 

B > DPP-H. 

4. Discussion 

Table 1 indicates significant distinctions in stability and structural 

feature of investigated samples. First of all, there has been 

observed a great difference between substituted derivates and 

unsubstituted DPP. In fact, all the substituted samples were less 

stable thermally (except DPP-H where stability could not be 

determined) than the unsubstituted parent sample DPP. The onset 

temperature of degradation 238 C found for the least stable 

derivative DPP-MM is about 145 C lower compared to the DPP 

(383 C). Table 1 summarizes the data obtained from TGA under 

inert atmosphere and oxidative atmosphere of air. As can be seen in 

several cases, the temperatures of evaporation in nitrogen are 

similar to those obtained in air (i.e., DPP-MM, DPP-B and possibly 

DPP-BB). That suggests that in those samples, oxygen did not play 

an important role in their degradation. 

The highest stability of DPP can be easily explained with respect 

to its structure. As already mentioned, overlapping of pep electrons 

between adjacent molecules occurs due to the planarity of the 

molecule [8]. The compact and rigid structure is stabilized by four 

intermolecular hydrogen bonds per molecule between the eNH 

group of one molecule and the oxygen atom of the neighboring one

along the b axis [11]. This interaction further contributes to the 

insolubility of the non-N-substituted DPPs. In DPP, the number of 

atomic contact along the stacking axis is 9 [12]. That number 

strongly depends on the character of the N-substitution of the 

derivate [13]. Therefore, the existence of hydrogen bonds between 

the eNH group and oxygen on the central pyrrolo-pyrrole core 

additionally increases the energy needed for molecule defragmentation 

as confirmed by Tev or Ts or degradation TD. On 

the contrary, it has been stated that the torsion angles between the 

central pyrrolo-pyrrole part and the phenyls are independent of 

the alkyl length [7], therefore, the difference between derivates 

with different alkyl length has to be related to different properties. 

Remaining char observed on TGA for DPP sample confirms the 

hypothesis about the degradation which follows the sublimation or 

evaporation. Traditionally, the DPP pigments are deposited on 

a surface at elevated temperatures. The char formation indicates 

that choosing an inappropriate temperature can lead to the 

pigment degradation since Ts and TD of this sample are not significantly 

different. In TGA experiments the linear heating is employed 

which implies that the sample has not enough time to sublimate 

completely from the pan. In technological (industrial) practise this 

problem can be (and usually is) solved by pressure reduction [12].It 

is clear that the processes of evaporation are relatively moderate 

and since the temperature of degradation is shifted only 15 C 

higher, the deposition under vacuum is necessary. 

The introduction of two methyl groups to the nitrogen atoms 

breaks the planarity of the molecule [7] decreasing the strength of 

H-bonds and consequently causes easier defragmentation of the 

molecule. That can be identified in the sample DPP-MM which 

showed the lowest onset on DTG plot. Since Tev and TD in air are 

similar, it could be expect that the temperature is associated with 

sample’s evaporation. However, as suggested by TGA analysis in 

nitrogen, that temperature is again either close or identical to the 

temperature of sample degradation since there was a char observed 

at the end of the analysis at 650 C. In contrast, it can be seen that 

N-substitution by methyl groups in sample DPP-MM caused relatively 

high melting temperatures of present crystals (very close to 

the temperature of evaporation/degradation) with the highest 

melting enthalpy in comparison with other samples. Unlike the 

other samples, DPP-MM was not able to be measured after different 

thermal history due to the vicinity of both temperatures. The value 

of melting enthalpy reported in Table 2 can also be biased by 

processes occurring simultaneously. 

A similar situation was observed for sample DPP-B. Unlike the 

sample DPP-MM, DPP-B presents an asymmetrical derivate of DPP 

which seems to increase both temperatures of evaporation and 

crystal melting. Again, the temperatures of degradation determined 

using TGA in both atmospheres were very close to each other 



Table 2 

Comparison of results obtained by DSC measurement for samples which underwent different thermal history. For better understanding only major events are given, the rest 

can be found in the text. DPP is not reported due to the absence of significant transitions. 

Thermal history Sample Crystallization I Crystallization II Melting I Meting II Glass transition 

Tonset [ C] DH [J g 1 ] Tonset [ C] DH [J g 1 ] Tonset [ C] DH [J g 1 ] Tonset [ C] DH [J g 1 ] Tmidpoint [ C] 

moderate cooling DPP-MM e e e e 234.4 109.4 e e e 

rapid cooling DPP-MM n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 

moderate cooling DPP-B e e e e 245.4 93.8 e e e 

rapid cooling DPP-B e e e e 244.6 92.5 e e 18.3 

moderate cooling DPP-BB 123.9 38.5 e e 120.1 72.3 135.2 70.9 e 

rapid cooling DPP-BB 55.5 69.0 e e 108.3 6.1 135.6 83.9 5.1 

moderate cooling DPP-H e e e e 211.9 75.8 e e e 

rapid cooling DPP-H e e e e 212.1 74.9 e e e 

moderate cooling DPP-HH e e e e 115.2 96.3 e e e 

rapid cooling DPP-HH 25.3 37.4 62.1 30.7 114.7 95.4 e e 22.2 

suggesting the same explanation as given for DPP-MM sample, i.e. 

sample is simultaneously evaporated and decomposed above Tev. 

That observation is confirmed by the presence of char at 650 C 

(Table 1). 

An increase in the onset temperature was observed also for the 

second asymmetrical sample DPP-H. The significant difference in 

the onset temperatures obtained under different conditions indicates 

the decrease of thermo-oxidative resistance with the 

increasing length of alkyl chain. This can be interrelated to the 

decrease in temperature of crystal melting in the sample. It is our 

hypothesis that alkyl chains have higher molecular motion after the 

crystalline structure melting and reactive gas can easily diffuse 

through the sample. It is well known that aliphatic chains are 

relatively unstable under a thermo-oxidative attack [14], hence, the 

stability of the derivatives under study decreases with the 

increasing length of alkyl chain. 

Table 2 reports that asymmetrical molecules, i.e. samples DPP-B 

and DPP-H did not show any response to the different thermal 

history which implies a relatively easy molecular transport to form 

crystals and no tendency to polymorphism. In contrast, symmetrical 

molecules with longer alkyl chains DPP-BB and DPP-HH seem 

to have tendency to form different crystalline forms resulting in 

occurrence of multiple peaks in DSC signal. In contrast to the 

sample DPP-HH, when the DPP-BB sample was cooled rapidly, 

the enthalpy of melting dropped down which indicates that the 

molecular motion during the crystal formation of both samples was 

disturbed by different extraneous factors. Moderate cooling of 

sample DPP-BB gave melting-crystallization-melting sequence 

while DPP-HH simply melted in one step and at lower temperature 

than DPP-BB. When cooled quickly, DPP-HH pre-crystallized in two 

steps while the onset of the first melting was at lower temperature 

than that for sample DPP-BB. That implies that in the first stage the 

longer alkyl chains in sample DPP-HH needed lower energy input to 

re-crystallize rather than the shorter chain in sample DPP-BB. 

Accordingly, inspired by melting temperatures and enthalpies of 

pure alkanes, it is supposed that there is a hindrance in molecular 

motion in C4H9 alkyl chain reducing the rate of crystallization. 

There is a possible explanation that the DPP molecular skeleton has 

an influence on the alkyl chain via van der Waals interactions. In 

fact, the first carbons of alkyl chain can be affected by the presence 

of neighboring electron acceptor atom having a great influence on 

the molecular motion of the whole chain. The other possibility is 

that the molecular motion is influenced by the whole DPP skeleton 

and the C4H9 chain length is not long enough to overcome the 

electrostatic interactions between adjacent DPP molecules. Since 

there is a strong intermolecular interaction between oxygen lone 

electron pair and hydrogen of eNH group [18], it seems that the H 

atom can be substituted in its role by short alkyl chain since the

142 

melting of DPP-MM sample is relatively high; on the contrary, the 

temperature of degradation/evaporation is very close, as a result 

the H-bonds formed by eNH group is weaker and consequently 

destabilizes the structure at relatively low temperatures. 

Using the nomenclature of Lehman [15], enantiotropic polymorphism 

pertains two crystal forms that undergo reversible phase 

exchanges between one another, while monotropic polymorphism 

corresponds to two crystal forms where one e a kinetically trapped, 

metastable form e undergoes an irreversible phase change to the 

other thermodynamically more stable form [16]. Fig. 5 indicates 

two crystalline structures present in sample DPP-BB represented by 

two endothermal melting peaks. Clearly, the existence of the less 

stable form depends on the rate of cooling, so it is kinetically 

governed and therefore the sample crystalline structure is monotropically 

polymorphous. In the case of sample DPP-HH (Fig. 6), 

after cooling the kinetically most favorable polymorph crystallized 

first and subsequently transformed into thermodynamically stable 

one. Again, such behavior can be attributed to the monotropic 

polymorphism. 

Fruitful discussion can be held after comparison of monosubstituted 

and bi-substituted derivatives. The TDs obtained for the 

mono-substituted derivatives were always higher than those for the 

bi-substituted. A possible explanation implies the electron donating 

character of the alkyl groups. Due to the mesomeric effect between 

the nitrogen and oxide atoms, the electron density is unequally 

distributed over the molecule and creates a dipole. The alkylation 

even increases the mesomeric effect and consequently increases the 

polarity of the molecule. This can be experimentally observed as 

a blurring of vibrational structure of electron spectra [7,16,17]. 

Therefore, the electron donating character of the substituted alkyls 

increases reactivity and consequently causes easier defragmentation 

of the molecule. As a result the mono-substituted derivatives 

are thermally more stable because of their lower reactivity. 

In order to support our statement about the evaporation followed 

by degradation, the DPP-MM sample was thermally treated 

at specific temperatures and the sample composition was followed 

by FTIR analysis (KBr pellet technique). As shown in Fig. 7, at 

temperature 260 C, i.e., 3 C below the predicted decomposition 

temperature, the sample still resembled the molecular character of 

DPP-MM. At 280 C the FTIR spectra showed a shift in intensities at 

several wave numbers, and the shift continued with increasing 

temperature (not shown). The attribution of peaks wave numbers 

Fig. 7. Comparison of FTIR records of sample DPP-MM, and DPP-MM heated up to 260 

and 280 C. The Figure shows only selected wavenumbers range. 



to bond vibrations can be found for example in [3]. It was impossible 

to determine the exact temperature at which the change of 

structure occurred since the degradation did not take part in the 

whole volume of the sample. Indeed, the changes were observable 

at first sight, the color of the pigment changed from red to orange at 

280 C and greenish above 300 C. 

5. Conclusion 

One unsubstituted sample, three symmetrically N-substituted 

samples (methyl, butyl and heptyl) and two asymmetrically Nsubstituted 

samples (butyl and heptyl) of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

were investigated to observe 

the influence on physical-chemical properties of different alkyl 

chains and symmetry of substitution. From the point of view of 

their evaporation temperature, thermal stability and thermooxidative 

stability, it was revealed that substitution brought about 

significant destabilization of the structure in comparison with 

parental molecule. It was demonstrated that the length of 

the substituting alkyl chain is a crucial factor in their stability; the 

shorter chain the less stable derivate was obtained while 

the symmetrical derivates were less stable than asymmetrical ones. 

As revealed by DSC, unlike the other samples, the symmetrical 

derivates indicated monotropical polymorphism. On the contrary, 

DSC experiments did not reveal the presence of different crystalline 

structures in DPP, although the presence of two crystalline forms 

was reported [19]. It seems that the thermal agitation (and therefore 

DSC) is not a suitable manner for transformation of those 

phases, it is likely that the aforementioned weak interactions are 

strong enough to resist their vibration upon heating. 

Acknowledgements 

The financial support of the Ministry of Education of the Czech 

Republic e project MSM 0021630501 and the Academy of Sciences 

of the Czech Republic e project KAN401770651 are acknowledged. 

References 

[1] (a) Rochat AC, Cassar L, Iqbal A. EP 94911; 1983. (b) Iqbal A, Pfenninger J, 

Rochat AC, Babler F. EP 181290; 1989. (c) Pfenninger J, Iqbal A, Rochat AC, 

Wallquist O. USP 4778899; 1986. (d) Surber W, Iqbal A, Stern C. EP 302018; 

1989. (e) Wooden G, Schloeder I, Wallquist O. EP 672729; 1995. (f) Hendi SB. 

EP 962499; 1999. 

[2] Zambounis JS, Hao Z, Iqbal A. Latent pigments activated by heat. Nature 

(London) 1997;388(6638):131e2. 

[3] Fukuda M, Kodama K, Yamamoto H, Mito K. Evaluation of new organic 

pigments as laser-active media for a solid-state dye laser. Dyes and Pigments 

2004;63(2):115e25. 

[4] Mizuguchi J, Imoda T, Takahashi H, Yamakami H. Polymorph of 1,4-diketo-3,6bis-(4’-dipyridyl)-pyrrolo-[3,4-c]pyrrole 

and their hydrogen bond network: A 

material for H2 gas sensor. Dyes and Pigments 2006;68(1):47e52. 

[5] Hoki T, Takahashi H, Suzuki S, Mizuguchi J. Hydrogen gas sensor based upon 

proton acceptors integrated in copper-tetra-2,3-pyridinoporphyradine. IEEE 

Sensors Journal 2007;7(5):808e13. 

[6] Beyerlein T, Tieke B, Forero-Lenger S, Brütting W. Red electroluminescence 

from a 1,4-diketopyrrolo[3,4-c]pyrrole (DPP)-based conjugated polymer. 

Synthetic Metals 2002;130(2):115e9. 

[7] Vala M, Weiter M, Vynuchal J, Toman P, Lunák Jr S. Comparative studies of 

diphenyl-diketo-pyrrolopyrrole derivatives for electroluminescence applications. 

Journal of Fluorescence 2008;18(6):1181e6. 

[8] Potrawa T, Langhals H. Fluorescent dyes with large stokes shifts e soluble 

dihydropyrrolopyrrolediones. Chemische Berichte 1987;120(7):1075e8. 

[9] Aret E, Meekes H, Vlieg E, Deroover G. Polymorphic behavior of a yellow 

isoxazolone dye. Dyes and Pigments 2007;72:339e44. 

[10] Mizuguchi J, Wooden G. A large bathochromic shift from the solution to the 

solid state in 1,4-diketo-3,6-diphenyl-pyrrolo-[3,4-c]-pyrrole. Berichte der 

Bunsen-Gesellschaft für Physikalische Chemie 1991;95:1264e74. 

[11] Mizuguchi J. Correlation between crystal and electronic structures in diketopyrrolopyrrole 

pigments as viewed from exciton coupling effects. Journal of 

Physical Chemistry A 2000;104:1817e21.

[12] Mizuguchi J, Grubenmann A, Wooden G, Rihs G. Structures of 3,6-diphenylpyrrolo[3,4-c]pyrrole-1,4-dione 

and 2,5-dimethyl-3,6-diphenylpyrrolo 

[3,4-c]pyrrole-1,4-dione. Acta Crystallographica 1992;B48:696e700. 

[13] Weiter M, Salyk O, Bednár P, Vala M, Navrátil J, Zmeskal O, Vynuchal J, Lunák 

Jr. S. Morphology and properties of thin films of diketopyrrolopyrrole derivatives, 

Materials Science and Engineering: B, submitted for publication. 

[14] Válková D, Kislinger J, Pekar M,Kucerík J. The kinetics of thermo-oxidative 

humic acids degradation studied by isoconversional methods. Journal of 

Thermal Analysis and Calorimetry 2007;89:957e64. 

[15] Lehman O. Die krystallanalyse. Leipzig: Wilhelm Engelmann; 1891. 



[16] Hauser MR, Zharakov L, Doxsee KM, Tonglei L. Polymorphism of a simple 

organic amide. Crystal Growth and Design 2008;8(12):4428e31. 

[17] Lunák S, Vynuchal J, Vala M, Havel L, Hrdina R. The synthesis, absorption and 

fluorescence of polar diketo-pyrrolo-pyrroles. Dyes and Pigments 

2009;82:102e8. 

[18] Vala M, Vynuchal J, Toman P, Weiter M, Lunák Jr S. Novel soluble diphenyldiketo-pyrrolopyrroles. 

Experimental and theoretical study. Dyes and 

Pigments 2009;89:102e8. 

[19] Hao Z, Iqbal A. Some aspects of organic pigments. Chemical Society Reviews 

1997;26:203e13.

The geometry and absorption of diketo-pyrrolo-pyrroles 

substituted with various aryls 

Stanislav Luňák Jr. a , Lukásˇ Havel a , Jan Vyňuchal b,c, *, Petra Horáková a , 

Jirˇí Kučerík d , Martin Weiter d , Radim Hrdina a 

a 

Department of Organic Technology, Faculty of Chemical Technology, University of Pardubice, Studentská 95, CZ-532 10 Pardubice, Czech Republic 

b 

Research Institute of Organic Syntheses, Rybitví 296, CZ-533 54 Rybitví, Czech Republic 

c 

Synthesia a.s., Pardubice, Semtín 103, CZ-532 17 Pardubice, Czech Republic 

d 

Faculty of Chemistry, Brno University of Technology, Purkyňova 118, CZ-612 00 Brno, Czech Republic 

article info 


Received 30 June 2009 


25 September 2009 

Accepted 28 September 2009 

Available online 1 October 2009 

Keywords: 

Diketo-pyrrolo-pyrroles (DPP) 

Time dependent density functional theory 

(TD DFT) 

Absorption 

Fluorescence 


abstract 

The present authors have recently shown that calculations based 

on time dependent density functional theory (TD DFT) could predict 

the absorption maxima of diketo-pyrrolo-pyrrole (DPP) pigments 

which had been substituted with various combinations of strong 

electron-donating and electron-withdrawing substituents in the 

para positions of both pendant phenyl rings [1]. A necessary 

component of such computation was the introduction of solvent 

effects by a polarized continuum model (PCM). The aim of this paper 

is to challenge this methodology by interpreting the relationship 

between structure and absorption of a series of symmetrical and 

unsymmetrical DPPs that comprise different combinations of aryl 

substituents (Table 1). 

3,6-Diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (BPPB 

in our notation) is a basic chromophore of this set; it has been 

patented by CIBA [2]. BPPB itself (C.I. Pigment Red 255) and at least 

* Corresponding author at: Research Institute of Organic Syntheses, Rybitví 296, 

CZ-533 54 Rybitví, Czech Republic. Tel.: þ420 466 823 351; fax: þ420 466 822971. 

E-mail address: jan.vynuchal@vuos.com (J. Vyňuchal). 

0143-7208/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.dyepig.2009.09.014 

Dyes and Pigments 85 (2010) 27–36 




A series of five symmetrical and four unsymmetrical diaryl substituted diketo-pyrrolo-pyrroles was 

synthesized; two unsymmetrical derivatives are reported for the first time. The relationship between the 

theoretical excitation energies of the S0 / S1 transition, computed by time dependent density functional 

theory and the experimental positions of 0–0 vibronic bands in the visible absorption (or fluorescence 

excitation) spectra was studied. Experimental data were obtained from either solution or from low 

temperature organic solvent glass, in which the progressions of the vibrational structure enabled correct 

assignment of vibronic sub-bands in some cases. Theoretical calculations predicted that a linear bathochromic 

and hyperchromic shift would accompany substitution of each phenyl in the parent 3,6-diphenyl- 

2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione by providing a more extensively conjugated aryl centre 

(2-naphthyl, biphenyl, stilbenyl) for the ensuing planar derivatives. Qualitatively, the experimental 

bathochromic shifts of the 0–0 vibronic sub-bands were in exact agreement with theory, whilst hyperchromic 

shifts were affected by the very low solubility of the planar, symmetrical derivatives. Deviations 

from this ideal behaviour were observed for non-planar derivatives (aryl ¼ stilbenyl or 1-naphthyl), for 

which the dihedral angles describing the aryl, out-of-plane torsions were probably underestimated by DFT. 


five its symmetrical derivatives substituted on phenyl form 

a commercially very successful family of high performance organic 

pigments [3]. One of them, BiPPBi (C.I. Pigment Red 264) was also 

used in this study. These two pigments are the only ones from the 

model set, for which the structure was estimated experimentally 

using X-ray diffraction [4,5]. The other compounds under study were 

not commercialised at the time of manuscript preparation. 

Extensive literature exists on DPPs in general and, more specifically, 

in relation to commercial examples; in this context, >279 references 

exist for BPPB and 138 for BiPPBi were found as at 08/06/2009. In 

contrast, there is a paucity of citations relating to other symmetrical 

derivatives, with just 6 references to 1NPP1N,7for2NPP2N and 2 for 

StPPSt being found in patent literature. Four patents discuss the 

asymmetrical compound BiPPB and 1 patent describes 1NPPB;asno 

references relating to the 2-naphthyl compound 2NPPB and the stilbene 

analogue StPPB were found, the syntheses of these two particular 

compounds was described in detail. Styryl (phenyl–ethenyl) PePPB 

and PePPPe derivatives were handled only theoretically, as a synthetic 

route to theses compounds is not known [6]. 

With exception of the authors’ previous work [1], noab initio 

calculations of DPP pigments have been published and references

28 

Table 1 

Notation of the compounds studied. 

Ar 

to only semiempirical PPP [7] and INDO/S studies on BPPB and its 

aggregates [8] were found. The latter computations were based on 

X-ray geometry [7] which was later revised [4] and which underestimated 

the visible absorption maximum compared to its 

experimental counterpart [9]. 


2.1. Syntheses and analysis 

Ar 

HN NH 

O 

BPPB was synthesized from benzonitrile and diisopropyl 

succinate [10]. Other symmetrical derivatives (BiPPBi, 1NPP1N, 

2NPP2N and StPPSt) were synthesized in an analogous manner 

from corresponding nitriles purchased from Aldrich, except for 

4-cyano-stilbene, which was synthesized as described bellow. The 

purity of all compounds was determined using elemental analysis, 

MS and 1 H NMR. 

The unsymmetrical derivatives (BiPPB, 1NPPB and StPPB)were 

synthesized by the base-catalysed condensation of ethyl 4,5dihydro-5-oxo-2-phenyl(1H)pyrrole-3-carboxylate(phenyl-pyrrolinone 

ester) as described previously [11] with the above 

mentioned nitriles. 2NPPB was synthesized from benzonitrile and 

ethyl 4,5-dihydro-5-oxo-2-(2-naphthyl)-(1H)pyrrole-3-carboxylate 

(2-naphthyl-pyrrolinone ester), which synthesis is described 

bellow. The syntheses of two till unknown unsymmetrical derivatives 

(2NPPB and StPPB) is presented in detail. 

2.1.1. Syntheses of 4-cyano-stilbene 

Triethanolamine (200 ml), 4-bromobenzonitrile(18.2 g, 0.1 mol), 

styrene (10.4 g, 0.1 mol) and palladium acetate (0.23 g,1 mmol) were 

O 

Ar 

symmetrical 

BPPB – 

BiPPBi BiPPB 

2NPP2N 2NPPB 

1NPP1N 1NPPB 

StPPSt StPPB 

PePPPe PePPB 

S. Luňák Jr. et al. / Dyes and Pigments 85 (2010) 27–36 

HN NH 

O 

O 

Ar 

unsymmetrical 

charged into a 0.5 l Keller flask equipped with a stirrer, reflux 

condenser, thermometer and a nitrogen inlet. The reaction mixture 

was heated out at 100 C for 10 h. After a cooling to room temperature 

the product was extracted with ether (2 300 ml). The ether 

layers were washed with water, dried with magnesium sulphate and 

evaporated. The yellow product was dissolved by stirring in methanol 

(which removed triethanolamine), filtered and dried. Yield: 

19.47 g (95%). The melting point was 116–118 C (lit. [12] 117–119 C). 

2.1.2. Syntheses of ethyl 4,5-dihydro-5-oxo-2-(2-naphhtyl)- 

(1H)pyrrole-3-carboxylate (2-naphthyl-pyrrolinone ester) 

2.1.2.1. Preparation of ethyl 2-naphthoate. 2-Naphthoic acid 

(Aldrich, 60 g, 0.348 mol), ethanol (226 ml) and sulphuric acid 

(7 ml) were added to the two-necked flask equipped with thermometer, 

stirrer and refluxing condenser. The reaction mixture was 

heated to reflux for 10 h and after that the mixture was cooled to 

room temperature; excess ethanol was distilled off. The ensuing 

product was extracted with diethyl ether; the organic layer was 

separated, washed with sodium carbonate (5%) and water and then 

dried over Na2SO4. The solvent was removed under reduced pressure. 

The amount of the oily product was 52 g (yield 75%). 

2.1.2.2. Preparation of ethyl 3-(2-naphthyl)-3-oxopropanoate. A 

mixture of sodium hydride (caution: reacts violently with water, 

liberating hydrogen; incompatible with water, acids, alcohols, strong 

oxidizing agents; Aldrich 60%, 16.8 g, 0.42 mol), ethyl 2-naphthoate 

obtained by Section 2.1.2.1 (42 g, 0.21 mol) and 1-butoxybutane 

(360 ml) was added to the three neck flask equipped with thermometer, 

stirrer, dropping funnel and refluxing condenser. The 

reaction mixture was heated to 100 C and ethyl acetate (27.6 g, 

0.313 mol) in 1-butoxybutane (20 g) was added to the mixture by 

means of dropping funnel within about 1.5 h. The suspension was 

heated to reflux for 6 h, then cooled to room temperature and 

diluted with diethyl ether (100 ml). The obtained salt was filtrated 

off, washed with diethyl ether (300 ml). Subsequently, the suspension 

was poured onto 300 g ice and acidified by hydrochloric acid to 

pH ¼ 2. The product was extracted with diethyl ether, organic layer 

was separated, washed with sodium carbonate (5%) and water. Then 

dried over Na2SO4. The solvent was removed under reduced pressure. 

The amount of oily product was 32.4 g (64% of theory). 

2.1.2.3. Preparation of ethyl 4,5-dihydro-5-oxo-2-(2-naphthyl) 

(1H)pyrrole-3-carboxylate. Ethyl 3-(2-naphthyl)-3-oxopropanoate 

(32.4 g, 0.134 mol) obtained by Section 2.1.2.2, ethyl bromoacetate 

(24.6 g, 0.147 mol), sodium carbonate (19.3 g), acetone (32 ml) and 

ethyleneglycol dimethylether (32 ml) were added to the threenecked 

flask equipped with thermometer, stirrer and refluxing 

condenser. The reaction mixture was refluxed for 14 h. Acetone was 

continuously added into the reaction mixture to keep the constant 

volume due to evaporating off. Subsequently, the mixture was 

cooled down at room temperature and inorganic salt was filtrated 

and washed by acetone. The filtrate and acetone from the washing 

process was combined and acetone was distilled off with other 

volatile fractions up to 150 C under nitrogen. Acetic acid (101 ml) 

and ammonium acetate (58 g) were added to the dark liquid 

distilling residue. The mixture was kept under reflux at 120 C for 

4 h. 16.1 g (yield 43%) of a product was obtained by filtration from 

the mixture after the cooling. A sample for analysis was recrystallized 

from toluene. The melting point was 188–193 C. 

Calculated: C (72.58), H (5.37), N (4.98). Found: C (72.50), 

H (5.35), N (5.11). 

MW ¼ 281 Da; positive-ion APCI-MS: m/z 282 [M þ H] þ (100%) 

1 H chemical shifts: 10.83 (1H, s, NH); 8.21–7.61 (7H, m, ArH); 

4.05 (2H, q, CH2); 3.49 (2H, s, CH2); 1.10 (3H, t, CH3).

2.1.3. Syntheses of 3-(2-naphthyl)-6-phenyl-2,5dihydropyrrolo[3,4-c]pyrrole-1,4-dione 

(2NPPB) 

tert-Amyl alcohol (33 ml) and sodium metal (caution: reacts 

violently with water, liberating hydrogen; flammable solid; 

incompatible with water, strong oxidizing agents; air sensitive; 

0.7 g, 30 mmol) were charged into a 100 ml three-necked flask 

equipped with a stirrer, reflux condenser and thermometer. The 

sodium metal was dissolved under reflux in the presence of catalytic 

amount of FeCl3 (which approximately took 1 h), whereupon 

benzonitrile (1.4 g, 13.6 mmol) was added. 2-Naphthyl-pyrrolinone 

ester (2.5 g, 8.9 mmol), obtained according to Section 2.1.2.3 was 

continuously introduced in small amounts over 0.5 h. The ensuing 

mixture was stirred under reflux for 1 h and the hot suspension was 

then filtered, the filter cake suspended in 100 ml tert-amyl alcohol 

and then 10 ml acetic acid was added to protolyse the salt. Protolysis 

was carried out at 100 C for 2 h. The resulting hot 

suspension was filtered, and the filter cake was washed with hot 

water to neutral washings. The filter cake was suspended in 300 ml 

methanol. The suspension was heated to boiling and refluxed for 

2 h. The hot suspension was filtered, washed with ethanol and hot 

water Yield: 1.5 g (54%). 

Calculated: C(78.09), H(4.17), N(8.28). Found C(77.19), H(4.20), 

N(8.06) 

MW ¼ 338 Da; Negative-ion APCI-MS: m/z 337 [M H] (100%) 

1 

H chemical shifts: 11.45 (2H, br s, NH); 9.03 (1H, m); 8.7 (1H, 

m); 8.55(2H, m); 8.14(1H, m); 8.04 (1H, m); 8.00 (1H, m); 7.56– 

7.72 (5H, m). 

13 

C chemical shifts were not determined due to a very low 

solubility of the sample. 

2.1.4. Syntheses of 3-(4-stilbenyl)-6-phenyl-2,5dihydropyrrolo[3,4-c]pyrrole-1,4-dione 

(StPPB) 

tert-Amyl alcohol (67 ml), sodium metal (1.43 g, 97 mmol) and 

a catalytic amount of FeCl3 were charged into a 250 ml threenecked 

flask equipped with a stirrer, reflux condenser, thermometer 

and nitrogen inlet. The sodium metal was dissolved under the 

reflux, whereupon 4-cyano-stilbene (6.4 g, 31 mmol) obtained 

according to Section 2.1.1 was added. After that phenyl-pyrrolinone 

ester (7.27 g, 31 mmol) was added within 0.5 h. Finally, this mixture 

was stirred and refluxed for 2 h. The reaction mixture was cooled to 

a60 C and infused into 200 ml distilled water. The mixture was 

carried out at 80 C for 2 h. The resulting hot suspension was 

filtered and filter cake was washed with 35 ml of hot isopropyl 

alcohol and than with hot water to neutral washings. The filter cake 

was suspended into methanol. The suspension was heated to 

boiling and refluxed 0.5 h. The hot suspension was filtered, washed 

with methanol and dried. Yield: 6.66 g (54%). 

Calculated: C(79,98), H(4,65), N(7,17). Found C(79,61), H(4,62), 

N(7,07) 


1 

H chemical shifts: 11.37 (2H, br s, NH); (7.54 (1H, d, J ¼ 16.7 Hz); 

7.38 (1H, d, J ¼ 16.7 Hz); 8,53 (4H, m); 7.86 (2H, d), 7.63 (3H, m)) 

signals of Ar–CH ¼ CH–Ar; 7.70 (2H, ortho, ArH); 7.47 (2H, meta, 

ArH), 7.38 (1H, para, ArH) 

13 

C chemical shifts were not determined due to a very low 

solubility of the sample. 

2.2. Instrumental equipment 

The room temperature (DMSO) absorption measurements were 

carried out on a Perkin–Elmer Lambda 9 absorption spectrometer. 

The room temperature (DMSO, MTHF) and low temperature (MTHF, 

S. Luňák Jr. et al. / Dyes and Pigments 85 (2010) 27–36 29 

77 K) fluorescence emission and excitation spectra were measured 

on Perkin Elmer LS 35 fluorescence spectrometer equipped with 

commercial low temperature accessory. 

Thermogravimetric studies (TGA) were performed using TA 

Instruments TGA Q5000 (New Castle, Delaware, USA) device in 

100 ml open platinum pans. The samples, typically 5 mg, were 

heated by thermal ramp of 10 C min 1 from 40 C to 650 Cin 

dynamic nitrogen atmosphere (25 ml min 1 ). Calorimetric analyses 

(DSC) were carried out employing TA Instruments DSC Q200 

calorimeter equipped with external cooler RCS90 allowing experimental 

temperature range from 90 to 500 C. Experiments were 

conducted in open TA TzeroÔ aluminum pans. Thermal history of 

all samples was set up to be the same using of heating ramp of 

3 C min 1 from 40 Cto 90 C and then 10 C/min 1 to the 

temperature determined by TGA as Ts (Table 2). All DSC experiments 

were made under 50 ml min 1 nitrogen purge. Before 

analyses device was calibrated for temperature and enthalpy using 

indium, tin and zinc standards (Perkin Elmer, Waltham, Massachussets, 

USA). All the records were assessed by TA Universal 

Analysis 2000 software version 4.4A. 

The equipment for other analytical measurements and the 

analytical procedures are the same as described in Ref. [1]. 

2.3. Computational procedures 

The geometry of all eleven compounds was optimized using 

quantum chemical calculations based on DFT. Hybrid threeparameter 

B3LYP functional [13] in combination with 

6-311G(d,p) basis was used. No constraints were preliminary 

employed, but, if the non-constrainted computations converged 

to symmetrical structures, the final computations were carried 

out with these symmetry constraints. No imaginary frequencies 

were found after diagonalization of Hessian matrix, confirming 

that the computed geometries were real minima on the ground 

state hypersurfaces. 

The TD DFT method was used for a computation of vertical 

excitation energies on the computed geometry. The same 

exchange-correlation functional (B3LYP) was used with rather 

broader basis set (6-311 þ G(2d,p)) particularly efficient for TD 

modeling of organic dyes [14]. Solvent effect of dimethylsulfoxide 

(DMSO) was involved by non-equilibrium PCM [15]. 

All the methods were taken from Gaussian03W program suite 

[16], and the default values of computational parameters were 

used. The results were analyzed using GaussViewW from Gaussian 

Inc., too. 

Table 2 

Experimental absorption and fluorescence excitation and emission maxima and 

sublimation temperatures Ts determined by TGA. 

Comp. Absorption Fluorescence Ts [ C] 

DMSO (20 C) MTHF (77 K) 

labs 3max lem lex lem 

BPPB 505 34200 517 512 515 383 

2NPP2N 529 30400 547 – – 463 

2NPPB 517 37200 534 523 527 372 

1NPP1N 471 7900 567 498 527 278 

1NPPB 493 21500 558 503 511 347 

BiPPBi 535 17300 549 – – 477 

BiPPB 520 40100 535 526 531 415 

StPPSt 565 33600 578 – – ?410 

StPPB 535 44300 554 548 550 ?428 

labs, absorption maximum [nm]; lex, excitation maximum [nm]; lem, emission 

maximum [nm]; 3max, molar absorptivity [l mol 1 cm 1 ], values in italics come from 

insufficiently soluble compounds.

30 


3.1. Syntheses and sublimation 

The symmetrical derivatives were synthesized from diisopropyl 

succinate and corresponding aromatic nitrile. The synthesis of 

unsymmetrical derivatives was carried out from ethyl 4,5-dihydro- 

5-oxo-2-phenyl(1H)pyrrole-3-carboxylate (phenyl-pyrrolinone 

ester) and corresponding aromatic nitrile (Scheme 1 for BiPPB), 


Scheme 1. 

except 2NPPB, which was synthesized from ethyl 4,5-dihydro-5oxo-2-(2-naphthyl)-(1H)pyrrole-3-carboxylate(2-naphthyl-pyrrolinone 

ester) and benzonitrile (Scheme 2). The reaction yields were 

usually over 50%. The purity of the compounds was checked by 

elemental analysis, 1 H NMR and mass spectroscopy. For details of 

the syntheses and analytics see Experimental. 

Synthesized compounds were characterized by sublimation 

temperature Ts (Table 2) determined by thermogravimetry (TGA). 

In fact, the temperature Ts stands for the temperature at which

mass loss starts; kinetics of sublimation is very slow and thus 

progressive increase in temperature causes later the degradation of 

the sample. The char which could be seen at the end of the TGA 

experiment typically reached from 10 to 40% of original sample 

mass. Experiments carried out using differential scanning calorimetry 

(DSC) revealed no phase transitions within 90 C and Ts. 

TGA of StPPB and especially StPPSt show the slowest kinetics of 

a sublimation process, for which Ts was determined only tentatively 

(Table 2). 

The synthesized compounds are pigments highly insoluble in 

common solvents, except 1NPPB and especially 1NPP1N. The 

unsymmetrical pigments (BiPPB, 2NPPB and StPPB) are slightly 

better soluble than the corresponding symmetrical ones (BiPPBi, 

2NPP2N and StPPSt). 

3.2. DFT ground state geometry and energy 

The restricted B3LYP calculations resulted in a strictly planar 

geometry for BPPB and thus C2h symmetry [1]. The dihedral angle 

between phenyl and pyrrolinone rings in unsymmetrical biphenyl 

substituted compound BiPPB was also near to zero, while between 

both phenyls it was about 38 . The same angle between phenyls in 

biphenyl moiety was found for both rotamers (C2, Ci) ofBiPPBi, 

which differ by a mutual orientation of rotated terminal phenyl 

rings. The ground state energy of Ci rotamer is negligibly higher 

(Table 3). 

Two (three) minima of energy were found for 2NPPB (2NPP2N), 

all of them corresponding to planar geometry (Fig. 1). The most 

stable rotamers are 2NPP2N (180–180) and 2NPPB (0–180), but the 

energy differences are marginal (Table 3) as the steric interaction in 

all two (three) rotamers is almost the same. 

The situation for 1-naphthyl substituted DPPs is different. They are 

non-planar, as both 1-naphthyl and phenyl are always rotated out 

from a plane of central heterocycle. Such rotation of phenyl ring of 

1NPPB, induced by the rotation of 1-naphthyl bonded to the opposite 

ring of a central heterocycle, is analogical to the case of N-monoalkylated 

BPPB [10]. If planar, there should exist two (three) minima 

for 1NPPB (1NPP1N) by analogy with 2-naphthyl conformers, 

differing in this case by a steric interaction of a naphthalene ring 


Scheme 2. 

Table 3 

DFT computed relative ground state energy and PCM TD DFT computed excitation 

energies (converted to lmax [nm]) and oscillator strengths (fosc) in DMSO. 

Compound Symmetry Dihedral 

angles a 

Relative 

internal 

energy b 

S0 / S1 

transition 

characteristics 

lmax fosc 

BPPB C2h 0–0 – 494 0.641 

2NPP2N C2h 0–0 0.21 523 1.156 

Cs 0–180 0.15 534 0.952 

C2h 180–180 0.00 542 0.840 

2NPPB Cs 0–0 0.09 509 0.886 

Cs 0–180 0.00 519 0.718 

1NPP1N Ci 134–134 12.85 493 0.584 

C2 136–136 12.12 497 0.599 

C1 28–135 11.46 516 0.666 

C1 29–136 10.95 513 0.679 

Ci 29–29 10.29 537 0.755 

C2 29–29 9.64 532 0.767 

1NPPB C1 7–136 6.19 495 0.611 

C1 7–29 4.87 515 0.703 

BiPPBi Ci 0–0 0.01 531 1.168 

C2 0–0 0.00 531 1.170 

BiPPB C1 0–0 – 513 0.894 

StPPSt C2h 0–0 0.15 600 2.012 

Cs 0–180 0.12 601 1.959 

C2h 180–180 0.00 601 1.923 

StPPB Cs 0–0 0.06 550 1.355 

Cs 0–180 0.00 550 1.296 

PePPPe C2h 0–0 1.89 574 1.402 

Cs 0–180 0.89 588 1.128 

C2h 180–180 0.00 598 0.974 

PePPB Cs 0–0 0.90 534 1.016 

Cs 0–180 0.00 547 0.789 

a The first value is the dihedral angle between phenyl and pyrrolinone, the second 

is between non-phenyl aryl and pyrrolinone for unsymmetrical derivatives. 

b Relative to the bolded energy of most stable isomer [kcal. mol 1 ].

32 

non-bonded to pyrrolinone ring with either N–H or C]O group. 

Furthermore, each of them can theoretically exist in two rotameric 

forms differing by a mutual sense of aryl rotations. In summary, 4 (6) 

minima should exist for 1NPPB (1NPP1N). 

Only two of the theoretical four minima were found for 1NPPB, 

showing the naphthyl-pyrrolinone dihedral angle 29 (136 ) and 

phenyl-pyrrolinone angle 7 in both cases. Even if the starting 

geometry favoured the rotamer with opposite sense of phenyl 

rotation (173–136, 173–29), the geometry converged to the above 


Fig. 1. Rotamers of 2NPP2N, 1NPP1N, StPPSt and PePPPe. 

mentioned ones (7–136, 7–29). The energy difference is not 

negligible in this case: the 1NPPB (7–136) is 1.32 kcal/mol higher in 

energy than 1NPPB (7–29), so the steric interaction in an 

arrangement, where the naphthalene ring non-bonded to pyrrolinone 

is closer to carbonyl group, is more pronounced. 

All six possible rotamers of 1NPP1N were found as the local 

minima at this level of calculation. Three rotamers with the same 

sense of aryl rotations corresponding to Ci symmetry for (29–29) 

and (134–134) dihedral angle sets are shown in Fig. 1, too. The

energy difference between the pair of rotamers with opposite sense 

of aryl rotations is low (less than 1 kcal mol 1 ), preferring C2 

symmetry. The energy difference among three rotamers differing 

by a mutual orientation of naphthalene with respect to carbonyl 

group are more pronounced: (29–136) and C2 (136–136) rotamers 

are higher in energy with respect to the most stable one C2 (29–29) 

for 1.31 kcal mol 1 and 2.48 kcal mol 1 , respectively. 

Generally, any rotamer of 2-naphthyl derivatives is always more 

stable than the most stable 1-naphthyl isomer. The differences 

between the most stable ones are 4.87 kcal mol 1 between 1NPPB 

(7–29) and 2NPPB (0–180), and 9.64 kcal mol 1 between 1NPP1N 

(C2 (29–29)) and 2NPP2N (180–180). 

Stilbenyl derivatives (only trans arrangement was taken into 

account) are completely planar by theory, so as the styryl ones 

(Fig. 1). The former ones evoke the 2-naphthyl DPPs with 

a marginal differences of the ground state energy between all 

rotamers, while the latter ones are closer to 1-naphthyl DPPs with 

indispensable differences among the rotamers’ energies (Table 3). 

The experimental X-ray structures are available only for BPPB 

[4] and BiPPBi [5]. The computed geometry of both compounds 

well predicts aromatic character of phenyl rings and bond lengths 

alternation in diketo-pyrrolo-pyrrole moiety. The main difference 

between computed geometry and that obtained from X-ray 

diffraction on crystals is in planarity. According to X-ray diffraction 

the pendant phenyl groups on both compounds are twisted with 

respect to the heterocycle plane. The dihedral angle is reported to 

be equal to 7 for BPPB [4] and the molecule is of Ci symmetry in 

crystal. The dihedral angle phenyl-pyrrolinone is 18–19 for BiPPBi, 

the phenyl–phenyl one is 33 and the molecule is of C1 symmetry in 

crystal, because the Ci symmetry is slightly distored through a nonplanarity 

(4 ) on central dipyrrolinone heterocycle. 

We have discussed the non-planarity of further DPP pigments, 

whose X-ray structures are available, in our previous study [1] and 

ascribed the non-zero dihedral angles between phenyl and pyrrolinone 

planes to packing effects in crystal phase. The phenyl– 

phenyl dihedral angle in biphenyl moiety is less important for 

a good prediction of spectral behaviour, so the difference about 5 

between computed and experimental values is acceptable. 

3.3. PCM TD DFT vertical excitation energies in DMSO 

The vertical excitation energies of the lowest electronic transition 

recomputed to wavelengths (lmax) and oscillator strengths (fosc)ofall 

the compounds computed using PCM TD DFT (B3LYP/6- 

311 þ G(2d,p)) on B3LYP/6-311G(d,p) geometry in dimethylsulfoxide 

(DMSO) are summarized in Table 3. Table S1 in Supplementary 

information contains the computed spectral characteristics of four 

lowest S0 / Sn transitions. The lowest excited state is always of 

S1(pp * ) character, and the transition S0 / S1 is symmetry allowed of 

HOMO / LUMO type, significantly (always more than 90 nm) 

separated from the nearest forbidden state (either on carbonyl 

localized np * or HOMO / LUMO þ 1delocalizedpp * ). 

The difference in lmax and fosc between C2 and Ci rotamers of 

BiPPBi is negligible for the first three transitions. Each phenyl 

substitution brings the same bathochromic shift of S0 / S1 transition 

(19 nm), when going from BPPB through BiPPB to BiPPBi, 

accompanied by almost linear hyperchromic shift (Table 3). On the 

other hand the energies of S0 / S1 transition of 2-naphthyl 

derivatives depends on a rotamer type strongly. The increment in 

predicted lmax values is about 10 nm per one naphthyl rotation, the 

most bathochromically shifted rotamers are 2NPP2N (180–180) 

and 2NPPB (0–180). Rather surprisingly, this bathochromic trend 

among the rotamers is accompanied by the hypochromic one. 

Bathochromic and hyperchromic shift is also linear when going 

from BPPB through 2NPPB to 2NPP2N and the rotamers with 


corresponding arrangement of 2-naphthyl substituent with respect 

to pyrrolinone are taken into account: e.g. the increment in lmax is 

15 nm for an arrangement with dihedral angles equal to 0 and the 

values of fosc are almost the same as for biphenylyl set. 

The rotamers in stilbenyl set show marginal differences of lmax 

values and moderate ones for fosc. On the other hand the styryl 

derivatives resemble the 2-naphthyl set; the dependence of these 

spectral features on a rotameric arrangement is even more 

pronounced, including the coupled batho and hypochromic trends 

among the rotamers. Generally, any increase of a conjugated 

system of pendant aryls leads to bathochromic shift with respect to 

parent BPPB for planar DPPs. The most efficient is stilbene, followed 

closely by styryl. The position of biphenyl and 2-naphthyl in 

this sequence depends on a rotameric form of 2-naphthyl DPPs. The 

S0 / S1 transition energies of unsymmetrical derivatives lie 

approximately in the middle of the interval between the corresponding 

values of symmetrical analogues and BPPB, oscillator 

strengths are close to their arithmetic mean. 

The excitation energies predicted for 1-naphthyl derivatives are 

strongly dependent on a degree of non-planarity. The position of 

lmax covers a wide range from the values close to the parent BPPB 

for the most distored rotamers to the values similar as for their 

planar 2-naphthyl isomers. Rather surprisingly, fosc depends on 

a geometry only moderately, probably because the hyperchromic 

trend, caused by an increase of conjugated system, is compensated 

by a hypochromic trend, resulting from a planarity perturbation. 

3.4. Experimental absorption and fluorescence excitation spectra 

All compounds, except 1NPP1N and 1NPPB, show very limited 

solubility even in DMSO at room temperature. The worst soluble 

compounds are BiPPBi, 2NPP2N and StPPSt, all showing the 

spectral artefacts. The spectrum of 2NPP2N (and BiPPBi, too) 

shows a long wavelength tailing caused by a light scattering of the 

unsoluted particles of a pigment. The spectrum of StPPSt has 

furthermore a long wavelength spectral band at 612 nm, that can be 

probably attributed to dimer or higher aggregate (Fig. 2). Both types 

of spectral artefacts are not detected in fluorescence excitation 

spectra of these compounds. Other derivatives are better soluble 

and a complete agreement between absorption and fluorescence 

excitation is observed. 

The absorption spectra of all compounds except 1NPP1N and 

1NPPB (Fig. 3) show the spectral shape very similar to parent BPPB. 

Their vibronic structure, well resolved even in DMSO at room 

temperature, enables the identification of 0–0 vibronic sub-band, 

that can be compared with the theoretical value. This sub-band 

Relative intensity (-) 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

300 350 400 450 500 550 600 650 700 750 800 

(nm) 

2NPP2N 

StPPSt 

Fig. 2. The room temperature absorption spectra of DMSO solutions of StPPSt and 

2NPP2N.

34 

(l.cm-1.mol-1) 

forms also an absolute spectral maximum. All compounds fluoresce 

in DMSO, showing approximately a mirror symmetry relation 

between excitation and emission. The wavelengths of absorption 

and emission 0–0 vibronic sub-bands are summarized in Table 2. 

Stokes shift lies between 10 and 20 nm. The vibronic structure is 

further sharpened in low temperature (77 K) 2-methyl-tetrahydrofuran 

(MTHF) glass, at which the fluorescence emission and 

excitation spectra were measured. The typical behaviour is shown 

in Fig. 4 for StPPB. The excitation maxima are shifted bathochromically, 

as MTHF glass is even more polar environment than 

DMSO solution [17], and the emission maxima hypsochromically, as 

the excited state relaxation processes are limited in rigid glass. 

Finally, Stokes shift is decreased to 2–5 nm (Table 2). BiPPBi, 

2NPP2N and StPPSt were not sufficiently soluble in MTHF even at 

concentrations lower than 10 6 M to measure their low temperature 

fluorescence emission and excitation spectra. 

1-Naphthyl derivatives show partially (1NPPB) or fully 

(1NPP1N) blurred vibronic structure (Fig. 3) in DMSO, as a consequence 

of non-planarity, so an identification of 0–0 vibronic transition 

is difficult, especially for 1NPP1N. Their low temperature 

fluorescence excitation spectra show quite well resolved vibronic 

structure for 1NPPB (Fig. 5) and rather worse resolution for 

1NPP1N (Fig. 6). Evolution of the spectra when going from room to 

low temperature may be considered as an evidence, that the 

absolute spectral maximum corresponds to 0–0 vibronic transition 

for 1NPPB and probably to 0–1 transition for 1NPP1N. 

If we do not consider both non-planar 1-naphthyl DPPs for this 

moment, we can see several clear trends. Larger conjugated system 

of an aryl substituent causes a bathochromic shift; labs of unsymmetrical 

derivative is exactly an arithmetic mean of parent BPPB and 


35000.0 

30000.0 

25000.0 

20000.0 

15000.0 

10000.0 

5000.0 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

300 350 400 450 500 550 600 

(nm) 

0.0 

350 400 450 500 550 600 650 700 750 

(nm) 

BPPB 

1NPP1N 

1NPPB 

Fig. 3. The room temperature absorption spectra of DMSO solutions of BPPB, 1NPPB 

and 1NPP1N. 

Abs. 300K 

Fl.300K 

Ex.77K 

Fl. 77K 

Fig. 4. The room temperature absorption and fluorescence (DMSO) and low temperature 

(MTHF) fluorescence emission and excitation spectra of StPPB. 



0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

350 400 450 500 550 600 650 700 750 

(nm) 

Abs.300K 

Fl.300K 

Ex.77K 

Fl. 77K 

Fig. 5. The room temperature absorption and fluorescence emission and low 

temperature fluorescence emission and excitation spectra of 1NPPB in MTHF. 

corresponding symmetrical derivative as predicted by theory. When 

going from BPPB to all three unsymmetrical derivatives, a hyperchromic 

shift is observed, also in a qualitative agreement with 

computational results. But molar absorptivities of all three 

symmetrical derivatives are lower than those ones of corresponding 

unsymmetrical ones, on the contrary to the theoretical results, predicting 

approximately linear increase. The main reason for this 

discrepancy is an extremal insolubility of symmetrical pigments, 

making impossible a correct estimation of 3max. The difference in 

3max values between BPPB and BiPPB is 5900 l mol 1 cm 1 ,sothe 

similar value should be expected according to theoretical predictions 

between BiPPB and BiPPBi. Thus3max value of BiPPBi, extrapolated 

from better soluble BPPB and BiPPB, is46000lmol 1 cm 1 ,while 

the experimental one is 17 300 l mol 1 cm 1 .Thevalueof2NPP2N of 

3max is also lower (30 400 l mol 1 cm 1 ) than the one derived by 

extrapolation from BPPB and 2NPPB (40 200 l mol 1 cm 1 ), 

although the difference is not so dramatic as for biphenylyl set. The 

same type of inconsistency between the value (54 400 l mol 1 cm 1 ) 

extrapolated from BPPB and StPPB and experimental (33 

600 l mol 1 cm 1 ) one for StPPSt is observed, too, from the same 

reasons. 

There is quite a good agreement between computed and 

experimental maxima for BPPB, BiPPB and BiPPBi, for which 

either there is only one possible geometry or both rotamers give the 

same theoretical lmax. The experimental maxima are always at 

rather longer wavelengths, but the differences are acceptable 

(11 nm, 7 nm and 4 nm). The situation seems to be similar to that 

one described in Ref. [1]: the para substituted derivatives of BPPB 

are computed rather better than the parent chromophore itself. 


0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

350 400 450 500 550 600 650 700 750 

(nm) 

Abs.300K 

Fl.300K 

Ex.77K 

Fl.77K 

Fig. 6. The room temperature absorption and fluorescence emission and low 

temperature fluorescence emission and excitation spectra of 1NPP1N in MTHF.


0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0.0 

350 400 450 500 550 600 650 700 750 

(nm) 

Ex.300K 

Fl.300K 

EX.77K 

Fl.77K 

Fig. 7. The room and low temperature fluorescence emission and excitation spectra of 

2NPPB in MTHF. 

No dependence of the fluorescence emission spectrum on the 

excitation wavelength (and opposite) was observed for any sample, 

either at room or low temperature. As the difference in absorption 

maxima of rotamers of 2-naphthyl derivatives should be about 

10 nm, a similar value as experimentally obtained for rotamers of 2naphthyl-ethylenes, 

we can conclude, that only one rotamer of 

2NPPB and 2NPP2N is present in solution [18], although their 

ground state energy is almost the same. Furthermore, a mixture of 

spectrally shifted rotamers could hardly produce the spectra with 

such sharp vibronic structure as shown in Fig. 7. Thus the question 

arises, whether the rotamer present in solution can be estimated by 

a comparison of the experimental and theoretical lmax. The 

experimental values are closer for 2NPPB (0–0) rotamer and lie 

between 2NPP2N (0–0) and 2NPP2N (0–180) rotamers. Thus, if we 

suppose, that the same orientation of naphthalene ring is preferred 

in both compounds, the rotamers characterized by dihedral angle 

equal to 0 (Fig. 1) can be concluded as more probable. This 

assignment is also consistent with a comparison of 2NPPB (0–0) 

with BiPPB: the difference in lmax is 4 (3) nm by theory (experiment) 

and 3max are very close as predicted. 

On the contrary to 2-naphthyl and biphenylyl derivatives the 

experimental absorption maxima of stilbenyl ones are considerably 

blue shifted with respect to the theoretical values. Furthermore, 

molar absorptivity of StPPB is only a bit higher than for BiPPB, 

although the theoretical prediction supposes a higher value of 3max. 

We consider two sources of this discrepancy. First, trans-stilbene, 

although planar in crystal [19] and by high level quantum chemical 

calculations [20], is often considered as non-planar in solution with 

both phenyls partially rotated out-of-plane [21]. Such rotation 

could cause a considerable hypsochromic and hypochromic shift, if 

present in StPPB and StPPSt. Second, both stilbenyl derivatives 

show the longest conjugated chain in one direction, that can be 

a problem for TD DFT method, because of its known incorrect 

asymptotic behaviour with respect to the long distance between 

charges [22]. Both these effect can be less significant in styryl 

derivatives PePPB and PePPPe, so it is possible, that they could be 

experimentally bathochromically shifted with respect to stilbenyl 

analogues, although the theory predicts the opposite relation. Thus 

it is desirable to find a synthetic alternative for them [6]. 

The most controversial results were obtained for non-planar 

well soluble 1-naphthyl derivatives. They show significantly higher 

Stokes shift in DMSO, dramatically decreased in MTHF glass, mainly 

as a consequence of limited ability of excited state geometrical 

relaxation in rigid environment. The experimental values of 3max 

are significantly decreased with respect to parent chromophore or 

to 2-naphthyl isomers as qualitatively expected for the lost 

planarity, but not quantitatively predicted by TD DFT. Furthermore, 


the value extrapolated from BPPB and 1NPPB (8800 l mol 1 cm 1 ) 

is close to the experimental one (7900 l mol 1 cm 1 ) for 1NPP1N, 

that is only qualitatively in accordance with theory and only for the 

most distored rotamer set, e.g. BPPB / 1NPPB (7–136) / 

1NPP1N (Ci, 134–134). Even if we take into account, that the 

absorption maximum of 1NPP1N corresponds to 0–1 vibronic 

transition, experimental lmax of both 1-naphthyl derivatives show 

a hypsochromic shift with respect to parent BPPB on the contrary 

to the theoretical predictions for any rotamer. Simply said, the 

computations underestimate the excitation energies and overestimate 

the probability of spectral transitions. We do think, that 

the explanation of this discrepancy comes from the underestimation 

of dihedral angles by DFT calculations of the ground state 

geometry. The synthesis of further non-planar symmetrical and 

unsymmetrical till unknown DPPs, with N-heteroaryles coming 

from 4-cyano-quinoline and 1-cyano-isoquinoline, is now in 

progress. Thus, we return to the detailed discussion of 1-naphthyl 

DPPs with similar steric hindrance after collecting more experimental 

data from their N-heteroanalogues. 


The effect of a size of a conjugation system of aryl substituents 

on the absorption spectra of diketo-pyrrolo-pyrroles was studied. 

Two new unsymmetrical derivatives were synthesized in order to 

complete the investigated set. PCM TD DFT calculations predict 

a linear increase of both lmax and 3max with a substitution of each 

phenyl in parent BPPB by larger aryl for planar derivatives. Qualitatively, 

the experimental bathochromic shifts of 0–0 vibronic subbands 

are in exact agreement with theory, while the hyperchromic 

shifts are affected by extremally low solubility of planar symmetrical 

derivatives. Quantitatively, the theory only slightly overestimates 

the excitation energies in this case. The deviations from 

this ideal behaviour were observed for non-planar derivatives 

(aryl ¼ stilbenyl or 1-naphthyl), for which the dihedral angles 

describing the aryl out-of-plane torsions are probably underestimated 

by DFT. 

Acknowledgments 

Authors acknowledge the support of the grant project No. 

2A-1TP1/041 sponsored by the Ministry of Trade and Industry of 

the Czech Republic. 

Appendix. Supplementary information 

Supplementary data associated with this article can be found, in 

the online version, at doi:10.1016/j.dyepig.2009.09.014. 

References 

[1] Luňák Jr S, Vyňuchal J, Vala M, Havel L, Hrdina R. The syntheses, absorption 

and fluorescence of polar diketo-pyrrolo-pyrroles. Dyes Pigments 2009; 

82:102–8. 

[2] Iqbal A, Cassar L. EP 98808 (Ciba-Geigy, 1982). 

[3] Herbst M, Hunger K. Industrial organic pigments. Weinheim: VCH; 1993. 

[4] Mizuguchi J, Rihs G. Electronic-spectra of 1,4-diketo-3,6-diphenyl-pyrrolo-[3,4-c]-pyrrole 

in the solid-state. Ber Bunsenges Phys Chem 1992;96(4): 

597–606. 

[5] Mizuguchi J, Miyazaki T. Crystal structure of 3,6-bis(4-biphenylyl)pyrrolo[3,4c]pyrrole-1,4-dione, 

C 30 H20N2O2. Z Krystallogr – New Cryst Struct 

2002;217:43–4. 

[6] Morton CJH, Gilmour R, Smith DM, Lightfoot P, Slawin AMZ, MacLean EJ. 

Synthetic studies related to diketopyrrolopyrrole (DPP) pigments. Part 1: the 

search for alkenyl DPPs. Unsaturated nitriles in standard DPP syntheses: 

a novel cyclopenta[c]pyrrolone chromophore. Tetrahedron 2002;58:5547–65. 

[7] Iqbal A, Kirchmayr R, Pfenninger J, Rochat AC, Wallquist O. The synthesis and 

properties of 1,4-diketo-pyrrolo[3,4-c]pyrroles. Bull Soc Chimi Belges 

1988;97(8–9):615–43.

36 

[8] Adachi A, Nakamura S. Absorption spectrum shift in the solid state. A MO 

study of pyrrolopyrrole pigment. J Phys Chem 1994;98:1796–801. 

[9] Wallquist O. In: Smith HM, editor. High performance pigments. Weinheim: 

Wiley-VCH; 2002. p. 159–84. 

[10] Vala M, Weiter M, Vyňuchal J, Toman P, Luňák Jr S. Comparative studies of 


J Fluoresc 2008;18(6):1181–6. 

[11] Vyňuchal J, Luňák Jr S, Hatlapatková A, Hrdina R, Lyčka A, Havel L, et al. The 

synthesis, absorption, fluorescence and photoisomerisation of 2-aryl-4-arylmethylidene-pyrroline-5-ones. 

Dyes Pigments 2008;77(2):266–76. 

[12] Wang L, Li H, Li P. Task-specific ionic liquid as base, ligand and reaction medium 

for the palladium-catalyzed Heck reaction. Tetrahedron 2009;65(1):364–8. 

[13] Becke AD. Density-functional thermochemistry. III. The role of exact exchange. 

J Chem Phys 1993;98:5648–52. 

[14] Jacquemin D, Perpète EA, Ciofini I, Adamo C. Accurate simulation of optical 

properties in dyes. Acc Chem Res 2009;42:326–34. 

[15] Tomasi J, Mennucci B, Cammi R. Quantum mechanical continuum solvation 

models. Chem Rev 2005;105:2999–3094. 

[16] Gaussian 03 W, Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, Robb MA, 

Cheeseman JR, Montgomery Jr JA, Vreven T, Kudin KN, Burant JC, Millam JM, 

Iyengar SS, Tomasi J, Barone V, Mennucci B, Cossi M, Scalmani G, Rega N, 

Petersson GA, Nakatsuji H, Hada M, Ehara M, Toyota K, Fukuda R, Hasegawa J, 

Ishida M, Nakajima T, Honda Y, Kitao O, Nakai H, Klene M, Li X, Knox JE, 

Hratchian HP, Cross JB, Bakken V, Adamo C, Jaramillo J, Gomperts R, 


Stratmann RE, Yazyev O, Austin AJ, Cammi R, Pomelli C, Ochterski JW, Ayala PY, 

Morokuma K, Voth GA, Salvador P, Dannenberg JJ, Zakrzewski VG, Dapprich S, 

Daniels AD, Strain MC, Farkas O, Malick DK, Rabuck AD, Raghavachari K, 

Foresman JB, Ortiz JV, Cui Q, Baboul AG, Clifford S, Cioslowski J, Stefanov BB, 

Liu G, Liashenko A, Piskorz P, Komaromi I, Martin RL, Fox DJ, Keith T, 

Al-Laham MA, Peng CY, Nanayakkara A, Challacombe M, Gill PMW, Johnson B, 

Chen W, Wong MW, Gonzalez C, Pople JA. Wallingford, CT: Gaussian, 

Inc.; 2004. 

[17] Zoon PD, Brouwer AM. A push–pull aromatic chromophore with a touch of 

merocyanine. Photochem Photobiol Sci 2009;8:345–53. 

[18] Castel N, Fischer E, Bartocci G, Masetti F, Mazzucato U. Viscosity-induced 

emission anomalies in 1,2-diarylethylenes and distyryl-benzenes and -naphthalenes. 

J Chem Soc Perkin Trans II 1985, 1969–75. 

[19] Bouwstra JA, Schouten A, Kroon J. Structural studies of the system 

trans-azobenzene/trans-stilbene. II. A reinvestigation of the disorder in 

the crystal structure of trans-stilbene, C14H12. Acta Crystallogr C 1984;40: 

428–31. 

[20] Watanabe H, Okamoto Y, Furuya K, Sakamoto A, Tasumi M. Vibrational analysis 

of trans-stilbenes in the ground and excited singlet electronic states 

revisited. J Phys Chem A 2002;106:3318–24. 

[21] Catalán J. On the nonplanarity of trans-stilbene. Chem Phys Lett 

2006;421:134–7. 

[22] Dreuw A, Head-Gordon M. Single-reference ab initio methods for the calculation 

of excited states of large molecules. Chem Rev 2005;102(11):4009–37.

Novel, soluble diphenyl-diketo-pyrrolopyrroles: Experimental 

and theoretical study 

M. Vala a, *, J. Vyňuchal b , P. Toman c , M. Weiter a , S. Luňák Jr. d 

a Faculty of Chemistry, Brno University of Technology, Purkyňova 464/118, CZ-612 00 Brno, Czech Republic 

b Research Institute of Organic Syntheses, Rybitví 296, CZ-533 54 Rybitví, Czech Republic 

c Institute of Macromolecular Chemistry v. v. i., Academy of Sciences of the Czech Republic, Heyrovsky Sq. 2, CZ-162 00 Prague, Czech Republic 

d Faculty of Chemical Technology, University of Pardubice, Studentská 95, CZ-530 09 Pardubice, Czech Republic 

article info 


Received 16 March 2009 


29 July 2009 

Accepted 30 July 2009 

Available online 14 August 2009 

Keywords: 

Diketo-pyrrolo-pyrrole 

DPP 

Photoluminescence 

Fluorescence 

Absorption 


abstract 

Derivatives of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole- 

1,4-dione, commonly referred to as DPPs, constitute an important 

class of high-performance pigments [1–13] (parent molecule I in 

Fig. 1). The compounds are endowed with brilliant shades (ranging 

from yellow-orange to red-violet) and exhibit exceptional resistance 

to chemical, heat, light, and weather. Furthermore, some of 

their physical properties such as high melting points are exceptional 

in view of their very low Mr, in conventional pigment 

molecule terms. It has been shown that DPP units introduced into 

various materials, such as polymers [14–23] dendrimers [24], 

polymer–surfactant complexes [25], and oligomers [26] results in 

deeply coloured, highly photoluminescent [15–26] and electroluminescent 

[19,20] materials. Owing to their interesting properties, 

there is wide range of possible applications which have been 

already investigated covering for example latent pigment [27], 

charge generating materials for laser printers and information 

storage systems [28–33], solid-state dye lasers [30] or gas detectors 

[34,35]. 

* Corresponding author. Tel.: þ420 541 149 411; fax: þ420 541 149 398. 

E-mail address: vala@fch.vutbr.cz (M. Vala). 

0143-7208/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.dyepig.2009.07.014 

Dyes and Pigments 84 (2010) 176–182 




Derivatives of diphenyl-diketo-pyrrolopyrrole, possessing electron-donating or withdrawing groups in 

the p-position of the phenyl, were synthesized and studied using optical characterization (absorption, 

fluorescence, time-resolved fluorescence) and quantum chemical calculation. An increase in absorption 

coefficient 10 5 dm 3 mol 1 cm 1 was observed using electron–donor groups; a bathochromic shift in 

both absorption and luminescence peaks was observed as a result of increased conjugation. Soluble 

derivatives were obtained by the introduction of alkyl groups (by N-alkylation) in the central pyrrolopyrrole 

unit. Calculated phenyl torsion angles using HF and B3LYP methods showed that the loss of 

molecule planarity reduced the extent of overlap between the p-orbitals of the central pyrrolopyrrole 

unit and phenyls after N-alkylation. This treatment thus reduced both the bathochromic shift and 

increased absorption coefficient. The presence of the donor or acceptor groups in itself does not influence 

molecule planarity. 


The key issue for the construction of any device either in the 

form of thin film composed of DPP or incorporation of the DPP unit 

into supporting matrix, is solubility. DPPs are insoluble in the 

majority of common solvents. Whilst this is favourable for many 

applications, the ability to solubilize the compounds would offer 

the possibility of using solution-based techniques (spin-coating, 

drop-casting, inject printing, etc.) to prepare devices from DPPs. 

One reason for their insolubility is the existence of H-bonds 

between the –NH group and oxygen. Since the basic DPP core is 

perfectly planar, p–p electron overlap occurs in the solid state and 

also contributes to their insolubility. These interactions can be so 

strong as to impart colour change between the solid and dissolved 

forms and influence other properties, such as fluorescence and 

Stokes shift [36]. It is therefore clear, that modified solubility can be 

achieved either through N-substitution and/or disruption of 

molecular planarity [8]. 

A previous contribution by the present workers [37] discussed 

the influence of N-alkylation on optical properties and employed 

quantum chemical calculations to correlate the results with molecule 

geometry. In this paper, electron-donating (IV–VIII) or 

accepting (IX, X) groups were introduced at the p-position on the 

phenyl so as to influence the electronic spectra of the compounds. 

Further, some of these derivatives were N-alkylated in order to 

modify their solubility (VII–X). These derivatives were compared

with the parent (I) and N-alkylated (II, III) 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

(Fig. 1). The observed optical 

properties of both, the donor or acceptor substituted only and 

substituted and N-alkylated derivatives are explained according to 

the results obtained by quantum chemical calculations. 


The UV–VIS absorption and photoluminescence spectra were 

recorded in dimethylsufoxide (DMSO) purchased from Aldrich. The 

molar absorption coefficients were calculated from the linear part 

of the concentration dependence of absorption A ¼ f(c) measured in 

5 cm quartz cuvette. The photoluminescence spectra and quantum 

yields (PLQYs) were obtained according to the comparative method 

[38], where for each test sample gradient of integrated fluorescence 

intensity vs. absorbance PL ¼ f(A) is used to calculate the PLQY using 

two known standards. The standards were previously crosscalibrated 

to verify the method. This calibration revealed accuracy 

better than w3%. The photoluminescence lifetime sPL was 

measured using spectrograph and fast ICCD camera. The samples 

were excited by second or third harmonic of Nd:YAG laser (532 or 

355 nm) with light pulse time duration of w30 ps. The temporal 

resolution of the system is approximately 25 ps. 


3.1. Absorption 

The spectral properties of the prepared derivatives are 

compared in Figs. 2 and 3 and summarised in Table 1. The Influence 

of N-substitution on the parent derivative I on absorption is 

depicted in Fig. 2a. It can be seen, that insertion of an alkyl group 

decreases molar absorption coefficient (hypochromic shift) and 

simultaneously the longer wavelength maximum is shifted towards 

higher energy region (hypsochromic shift). Furthermore, the 

vibration structure is less pronounced. As was pointed out in our 

previous paper [37], this is caused by torsion between pyrrolinone 

central part and phenyl adjacent to the alkyl group and consequently, 

is caused by loss of molecule planarity which is in turn 

responsible for loss of effective conjugation. Since the addition of 

second alkyl rotates also the second phenyl group, this effect is even 

M. Vala et al. / Dyes and Pigments 84 (2010) 176–182 177 

Fig. 1. The basic structure of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (I), also known as DPP and the respective derivatives used in this study. The definition of 

calculated torsion angles a and b. 

more pronounced. The loss of vibration structure can be attributed 

to the increased dipole moment interacting with polar DMSO 

solvent [39]. The dipole–dipole interaction of bi-substituted 

derivatives with the completely non-planar structure is the most 

pronounced. No dependency on the length of the alkyl used was 

found in our previous work [37]. 

Introduction of electron-donating groups has significant effect 

on the DPP absorption [40]. Increase of the absorption coefficient 

from 3 ¼ 3.4 10 4 dm 3 mol 1 cm 1 of the parent compound I to 

3 ¼ 1.3 10 5 dm 3 mol 1 cm 1 for compound V bi-substituted by 

N,N-dimethylamin in p-position on phenyls, accompanied with 

strong bathochromic shift (up to 55 nm), was observed (Fig. 2b). 

This behaviour implies that charge separation occurs via electron 

delocalization leading to creation of permanent dipole moment. 

Therefore, the central part composed of H-chromophores behaves 

as an electron-accepting group. Blurring of vibration structure in 

case of the mono-substituted derivative (IV) was observed, 

whereas for the bi-substituted (V) was not. We explain this finding 

by the fact that due to symmetry of the bi-substituted derivative is 

its resulting dipole moment smaller than for the mono-substituted 

asymmetric derivative. 

Similar increase of the absorption coefficient 3 value and change 

of the peak position was achieved using piperidine group (VI) 

(Fig. 2c). For this derivative, we studied also the impact of 

N-alkylation. Introduction of one alkyl (VII) decreased the 3 only 

slightly. After addition of second alkyl (VIII) we observed almost 

the same value as for the parent molecule (I). This was accompanied 

by the hypsochromic shift and blurring of the vibration 

structure. We propose the same mechanism as for the N-alkylated 

only derivatives: the N-alkylation causes rotation of the phenyls 

and consequently breaks the molecule symmetry and hence the 

effective conjugation and increases the polarity. 

To describe the influence of groups with the electron-withdrawing 

character, derivatives with the halogen element (chloride) 

were prepared. Since the aim was to prepare soluble derivatives we 

will discuss the alkylated only derivatives. Fig. 2d compares the 

observed absorption coefficients 3. The introduction of the chloride 

did not caused increase of 3. This is further evidence for the electron-accepting 

character of the central part. For the alkylated 

derivatives we observed hypso- and hypochromic shift with the 

loss of vibration structure again.

178 

a b 

(dm 3 mol -1 cm -1 ) 

4x10 4 

2x10 4 

1x10 5 

5x10 4 

I 

II 

III 

0 

300 400 500 600 

wavelength (nm) 

2x10 5 c d 

(dm 3 mol -1 cm -1 ) 

I 

VI 

VII 

VIII 

0 

300 400 500 600 


(dm 3 mol -1 cm -1 ) 

(dm 3 mol -1 cm -1 ) 

2x10 5 

1x10 5 

5x10 4 

4x10 4 

2x10 4 

I 

IV 

V 

0 

300 400 500 600 


I 

IX 

X 

0 

300 400 500 600 


Fig. 2. The influence of N-alkyl substitution (a), and various donor (b, c) and acceptor (d) groups on the DPP central part on molar absorption coefficient. 

a 1,0 

b 

0,8 

I 

II 

PL 

0,6 

0,4 

0,2 

0,0 

0,6 

0,4 

0,2 

0,0 

500 600 700 


500 600 700 


1,0 

0,8 

0,6 

0,4 

0,2 

0,0 

c 1,0 

d 1,0 

0,8 

I 

VI 

0,8 

PL 

M. Vala et al. / Dyes and Pigments 84 (2010) 176–182 

III 

VII 

VIII 

PL 

PL 

0,6 

0,4 

0,2 

0,0 

500 600 700 


500 600 700 


Fig. 3. Comparison of photoluminescence spectra scaled using the PL quantum yields (PLQY$PL/PLmax) of N-alkylated (a), donor (b, c) and acceptor (d) substituted DPP derivatives. 

I 

IV 

V 

I 

IX 

X

Table 1 

Experimental values for molar absorption coefficient 3, position of absorption lAbs 

and luminescence lPL peak maximums, Stokes shift DlStokes, and photoluminescence 

quantum yield PLQY and lifetime sPL of the prepared DPPs in dimethylsulfoxide. 

3 

(dm 3 mol 1 cm 1 ) 

3.2. Photoluminescence 

lAbs 

(nm) 

lPL 

(nm) 

DlStokes 

(nm) 

PLQY 

( ) 

sPL 

(ns) 

I 34 300 507 519 12 0.74 6.21 

II 21 300 493 525 32 0.69 6.67 

III 18 500 467 530 63 0.69 6.57 

IV 86 500 544 580 36 0.49 2.88 

V 126 000 562 580 18 0.57 3.46 

VI 108 000 562 582 20 0.58 3.66 

VII 100 600 553 592 39 0.42 3.38 

VIII 42 400 536 599 63 0.41 3.37 

IX 36 000 501 534 33 0.60 6.79 

X 24 500 473 538 65 0.51 6.63 

The photoluminescence (PL) spectra are compared in Fig. 3. The 

PL intensity is recalculated using PL quantum yield (PLQY): the 

measured spectra were normalised to its maximum and multiplied 

by PL quantum yield (PL ¼ PLQY$PLl/PLMax). After this transformation, 

the heights of the curves give direct evidence of the 

efficiency of the light emission similarly to the 3 in the case of light 

absorption. 

For the N-alkylated derivatives, we found practically the same 

PLQY in the accuracy range of the method. The Stokes shift was 

increased from 12 nm for the parent derivative to 32 nm and 63 nm 

for the monoalkylated and dialkylated derivatives, respectively. The 

observed spectra (Fig. 3a) were characteristic by graduate loss of 

mirror symmetry of absorption-fluorescence and vibronic structure. 

As was pointed out, the phenyl torsion due to the N-alkylation 

is the main mechanism for this behaviour in polar DMSO. 

Fig. 3b and c show the influence of electron-donating groups. The 

mono-substituted derivative shows a smaller PLQY compared to 

the di-substituted one. This is in accordance with the values of the 

absorption coefficient 3: the polarity of the mono-substituted 

molecule (IV) is higher compared to the symmetric V and VI. The 

observed Stokes shifts confirm this hypothesis: for the monosubstituted 

IV reaches the value 63 nm whereas for di-substituted V 

and VI is only 18 nm and 20 nm, respectively. The N-alkylation 

causes further decrease of PLQYaccompanied with increasing Stokes 

shift similarly to the N-alkylated only derivatives. The electronwithdrawing 

group (IX and X) causes analogous behaviour (Fig. 3d). 

We also determined fluorescence lifetime sPL of the prepared 

derivatives. Table 1 summarises the obtained results. All of the 

observed fluorescence decays followed first order kinetics, i.e. 

showed monoexponencial decay, see Fig. 4. The N-alkylation only 

Counts 

R i 

10000 

1000 

1 

0 

-1 

0 5 10 

Time (ns) 

15 20 

Fig. 4. Typical photoluminescence decay of DPP (here V) after 30 ps excitation at 

532 nm (on top) with weighted residuals to monoexponential fit (on bottom). 


caused slight increase of the lifetime. As for the PLQY, the lifetime of 

the donor-substituted derivatives decreased relative to the parent I. 

Subsequent alkylation caused further reduction of the observed 

lifetime. The longest lifetime was observed for chlorine substituted 

derivative with broken symmetry (IX). The shortest lifetime was 

observed for the compound IV mono-substituted by N,N-dimethylamin 

in p-position on phenyl. The lifetime of its bi-substituted 

counterpart V was found to be higher. 

3.3. Quantum chemical study 

3.3.1. Methods 

The molecular conformations and absorption and luminescence 

spectra of the synthesized derivatives were characterized by means 

of the quantum chemical methods in order to better understand 

the observed behaviour. 

The molecular conformations were optimized by means of both 

the Hartree-Fock (HF) and the hybrid HF/density functional theory 

method B3LYP [41,42] at the 6–31G* level. The HF method usually 

provides a fairly good description of the ground state molecular 

conformations and is used for a major part of the present-day 

calculations of the electronic properties. The latter method was 

successfully used for the conformation study of many different 

p–conjugated systems [43–45]. Although the B3LYP method 

requires more computational time than the HF method, its 

computational requirements are much lower than demands of other 

‘‘correlated’’ methods. The main difference of the HF and B3LYP 

methods is that usually the former underestimates and the latter 

slightly overestimates the electron delocalization and the degree of 

conjugation in the conjugated molecules. The B3LYP conformations 

are usually close to the conformations either calculated by the 

Møller–Plesset method or obtained experimentally, see e.g. [46–48]. 

First excited states S1 of the studied derivatives were calculated 

using time-dependent B3LYP (TD–B3LYP) method at the optimized 

HF geometry. Time-dependent density functional methods recently 

became an effective and rather accurate tool for single point calculations 

of electronic excitations in various, namely conjugated, 

molecular systems [49–51]. However, this method is not suitable for 

the excited state conformation optimization necessary for luminescence 

spectra calculations. For this reason, relaxed (exciton) 

conformations of the S1 state were optimized by means of ab initio 

configuration interaction method with single-excitation (CIS) 

method. The exciton conformations were subsequently used for the 

luminescence spectra calculations using TD–B3LYP method. 

Keeping the same level of the calculations enabled determination of 

the Stokes shift DEStokes and deformation energy Edef of the relaxed 

exciton state. 

3.3.2. Results 

The calculated molecular parameters of the studied derivatives 

are presented in Table 2. Comparison of the phenyl torsion angles 

calculated by means of HF and B3LYP methods, respectively, shows 

the same trends determined by both methods. The differences in 

absolute values can be explained by the different electron delocalization 

predicted by these methods. The results show that the Nalkylated 

derivatives possess significantly rotated phenyl groups of 

the central DPP unit in the position adjacent to the alkyl, while the 

basic I molecule is completely planar. Phenyl group rotation 

significantly decreases the overlap between p-orbitals of the 

central DPP unit and the respective phenyl. As a result, the frontier 

orbital (HOMO and LUMO) energetic levels are shifted and consequently, 

absorption and luminescence spectra are modified. The 

absorption peak energies ES0/S1 of the N-alkylated derivatives 

show a hypsochromic shift strongly correlated with the phenyl 

torsion angles a and b (for the definition of the angles see Fig. 1).

180 

Table 2 

Phenyl torsion angles calculated by the HF and B3LYP methods. Lowest absorption 

energy ES0/S1, oscillator strength fS0/S1 of this transition, 1st luminescence peak 

Elum, Stokes shift DEStokes, and deformation energy Edef of the relaxed excited state 

calculated by the ab initio CIS method. 

B3LYP 

method 

HF 

method 

Simultaneously, the oscillator strengths of the absorption peaks of 

the molecules IV–VIII are notably higher than that of the basic I 

molecule. On the other hand, the absorption peaks of the molecules 

II, III, and X are reduced. These findings are in a good agreement 

with the experimentally measured molar absorption coefficients 

shown in Fig. 2. The calculated results further show, that Stokes 

shifts DEStokes and deformation energies Edef of the excited state of 

the N-alkylated derivatives are considerably increased. The calculated 

luminescence peak Elum depends only slightly on the phenyl 

torsion angles a and b. 

The substitution of phenyls by donor or acceptor groups has 

almost no influence on the phenyl torsion angles and the molecular 

conformation of the central DPP unit. However, it leads to the 

bathochromic shift of the absorption and luminescence peaks due 

to the increased effective extent of the conjugation. 

3.4. Syntheses and analyses 

ES0/S1 

(eV) 

fS0/S1 Elum 

(eV) 

DEStokes 

(eV) 

Edef 

(eV) 

a ( ) b ( ) a ( ) b ( ) 

I 0.0 0.0 0.0 0.0 2.837 0.49 2.427 0.410 0.339 

II 36.0 6.7 46.9 16.9 2.935 0.40 2.424 0.511 0.437 

III 36.5 36.5 46.1 46.1 3.012 0.37 2.441 0.571 0.482 

IV 0.0 0.0 0.0 0.0 2.691 0.79 2.365 0.327 0.309 

V 0.0 0.0 0.0 0.0 2.640 1.03 2.325 0.315 0.294 

VI 3.1 3.1 10.5 10.5 2.624 1.13 2.293 0.331 0.326 

VII 27.5 6.3 42.6 12.5 2.714 0.95 2.296 0.417 0.394 

VIII 29.7 29.7 41.6 41.6 2.786 0.78 2.262 0.482 0.459 

IX 34.1 6.7 45.7 16.2 2.875 0.49 2.366 0.508 0.439 

X 34.4 34.4 44.9 44.9 2.949 0.43 2.382 0.567 0.483 

The synthesis of the starting ethyl 4,5-dihydro-5-oxo-2-phenyl(1- 

H)pyrrole-3-carboxylate (pyrrolinone ester) was described previously 

[52], as was the syntheses of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4c]pyrrole-1,4-dione 

(I), 3,6-Diphenyl-2-butyl-2,5-dihydro-pyrrolo 

[3,4-c]pyrrole-1,4-dione (II) and 3,6-Diphenyl-2,5-dibutyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

(III) [37]. The 4-fluorobenzonitrile, 

diisopropyl succinate, natrium, tert-amyl alcohol and the 

remaining common solvents were obtained from the Research Institute 

of Organic Syntheses. 

3.4.1. Synthesis of 3-(phenyl)-6-(4-dimethylamino-phenyl)-2, 

5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (IV) 

80 ml of tert-amyl alcohol and 2.8 g (0.12 mol) of sodium metal 

(caution: extremely dangerous and corrosive; highly unstable; 

reacts violently with water; can form flammable hydrogen in 

contact with air.; incompatible with water, oxygen, carbon dioxide, 

carbon tetrachloride, halogens, acetylene, metal halides, ammonium 

salts, oxides, oxidizing agents, acids, alcohols, chlorinated 

organic compounds, many other substances) (in three portions) 

were charged into the 250 ml three-necked flask equipped with 

a magnetic stirrer, a reflux condenser, a thermometer and 

a nitrogen inlet. The sodium metal was dissolved under reflux in 

the presence of a catalytic amount of FeCl3 (approximately 2 h) and 

5.8 g (0.04 mol) of 4-dimethylamino-benzonitrile was added. After 

that, pyrrolinone ester [44] (9.2 g, 0.04 mol) was continuously 

introduced in small portions within 0.5 h. Subsequently, this 

mixture was stirred under reflux for 2 h and the ensuing hot salt 

was filtered. The protolysis was made separately in 120 ml of 2propanol 

and 80 ml of distilled water under reflux for 2 h. The 


product was filtered and the filter cake washed with hot water to 

neutral washings. The filter cake was dried and suspended in 

100 ml of methanol. The suspension was heated to boiling and 

refluxed for 1 h; the ensuing hot suspension was filtered, washed 

with methanol and hot water. Yield: 2 g (30%) of IV compound. 

Calculated: C (72.49), H (5.17), N (12.68). Found: C (71.96), H 

(5.18), N (12.43). MW ¼ 331 Da; Negative-ion APCI-MS: m/z 330 

[M H] (100%). 1 H chemical shifts: chemical shifts were not 

determined due to a very low solubility of the sample. 

3.4.2. Synthesis of 3,6-bis-(4-dimethylamino-phenyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione 

(V) 

182 ml of tert-amyl alcohol and 11.4 g (0.50 mol) of sodium 

metal (in three portions) were charged into the 0.5 dm 3 Keller flask 

equipped with a stirrer, a reflux condenser, a thermometer and 

a nitrogen inlet. The sodium metal was dissolved under the reflux 

in the presence of catalytic amount of FeCl3 (approximately 2 h), 

and 25 g (0.7 mol) of 4-dimethylamino-benzonitrile was added. 

Diisopropyl succinate (16.9 g, 0.08 mol) dissolved in 16.9 g of tertamyl 

alcohol was introduced over 3 h and the mixture stirred at 

reflux for 1 h. The reaction mixture was cooled to 60 C and then 

500 ml of distilled water was added to protolyse the salt. The 

protolysis was carried out at 80 C for 2 h. The resulting hot 

suspension was filtered and the filter cake washed with hot water 

to neutral washings. The filter cake was dried and suspended in 

500 ml of acetone. The suspension was heated to boiling and 

refluxed for 1 h; the hot suspension was filtered, washed with 

acetone and hot water. Yield: 3.1 g (10%) of V compound. 



[M H] (100%). 1 H chemical shifts: chemical shifts were not 

determined due to a very low solubility of the sample. 

3.4.3. Synthesis of 3,6-di-(4-piperidinophenyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione 

(VI) 

Synthesis of 4-piperidine-1-yl-benzonitrile (starting nitrile): 

Dry, pure N,N-dimethylacetamide (400 ml), 47.8 g (0.4 mol) p-fluorobenzonitrile 

(caution: incompatible with strong oxidizing 

agents, strong acids, strong bases) and 84 g (0.99 mol) of piperidine 

were charged into a 1 dm 3 Erlenmeyer flask equipped with stirrer 

and condenser. Reaction was carried out at 100O110 C for 8 h, the 

gases from the reaction being exhausted via the fume-chamber. 

Subsequently, the reaction mixture was poured onto 1 kg ice and 

the crude product was collected by filtration and recrystallized 

from 80% ethanol. Yield: 43.5 g (60%) of 4-piperidine-1-yl-benzonitrile 

(m.p. 53O55 C). 

Synthesis of VI: 390 ml of tert-amyl alcohol and 24.4 g (1 mol) of 

sodium metal (in three portions) were charged to a 1.5 dm 3 Keller 

flask equipped with stirrer, reflux condenser, thermometer and 

a nitrogen inlet. The sodium metal was dissolved under reflux in 

the presence of a catalytic amount of FeCl3 (which took approximately 

2 h), and 67 g (0.36 mol) of 4-piperidine-1-yl-benzonitrile 

was added. After that, diisopropyl succinate (36.3 g, 0.18 mol) dissolved 

in 36.3 g of tert-amyl alcohol was added over 3 h. Subsequently, 

the mixture was stirred at reflux for 1 h and the ensuing 

mixture was cooled to 60 C, and then 700 ml distilled water was 

added to protolyse the salt. Protolysis was carried out at 80 C for 

2 h. The resulting hot suspension was filtered and the filter cake 

was washed with hot water to neutral washings. The filter cake was 

dried and suspended in 800 ml acetone. The suspension was heated 

to boiling and refluxed for 1 h. The hot suspension was filtered, 

washed with acetone and hot water. Yield: 12 g (15%) of VI 

compound. 


(6.55), N (12.11). MW ¼ 454 Da; Negative-ion APCI-MS: m/z 453

[M H] (100%). 1 H chemical shifts: 10.93 (2H, br s, NH), 8.36 (4H, 

m, ArH); 7.07 (4H, m, ArH); 3.43 (8H, m, –CH2 CH2CH2N); 1.65 (12H, 

m, –CH2CH2 CH2N and –CH2CH2CH2N) 

3.4.4. Synthesis of 3,6-di-(4-piperidinophenyl)-2-butyl-2, 

5–dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (VII) and 3,6-di- 

(4-piperidinophenyl)-2,5-butyl-2,5–dihydro-pyrrolo[3,4-c]pyrrole- 

1,4-dione (VIII) 

13.7 g (0.03 mol) of the intermediate VI and 90 g of dry DMF were 

charged into an evaporating flask and stirred. 12.2 g of 30% methanolic 

solution of sodium methylate was added. The fine slurry of 

sodium salt of VI was stirred for 20 min, methanol was distilled 

under vacuum (t < 40 C, p ¼ 40 mbar) and then 12.6 g (0.093 mol) of 

n-butyl bromide was added. The mixture was heated to 80 C and 

stirred for 20 h after which time, the temperature was increased to 

80–100 C and this was maintained with stirring for a further 2 h. 

The reaction mixture was added to 1000 ml of distilled water and the 

ensuing solution boiled. The final mixture was cooled to 10 C and 

the product filtered. The filter cake was reslurried in 200 ml of 

methanol, the suspension boiled and then filtered. In this step all byproducts 

from alkylation were removed by TLC (mobile phase: 

acetone:n-hexane (2:3), thin layer: Alugram Sil G/UV). The filter cake 

from the previous step (a mixture of mono-, di-substituted product 

and starting material) was reslurried in 300 ml of acetone. The 

suspension was boiled and filtered. After cooling, the di-substituted 

product was obtained. This extraction procedure was repeated twice 

after which, the raw, di-substituted product was recrystallized from 

acetone. In this way 1.7 g of dark blue VIII was obtained. The filter 

cake from the previous step (a mixture of mono-alkylate product 

and starting material) was reslurried in 300 ml of acetone together 

with 10 g silica gel for column chromatography (0.06–0.2 mm, pore 

diameter 6 nm). The suspension was boiled and filtered; acetone 

from the filtrate was evaporated and 0.22 g of dark blue VII was 

obtained after the filtration. 

VII: Calculated: C (75.26), H (7.50), N (10.97). Found: C (74.21), H 


[M H] (100%). 1 H chemical shifts: 10.90 (1H, br. s, NH); 8.38 (2H, 

m, H-ortho); 7.81 (2H, m, H-ortho); 7.08 (4H, m, H-meta); 3.86 (4H, 

t, NCH2); 3.43 (8H, m, –CH2 CH2CH2N); 1.65 (12H, m, -CH2CH2 CH2N 

and –CH2CH2CH2N); 1.55 (2H, m, CH2); 1.26 (2H, m, CH2); 0.87 (3H, 

t, CH3). 

VIII: Calculated: C (76.29), H (8.18), N (9.89). Found: C (76.08), H 

(8.09), N (9.84). MW ¼ 566 Da; Pozitive-ion APCI-MS: m/z 567 

[M þ H] þ (100%). 1 H chemical shifts: 7.84 (4H, m); 7.1 (4H, m); 3.81 

(4H, t, NCH2); 3.40 (8H, m, -CH2 CH2CH2N); 1.65 (12H, m, -CH2CH2 

CH2N and –CH2CH2CH2N) 1.50 (4H, m, CH2); 1.25 (4H, m, CH2); 0.86 

(6H, t, CH3). 

3.4.5. Syntheses of 3,6-bis-(4-chloro-phenyl))-2-butyl-2,5– 

dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione (IX) and 3,6-bis-(4-chlorophenyl))-2,5-butyl-2,5–dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

(X) 

The starting 3,6-Bis-(4-chloro-phenyl)-2,5–dihydro-pyrrolo- 

[3,4-c]pyrrole-1,4-dione was purchased from Synthesia as the 

commercial pigment Versal Red DP3G. The sample was refluxed in 

2-propanol before for 1 h and the ensuing hot suspension was 

filtered, washed with 2-propanol and hot water. 46.6 g (0.13 mol) of 

this intermediate and 500 ml of dry DMF were charged into an 

evaporating flask and stirred. Subsequently, a methanolic solution 

of sodium methylate prepared from 6 g (0.26 mol) of sodium metal 

and 50 ml of methanol was added. The fine slurry of the sodium salt 

of I was stirred for 20 min, methanol was distilled under vacuum 

(t < 40 C, p ¼ 40 mbar) and then 100 g (0.735 mol) of n-butyl 

bromide was added. The mixture was heated to 60 C and stirred 

for 20 h, after which time the temperature was increased to 100 C 

and maintained at this temperature for a further 2 h with stirring. 


The reaction mixture was added to 4500 ml of distilled water and 

boiled; the final mixture was cooled to 10 C and the product was 

filtered 

The filter cake was reslurried in the mixture of methanol 

(300 ml) and acetone (300 ml) and the ensuing suspension was 

boiled and filtered. The filter cake (10.8 g) was identified as 

a starting material. After cooling of the filtrates, a reddish substance 

(a mixture of IX and X) was obtained which was recrystallized from 

ethanol. The more soluble X was separated from the filtrate by 

evaporation of ethanol and the less-soluble derivative IX was 

obtained from the filter cake. Derivatives IX a X were three times 

recrystallized from ethanol. 

IX: Calculated: C (63.93), H (4.39), N (6.78), Cl (17.16). Found: C 

(63.51), H (4.5), N (6.70), Cl (N/N). MW ¼ 412 Da; Negative-ion 

APCI-MS: m/z 411 [M H] (100%). 1 H chemical shifts: 11.30 (1H, br. 

s, NH); 8.53 (2H, m, H-ortho); 7.91 (2H, m, H-ortho); 7.73 (4H, m, Hmeta); 

3.83 (2H, t, NCH2); 1.45 (2H, m, CH2); 1.20 (2H, m, CH2); 0.80 

(3H, t, CH3). 

X: Calculated: C (66.53), H (5.58), N (5.97), Cl (15.11). Found: C 

(66.42), H (5.73), N (5.92), Cl (15.81). MW ¼ 468 Da; Positive-ion 

APCI-MS: m/z 469 [M H] (100%). 1 H chemical shifts: 7.83 (4H, 

m); 7.65 (4H, m); 3.67 (4H, t, NCH2); 1.35 (4H, m, CH2); 1.11 (4H, m, 

CH2); 0.73 (6H, t, CH3). 

3.5. Experimental equipment 

3.5.1. Mass spectrometry 

The ion trap mass spectrometer MSD TRAP XCT Plus system 

(Agilent Technologies, USA) equipped with APCI probe was used. 

Positive-ion and negative-ion APCI mass spectra were measured in 

the mass range of 50–1000 Da in all the experiments. The ion trap 

analyzer was tuned to obtain the optimum response in the range of 

the expected m/z values (the target mass was set from m/z 289 to 

m/z 454). The other APCI ion source parameters: drying gas flow 

rate 7 dm 3 min 1 , nebulizer gas pressure 60 psi, drying gas 

temperature 350 C, nebulizer gas temperature 350 C. 

The samples were dissolved in a mixture of DMSO/acetonitrile 

and methanol in various ratios. All the samples were analyzed by 

means of direct infusion into LC/MS. 

3.5.2. Elemental analysis 

Perkin Elmer PE 2400 SERIES II CHNS/O and EA 1108 FISONS 

instruments were used for elemental analyses. 

3.5.3. Nuclear magnetic resonance 

Bruker AVANCE 500 NMR spectrometer operating at 

500.13 MHz for 1H was used for measurements of the 1H NMR 

spectra and A Bruker AMX 360 NMR spectrometer, operating at 

360.13 MHz for 1H and 90,56 MHz for 13C, was used for 

measurements of 1H and 13C NMR spectra. The compounds were 

dissolved in hexadeuteriodimethyl sulfoxide. The 1H and 13C 

chemical shifts were referred to the central signal of the solvent 

(d ¼ 2.55 (1H) and 39.60 (13C)). Positive values of chemical shifts 

denote shifts to higher frequencies. 

3.5.4. IR spectrometry 

IR spectra were determined by FT-IR spectrometer Nicolet 

Magna-IR 760. Samples were measured by KBr pellet technique. 

KBr pellet (diameter 13 mm) was prepared from 1 mg sample and 

300 mg KBr. 


Novel diphenyl-diketo-pyrrolopyrroles with electron-donating 

or withdrawing groups were prepared. To increase their solubility,

182 

we introduced N-alkylation on the central DPP part. The prepared 

materials were studied experimentally and by the quantum 

chemical calculations. One of the key-parameter governing 

absorption and luminescence is the effective extent of the conjugation. 

This is maximised when the molecule is perfectly planar. 

Substitution of electron-donating or withdrawing groups affected 

the molecule planarity only slightly. However, hyperchromic and 

bathochromic shift in absorption was observed using electrondonating 

groups suggesting electron-accepting character of the 

central part. On the other hand, N-alkylation introduced to increase 

the solubility of the DPP derivatives broke the planarity and thus 

reduced this effect. 


The research was supported by the Ministry of Industry and 

Trade of the Czech Republic via Tandem project No FT-TA3/048 and 

by the Grant Agency of the Academy of Sciences of the Czech 

Republic via project A401770601. The access to the METACentrum 

supercomputing facilities provided under the research intent 

MSM6383917201 as well as the computer time on the servers Luna/ 

Apollo in the Institute of Physics of the AS CR, v.v.i., Prague is highly 

appreciated. 

References 

[1] Rochat AC, Cassar L, Iqbal A. EP 94911; 1983. 

[2] Iqbal A, Pfenninger J, Rochat AC, Babler F. EP 181290; 1989. 

[3] Pfenninger J, Iqbal A, Rochat AC, Wallquist O. USP 4778899; 1986. 

[4] Surber W, Iqbal A, Stern C. EP 302018; 1989. 

[5] Wooden G, Schloeder I, Wallquist O. EP 672729; 1995. 

[6] Hendi SB. EP 962499; 1999. 

[7] Closs F, Gompper R. 2,5-Diazapentalene. Angewandte Chemie 1987;99(6): 

564–7. 

[8] Potrawa T, Langhals H. Fluorescent dyes with large stokes shifts – soluble 

dihydropyrrolopyrrolediones. Chemische Berichte 1987;120(7):1075–8. 

[9] Langhals H, Potrawa T, Noeth H, Linti G. The influence of packing effects on solidstate 

fluorescence of diketopyrrolopyrroles. Angew Chemie 1989;101(4):497–9. 

[10] Iqbal A, Jost M, Kirchmayer R, Pfenninger J, Rochat AC, Wallquist O. Synthesis 

and properties of 1,4-diketopyrrolo[3,4-c]pyrroles. Bulletin des Societes Chimiques 

Belges 1988;97(8–9):615–43. 

[11] Iqbal A, Cassar L, Rochat AC, Pfenninger J, Wallquist. New heterocyclic 

pigments. Journal of Coatings Technology 1988;60(758):37–45. 

[12] Herbst M, Hunger K. Industrial organic pigments. Weinheim: VCH; 1993. 

[13] Hao Z, Iqbal A. Some aspects of organic pigments. Chemical Society Reviews 

1997;26(3):203–13. 

[14] Chan WK, Chen Y, Peng Z, Yu L. Rational designs of multifunctional polymers. 

Journal of the American Chemical Society 1993;115(25):1735–43. 

[15] Eldin SH, Iqbal A, Hao Z, Lamatsch B. EP 0787730. Ciba Specialty Chem; 1993. 

[16] Eldin SH, Iqbal A. EP 0787731. Ciba Specialty Chem; 1997. 

[17] Lange G, Tieke B. New deeply colored and fluorescent polymers with 1,4dioxo-3,6-diphenylpyrrolo[3,4-c]pyrrole 

units in the main chain. Macromolecular 

Chemistry and Physics 1999;200(1):106–12. 

[18] Beyerlein T, Tieke B. New photoluminescent conjugated polymers with 1,4dioxo-3,6-diphenylpyrrolo[3,4-c]pyrrole 

(DPP) and 1,4-phenylene units in the 

main chain. Macromolecular Rapid Communications 2000;21(4):182–9. 

[19] Beyerlein T, Tieke B, Forero-Lenger S, Brütting W. Red electroluminescence 

from a 1,4-diketopyrrolo[3,4-c]pyrrole (DPP)-based conjugated polymer. 

Synthetic Metals 2002;130(2):115–9. 

[20] Cao D, Liu Q, Zeng W, Han S, Peng J, Liu S. Synthesis and characterization of 

novel red-emitting alternating copolymers based on fluorene and diketopyrrolopyrrole 

derivatives. Journal of Polymer Science, Part A: Polymer 

Chemistry 2006;44(8):2395–405. 

[21] Rabindranath AR, Zhu Y, Heim I, Tieke B. Red emitting N-functionalized 

poly(1,4-diketo-3,6-diphenylpyrrolo[3,4-c]pyrrole) (Poly-DPP): a deeply colored 

polymer with unusually large stokes shift. Macromolecules 2006;39:8250–6. 

[22] Cao D, Liu Q, Zeng W, Han S, Peng J, Liu S. Diketopyrrolopyrrole-containing 

polyfluorenes: facile method to tune emission color and improve electron 

affinity. Macromolecules 2006;39:8347–55. 


[23] Zhu Y, Rabindranath AR, Beyerlein T, Tieke B. Highly luminescent 1,4-diketo-3,6-diphenylpyrrolo[3,4-c]pyrrole-(DPP-) 

based conjugated polymers 

prepared upon Suzuki coupling. Macromolecules 2007;40:6981–9. 

[24] Hofkens J, Verheijen W, Shukla R, Dehaen W, De Schryver FC. Detection of 

a single dendrimer macromolecule with a fluorescent dihydropyrrolopyrroledione 

(DPP) core embedded in a thin polystyrene polymer 

film. Macromolecules 1998;31(14):4493–7. 

[25] Behnke M, Tieke B. Photoluminescent amphiphilic 1,4-diketo-3,6-diphenylpyrrolo-[3,4-c]-pyrrole 

derivative and its complexes with polyelectrolytes. 

Langmuir 2002;18(10):3815–21. 

[26] Smet M, Metten B, Dehaen W. Construction of rod-like diketopyrrolopyrrole 

oligomers with well-defined length. Tetrahedron Letters 2001;42(37):6527–30. 

[27] Zambounis JS, Hao Z, Iqbal A. Latent pigments activated by heat. Nature 

(London) 1997;388(6638):131–2. 

[28] Rochat AC, Wallquist O, Iqbal A, Mizuguchi J. EP 353184. Ciba-Geigy; 1990. 

[29] Fukuda M, Kodama K, Yamamoto H, Mito K. Solid-state laser with newly 

synthesized pigment. Dyes and Pigments 2002;53(1):67–72. 

[30] Fukuda M, Kodama K, Yamamoto H, Mito K. Evaluation of new organic 

pigments as laser-active media for a solid-state dye laser. Dyes and Pigments 

2004;63(2):115–25. 

[31] Langhals H. Ger Pat 3901988; 1990. 

[32] Mizuguchi J, Rochat CA. A new near-infrared photoreceptor based on 1,4dithioketo-3,6-diphenylpyrrolo[3,4-c]-pyrrole. 

Journal of Imaging Science 

1988;32(3):135–40. 

[33] Mizuguchi J. Phase-change of 3,6-diphenzlpyrrolo [3,4-c]pzrrole-1,4-dithiones 

for optical storage-systems. Chimia 1994;48:439. 

[34] Mizuguchi J, Imoda T, Takahashi H, Yamakami H. Polymorph of 1,4-diketo-3,6bis-(4’-dipyridyl)-pyrrolo-[3,4-c]pyrrole 

and their hydrogen bond network: 

a material for H2 gas sensor. Dyes and Pigments 2006;68(1):47–52. 2005. 

[35] Hoki T, Takahashi H, Suzuki S, Mizuguchi J. Hydrogen gas sensor based upon 

proton acceptors integrated in copper-tetra-2,3-pyridinoporphyradine. IEEE 

Sensors Journal 2007;7(5):808–13. 

[36] Song B, Wei H, Wang Z, Zhang X, Smet M, Dehaen W. Supramolecular nanofibers 

by self-organization of bola-amphiphiles through a combination of hydrogen 

bonding and p–p stacking interactions. Advanced Materials 2007;19:416–20. 

[37] Vala M, Weiter M, Vyňuchal J, Toman P, Luňák Jr S. Comparative studies of 


Journal of Fluorescence 2008;18(6):1181–6. 

[38] Williams ATR, Winfield SA, Miller JN. Relative fluorescence quantum yields 

using a computer-controlled luminescence spectrometer. Analyst (Cambridge, 

United Kingdom) 1983;108(1290):1067–71. 

[39] Luňák Jr S, Vyňuchal J, Vala M, Havel L, Hrdina R. The synthesis, absorption and 

fluorescence of polar diketo-pyrrolo-pyroles. Dyes and Pigments 2009;82(2): 

102–8. 

[40] Wallquist O. In: Smith HM, editor. High performance pigments. Weinheim: 

Wiley-VCH; 2002. p. 159–84. 

[41] Lee CT, Yang WT, Parr RG. Development of the Colle-Salvetti correlationenergy 

formula into a functional of the electron density. Physical Review B: 

Condensed Matter and Materials Physics 1988;37(2):785–9. 

[42] Becke AD. Density-functional thermochemistry. III. The role of exact exchange. 

Journal of Chemical Physics 1993;98(7):5648–52. 

[43] Toman P, Nesˇpu˚ rek S, Yakushi K. Electronic states and infrared spectroscopy of 

Ni- and Co-phthalocyanines: neutral and oxidized forms. Journal of Porphyrins 

and Phthalocyanines 2002;6(9–10):556–62. 

[44] Ignatyev IS, Sundius T. Competitive ring hydride shifts and tolyl-benzyl rearrangements 

in tolyl and silatolyl cations. Chemical Physics Letters 2000; 

326(1,2)):101–8. 

[45] Guo JD, Luo Y, Himo F. Density functional theory study of the canthaxanthin and 

other carotenoid radical cations. Chemical Physics Letters 2002;366(1,2)):73–81. 

[46] Toman P, Nesˇpu˚ rek S, Jang JW, Lee CE. Oligo[methyl(phenyl)silane] ion–radical 

conformations calculated by the B3LYP method. International Journal of 

Quantum Chemistry 2005;101(6):746–52. 

[47] Choi CH, Kertesz M. Consistencies between experiments and quantum 

calculations of strained C–C single bond lengths. Chemical Communications 

1997;22:2199–200. 

[48] Choi CH, Kertesz M. Bond length alternation and aromaticity in large annulenes. 

Journal of Chemical Physics 1998;108(16):6681–8. 

[49] Casida ME. In: Chong DP, editor. Recent advances in density-functional 

methods, part I. Singapore: World Scientific; 1995. p. 155–92. 

[50] Gross EKU, Dobson JF, Petersilka M. In: Nalewajski RF, editor. Topics in current 

chemistry. Density Functional Theory II, vol. 181. Berlin/Heidelberg: Springer; 

1996. p. 81–172. 

[51] Takahashi M, Kira M, Sakamoto K, Müller T, Apeloig Y. Theoretical prediction of 

vertical transition energies of diaminosilylenes and aminosubstituted disilenes. 

Journal of Computational Chemistry 2001;22(13):1536–41. 

[52] Vyňuchal J, Luňák Jr S, Hatlapatková A, Hrdina R, Lyčka A, Havel L, et al. The 

synthesis, absorption, fluorescence and photoisomerization of 2-aryl-4-arylmethylidene-pyrroline-5-ones. 

Dyes and Pigments 2008;77(2):266–76.

J Therm Anal Calorim 

DOI 10.1007/s10973-011-1896-8 

Stability and physical structure tests of piperidyl and morpholinyl 

derivatives of diphenyl-diketo-pyrrolopyrroles (DPP) 

Jirˇí Kučerík • Jan David • Martin Weiter • 

Martin Vala • Jan Vyňuchal • Imad Ouzzane • 

Ota Salyk 

3 rd Joint Czech-Hungarian-Polish-Slovak Thermoanalytical Conference Special Chapter 

Ó Akadémiai Kiadó, Budapest, Hungary 2011 

Abstract Crystalline structure, thermo-oxidative and 

thermal stability of symmetrical and asymmetrical piperidyl 

and morpholinyl derivatives of both N-substituted and non- 

N-substituted butyl diphenyl-diketo-pyrrolopyrrole (DPP) 

pigments were studied using differential scanning calorimetry 

(DSC) and thermogravimetry (TG). Except for the 

asymmetrical morpholine DPP derivative, all the samples 

showed melting peaks which were relatively close to their 

degradation temperatures (from 260 to 430 °C). Using DSC, 

monotropic polymorphism was revealed in the symmetrical 

piperidyl-N-butyl-derivative which confirmed earlier 

observation about tendency of symmetrical N-alkyl DPP 

derivates to form several crystalline structures. TG carried 

out under nitrogen atmosphere served for distinguishing of 

evaporation/sublimation and degradation temperatures. 

Temperatures of evaporation/sublimation were typically 

10–30 °C lower in comparison with temperatures of thermal 

degradation. The highest thermal (450 °C) and thermo-oxidative 

stability (around 360 °C) showed the DPP derivatives 

J. Kučerík (&) 

Institute of Environmental Sciences, University of Koblenz- 

Landau, Fortstrasse 7, 768 29 Landau, Germany 

e-mail: kucerik@uni-landau.de 

J. Kučerík J. David M. Weiter M. Vala O. Salyk 

Faculty of Chemistry, Brno University of Technology, 

Purkyňova 118, Brno 612 00, Czech Republic 

J. David M. Weiter M. Vala I. Ouzzane 

Faculty of Chemistry, Centre for Materials Research CZ.1.05/ 

2.1.00/01.0012, Brno University of Technology, Purkyňova 

464/118, Brno 612 00, Czech Republic 

J. Vyňuchal 

Research Institute of Organic Syntheses, Rybitví 296, 

533 54, Czech Republic 

containing morpholine moieties with no alkyl substitution on 

NH-group of DPP core. The presence of the latter was found 

to be the most destabilizing factor. Piperidyl group showed 

more stabilizing effect due to its polar character and its 

influence on p–p intermolecular interactions of neighbouring 

phenyl groups. The highest stabilizing effect of morpholine 

moiety on DPP structure was explained based on the 

presence of polar oxygen atom in that group. The preparations 

of 3,6-di-(4-morpholinophenyl)-2,5-dihydro-pyrrolo- 

[3,4-c]pyrrole-1,4-dione and 3-(phenyl)-6-(4-morpholinophenyl)-2,5-dihydropyrrolo[3,4-c]pyrrole-1,4-dione 

are reported. 

Keywords Derivatives Diphenyl-diketo-pyrrolopyrrole 

(DPP) Electroluminescent devices Polymorphism 

Thermal stability Thermo-oxidative stability 

Introduction 

Currently, a strong effort to produce organic electroluminescent 

devices (OLED) usable as a new generation of 

lamps and full colour flat panel displays, can be recognized. 

The potential advantages of these devices are their 

high efficiency, low driving voltage, versatility in their 

application (e.g. flexibility and transparency), low mass 

and relatively low production costs [1]. In order to fulfil all 

the requested parameters, the interest is focused not only 

on their optical properties, but also on physical–chemical 

characteristics such as solubility, resistance against various 

influences such as oxygen or temperature fluctuation. 

3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione 

known as DPP and its whole family of derivates are 

nowadays of a great interest [1–10]. Similarly, as other 

organic pigments they consist of centrosymmetric molecule 

having zero dipole moment [7]. Despite being of a 

123

elatively low molecular weight, DPP is an insoluble, 

crystalline material, thermally stable up to approximately 

400 °C [8]. Physical properties are related to the presence 

of strong intermolecular bonds, which stabilize the crystal 

structure [1]. 

The derivatization of DPP is essential since resulted 

materials have improved physical–chemical properties 

such as for example, solubility, keeping the same or even 

better application properties in comparison with the 

parental DPP. Recently, it has been demonstrated that the 

introduction of piperidino (donor) and cyano (acceptor) 

groups into the DPP molecule had a strong influence on its 

absorption maxima. While both types of substitution 

resulted in bathochromic and hyperchromic shifts with 

respect to the parental DPP, the influence of piperidino 

group appeared to have the strongest effect [7]. 

Another example is a symmetrical dipyridyl derivate 

(DPPP) which shows a high proton affinity and, therefore, 

represents a good candidate for H2 gas sensors [9]. However, 

only one of two possible crystal phases of DPPP was 

shown to be sensitive for H2 detection; the reason of 

inactivity of one form is the interaction between N atom of 

pyridyl rings and NH-group(s) of DPP skeleton [9]. 

Thermal analysis represents a powerful tool in analysis of 

inorganic and organic pigments. The most important techniques 

are thermogravimetric analysis (TGA) and differential 

scanning calorimetry (DSC), applied either separately, 

simultaneously or in combination with other techniques. 

Recently, those techniques were used in order to study the 

stability of DPP N-alkyl derivatives and polymorphism 

occurring upon fast and moderate cooling of the material [8]. 

More recently, the thermogravimetrical analysis of DPP 

derivatives of red-emitting diketopyrrolopyrrole-alt-phenylenevinylene 

[11] polymers and poly(arylene ethynylene)s 

derived from 1,4-diketo-3,6-diphenylpyrrolo[3,4-c] pyrrole 

[12] were reported. The thermal stability of the products 

were assessed in nitrogen atmosphere as ranging from 260 

to 400 °C [11, 12]. 

The main aim of this study is the evaluation of the 

thermal and thermo-oxidative stability of DPP derivates 

with para-substituted phenyl groups and partially substituted 

NH-groups. Furthermore, DSC is employed in order 

to reveal possible phase transitions in heating run upon 

different cooling regimes. This should imitate the possible 

fluctuation of environmental conditions, which can hamper 

Fig. 1 Molecular structure of 

investigated DPP derivatives 

123 

N N 

O 

O 

processing and possible applications of DPP derivatives. 

All parameters determined using thermo-analytical techniques 

are discussed with respect to the molecular structure 

of studied samples. 

Experimental 

Thermal analysis 

TG studies were performed using TA Instruments TGA 

Q5000 (New Castle, DE, USA) device in 100-lL open 

platinum pans. The samples, typically around 5 mg, were 

heated by thermal ramp of 10 °C min -1 from 40 to 650 °C 

in a dynamic atmosphere of either nitrogen (thermal stability) 

or air (thermo-oxidative stability) of 25 mL min -1 . 

Calorimetric analyses were carried out employing TA 

Instruments DSC Q200 calorimeter equipped with an 

external cooler RCS90 allowing experimental temperature 

range from -90 to 500 °C. Experiments were conducted in 

open TA Tzero TM 

open aluminium pans. Thermal history of 

all samples was set up to be the same using a heating ramp 

of 10 °C min -1 from 40 °C to the temperature of 5 °C 

lower than the degradation onset, which was previously 

determined using thermogravimetry. Next, the moderate 

cooling ramp (0.5 °C min -1 ) was applied to reach -90 °C 

followed by 1 min of an isothermal stage. Next segment 

was performed using a heating ramp of 10 °C min -1 from 

-90 °C to the temperature of 5 °C lower than degradation 

onset. The last segment included a 10 °C min -1 heating 

run followed after the rapid equilibration of the sample 

down to -90 °C (quenching) and 1 min of isothermal 

stage. All DSC experiments were made under dynamic 

atmosphere of nitrogen, flow rate 50 mL min -1 . Before the 

analyses, the device was calibrated for temperature and 

enthalpy using deionized water (own production), indium 

and tin standards (Perkin Elmer, Waltham, MA, USA.). 

Samples 

NH NH 

HN HN 

O 

N 

Five DPP derivates were investigated in this study. The 

molecular structures of tested DPP derivatives are reported 

in Fig. 1. The preparation of DPP1, DPP4 and DPP5 is 

reported in Ref. [9]. Preparation of DPP2 and DPP3 is 

given in following paragraphs. 

O 

O 

N 

O 

N 

DPP1 DPP2 DPP3 DPP4 DPP5 

O 

HN 

O 

NH 

N 

O 

N 

H C N 

9 4 

O 

O 

N C H 

4 9 

J. Kučerík et al. 

N 

H C N 

9 4 

O 

O 

NH 

N

Stability and physical structure tests of piperidyl and morpholinyl derivatives of DPP 

Synthesis of 4-morpholine-1-yl-benzonitrile (starting 

nitrile) 

Dry N,N-dimethylacetamide (p.a., 400 mL), p-fluorobenzonitrile 

(47.8 g; 0.4 mol) and morpholine (85 g; 

0.98 mol) were charged into a 1-dm 3 Erlenmeyer flask 

equipped with a stirrer and condenser. The reaction was 

carried out at 100–110 °C for 8 h. The reaction gases from 

the reaction were let out to fume-chamber. Subsequently, 

the reaction mixture was poured onto 1 kg ice. The crude 

product was collected by filtration and recrystallized from 

80% ethanol. Yield was 38 g (50%) of 4-morfoline-1-ylbenzonitrile 

(m.p. 53–55 °C). 

Synthesis of DPP2 (3,6-di-(4-morpholinophenyl)- 

2,5–dihydro-pyrrolo[3,4-c]pyrrole-1,4-dione) 

Tert-amyl alcohol (390 mL) and sodium metal (24.4 g, 

1 mol, in three portions) were charged into an 1.5-L Keller 

flask equipped with a stirrer, reflux condenser, thermometer 

and nitrogen inlet. The sodium metal was dissolved under 

reflux in the presence of catalytic amount of FeCl 3 (which 

took approximately 2 h), and 4-morpholine-1-yl-benzonitrile 

(69 g, 0.37 mol) was added. After that, diisopropyl 

succinate (36.2 g, 0.18 mol) dissolved in tert-amyl alcohol 

(36.3 g) was added drop-wise within 3 h. Subsequently, 

this mixture was stirred under reflux for 1 h. The reaction 

mixture was cooled to 60 °C, and then 1000 mL of distilled 

water was added to protonate the salt. The protolysis was 

carried out at 80 °C for 2 h. The resulting hot suspension 

was filtered, and the filter cake was washed with hot water 

to neutral pH. The filter cake was dried and suspended in 

800 mL acetone. The suspension was boiled and refluxed 

for 1 h. The hot suspension was filtered, washed with 

acetone and hot water. Yield of the DPP2 was 19.5 g 

(23.9%). Theoretical values of elemental analysis: C 

(68.11), H (5.72), N (12.22). Determined values of elemental 

analysis: C (67.89), H (5.75), N (12.05). 1 H 

chemical shifts: (500 MHz, DMSO) 10.99 (2H, s, NH); 

8.40 (4H, m, ArH); 7.11 (4H, m ArH); 3.78 (8H, t, 

H morpholine); 3.39 (8H, t, H morpholine). 

Synthesis of DPP3 (3-(Phenyl)-6-(4-morpholinophenyl)- 

2,5–dihydropyrrolo[3,4-c]pyrrole-1,4-dione) 

Tert-amyl alcohol (80 mL) and sodium metal (2.8 g, 

0.12 mol) were charged into a 250-cm 3 flask equipped with 

a stirrer, reflux condenser, thermometer and a nitrogen 

inlet. The sodium metal was dissolved under the reflux in 

the presence of catalytic amount of FeCl3 (which approximately 

took 2 h), whereupon 4-morpholine-1-yl-benzonitrile 

(7.5 g, 0.04 mol) was added. After that, pyrrolinone 

ester (9.2 g, 0.04 mol, in small portions) was continuously 

added within 0.5 h. Finally, this mixture was stirred and 

refluxed for 2 h. The hot suspension of sodium salt of 

compound DPP3 was collected by suction. The filter cake 

was charged into 200 mL propan-2-ol/water mixture (3/2 

by vol), and the suspension was heated to boiling and 

refluxed for 2 h. The product was collected by filtration, 

and the filter cake was charged into 100 mL methanol and 

refluxed for a short time. The hot suspension was filtered, 

the filter cake was washed with methanol, and finally with 

hot water. Yield: 5.3 g (36%) compound DPP3. Theoretical 

values of elemental analysis: C (70.76), H (5.13), N 

(11.25). Determined values of elemental analysis: C 

(70.06), H (5.10), N (10.98). 1 H chemical shifts: 500 MHz, 

DMSO) 11.19 (1H, s, NH); 11.16 (1H, s, NH); 8.46 (4H, m, 

ArH); 7.57 (3H, m ArH); 7.14 (2H, m ArH); 3.78 (8H, t, 

H morpholine); 3.39 (8H, t, H morpholine). 

Results and discussion 

The derivative TG results, i.e. DTG of samples measured 

under nitrogen and air are reported in Figs. 2 and 3, 

respectively. As it can be seen, the DTG curves are 

reported in the reverse direction then calculated in order to 

simplify the data reading. Table 1 summarizes the data 

obtained from TG, DTG and DSC analysis of DPP derivates. 

DTG–air and DTG–nitrogen–evaporation onset 

results show the onsets determined from DTG records by 

the approach indicated in the small frame in Fig. 2. While 

DTG–air has the meaning of thermo-oxidative stability, the 

DTG–nitrogen–evaporation onset indicates the temperature 

of intensive mass loss onset, i.e. it indicates either evaporation 

or sublimation. The character of the process, if either 

evaporation or sublimation takes place, is discussed in 

following paragraphs with respect to the obtained DSC 

results. The DTG–nitrogen–degradation onset stands for 

Derivative mass/% °C –1 

3.5 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

DPP1 

DPP2 

DPP3 

DPP4 

DPP5 

T onset 

280 300 320 340 360 380 

0.0 250 275 300 325 350 375 400 425 450 475 500 

Temperature/°C 

Fig. 2 Comparison of the first derivative of mass loss (DTG) of DPP 

derivatives in nitrogen, heating rate 10 °C min -1 

123

the thermal stability of a sample and it was determined 

from the second derivative as demonstrated in Fig. 4. This 

approach was developed and tested in Ref. [8]. Unlike for 

nitrogen experiments, the amount of char after air TG 

experiment is not reported since there was no rest after this 

kind of analysis. Regarding to the DSC results, Table 1 

reports the enthalpies of melting and onset temperatures of 

respective events. For sample DPP2, the enthalpy of 

melting is not reported since the melting was immediately 

followed by the sample’s evaporation and, therefore, peak 

area of melting was overlapped by the peak of evaporation. 

For the sample DPP3, no melting peak before the DTG 

onset was recorded, therefore, the nitrogen DTG onset 

indicates the temperature of sublimation. 

By applying TG [8], it was showed the onset temperature 

of sublimation of parental non-substituted DPP under 

nitrogen (sublimation) as high as 383 °C (for a heating rate 

10 °C min -1 ). That process was followed by the thermal 

degradation at 408 °C and the thermo-oxidative stability 

was determined around 356 °C (under the same conditions 

as used in this study). Despite the fact that two crystallographic 

forms in parental DPP sample may occur, the DSC 

tests disclosed no significant phase transition such as 

melting or glass transition in the temperature interval from 

Dreivative mass/% °C –1 

1.25 

1.00 

0.75 

0.50 

0.25 

0.00 250 300 350 400 450 500 550 600 650 


DPP1 

DPP2 

DPP3 

DPP4 

DPP5 

Fig. 3 Comparison of the first derivative of mass loss (DTG) of DPP 

derivatives in air, heating rate 10 °C min -1 

Table 1 Summary of TGA and DSC results, for detail explanation see the text 

-90 to 383 °C. In contrast, the alkyl derivates (substitution 

of H in NH-group in parental DPP molecule) were less 

stable (a difference more than 100 °C) and their physical 

structure showed a strong dependence on the thermal pretreatment 

(thermal history). That was explained as a consequence 

of a molecular symmetry disturbance caused by 

the presence of alkyl chains in the structure of DPP 

derivatives. As stated previously, pure DPP is stabilized by 

means of 3D intermolecular hydrogen bonds based on 

–NH O=C interaction, by p–p intermolecular interactions 

between adjacent phenolic groups, by electrostatic interactions 

of charged groups and partly also by van der Waals 

forces [10]. Substitution of one or both H atoms in the NHgroups 

by alkyl chains in DPP molecule caused the 

destabilization of crystalline structure of derivatives under 

study. In fact, significant differences were found in physical 

structures of derivates depending on the symmetry 

and/or asymmetry of derivatization. Symmetrical derivatives 

exhibited a strong dependency on the thermal history, 

i.e. differences were recorded in the DSC heating run of the 

sample which was previously cooled either quickly or 

slowly. Such approach revealed the polymorphism of 

symmetrical derivates with alkyl chains –C 4H 9 and –C 7H 15 

but not for –CH3. On the contrary, the asymmetrical 

Sample DPP1 DPP2 DPP3 DPP4 DPP5 

DTG–air/°C 332 357 378 292 326 

DTG–nitrogen–evaporation onset/°C 440 440 416 330 374 

DTG–nitrogen–degradation onset/°C 446 459 441 373 383 

Char in nitrogen/% 16.4 17.1 11.7 10.0 10.8 

Tmelting/°C 431 435 – 263 361 

DHmelting/J/g 213.7 n.d. – 77.1 a 

91.8 

a Only main melting peak is reported, minor ones are described in the text 

123 

1st derivative mass/% °C –1 

3.0 

2.5 

2.0 

1.5 

1.0 

0.5 

0.0 

360 380 400 420 440 460 



Fig. 4 The determination of degradation onset from the second 

derivative mass curve of sample DPP3 

0.1 

0.0 

–0.1 

–0.2 

–0.3 

2nd derivative mass/% °C –2


derivates showed practically no response in physical 

structure when exposed to a different thermal history. It is 

noteworthy that glass transition was observed only in some 

samples regardless to the symmetry of the molecule. 

Figure 2 reports the DTG of investigated samples in 

nitrogen. As already mentioned, the tests in nitrogen were 

carried out to obtain the temperatures of evaporation or 

sublimation; however, due to the intermolecular interactions 

stabilizing the DPP physical structure, processes of 

evaporation or sublimation are relatively slow and, therefore, 

the programmed continuous increase in the oven’s 

temperature causes later the degradation of the rest of the 

sample which was not removed yet and remained on the 

pan. In practise, when the sample is evaporated to be 

deposited on a surface, this problem can be solved by 

pressure reduction and keeping constant temperature during 

the deposition [10]. However, it can be seen that except 

for sample DPP5, all samples gave only one intensive DTG 

peak which indicates the one-step process. For this reason, 

the second derivative of TG signal was calculated in order 

to reveal some possible overlapping processes. Indeed, two 

separated processes were disclosed and attributed to the 

evaporation followed by the degradation, similarly as 

proved and published recently [8]. A typical determination 

is reported in Fig. 4. 

The highest onset in nitrogen TG experiments showed 

samples DPP1 and DPP2 followed by samples DPP3 and 

DPP5. The lowest onset was observed for sample DPP4. In 

contrast, experiments in oxidative atmosphere of air 

brought about a different order. The highest stability was 

observed for sample DPP3, further for DPP2. Under oxidative 

conditions, sample DPP1 showed a lower stability 

than DPP2 (difference 25 °C) and it was only slightly 

higher than the stability of sample DPP5. Again, the lowest 

stability was observed for sample DPP4. 

Differences in stabilities under different conditions were 

accompanied also by differences in physical structures as 

revealed by DSC measurement. It can be identified in 

Table 1 that melting temperatures of samples DPP1, DPP2 

and DPP5 are higher than DTG–air onset temperatures 

which suggest that samples underwent thermo-oxidative 

degradation before their melting. On the contrary, all the 

samples (except DPP3) were pre-melted before the onset 

determined by DTG under inert conditions. 

In general, it can be stated that all DPP derivates 

investigated in this study showed higher stability than Nalkyl 

derivatives tested in Ref. [8]. In contrast, as follows 

from the above-statements, the parental DPP showed 

higher thermal stability than DPP5 and DPP4; the thermooxidative 

stability was higher than DPP5, DPP4, DPP1 and 

similar to DPP2. 

Unlike the degradation in nitrogen, the degradation in 

oxidative atmosphere (Fig. 3) proceeded in several steps. 

The lowest stability showed samples with aliphatic chains 

in the structure. In fact, the mass loss extracted from TG 

curve in the temperature range corresponding to the first 

degradation step in sample DPP4 was about 20% which is 

equal to the molar fraction of alkyl part in that molecule. 

Analogous result can be obtained also for sample U5, i.e. 

detected mass loss was 11%. Therefore, it seems that the 

less stable part of the derivative molecule is the aliphatic 

chain attached to the N-molecular skeleton of DPP. The 

piperidine part of a molecule has less de-stabilizing effect, 

probably due to its polar character and its influence on p–p 

intermolecular interactions of phenyl groups. Employing 

the same approach as for aliphatic derivates for sample 

DPP1, the piperidyl group is decomposed in several steps. 

Figure 3 shows two identical peaks at 340 and 349 °C 

corresponding to 9 and 20% mass loss, respectively. At 

37% of degradation (i.e. when both piperidyl groups are 

degraded) at 450 °C which corresponds to the minimum 

between two main degradation stages. Piperidyl group is 

more resistant against thermo-oxidative attack than simple 

aliphatic chain. This can be easily identified also when the 

most stable sample DPP1 (with no alkyl chain) is compared 

with DPP4 (symmetrical N-alkyl derivatization), which is 

less stable and with DPP5 (asymmetrical N-alkyl derivatization), 

which is only slightly less stable in air, however, 

significantly less stable in nitrogen. Such order also supports 

the observation which was done in the study with Nalkyl 

derivates that asymmetrical derivates of DPP have 

higher stability than the symmetrical ones. 

Comparison of samples DPP1 and DPP2, i.e. samples 

with different para-substituents on phenyl groups of DPP 

showed only slight difference in thermo-oxidative stability 

while thermal stability was identical. The piperidyl groups 

showed lower stabilizing effect against oxidation than 

morpholine group which can be explained as a stabilizing 

effect of polar O atom in morpholine group. However, as 

indicated by DSC (Table 1) there is a similar influence of 

both substituents on melting temperature in both derivatives. 

Since parental DPP did not show any melting before 

the evaporation [8] it can be assumed that both substituents, 

donors of electrons, have an influence on the weakening 

or opening of the structure allowing the oxygen 

molecules to penetrate inside the structure and decompose 

the material. The degradation of morpholine groups in 

sample DPP2 above-mentioned approach, based on mass 

loss calculation, failed, which implies that the breaking 

down of that group proceeds in a more complicated way 

than aliphatic chains or piperidyl groups. Interestingly, 

such approach was successful in sample DPP3 where the 

mass loss of morpholine group corresponded to the minimum 

in DTG after the first degradation step. 

Comparison of DSC records of DPP1 and DPP4 can 

shed an additional light on the influence of aliphatic chains 

123

on the stability of DPP derivatives structure. As it can be 

seen, the alkyl chains destabilize significantly the structure 

and cause the lower stability of crystals in sample DPP4. 

Significantly higher melting enthalpy of sample DPP1 

indicates the formation of completely different crystalline 

structure than in the case of N-alkyl derivates (their 

enthalpy of melting) was reported as significantly lower 

than those reported in Ref. [8]. 

Differences between samples DPP3 (asymmetrical substitution 

of DPP’s phenyls) and DPP2 (symmetrical substitution) 

brought the insight into the influence of dipole 

moment on their thermal and thermo-oxidative stability. In 

contrast to DPP2, due to its asymmetry, the molecule DPP3 

has non-zero dipole moment [13] stabilizing the structure 

against oxygen agitation. It is noteworthy that DPP3 is the 

only sample which had no melting before the DTG onset. 

Therefore, the present dipole moment destabilizes the 

structure and the sublimation (thermal stability) of sample 

DPP3 occurs at lower temperatures than for DPP 2. 

As reported in Fig. 5, sample DPP4 showed a strong 

dependency on the thermal pre-treatment. When heated up 

without any pre-treatment, indicated as ‘C’ record in Fig. 4 

(i.e. measured as received), there can be seen three melting 

events (in Table 1 only the last peak, the most intensive 

one is reported). Small peaks occurred at 153 and 166 °C 

with respective enthalpies of 0.7 and 11.7 J g -1 . On the 

other hand, when cooled quickly, indicated as ‘A’ record, a 

glass transition with midpoint at 58 °C accompanied by a 

slight enthalpic recovery appeared followed by two exotherms 

attributable to crystallization. Peaks occurred at 110 

and 164 °C with enthalpies 39.8 and 5.1 J g -1 , respectively. 

Melting of present crystalline structure was 

observed at 263 °C. Finally, when cooled slowly, only the 

melting at 254 °C was observed with no pre-crystallization 

event (‘B’ record). 

DSC signal/W g –1 

0 20 40 60 80 

25 50 75 100 125 150 175 200 225 250 275 


Fig. 5 Polymorphism of sample DPP4 as revealed by DSC measurement. 

A heating after rapid cooling, B heating after moderate 

cooling, C heating run without thermal pre-treatment 

123 

A 

B 

C 

Such behaviour suggests the possible polymorphism of 

sample DPP4. As mentioned in previous paragraphs, similar, 

but not the same, temperature-dependent behaviour 

was observed for symmetrical N-alkyl DPP derivates, 

namely C4H9 and C7H15 derivatives [8]. That was attributed 

to the melting of two different crystalline forms 

implying the monotropic polymorphism. The possible 

existence of several crystalline structures was observed 

only in the first ‘C’ record. The run ‘A’ which shows also 

the glass transition can be explained as a consequence of 

quick cooling; the movement of molecules otherwise 

forming crystals is decelerated and instead, they form 

amorphous structures. Heating up of the sample causes 

molecular segments relaxation (glass transition) followed 

by two steps of crystal perfection. Since aliphatic groups 

are involved in the crystalline structure, two phases may 

imply the progressive formation of both aliphatic and 

piperidyl moieties containing crystalline domains. 

Conclusions 

Thermal analysis has already showed its potential to study 

physical–chemical properties of pigments and dyes, e.g. 

refs. [8, 14, 15]. In this study, the physical–chemical 

properties of DPP derivates were investigated employing 

thermal analysis methods. The determined temperatures, 

especially the distinguishing between evaporation/sublimation 

and degradation temperatures is important for the 

designing of experimental conditions for deposition of such 

materials in the form of thin layers. The high thermal and 

thermo-oxidative stability of DPP materials which was 

determined using TG is a promising factor supporting their 

future application. Furthermore, the knowledge on the 

physical structure, as revealed by DSC showed the potential 

problem in manipulating with some DPP derivates 

since only an appropriate crystalline structure can be 

requested for the specific application. 

Acknowledgements The financial support of the Ministry of Education 

of the Czech Republic - project MSM 0021630501, Academy 

of Sciences of the Czech Republic project KAN401770651 and Czech 

Science Foundation project GACR 203/08/1594 are acknowledged. 

This study was also supported by the project ‘‘Centre for Materials 

Research at FCH BUT’’ No. CZ.1.05/2.1.00/01.0012 from ERDF. 

References 


1. Vala M, Weiter M, Vyňuchal J, Toman P, Luňák S Jr. Comparative 

studies of diphenyl-diketo-pyrrolopyrrole derivatives for 

electroluminescence applications. J Fluoresc. 2008;18:1181–5. 

2. Mizuguchi J. Correlation between crystal and electronic structures 

in diketopyrrolopyrrole pigments as viewed from exciton 

coupling effects. J Phys Chem A. 2000;104:1817–21.


3. Hoki T, Takahashi H, Suzuki S, Mizuguchi J. Hydrogen gas 

sensor based upon proton acceptors integrated in copper-tetra-2, 

3-pyridinoporphyradine. IEEE Sensors J. 2007;7:808–13. 

4. Beyerlein T, Tieke B, Forero-Lenger S, Brütting W. Red electroluminescence 

from a 1, 4-diketopyrrolo[3, 4-c]pyrrole (DPP)based 

conjugated polymer. Synthetic Metals. 2002;130:115–9. 

5. Potrawa T, Langhals H. Fluorescent dyes with large Stokes shifts 

- soluble dihydropyrrolopyrrolediones. Chemische Berichte. 

1987;120:1075–8. 

6. Fukuda M, Kodama K, Yamamoto H, Mito K. Evaluation of new 

organic pigments as laser-active media for a solid-state dye laser. 

Dyes Pigments. 2004;63:115–25. 

7. Luňák S, Vyňuchal J, Vala M, Havel L, Hrdina R. The synthesis, 

absorption and fluorescence of polar diketo-pyrrolo-pyrroles. 

Dyes Pigments. 2009;82:102–8. 

8. David J, Weiter M, Vala M, Vyňuchal J, Kučerík J. Stability and 

structural aspects of diketopyrrolopyrrole pigment and its N-alkyl 

derivatives. Dyes Pigments. 2011;89:137–43. 

9. Vala M, Vyňuchal J, Toman P, Weiter M, Luňák S Jr. Novel, 

soluble diphenyl-diketo-pyrrolopyrroles: Experimental and theoretical 

study. Dyes Pigments. 2010;84:176–82. 

10. Weiter M, Salyk O, Bednárˇ P, Vala M, Navrátil J, Zmesˇkal O, 

Vyňuchal J, Luňák S Jr. Morphology and properties of thin films 

of diketopyrrolopyrrole derivatives. Mat Sci Eng B. 2009;165: 

148–52. 

11. Qiao Z, Xu Y, Lin S, Peng J, Cao D. Synthesis ands characterization 

of red-emitting diketopyrrolopyrrole-alt-phenylenevinylene 

polymers. Synthetic Metals. 2010;160:1544–50. 

12. Palai AK, Mishra SP, Kumar A, Srivastava R, Kamalasana MP, 

Patri M. Synthesis and characterization of alternative donoracceptor 

arranged poly(arylene enthylene)s derived from 1, 

4-diketo-3, 6-diphenylpyrrolo[3, 4-c]pyrrole (DPP). Eur Polym J. 

2010;46:1940–51. 

13. Mizuguchi J, Imoda T, Takahashi H, Yamakami H. Polymorph of 

1, 4-diketo-3, 6-bis-(4 0 -dipyridyl)-pyrrolo-[3, 4-c]pyrrole and 

their hydrogen bond network: A material for H2 gas sensor. Dyes 

Pigments. 2006;68:47–52. 

14. Rotaru A, Moanta A, Popa G, Rotaru P, Segal. E. Thermal 

decomposition kinetics of some aromatic azomonoethers. full 

access. Part IV. Non-isothermal kinetics of 2-allyl-4-((4-(4methylbenzyloxy)phenyl)diazenyl)phenol 

in air flow. J Therm 

Anal Calorim. 2009;97:485–91. 

15. Rotaru A, Moanta A, Rotaru P, Segal E. Thermal decomposition 

kinetics of some aromatic azomonoethers Part III. Non-isothermal 

study of 4-[(4-chlorobenzyl)oxy]-4 0 -chloroazobenzene in 

dynamic air atmosphere. J Therm Anal Calorim. 2009;95:161–6. 

123

Thin polyphenylene vinylene electrophoretically and spin-coated films – 

photoelectrical properties 

D. Mladenova a,b,∗ , I. Zhivkov a,b,∗∗ , I. Ouzzane a , M. Vala a , D. Budurova c , M. Weiter a 

a Brno University of Technology, Faculty of Chemistry, Centre for Materials Research, Purkynova 118, 612 00 Brno, Czech Republic 

b Institute of Optical Materials and Technologies ”Acad. J. Malinowski”, Bulgarian Academy of Sciences, Acad. G. Bonchev Str. bl. 101/109, 

1113 Sofia, Bulgaria 

c Institute of Polymers, Bulgarian Academy of Sciences, Acad. G. Bonchev Str. bl. 103A, 1113 Sofia, Bulgaria 

Abstract 

Thin poly[2-methoxy-5-(3,7-dimethyloctyloxy)-1,4-phenylene vinylene] (MDMO-PPV) films were prepared 

by electrophoretic deposition (EPD). Absorption spectra measured in a toluene solution and a toluene/ 

acetonitrile suspension with the same MDMO-PPV concentration of 0.0033 g.l -1 were analysed. An observed broadening 

of the characteristic absorption peak could be related to the formation of tightly-folded polymer chains in the 

suspension. 

Thin films of about 300 nm thickness were prepared by EPD from suspension and spin coating (SC) from solutions 

with a concentration of 0.0033 g.l -1 and 8.95 g.l -1 , respectively. 

Atomic force microscopy study of surface morphology shows that the SC technique produces films with smooth 

and flat surfaces. The surfaces of the films obtained by the EPD method are rougher. 

The fine film structure of the SC films does not result in better photovoltaic properties. 

The ITO|MDMO-PPV|Al structure with EPD MDMO-PPV films behaves as a photovoltaic cell, while the 

same sample configuration with SC MDMO-PPV films acts more like a photoresistor. EPD and SC films exhibit the 

same charge-carrier photogeneration mechanism. 

Keywords: Molecular electronics, Organic solar cells, Electrophoretic deposition, Spin coating, 

Poly[2-methoxy-5-(3,7-dimethyloctyloxy)-1,4-phenylene vinylene] 


Conjugated polymers are a class of organic semiconductors 

that have attracted much interest in recent 

decades from both fundamental and practical points of 

view.[1] The π-electron system on their main chain provides 

unique electronic and optical properties that could 

not be predicted by conventional solid state theories. 

Much effort has been devoted to developing electronic 

devices that use conjugated polymers as electroluminescent 

diodes, photovoltaic cells, gas sensors, 

and field-effect transistors.[2] In contrast to traditional 

∗ Corresponding author 

∗∗ Author of the initial concept 

Email addresses: xcmladenova@fch.vutbr.cz 

(D. Mladenova), zhivkov@fch.vutbr.cz (I. Zhivkov), 

ouzzane@fch.vutbr.cz (I. Ouzzane), vala@fch.vutbr.cz 

(M. Vala), dbudurova@polymer.bas.bg (D. Budurova), 

weiter@fch.vutbr.cz (M. Weiter) 

inorganic semiconductors, which require high processing 

temperatures, conjugated polymers are synthesized 

at near room-temperature conditions. Their solubility 

could be significantly improved to deposit wet-process 

films under atmospheric pressure. As a result, large-area 

films could be obtained by relatively inexpensive (compared 

to vacuum-based methods) coating technologies – 

spin and dip coating, spray and Langmuir Blodgett (LB) 

deposition, ink-jet printing, electrophoretic deposition, 

etc. 

The spin-coating (SC) technique is a widely used 

method to prepare high quality polymer films for electronic 

devices. However, this is one of the most uneconomical 

methods, because most of the solution dropped 

on the substrate is blown away during the spinning.[3] 

Electrophoretic deposition (EPD) allows the preparation 

of films of several hundred nanometers from a 

low suspension concentration.[4] The particle size in the 

EPD suspension can be controlled by changing the ratio 

Preprint submitted to Surface and Coatings Technology March 12, 2012

of solvent and non-solvent.[5] Deposition from a suspension 

with a high non-solvent concentration results 

in a rougher film structure. This effect seems to improve 

the performance of gas sensor devices[6], as the 

film porosity may enable the fast absorption/desorption 

of dopants and target molecules. In contrast, a deposition 

from a suspension with a high solvent concentration 

results in flat and uniform films, applicable as 

active layers in polymer electroluminescent devices or 

solar cells.[7] 

EPD enables quick patterned deposition, because the 

covered area can be specified by the electrification of 

selected electrodes.[8] 

The application of the EPD method in the development 

of thin layer based organic devices needs further 

investigation of the mechanism, kinetics of the electrophoretic 

process, and structure and properties of the 

films. 

This paper presents a comparative study of the properties 

of poly[2-methoxy-5-(3,7-dimethyloctyloxy)- 

1,4-phenylene vinylene] (MDMO-PPV) films deposited 

electrophoretically and cast by SC. The study seeks 

potential applications for these films in solar energy 

conversion technology and other branches of organic 

electronics. 

2. Material and methods 

A stock solution (concentration of 0.165 g.l -1 ) 

was prepared by dissolving 3.3 mg MDMO-PPV 

(Sigma-Aldrich, catalogue number: 546461) in 20 ml 

toluene (Sigma-Aldrich Toluene, catalogue number: 

PLC22C11X), then heating for 5 min at 60 ◦ C, followed 

by ultrasonic treatment for 10 min. A homogeneous solution 

without clearly visible undissolved particles was 

obtained. 

An EPD suspension with MDMO-PPV concentration 

of 0.0033 g.l -1 and toluene/acetonitrile ratio of 50% 

(Sigma-Aldrich Acetonitrile, catalogue number: 34851) 

was prepared. For a 20 ml suspension with a concentration 

of 0.0033 g.l -1 and toluene/acetonitrile ratio 

of 50%, 0.4 ml from the stock solution was diluted 

in 9.6 ml pure toluene, then 10 ml of acetonitrile 

was added. The suspension obtained clearly changes 

color[1], which could be related to the formation of (micro) 

nano-sized solid particles. The prepared suspension 

was immediately used for film deposition or measurement 

to prevent further particle coagulation. 

A solution (0% acetonitrile) with the same MDMO- 

PPV concentration of 0.0033 g.l -1 was prepared for optical 

absorption measurements. The optical absorption 

2 

spectra of the prepared suspension and solution were 

measured by a Varian Cary 50 UV-Vis dual beam spectrophotometer. 

The measurement was carried out in a 

quartz cuvette with an optical path of 10 mm. The baseline 

was taken from the cuvette, filled with pure toluene 

or toluene/acetonitrile mixture in a 1:1 ratio (50% acetonitrile). 

Then the spectra in the 650-270 nm range were 

measured. 

Figure 1: Electrophoretic cell with two ITO plate electrodes fixed at a 

distance of 3 mm 

An electrophoretic cell with two ITO plate electrodes 

fixed at a distance of 3 mm (Figure 1) was developed, 

simplifying a previously published construction.[3] The 

parallel electrode arrangement was adjusted by a proper 

spacer. The modified construction allows the removal of 

the spacer before immersing the cell in the suspension, 

reducing the dielectric induction and homogenizing the 

electric field between the electrodes. 

The electrical parameters (voltage and current) of 

the EPD process were controlled by the Keithley 2410 

SourceMeter (voltage range of 0 ÷1100 V and current 

measurement from 10pA to 1A). 

After applying voltage between the electrodes, the 

current continuously decreases. A deposition on the 

positive electrode starts when the current reaches about 

80-40 µA. The film, about 300 nm thick, completely 

grows within 3-4 min. 

A solution with a concentration of 8.95 g.l -1 was prepared 

and SC was done on the KW-4A Spin Coater 

(Chemat Technology, Inc.). Spinning was applied at 

1000 rpm for 3 sec. and 2600 rpm for 60 sec. to obtain 

about 300 nm-thick films.

The film thickness was determined by the chromatic 

distance method on the MicroProf R⃝ FRT optical surface 

measuring system. Samples for thickness measurement 

were prepared by scratching the film and a subsequent 

vacuum deposition of about 100 nm Al to equalize the 

optical reflection from both scratched and unscratched 

areas. 

Surface morphology images of MDMO-PPV films 

were taken by the NTEGRA Prima AFM. Measurements 

were carried out in tapping (semicontacting) 

mode (frequency of 170 kHz, amplitude 80-100 nm at a 

scanning rate of 0.8 Hz). 

Samples for electrical measurements of 

25×15 mm were cut from commercial ITO-coated 

glass slides (Sigma-Aldrich 636916-25PAK). The 

sample preparation is schematically drawn in Figure 2. 

The top Al electrodes of 100 nm thickness were 

deposited in a vacuum; copper wires were then bonded 

to the electrodes by a silver paste (Dotite R⃝ Silver Paint 

D-550). 

Photoelectrical measurements were carried out in an 

oil-free vacuum of 2.2×10 -5 Pa with the Keithley 6517A 

Electrometer. Monochromatic light was produced by 

a LOT-Oriel halogen lamp LSH502 and a LOT-Oriel 

monochromator MSH101. Light power was controlled 

by an iris diaphragm and measured by the Gigahertz- 

Optik - X97 Irradiance Radiometer. 

Figure 2: Preparation of a sample for photoelectrical measurement: 

a) structuring of ITO anode; b) MDMO-PPV deposition (EPD considered 

here); c) deposition of top Al cathode; d) wire bonding by a 

silver paste 

Photoelectrical measurements start with spectral dependence 

of the photocurrent at zero applied voltage; I- 

V characteristics were then measured in both directions 

of the voltage scale in the dark and exposed to light. 

Finally, the dependence of the photocurrent on the incidental 

light power (irradiance) was measured. The sample 

was exposed to monochromatic light at a wavelength 

of 560 nm. 

3 

3. Results and Discussion 

3.1. UV-VIS spectra 

The optical absorption spectra of the solution and 

the 50% toluene/acetonitrile suspension with the same 

MDMO-PPV concentration of 0.0033 g.l-1 are presented 

in Figure 3. The solution spectrum (Figure 3, 

curve 2) consists of the characteristic MDMO-PPV absorption 

peak.[9] The peak is slightly broad and asymmetric 

due to the ”red” shift with respect to the main 

peak shoulder. This effect could be related to a slight 

interaction of the MDMO-PPV molecules. 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

Figure 3: Optical absorption spectra of MDMO-PPV suspension 

(curve 1) and solution (curve 2) 

In the suspension spectrum (Figure 3, curve 1), 

the ”red” shoulder strength increases, which leads to a 

greater broadening of the peak. This effect could be related 

to the appearance of a precipitated solid phase during 

the suspension formation, caused by the polar precipitating 

acetonitrile. It is known that for more crystalline 

organic materials (e. g. poly(3-octylthiophene)), 

such precipitation can even lead to a ”red” shift of the 

whole characteristic absorption peak.[10] The effect of 

the peak broadening could be used for a qualitative estimation 

of the suspension properties. 

3.2. Film thickness measurement and surface morphology 

characterization 

2D and 3D AFM images of EPD and SC films deposited 

from the suspension and the solution (concentrations 

of 0.0033 g.l -1 and 8.95 g.l -1 , respectively) are 

presented in Figure 4. In both cases, a film thickness 

of about 300 nm was determined by recording the profile 

of a scratched area with a chromatic distance measurement. 

AFM 2D images of EPD and SC films show 

relatively smooth surfaces. The SC method results in a 

�

film with finer surface morphology (Figure 4b), which 

is an expected result. The surface morphology of the 

films obtained by EPD (Figure 4a) are rougher. Grains 

of about 0.2-0.5 µm diameter observed on both film surfaces 

could be considered as dust particles. 

Figure 4: AFM images of a) EPD and b) SC films; 2D (up) and 3D 

(down) images; scanned area of 5×5 µm 

From the dust-free areas of the EPD and SC films, average 

roughness values of 2.00 nm and 1.90 nm were 

found, respectively. The root mean square was calculated 

at the same conditions as 2.47 nm and 2.77 nm, 

respectively. 

3.3. Electrical measurements 

Spectral dependences of the photocurrent, measured 

at zero applied voltage between the electrodes for structures 

with EPD and SC MDMO-PPV films are presented 

in Figure 5, curve 1, and Figure 5, curve 2, 

respectively. 

Comparing Figures 3 and 5, it could be concluded 

that generally the MDMO-PPV photocurrent spectrum 

is similar to the absorption spectrum. There is a clear 

characteristic peak in the photocurrent spectrum at 560 

nm. The peak position is ”red” shifted (about 50 nm) 

with respect to the maximum of the absorption spectrum. 

This effect of energy gap reduction could be related 

to the formation of a solid state. The photocurrent 

peak obtained from EPD film (Figure 5, curve 

1) is slightly broader than the peak obtained from SC 

film (Figure 5, curve 2). This result is similar to that 

obtained from absorption spectra measurement (Sec. 

3.1). The photocurrent measured from structures with 

SC films is 3 times higher than that obtained from EPD 

samples. I-V characteristics measured in the dark on the 

ITO|MDMO-PPV|Al structure with SC MDMO-PPV 

4 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

Figure 5: Spectral dependence of the photocurrent at zero applied 

voltage: EPD (curve 1) and SC (curve 2) films of about 300 nm thicknesses 

film of about 300 nm thickness are presented in Figure 

6, curve 2. The curves are nonlinear and symmetrical. 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

Figure 6: I-V characteristics measured in the dark on the ITO|MDMO- 

PPV|Al structures with EPD (curve 1) and SC (curve 2) MDMO-PPV 

films of similar thicknesses about 300 nm 

The same type of measurement on structures with 

EPD MDMO-PPV films of about 300 nm thickness is 

presented in Figure 6, curve 1. In the second case 

the shape of the characteristics is typical for a diode 

structure. To estimate the electrical parameters of the 

samples, the same data are plotted in a semilogarithmic 

scale (Figure 7) (negative values of the current are multiplied 

by -1). 

From the dark current measurements on a sample 

with EPD film (Figure 7a, curve 1), a diode contact 

barrier could be observed at 0.16 V. Overcoming this 

barrier changes the sign but does not lead to a considerable 

increase of the current. Therefore this effect more 

probably results from the influence of charged defects in 

the depletion region of the diode. A similar but smaller 

�

Figure 7: I-V characteristics measured in the dark (curve 1) and under illumination (curve 2) with monochromatic light (λ=560 nm, irradiance 

0.59 mW.cm -2 ) on ITO|MDMO-PPV|Al structures with a) EPD and b) SC MDMO-PPV film with about 300 nm thicknesses 

contact barrier was observed on some of samples with 

SC films. Therefore it is probably not only connected 

with the EPD process, but more probably related to the 

metal (oxide)/organic interface. 

Overcoming the second contact barrier at 0.6 V leads 

to an exponential increase of the current. Therefore, this 

value could be considered as the diode forward voltage 

drop (Ud). Applying reverse bias, the electrical current 

slightly grows. Comparing the I-V characteristics (Figure 

7a, curve 1) in forward and reverse directions (at a 

±1.1 V voltage), a rectification ratio of 1.6×10 4 is determined. 

It could be concluded from the dark current 

measurements that the ITO|MDMO-PPV|Al structures 

with EPD MDMO-PPV film exhibit a clear diode behavior. 

I-V characteristics were measured on the same sample 

under illumination (Figure 7a, curve 2) with monochromatic 

light (λ=560 nm, irradiance 0.59 mW.cm -2 ). 

For positive voltages applied to a sample with EPD film, 

the I-V characteristics measured are similar to those 

measured in the dark (Figure 7a, curve 1). For negative 

applied voltages, the photocurrent measured is more 

than 2 orders of magnitude higher than the dark current, 

which express a clear photovoltaic (PV) cell behaviour. 

I-V characteristics measured on samples with SC 

MDMO-PPV films are nonlinear and symmetrical (Figure 

7b). 

Processing the data for the EPD MDMO-PPV PV 

cell (Figure 7a, curve 2) determined short circuit current 

Jsc=8.13×10 -10 A.cm -2 and open circuit voltage 

Uoc=0.5 V. From the area confined by Jsc and Uoc, 

the dependence of the electrical power on the voltage 

is plotted on Figure 8, right Y axis. The maximum 

electrical power found were Pmax=7.56×10 -8 mW.cm -2 

5 

at voltage Ump=0.18 V and current Jmp=4.20×10-10 A.cm-2 . 

The power conversion efficiency η=1.3×10-5 % is calculated. 

The low value of the power conversion efficiency 

measured for organic semiconductors is not exceptional. 

A similar value of 4.2×10-4 % was reported 

in the literature for MEH-PPV/C60 donor-acceptor composite, 

where acceptor doping is used to improve the 

efficiency.[11] 

�� 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

�� 

�� 

� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

Figure 8: Dependence of the power (right Y axis) and current (left Y 

axis) on the voltage applied, as calculated from Figure 7a, curve 2 

The power conversion efficiency could be considerably 

increased in some of the following ways: decreasing 

the film thickness; using donor-acceptor composite; 

and preparing multilayer structures to reduce the 

electrode/semiconductor contact barrier. Such investigations 

are beyond the scope of this work. It should 

be noted here that our previous work demonstrated the 

advantage of the EPD method for constructing a multilayer 

structure from films generally dissolved in the 

same solvent.[12] Similar multilayer structures could be

used further for decreasing the contact barrier. 

The dependences of the photocurrent on the incidental 

light power (irradiance) for EPD and SC MDMO- 

PPV films are plotted on Figure 9. In both cases, the 

photocurrent is proportional to Gγ , where G is the photogeneration 

rate and γ is the slope in the presented 

graphs. For the EPD and SC devices, a slope of 0.96 

and 1.03 is found, respectively. This result agrees with 

the literature data[13] and represents a monomolecular 

photogeneration mechanism. 

� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

�� 

Figure 9: Dependence of the photocurrent on the light intensity measured 

at a fixed wavelength of λ=560 nm on samples with EPD (curve 

1) and SC (curve 2) MDMO-PPV films 

It could be concluded that the EPD process of film 

preparation compared to the SC method does not change 

the photogeneration mechanism. The short circuit photocurrent 

measured from samples with SC films (Figure 

9, curve 2) follows the tendency observed in Figure 5 

and is about 1.5 times higher than EPD films (Figure 

9, curve 1). This result demonstrates the good photoconductive 

properties of the MDMO-PPV films, which 

could be observed at low contact barrier. It confirms that 

the key point for increasing the MDMO-PPV power efficiency 

is the optimization of the PV cell, thus increasing 

the Uoc. This could be achieved better with EPD 

(compared to SC) technique. 

4. Conclusion 

Absorption spectra of solution and suspension with 

the same MDMO-PPV concentration of 0.0033 g.l -1 

were measured. An observed broadening of the characteristic 

peak could be related to the formation of a solid 

phase in the suspension. 

Thin films of about 300 nm thicknesses were prepared 

by EPD from a suspension and SC from a solu- 

� 

�� 

6 

tion with a concentration of 0.0033 g.l -1 and 8.95 g.l -1 , 

respectively. 

The AFM surface morphology study shows that SC 

produces films with smooth and flat surfaces. The surfaces 

of the films obtained by EPD method are rougher. 

The fine film structure of the SC films does 

not result in better photovoltaic properties. 

ITO|MDMO-PPV|Al structure with EPD MDMO- 

PPV films behaves as photovoltaic cell; the same 

sample configuration with SC MDMO-PPV films acts 

more like a photoresistor. EPD and SC films exhibit the 

same mechanism of charge-carrier photogeneration. 


The authors are grateful to Prof. Stanislav Nespurek, 

Institute of Macromolecular Chemistry, Academy of 

Sciences of the Czech Republic, for his support and for 

many clarifying and stimulating discussions. 

This work was supported by the South Moravian Region 

and the Seventh Framework Programme for Research 

and Development (grant SIGA 885), by the IGA 

Brno University of Technology via FCH/FEKT-S-11-2 

project, Grant Agency of the Czech Republic project 

No. P205/10/2280, project ”Centre for Materials Research 

at FCH BUT” No. CZ.1.05/2.1.00/01.0012 supported 

by ERDF and the National Fund of the Ministry 

of Education and Science, Bulgaria (grant DO 02-254). 

References 

[1] A. J. Heeger, Rev. Mod. Phys. 73 (2001) 681. 

[2] J. H. Burroughs, D. D. C. Bradley, A. R. Brown, R. N. Marks, K. 

Mackay, P. L. Burns, A. B. Holmes, Nature 347 (1990) 539. 

[3] K. Tada, M. Onoda, J. Phys. D: Appl. Phys. 42 (2009) 172001 

(5pp). 

[4] K. Tada, M. Onoda, Thin Solid Films 518 (2009) 711-713. 

[5] K. Tada, M. Onoda, Jpn. J. Appl. Phys. 42 (2003) L1279. 

[6] J. J. Miasik, A. Hooper, B. C. Tofield, J. Chem. Soc., Faraday 

Trans. 1 82 (1986) 1117. 

[7] T. Piok, S. Gemarith, C. Gadermaier, H. Plank, F. P. Wenzl, S. 

Patil, D. Neher, Adv. Mater. 15 (2003) 800. 

[8] K. Tada, M. Onoda, Synthetic Metals 152 (2005) 341-344. 

[9] P. van Hal, M. Wienk, J. Kroon, W. Verhees, L. Slooff, W. van 

Gennip, P. Jonkheijm, R. Nanesen, Adv. Mater. 15 (2003) 118. 

[10] Vu Quoc Trung, Dissertation: Electrophoretic deposition of 

semiconducting polymer metal/oxide nanocomposites and characterization 

of the resulting films, Dresden, 2006, p. 109. 

[11] Xiaoliang Mo, Toshiko Mizokuro, Hiroyuki Mochizuki, Nobutaka 

Tanigaki, Takashi Hiraga, Jpn. J. Appl. Phys. 44 no. 1B (2005) 

656-657. 

[12] D. Mladenova, D. Dimov, D. Karashanova, S. Boyadzhiev, T. 

Dobreva, D. Budurova, V. Sinigersky, I. Zhivkov, J. Optoelectron. 

Adv. Mater. 12 (2010) 1952-1956. 

[13] V. D. Mihailetchi, J. Wildeman, P. W. M. Blom, Phys. Rev. Lett. 

94 (2005) 126602.

17th International Summer School on Vacuum, Electron, and Ion Technologies (VEIT 2011) IOP Publishing 

Journal of Physics: Conference Series 356 (2012) 012040 doi:10.1088/1742-6596/356/1/012040 

Characterization of electrophoretic suspension for thin 

polymer film deposition 

D Mladenova 1,2,5 , M Weiter 1 , P Stepanek 3 , I Ouzzane 1 , M Vala 1 , V Sinigersky 4 

and I Zhivkov 1,2 

1 Centre for Materials Research, Faculty of Chemistry, Brno University of Technology, 

118 Purkynova, 612 00 Brno, The Czech Republic 

2 Institute of Optical Materials and Technologies, Bulgarian Academy of Sciences, 

Acad. G. Bonchev Str. Bl. 101, 1113 Sofia, Bulgaria 

3 Department of Supramolecular Polymer Systems, Institute of Macromolecular 

Chemistry, Academy of Sciences of The Czech Republic, 

2 Heyrovskeho nam., 162 06 Praha 6, The Czech Republic 

4 Institute of Polymers, Bulgarian Academy of Sciences, 

Acad. G. Bonchev Str., Bl. 103A, 1113 Sofia, Bulgaria 

E-mail: dnl@clf.bas.bg 

Abstract. The optical absorption and fluorescence spectra of poly [2-methoxy-5-(3′,7′dimethyloctyloxy)-1,4-phenylenevinylene] 

toluene solutions and 50:50% toluene/acetonitrile 

suspensions show clearly distinguishable differences (e.g., peak broadening and shifting), 

which could be used for characterization of suspensions with different acetonitrile content. The 

dynamic light scattering (DLS) measurement of the suspensions prepared showed a particle 

size of 90 nm. Thin films with thicknesses of about 400 nm were prepared by electrophoretic 

deposition (EPD) and spin coating. As the films are very soft, a contactless optical profilometry 

techique based on chromatic aberration was used to measure their thickness. AFM imaging of 

spin coated and EPD films revealed film roughness of 20÷40 nm and 40÷80 nm, respectively. 

The EPD film roughness seems to be less than the suspension particle size obtained by DLS, 

probably due to the partial film dissolving by the toluene present in the suspension. 


Among the variety of the methods for “wet” polymer thin film deposition [1] (e. g. spin and dip 

coating, spray and Langmuir-Blodgett deposition, and ink-jet printing), the electrophoretic deposition 

(EPD) [2] has the advantages of using a diluted suspension for deposition of relatively thick films, 

ability for covering a large area and the unique property of separating the solidification stage 

(precipitation of a solid phase in the suspension) from the film formation stage, which takes place on 

the electrode. 

One of the main problems impeding the wide usage of EPD for thin polymer film preparation is the 

instability – the suspension particle size depends strongly on the precipitation conditions and tends to 

5 To whom any correspondence should be addressed. 

Published under licence by IOP Publishing Ltd 

1



grow with the time. This effect creates difficulties in controlling the EPD thin film structure and 

morphology. 

This study aims to establish methods for characterization of critical stages of the EPD process of 

deposition of thin poly[2-methoxy-5-(3′,7′-dimethyloctyloxy)-1,4-phenylenevinylene] (MDMO-PPV) 

films. 

2. Experimental details 

The EPD suspension with MDMO-PPV (Sigma-Aldrich, catalogue number 546461) concentration of 

0.0033 g l -1 and toluene/acetonitrile ratio of 50:50% (toluene 99.8%, acetonitrile 99.8%) was prepared 

and used immediately for measurement or deposition to prevent further particle coagulation. 

Dynamic light scattering (DLS) measurements of the suspension prepared were performed on a 

Malvern Zetasizer Nano ZS instrument equipped with a helium-neon laser; the scattering angle was 

173°. The data were processed taking into account the viscosity of the toluene/acetonitrile mixture 

with 50 % acetonitrile content [3]. 

The EPD thin film was deposited on the positive electrode at a current of about 50÷70 µA. 

A solution with concentration of 8.95 g l -1 was prepared and spin coating at approx. 2500 rpm for 

60 s was carried out on a KW-4A Chemat Technology Inc. spin coater. 

The film thickness of the deposited MDMO-PPV films was determined by a MicroProf® FRT 

optical profilometer based on chromatic aberration. The method has the advantage of performing fast 

high-resolution contactless and non-destructive measurements, which is of paramount importance in 

our case of soft polymer films. The films were scratched by a sharpened tungsten wire then a thin 

(about 100 nm) Al film was deposited in vacuum to equalize the optical reflection from both scratched 

and unscratched areas. 

Surface morphology images of MDMO-PPV films were taken by NTEGRA Prima AFM. The 

measurements were carried out in semicontacting mode (frequency of 170 kHz, amplitude 80÷100 nm 

and scanning rate of 0.5 Hz). 


3.1. Suspension characterization 

3.1.1. Absorption spectra. Optical absorption spectra of a solution and a 50:50 % toluene/acetonitrile 

suspension with the same MDMO-PPV concentration of 0.0033 g l -1 are presented in figure 1. The 

solution spectrum (curve 1) consists of the characteristic MDMO-PPV absorption peak [4]. 

In the suspension (curve 2) spectrum, a “red” shoulder appears which leads to a broadening of the 

peak. This effect could be related to the appearance of a precipitated solid phase during the suspension 

formation caused by the precipitating polar acetonitrile. 

Absorbance units 

0.3 

0.2 

0.1 

0% - 1 

50% - 2 

0.0 

350 400 450 500 550 600 

Wavelength, � [nm] 

Figure 1. Absorption spectra of a MDMO- 

PPV solution (curve 1) and a suspension 

with 50% acetonitrile content (curve 2). 

2 

Emission, [a.u.] 

7 0% -1 

50% -2 

6 

5 

4 

3 

2 

1 

0 

450 500 550 600 650 700 750 800 

Wavelength, � [nm] 

Figure 2. Fluorescence spectra of a MDMO- 

PPV solution (curve 1) and a suspension with 

50% acetonitrile content (curve 2).



3.1.2. Fluorescence spectra. More detailed information about the material under study can be obtained 

from the fluorescence spectra, as they present information from two processes – absorption and 

subsequent emission. In figure 2, fluorescence spectra of a MDMO-PPV solution (curve 1) and a 

suspension with 50 % acetonitrile (curve 2) are plotted. The maximum of the spectrum in the 

suspension is “red” shifted by about 30 nm. The spectrum shift reflects more precisely the formation 

of the solid phase. 

It could be concluded that effect of the peak 

0.8 

20 

broadening in the absorption spectra could be used 

15 

for a qualitative estimation of the suspension 

0.6 

10 

properties, while the peak shifts in the fluorescence 

5 

spectra yield more detailed information about the 

0.4 

0 

formation of a solid phase in the suspension. 

3.1.3. Dynamic light scattering. The size of the 

particles forming the solid-state phase in the 

toluene/acetonitrile suspension with 50 % 

acetonitrile content was estimated by DLS. The 

typical correlation function obtained (figure 3) 

allows a straightforward determination of the 

particle size. The inset in the figure presents the 

particle size distribution by the intensity obtained 

using inverse Laplace transformation. The data 

obtained indicate an average particle diameter of 

90 nm. 

3.2. Thin film characterization 

3.2.1. Optical profilometer film thickness 

measurement. Figure 4, a) and b) present scanned 

optical aberration images of a scratched 

MDMOPPV. The scratched area is clearly 

distinguished, which allows a satisfactory film 

thickness determination. A film thickness of about 

400 nm was determined by processing the data 

from a single profile line (figure 4, c). Optical- 

aberration 3D and 2D images can be used as a 

Correlation function 

a) 

b) 

c) 

0.2 

0.0 

10 0 

average size 90 nm 

10 1 

Intensity (%) 

10 1 

10 2 

Time (�s) 

10 2 

Size, d (nm) 

10 3 

Figure 3. DLS measured curves. 

10 3 

10 4 

Figure 4. Optical aberration scanning 

of a scratched MDMO-PPV film: a) – 3D, 

b) – 2D and c) – 1D images. 

preliminary film-surface morphology estimation. 

A film thickness of about 400 nm was measured by the same procedure for the spin-coated films. 

3.2.2. AFM imaging. 2D and 3D AFM images of EPD deposited films are shown in figure 5. The 

surface roughness observed is less than but comparable to the particle size as obtained by DLS. 

Despite the general assumption that the size of the particle in the suspension should be preserved after 

EPD of a film [5], partial dissolving of the particles deposited on the substrate by the solvent (50% 

toluene in the suspension) is possible, which decreases the film roughness. Thus, varying the 

toluene/acetonitrile ratio gives an opportunity to control the film roughness. 

For comparison, the AFM image of a spin-coated film with similar thickness is presented in 

figure 6. The picture shows a predominant film surface roughness of 20÷40 nm, which is smoother 

than the surface of the EPD film. The peaks observed with height approx. 50÷70 nm could be 

connected with the presence of undissolved or aggregated MDMO-PPV particles due to the relatively 

high solution concentration. 

3



Figure 5. AFM 2D and 3D images of an EPD 

film measured on a 5�5 µm scanned area. 

Figure 6. AFM 2D and 3D images of a spin 

coated film measured on 5�5 µm scanned area. 

Conclusions 

A combination of experimental methods was applied to the characterization of the different stages of 

the polymer electrophoretic deposition process. The methods could be used to control the suspension 

stability and the film structure and morphology, which are critical parameters during the EPD of thin 

polymer films for solar energy conversion purposes. 


This work was supported by the South Moravian Region and the 7 th Framework Program for Research 

and Development (Grant SIGA 885), and by the Bulgarian National Science Fund at the Ministry of 

Education, Youth and Science (Grant DO 02-254). 

References 

[1] Tada K and Onoda M 2009 Molecular Crystals and Liquid Crystals 505 124-9 

[2] Boccaccini A R and Zhitomirsky I 2002 Current Opinion in Solid State and Materials Science 

6 251-60 

[3] Rltroulls G, Papadopoulos N and Jannakoudakls D 1986 J. Chem. Eng. Data 37 146-8 

[4] Quoc T V 2006 Electrophoretic deposition of semiconducting polymer metal/oxide 

nanocomposites and characterization of the resulting films (Dresden Technischen 

Universität Dresden Germany) p 109 

[5] Landfester K, Montenegro R, Scherf U, Gqnter R, Asawapirom C, Patil S, Neher D and 

Kietzke T 2002 Adv. Mater. 14 651 

4

Materials Science and Engineering B 165 (2009) 148–152 


Materials Science and Engineering B 

journal homepage: www.elsevier.com/locate/mseb 

Morphology and properties of thin films of diketopyrrolopyrrole derivatives 

Martin Weiter a , Ota Salyk a , Pavel Bednáˇr a , Martin Vala a ,Jiˇrí Navrátil a,∗ , Odlˇrich Zmeˇskal a , 

Jan Vyňuchal b , Stanislav Luňák Jr. c 

a Brno University of Technology, Faculty of Chemistry, Purkynova 118, 612 00 Brno, Czech Republic 

b Research Institute of Organic Syntheses, Rybitví 296, 533 54 Rybitví, Czech Republic 

c Department of Technology of Organic Compounds, Faculty of Chemical Technology, University of Pardubice, Studentská 95, 530 09 Pardubice, Czech Republic 

article info 


Received 29 August 2008 

Received in revised form 4 September 2009 

Accepted 23 September 2009 

Keywords: 

Surface morphology 

Organic substances 

Chemical vapour deposition 

Electron microscopy 

Thin films 


abstract 

Organic electronic devices based on different types of organic 

semiconductors such as polymers, oligomers, dendrimers, dyes 

and pigments are already entering the commercial world. Among 

them the small organic molecule thin films are the subject of 

intense research activity as they provide high quality thin films and 

nanostructures. This paper deals with derivatives of 3,6-diphenyl- 

2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4 diones, commonly referred 

as DPP, which constitute a promising class of small molecular semiconductors. 

These compounds have been the object of intensive 

research for pigment application since 1974 as their exhibit a variety 

of shades in the solid state and especially chemical, light and 

thermal stability [1,2]. DPP itself has a high molar absorption coefficient, 

as well as high quantum yield of fluorescence, therefore low 

molecular weight derivatives of DPP have been extensively studied 

on their optical and photophysical properties [3–5]. Potential 

application of DPP derivatives as a luminescent media in a polymer 

matrices [6–8], solid-state dye lasers [9], OLED devices [10] 

and organic field-effect transistors [11] was reported. Recently a 

new application as hydrogen sensing material utilizing variable 

conductivity of DPP pyridyl derivative occurred [12]. 

Thin films of small molecular semiconductors are usually prepared 

by means of a variety of complex techniques including 

physical or chemical vapour deposition, organic molecular beam 

∗ Corresponding author. Tel.: +420 541149396; fax: +420 541211697. 

E-mail address: xcnavratil@fch.vutbr.cz (J. Navrátil). 

0921-5107/$ – see front matter © 2009 Elsevier B.V. All rights reserved. 

doi:10.1016/j.mseb.2009.09.017 

Thin layers of five derivatives of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4 diones, which constitute 

a promising class of small molecular semiconductors, were investigated. The morphology of the 

thin layers prepared by both vacuum evaporation and spin casting were studied using Scanning Electron 

Microscopy and Atomic Force Microscopy. The relation between molecular structure and their thin films 

morphology was found. The electroluminescence behaviour of selected derivatives is also discussed with 

regard to morphology studies. 

© 2009 Elsevier B.V. All rights reserved. 

epitaxy or solution-based deposition techniques. The performance 

of small molecular organic devices has been shown to be highly 

sensitive to film morphology and processing conditions. Often, the 

solution deposited active layers of devices (e.g. spin cast films) 

exhibit a high portion of microcrystallites and aggregates whereas 

the vapour deposition techniques provide high quality crystalline 

films, characterized by improved charge transport properties compared 

with those of solution deposited films. The relationship 

between the organic thin film morphology and the device performance 

is nowadays subject of the research activity. 

In this study we investigated a group of five DPP derivatives 

depicted in Fig. 1. In order to increase solubility required for low 

cost solution-based casting, the basic DPP structure was modified 

by different alkyl substitutions on the nitrogen atoms. In addition, 

the electronic properties of one derivative (DPP VI) were altered by 

di-donor substitution. 

Our previous studies based on quantum chemical calculations 

showed that both symmetrically (DPP III, DPP V, DPP VI) and nonsymmetrically 

(DPP II, DPP IV) substituted derivatives have rotated 

phenyl groups, as opposed to the non-substituted basic structure, 

which is nearly perfectly planar. The substitution of alkyl 

chain leads to the rotation of the adjacent phenyl group. The symmetrically 

substituted derivatives have thus rotated both phenyls. 

The rotation was independent on the length of the alkyl chain. 

These rotations subsequently modified absorption and photoluminescence 

spectra [13]. The theoretical results were confirmed 

by experimental optical characterization of solutions of selected 

derivatives. They showed that the increasing phenyl torsion leads 

to reduction of the conjugation extend and subsequently to a slight

M. Weiter et al. / Materials Science and Engineering B 165 (2009) 148–152 149 

Fig. 1. Structure of basic DPP molecule and prepared derivatives and their temperatures of melting point. 

hypsochromic shift of the absorption and bathochromic shift of the 

photoluminescence spectra as predicted from the calculations. The 

vibrational structure was less pronounced with increasing phenyl 

torsion and larger Stokes shift was observed. Simultaneously, the 

molar absorptivity decreased as the deformation increased. On the 

other hand, the measured fluorescence quantum yields were modified 

only slightly [13]. These properties, together with chemical, 

light and thermal stability predestine them as potential candidates 

for different optoelectronic applications. Therefore the film forming 

and electroluminescence properties of these materials were investigated 

and the question of relation between the chemical structure 

and morphology of prepared thin films was addressed. 


The DPP derivatives were synthesized and analyzed to confirm 

the molecule structure by A Bruker AMX 360 NMR spectrometer, 

ion trap mass spectrometer MSD TRAP XCT equipped with 

APCI, EA 1108 FISONS instrument for elemental analysis and 

Fourier transform infrared spectrometer (see [13] for details). 

Thin films were prepared by spin coating and by vacuum evaporation 

method. Low resistivity silicon substrates were used 

for morphology studies, whereas indium tin oxide (ITO) coated 

low alkali Corning glass was used for electro-optical and quartz 

glass for optical characterization. Thin layers spin-casted from 

chloroform–toluene solution (7:3) were typically 100–200 nm 

thick as measured by elipsometry. The vacuum deposition of 

200 nm thick layers was carried out at a pressure of 1 × 10 −4 Pa 

with deposition rate from 0.2 to 0.5 nm/s. The substrate temperature 

was maintained constant during the deposition process, being 

in the range 250–420 K. The annealing of the films was carried 

out in vacuum at various temperatures with regard to melting 

point of annealed substances. The morphology of the samples 

was investigated by Scanning Electron Microscopy (SEM) and by 

Atomic Force Microscopy (AFM). Multilayered sandwiched structures 

consisting of hole transport layer, emissive layer and electron 

transport layer were prepared for electroluminescence characterization. 

ITO covered glass substrates were used as transparent 

anodes. Subsequently, a hole-transporting layer of poly(3,4ethylenedioxythiophene):poly(styrenesulfonic 

acid) (PEDOT:PSS) 

and active electroluminescence layer of DPP derivative were spincasted. 

The structure was completed by vacuum deposition of 

electron-transporting layer of aluminium tris(8-hydroxyquinoline) 

(Alq 3) covered by vacuum deposited 100 nm thick aluminium top 

electrode. 

Fig. 2. Comparison of the structure of the thin layers of the basic DPP material DPP I 

prepared at different substrate temperatures as probed by SEM: (a) 255 K, (b) 290 K, 

(c) 373 K and (d) 423 K.

150 M. Weiter et al. / Materials Science and Engineering B 165 (2009) 148–152 


3.1. Morphology 

Thin layers prepared by both spin casting and vacuum depositions 

were polycrystalline but the shapes and dimensions of 

crystallites were found to be dependent on the structure of the 

materials and temperature of the substrate during deposition. The 

effect of substrate temperature T S during vacuum evaporation on 

film morphology of the basic DPP structure (DPP I) which exhibits 

highest melting point is illustrated in Fig. 2. At lower substrate 

temperatures (T S = 255 K and T S = 290 K) the dominating forms are 

oval crystallites forming island structure, whereas at higher T S 

(T S = 373 K and T S = 423 K) chaotically oriented ribbon-like crystallites 

of length increasing up to 1 �m prevail. 

The formation of larger clusters with increasing T S can be 

described as a thermally activated process in the coarse of which 

a particle impinged onto the substrate surface can move laterally 

unless it loses its kinetic energy and finds the energy potential 

well. It is usually after joining with other particles and this particle 

– molecules – cluster is the nucleus of future columnar or 

island structure. The high deposition temperature also significantly 

decreases the adhesion of deposited layers. It is caused by subsequent 

shrinkage during cooling, which is more pronounced for 

organic layers than for substrates and it resulted in peeling observable 

especially at T S = 423 K. The free crystallites endings in space 

give high reflection in SEM due to the charging and therefore they 

appear as bright spots. 

The studies made with different substrates show that the morphology 

is practically independent on the nature of the substrate. 

The key impact on the morphology of thin layers was found to be 

Fig. 3. Comparison of the structure of the thin films evaporated at room temperature 

as probed by SEM: (a) basic DPP molecule DPP I, (b) symmetrically substituted DPP 

III, (c) monosubstituted DPP IV, and (d) functionalized symmetrically substituted 

DPP VI. 

based on the substitution of central DPP unit by alkyl side chains 

with different lengths. Seeing that the influence of alkyl chain 

length is minor, the crucial factor is the type of substitution, which 

can be unsymmetrical (one substituted alkyl chain) in the case of 

Fig. 4. Surfaces of the thin films evaporated at room temperature as studied by AFM: (a) basic DPP molecule DPP I, (b) symmetrically substituted DPP III, (c) monosubstituted 

DPP IV, and (d) functionalized symmetrically substituted DPP VI.

Fig. 5. Current–voltage characteristics and total electroluminescence intensity of 

derivative DPP VI and the device structure as an insert. 

derivatives DPP II, DPP IV or symmetrical (two substituted alkyl 

chains) in case of derivatives DPP III, DPP V and DPP VI. A comparison 

of the structure of evaporated thin films probed by SEM 

is depicted in Fig. 3, the surfaces of the layers studied by AFM are 

shown in Fig. 4. 

The figures reveal that the symmetrically substituted derivatives 

form planar large crystallites with sizes increasing up to 1 �m, 

whereas the asymmetrically substituted derivatives form highly 

rough fiber crystallites, their lengths being up to 1 �m. It was found 

that the crystal size is slightly dependent on the alkyl chain length; 

in particular the derivative DPP II monosubstituted by butyl (C 4H 9) 

side chain forms smaller fiber crystallites in comparison with their 

analog DPP IV substituted by heptyl (C7H 15). This effect is worse 

distinguishable at planar large crystallites formed by symmetrically 

substituted derivatives DPP III and DPP V. Spontaneous crystallization 

of these materials after deposition was observed, but should 

be inhibited by annealing which also stabilizes the interfaces. The 

morphology of the samples prepared by spin casting was also studied, 

but no significant differences were recognized. 

The observed behaviour can be explained according to the 

molecular structure. It is worth to note, that the basic DPP molecule 

is almost planar and its intermolecular energy was calculated [14] 

deriving from �–� stacking forces (42%), hydrogen bonds (21%), 

electrostatic attraction and other minor contribution. Substitution 

of the alkyl group led to the rotation of the adjacent phenyl group 

and therefore not only caused loss of planarity and effective conjugation 

but also interfered with the intermolecular �–� stacking 

of the aryl rings. Introduction of the second alkyl also rotates the 

second phenyl which intensifies the above phenomena. This is 

exemplified as the decrease of melting point starting from 580 K for 

unsubstituted DPP DPP I, through 523 K and 484 K for monosubstituted 

DPP II and DPP IV, down to 393 K and 383 K for symmetrically 

substituted DPP III and DPP V. 

3.2. Electroluminescence 

On the basis of the findings described above symmetrically 

substituted derivatives DPP III, DPP V and DPP VI resulted as 

suitable for electroluminescence (EL) characterization. The typical 

current–voltage (I–V) characteristic together with electroluminescence 

(EL) intensity of DPP VI derivative is depicted in Fig. 5 in 

double logarithmic scale. It shows that the turn-on voltage for this 

diode is ∼3 V. At this voltage the previously ohmic nature of the 

I-V characteristic changes to the space-charge-limited, where the 

current flow is bulk-limited. The low value of the turn-on voltage 

implies that reasonable charge balancing was achieved due to 

M. Weiter et al. / Materials Science and Engineering B 165 (2009) 148–152 151 

Fig. 6. Normalized electroluminescence spectra of symmetrically substituted 

derivatives. 

the barrier reducing pre-contact layers (PEDOT:PSS and Alq3). This 

allowed us to measure also the spectrally resolved electroluminescence 

of the selected derivatives, see Fig. 6. The spectral position of 

the EL coincides with the position of fluorescence of the respective 

thin films. 

The normalized electroluminescence spectra show that the electroluminescence 

depends on the substitution used rather than on 

the length of the alkyl chains used, which is in accordance with the 

quantum chemical calculations and optical spectroscopy measurement 

[1]. The substitution of piperidine groups on phenyls led to the 

large bathochromic shift of the absorbance and photoluminescence 

spectra and thus also to the observed EL. The EL efficiency is low, 

as only basic unoptimized OLED structure was used in this device 

structure ITO/PEDOT:PSS (60 nm)/U29 (150 nm)/Alq3 (40 nm)/Al 

(200 nm) the thickness was obtained by elipsometry. However, the 

EL response depends on many material parameters and the optimization 

of multilayered structure is necessary. 


The morphology of thin films of DPP derivatives prepared by 

both evaporation and spin coating methods were studied by SEM 

and AFM. It was found that the crucial factor affecting morphology 

is type of substitution of basic DPP by alkyl chains, which can 

be unsymmetrical or symmetrical. The symmetrically substituted 

derivatives form planar large crystallites, whereas the asymmetrical 

ones form highly rough fiber crystallites. The symmetrically 

substituted derivatives showed a significant electroluminescent 

behaviour, nevertheless the optimization of multilayered structure 

is necessary to achieve high electroluminescence efficiency. 

Acknowledgment 

This work was supported by the Ministry of Industry and Trade 

of the Czech Republic by project FT-TA3/048 and by the Grant 

Agency of Academy of Science via project A401770601. 

References 

[1] O. Wallquist, Diketopyrrolopyrrole (DPP) pigments, in: High Performance Pigments, 

Wiley–VCH publishers, Weinheim, 2002. 

[2] M. Herbst, K. Hunger, Industrial Organic Pigments, Wiley–VCH publishers, 

Weinheim, 1993. 

[3] M. Fukuda, K. Kodama, H. Yamamoto, K. Mito, Dyes Pigments 53 (2002) 67–72. 

[4] J. Mizuguchi, A.C. Rochat, J. Imag. Sci. 32 (1988) 135. 

[5] J. Mizuguchi, J. Phys. Chem. A 104 (2000) 1817. 

[6] G. Lange, B. Tieke, Macromol. Chem. Phys. 200 (1999) 106–112. 

[7] T. Beyerlein, B. Tieke, Macromol. Rapid Commun. 21 (2000) 182–189.

152 M. Weiter et al. / Materials Science and Engineering B 165 (2009) 148–152 

[8] M. Smet, B. Metten, W. Dehaen, Tetrahedron Lett. 42 (2001) 6527–6530. 

[9] M. Fukuda, K. Kodama, H. Yamamoto, K. Mito, Dyes Pigments 63 (2004) 

115–125. 

[10] Patents WO 2004/090046, US 2005/0008892. 

[11] H. Yanagisawa, J. Mizuguchi, S. Aramakil, Y. Sakai, Jpn. J. Appl. Phys. 47/6 (2008) 

4728–4731. 

[12] H. Takahashi, J. Mizuguchi, J. Appl. Phys. 034908 (2006) 100. 

[13] M. Vala, M. Weiter, J. Vyňuchal, P. Toman, S. Luňák Jr., J. Fluoresc. (2008), 

doi:10.1007/s10895-008-0370-x. 

[14] D. Thetford, J. Cherryman, A.P. Chorlton, R. Docherty, Dyes Pigments 63 (2004) 

259–276.

Special Issue: Research Article 

Received: 10 January 2008, Accepted: 25 May 2008, Published online in Wiley InterScience: 18 November 2008 

(www.interscience.wiley.com) DOI: 10.1002/pat.1260 

Model of the influence of energetic disorder 

on inter-chain charge carrier mobility in 

poly[2-methoxy-5-(2 0 -ethylhexyloxy)p-phenylene 

vinylene] 

Petr Toman a *, Stanislav Nesˇpu˚rek a,b , Martin Weiter b , Martin Vala b , 

Juliusz Sworakowski c , Wojciech Bartkowiak c and Miroslav Mensˇík a 

The theoretical model of the inter-chain charge carrier mobility in poly[2-methoxy-5-(2(-ethylhexyloxy)-p-phenylene 

vinylene] (MEH–PPV) doped with polar additive is put forward. The polymer chain states of a charge carrier were 

calculated by means of diagonalization of a tight-binding Hamiltonian, which includes disorder in both the local 

energies and transfer integrals. Consequently, the inter-chain charge carrier transport is taking place on a spatially 

and energetically disordered medium. Because it is believed that the additive does not significantly influence the 

polymer supramolecular structure, the polymer conformations were simplified as much as possible. On the other 

hand, the energetic disorder is rigorously described. The transfer rates between the polymer chains were determined 

using the quasi-classical Marcus theory. The model considered the following steps of the charge carrier transport: the 

charge carrier hops to a given polymer chain. Then, the charge carrier thermalizes to the Boltzmann distribution over 

all its possible states on this chain. After that, the charge carrier hops to any possible state on one of the four nearest 

neighboring chains. The results showed that the inter-chain charge carrier mobility is very strongly dependent on the 

degree of the energetic disorder. If the energetic disorder is doubled from 0.09 to 0.18 eV, the mobility decreases by 

two or three orders of magnitude. Copyright ß 2008 John Wiley & Sons, Ltd. 

Keywords: charge transport; conducting polymers; photochromism; Monte Carlo simulation; quantum chemistry 

INTRODUCTION 

Recently, poly[2-methoxy-5-(20-ethylhexyloxy)-p-phenylene vinylene] 

(MEH–PPV) was intensively studied because it exhibits 

properties that are interesting for many applications in material 

science. [1–3] 

It has attracted considerable attention due to its 

semiconductivity, photosensitivity, sensing properties, electroluminescence, 

etc. The numerous applications, including sensors 

for different gases, solar cells, field-effect transistors, electroluminescent 

diodes, etc., were mentioned. [4–6] For the efficient 

functioning of many of these devices, charge carrier transport 

plays an important role. [7] The charge carrier mobility must be as 

high as possible. Thus, the studies of transport properties 

represent an important point of the research. 

Charge carrier transport in 3D polymeric materials consists of 

charge moving through the chain (molecular wire) and of 

inter-chain hopping. [8] The transport states of the both features 

are usually characterized by geometrical and energetic disorder; 

thus, the charge moving is influenced by hopping mechanism 

through the intra-chain states (tail states) and by inter-molecular 

hops. The energy distribution of the transport states is strongly 

influenced by the dispersion of polarization energy. Note that 

intra-chain hopping states are usually shallower. It was found that 

the mobility value can be influenced by doping. [9] Some highly 

polar additives decrease the value of charge carrier mobility in 

Polym. Adv. Technol. 2009, 20 263–267 Copyright ß 2008 John Wiley & Sons, Ltd. 

the doped polymer. The occurrence of polar species in the 

polymer material results in the broadening of both types of the 

energy distribution. In this paper, we describe the background 

and energy distribution of the transport hopping states and the 

influence of the dipolar additives on charge carrier transport. 

* Correspondence to: P. Toman, Institute of Macromolecular Chemistry, Academy 

of Sciences of the Czech Republic, v.v.i., Máchova St. 7, 120 00 Praha 2, 

Czech Republic. 

E-mail: toman@imc.cas.cz 

a P. Toman, S. Nesˇpu˚rek, M. Mensˇík 

Institute of Macromolecular Chemistry, Academy of Sciences of the Czech 

Republic, v.v.i., Heyrovsky´ Sq. 2, 162 06 Prague 6, Czech Republic 

b S. Nesˇpu˚rek, M. Weiter, M. Vala 

Faculty of Chemistry, Brno University of Technology, Purkyňova 118, 612 00 

Brno, Czech Republic 

c J. Sworakowski, W. Bartkowiak 

Institute of Physical and Theoretical Chemistry, Wroclaw University of 

Technology, Wyb. Wyspiańskiego 27, 50-370 Wroclaw, Poland 

Contract/grant sponsor: Czech Science Foundation; contract/grant number: 

203/06/0285. 

Contract/grant sponsor: Wroclaw University of Technology. 

263

264 

INTRA-CHAIN STATES AND CHARGE 

TRANSPORT THROUGH THE 

MOLECULAR WIRE 

The polymer chain states can be calculated by means of a 

method similar to the modeling of the on-chain charge carrier 

mobility presented in our previous paper. [10] The polymer chain is 

modeled by a sequence of N sites corresponding to the repeat 

units (alternating phenylenes and vinylenes). The charge carrier 

motion on such a chain can be described by the tight-binding 

approximation Hamiltonian: 

H ¼ XN 

n¼1 

where a n and a þ n 

"na þ n an bn;nþ1 a þ nþ1 an þ a þ n anþ1 (1) 

are annihilation and creation operators of a 

charge carrier at an nth site, en the energy of a charge carrier 

localized at this site, and bn,n þ 1 is the transfer integral between 

the sites n and n þ 1. Both quantities en and bn,n þ 1 are influenced 

by the random structure of the polymer chain and its 

surrounding. 

Using this Hamiltonian (1) with the molecular parameters en 

and b n,n þ 1 and the hole (MEH–PPV is the hole transporting 

material) wave function 

jcðtÞi ¼ XN 

cnðtÞjni (2) 

n¼1 

where jni is a state located at nth site; the time-dependent 

Schrödinger equation can be written in the form 

HjcðtÞi ¼ ih @ 

@t cðtÞ j i (3) 

This equation can be solved either by means of the direct 

numerical integration [10] or using stationary states jwni, which are 

solutions of the time-independent Schrödinger equation 

H j’ ni 

¼ En j’ ni 

(4) 

The solution of eqn (3) is then given by the relation 

jcðtÞi ¼ XN 

n¼1 

kne iEnt 

h j’ ni 

(5) 

in which the time-independent coefficients kn can be found from 

the initial conditions c 0(t ¼ 0) ¼ 1 and c i(t ¼ 0) ¼ 0 for any i 6¼ 0. 

While both approaches, i.e. direct numerical integration of eqn 

(3) and solution using stationary states, yield identical charge 

carrier wave function jc(t)i, the latter also provides the spectrum 

of the energy eigenvalues En and eigenstates jwni for charge 

carrier. 

For the case of polar additive, the transfer integrals b n,nþ1 and 

the energetic disorder of en were calculated according to the 

model described in Reference 10. Because the mutual interactions 

of the additive molecules were neglected, the standard 

deviation s(e n) of the e n distribution was proportional to the 

dipole moment m of the additive and to the square root of the 

additive concentration Hc. The energetic disorder can be easily 

quantified by the standard deviation of the e n distribution, which 

is broadened in this case. However, there are also some other 

characteristics, like site-to-site correlation, that are important for 

Figure 1. Diagram of the polymer valence band. The value of the 

energetic disorder is indicated by the standard deviation s(e). Curve 

s(e) ¼ 0 corresponds to the as prepared polymer and curves s(e) ¼ 0.18 

and 0.36 eV to the polymer doped with the additives with different dipole 

moments. If the additive concentration is 0.4 nm 1 , these values correspond 

to the additive dipole moments 6 and 12 D, respectively. 

obtaining correct results. For typical values of m ¼ 12 D and 

c ¼ 1 10 4 A˚ 3 , the standard deviation s(en) ¼ 0.18 eV. Note that 

this model of the energetic disorder does not take into account 

the polarization effects of the reaction field of the dipoles. 

Figure 1 shows a typical diagram of the valence band of the as 

prepared and doped polymer. An increasing energetic disorder 

leads to the broadening of the originally sharp valence band edge 

and formation of the tail states in the gap. These states, owing to 

their relatively low density and consequently a weak connectivity, 

behave as hole traps. Furthermore, the valence states in a doped 

polymer are less delocalized along the polymer chain than the 

states in the as prepared polymer (as shown in Fig. 2). 

THEORETICAL MODEL OF THE 

INTER-CHAIN HOPPING 

P. TOMAN ET AL. 

The description of the inter-chain charge carrier motion in 

conjugated polymers is difficult due to the absence of any 

Figure 2. Delocalization of the charge carrier chain states on the polymer 

chain. The graphs on the left describe the as prepared polymer and 

the graphs on the right the doped polymers. Top graphs show the HOMOs 

and bottom graphs show the orbitals from the middle of the upper 

branch of the valence band. 

www.interscience.wiley.com/journal/pat Copyright ß 2008 John Wiley & Sons, Ltd. Polym. Adv. Technol. 2009, 20 263–267

INTER-CHAIN CHARGE TRANSPORT IN DOPED MEH–PPV 

well-ordered crystal structure typical for molecular crystals or 

inorganic semiconductors. Conjugated polymer chains are 

twisted and kinked and possess a rather high ratio of chemical 

defects. The structural disorder of a polymer chain is accompanied 

by an energetic disorder, i.e. some kind of more or less 

random distribution of the energies of the energetic states of the 

chain, in which the charge carrier can be found. The disordered 

chain structure results in a disordered supramolecular structure 

of the material. Thus, the inter-chain charge carrier transport is 

realized in spatially and energetically disordered systems. 

Moreover, such a system is dynamic and undergoes relaxation 

related to the charge carrier motion, which is called a polaron 

formation. Hence, it is hardly possible to describe the charge 

carrier transport completely from the first principles. The aim of 

the theoretical model presented in this paper is to describe 

charge carrier mobility changes related to the polar additive. 

Quantum chemical calculations showed that the polar additive 

molecules considerably influence the on-chain electrostatic 

potentials. Consequently, the energies and shape of the polymer 

chain states are modified. It is assumed that this reaction does not 

significantly alter the scale of the spatial supramolecular disorder. 

For these reasons, the supramolecular structure was simplified as 

much as possible. 

The simplified three-dimensional polymer structure can be 

schematically described by an array of equidistantly placed 

parallel polymer chains of a given length N (as shown in Fig. 3). It 

should be noted that the length N is chosen rather as a typical 

length of a conjugated segment without chemical or structural 

defects (several hundreds of repeat units) than the length of the 

real polymer chain. Thus, the continuous disorder model of the 

torsional disorder is combined with a rod-like model of the chain 

defects that completely stops the on-chain transport. The 

additive molecules are randomly placed between these chains 

without further specifications of their positions and orientations. 

Each polymer chain is characterized by a set of its eigenstates, in 

which a charge carrier can be found. No correlation between 

chains is assumed. Only the transitions between four nearest 

neighbor chains are taken into account. The corresponding 

transfer rates of hopping from the chain A are denoted in Fig. 3 by 

the letters L i, R i, D i, and U i. 

It should be remarked that the number M of the chains in each 

direction should be large enough (up to several hundreds) in 

order to neglect the influence of the finite size of the model 

system. Since the total number of the chains M 2 was taken to be 

very large, some periodicity was introduced. Only 400 independent 

chains were calculated and in this way an ‘‘elementary cell’’ 

Figure 3. Simplified polymer structure for inter-chain charge carrier 

mobility modeling. 

20 20 chain was created. This ‘‘elementary cell’’ was then 

periodically repeated in both directions in order to get the whole 

considered model system of M 2 chains. 

The inter-chain transfer is slow in comparison with the charge 

carrier thermalization, which occurs typically in times of several 

picoseconds. Thus, it is possible to expect full charge carrier 

thermalization to the Boltzmann distribution over all states of the 

given chain between two subsequent inter-chain hops. Note that 

under usual experimental conditions, it is almost impossible that 

there is more than one charge carrier on one chain segment. 

Therefore, if there is a charge carrier on the given chain A, the 

probability of occupation of the state i at temperature T is 

piðEiÞ ¼ 

expð Ei=kTÞ 

ZT ð Þ 

where Ei is the energy of state i, k the Boltzmann constant, and 

Z(T) is the partition function over all states of the chain A. 

The rate for charge transfer between an initial state i with the 

energy Ei on the chain A and a state j with the energy Ej on an 

adjacent chain B can be evaluated using Marcus equation 

vi!j ¼ J2 rffiffiffiffiffiffiffiffi 

ij p Ei Ej l 

exp 

h lkT 

2 

! 

(7) 

4lkT 

where l is the reorganization energy and Jij is the effective charge 

transfer integral. The use of the quasi-classical Marcus concept [11] 

instead of the quantum mechanical one is justified by the fact 

that the inter-chain transfer integrals Jij are much smaller than the 

reorganization energy l. Consequently, the charge carrier 

residing on a given chain loses any quantum coherence due 

to its interaction with the phonon reservoir before jumping to 

another chain. 

The reorganization energy can be in principle calculated using 

standard quantum chemical methods. Knowing the expansion 

coefficients ci,a of each chain state i, it is possible to calculate the 

transfer integrals Jij between states i and j located on two 

different chains 

Jij ¼ X 

(8) 

a;b 

ci;acj;bJabdab 

where a and b are repeat units of chains i and j, respectively, J ab 

the transfer integral between the corresponding repeat units of 

adjacent chains (as shown in Fig. 4), and dab is Kronecker delta. 

While the expansion coefficients c i,a are strongly dependent on 

the chain energetic disorder, the transfer integrals Jab can be 

taken constant, since no significant influence of the photochromic 

reaction on the spatial supramolecular disorder is assumed. 

The value of J ab can be estimated from the energy splitting 

between HOMOs of two benzene molecules located at the typical 

interchain distance ( 10 A˚). Since we believe that the spatial 

Figure 4. Detail of two neighboring polymer chains A and B. Letters a 

and b denote repeat units, i and j are polymer chain states. 

Polym. Adv. Technol. 2009, 20 263–267 Copyright ß 2008 John Wiley & Sons, Ltd. www.interscience.wiley.com/journal/pat 

(6) 

265

266 

supramolecular disorder does not play a significant role, 

distribution of Jab was taken as a standard normal distribution 

multiplied by a typical value of s(Jab) ¼ 10 4 eV. Note that this is 

just a multiplication factor that can be used to scale the 

calculated absolute values. 

From the charge transfer rates ni ! j between two states and the 

thermalized occupation probability pi of the initial state the 

charge transfer rates n A ! B between two adjacent chains A and B 

can be easily calculated 

nA!B ¼ X 

i 2 Aj2 B 

piðEiÞni!j whereas summation goes through all states of the respective 

chain. 

Thus, our model assumes the following steps of the inter-chain 

charge carrier transport: 

charge carrier moving to any possible state on the chain A, 

charge carrier thermalization over all its possible states on the 

chain A, 

charge carrier hops to any possible state on one of the four 

nearest neighboring chains; the transfer rate is given by the 

Marcus eqn (7). 

Determining the n A ! B values makes possible to construct the 

master equation describing the inter-chain charge carrier motion 

dPAðtÞ 

dt 

(9) 

X 

¼ vA!BPBðtÞ (10) 

B 

where PA(t) is the probability of finding the given charge carrier 

on the chain A. Att¼0 is the charge carrier localized on a single 

chain, i.e. P0(t ¼ 0) ¼ 1 and all other PA equal to zero. The master 

equation can be solved either by direct numerical integration or 

by means of finding the eigenstates of the nA ! B matrix. The 

choice between these two approaches should be done with 

regard to the available computer resources. 

Once the time evolution of PA(t) is known, then the meansquare 

displacement D 2 (t) of the charge carrier in the direction 

perpendicular to that of the chain segments can be defined as 

D 2 ðtÞ ¼ X 

i 2 Ad2PAðtÞ (11) 

A 

with d being inter-chain distance and iA the dimensionless projection 

of the distance of the chains ‘‘A’’ and ‘‘0’’ to the direction of 

the electric field. To achieve numerical stability, this quantity was 

averaged over 100 different Monte Carlo realizations of the 

disordered polymer chains. It was found that the convergence in 

this case is much faster than that of convergence of the 

analogous quantity during the intra-chain transport calculations. 

The quantity D 2 (t) is related to the frequency-dependent 

charge carrier mobility at the zero field limit by means of 

well-known Kubo formula [12] 

mv ð Þ ¼ ev2 

2kT Re 

Z1 D 2 2 

3 

4 ðtÞ expð ivtÞdt5 

(12) 

0 

in which e is the elementary charge and v ¼ 2pf is the radian 

frequency of the external field. 

It should be pointed out that this equation comes from the 

fluctuation dissipation theorem stating that the linear response of 

a system in the thermodynamic equilibrium to a small external 

perturbation is the same as its response to a spontaneous 

fluctuation. Otherwise, the time evolution of D 2 (t) would describe 

the charge carrier thermalization showing a rapid increase at 

the initial stage, which would be followed by a normal diffusive 

motion, when the thermal equilibrium is achieved and the system 

starts fluctuating. For specific Monte Carlo data, it is rather 

difficult to predict the time necessary for the system thermalization. 

For this reason, to get correct results also for high 

frequencies, it is necessary to pay special attention to the way of 

the selection of the chain ‘‘0,’’ on which the charge carrier is 

localized at t ¼ 0 during each Monte Carlo run. Therefore, each 

master equation solution was preceded by a determination of the 

thermodynamic equilibrium distribution Pcell A of a charge carrier in 

an isolated ‘‘elementary cell’’ consisted of 20 20 polymer chains. 

The chain ‘‘0’’ was then randomly selected with the weights equal 

to the calculated equilibrium probabilities Pcell A . With regard to the 

Monte Carlo averaging, this procedure ensures that the model 

system is in the thermodynamic equilibrium from the start of the 

time evolution. 

RESULTS AND DISCUSSION 

P. TOMAN ET AL. 

The inter-chain hole mobility in MEH–PPV doped by a polar 

additive was modeled by the above-described model with the 

following parameters: The size of the array of the polymer chains 

(Fig. 3) was M ¼ 601 chains. Each of these chains consisted of 

N ¼ 501 repeat units (phenylenes and vinylenes). The temperature 

Figure 5. The dimensionless mean-square displacements D 2 (t)/d 2 as a 

function of time calculated for s(en) ¼ 0 and 0.18 eV. 

www.interscience.wiley.com/journal/pat Copyright ß 2008 John Wiley & Sons, Ltd. Polym. Adv. Technol. 2009, 20 263–267

INTER-CHAIN CHARGE TRANSPORT IN DOPED MEH–PPV 

Figure 6. Inter-chain hole mobility in MEH–PPV calculated for different 

degrees of the energetic disorder s(e n) using reorganization energy 

(a) l ¼ 0.1 eV, (b) l ¼ 0.4 eV. 

was T ¼ 293 K. The estimated inter-chain distance d ¼ 1 nm. The 

reorganization energy in MEH–PPV was estimated to be between 

0.1 and 0.4 eV on the basis of the B3LYP calculations of the 

oligomers. These values are consistent with the values 

determined by Prins et al. [13] for similar phenylene–vinylene 

derivatives. 

The dimensionless mean-square displacements D 2 (t)/d 2 calculated 

for polymers with different degree of the energetic disorder 

s(en) from zero to 0.18 eV are almost linear functions of time t, 

which is an evidence of the diffusive hole motion. However, for 

higher values of s(e n) there is higher slope of this dependence at 

short times (as shown in Fig. 5). It could be related to an imperfect 

thermal equilibrium at the beginning of the time evolution due to 

small number of Monte Carlo realization of the disorder and 

subsequent thermalization of the system. Nevertheless, we do 

not have a sure-footed explanation of this phenomenon. 

The frequency-dependent inter-chain hole mobility calculated 

according to eqn (12) for reorganization energies l ¼ 0.1 and 

0.4 eV is shown in Fig. 6. While the mobility in the polymer with a 

low degree of the energetic disorder is independent of the 

frequency, for higher degree of s(e n) there is a certain increase of 

the mobility with the frequency, which is related to the 

above-mentioned change of the slope in the D 2 (t)/d 2 plot. 

However, for all frequencies, there is a very strong dependence of 

the mobility on s(en). At lower frequencies, the mobility decreases 

by two or three orders of magnitude, if the width of the energetic 

distribution is doubled from 0.09 to 0.18 eV. Such a change of 

s(en) can be achieved by the change of the additive dipole 

moment. It should be remarked that our model of the energetic 

disorder does not involve the influence of the reaction field of the 

dipoles. Inclusion of this effect may decrease the energetic 

disorder up to 50%. Nevertheless, it is possible to increase the 

additive concentration up to about 20%wt and achieve the same 

effect. 


The computer time at the MetaCenter (Prague and Brno) and at 

the Institute of Physics of the ASCR, v. v. i. (project Luna) is 

gratefully acknowledged. 

REFERENCES 

[1] (Eds: T. A. Skotheim, R. L. Elsenbaumer, J. R. Reynolds), Handbook of 

Conducting Polymers, Marcel Dekker, New York, 1998. 

[2] X. Y. Deng, L. P. Zheng, C. H. Yang, Y. F. Li, G. Yu, Y. Cao, J. Phys. Chem. B 

2004, 108, 3451–3456. 

[3] A. Fujii, S. V. Frolov, Z. V. Vardeny, K. Yoshino, Jpn. J. Appl. Phys. Part 2 

Lett. 1998, 37, L740–L742. 

[4] H. Yamamoto, J. Wilkinson, J. P. Long, K. Bussman, J. A. Christodoulides, 

Z. H. Kafafi, Nano Lett. 2005, 5, 2485–2488. 

[5] L. Edman, J. Swensen, D. Moses, A. J. Heeger, Appl. Phys. Lett. 2004, 84, 

3744–3746. 

[6] F. C. Chen, Q. F. Xu, Y. Yang, Appl. Phys. Lett. 2004, 84, 3181–3183. 

[7] M. Jaiswal, R. Menon, Polym. Int. 2006, 55, 1371–1384. 

[8] F. S. Santos, R. M. Faria, A. R. de Andrade, G. C. Faria, C. A. Amorin, 

S. Mergulhao, Thin Solid Films 2007, 515, 8034–8039. 

[9] S. Nesˇpu˚rek, H. Valerián, A. Eckhardt, V. Herden, W. Schnabel, Polym. 

Adv. Technol. 2001, 12, 306–318. 

[10] P. Toman, S. Nesˇpu˚rek, M. Weiter, M. Vala, J. Sworakowski, 

W. Bartkowiak, M. Mensˇík, Polym. Adv. Technol. 2006, 17, 673–678. 

[11] V. May, O. Kühn, Charge and Energy Transfer Dynamics in Molecular 

Systems, 1st edn. Wiley, Berlin, 2000. 

[12] R. Kubo, J. Phys. Soc. Japan 1957, 12, 570–586. 

[13] P. Prins, K. Senthilkumar, F. C. Grozema, P. Jonkheijm, A. P. H. J. 

Schenning, E. W. Meijer, L. D. A. Siebbeles, J. Phys. Chem. B 2005, 

109, 18267–18274. 

Polym. Adv. Technol. 2009, 20 263–267 Copyright ß 2008 John Wiley & Sons, Ltd. www.interscience.wiley.com/journal/pat 

267

Eur. Phys. J. Appl. Phys. 48, 10401 (2009) 

DOI: 10.1051/epjap/2009112 

Regular Article 

THE EUROPEAN 

PHYSICAL JOURNAL 

APPLIED PHYSICS 

Photoinduced reversible switching of charge carrier mobility 

in conjugated polymers 

M. Weiter 1 ,J.Navrátil 1,a ,M.Vala 1 ,andP.Toman 1,2 

1 Brno University of Technology, Faculty of Chemistry, Purkynova 118, 612 00 Brno, Czech Republic 

2 Institute of Macromolecular Chemistry, AS CR, v.v.i., Prague, Czech Republic 

1 Introduction 

Received: 29 August 2008 / Received in final form: 3 April 2009 / Accepted: 21 April 2009 

Published online: 26 June 2009 – c○ EDP Sciences 

Abstract. Photoinduced reversible switching of charge carrier mobility in conjugated polymers was studied 

by theoretical and experimental methods. The quantum chemical calculations showed that the presence 

of dipolar species in the vicinity of a polymer chain modifies the on-chain site energies and consequently 

increases the width of the distribution of hopping transport states. The influence of photoswitchable 

charge carrier traps on charge transport was evaluated by current-voltage measurement and by impedance 

spectroscopy method. It was found that deep traps switchable by photochromic reaction may significantly 

control the transport of charge carriers, which is exemplified as a significant decrease of the current and 

increase of parallel resistance measured by impedance spectroscopy. 

PACS. 73.61.-r Electrical properties of specific thin films – 82.35.-x Polymers: properties; reactions; 

polymerization 

As an emerging area in organic electronics, polymer memories 

and switches have become an active research topic 

in recent years [1]. This paper deals with the concept of 

the photochromic switching of charge carrier transport in 

polymers. As the conductivity mechanism in these materials, 

a variable-range hopping in a positionaly random 

and energetically disordered system of localized states is 

widely accepted [2,3]. Over the last decades, hopping in 

random systems was extensively studied. Among these 

studies, the approach based on so-called effective transport 

energy level was shown to be especially efficient [4,5]. 

When the effective transport energy is established, the 

variable range hopping problem is virtually reduced to 

trap controlled transport model. According to this model, 

the transport of charge carriers in molecular solids is 

strongly influenced by the presence of centres capable of 

localizing charge carriers (traps). It was shown that deep 

traps may significantly affect the energy of the transport 

level and mobility of charge carriers [6] and thus control 

their transport. 

Investigated polymer switch is based on switching 

of charge carrier mobility by photochromic species distributed 

in polymer matrix. Photochromic reactions, in 

addition to the changes in electronic spectra, are also accompanied 

by variations in refractive index, dielectric con- 

a e-mail: xcnavratil@fch.vutbr.cz 

10401-p1 

stant, enthalpy, etc. [7]. Moreover, the reversible changes 

in physical or chemical properties of the photochromic 

species can be transferred to the microenvironment and 

supramolecular structure, and thus, can induce rich modifications 

in the surroundings. In a molecular solid build 

of non-polar polarizable units, e.g. polymer segments, containing 

a small amount of polar guest species, its dipole 

moment contributes to the field acting on surrounding 

molecules and modifies the local values of the polarization 

energy. This modification can cause a local decrease 

of the ionisation energy in an otherwise perfect crystal lattice, 

which represents a trap for hole. Thus, the presence 

of polar species may result in production of local states 

(charge traps) – in their vicinity; even thus they are not 

necessarily trapping sites themselves [8,9]. Reversible creation 

of such polar species can be obtained by e.g. suitable 

photochromic molecules. The induced change of electrostatic 

potential due to the charge-dipole interactions 

also shifts the site energies of individual polymer repeating 

units, and consequently the polymer transport levels 

are modified. Since the position and orientation of the 

additive with respect of the polymer chain are essentially 

random the effect results in broadening of the distribution 

of the transport states and consequently to the lowering of 

the charge carriers mobility. In the case of reversible formation 

and annihilation of such traps the electric charge 

transport can be even changed from space-charge limited 

to trap limited [10].

C 

H 3 

CH 3 

CH 3 

N O 

The European Physical Journal Applied Physics 

NO 2 

C 

H 3 

CH 3 

CH 3 

N O 

Fig. 1. Photochromic reaction of the spiropyran (left) to its metastable merocyanine form (right). 

The purpose of the present work is to examine by 

quantum chemistry modeling and experimental characterization 

the optical and electrical switching properties 

of the suggested switch. For the study the 

π-conjugated photoconductive polymers poly[2-methoxy- 

5-(2’-ethylhexyloxy)-p-phenylenevinylene] (MEH-PPV) 

doped by photochromic spiropyran 6-nitro-1’,3’,3’, -trimethylspiro[2H-1-benzopyran-2,2’-indoline] 

(SP), which can 

be converted to a higher dipole moment possessing form 

referred to as (photo)merocyanine (MR), were used. 

The photochromic reaction of the spiropyran (SP) into 

(photo)merocyanine is depicted in Figure 1. 

2 Theoretical modeling 

In principle, the polar additive may influence the hole 

transport in two ways. First, if the highest occupied molecular 

orbital (HOMO) of the additive molecule is above the 

HOMO of the polymer, the additive molecules serve as energy 

level (chemical) traps. Second, the additive molecule 

possesses a large dipole moment that modifies the surrounding 

electrostatic potential landscape due to chargedipole 

interactions (dipolar traps) [11,12]. 

It was shown in our previous papers that SP/MR attached 

to the σ-conjugated poly[methyl(phenyl)silylene] 

creates chemical traps for holes [11,13]. However, the 

HOMO’s of the π-conjugated polymers lie generally higher 

than the ones of the σ-conjugated polymers. The quantum 

chemical calculations show, that the HOMO of MEH-PPV 

is at least about 1 eV above the HOMO’s of SP and MR. 

For this reason we expect, that the additive does not create 

energy level traps in the investigated system, but influences 

the hole transport through the charge-dipole interactions. 

The polymer chain is modeled by a sequence of N = 

4000 sites corresponding to the repeat units (alternating 

phenylenes and vinylenes). Each site n is described by the 

energy εn of a hole located at this site. The hole transport 

between the sites n and m is described by the transfer integral 

bn,m. Because of linear character of the MEH-PPV 

chain and the size of the repeat units only the transfer integrals 

between the neighboring repeat units are important 

and the other can be neglected (tight-binding approximation). 

A typical value of the transfer integrals bn,n+1 is 

about 1 eV, being significantly higher than the random 

10401-p2 

NO 2 

disorder in site energies εn. This fact justifies the description 

of the on-chain hole motion using delocalized states 

approach rather than as hopping between localized states. 

Thus, hole motion on such a chain can be described by the 

Hamiltonian 

H = 

N� 

n=1 

� 

εna + � + 

n an − bn,n+1 a n+1an + a + �� 

n an+1 , (1) 

where an and a + n are annihilation and creation operators 

of a hole at an nth site. Both quantities εn and bn,n+1 are 

influenced by the random structure of the polymer chain 

and its surrounding. The energy εn is essentially equal to 

the negative of the first ionization potential of the corresponding 

repeat unit. Grozema et al. [14] developed a 

continuous disorder type model of the transfer integral 

bn,n+1 distribution, showing that the hole mobility in a 

pure MEH-PPV is limited by the torsional disorder. We 

assume that the influence of the additives on the electronic 

coupling between the polymer repeat units is small 

in comparison with the electrostatic charge-dipole interaction 

modulating the site energies εn. 

Polar species in the polymer chain vicinity modify 

the on-chain electrostatic potential due to the chargedipole 

interactions between a hole moving on the chain 

and dipole moments of individual additive molecules dispersed 

in the polymer. It is easy to show that the sum of 

these electrostatic potential changes shifts the hole site energies 

εn by the value 〈HOMO| � 

Δφi|HOMO〉, where 

i 

Δφi are the changes of the electrostatic potential describing 

the charge-dipole interactions of a charge carrier localized 

at |HOMO〉 with all surrounding polar additive 

molecules. The change of the shape of the highest molecular 

orbital |HOMO〉 of the corresponding repeat unit induced 

by the additive is neglected (frozen orbital approximation) 

[11]. Since the positions and orientations of the 

additive molecules with respect to the polymer chain are 

essentially random, the effect results in broadening of the 

distribution of transport states. The most important parameter 

of this distribution (energetic disorder) is its halfwidth 

σ(εn). 

Recently, energetic disorder was numerically modeled 

by a dipolar lattice model [15]. This model considers a 

regular three-dimensional cubic lattice of sites being subject 

to periodic boundary conditions. A fraction of the 

sites is occupied by randomly oriented, immobile, and

M. Weiter et al.: Photoinduced switching of charge carrier mobility in conjugated polymers 

non-interacting dipoles. The electrostatic potential is then 

calculated for each site as a sum of the Coulombic potentials 

of all dipoles. This model was later analytically 

evaluated by Young [16]. He investigated the shape of the 

distribution and derived an equation for its half-width σ, 

being proportional to the dipole moment and the square 

root of the dipole concentration. Our model of the energetic 

disorder is a modification of this approach in order 

to take into account the linear shape of the polymer 

main chain, the size of its substituents, the absence of 

any well-ordered structure, and the fact, that the charge 

transport proceeds predominantly on the conjugated main 

chain. For this reason, the polymer chain was modeled as 

a line. Randomly oriented additive molecules, represented 

by point dipoles, were randomly placed in the vicinity of 

this line, but it was assumed that no additive molecule 

was placed at a distance shorter than 10 ˚A, which corresponds 

to the mean size of the polymer substituents and 

the size of the polar additive molecules. On the other hand, 

the influence of the additive molecules distant more than 

50 ˚A from the polymer chain was neglected. The additive 

molecules were placed also beyond the chain ends in order 

to ensure the homogeneity of the εn distribution along the 

whole chain. The concentration of the additive was taken 

to be c = 4 × 10 −4 ˚A −3 . For each center representing 

a repeat unit, the energetic disorder was calculated as a 

sum of Coulombic electrostatic potentials from all additive 

molecules. With regard to the value of the minimal 

distance of an additive molecule from the chain the size 

of the polymer repeat units was neglected. The energetic 

disorder of εn was calculated according to the abovedescribed 

model for several values of the dipole moment 

of the additive m. According to the central limit theorem 

[17], the resulting εn distribution is a Gaussian-type 

distribution. For a typical value of m =12Dthehalfwidth 

σ(εn) =0.37 eV. Because the mutual interaction of 

the additive molecules is neglected, the half-width σ(εn)is 

proportional to the dipole moment m of the additive and 

to the square root of the additive concentration √ c just 

as in the dipolar lattice model [15]. However, the value of 

σ(εn) calculated according to our model does not follow 

the relations derived by Young [16]. Furthermore it should 

be noted, that the εn values show a strong site-to-site 

correlation between up to about 10th nearest neighboring 

sites. The correlation coefficient between the nearest 

neighbor εn values is 0.97. This fact can be explained by 

the long-range character of the charge-dipole interactions 

and the size of the MEH-PPV substituents hindering from 

close contact between additive molecules and the main 

chain. It should be pointed out, that the site-to-site correlation 

significantly affects the transport, thus the direct 

numerical calculation of the εn values cannot be replaced 

by a simple generation of random numbers from a normal 

distribution. 

The dipole moments of SP and MR forms calculated by 

the Hartree-Fock method are 5.5 and 11.9 D, respectively. 

These values suggest that the SP → MR reaction results 

in approximately doubling the energetic disorder. Moreover, 

one should take into account that, while the value 

obtained for SP is close to reality, the dipole moment of 

Mobility [cm 2 /Vs] 

10401-p3 

1000 

100 

10 

1 

0,1 

0,01 

no additive (0 D) 

SP (6 D) 

MR (12 D) 

1E-3 

0,1 1 10 100 1000 

Frequency [GHz] 

Fig. 2. The calculated frequency-dependent mobility for different 

additive dipole moments. The additive concentration was 

c =4× 10 −4 ˚A −3 . 

MR is probably underestimated since the polar environment 

increases the zwitterionic character of MR. Bletz 

et al. [18] reported the dipole moment of MR measured 

in a polar environment to amount to 15÷20 D. Thus the 

real switching effect may be more effective than that estimated 

using the calculated values. The hole on-chain mobilities 

μ(ω), calculated for different values of the additive 

dipole moments, are shown in Figure 2. All curves exhibit 

a saturation of μ(ω) at low frequencies corresponding to 

the diffusive charge carrier motion in the long-time limit 

(t >25 ps), and a rapid increase for higher frequencies 

related to the fast initial hole delocalization (t

Current (A) 

10 -4 

10 -5 

10 -6 

10 -7 

10 -8 

10 -9 

0% 

2% 

5% 

10% 

2 4 6 8 10 12 14 

Voltage (V) 

Fig. 3. Current-voltage characteristics for various concentration 

of spiropyran after the photochromic conversion induced 

by high photon dose corresponding to the merocyanine absorbance 

saturation. 

3 Experimental 

Polymer device was manufactured as a sandwich cell with 

a dielectric layer of MEH-PPV containing 0–30% wt. of 

admixedSP.Theactivepolymer layer was spin casted 

from chloroform solution on transparent indium tin oxide 

(ITO) electrode covering part of the glass substrate. The 

thickness of the active layer was about 150 nm. The structure 

was completed by evaporation of aluminium top electrode 

typically 100 nm thick. Average electrode area that 

delimitates the active area of the device was 3 mm 2 .The 

photochromic reaction of spiropyrane was activated using 

a Nd:YAG pulse laser (1 μJ/pulse) with third harmonic 

generation at 355 nm in order to measure the irradiation 

of the sample precisely. The electric response was studied 

by measuring the current-voltage j(V ) characteristics of 

the samples in the dark with Keithley 6517A electrometer. 

Dielectric properties were studied using a Hewlett 

Packard 4192A impedance analyzer. The measurements 

were performed in vacuum cryostat at room temperature. 

4 Results and discussion 

The photoswitching of charge carrier mobility was studied 

by standard current-voltage j(V )measurement.The 

results for typical devices are shown as log-log plot in Figure 

3 where the variation of the current at high irradiation 

dose corresponding to the merocyanine concentration saturation 

for different spiropyrane concentration is shown. 

In organic thin film devices the current is typically contact 

limited in low field region, whereas at higher field region 

space-charge or charge-trap limited conductivity are commonly 

accepted [19]. The results show this behavior. At 

low forward-bias voltages below 7–10 V the increase of 

j with V is relatively small, whereas in the higher field 

region the slope of the dependence is more pronounced, 


10401-p4 

which is in accordance with Space-charge limited current 

(SCLC) theory. This theory proposes that the space 

charge which limits conduction is stored in the traps. In 

the case of energetically discrete trapping level, the SCL 

current can be expressed as 

jSCL = 9 

2 V 

εε0μθ , (2) 

8 L3 where, ε and ε0 is the relative permittivity and permittivity 

of vacuum, μ is the charge carrier mobility, V is the 

applied voltage, L is the electrode distance and θ is the 

ratio of free to total charge carriers. 

However, in cases of practical interest traps are usually 

distributed in energy. In that case traps will be filled from 

the bottom to the top of the distribution as applied electric 

field increases. This is equivalent to an upward-shift in 

the quasi-Fermi level with electric field. As a consequence, 

θ increases with electric field and the j(V ) characteristics 

becomes steeper. In terms of present work, the distribution 

of charge traps describes those induced by spiropyrane 

to merocyanine photochromic conversion. The presence 

of distribution of traps opens additional pathways to 

the relaxation of charge carriers towards steeper states. A 

zero order analytic description of the effect can be based 

on the Hoesterey and Letson formalism [20]. The latter is 

premised on the argument that the carrier mobility in a 

system with relative trap concentration c is the product 

of the mobility in the trap-free system μ0 multiplied by 

trapping factor: 

μ(c) =μ0 

� � ��−1 Et 

1+c exp , (3) 

kT 

where Et is the energy of trapping level, k is the 

Boltzmann constant and T is the temperature. Consequently, 

the current flowing through the sample with enhanced 

number of trapping states will be less than in sample 

without traps. Figure 3, which shows the decrease of 

the photocurrent with increasing concentration of spiropyrane 

at high irradiation dose, proves this notion. Complementary, 

the decrease of the current with increasing 

photon dose demonstrated by number of laser pulses was 

observed. As the merocyanine concentration increase exponentially 

with photon dose and tends to saturate at high 

irradiation, the decrease of the current limits by about 

two orders of magnitude. In both cases the decrease is 

fully reversible after thermal fading in the dark or irradiation 

with a red light. The essential message is that the 

current thorough the irradiated device is significantly lowered 

by the presence of polar charge traps caused by photochromic 

conversion of spiropyrane to merocyanine. In 

another words the presence of traps lowers the mobility of 

charge carriers as expected from theoretical calculations. 

To provide better insight into studied phenomena the 

real and complex part of the impedance ZRe and ZIm were 

recorded at test frequencies between 10 and 5 × 10 6 Hz. 

The measured data were analyzed in the form of Cole-Cole 

diagram (real part of Z vs. imaginary part of Z) wherein 

the frequency increases from right to left. The variations

ZIm (Ω) 

2,5x10 6 

2,0x10 6 

1,5x10 6 

1,0x10 6 

5,0x10 5 

0,0 

M. Weiter et al.: Photoinduced switching of charge carrier mobility in conjugated polymers 

0 

50 

100 

200 

400 

0 1x10 6 

2x10 6 

3x10 6 

Z Re (Ω) 

4x10 6 

5x10 6 

Fig. 4. Cole-Cole plot of the 20% mixture of the MEH-PPV:SP 

before (0 pulses) and after the photochromic conversion for four 

light doses expressed as a number of pulses (1 µJ/pulse). 

of ZIm with ZRe as a function of photon dose at constant 

bias of 5 V for the device with 20% of spiropyrane are 

showninFigure4.AlltheZIm versus ZRe dependency 

shows a single semicircle which increases in size with increasing 

photon dose. This single semicircle could be fitted 

very well to a parallel combination of bulk resistance Rp 

and capacitance Cp in series with a resistance Rs, which 

is probably caused by the Ohmic contact at hole injecting 

ITO/MEH-PPV interface. From Figure 4 the bulk parallel 

resistance can be evaluated as the virtual intercept 

point of each Cole-Cole plot with ZRe axis. Following this 

evaluation, Figure 4 clearly demonstrates the increasing 

parallel resistance of the sample with increasing photon 

dose, which is in accordance with previous results. The 

comparison of data obtained by impedance analysis and 

steady-state j(V ) characterization is depicted in Figure 5 

for samples doped by 20% of spiropyrane after irradiation. 

Herein the results are related to the absorption of 

the samples at 590 nm, which is proportional to merocyanine 

concentration as was described above. In this figure 

the left y-axis represents the relative increase of the parallel 

resistance obtained by impedance analysis, whereas the 

reverse value of the relative decrease of the current evaluated 

form the j(V ) characteristics is marked on right 

y-axis. It is shown that the dependencies which manifest 

the influence of merocyanine charge traps on the charge 

transport in MEH-PPV matrix are both almost linear. 

5 Conclusions 

The possibility of switching of charge carrier mobility 

was demonstrated. The quantum chemistry calculations 

showed that the presence of polar additive in the vicinity 

of polymeric chain modifies its transport levels. This increase 

in the energetic disorder eventuates in the decrease 

of the hole mobility. The change of the additive dipole 

moment from ca. 6 D to 12 D, which corresponds to the 

studied photochromic reaction, results in an almost five- 

Parallel resistance (Ω) 

10401-p5 

7x10 6 

6x10 6 

5x10 6 

4x10 6 

3x10 6 

2x10 6 

1x10 6 

0 

Parallel resistance 

Current change 

0.04 0.06 0.08 0.10 0.12 

Δ Absorbance 

Fig. 5. The dependence of ratio of parallel resistance after the 

photochromic conversion to the value before conversion on the 

change of absorbance (left y-axis) and the ratio of the current 

before the photochromic conversion and after for different light 

dose at 4.2 V of the 20% mixture of the MEH-PPV:SP. 

fold decrease of the on-chain mobility. The experimental 

behaviour of the system explored by means of currentvoltage 

characterization showed a significant decrease of 

the current thorough the sample after irradiation. The current 

decrease is proportional either to the concentration 

of spiropyrane in the sample or to the irradiation dose. 

The increase of parallel resistance of the sample with irradiation 

dose obtained by impedance analysis confirms this 

outcome. According to the trap controlled hopping model 

for the description of charge transport it was stated that 

the presence of new dipolar traps results in the decrease 

of the charge carrier mobility and thereby lowering the 

current as predicted by the theoretical calculations. 

This work was supported by project KAN401770651 from 

the Academy of Sciences of the Czech Republic, project GA 

203/06/0285 via the Czech Science Foundation and by project 

No. 0021630501 from Ministry of Education, Youth and Sport. 

A possibility of using computer time in MetaCenter is gratefully 

acknowledged. 

References 

1. G. Hadziioannou, G.G. Malliaras, Semiconducting polymers, 

Vols. 1 and 2 (Wiley-VCH, Weinheim, 2007) 

2. M. Pope, C.E. Swenberg, Electronic Processes in Organic 

Crystals and polymers, 2nd edn. (Oxford University Press, 

Oxford, 1999) 

3. H. Bässler, Phys. Stat. Sol. B 15, 175 (1993) 

4. V.I. Arkhipov, E.V. Emelianova, G.J. Adriaenssens, Phys. 

Rev. B 64, 125125 (2001) 

5. V.I. Arkhipov, P. Heremans, E.V. Emelianova, G.J. 

Adriaenssens,H.Bässler,J.Phys.:Condens.Matter42, 

9899 (2002) 

6. V.I. Arkhipov, J. Ryenaert, Y.D. Jin, P. Heremans, E.V. 

Emelianova, G.J. Adriaenssens, H. Bässler, Synt. Met. 

138, 209 (2003) 

18 

16 

14 

12 

10 

8 

6 

4 

2 

0 

I0/Ii

7. H. Durr, H. Bouas-Laurent (Eds.), Photochromism: 

molecules and systems (Elsevier, Amsterdam, 2003) 

8. S. Neˇspùrek, J. Sworakowski, Thin Solid Films 393, 168 

(2001) 

9. M. Weiter, M. Vala, S. Neˇspùrek, J. Sworakowski, O. 

Salyk, O. Zmeˇskal,Mol.Cryst.Liq.Cryst.430, 227 (2005) 

10. P. Anderson, N.D. Robinson, M. Berggren, Adv. Mater. 

17, 1798 (2005) 

11. P. Toman, W. Bartkowiak, S. Neˇspùrek, J. Sworakowski, 

R. Zale´sny, Chem. Phys. 316, 267 (2005) 

12. F.L.E. Jakobsson, X. Crispin, M. Berggren, Organ. 

Electron. 10, 95 (2009) 

13. P. Toman, S. Neˇspùrek, W. Bartkowiak, J. Sworakowski, 

J. Lumin. 112, 386 (2005) 


To access this journal online: 

www.edpsciences.org 

10401-p6 

14. F.C. Grozema, P.T. van Duijnen, Y.A. Berlin, M.A. 

Ratner, L.D.A. Siebbeles, J. Phys. Chem. B 106, 7791 

(2002) 

15. A. Dieckmann, H. Bässler, P.M. Borsenberger, J. Chem. 

Phys. 99, 8136 (1993) 

16. R.H. Young, Phil. Mag. B 72, 435 (1995) 

17. J.A. Rice, Mathematical Statistics and Data Analysis, 2nd 

edn. (Duxbury Press, Belmont, 1995), ISBN 0-534-20934-3 

18. M. Bletz, U. Pfeifer-Fukumura, U. Kolb, W. Baumann, J. 

Phys. Chem. A 106, 2232 (2002) 

19. P.W.M. Blom, M.J.M. deJong, J.J.M. Vleggaar, Appl. 

Phys. Lett. 68, 3308 (1996) 

20. D.C. Hoesterey, G.M. Letson, J. Phys. Chem. Solids 24, 

1609 (1963)

Fractal–cantorian geometry of space-time 

Oldrich Zmeskal *, Martin Vala, Martin Weiter, Pavla Stefkova 

Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech Republic 

article info 


Accepted 25 March 2009 

* Corresponding author. 

E-mail address: smeskal@fch.vutbr.cz (O. Zmeskal). 

abstract 

0960-0779/$ - see front matter Ó 2009 Published by Elsevier Ltd. 

doi:10.1016/j.chaos.2009.03.106 

Chaos, Solitons and Fractals 42 (2009) 1878–1892 


Chaos, Solitons and Fractals 

journal homepage: www.elsevier.com/locate/chaos 

This contribution is concerned with the extension of fractal theory used for the description 

of elementary stationary physical fields (gravitational, electric fields, fields of weak and 

strong interactions) as well as stationary fields of other physical quantities (thermal and 

acoustic) defined in the authors’ previous contributions to space-time area. This theory, 

defined generally in E-dimensional Euclidean space, was applied for description of stationary 

effects in one-, two- and three-dimensional space, respectively ðr ¼ xi þ yj þ zk, where 

i, j, k are orthogonal unitary vectors of Euclidean space). The agreement of laws formulated 

in various science disciplines with presented theory was proven for Euclidean objects (e.g. 

Newton gravitation law, Coulomb law, Planck’s radiation law, and 1st Fick’s law). In addition, 

the presented theory enables extension of validity of given laws for objects having 

fractal character. 

In this contribution, another extension of fractal theory is presented in the area of socalled 

pseudo-Euclidean coordinates, where E-dimensional space consists of p Euclidean 

and q pseudo- Euclidean dimensions ðE ¼ p þ qÞ. 

Special case of this space is the space-time ðs ¼ xi þ yj þ zk þ ictlÞ, where number of 

Euclidean dimensions is p ¼ 3 and number of pseudo-Euclidean dimensions is q ¼ 1, which 

are only preserved (i is imaginary unit, c is speed of light and i, j, k, l are orthogonal unitary 

vectors of Minkowski space). 

Physical quantities of this four-dimensional orthogonal space are very often transformed 

into three-dimensional curved space by means of parametric formulation of quantities 

r 0 ðt 0 Þ¼x 0 ðt 0 Þi þ y 0 ðt 0 Þj þ z 0 ðt 0 Þk; ðx 0 ¼ bðx vtÞ; y 0 ¼ y; z 0 ¼ z, where t 0 ¼ bðt ðv=c 2 ÞxÞ and 

b ¼ð1 v 2 =c 2 Þ 1=2 , respectively). This forms the basis for the formulation of laws of special 

and general theory of relativity. The time dilatation and the length contraction or relativist 

transformation of the mass result from these transformations. 

In many other cases physical laws are formulated in reality in four-dimensional spacetime 

(i.e. by means of independent coordinates x, y, z, t). It is concerned with 2nd Fick’s 

law, 2nd Fourier’s law, Schrödinger’s equation, continuity equation, etc. 

However, it is possible to eliminate one coordinate (e.g. time t) from equations by implementation 

of suitable quantity independent of this coordinate (e.g. on time t) in special 

cases. It is the case of steady flows of physical quantities (e.g. steady state electric current, 

steady state heat flow). In this case it is possible to formulate physical laws formally like in 

stationary cases (i.e. in three-dimensional space with coordinates x, y, z but by means of 

dynamic physical quantities). In this way the fractal theory of so-called space charge limited 

currents (SCLC) was solved (give express citation). 

Ó 2009 Published by Elsevier Ltd.


Space-time is a geometrical model of universe that combines 3D space and 1D time into a single construct called the 

space-time continuum. Time plays in this continuum the role of the 4th dimension. According to the Euclidean space perception, 

our universe has three-dimensions of space, and one-dimension of time. By combining the two concepts into a single 

manifold, physicists are able to significantly simplify the form of most physical laws. 

The problem of the actual number of dimensions of our universe is still open, as some theories (such as the string theory) 

predict as many as 26. In these theories, however, all the additional dimensions are such that the universe measured along 

them is subatomic in size. As a result, even if the universe had many more dimensions, we would only perceive 4 of them [1]. 

The general relativistic invariant line element in E-dimensional space reads, in terms of Einstein’s convention of summation 

on identical lower and upper indices [2] 

ds 2 ¼ g lmdx l dx m ; ðl; m ¼ 1; 2; ...; EÞ: ð1Þ 

The new concept of space-time brings with it a new concept of distance. Whereas distances are always positive in E-dimensional 

Euclidean spaces g ll ¼ 1 for l ¼ 1; 2; ...; E (Einstein notation has been used for the tensors) and equal to zero for any 

other situations (g lm ¼ 0 for l–mÞ, so thus 

dr 2 ¼ dx 2 

1 

þ ...þ dx2 E ; ð2Þ 

the distance between any two events in E-dimensional spaces with p Euclidean and q pseudo-Euclidean dimensions 

ðE ¼ p þ qÞ may be real, zero, or imaginary [3] 

ds 2 ¼ dx 2 

1 þ ...þ dx2 p 

dx 2 

pþ1 ... dx 2 

pþq : ð3Þ 

The signs would be all positive ðg ll ¼ 1; l ¼ 1; 2; ...; pÞ for a Euclidean coordinates, negative (g ll ¼ 1 for 

l ¼ p þ 1; p þ 2; ...; p þ qÞ for pseudo-Euclidean coordinates of space, and equal to zero for any other situations (g lm ¼ 0 

for l–m). 

There are three-dimensions connected with the Euclidean and one with pseudo-Euclidean coordinate in four-dimensional 

time-spaces. These spaces have line elements given by Eqs. (2) or (3), respectively 

ds 2 ¼ dx 2 þ dy 2 þ dz 2 

O. Zmeskal et al. / Chaos, Solitons and Fractals 42 (2009) 1878–1892 1879 

dðctÞ 2 ; ð4Þ 

where x, y, z are Cartesian coordinates of three-dimensional space and c is the speed of light in vacuum (or speed of any other 

physical quantity). 

Eq. (4) formulates dimension of elementary vector 

ds ¼ dxi þ dyj þ dzk þ dðictÞl ð5Þ 

with orthogonal unitary vectors i, j, k, l. For spherical arrangement, it is possible to integrate elementary vector (Eq. (5)) ina 

simplistic manner. For constant speed c, it is given space-time vector formulating point location in space-time with coordinates 

(x, y, z, ict) from the beginning of coordinate system 

s ¼ xi þ yj þ zk þ ictl: ð6Þ 

This situation is formulated for 2D – Euclidean space with coordinates (x, y) inFig. 1a and for 2D orthogonal space with one 

Euclidean and one pseudo-Euclidean coordinate for Fig. 1b. Both of these spaces are subspaces of 4th dimensional Minkow- 

y 

r (x , y ) 

r = x i + y j 

x 

ct 

s = x i + ict l 

s (x , ct ) 

Fig. 1. (a) 2D Euclidean spherical space ðp ¼ 2; q ¼ 0Þ and (b) 2D pseudo-Euclidean hyperbolical space ðp ¼ 1; q ¼ 1Þ. 

x

1880 O. Zmeskal et al. / Chaos, Solitons and Fractals 42 (2009) 1878–1892 

ski space. Pictures can be also understood as two views at 3D orthogonal time-space (x, y, ict) with two Euclidean and one 

pseudo-Euclidean coordinate. 

The space-time interval (line element) quantifies the new distance (in Cartesian coordinates x, y, z, t) 

s 2 ¼ x 2 þ y 2 þ z 2 

c 2 t 2 ; ð7Þ 

as the differences of the space and time coordinates of the two events are denoted by r and t, respectively, given as 

r 2 ¼ x 2 þ y 2 þ z 2 . 

Pairs of events in space-time may be classified into three distinct types based on ‘how far’ apart they are: 

time-like (sufficient time elapse, for there to be a cause-effect relationship between the two events; s 2 < 0). 

light-like (the space between the two events is exactly balanced by the time between the two events; s 2 ¼ 0). 

space-like (insufficient time elapse for there to be a cause-effect relation between the two events; s 2 > 0). 

Events with a negative space-time interval are in each other’s future or past, and the value of the interval defines the 

proper time measured by an observer travelling between them. Events with a space-time interval of zero are separated 

by the propagation of a light signal. 

Certain types of world-lines (called geodesics of the space-time), are the shortest paths between any two events, with 

distance being defined in terms of space-time intervals. The concept of geodesics becomes critical in general relativity, since 

geodesic motion may be thought of as ‘‘pure motion” (inertial motion) in space-time, this means, free from any external 

influences. 

The characteristic feature of this space-time is the Light Cone, a double-cone centred at each event in space-time. By the 

conventional choice of units used in relativity, the sides of the cone are sloped at 45 °. This corresponds to choose units 

where time is measured in seconds and distances in light-seconds. A light-second is the distance light travels in one second. 

The upper-cone (called the future light-cone) represents the future of a light-flash emitted at that event. The lower-cone 

(called the past light-cone) represents all directions from which light-flashes can be received at that event. 

The generalization of the Eq. (7) consists in change from spherical arrangement of the spatial coordinates to the ellipsoidal 

arrangement 

x 

x1 

2 

þ y 

y 1 

2 

þ z 

z1 

2 

t 

t1 

2 

¼ 1: ð8Þ 

This change of invariant vector notation s at Eq. (7) enables to generalize description also on the cases where the components 

of speed in direction of individual axes are different. 

For s ¼ x1 ¼ y 1 ¼ z1 ct1 the Eq. (8) describes the situation given at Fig. 1b, which represents limiting case (maximal 

speed of dilatation, i.e. the speed of light). The equation also describes cases when light (energy) is propagated with smaller 

speed, i.e. s > x1 ¼ y 1 ¼ z1 ¼ vt1 (e.g. for speed of light v in transparent medium with refractive index n ¼ c=v). In this case, 

the invariant vector is s ¼ nx1 ¼ ny 1 ¼ nz1 ct1. 

The last most common case that is possible to describe by means of the Eq. (7) is the case when the speed of energy (light) 

passing through the medium depends on the direction of dilatation (anisotropic medium, s ¼ nxx1 ¼ nyy 1 ¼ nzz1 ct1Þ. This 

situation is demonstrated for 2D – Euclidean space with coordinates (x, y)atFig. 2a, for 2D orthogonal space with one Euclidean 

and one pseudo-Euclidean coordinates at Fig. 2b. It is necessary to formulate the space-time vector s(x, y, z, t) (Eq. (6)) 

more generally 

y 

r = n x x i + n y y j 

r (x , y ) 

x 

vt 

s = n x x i + ict l 

l = x i + ivt l 

l (x , vt ) 

Fig. 2. (a) 2D Euclidean spherical space ðp ¼ 2; q ¼ 0Þ for nx–ny and (b) 2D pseudo-Euclidean hyperbolical space ðp ¼ 1; q ¼ 1Þ for v < c (n > 1, 

respectively). 

x

s ¼ nxxi þ nyyj þ nzzk þðictÞl: ð9Þ 

Other generalization consists in shift of the centre of the spherical object (mass point, sources of energy, light) in point 

with coordinates ðx0; y 0; z0; ct0Þ 

x x0 

x1 

2 

þ y y 0 

y 1 

2 

þ 

z z0 

z1 

2 

t t0 

t1 

2 

¼ 1: ð10Þ 

In this case, the space-time vector will be equal for an observer being in time t ¼ 0 at the beginning of the coordinate 

system (see Eq. (9)) 

s0 ¼ nxx0i þ nyy 0j þ nzz0k þ ict0l: ð11Þ 

The change of its position in regards to the initial position ðDs ¼ s s0Þ will be Ds ¼ nxx1 ¼ nyy 1 ¼ nzz1 ct1, respectively. 

It is possible to express space-time vector by relation 

s ¼ nxðx x0Þi þ nyðy y 0Þj þ nzðz z0Þk þ icðt t0Þl: ð12Þ 

The situation described is demonstrated for 2D orthogonal space with one Euclidean and one pseudo-Euclidean coordinate at 

Fig. 3. It describes event that began in the past and its consequences are observed ðt0 < 0Þ at the time of the measurement, 

the depicts the situation when Fig. 3b the measurement began before the beginning of the relation ðt0 > 0Þ. In both cases the 

event arises in the beginning of the coordinate system ðx0 ¼ 0Þ, for v < c (nx > 1, respectively). 

We receive by means of extension of the conclusion on 4D pseudo-Euclidean space (space-time): e.g. x0 ¼ y 0 ¼ z0 ¼ 0, 

s 2 ¼ðnxxÞ 2 þðnyyÞ 2 þðnzzÞ 2 

ðctÞ 2 þ 2ct0t ðct0Þ 2 : ð13Þ 

In this relation, the coordinates (x, y, z) are converted in ‘‘optical coordinates”. This impact on space coordinates where the 

movement is instigated by mean of the light speed in vacuum ðnxx; nyy; nzzÞ. Mathematically, it asserts to the transformation 

of an ellipsoid to a sphere. 

The time components of the space-time vector have the following meaning: the ct0 responds to the time necessary for the 

phenomenon arriving to the observer, the 2ct0t expresses the diffusivity of the process (with diffusivity a ¼ 4ct0Þ. This means 

the incipient part of the process (induction period of the process) and the last member (ct) represents the respective process. 

Considering Eq. (13) it becomes apparent, that for the short times where t < t0 the diffuse processes will initially be used and 

only later the processes without diffusion (harmonic). 

The El Naschie’s golden field theory [4] is based on the so called Golden mean value, which can be given by the 

1; 1; 2; 3; ...Fnþ1; ... which obey Fnþ1 ¼ Fn þ Fn 1[5]. The Golden ratio of two successive Fibonacci numbers is limited by 

the value 

Fnþ1 

lim ¼ 

n!1 Fn 

1 

/ ¼ 1 þ /; ð1Þ 

pffiffiffi 

where Golden mean value is / ¼ð 5 1Þ=2 ¼ 0:6180339887. Eq. (4) implies that the Golden mean value can be calculated 

as 

p 

a 

ffiffiffi 

positive root of quadratic equation /ð1 þ /Þ ¼1. The negative root can be expressed as 1=/ ¼ ð1þ /Þ ¼ 

ð 5 þ 1Þ=2 ¼ 1:6180339887. 

El Naschie have demonstrated that the Golden mean value is equal to the Hausdorff dimension d ð0Þ 

c of the involved one- 

dimensional (superscript is equal to zero) Cantor transfinite sets which states have a probability equal to one [6]. By setting 

¼ / we can find the intersection rule of sets to any dimension n as follows 

d ð0Þ 

c 


vt 

l = x i +iv (t −t 0) l 

x 

vt 0 l (x , vt ) 

vt 

vt 0 l (x , vt ) 

l = x i +iv (t −t 0) l 

Fig. 3. 2D pseudo-Euclidean hyperbolical space ðp ¼ 1; q ¼ 1Þ (a) for future time coordinates (future light-cone, t0 < 0) and (b) for past time coordinates 

(past light-cone, t0 > 0). 

x


d ðnþ1Þ 

c ¼ d ð0Þ 

c 

n 

¼ / n : ð2Þ 

The average value of e1 with infinitely many dimensions nf using golden mean weights (centre of probability) can be 

written as 

Dime ð1Þ 

D E 

H ¼hdci ¼ X nf !1 

n/ 

0 

n / 1 

¼ ¼ 2 

ð1 /Þ / 3 ¼ 4 þ /3 : ð3Þ 

As follows form the work of Celerier and Notale [7], the velocity V denoted in general (in scale of relativity) can be obtained 

from a non-relativistic limit of the relativistic geodesics equation and not from the non-relativistic formalism, which involves 

symmetry breakings in a fractal 3D space. This velocity can be determined as a sum of two terms: a scale-independent, differentiable,‘‘classical” 

part and a power-law divergent, scale-dependent, non-differentiable ‘‘fractal” part [8] 

V ¼ v þ w ¼ v 1 þ a s ðDF 1Þ=DF ; ð4Þ 

Dt 

where DF is the fractal dimension of the path. Depending on the resolution at which it is considered, the transition scale s 

yields two distinct behaviours of the velocity. Since V v when Dt s and V w when Dt s. For the description of a 

quantum particle of mass m, the de Broglie scale can be identified with s of the system ðs ¼ h=EÞ and the fractal-like domain 

with the quantum one. It should be emphasized that, the geometry is actually fractal at all scales, even though the fractal 

contribution w becomes dominated by the classical one v at scales larger than the de Broglie scale. 

The scaled fluctuation a is described by a dimensionless stochastic variable which is normalized according to hai ¼0 and 

ha2i¼1. Because the DF ¼ 2 plays the role of a critical dimension [9], we will consider only the case of this fractal dimension 

2 here. The above description applies to any of the fractal geodesics. It follows that one of the geometric consequences of the 

fractal character of space is that there is infinity of fractal geodesics relating any couple of its points [9]. From Eq. (4) we can 

calculate coefficient 

a ¼ lnðw=aÞ 

lnðs=DtÞ ¼ DF 1 

; ð5Þ 

DF 

which describes the division of relativistic and non relativistic part of velocity. 

The last Eq. (5) points that the coefficient of space-time fractal structure relates to generally describing structure with 

Hausdorff dimension d ð0Þ 

c defined for e1 space (3) [10–12]. 

2. Field, potential and other quantities of conservative fractal structures 

Most of natural objects in space-time can be considered as fractal objects [13]. These objects can be analysed separately 

(e.g. in 3D space as stationary objects and/or in 1D time as signals) or in complex form. Fractals can be described using the 

fractal measure (K) and fractal dimension (D). Using the elementary cell, the fractal measure defines (in practice) the magnitude 

of the convergence of space (or space-time); while the fractal dimension describes the trend of the change of coverage 

as a function of size of the measuring cell (its radius can be larger or smaller than this radius of the elementary cell). 

Fractal dimension can vary between two limits: 

for D ¼ 0, the change of structure of fractal as the function of size of measure will be maximum (in the real world, e.g. the 

idealized objects mass point or point charge represent such situation), 

for D ¼ E, where E is the Euclidean dimension, the change of fractal structure will not depend on the change of measure (in 

the real world, e.g. the idealized object rigid body or homogeneity charged body represents this situation). 

In our previous papers [14,15], the density of fractal physical quantity qðrÞ, (e.g. mass density) in E-dimensional Euclidean 

space En ðE ¼ nÞ was defined 

qðrÞ ¼ Km0 

; ð14Þ 

rE D 

where NðrÞ ¼Km0 is the count of coverings of radius r by elementary quantity m0, K is a fractal measure and D a fractal 

dimension. 

It is possible to define intensity of the physical field E by application of Gauss–Ostrogradsky theorem 

divE ¼ kGNqðrÞ; ð15Þ 

and for radial field with the help of equation 

D dEr 

D E þ 1 dr ¼ kGNqðrÞ; ð16Þ 

where constant GN is Newton’s gravitational constant and k has various meaning for individual configurations of the fields 

(for various fractal dimensions, see 0).

Intensity of gravitational field E (gravitational acceleration) and potential V are inter related by the equation 

E ¼ gradV; ð17Þ 

so both quantities are connected with density of fractal quantity qðrÞ by means of relation 

DV ¼ div gradV ¼ divE ¼ kGNqðrÞ; ð18Þ 

where D is the Laplace operator. This equation can be rewritten for radial distribution of fractal quantity qðrÞ in the form 

D d 

D E þ 1 

2 V r 

dr 2 ¼ kGNqðrÞ: ð19Þ 

From the density of quantity qðrÞ we can determine radial field intensity Er and corresponding potential V r of physical 

(e.g. gravitational) field 

Er ¼ kGN 

D 

Km0 

r E D 1 ; V r ¼ 

kGN Km0 

DðD E þ 2Þ rE D 2 ð20Þ 

on dimension r of elementary cell. 

Table 1 gives the notable fractal dimensions in E-dimensional Euclidean space. Constants s0, r0 and q 0 are linear, surface 

and volume mass density of fractal structure, whereas m0 is the elementary quantity. 

By the integration of mass density over volume dV we can derive the mass of fractal matter in the space of volume 

V ¼ rE Z 

MðrÞ ¼ 

V 

qdV ¼ E 

D Km0r D : ð21Þ 

For mass point ðD ¼ 0Þ, the mass will be constant, which reflects the independence of the dimensions of limiting space. On 

the other hand for homogenous body ðD ¼ EÞ, this mass will enhance with Eth power of dimension of limiting space (for 

E ¼ 3 with the third power). 

3. Quantities of fractal structures in space-time (of gravitational field) 

3.1. Length contraction and time dilation 

It is also possible to apply quantities defined in previous chapter for E-dimensional Euclidean space on space-time. In this 

case, the vector r will be created ðE 1Þ with spatial coordinates ðp ¼ 1; 2; 3Þ and with one time coordinate ðq ¼ 1Þ. Dimension 

of this vector (space-time vector) 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

r ¼ c2t 2 

q 

; ð22Þ 

r 2 T 

where rT is size of spatial vector rT;t is time coordinate and c is speed of the light in vacuum, which is invariant in regard to 

the choice of inertial relative system. 

By means of simple modification of Eq. (22) it is possible to deduce relation for transformation of coordinates of the vector 

rT radial fractal ðE 1Þ-dimensional space to E-dimensional space-time vector r 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

rðvÞ ¼ict 1 r2 T =ðctÞ2 

q 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

¼ r0 1 v 2 =c2 q 

; ð23Þ 

where v ¼ rT=t ¼ const: is the speed of movement of fractal structure in the space and r0 ¼ ict ¼ const: ði ¼ ffiffiffiffiffiffiffi p 

1Þ 

is its 

dimension (radius) in the case that fractal structure does not move with regard to the relative system. 

It is also possible using Eq. (23) to define the relation for transformation of time interval from the equation (on the 

assumption, that r ¼ const:). 


r ¼ ict0 ¼ ict 1 v 2 =c2 q 

; ð24Þ 

where t0 is the time of the process duration with regard to relative system at rest. 

Table 1 

Notable fractal dimensions in E-dimensional Euclidean space. 

D Independent quantity Kind of field Volume for E ¼ 3 kGNm 0 

Generally For E ¼ 3 


0 0 M0 ¼ const: Mass point V ¼ 4pr 3 =3 GNm0 

E 2 1 V r ¼ const: Equipotential field V ¼ 2pr 3 2GNs 0 

E 1 2 Er ¼ const: Homogenous intensity of field V ¼ 8r 3 4pGNr 0 

E 3 q ¼ const: Homogenous density of field 4pGNq 0


By means of simple arrangement we receive 

t0 


1 v2 =c2 tðvÞ ¼p 

: ð25Þ 

Eqs. (23) and (25) are known as relations for length contraction and time dilation in a special theory of relativity. 

3.2. Density of fractal quantity 

It is also possible to modify other quantities defined in the previous chapter in the same way. Density of fractal quantity is 

possible to be expressed in E-dimensional space-time (for t ¼ const:) for example with the relation 

q0 ð1 v2 =c2Þ Km0 

qðvÞ ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ðr2 T c2t 2 q ¼ q ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ; ð26Þ 

E D 

E D 

Þ 

where q 0 ¼ Km0=ðictÞ E D is the density of fractal structure in rest with regard to relative system. For speeds much smaller 

than the speed of light it is possible to use approximate relation following from the neglecting of members of higher orders 

during the series development 

E D 

qðvÞ ffiq0 1 þ 

2 

v2 c2 ffi q E D 

0 exp 

2 

v 2 

c 2 : ð27Þ 

From the Eq. (26) it follows, e.g. for movement of mass point ðD ¼ 0Þ in the direction of axis xðE ¼ 2; p ¼ 1; q ¼ 1Þ where one 

coordinate is time and the other represents axis that the relation for density of body can be expressed as 

qðvÞ ¼ 

q0 1 v 2 ; ð28Þ 

=c2 which is known from the special theory of relativity. 

However, it is also possible to understand Eq. (26) more generally. During the expansion of mass in E-dimensional space, 

the density will increase in relation to the space properties (characterized by fractal dimension D). The dominant changes of 

the density occur for energy expansion from the mass point ðD ¼ 0Þ. The density will not be changed with the speed for 

homogeneously filled space ðE ¼ DÞ. 

The dependences of expansion density of fractal quantity at Eq. (26) from surface source (E ¼ 4, D ¼ 2, linear arrangement), 

line source (E ¼ 4, D ¼ 1, cylindrical arrangement) and point source (E ¼ 4, D ¼ 0, spherical arrangements) are plotted 

in Fig. 5. The results for surface point source are in correlation with results for movement of mass point in 1D space (2D 

space-time, respectively), ðE ¼ 2; D ¼ 0Þ, see Fig. 4. 

For small speeds of movement (relativistic compression), it is possible to implement simplifying approximation: linear or 

exponentional function, Eq. (27), respectively. It follows from the analysis of the dependences, that already for speeds smaller 

than half of the speed of light ðv < c=2Þ the mistake between correct and the approximated values is less than 10%. 

It is also possible to express the dependence of the intensity and potential of fractal field on the speed of dilation and 

contraction of the space (with constant speed) 

ð1 

Er0 

v2 =c2 E 

Þ 

D 1 

ð1 

V r0 

v2 =c2 E 

Þ 

D 2 

ErðvÞ ¼q 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ; V rðvÞ ¼q 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ; ð29Þ 

where Er0 ¼ E r0 =ðictÞ E D 1 , V r0 ¼ V r0 =ðictÞ E D 2 , ðE r0 ¼ GNKm0=D; V r0 ¼ E r0 =ðE D 2ÞÞ and v ¼ rT=t ¼ const: 

For conditions discussed for density of fractal structure ðE ¼ 2; D ¼ 0Þ, thus corresponds to the movement of mass point 

(body) in direction of axis x and the relations will have form 

Er0 


1 v 2 =c2 ErðvÞ ¼p 

; V r ¼ V r0 ¼ const: ð30Þ 

Fig. 4. Space-time geometry in 4th dimensional space ðE ¼ 4Þ with three Euclidean ðp ¼ 3Þ and one pseudo-Euclidean dimension ðq ¼ 1Þ: (a) plane-parallel, 

(b) cylindrical, (c) spherical and their fractal dimensions D. The arrows mark direction of the movement (expansion) of the mass.

From the first equation, it follows that the intensity of gravitational field (gravitational acceleration) grows up with second 

root. The second equation tells us that the field is equipotential in the whole space (the dimension of speed of fractal structure 

is constant in 1D space). 

These relations will also have the same form in 4D space for geometrical shapes (places) defined in the plane 

yzðE ¼ 4; D ¼ 2Þ moving in direction of axis x with constant speed v. 

3.3. Mass in theory of relativity 

From Eq. (26), it follows that the density of fractal quantity depends on the difference of Euclidean and fractal theory. 

Protruding from this assertion is that for various arrangements (see Table 2) the density of fractal quantity can be described 

with the same dependence (for E D ¼ const:). 

The relativistic change of the mass will depend on the direction of change of the density (movement of the mass) in contrast 

to the Eq. (21) where the symmetrical change of the density in E-dimensional space was assumed. 

If this change is only in one direction (plan-parallel arrangement) the volume is directly proportional to the length of the 

object in this direction) V r. 

The volume will be directly square power proportional to the length of the object V r2 , in two directions, it means in 

the plane (cylindrical arrangement). 

The volume will be directly third power proportional to the length of the object V r3 in three directions, it means in 3 D 

space (spherical arrangement). 

Assuming movement of the mass point in direction of x axis ðE ¼ 2; D ¼ 0Þ only one coordinate of the volume ðEV ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

¼ 1Þ 

will be changed, the volume will be V ¼ V 0 1 v 2 =c2 p 

, where V 0 ¼ ict and the mass M(r) is approximately possible to be 

expressed by means of the Eq. (28) in the form 

M0 


1 v 2 =c2 MðvÞ qðrÞV ¼ p ; ð31Þ 

where M0 ¼ q 0 V 0 is also a known relation from the special theory of relativity. Using Eqs. (21) and (26) a more general rel- 

ativistic relation for the mass can be derived 

Z 

MðvÞ ¼ qdV 

M0 

¼ q ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi ; ð32Þ 

V 

ρ (a.u.) 

10 

5 

0 

0 

ð1 v 2 =c2 E D 1 

Þ 

STR EXP CTR 

STR EXP CTR 

STR EXP CTR 

where M0 ¼ Km0=ðD E þ 1Þ=ðictÞ E D 1 . Based on the values listed in Table 2 (plan-parallel arrangement) we receive further 

known relation for the mass transformation for the theory of relativity. 

0.5 

v/c 

D = 0 

D = 1 

D = 2 

Fig. 5. The relativistic (STR), classical (CTR) and exponential (EXP) dependences of the density of fractal quantity on the speed (or expanding) of energy in 

4th dimensional space ðE ¼ 4Þ for planar ðD ¼ 2Þ, cylindrical ðD ¼ 1Þ and spherical ðD ¼ 0Þ case. 

Table 2 

Possible model arrangement of space-time. 


Arrangement Plan-parallel Cylindrical Spherical 

Space-time dimension (E) 4 3 2 4 3 4 

Euclidean dimension (p) 3 2 1 3 2 3 

Pseudo-Euclidean dimension (q) 1 1 1 1 1 1 

Fractal dimension (D) 2 1 0 1 0 0 

Volume dimension ðEV ¼ E D 1Þ 1 1 1 2 2 3 

1


Analogous results can be also derived for EV ¼ 2, when V ¼ V 0 ð1 v 2 =c 2 Þ a V 0 ¼ðictÞ 2 and for EV ¼ 3, when 

V ¼ V 0 ð1 v 2 =c 2 Þ 3=2 and V 0 ¼ðictÞ 3 , respectively. Equation can be generally written as 

M0 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ð1 v 2 =c2Þ E D EV MðvÞ ¼q 

; ð33Þ 

where M0 ¼ Km0EV =ðD E þ EV Þ=ðictÞ E D E V . 

It is evident from Table 2 that this relation changes to the Eq. (31) for M0 ¼ Km0EV =ðictÞ all combinations of dimensions. 

Conclusion arising from this fact is that the relativistic mass transformation of physical quantity is not dependent on the 

nature of the mass (energy) movement. 

An interesting conclusion follows from these considerations: individual quantities can come into the transformation relations 

with various fractal and Euclidean dimension. 

3.4. Density of energy and energy in theory of relativity 

It is possible to express the density of energy in the E-dimensional space-time (for t ¼ const), e.g. by means of Eqs. (14) 

and (20) (Eqs. (26) and (29), respectively) as 

wðvÞ ¼qðvÞV rðvÞ ¼ 

w0 

ð1 v 2 =c2 ; ð34Þ 

E D 1 

Þ 

where w0 ¼ GNK 2 m 2 0 =ðc2 t 2 Þ E D 1 is the density of energy of fractal structure provided its with regard to the relative system in 

rest. 

For speeds much less than that of light it is also possible alongside that of density, to use the relations that come from the 

neglecting of members of higher orders during the series development. 

wðvÞ ffiw0 1 þðE D 1Þ v2 

c2 ffi q 2 

0 exp ðE D 1Þv 

c2 : ð35Þ 

from Eq. (34) it follows thus for the movement of mass point (D=0) in direction of x axis (E = 2, one coordinate is time, the 

other represents axis x) that the equation for density of energy of fractal body becomes 

wðvÞ ¼ 

w0 

1 v 2 : ð36Þ 

=c2 By integration of Eq. (36) over volume V ¼ V 0 ð1 v 2 =c 2 Þ E V =2 , where V 0 ¼ðictÞ E V we receive relativistic relation for 

energy 

Z 

EðvÞ ¼ 

V 

E0 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ð1 v 2 =c2Þ 2E 2D EV 2 

wdV ¼ q ; ð37Þ 

where E0 ¼ GNK 2 m 2 0 EV =ð2D 2E þ EV þ 2Þ=ðictÞ 2E 2D E V 2 . 

For special cases listed in Table 2 (e.g. for EV ¼ðE D 1Þ it is possible to simplify the equation 

E0 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ð1 v 2 =c2Þ EV EðvÞ ¼q 

; ð38Þ 

where E0 ¼ GNK 2 m 2 0 =ðictÞE V ¼ GNK 2 m 2 0 =V 0 . 

Further modification (for plan-parallel arrangement, EV ¼ 1Þ of Eq. (38), we receive well known relation for transformation 

of energy in special theory of relativity 

E0 


1 v2 =c2 EðvÞ ¼p 

; ð39Þ 

from which E0=M0 ¼ GNKm0 ¼ c 2 . 

4. Time dependences of fractal quantities (of gravitational and thermal field) 

4.1. Density of fractal quantity without diffusion 

In previous chapter, we equated time from the relation for density of fractal structure (14) defined in space-time (26). 

In this way, we received connection between densities of the structure in the system moving with speed v in regards to its 

density in the body. It is also possible to eliminate the position vector of dimensional coordinates rT in the same way. 

Vector r will be again defined ðE 1Þ by spatial coordinates ðp ¼ 1; 2; 3Þ and one time coordinate ðq ¼ 1Þ. It is possible to 

express the time change of the density of fractal structure in E- dimensional space-time (for r ¼ const:) likewise (26)

q 0 

Km0 

qðtÞ ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ðr2 T c2t 2 q ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

E D 

Þ ðt 2 =s2 q ; ð40Þ 

E D 

M 1Þ 

where q0 ¼ Km0=ðirTÞ E D is the density of fractal structure at time t ¼ 0s, i ¼ ffiffiffiffiffiffiffi p 

1 and sM ¼ rT=c is the time constant characterizing 

the change of the quantity in any given location of space. 

For times much longer than the dimension of the time constant (it means for the speeds v much smaller than speed of 

light c) it is possible to write simplified relation 

qðtÞ ffiq 0 

sM 

t 

E D 

: ð41Þ 

This relation is very often used like an approximation for description of time process of density (concentration of the 

charge, respectively) in homogenous electric field ðD ¼ E 1Þ. 

However, realistic approximation of Eq. (40) comes from the series development with neglecting of members of higher 

orders (PWR), by means of exponentional function (EXP), respectively 

qðtÞ ffiq 0 

sM 

t 

E D 

E D 

1 þ 

2 

s 2 M 

t 2 

ffi q 0 

sM 

t 

E D 

exp 

E D 

2 

s 2 M 

t 2 : ð42Þ 

These approximations have their own foundation for very long times. From the analysis of dependences it follows (see Fig. 6) 

that the error between correct and approximated values is less than 10% only for values twice longer than the time constant. 

It is not possible to use the mentioned approximation for the longer times ðt > 2sMÞ, because the density has generally a 

complex character 

q ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi : ð43Þ 

qðtÞ ¼ð 1Þ ðE DÞ=2 q0 ð1 t 2 =s2 D 

MÞE For times much shorter than the dimension of time constant, it is possible to use again simplified relations following from 

the series development with neglecting of components of higher orders (PWR) or more precisely by means of exponential 

function (EXP) 

qðvÞ ffiq0ð 1Þ ðE DÞ=2 E D 

1 þ 

2 

t 2 

s 2 M 

4.2. Density of fractal quantity with diffusion 

ffi q 0 ð 1Þ ðE DÞ=2 exp 

E D 

2 

t 2 

s 2 M 

: ð44Þ 

If we suppose that the effect occurred in other time than the measurement was initiated (later or sooner, see Eqs. (10) or 

(12)), the spatial vector can be expressed by the relation r 2 ¼ r 2 T c 2 ðt t0Þ 2 , where r 2 T ¼ x2 þ y 2 þ z 2 is the radius of fractal 

space and t0 is delay of the time response (so-called induction period). The density of fractal structure will be 

Km0 

qðtÞ ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

r2 T c2ðt t0Þ 2 

Km0 

r 

h i 

¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

E D 

r2 0 þ 4a0t c2 q ; 

2 E D 

t 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ð45Þ 

where r0 ¼ r2 T c2t 2 

q 

0 is the quantity of initial space-time vector and a0 ¼ c2t0=2 is the maximum value of diffusivity (for 

D ¼ E). By simple modification of Eq. (45) we obtain 

ρ (a.u.) 


COR EXP PWR 

COR EXP PWR 

COR EXP PWR 

D = 0 

D = 1 

D = 2 

0 

0 1 2 3 

t/ τ M 

Fig. 6. Correct time dependences of fractal quantity density (COR), and their exponential (EXP) and power (PWR) approximations for t sM and for t sM 

in 4th dimensional space ðE ¼ 4Þ for planar ðD ¼ 2Þ, cylindrical ðD ¼ 1Þ and spherical ðD ¼ 0Þ case.


Km0 

qðtÞ ¼ 

ð4a0tÞ ðE DÞ=2 1 þ r2 0 

4a0t þ c2t 4a0 

ðD EÞ=2 

: ð46Þ 

It is also possible to divert this relation by means of simple modifications (see Appendices A and B) to the exponential 

function 

Km0 

qðtÞ ¼ 

exp 

ðE DÞ=2 

ð4a0tÞ 

E D 

2 

r 2 0 

4a0t 

: ð47Þ 

If we compare Eqs. (47) and (62) we can deduce that the conversion is possible only under following condition c 2 ¼ 2r 2 0 . 

These corrections are often used in models applying the exponential functions. It is also possible to express time dependences 

of intensity and potential of fractal field in given place space (for rT ¼ const:) in the same way 

ErðtÞ ¼ 

V rðtÞ ¼ 

Er0 exp 

ðE D 1Þ=2 

ð4a0tÞ 

V r0 

exp 

ðE D 2Þ=2 

ð4a0tÞ 

E D 1 

2 

E D 2 

2 

r 2 0 

4a0t 

r 2 0 

4a0t 

; ð48Þ 

; ð49Þ 

where a0 ¼ c 2 t0=2 is the maximum value of diffusivity (for D ¼ E), E r0 ¼ kGNKm0=D and V r0 ¼ E r0 =ðE D 2Þ, similarly to 

Eq. (29). 

4.3. Thermal field of fractal structures 

For thermal field, the potential expression of the temperature is given in Eq. (48). In the case of thermal field for the 

dependence of temperature on radius using, we can write [16,17] 

TrðrÞ ¼ hc 

k 

D Eþ2 

Kr 

: ð50Þ 

DðD E þ 2Þ 

If the vector r in the Eq. (50) is expressed like r 2 ¼ r 2 T c 2 ðt t0Þ 2 , where t0 is the time response delay (so-called induction 

period), it is possible (alike by decomposition of the density) to re-write it to the relation 

TrðtÞ ¼ hc 

k 

ðD 

Kð4a0tÞ 

Eþ2Þ=2 

DðD E 2Þ 

1 þ r2 0 

4a0t þ c2 t 

4a0 

ðD Eþ2Þ=2 

: ð51Þ 

If the heat diffuses by significantly smaller speed ðr2 T a0t, small distances or long times), then the terms in parenthesis can 

be viewed as significant in the expansion of exponential function ð1 x e xÞ and we can write 

TrðtÞ ¼ hc 

k 

ðD Eþ2Þ=2 

Kð4a0tÞ 

DðE D 2Þ exp 

E D 2 

2 

r 2 0 

4a0t 

If we substitute for the thermal diffusivity a ¼ 2a0=ðE D 2Þ, where a is the coefficient of thermal diffusivity of the body 

with fractal dimension D, we obtain 

TrðtÞ ¼ Khc 

k 

½2ðED2ÞatŠ DðE D 2Þ 

ðD Eþ2Þ=2 

exp 

r 2 0 

4at 

For the total heat transferred to the body from the heat source 

QðtÞ ¼ 2hc 

k 

we can write 

ð52Þ 

: ð53Þ 

Kt 

D½ðE D 2Þ=2pŠ ðD EÞ=2 ð54Þ 

QðtÞ 

TrðtÞ ¼ 

exp 

ðE DÞ=2 

cpqð4patÞ 

r 2 0 

4at 

: ð55Þ 

From the last relation it is apparent, that the time dependence of the temperature will depend on the experimental arrangement. 

This applies to the values of Euclidean and fractal dimensions and also on properties of excitation source; see Eq. (54). 

Using the pulse transient method, the delivered heat will be constant, and by the step wise method, the delivered heat 

will change linearly with time. Generally speaking, the actuating quantities (e.g. heat) can take different fractal dimensions 

in the equation. 

Eq. (55) is applicable in [18–20] for fractal dimensions D ¼ 0; 1; 2 and topological dimension E ¼ 3; see Fig. 7. 

The typical time responses of temperature for the rectangle (Dirac) pulse of different input power of heat with various 

pulse widths are presented in Fig. 8, [16].

The heat power and width of the pulse were changed to find the optimal measurement conditions and subsequently to 

determine the reliable data of the thermal diffusivity, specific heat and thermal conductivity of the studied material. 

5. Conclusion 

Fig. 7. Heat flow geometry for (a) plane-parallel, (b) cylindrical and (c) spherical coordinates Euclidean space. 

ΔT (°C) 


1.2 

0.6 

0.0 

0 

Fig. 8. Temperature responses of the sample measured by the pulse transient method for different heat powers and various pulse widths. 

Two important applications of the fractal theory are discussed in this contribution. Both of them originate from the theory 

of space-time. 

The first deals with the formulation of laws of the special theory of relativity for fractal structures in E-dimensional spacetime 

with ðE 1Þ-dimensional coordinates and with one time coordinate. The obtained results are in accordance with the 

special theory of relativity of the mass point moving in 4D space-time. However, it is also possible to extend these results 

to objects that embody fractal structure both in macro world (space objects) and in micro world (elementary particles). 

By extending to the more-dimensional space-time ðE > 4Þ it is also possible to formulate laws of general theory of relativity 

with the help of the described theory. 

Hypothetically, it is possible to apply the mentioned mathematical apparatus also to space-times with more time coordinates. 

Other important conclusion being also in accordance with the special theory of relativity consists in an idea that 

various physical quantities can come into the resulting equations with various fractal dimension [22–24]. Example for the 

calculation of mass of ðm ¼ qVÞ the density has Euclidean dimension Eq ¼ 3, but the volume has only EV ¼ 1. 

The second presented application is focused on problems of transient measurement of various physical quantities having 

fractal character. In this case the theory is generally formulated in E-dimensional space. It follows from the analysis described 

in the contribution that the expression of time dependences by means of combination of exponentional and power 

functions (e.g. by formulation of Planck radiation law) is equivalent to the expression by means of power functions defining 

fractal physical quantities in space-time as discussed in this contribution. The article also outlines the conditions enabling 

the series development of these functions to the power range under which errors are negligible (number of development 

members, coefficients of power and exponential function). If we balance the result from power dependence describing characters 

of fractal fields, we can discuss suitable conditions under which it is possible to approximate power range by means of 

the functions used in classic theories. We believe that it is possible to eliminate the possible deviations of the experiments 

and models just by consistent using of proposed fractal theories. 

In practice the transient measurement can be realized for various experiment arrangements of the experiment (planar, 

cylindrical, and spherical). In this case, the responses depend not only on experimental arrangement but also on the properties 

of actuating signal. Example for calculation of specific heat by means of pulsed transient, the method of the temperature 

with dimension depends on experiment arrangement (for spherical arrangement, it means from punctual temperature 

source ET ¼ 3) comes into the relation cp Q=T, heat with Euclidean dimension EQ ¼ 1. 

400 

t (s) 

15 100 

20 200 

23 800 

28 700 

40 000 

J m –2 

J m –2 

J m –2 

J m –2 

J m –2



This work was supported by Project KAN401770651 from The Academy of Sciences of the Czech Republic and by Project 

and by Grant FT-TA3/048 from the Ministry of Industry and Trade of the Czech Republic. 

Appendix A. Series development of exponential function on power – in denominator 

The conversion between fractal expression of time dependences of physical quantities (i.e. by means of power range) and 

their classical expression (by means of exponential function, of power, and of exponential function, respectively) it is possible 

to realize with the help of exponential function series development into the power range. Exponential function 

f ðxÞ ¼f0x m expð nxÞ ð56Þ 

can be represented by Planck radiation law 

2phm 3 

wðmÞ ¼ 

c3 ; ð57Þ 

½expðhm=kTÞ 1Š 

which means the dependence of density of energy (spectral radiance) on the frequency of the thermal radiation. The variable 

m is frequency of thermal radiation, coefficient m is its exponent ðm ¼ 3Þ and coefficient n is dependent on the temperature 

n ¼ h=kT (for high frequencies and low temperatures when the constant ‘‘1” can be negligible). Function (56) has maximum 

for xm ¼ m=n, that constitutes in the relation for the density of energy maximal spectral radiance for frequency mm ¼ mkT=h, 

more exactly defined with using Lambert’s function u ¼ m þ Wð me m Þ for frequency mm ¼ ukT=h, respectively. It will be 

mm 2:821439kT=h for m ¼ 3 [16]. 

The perverted values of the variables can be possibly used to transpose into an exponential function in a similar way as 

Eq. (56) into the form 

f ðxÞ ¼f0x m expð n=xÞ: ð58Þ 

This equation can express, e.g. Planck radiation law in the form 

2phc 

wðkÞ ¼ 

k 5 ½expðhc=kkTÞ 1Š 

This means the dependence of the density of energy (spectral radiance) on wavelength of the thermal radiation. In this 

case, the variable x is the wavelength of temperature radiation, coefficient m is its exponent ðm ¼ 3Þ and coefficient n is 

dependent on temperature n ¼ hc=kT (for low wavelengths and low temperatures, when the constant ‘‘1” can be negligible). 

Function (58) has maximum for xm ¼ n=m, that represents maximal spectral radiance for the wave length km ¼ mhc=kT in 

the relation for density of energy, resp. more exactly with using Lambert’s function u ¼ m þ Wð me m Þ for the wave length 

km ¼ uhc=kT. It will be km 4:965114hc=kT for m ¼ 5, respectively 

Eq. (58) can also express temperature dependence on the time acquired using pulsed transient method [16–20] 

Q 

TðtÞ ¼ 

cpqð4patÞ m exp r 2 

T =4at : ð60Þ 

where Q is the total heat transferred to a body, rT is the distance of heat source from temperature detector, cp is the specific 

heat capacity at constant pressure, q is the mass density and a is the coefficient of thermal diffusivity. Coefficient m represents 

an exponent dependent on an experiment configuration (e.g. m ¼ 3=2 for planar arrangement) and coefficient 

n ¼ r 2 T =4a. 

By the development of exponential functions (see Eqs. (56), or(58), respectively) to the power series we get following 

relations 

or 

f0x m 

f ðxÞ ¼f0x m expð nxÞ; f ðxÞ ¼ 

ð1 þ x þ x2 =2 þ ...Þ n ; ð61Þ 

f0x m 

f ðxÞ ¼f0x m expð n=xÞ; f ðxÞ ¼ 

ð1 þ 1=x þ 1=2x2 þ ...Þ n : ð62Þ 

These equations lead already for the first three members of the development to power series to functions having two extremes. 

For the first case it is possible to express the location of these extremes by relations 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ðm nÞ ðm nÞ 

xm ¼ 2 q 

þ 4mðn m=2Þ 

: ð63Þ 

2ðn m=2Þ 

Positions of these two extremes will be approximately equal for m n 

ð59Þ

xm ¼ 

ðm nÞ ðm nÞ 

: ð64Þ 

2n 

The first of which is identical with the position of the extreme of the exponential function xm ¼ m=n, (see Eq. (56)). For 

Wien’s displacement law [21] it means, that for xm ¼ mmm=m0, where m0 ¼ kT=h is minimal frequency of Einstein–Bose distribution 

function (see Eq. (58)) that the following condition must be satisfied: 1 < hmm=kT < hm=kT. 

In the same manner, the Wien’s displacement law is formulated with the help of wave length (see Eq. (59)) which must 

satisfy the following condition: k0=hc > km=hc > k=hc for xm ¼ mkm=k0, where k0 ¼ hc=kT is minimal wave length of Einstein– 

Bose distribution function (see Eq. (59)). 

And finally for the maximum of the temperature responses (see Eq. (60)) an expression of the exponential function is possible 

to be obtained by means of power range for xm ¼ mam=a0, where a0 ¼ hc=kT is the coefficient of thermal diffusivity provided 

that 4a0=r 2 T > 4am=r 2 T > 4a=r2 T . 

These dependences are compared in Fig. 9. The deviations between both models are dependent on the m/n ratio. For 

m=n 1 the deviations are negligible already by application of a polynomial approximation by means of second order. 

Appendix B. Series development of an exponential function to the power function – in numerator 

By the development of exponential functions into the power series (see Eqs. (56), or(58), respectively) we receive the 

following equations 

or 

f (x) 

0.3 

0.2 

0.1 

0 

0 0.2 0.4 0.6 0.8 1 

0.0000 

0 5 10 15 20 

x 

x 

f ðxÞ ¼f0x m expð nxÞ; f ðxÞ ¼f0x m ð1 x þ x 2 =2 ...Þ n ; ð65Þ 

þf ðxÞ ¼f0x m expð n=xÞ; f ðxÞ ¼f0x m ð1 1=x þ 1=2x 2 


EXP 

PWR 

Fig. 9. (a) Development of an exponential function (56) into the power series (61) for m ¼ 3, n ¼ 18 (model of Planck radiation law in the form given by Eq. 

(57)), (b) development of an exponential function (58) into the power series (62) for m ¼ 5, n ¼ 30 (model of Planck radiation law in the form given by Eq. 

(59)). 

...Þ n : ð66Þ 

These equations lead already for the first three members of the development to the power series to functions having two 

extremes. For the first case it is possible to express the position of these extremes by means of relations 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

ðm þ nÞ ðm þ nÞ 

xm ¼ 2 q 

þ 4mðn þ m=2Þ 

: ð67Þ 

2ðn þ m=2Þ 

Positions of these two extremes will be approximately equal for m n 

ðm þ nÞ ðm nÞ 

xm ¼ : ð68Þ 

2n 

The first is identical with position of extreme of exponential function xm ¼ m=n, (see Eq. (56)). For Wien’s displacement law 

[21] it means, that for xm ¼ mmm=m0, where m0 ¼ kT=h is minimal frequency of Einstein-Bose distribution function (see Eq. 

(57)) has to satisfy the following condition: 1 < hmm=kT < hm=kT. 

Likewise, Wien’s displacement law can be formulated by means of wave length (see Eq. (59)) which must satisfy the following 

condition: k0=hc > km=hc > k=hc for xm ¼ mkm=k0, where k0 ¼ hc=kT is minimal wave length of Einstein–Bose division 

(see Eq. (59)). 

And finally for the maximum of the temperature response (see Eq. (60)) an expression of exponential function is possible 

to obtain by means of power for xm ¼ mam=a0, where a0 ¼ hc=kT is the coefficient of thermal diffusivity provided that 

4a0=r2 T > 4am=r2 T > 4a=r2 T . 

f (x) 

0.0010 

0.0008 

0.0006 

0.0004 

0.0002 

EXP 

PWR


f (x) 

These dependences are compared in Fig. 10. The deviations between both models are also dependent on the m/n ratio as 

in the first case. For m=n 1 the deviations are negligible already by application of a polynomial approximation by means of 

second order. 

References 

0.3 

0.2 

0.1 

EXP 

PWR 

0 

0.0000 

0 0.2 0.4 

x 

0.6 0.8 1 0 5 10 

x 

15 20 

Fig. 10. (a) Development of an exponential function (56) into power series at Eq. (65) for m ¼ 3, n ¼ 18 (model of Planck radiation law in the form given by 

Eq. (57)), (b) development of exponential function given by Eq. (58) into power series (66) for m ¼ 5, n ¼ 30 (model of Planck radiation law in the form given 

by Eq. (59)). 

[1] Spacetime, Wikipedia. Available from: http://en.wikipedia.org/wiki/Spacetime. 

[2] Nottale L. Fractal space-time and microphysics. Singapore: World Scientific; 1998. 

[3] Rosen J. Embedding of various relativistic spaces in pseudo-Euclidean spaces. Rev. Mod. Phys. 1965;37:204–14. 

[4] El Naschie MS. Superstrings, knots and non-commutative geometry in E infinite space. Int. J. Theor. Phys. 1998;37:12. 

[5] Castro C. Fractal strings as an alternative justification for El Naschie’s cantorian space time and the fine structure constant. Chaos, Solitons & Fractals 

2002;14:1341–51. 

[6] El Naschie MS. A review of E infinite theory and the mass spectrum of high energy particle physics. Chaos, Solitons & Fractals 2004;19:209–36. 

[7] Celerier MN, Nottale L. The Pauli equation in scale relativity. LUTH, CNRS, Observatoire de Paris-Meudon, September 20, 2006. 

[8] Nottale L. Scale relativity and quantization of universe. Astron. Astrophys. 1997;327:867–89. 

[9] Nottale L. Scale relativity and fractal space-time: applications to quantum physics, cosmology and chaotic systems. Chaos, Solitons & Fractals 

1996;7:877–938. 

[10] El Naschie MS. An irreducibly simple derivation of the Hausdorff dimension of spacetime. Chaos, Solitons & Fractals 2009;41:1902–4. 

[11] El Naschie MS. On the Witten–Duff five Branes model together with knots theory and E8E 8 super strings in a single fractal spacetime theory. Chaos, 

Solitons & Fractals 2009;41:2018–21. 

[12] El Naschie MS. Knots and exceptional Lie groups as building blocks of high energy particle physics. Chaos, Solitons & Fractals 2009;41:1799–803. 

[13] Mandelbrot BB. Fractal geometry of nature. New York: W.H. Freeman and Co.; 1983. 

[14] Zmeskal O, Nezadal M, Buchnicek M. Fractal–cantorian geometry, Hausdorff dimension and the fundamental laws of physics. Chaos, Solitons & Fractals 

2003;17:113–9. 

[15] Zmeskal O, Nezadal M, Buchnicek M. Field and potential of fractal–cantorian structures and El Naschie’s e (1) theory. Chaos, Solitons & Fractals 

2004;19:1013–22. 

[16] Zmeskal O, Buchnicek M, Vala M. Thermal properties of bodies in fractal and cantorian physics. Chaos, Solitons & Fractals 2005;25:941–54. 

[17] Stefkova P, Zmeskal O, Capousek R. Study of thermal field in composite materials. In: Novak Miroslav M, editor. Complexus Mundi. World Scientific; 

2006. p. 217–24. 

[18] Carslaw HS, Jaeger JC. Conduction of heat in solids. London: Clarendon Press; 1959. 

[19] Krempasky´ J. Measurement of thermophysical quantities. VEDA Bratislava; 1969. 

[20] Kubičár L’. Pulse measurement of measuring basic thermophysical parameters. VEDA Bratislava and Elsevier; 1990. 

[21] Weisstein WE. World of physics. Wien’s displacement law. Wolfram Research. Available from: http://scienceworld.wolfram.com. 

[22] Sidharth BG. The nature of quantum space-time and the cantorian e ð1Þ proposal. Chaos, Solitons & Fractals 2002;14:1325–30. 

[23] Sidharth BG. Dimensionality and fractals. Chaos, Solitons & Fractals 2002;14:831–8. 

[24] Ord GN. Fractal space-time and the statistical mechanics of random walks. Chaos, Solitons & Fractals 1996;7:821–43. 

f (x) 

0.0010 

0.0008 

0.0006 

0.0004 

0.0002 

EXP 

PWR

Notes to ‘‘An irreducibly simple derivation of the Hausdorff dimension 

of spacetime” by M.S. El Naschie 

Oldrich Zmeskal *, Martin Weiter, Martin Vala 

Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech Republic 

article info 


Accepted 20 January 2009 

Communicated by: Prof. G. Iovane 

1. Random Hausdorff dimension 

abstract 

Some new details of calculation of random Hausdorff dimension, not only for spacetime, 

but for any other topological dimension are presented in this note. In the second part, there 

are some first iteration of Hausdorff dimensions (based on the Cantor discontinuum or 

Sierpinsi triangle) and their limited values. 


The terms for calculation of random Hausdorff dimension of space-time described in contribution [1] can be generally 

calculated by iteration equation 

Dnþ1 ¼ D1 þ a 

ð1Þ 

Dn 

where D 1 = 4 and a = 1. 

We suppose that the Eq. (1) converges to value D1 for n ? 1. Then we get its limited value by solving of the quadratic 

equation 

from which 

D 2 

1 D1D1 a ¼ 0; ð2Þ 

D1ð1;2Þ ¼ D1 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

D 2 

q 

1 þ 4a 

: ð3Þ 

2 

We will get really the fractal dimension value D 1 = 4.2361...for D 1 = 4 and a = 1 from this equation. The fractional part, 

namely 0.2361... is easily shown to be exactly / 3 where 

/ ¼ 

pffiffiffi 

5 1 =2: ð4Þ 

Any other values of constant D 1 and a for other powers of number / (Golden mean value) are set in the Table 1. These 

values can be determined by the iteration calculation 

D1;n ¼ D1;n 1 þ D1;n 2; an ¼ an 1 ð5Þ 

for a1 =1,D1,1 = 1 or with using of index nan =( 1) n . Constants D1 and a are representing the coefficients for conversion of / n 

to / n . The limited values of interaction (1) or calculated from (3) or (4) are at the last column. 

* Corresponding author. 

E-mail address: zmeskal@fch.vutbr.cz (O. Zmeskal). 

0960-0779/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.chaos.2009.01.022 



Chaos, Solitons and Fractals 

journal homepage: www.elsevier.com/locate/chaos

Table 1 

Coefficients of n-order random Hausdorff dimension. 

n an D1,n D1 ¼ D1;n þ a 

D1 

0 1 2 / 0 =2 / 0 

1 1 1 / 1 =1+/ 1 

2 1 3 / 2 =3 / 2 

3 1 4 / 3 =4+/ 3 

4 1 7 / 4 =5 / 4 

5 1 11 / 5 =11+/ 5 

6 1 18 / 6 =18 / 6 

7 1 29 / 7 =29+/ 7 

8 1 47 / 8 =47 / 8 

9 1 76 / 9 =76+/ 9 

10 1 123 / 10 = 123 / 10 

n ( 1) n 

D1,n 1 + D1,n 2 / n = D1,n +( 1) n / n 

Table 2 

Values of n-order Hausdorff dimension for different parameters m and r. 

m n=1 n =2 n =3 n =4 

2. Some rational values of Hausdorff dimensions 

Calculated values of Hausdorff dimensions for integer parts repeating number m and selected rational ratio measure change 

r near to values random Hausdorff dimensions from Table 1 (D = ln m/ln r) are presented in Table 2. The basic Hausdorff fractal 

dimension were selected as Cantor discontinuum (m =2,r =3,D 1 = ln 2/ln 3) and more precision values by the term 

ln r 

D ¼ 

lnðmrÞ ¼ 

1 

: ð6Þ 

1 þ ln m= ln r 

For the second and the third iteration, it is D2 = ln3/ln(2 3) and D3 = ln6/ln (3 6). 

The general iteration equation for n = 1 is then equal to 

Dkþ1 ¼ 1 

: 

1 þ Dk and for n =2to 

ð7Þ 

1 

Dkþ1 ¼ 

2 

Dk 

: 

Dk 

ð8Þ 

The limited value of this iteration is the golden mean value as is evident from the first column of Table 2. In a similar way, 

we can set the first and higher iteration of n-order random Hausdorff dimensions. The limited values are (as is evident from 

Table 2, second row), equal to n-th power of golden mean value (/ n ). 

3. Conclusion 

It is evident that the limit values of Hausdorff dimension derivative from Cantor discontinuum are equal to the n-th power 

of golden mean value. These results are the same as the result of random Hausdorff dimension. The differences between the 

experimental coefficients m and their ideal value (first column m r) are caused by the differences between iteration value and 

n power golden mean value. 


This work was supported by project KAN401770651 from The Academy of Sciences of the Czech Republic. 

Reference 


0.6180 r 0.3820 r 0.2361 r 0.1459 

2 3 0.6309 6 0.3869 19 0.2354 116 0.1459 

3 6 0.6132 18 0.3801 105 0.2361 1864 0.1459 

6 18 0.6199 109 0.3819 1978 0.2361 21554068 0.1459 

18 107 0.6186 1934 0.3820 207692 0.2361 401574147 0.1459 

108 1951 0.6180 210655 0.3820 410885916 0.2361 

1944 209518 0.6180 407303919 0.3820 

209952 408668420 0.6180 

408146688 

[1] El Naschie MS. An irreducibly simple derivation of the Hausdorff dimension of spacetime. Chaos, Solitons & Fractals 2009;41(4):1902–4. 

/ n 

1.0000... 

1.6180... 

2.6180... 

4.2361... 

6.8541... 

11.0902... 

17.9443... 

29.0344... 

46.9787... 

76.0132... 

122.9919...

J Fluoresc (2008) 18:1181–1186 

DOI 10.1007/s10895-008-0370-x 

ORIGINAL PAPER 

Comparative Studies of Diphenyl-Diketo-Pyrrolopyrrole 

Derivatives for Electroluminescence Applications 

Martin Vala & Martin Weiter & Jan Vyňuchal & 

Petr Toman & Stanislav Luňák Jr. 

Received: 31 October 2007 /Accepted: 14 March 2008 /Published online: 22 May 2008 

# Springer Science + Business Media, LLC 2008 

Abstract Four different derivatives of diphenyl-diketopyrrolopyrrole 

(DPP) with alkyl side groups were synthesized 

to increase their solubility. Quantum chemical 

calculations revealed that the substitution influenced molecular 

geometry and subsequently modified absorption and 

photoluminescence spectra. The theoretical results were 

confirmed by experimental characterization. With increasing 

phenyl torsion the vibrational structure was less 

pronounced and larger Stokes shift was observed. Simultaneously, 

the molar absorption coefficient decreased as the 

deformation increased. On the other hand, the measured 

fluorescence quantum yields were modified only slightly. 

This indicates the possibility to prepare soluble derivatives 

without loss of quantum yields and to use these materials 

for construction of efficient and stable electroluminescent 

devices. Furthermore, the electroluminescence of the thin 

M. Vala (*) : M. Weiter 

Faculty of Chemistry, Brno University of Technology, 

Purkynova 118, 

Brno 612 00, Czech Republic 

e-mail: vala@fch.vutbr.cz 

J. Vyňuchal 

Research Institute of Organic Syntheses, 

Rybitvi 296, 

Rybitvi 533 54, Czech Republic 

P. Toman 

Institute of Macromolecular Chemistry AS CR, v. v. i., 

Heyrovsky Sq. 2, 

162 06 Prague 6, Czech Republic 

S. Luňák Jr. 

Department of Technology of Organic Compounds, 

Faculty of Chemical Technology, University of Pardubice, 

Studentská 95, 

Pardubice 530 09, Czech Republic 

layer devices based on the soluble low molecular DPPs 

were characterized and discussed. 

Keywords Diphenyl-diketo-pyrrolopyrrole . 

Organic light emitting diodes . OLED . Organic electronics . 

Electroluminescence 

Introduction 

Nowadays, we can notice the strong effort to produce 

organic electroluminescent devices (OLED) that can be used 

as a completely new generation of lamps and full colour flat 

panel displays. The potential advantages of these devices are 

high efficiency, low driving voltage, versatility in its 

application (flexibility, transparency), low weight, relatively 

cheap production, environmentally friendly materials, etc. 

There is a big deal of discussion whether low molecular 

materials with high stability or polymeric ones with excellent 

film forming properties and therefore offering low-cost 

solution-based processing are more advantageous [1]. 

Nowadays, the most efficient devices used in display 

prototypes utilise combination of the materials providing 

specific functionality, e.g. hole or electron transport, 

reduction of injection barrier for holes and electrons, and 

of course the exciton formation and efficient radiative 

recombination. The materials chosen to build the device 

have to fulfil not only those requirements mentioned, but 

also their IP (ionisation potential) and EA (electron affinity) 

have to be aligned to allow effective charge migration [2]. 

As can be seen, only one advantageous attribute, e.g. high 

fluorescence quantum yield, is not enough to build efficient 

electroluminescent device. It is therefore common to 

functionalise promising material in such way, which does 

not affect the intrinsic desired properties.

1182 J Fluoresc (2008) 18:1181–1186 

In this study we investigated group of several derivatives 

of 3,6-diphenyl-2,5-dihydro-pyrrolo[3,4-c]pyrrole-1,4 

dione, also known as DPP, see Fig. 1. DPP itself has a 

high quantum yield of fluorescence (ΦF), as well as a high 

molar absorption coefficient. Although it has been already 

reported that some derivatives are potentially suitable for 

electro-optical applications [3], these materials are mainly 

used as high performance pigments and are valued for their 

fatigue resistance. Several derivatives have been synthesised 

and studied to increase solubility of the DPP in organic 

solvents and thus offer cheap solution-based deposition 

techniques. The article discuss the influence of the change 

of the structure on the electronic spectra, fluorescence 

quantum yields, position of HOMO and LUMO orbitals 

necessary for efficient charge transfer, etc. In addition to 

experimental optical characterization, quantum chemical 

calculations were employed to determine these parameters 

and to find links between structure and functionality. 

Experimental 

The synthesised materials were analysed to confirm the 

molecule structure by A Bruker AMX 360 NMR spectrometer, 

ion trap mass spectrometer MSD TRAP XCT equipped 

with APCI, EA 1108 FISONS instrument for elemental 

analysis and Fourier transform infrared spectrometer. The 

referred ultraviolet-visible spectroscopy (UV-VIS) absorption 

spectra were recorded in dimethylsufoxide (DMSO). 

The molar absorption coefficients were calculated from the 

dependence of absorption on concentration A=f(c) measured 

in 5 cm quartz cuvette (c

J Fluoresc (2008) 18:1181–1186 1183 

solubility of the sample. MS analysis, M=288: positive-ion 

MS: m/z 289 [M+H] + , 100%. Elemental analysis: calculated: 

C (74.99), H (4.20), N (9.72); found: C (74.99), H 

(4.20), N (9.72). 

Synthesis of DPP2 and DPP3 

11.6 g (0.04 mol) of the intermediate DPP1 and 120 g of 

dried dimethylformamide (DMF) were charged into the 

evaporative flask. The suspension was shortly stirred up. 

Subsequently, 16.2 g of 30% methanolic solution of sodium 

methylate was added. The fine slurry of sodium salt of 

DPP1 was stirred for 20 min, methanol was distilled out 

under the vacuum (t

1184 J Fluoresc (2008) 18:1181–1186 

ular conformations of the selected DPP derivatives were 

determined by means of the Hartree-Fock (HF) and B3LYP 

methods at 6–31G* level. The molecules were considered 

to be isolated, geometry was fully optimized with no 

molecular symmetry taken a priori into account. B3LYP is a 

hybrid HF/density functional theory (DFT) method, which 

combines Becke’s three-parameter exchange functional [6] 

with the Lee–Yang–Paar correlation functional [7]. It was 

successfully used for the calculations of the conformations 

of the different π-conjugated systems [8–10]. At the same 

time, the computer requirements of this method are 

comparable rather with the HF method than other “correlated” 

methods. However, the B3LYP method has also 

some disadvantages. B3LYP method, like other DFT-type 

methods, overestimates the electron delocalization and the 

degree of conjugation. The second drawback is that 

standard DFT-type methods cannot be used in combination 

with the configuration interaction (CI) method for the 

calculation of the relaxed excited state conformations. For 

this reason, molecular conformations were also calculated 

using HF method. For all the studied molecules we found 

only usual differences between HF and B3LYP calculated 

conformations, that are connected with the inclusion of the 

correlation energy in the B3LYP method. 

The optimized conformations show that some of the 

substituents influence the molecular geometry of the central 

DPP unit. The most important conformational parameters 

are the torsion angles α and β of the phenyls (see Fig. 1). 

While the unsubstituted DPP molecule is planar α=β=0°, 

derivatives denoted as DPP3 and DPP5 possess significantly 

rotated phenyl groups (see Table 1); in DPP2 and DPP4 

only the phenyl next to the substituted nitrogen atom is 

rotated. Phenyl group rotation significantly reduces the 

charge transfer integral between phenyls and the central 

DPP unit. Consequently the effective extent of conjugation 

is decreased and many electronic properties like absorption 

and luminescence are modified. 

Absorption and luminescence 

First excited states S1 of the studied molecules were 

calculated using ab initio configuration interaction method 

using single-excitation (CIS method) at the geometry 

optimized by the HF method. Absorption excitation 

energies ES0!S1 

are shown in Table 1. The ab initio CIS 

method enables to determine the trends in the excited state 

properties connected with the conformation change of the 

central DPP unit. However, the calculated absolute values 

of the excitation energies poorly reproduce the experimental 

results. 

The full UV–VIS absorption spectra of the studied 

molecules were calculated using time-dependent B3LYP 

(TD-B3LYP) method at the B3LYP optimized geometry. 

Time-dependent density functional methods recently became 

an effective and rather accurate tool for single point 

calculations of electronic excitations in various, namely 

conjugated, molecular systems [11–13], but they are not 

suitable for the excited state conformation optimization 

necessary for luminescence spectra calculations. They 

rather well reproduce the experimental peak positions, but 

obviously without a strong vibrational structure of the first 

transition. 

To obtain information about luminescence transitions, 

relaxed conformations of the S1 state were optimized by 

means of ab initio CIS method. During the S1 state 

relaxation the bond length alternation in the central DPP 

unit is reversed and the phenyl character becomes partly 

quinoidal. Finding relaxed conformations enabled determination 

of the first luminescence peak energy E lum, Stokes 

shift ΔEStokes, and deformation energy Edef of the relaxed 

excited state (see Table 1). It was found that the excitation 

energies ES0!S1 of the derivatives with the rotated phenyl 

groups exhibit a hypsochromic shift strongly correlated 

with the values of the torsion angles α and β. Similarly also 

ΔEStokes and Edef are significantly influenced by the phenyl 

Table 1 Phenyl torsion angles calculated by the HF and B3LYP methods, lowest absorption energy ES0!S1 , first luminescence peak E lum, Stokes 

shift ΔEStokes, and deformation energy Edef of the relaxed excited state 

Derivative B3LYP method HF method ES0!S1 E lum ΔE Stokes E def 

α [°] β [°] α [°] β [°] [eV] [eV] [eV] [eV] 

DPP1 0.0 0.0 0.0 0.0 2.837 2.427 0.410 0.339 

DPP2 36.0 6.7 46.9 16.9 2.935 2.424 0.511 0.437 

DPP3 36.5 36.5 46.1 46.1 3.012 2.441 0.571 0.482 

DPP4 36.7 7.7 46.9 16.9 2.933 2.422 0.511 0.437 

DPP5 35.9 35.9 46.0 46.0 3.010 2.438 0.571 0.482 

For the absorption and luminescence calculations, the ground state conformations were optimized by means of the HF method and the relaxed 

excited state conformations were calculated using the ab initio CIS method

J Fluoresc (2008) 18:1181–1186 1185 

rotation. The calculated first luminescence peak changes 

only slightly. 

Optical and optoelectrical characterisation 

The substitution of central DPP unit by alkyl side chains 

resulted in hypsochromic shift of the absorption (see 

Fig. 2a). This shift increases with the number of alkyl 

groups but is not affected by the length of the alkyls used. 

Furthermore, the vibration modes present in the spectrum of 

the non-substituted molecules were reduced. This tendency 

is further amplified as the substitution introduces second 

alkyl group. The spectral shift is accompanied with 

decrease of molar absorption coefficient (see Table 2). 

The fluorescence spectra of the synthesized derivatives 

(Fig. 2b) shows bathochromic shift with respect to the 

primary DPP1. The increasing Stokes shift is also accom- 

(a) 

A/A Max 

A/A Max 

(b) 

FL/FL Max 

FL/FL Max 

1.0 

0.5 

0.0 

1.0 

0.5 

0.0 

1.0 

0.5 

0.0 

1.0 

0.5 

DPP1 

DPP4 

DPP5 

DPP1 

DPP2 

DPP3 

300 400 500 600 


DPP1 

DPP4 

DPP5 

DPP1 

DPP2 

DPP3 

0.0 

450 500 550 600 650 700 


Fig. 2 Absorption a and fluorescence b spectra measured in 

dimethylsulfoxide. The spectra were normalized to the longer 

wavelength band. Clear hypsochromic shift in absorption and bathochromic 

shift in fluorescence (FL) spectra accompanied with the lost 

of vibronic structure can be observed as the substitution takes place 

Table 2 Experimental values for molar absorption coefficient ɛ, 

position of absorption l AbsMax and luminescence l FLMax peak 

maximums, Stokes shift Δl Stokes and fluorescence quantum yield Φ F 

(ΔΦ F

1186 J Fluoresc (2008) 18:1181–1186 

technique. It has to be mentioned that the DPP1 is not 

soluble enough for spin casting technique and was prepared 

by thermal vacuum evaporation. The mono substituted 

derivatives prepared by spin casting showed tendency to 

form highly rough (tens of nanometer) and up to more than 

5 μm long curved “lying grass” like structures. The 

symmetrically substituted derivatives formed large crystals 

up to tens of μm long tightly packed together. This filmforming 

properties influence the electric response and 

therefore the electroluminescence behaviour to a considerable 

extent. 

Conclusions 

Basic structure and four derivatives of diphenyl-diketopyrrolopyrrole 

were synthesized and compared from the 

point of view of their potential use as light emitting layer for 

organic electroluminescence device. It was found that the 

electronic properties strongly depend on the planarity of 

the molecules, which was decreased by the substitution. The 

measurements showed that the original high fluorescence 

quantum yield reminds nearly the same. This indicates the 

possibility to prepare derivatives soluble in solvents suitable 

for cheap large-scale production without loss of fluorescence 

quantum yields and therefore to use these materials for 

construction of efficient electroluminescent devices. In order 

to get the best performance it is necessary to optimise the 

OLED structure for each derivative. 

Acknowledgement The research was supported by the Ministry of 

Industry and Trade of the Czech Republic via Tandem project No. FT- 

TA3/048 and by the Grant Agency of the Academy of Sciences of the 

Czech Republic via project A401770601. 

References 

1. Friend RH, Gymer RW, Holmes AB, Burroughes JH, Marks RN, 

Taliani C, Bradley DDC, Dos Santos DA, Brédas JL, Lögdlund 

M, Salaneck WR (1999) Electroluminescence in conjugated 

polymers. Nature 397:121–128 

2. Pope M, Swenberg CE (1999) Electronic processes in organic 

crystals and polymers, 2nd edn. Oxford University Press, Oxford 

3. Beyerlein T, Tieke B, Forero-Lengerb S, Brütting W (2002) Red 

electroluminescence from a 1,4-diketopyrrolo[3,4-c]pyrrole 

(DPP)-based conjugated polymer. Synthetic Metals 130(2):115– 

119 

4. Williams ATR, Winfield SA, Miller JN (1983) Relative fluorescence 

quantum yields using a computer controlled luminescence 

spectrometer. Analyst 108:1067 

5. Frisch MJ, Trucks GW, Schlegel HB, Scuseria GE, Robb MA, 

Cheeseman JR, Montgomery JA Jr, Vreven T, Kudin KN, Burant 

JC, Millam JM, Iyengar SS, Tomasi J, Barone V, Mennucci B, 

Cossi M, Scalmani G, Rega N, Petersson GA, Nakatsuji H, Hada 

M, Ehara M, Toyota K, Fukuda R, Hasegawa J, Ishida M, 

Nakajima T, Honda Y, Kitao O, Nakai H, Klene M, Li X, Knox 

JE, Hratchian HP, Cross JB, Adamo C, Jaramillo J, Gomperts R, 

Stratmann RE, Yazyev O, Austin AJ, Cammi R, Pomelli C, 

Ochterski JW, Ayala PY, Morokuma K, Voth GA, Salvador P, 

Dannenberg JJ, Zakrzewski VG, Dapprich S, Daniels AD, Strain 

MC, Farkas O, Malick DK, Rabuck AD, Raghavachari K, 

Foresman JB, Ortiz JV, Cui Q, Baboul AG, Clifford S, Cioslowski 

J, Stefanov BB, Liu G, Liashenko A, Piskorz P, Komaromi I, 

Martin RL, Fox DJ, Keith T, Al-Laham MA, Peng CY, 

Nanayakkara A, Challacombe M, Gill PMW, Johnson B, Chen 

W, Wong MW, Gonzalez C, Pople JA (2004) Computer program 

Gaussian 03. Gaussian, Wallingford 

6. Becke AD (1993) Density-functional thermochemistry, 3. The role 

of exact exchange. J Chem Phys 98(7):5648–5652 

7. Lee CT, Yang WT, Parr RG (1988) Development of the Colle- 

Salvetti correlation-energy formula into a functional of the 

electron-density. Phys Rev B 37(2):785–789 

8. Toman P, Nešpůrek S, Yakushi K (2002) Electronic states and 

infrared spectroscopy of Ni- and Co-phthalocyanines: neutral and 

oxidized forms. J Porphyr Phthalocya 6(9–10):556–562 

9. Ignatyev IS, Sundius T (2000) Competitive ring hydride shifts and 

tolyl-benzyl rearrangements in tolyl and silatolyl cations. Chem 

Phys Lett 326(1–2):101–108 

10. Guo J-D, Luo Y, Himo F (2002) Density functional theory study 

of the canthaxanthin and other carotenoid radical cations. Chem 

Phys Lett 366(1–2):73–81 

11. Gross EKU, Dobson JF, Petersilka M (1996) Density functional 

theory II. In: Nalewajski RF (ed) Topics in current chemistry, vol 

181. Springer, Berlin, pp 81–172 

12. Casida ME (1995) Time-dependent density functional response 

theory for molecules. In: Chong DP (ed) Recent advances in 

density-functional methods, part I. World Scientific, Singapore, pp 

155–192 

13. Takahashi M, Kira M, Sakamoto K, Müller T, Apeloig Y (2001) 

Theoretical prediction of vertical transition energies of diaminosilylenes 

and aminosubstituted disilenes. J Comput Chem 22 

(13):1536–1541 

14. Nijegorodov N (2006) The influence of planarity, rigidity and 

internal heavy atom upon fluorescence parameters and the 

intersystem crossing rate constant in molecules with the biphenyl 

basis. Spectrochimica Acta Part A 64:1–5


Conductivity of natural and modified DNA measured by scanning tunneling 

microscopy. The effect of sequence, charge and stacking 

Irena Kratochvílová a, ⁎, Karel Král a , Martin Bunček b , Alena Víšková b , Stanislav Nešpůrek c , Anna Kochalska c , 

Tatiana Todorciuc c , Martin Weiter d , Bohdan Schneider e 

a Institute of Physics, ASCR, v.v.i., Na Slovance 2, CZ-182 21 Prague, Czech Republic 

b GENERI BIOTECH s.r.o., Machkova 587, CZ-500 11 Hradec Kralové, Czech Republic 

c Institute of Macromolecular Chemistry ASCR, v.v.i., Heyrovského nám. 2, CZ-162 06 Prague 6, Czech Republic 

d Faculty of Chemistry, Brno University of Technology, Purkyňova 118, CZ-612 00 Brno, Czech Republic 

e Institute of Biotechnology AS CR, v.v.i., Vídeňská 1083, CZ-142 20 Prague, Czech Republic 

article info 


Received 1 June 2008 

Received in revised form 12 August 2008 

Accepted 16 August 2008 

Available online 28 August 2008 

Keywords: 

DNA conductivity 

Charge transport in molecular systems 

STM 

Electronic properties of biomolecules 


abstract 

The DNA molecule, containing the genetic code of all living species, 

has recently become a center of great attention on the part of chemists 

and physicists, one of the reasons being DNA's potential use in 

nanoelectronic devices [1–4], both as a template for assembling 

nanocircuits and as an active element of such circuits. Charge 

migration along DNA molecules has attracted scientific interest for 

more than fifty years. The reports on the possible high rates of charge 

transfer between the donors and acceptors through DNA, obtained 

from solution chemistry experiments [5], have triggered a series of 

direct electrical transport measurements on bundles and networks, 

because a truly conducting form of DNA would have a major impact on 

the developments in nanotechnologies. 

Extended electronic states of DNA could play an important role in 

biology, e.g. through the processes of DNA-damage sensing or 

repairing via long-range charge transfer [6,7]. The prevailing DNA 

architecture, the double helix, has well stacked, nearly parallel bases 

with overlapping π-electron systems. Such π-electron systems may be 

⁎ Corresponding author. 

E-mail addresses: krat@fzu.cz (I. Kratochvílová), kral@fzu.cz (K. Král), 

martin.buncek@generi-biotech.com (M. Bunček), nespurek@imc.cas.cz (S. Nešpůrek), 

weiter@fch.vutbr.cz (M. Weiter), bohdan@img.cas.cz (B. Schneider). 


doi:10.1016/j.bpc.2008.08.005 

Biophysical Chemistry 138 (2008) 3–10 


Biophysical Chemistry 

journal homepage: http://www.elsevier.com/locate/biophyschem 

The conductivity of DNA covalently bonded to a gold surface was studied by means of the STM technique. Various 

single- and double-stranded 32-nucleotide-long DNA sequences were measured under ambient conditions so as 

to provide a better understanding of the complex process of charge-carrier transport in natural as well as 

chemically modified DNA molecules. The investigations focused on the role of several features of DNA structure, 

namely the role of the negative charge at the backbone phosphate group and the related complex effects of 

counterions, and of the stacking interactions between the bases in Watson–Crick and other types of base pairs. 

The measurements have indicated that the best conductor is DNA in its biologically most relevant doublestranded 

form with Watson–Crick base pairs and charged phosphates equilibrated with counterions and 

water. All the studied modifications, including DNA with non-Watson–Crick base pairs, the abasic form, and 

especially the form with phosphate charges eliminated by chemical modifications, lower the conductivity of 

natural DNA. 


good candidates for long-distance and one-dimensional (linear) 

charge transport [8]. Several authors have indicated that DNA 

conducts electric charge via the hopping mechanism [9–11], but the 

electronic properties of DNA remain controversial. Charge-transfer 

reactions and conductivity measurements exhibit a large variety of 

possible electronic behavior, ranging from Anderson and band-gap 

insulators to effective molecular wires and induced superconductors. 

Indeed, understanding the conductance of a complicated polyelectrolyte 

aperiodic system is in itself a major scientific problem [12–16]. 

Historically, two basic experimental approaches have been 

pursued to investigate conduction through molecules: (i) contacting 

isolated single molecules or molecules in thin films, and (ii) studying 

transport in thick films and devices, such as organic thin-film 

transistors or light-emitting diodes [17,18]. The optimal experimental 

setup is to position isolated molecules between two electrical 

contacts, but this is very difficult to implement and especially difficult 

to verify. Working with the ordered arrays of parallel π-conjugated 

molecules, where in principle the binding to the substrate can be 

precisely controlled, offers a possibility to measure the individual 

molecules by making use of the scanning–tunneling-microscope 

(STM) tip. STM experiments have already been proven as a very 

suitable tool for investigating ordered monolayer films, making it 

possible to contact one or more molecules and obtain images of the 

structural characteristics of the film [19,20]. The experiments have

also been used to investigate room-temperature electronic properties 

of twelve base-pair d(GC) 12-d(GC) 12 DNA molecules attached to the 

gold surface by a thiol link [21]. The STM/STS experiments offer a novel 

way of probing the electronic properties of biomolecules on surfaces 

on the atomic level. 

In this work, we have used the STM technique in order to study the 

conductivity of several oligonucleotide sequences in single- and 

double-stranded forms under ambient conditions. The purpose of 

these investigations was to understand the complex processes of 

charge transport through DNA molecules and to dissect the role of the 

sugar-phosphate backbone, and of its charged phosphate group in 

particular, as well as of base stacking in the same strand and across 

strands. To this end, some of the studied oligonucleotide sequences 

were designed to form non-Watson–Crick base pairs, with the aim of 

making it possible to estimate the role of these mutation-causing base 

pairs. The role of the bases and of their stacking interactions in DNA 

conductivity was also studied at a more fundamental level by 

removing two or three nitrogenous bases at the central steps of a 

few sequences forming modified abasic nucleotides. Other sequences 

contain chemically modified phosphate groups, which eliminate their 

charge (Fig. 1). Such modifications make it possible to see the roles of 

the charged backbone and of the alkali-metal and alkaline-earthmetal 

counterions on conductivity. 


2.1. Material 

STM experiments were performed on 32-mer oligonucleotides of 

various sequences, some of which had been chemically modified. For 

further reference, all the measured oligonucleotides, including their 


4 I. Kratochvílová et al. / Biophysical Chemistry 138 (2008) 3–10 

Fig. 1. The chemical scheme of the studied nucleotides: (a) a natural nucleotide; b) a 

part of an abasic oligonucleotide with base removed; c) oligonucleotide with its 

phosphate neutralized by a p-isopropoxy group. 

labels, are listed in Table 1. The sequences were designed to investigate 

the differences: i) between the single-stranded (ss) and doublestranded 

(ds) DNA of C/G-rich composition, ii) between the singlestranded 

(ss) and double-stranded (ds) DNA of A/T-rich composition, 

iii) between dsDNA with only canonical Watson–Crick and containing 

non-Watson–Crick (“mismatched”) base pairs, and iv) between DNA 

with sequences composed of only natural (non-modified) nucleotides 

and chemically modified nucleotides. Further, two types of chemical 

modifications were studied: i) the elimination of nitrogenous bases, 

thus creating abasic nucleotides, in order to be able to gauge the 

influence of the stacked bases on the DNA conductivity, and ii) the 

replacement of the charged phosphate group with its neutral 

surrogate, which makes it possible to estimate the role of the 

phosphate charge on the DNA conductivity. The investigated DNA 

samples (Table 1) were measured in pairs selected in such a way that 

only one parameter would vary in a pair (see Fig. 1 for the chemical 

structures of the nucleotides). For instance, the phosphate charge 

present in the standard oligonucleotide (Fig. 1, label A) is eliminated in 

DNA E of the identical sequence, the sequences differ between A and B, 

or between C and its abasic mutant D. 

The sequences were selected so that they would not form such 

special structural features as loops or complex tertiary structures. 

Guanosine nucleotides were evenly distributed as every fourth base in 

the mixed sequences. The pure G/C (Table 1, ss: A and ds: 1) and A/T 

(Table 1, B and 2) oligonucleotides were designed for the evaluation of 

the effect which the guanine base might have on the overall DNA 

conductivity. The C/G, T/A and the mixed C/G/T/A sequences were 

prepared as single-stranded and double-stranded with their respective 

complementary sequences in order to evaluate the effect of 

single- versus double-stranded DNA forms. So as to ascertain the 

influence of the heterocyclic nitrogenous bases on the overall charge 

transport in DNA, we compared the conductivity of the mixed C/G/T/A 

sequence (Table 1, C — MIX) containing all four bases in equal 

proportion with guanine evenly distributed on the one hand with a 

chain with the same sequences except for three removed bases in the 

middle (Positions 15–17,Table 1,D— MIX_S) on the other. These abasic 

sequences produce a gap with three base pairs missing in the 

respective ds sample (Table 1, ds 3 and 4). Oligo d(T) where two bases 

in the middle were substituted by either two guanines or by abasic 

spacer, making two base gaps (Fig.1b), were also synthesized. To study 

the impact of charge in the DNA backbone on the charge transport, all 

the above sequences were also synthesized with a chemically 

modified phosphate group, which eliminates the phosphate charge. 

Thus the sequences were prepared as standard phosphodiesters 

(Fig. 1a), rendering a negative charge on each phosphate, and also as 

neutral but still polar p-isopropoxy derivatives (Fig. 1c, Table 1, E and 

NGC). How non-canonical (non-W–C) base pairs affect the conductivity 

was measured on DNA chains modified by introducing sequences 

with two non-W–C (“mismatched”) pairs (Table 1, ds 6 and 7). 

All the sequences were analyzed by MALDI-TOF mass spectroscopy 

in order to prove their identity and evaluate their purity. The 

sequences with neutralized phosphates charges (p-isopropoxy modified) 

showed a small or undetectable number of Na + /K + adduct peaks, 

and having compared them to MALDI-TOF measured concentration of 

Na + /K + in charged nucleotides, we concluded that the sequences with 

uncharged phosphates may contain no or only a very small number of 

Na + /K + counterions associated with the oligonucleotide. 

Oligonucleotides were synthesized in GENERI BIOTECH, s.r.o., on an 

ABI394 synthesizer using standard phosphoramidite chemistry. The 

standard base phosphoramidites, 5′-thiol modifier C6 and dSpacer CE 

phosphoramidite were purchased from Glen Research, USA, and used 

according to the manufacturer's recommendations. The p-isopropoxy 

derivatives of base amidites (deoxy adenosine (n-bz) p-isopropoxy 

phosphoramidite, deoxy Cytidine (n-bz) p-isopropoxy phosphoramidite, 

deoxy guanosine (n-ibu) p-isopropoxy phosphoramidite and 

thymidine p-isopropoxy phosphoramidite) were purchased from

Table 1 

The investigated DNA sequences 

ChemGenes Corporation, USA, and also used according to the 

manufacturer's recommendations. All oligonucleotide sequences 

were reverse-phase chromatography purified. The 5′-thiol-modified 

oligonucleotides were purified according to the manufacturer recommendations, 

aliquoted immediately after the purification and kept 

under argon atmosphere before use to prevent oxidative dimerization 

of the sulfhydryl groups. All the synthesized oligonucleotide sequences 

were analyzed by HPLC and MALDI-TOF for quality control. According 

to the MALDI-TOF analysis, the purity of all sequences was N98%. 

All the chemicals were purchased from Sigma Aldrich, USA. The 

blocking solution of 1mM 2-mercaptoethanol in MilliQ water (BS), a 

hybridization buffer of 100mM Tris.HCl/100mM NaCl in MilliQ water 

(HB) and a washing buffer of 100mM Tris–HCl/300mM NaCl in MilliQ 

water (WB) were prepared by dissolving the respective amounts of 

chemicals in pure MilliQ water, free of DNA/RNA and nucleases 

(Millipore Inc., USA). The 5′-thiol-modified oligonucleotides were 

dissolved in MilliQ water to 50μM concentration prior to use. 5μl of 

50μM solution of each 5′-thiol-modified oligonucleotide were spotted 

onto the gold support, forming a drop of ca 3mm in diameter. The 

spotted gold support slides were kept closed in a cartridge with 

humidified atmosphere created by water-filled basins. This cartridge 


I. Kratochvílová et al. / Biophysical Chemistry 138 (2008) 3–10 

Code Name Sequence Backbone modification 

A G/C Au–S-CGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG-3′ NO 

B A/T Au–S-ATAATAATAATAATAATAATAATAATAATAAT-3′ NO 

C MIX Au–S-GTTAGCACGATAGTCCGATAGTCAGTCAGTCC-3′ NO 

D MIX_dS Au–S-GTTAGCACGATAGTxxxATAGTCAGTCAGTCC-3′ NO 

E NGC Au–S-CGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG-3′ Uncharged p-isopropoxy 

Code Sequence Backbone modification 

1 Au–S-CGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG-3′ 

|||||||||||||||||||||||||||||||| 

3′-GCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-5′ 

NO 

2 Au–S-ATAATAATAATAATAATAATAATAATAATAAT-3′ 

|||||||||||||||||||||||||||||||| 

3′-TATTATTATTATTATTATTATTATTATTATTA-5′ 

NO 

3 Au–S-GTTAGCACGATAGTCCGATAGTCAGTCAGTCC-3′ 

|||||||||||||||||||||||||||||||| 

3′-CAATCGTGCTATCAGGCTATCAGTCAGTCAGG-5′ 

NO 

4 Au–S-GTTAGCACGATAGTxxxATAGTCAGTCAGTCC-3′ NO 

|||||||||||||| ||||||||||||||| 

5 

3′-CAATCGTGCTATCAxxxTATCAGTCAGTCAGG-5′ 

Au–S-TTTTTTTTTTTTTTTGGTTTTTTTTTTTTTTT-3′ 

|||||||||||||||||||||||||||||||| 

3′-AAAAAAAAAAAAAAACCAAAAAAAAAAAAAAA-5′ 

NO 

6 Au–S-TTTTTTTTTTTTTTTGGTTTTTTTTTTTTTTT-3′ 

|||||||||||||||‡‡||||||||||||||| 

3′-AAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAA-5′ 

NO 

7 Au–S-TTTTTTTTTTTTTTTCCTTTTTTTTTTTTTTT-3′ 

|||||||||||||||‡‡||||||||||||||| 

3′-AAAAAAAAAAAAAAACCAAAAAAAAAAAAAAA-5′ 

NO 

8 Au–S-TTTTTTTTTTTTTTTCCTTTTTTTTTTTTTTT-3′ 

|||||||||||||||||||||||||||||||| 

3′-AAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAA-5′ 

NO 

9 Au–S-TTTTTTTTTTTTTTTxxTTTTTTTTTTTTTTT-3′ 

||||||||||||||| ||||||||||||||||| 

3′-AAAAAAAAAAAAAAAxxAAAAAAAAAAAAAAA-5′ 

NO 

10 Au–S-CGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCG-3′ 

|||||||||||||||||||||||||||||||| 

3′-GCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC-5′ 

Uncharged p-isopropoxy 

11 Au–S-ATAATAATAATAATAATAATAATAATAATAAT-3′ 

|||||||||||||||||||||||||||||||| 

3′-TATTATTATTATTATTATTATTATTATTATTA-5′ 


12 Au–S-GTTAGCACGATAGTCCGATAGTCAGTCAGTCC-3′ 

|||||||||||||||||||||||||||||||| 

3′-CAATCGTGCTATCAGGCTATCAGTCAGTCAGG-5′ 


Single-stranded samples are labeled with letters A–E and named, double-stranded DNA are numbered 1–12. G, A, C, T are the symbols that designate the deoxynucleotides with 

either unmodified backbone (NO “backbone modification”) or the phosphate charge neutralized by an isopropoxy group (Fig. 1), whereas the symbols “x” indicate abasic nucleotides. 

Strands chemically attached to the gold plate start with Au–S. For double-stranded samples, “|” labels the Watson–Crick pair while “‡“ indicates a non-Watson–Crick pair. 

was incubated at 50°C for 16h, after which the gold support was 

washed twice with MilliQ water, and 5μl of 1mM 2-mercaptoethanol 

were spotted onto the same places as the oligonucleotides. The 2mercaptoethanol 

(2-ME) was used to enhance the accessibility of the 

immobilized probes to the complementary target sequences. The thiol 

group of 2-ME rapidly displaced the weaker absorptive contacts 

between the DNA nucleotides and the substrate, leaving the probes 

tethered primarily through the thiol end groups. The spots were “selfaligned”, 

because the gold support is hydrophobic and any water 

solution put onto the oligonucleotide-modified gold support concentrates 

in the oligonucleotide-containing spots. The slides were 

incubated in the same humidified cartridge at 40°C for 2h, after 

which the slides were washed 5 times with MilliQ water and dried 

under high-purity nitrogen (9.6). The gold-support slides with singlestranded 

oligonucleotide spots were kept in a closed box until use. The 

gold-support slides with the oligonucleotide spots planned to be 

analyzed as double-stranded were hybridized with the corresponding 

complementary oligonucleotides. The complementary oligonucleotides 

were incubated at 1μM concentration in HB at 80°C for 10min. 

Immediately after the incubation, 5μl of the corresponding complementary 

oligonucleotides were dropped onto the particular spots and 

5

incubated at 40°C for 1h, after which the spots were washed twice by 

WB and finally by MilliQ water. Subsequently, the slides were dried 

under a stream of nitrogen. The whole process was photographed for 

the easier alignment of the STM tip onto the oligonucleotide spots. All 

the slides were kept in a closed box in a cool and dry place before use. 

DNA molecules were attached to the gold surface through a sulfur– 

gold linkage (Fig. 2) [22]. The ssDNA with the 5′-thiol-modifier were 

used to produce a thiol group at the 5′-terminus of a synthetic 

oligonucleotide. Recent neutron reflective studies have indicated that 

ssDNA oligonucleotides form a compact layer on bare gold. Prior to the 

formation of thiolated-ssDNA, self-assembled 40nm thin Au (99.99% 

purity) monolayers were vacuum-evaporated on single crystalline 

silicon substrate b100N wafers, which were cut into 1cm × 1cm pieces. 

Subsequently, the substrates were blown using pure nitrogen and 

exposed to a solution of thiolated oligonucleotide probes in a sodium 

chloride buffer. 

2.2. Measurements 

The STM measurements were performed with the NTEGRA Prima 

NT MDT system under ambient conditions. Both topographic and 

spectroscopic data were obtained using freshly cut Pt/Ir tips. With 

STM, for a set point of small voltage ~ 10mV and relatively large 

current ~ 0.5nA and thus quite a small tip-sample distance, we 

observed the topography of the samples. The topographic images 

showed a considerable difference between the bare gold substrates 

and the samples with DNA molecules. In the case of molecular layers, 

specific surface patterns were observed. The occurrence of these 

patterns was attributed to an etching of the bottom gold layers arising 

from the reaction of the thiol-groups with the gold atoms, forming 

dissolvable complexes [23,24]. 

The DNA layers thickness have been investigated using variable 

angle spectroscopic ellipsometry (VASE, J.A.Woollam & co.) working in 

rotating analyzer mode. The measurements were carried out in the 

spectral range 300–1100nm at three angles of incidence 65, 70 and 

75°. The structural model was constructed to extract the optical 

functions of the film from the ellipsometry measurements. Structural 

model consists of: Si substrate/Au layer/DNA layer. The Si-substrate 

was considered as a semi-infinite medium. The optical constants of Si 

and Au materials were taken from [25]. The thicknesses of both layers 

and the optical constants of DNA layer were determined using a direct 

fitting procedure applied to the experimental ellipsometric data. The 

DNA molecules were ordered in similar geometric structures with the 

nearest-neighbor spacing being 1–2nm. The thickness of the DNA 

layers, determined by ellipsometry was 8.5–9.0nm. For 32-nucleotidelong 

DNA molecules, this length corresponds to the average distance 

between the neighboring bases of about 0.3nm, which corresponds to 

the base–base stacking distance intermediate between the B- and A- 

DNA forms. The DNA double strand is not likely to be completely 

straight. The mean inclination of a double helix from the fixed vertical 

line at the length of 32 base pairs is expected to be about 25° as can be 



Fig. 2. The scheme of the attachment of the DNA 32-mers to the gold surface. 

Table 2 

A comparison of the conductivity of DNA samples measured on the same gold plate in one experiment 

estimated from the generally accepted persistent length P of a dsDNA 

of “random sequence”, P ~ 150 base pairs. A confrontation of the 

ellipsometry measurement and the persistent length of a DNA double 

strand leads to a conclusion that DNA molecules are oriented 

approximately perpendicularly to the Au substrate. 

In all cases, we qualitatively compared conductivity of two types of 

oligonucleotides. In our experimental setting the tip–sample distance 

was necessary and not easy to control. Firstly, we worked in constant 

height mode in very small area on both sides of the compared 

oligonucleotides type border. Secondly, beside current-voltage (I(V)) 

characteristics we also measured I(h) curves (I — current, h — distance 

between the tip and the surface) at the same points. I(h) curves have 

the advantage of being normalized and in [26] new approach for 

reading sequence of DNA molecule via tunnel-current decay has been 

demonstrated. The I(h) decay consists of two regions: the area of very 

short-range chemical interactions between the end of the tip and the 

terminate of the molecule plus the area of tunneling through the 

barrier between the tip and sample. The current initially decays slowly 

and then more rapidly. The I(h) curves are standardly fitted with two 

exponentials: 

i ¼ i0expð−β1hÞ; 0 b h b hc 

i ¼ ihc ð Þexpð−β2ðh−hcÞÞ; hc b h: 

Value of β 2 has been found in [26] as corresponding to decay 

constant of tunneling current. Thus, it can be supposed that at the 

breakpoint (h c) the interactions typical for tip extremely close to the 

substrate are broken and the tunnel current becomes dominant. The 

same position of the breakpoint and decay constants (β 2, β 1) means 

the same tip-surface interaction conditions. Working with different 

set points we can arrange the position of the tip in the proper 

interaction territory so that the distance between the tip and the DNA 

terminate is under control. Comparing histograms of the decay 

constants and I(h) curves breakpoints (hc) measured on various DNA 

samples we controlled position of the tip above the compared DNA 

modifications. 

In our experiments, we have measured current passing through 

the molecules so close to the tip that their contribution is at set voltage 

higher than the noise. For tip very close to the molecules (defined by 

the set point value) and very low voltages the number of the 

molecules contributing to the total current is as small as possible. 

Current–voltage characteristics were recorded for various feedback 

voltage and current set points, i.e. for different initial tip–sample 

distances. In all the experiments, the STM tip acted as the electrical 

contact on the “top” side of the assembled monolayer of the DNA 

molecules, whereas the supporting gold substrate acted as the other 

“bottom” contact. The distance between the top of the molecules and 

the STM tip was for all the set points 2.5–4Å. The I(V) and I(h) curves 

were measured at three different set points: 0.1nA, 0.1V; 0.2nA, 0.1V; 

0.5nA, 0.1V, corresponding to three different sample–tip separations, 

using the same strategy for all the samples. The experimental 

conditions were controlled using I(h) decay analysis and thus we 

were able to distinguish between the area of tunneling current and 

current passing through chemically interacted systems. The experimental 

setup (tip very close to the surface) allows us to expect that the 

current flows mainly through the molecule nearest to the tip without 

significant lateral intermolecular contribution to conduction. Two 

hundred consecutive I(V) sweeps in both voltage directions were 

DNA samples measured in one experiment 1/2 A/1 3/4 5/9 8/9 1/10 2/11 8/7 5/6 3/12 

DNA samples with higher conductivity 

The codes of DNA samples are listed in Table 1. 

1 1 3 5 8 1 2 8 5 3

Fig. 3. The typical I(V) curves of DNA GC 32-base double strand (DS GC, see Table 1,ds1) 

and DNA AT 32-base double strand (DS AT, see Table 1, ds 2). Set point 0.1 nA, 0.1 V, 

measured in one voltage direction. 

taken on each sample (Table 1). Final results presented in this paper 

are based on the average of a set from the collected I(V) curves. Only 

those curves which were not affected much by drift of the STM were 

included in the statistics. 

All the results taken into the consideration showed the same 

trends, i.e. the symmetry for both biases, linearity and super-linearity 

for lower and higher voltages, respectively. Due to large statistics we 

can (from our measurements) set the quantitative proportion of 

different DNA systems conductivities assuming approximately equal 

number of molecular densities. 


The results of the measurements are summarized in Table 2 and 

Figs. 3–7. The conductivity measurements for each considered 

structural and chemical feature and their possible explanations are 

discussed below. Noise, in the form of height fluctuations, was higher 

in the case of the topographic images of films than in the case of bare 

Fig. 4. The typical I(V) curves of DNA GC 32-base single strand (SS GC, see Table 1, SSA) 

and DNA GC 32-base double strand (DS GC, see Table 1, ds 1). Set point 0.1 nA, 0.1 V, 

measured in one voltage direction. 



Fig. 5. I(V) curves of double-helical DNA 32-mers with mixed G, A, C, T sequences 

(Table 1, ds sample 3) and double-helical DNA 32-mers with mixed G, A, C, T sequences 

with three bases missing in the middle (MIX_DS, see Table 1, ds 4). Set point 0.1 nA, 

0.1 V, measured in both voltage directions. 

gold. All the organic molecules that have been studied by STM until 

now show symmetry of the (I(V)) characteristics. The symmetry of the 

I(V) characteristics has been explained on a simple model [27]. 

The conductivity of all 32-nucleotide-long DNA molecules including 

the sulfur spacer was comparable in the STM experiments. We 

measured the conductivity of the DNA molecules using a scanning 

tunneling microscope under ambient conditions, i.e. in a humid air 

(40% humidity) environment and room temperature. Xu et al. [21], 

who measured DNA samples using ultrahigh vacuum scanning 

spectroscopy, concluded that DNA was a wide-band-gap insulator. 

From this comparison, we can see that the absence or at least 

substantially lower content of water in the ultrahigh vacuum plays a 

significant role in the charge pathway. In agreement with what Enders 

et al. pointed out in their summary [28], we have concluded that water 

molecules supporting the molecular structure improve the conditions 

for the electrical current passing through the whole DNA molecule. 

Fig. 6. I(V) curves of double-helical DNA 32-mers with G-C bases without chargebearing 

groups on the phosphates – DS NGC (see Table 1, ds 10) and standard doublehelical 

DNA 32-mers with G-C bases – DS GC (see Table 1, ds 1). Set point 0.1 nA, 0.1 V, 

measured in both voltage directions. 

7

3.1. G/C chain vs. A/T chain 

The Guanine/Cytosine-rich and Adenine/Thymine-rich oligonucleotides 

(Table 1, ds 1 and 2) were selected for the evaluation of the 

guanine effect on the overall DNA conductivity. 

We found that a double-helical sample with G/C bases is a better 

conductor than the double strand made of A/T bases (Fig. 3, Table 2). 

The guanine base is known to be easily oxidized, generating a charge 

carrier (hole). Once charges, and especially holes, are created in the 

uniform DNA chain, the hopping charge transport can apparently 

occur between discrete guanine sites or delocalized (e.g. polaron) 

domains [29]. Furthermore, the stacking of the adjacent base pairs is 

also likely to affect the conductivity via the π-electron overlap. The G– 

C pairs with more compact stacking compared to that in the A–T pairs 

have higher conductivity. 

3.2. Double-stranded vs. single-stranded DNA 

Typical I(V) curves of both ss and ds GC sequences (A and 1 in 

Table 1) are shown in Fig. 4. The conductivity of the double-stranded 

form is higher than that of the single strand when complementary 

sequences are compared, which is in agreement with the theoretical 

model of the same system [30]. Single strands can be considered much 



Fig. 7. Typical I(V) curves of DNA molecules containing 4 non-Watson-Crickbase pairs in 

the middle (TGG vs. AGG and TCC vs. ACC, see Table 1, ds 6 and ds 7, respectively) and 

standard dsDNA (TGG vs. ACC and TCC vs. AGG, see Table 1, ds 5 and ds 8, respectively). 

Set point 0.1 nA, 0.1 V, measured in both voltage directions. 

less structurally regular than the double helices because of their local 

and especially long-range deviations from the regular helical 

arrangement. Reduced stacking interactions then decrease the 

potential overlap of their π-electron systems and overall conductivity. 

Also the first solvation shell, known to play a crucial role in the 

structural integrity of the double-helical DNA [31,32], is likely to be 

much less ordered in ss than in dsDNA. Double-stranded DNA has a 

more regular structure including the first solvation shell, and its longrange 

periodicity decreases the dispersion of the polarization energy 

and makes the distribution of hopping states narrower. Considering 

these effects, the charge-carrier mobility, and thus conductivity, 

increases in more regular dsDNA systems. 

3.3. Base pairing — Watson–Crick vs. “mismatched” pairs 

Non-Watson–Crick or “mismatched” base pairs are the type of DNA 

damage where two non-complementary bases are paired, e.g. adenine 

with cytosine or thymine with guanine. The role of the non-W–C base 

pairs and their different stacking in DNA conductivity was estimated 

by comparing the conductivity of two dsDNA, the canonical 32nucleotide-long 

double-stranded DNA molecules (Table 1, ds 5 and 8) 

with analogical systems containing two non-W–C pairs in the middle 

(Table 1, sequences 6 and 7). The unequivocal conclusion is that the 

molecules containing non-W–C pairs are less conductive than the 

DNA double strands containing only W–C pairs (Fig. 7, Table 2). The 

mismatched molecules are expected to be under mechanical stress, 

and the disrupted regular periodicity of the stacked W–C pairs and 

their possibly worse stacking interaction can lead to a decrease in the 

electron transport efficiency [33]. 

3.4. Abasic nucleotides — structure change and interrupted stacking 

The role of base stacking in DNA conductivity was also estimated 

by comparing the conductivity of two double-stranded sequences 

with a mixed G/A/C/T sequence, one containing all bases in W–C 

pairs (number 3 in Table 1) and the other with the same sequences 

except for three bases in the middle, at positions 15–17, which were 

substituted with an abasic nucleotide spacer (number 4 in Table 1). 

The measurements consistently showed that samples with the abasic 

spacer had a lower conductivity than the standard DNA sample. The 

I(V) curves obtained for double-helical DNA samples 3 and 4 are 

compared in Fig. 5. In this case, the conductivity of the sample with 

the gap in the middle of the sequence was much lower than the 

conductivity of a standard DNA chain. The same result – a lower 

conductivity of an abasic dsDNA sample when compared with an 

intact dsDNA – was obtained in the case of the ds AT chain with two 

bases missing in the middle (sample 9). 

There are no examples of atomic-resolution structures of DNA 

molecules with two or even three base pairs replaced by an abasic 

nucleotide. However, structures missing just one base in one of the two 

strands in a double-helical construct may be significantly deformed, as 

for example in the crystal structure of human APE1 bound to abasic 

DNA [34]. Therefore, it is not possible simply to dissect the effect of the 

overall ds structure and quality of the stacking; both effects, less 

regular double-helical structure and sub-optimal stacking interactions, 

are likely to cause the lower conductivity of the abasic samples. The 

DNA backbone constitutes a quasi-one-dimensional periodic system, 

which is essentially independent of the base pair sequence and could 

allow for extended Bloch states. Nevertheless, conductivity through 

the backbone seems to be low because of the insulating sugar groups 

separating the phosphate groups from each other. 

3.5. Phosphate charge 

To study the influence of the DNA negative charge on its 

conductivity, we synthesized DNA chains with phosphates modified

y isopropoxy groups, thus eliminating phosphate negative charges 

(p-isopropoxy-modified sequences 10, 11, 12 in Table 1). The 

measurements undertaken for the pairs of double-stranded samples 

1–10, 2–11, and 3–12 (Table 1) demonstrated that in all three cases the 

p-isopropoxy-modified DNA sequences had a lower conductivity than 

their counterparts of natural DNA (Table 2, Fig. 6). 

In the polar aqueous environment, DNA forms a double helix with 

the hydrophobic base planes shielded from the aqueous solvent by the 

base-pair stacking in its core region with the charged phosphate fully 

exposed to the solvent. The phosphate negative charges are compensated 

by partially condensed counterions, typically mono- and bivalent 

alkali- and alkaline-earth metals such as Na + and Mg 2+ . The metals are 

fully integrated into the solvation shell, which is partially ordered [35– 

37]. On the basis of a MALDI-TOF analysis, the presence of Na + and K + 

cations in the p-isopropoxy-modified sequences is highly unlikely, and 

these metal cations probably do not play any role in the conductivity of 

sequences 10 and 11. In natural sequences with the presence of Na + or 

Mg 2+ counterions, the conductivity is increased partly due to the Na + or 

Mg 2+ states being localized in the large π–π⁎ energy gap. In the case of 

sodium, we have small activation gaps (of a few kT) between the water 

and sodium states, which could lead to hopping conductivity between 

the Na + centered states. For Mg 2+ , the occupied water-state energies are 

not only close to the Mg 2+ levels but also very close to the unoccupied π⁎ 

states, leading to the possibility of electron doping of DNA by water or 

Mg 2+ . Like in the case of the abasic dsDNA, the lower conductivity of 

uncharged dsDNA is caused, besides the electronic effects, also by the 

less regular structure of the uncharged dsDNA. 

The shape of the I(V) curves can in general be interpreted as 

follows: The current passes through the molecules and also tunnels 

through the tip–molecule area. For low voltages, ohmic behavior was 

observed due to the Boltzmann distribution of the charge carriers and 

the constant position of the Fermi level. The higher the voltage is the 

higher is the current passing through each molecule, resulting in the 

nonlinear effect of the charge–carrier injection (the shift of the DNA 

Fermi level to the electronic tail states and their occupation). 

Therefore, based on our topographic data, we assume that the 

differences in the conductivity of different samples come from the 

properties of the individual molecules, not from the specific properties 

of the molecular monolayers. 


The STM technique was used to study the conductivity of various 

DNA sequences in single- and double-stranded forms with one strand 

always covalently bonded to the gold surface. The purpose of our 

investigations was to provide more insight into the complex process of 

the charge–carrier transport in DNA molecules — the role of the sugarphosphate 

backbone, the role of the counterions complexed around 

the negatively charged phosphate oxygens, and the effect of the 

interactions between the bases and their pairs. 

The double-helical sample with the G/C bases is a better conductor 

than the double-stranded sequence containing only A and T nucleotides. 

Easy oxidation of the guanine base makes it possible to generate 

the charge carriers (holes). The charges, especially holes, created on 

the uniform DNA chain can move by the hopping charge transport 

through the discrete guanine sites. 

The conductivity of the double-stranded form is greater than that 

of the single-stranded one when complementary sequences are 

compared. Single strands can be considered much less structurally 

regular than the double helices. Regular structures could form better 

long-range ordering, which decreases the dispersion of the polarization 

energy and makes the distribution of hopping states narrower. 

Under these conditions, the charge–carrier mobility, and thus 

conductivity, in regular systems increases. 

We found that the conductivity of the samples with abasic spacers 

was lower than that of the natural dsDNA samples because of the lack 



of stacking interactions and likely also because of the structural 

irregularities and lost periodicity of the double strand. 

The DNA chains without charge-bearing phosphate groups were 

less conductive than natural dsDNA. The reasons are likely to be both 

electronic (the fact that neutral DNA lacks counterions with their effect 

on lowering the energy gaps between nucleotides) and structural 

(neutral DNA is likely to be distorted, irregular and hence more 

insulating than the natural dsDNA) [38]. 

Theoretical computations show that the orbitals occupied by the 

π-electrons contribute strongly to the electronic states, which arises 

from the electronic coupling between the neighboring bases [39,40]. 

Unlike the π-electrons, which can form extended states, water 

molecules and counterions create localized states of electrons, 

resulting in the hopping mechanism of conduction, with the inclusion 

of the electron-phonon interactions. The DNA molecule contains 

electronic states, which have an extended character and in which the 

electrons easily carry a ballistic current, and localized states of 

electrons, mediating the hopping mechanism of conduction. These 

two rather complementary pictures of conduction, π-electron overlap 

and hopping through energetically near states, may fit together. 

Based on our measurements, we can conclude that the best 

conductor is the natural double-stranded DNA form with its bases 

forming Watson–Crick pairs and surrounded by counterions and water 

molecules. Since electronic states are strongly connected with molecular 

structure and DNA structure changes with base sequences, type and 

concentration of counterions, and relative humidity, the electronic 

states are expected to depend on all of the following parameters: 

1. change of the regular structure; 

2. water (as a possible ion conductor) amount; 

3. counterion presence; in the case of DNA containing sodium, Na + 

can mediate hopping conductivity between the Na + -centered 

states; for DNA containing magnesium, there is a possibility of 

electron doping of DNA by water or Mg 2+ states. 


This work was supported by the institutional funds to Institute of 

Physics AS CR, v.v.i. (AV0Z10100520), Grant Agency of the Academy of 

Sciences of the Czech Republic (Grants No. KAN 200100 801, KAN 401 

770 651, KAN 400 720 701), the Ministry of Education Youth and Sports 

of the Czech Republic COST OC 137, COST 1041/2006-32 the Czech 

Science Foundation (Grant No. 203/08/1594, 202/07/0643), by the 

European Commission through the Human Potential Programme 

(Marie-Curie RTN BIMORE, Grant No. MRTN-CT-2006-035859) and by 

institutional funds to Institute of Biotechnology AS CR (AV0Z50520701). 

References 

[1] S. Záliš, I. Kratochvílová, A. Zambova, J. Mbindyo, T.E. Mallouk, T.S. Mayer, Combined 

experimental and theoretical DFT study of molecular nanowires negative differential 

resistance and interaction with gold clusters, Eur. Phys. J., E 18 (2005) 201–206. 

[2] I. Kratochvílová, A. Zambova, J. Mbindyo, B. Razavi, J. Holakovský, Current–voltage 

characterization of alkanethiol self-assembled monolayers in metal nanowires, 

Mod. Phys. Lett. B 16 (2002) 161–169. 

[3] I. Kratochvílová, S. Nešpůrek, J. Šebera, S. Záliš, M. Pavelka, G. Wang, J. 

Sworakowski, New organic FET-like photoactive device, experiments and DFT 

modeling, Eur. Phys. J., E 25 (2008) 299–307. 

[4] I. Kratochvílová, K. Král, M. Bunček, S. Nešpůrek, T. Todorciuc, M. Weiter, J. Navrátil, 

B. Schneider, J. Pavluch: Scanning tunneling spectroscopy study of DNA 

conductivity, Cent. Eur. J. Phys., 1895-1082 (Print) 1644-3608 (Online). 

[5] B. Giese, Electron transfer in DNA, Curr. Opin. Chem. Biol. 6 (2002) 612–618. 

[6] A. Heller, Spiers memorial lecture. On the hypothesis of cathodic protection of 

genes, Faraday Discuss. 116 (2000) 1–13. 

[7] B. Giese, M. Spichty, Long-distance charge transport through DNA: quantification 

and extension of the hopping model, Chem. Phys. Chem. 1 (2000) 195–198. 

[8] D.T. Odom, E.A. Dill, J.K. Barton, Robust charge transport in DNA double crossover 

assemblies, Chem. Biol. 7 (2000) 475–481. 

[9] M.E. Nuñez, D.B. Hall, J.K. Barton, Long-range oxidative damage to DNA: effects of 

distance and sequence, Chem. Biol. 6 (1999) 85–97. 

[10] G.B. Schuster, Long-range charge transfer in DNA: transient structural distortions 

control the distance dependence, Acc. Chem. Res. 33 (2000) 253–260. 

9

[11] B. Giese, Long-distance charge transport in DNA: the hopping mechanism, Acc. 

Chem. Res. 33 (2000) 631–636. 

[12] R.G. Enders, D.L. Cox, R.R.P. Singh, Colloquium: the quest for high-conductance 

DNA, Rev. Mod. Phys. 76 (2004) 195–217. 

[13] E.B. Starikov, S. Tanaka, N. Kurita, Y. Sengok, T. Natsume, W. Wenzel, Investigation 

of a Kubo-formula-based approach to estimate DNA conductance in an atomistic 

model, Eur. Phys. J., E 18 (2005) 437–445. 

[14] M. Taniguchi, T. Kawai, DNA electronics, Physica, E 33 (2006) 1–12. 

[15] H. Cohen, C. Nogues, R. Naaman, D. Porath, Direct measurement of electrical 

transport through single DNA moleculas of complex sequence, PNAS 102 (2005) 

11589–11593. 

[16] D. Ullien, H. Cohen, D. Porath, The effect of the number of parallel DNA molecules 

on electric charge transport through “standing DNA”, Nanotechnology 18 (2007) 

424015–424018. 

[17] H. Cohen, C. Nogues, D. Ullien, S. Daube, R. Naaman, D. Porath, Faraday Discuss. 131 

(2006) 367–376. 

[18] D. Porah, G. Cuniberti, R. Felice, Charge transport in DNA-based devices, Top. Curr. 

Chem. 237 (2004) 183–227. 

[19] A.I. Onipko, K.F. Berggren, Y.O. Klymenko, L.I. Malysheva, J.J.W.M. Rosnik, L.J. 

Geerlings, E. van der Drift, S. Radelaar, Scanning tunneling spectroscopy on πconjugated 

phenyl-based oligomers: a simple physical model, Phys. Rev. B 61 

(2000) 11118–11124. 

[20] J.J.W.M. Rosnik, M.A. Blauw, L.J. Geerlings, E. van der Drift, S. Radelaar, Tunneling 

spectroscopy and modeling of electron transport in small conjugated azomethine 

molecules, Phys. Rev. B 62 (2000) 10459–10466. 

[21] M.S. Xu, S. Tsukamoto, S. Ishida, M. Kimatura, Y. Arakawa, R.G. Endres, M. Shimoda, 

Conductance of single thiolated poly(GC)-poly(GC) DNA molecules, Appl. Phys. 

Lett. 87 (2005) 083902–1-3. 

[22] J.J.W.M. Rosink, A. Blauw, L.J. Geerligs, E. van der Drift, B.A.C. Rousseeuw, S. 

Radelaar, Growth and characterisation of organic multilayers on gold grown by 

organic molecular beam deposition, Opt. Mater. 9 (1998) 416–422. 

[23] C. Schoenenberger, J.A.M. Sondag-Huethorst, J. Jorritsma, L.G.J. Fokkink, What are 

the holes in self-assembled monolayers of alkanethiols on gold, Langmuir 10 

(1994) 611–614. 

[24] J.J.W.M. Rosink, A. Blauw, L.J. Geerligs, E. van der Drift, B.A.C. Rousseeuw, S. 

Radelaar, Growth and characterisation of organic multilayers on gold grown by 

organic molecular beam deposition, Opt. Mater. 9 (1998) 416–422. 



[25] [Handbook of Optical Constants of Solids, edited by E. D. Palik, 1985]. 

[26] Jin He, Lisha Lin, Peiming Zhang, Stuart Lidsay, Identification of DNA basepairing 

via tunnel–current decay, Nano Lett. 7 (2007) 3854–3858. 

[27] S. Datta, W. Tian, S. Hong, R. Reifenberger, I. Henderson, C. Kubiak, Current–voltage 

characteristics of self-assembled monolayers by scanning tunneling microscopy, 

Phys. Rev. Lett. 79 (1997) 2530–2533. 



[29] L. Cai, H. Tabata, T. Kawai, Self-assembled DNA networks and their electrical 

conductivity, Appl. Phys. Let. 77 (2000) 3105–3106. 

[30] E.B. Starikov, S. Tanaka, N. Kurita, Y. Sengok, T. Natsume, W. Wenzel, Investigation 

of a Kubo-formula-based approach to estimate DNA conductance in an atomistic 

model, Eur. Phys. J., E 18 (2005) 437–445. 

[31] E. Westhof, Structural bridges in nucleic acids, in: E. Westhof (Ed.), Water and 

biological macromolecules, CRC Press, Boca Raton, 1993. 

[32] H.M. Berman and B. Schneider. 1998. Nucleic acid hydration. In Handbook of 

nucleic acid structure. S. Neidle, ed. Oxford University (1999). 

[33] B. Giese, Electron transfer in DNA, Curr. Opin. Chem. Biol. 6 (2002) 612–618. 

[34] C.D. Mol, T. Izumi, S. Mitra, J.A. Tainer, DNA-bound structures and mutants reveal 

abasic DNA binding by APE1 and DNA repair coordination, Nature 403 (2000) 

451–456. 

[35] B. Schneider, M. Kabelac, Stereochemistry of binding of metal cations and water to 

a phosphate group, J. Am. Chem. Soc. 120 (1998) 161–165. 

[36] B. Halle, V.P. Denisov, Water and monovalent ions in the minor groove of B-DNA 

oligonucleotides as seen by NMR, Biopolymers 48 (1998) 210–233. 

[37] B. Schneider, K. Patel, H.M Berman, Hydration of the phosphate group in doublehelical 

DNA, Biophys. J. 75 (1998) 2422–2434. 



[39] F. Zahid, M. Paulsson, S. Datta, Chapter published, in: H. Morkoc (Ed.), Advanced 

Semiconductors and Organic nano-Techniques, Academic Press, 2003, See also 

arXiv: Cond-Mat/0208183. 

[40] B. Rezek, D. Shin, H. Uetsuka, Ch.E. Nebel, Microscopic diagnostics of DNA 

molecules on mono-crystalline diamond, Phys. Status Solidi, A 204 (2007) 

2888–2897.

422 

Cent. Eur. J. Phys. • 6(3) • 2008 • 422-426 

DOI: 10.2478/s11534-008-0072-7 

Central European Journal of Physics 

Scanning tunneling spectrosopy study of DNA 

conductivity 

Research Article 

Irena Kratochvílová 1∗ , Karel Král 1 , Martin Bunček 2 , Stanislav Nešp o 

urek 3 , Tatiana Todorciuc 3 , Martin 

Weiter 4 , Jiˇrí Navrátil 4 , Bohdan Schneider 5 , Jiˇrí Pavluch 6 

1 Institute of Physics, AS-CR, v.v.i., Na Slovance 2, 182 21 Prague, Czech Republic 

2 GENERI BIOTECH s.r.o., Machkova 587, 500 11 Hradec Kralové, Czech Republic 

3 Institute of Macromolecular Chemistry, AS-CR, v.v.i., Heyrovský sq. 2, 16206 Prague, Czech Republic 

4 Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech Republic 

5 Institute of Organic Chemistry and Biochemistry, AS-CR, v.v.i., Fleming sq. 2, 166 10 Czech Republic 

6 Faculty of Mathematics and Physics, Charles University in Prague, V Holešovièkách 2, 180 00 Prague, Czech Republic 

Received 16 November 2007; accepted 21 February 2008 

Abstract: We used STM to study the conductivity of 32 nucleotide long DNA molecules chemically attached to a gold 

surface. Two oligonucleotides containing all four base types namely G, A, C, T, one single stranded and 

one double helical, all showed conductance data significantly higher than DNA containing only T and A that 

were either single stranded d(T32) or double helical d(T32).d(A32) in confirmation. Within each sequence 

group, the conductivity of the double helical form was always higher than that of the single strand. We 

discuss the impact of structure, particular base stacking and affinity to the phase transition. 

PACS (2008): 87.14.gk, 81.07.-b, 81.07.Nb, 81.40.Rs 

Keywords: molecular electronics • DNA • scanning tunneling microscopy • conductivity • charge carrier transport 

© Versita Warsaw and Springer-Verlag Berlin Heidelberg. 

DNA is an important and promising molecule, not only due 

to its genetic function, but also as a molecular scaffold 

for nanotechnology [1]. The double helical DNA architecture, 

is well stacked consisting of near parallel bases 

stacked with their π-electron systems overlapping. Such 

π-electron systems may be good candidates for long distance 

and one-dimensional (linear) charge transport. In- 

∗ E-mail: krat@fzu.cz 

Author copy 

vestigations of DNA conductivity and its physical origin 

have significant implications towards the study of DNA 

damage and repair in biological systems, application of 

DNA in electronic nano-devices, and DNA-based electrochemical 

biosensors. The electronic transport of various 

types of organic molecules operating through πconjugated 

systems, including DNA, has been the subject 

of several recent studies, both theoretical and experimental 

[2–5]. Despite significant achievements, results on 

DNA conductivity published by different research groups 

present often conflicting and controversial explanations of

Irena Kratochvílová et al. 

the DNA-mediated charge transport [6–8]. 

Two basic experimental approaches have been pursued to 

investigate the conduction through molecules: (i) contacting 

isolated single molecules or molecules in thin 

films, (ii) studying transport in thick films and devices, 

such as organic thin-film transistors or light emitting 

diodes. The optimal experimental setup is to position 

isolated molecules between two electrical contacts but it 

is very difficult to realize and especially difficult to verify. 

Working with ordered arrays of parallel π-conjugated 

molecules where in principle, the coupling to the substrate 

can be precisely known, offer the possibility to address the 

individual molecule by making use of the scanning tunneling 

microscope (STM) tip. STM experiments have already 

been proven as well suitable tools for the investigation of 

ordered monolayer films allowing electrical contacting of 

one or a few molecules and to obtain images of the structural 

characteristics of the film [9, 10]. 

In this work, we used the STM to study the conductivity of 

different DNA sequences in single- and double-stranded 

forms covalently bonded to a gold surface under ambient 

conditions (i.e. air, room temperature). It is known that 

water molecules surrounding DNA strongly participate in 

DNA structure holding. Working under vacuum, the water 

molecules are expelled and the DNA structure is reserved 

mainly by the effect of inner shell water molecules and 

this results in drastic changes. 

Our DNA molecules were short and very precisely prepared 

as self-assembled 32-mer oligodeoxynucleotides 

making monolayers and were immobilized by attaching to 

a gold surface through the formation of disulfide bridges 

via the C6 spacer at the DNA 5’-end as shown in Fig. 

1. The 40 nm thin gold layer was prepared by evaporation 

of pure gold (99.99% purity) on a silicon wafer 

which was cut into 1 cm×1 cm pieces. Synthesized were 

two types of oligonucleotides, two 32-mers with uniform 

sequences, d(32T), d(32A), and two 32-mers with non-selfcomplementary 

sequences containing all four nucleotides, 

G, A, C, and T in equimolar ratio: 

5’-d(CAGCAGGGTCAGTCAATCTATCGTCCGTAATG)-3’ 

(labeled further as d(GACT)), and the complementary sequence 

5’-d(CATTACGGACGATAGATTGACTGACCCTGCTG)-3’ 

The spacer was incorporated to the 5’-end of d(32T) and 

d(GACT) oligonucleotides. These two molecules were 

subsequently chemically attached to the gold surface in 

their single stranded forms Complexation with their complementary 

strands, resulted in chemically intact DNA 

molecules, via double helice formation. All DNA samples 

were prepared as triethylammonium salt (TEA); bulky TEA 

counterion with low mobility was selected to reduce ionic 

conductance of the samples. 

Figure 1. Scheme of attachment of the DNA 32-mers to the gold 

surface. 

The STM measurements were performed with NTEGRA 

Prima NT MDT system using freshly cut Pt/Ir tips. Both 

topographic and spectroscopic data were obtained. With 

STM, for very small voltages of ∼10 mV and relatively 

large current of ∼ 0.5 nA, in view of the very small tipsample 

distances, the topography of the samples were observed.Topographic 

images showed a considerable difference 

between the bare gold substrates and DNA sample 

molecules . In the case of molecular layers, specific surface 

patterns were observed. The occurrence of these patterns 

has been attributed to etching of the bottom gold layers 

arising from the reaction of thiol-groups with gold atoms, 

forming dissolvable complexes [11, 12]. All the molecules 

were ordered in similar geometric structures with the nearest 

neighbour spacing of 1-2 nm. By ellipsometry, in which 

the thickness of all the measured molecular layers was established 

as 8.5-9 nm, we have confirmed that the 32 nucleotide 

long DNA molecules are oriented approximately 

perpendicular to the substrate. 

I(V ) spectra were taken for different feedback voltage and 

current setpoints, i.e., for different initial sample-tip distances. 

In all experiments, the STM tip act as the electrical 

contacts on the “top” side of the assembled monolayer 

of the DNA molecules, the supporting gold substrate acts 

as the other (bottom) contact. The distance between the 

top of the molecules and the STM tip for all the set points 

was 2.5-4 Å. In view of the experimental setup, it was predicted 

that the flow of current occurs mainly through the 

molecule nearest to the tip without significant lateral intermolecular 

contribution to conduction. 

Noise, in the form of height fluctuations, was larger in the 

case of topographic images of films than in the case of the 

bare gold. All the organic molecules that have been studied 

by STM till now showed symmetrical current-voltage 

(I − V ) characteristics. The symmetry of the I − V characteristics 

has been explained in a simple model [13]. 

I(V ) curves were measured at three different set points: 

0.1 nA, 0.1 V; 0.2 nA, 0.1 V; 0.5 nA, 0.1 V using the same 

strategy for all four DNA sequences. Six hundred consecutive 

I(V ) sweeps in both voltage directions (from - 

1.5 V to +1.5 V and from +1.5 V to -1.5 V) were taken 

on each sequence. We compared I(V ) spectra taken for 

different molecular systems for the same substrate under 

the same conditions (set point at the gold terrace). Final 


423

424 

results presented in this paper are based on the average 

of the curve data set for the subsets collected. Only 

those curves I(V ) were included in the averaging in the 

analysis that were not affected by appreciable drift of the 

STM. All the results taken into consideration showed the 

same trends. Typical examples of I(V ) curves measured 

at set point 0.1 nA; 0.1 V are shown in Figs. 2, 3 and 4. 

In our experiments we have measured current tunneling 

through the tip-molecule area for the molecules so close 

to the tip that their contribution is set at voltage levels 

above the noise. For tips very close to the molecules 

(defined by the set point value) at very low voltages the 

number of molecules contributing to the total current is 

small. As we could not estimate exactly the number of 

the molecules, we proceeded to to compare conductances 

of different DNA sequences for both single- and doublestranded 

forms. The term conductivity is widely used in 

equivalent experiments (STM/AFM measured current vs. 

voltage curves on bundles of molecules) that we have decided 

to keep its common meaning. 

The shape of the I(V ) curves can be interpreted as follows: 

current passes through the molecule and also tunnels 

through the tip-molecule area. For low volatges the 

ohmic behaviour was observed due to the Botzmann distribution 

of the charge carriers and constant position of the 

Fermi level. As voltage is increasing the current passing 

through each molecule is higher – nonlinear effect 

of charge carrier injection takes place (shift of the DNA 

Fermi level to the electronic tale states and their occupation). 

Also the number of the molecules contributing to 

the total current is rapidly increasing so the total current 

is rising up very sharply at higher voltages. 

Comparison of conductivity of two single stranded sequences, 

d(T32) and d(GACT), and two double stranded, 

d(T32).d(A32) and d(GACT).d(CTGA), can be summarized 

as follows. The largest difference was found between conductivity 

of single-stranded form of oligonucleotides containing 

only T and the double-stranded form of mixed G, A, 

C, T sequences. Both samples with the “mixed” sequence, 

either in single- or double-stranded form, showed larger 

conductivity than either sample containing the d(T32) sequence 

(Figs. 2, 3). We observed the double helical sample 

with the mixed G, A, C, T sequences to be the best 

conductor from our DNA sample set (Fig. 4). Conductivity 

of the double-stranded form is larger than that of the 

single-strand when complementary sequences are compared, 

which is in agreement with theoretical model of 

the same system [7]. 

Based on our topographic data, we assume that the main 

reason for differences in sampleconductivity arise from the 

properties of the individual molecules, not as a function of 

the molecular monolayers. 

Scanning tunneling spectrosopy study of DNA conductivity 

Figure 2. Typical I(V ) curve of DNA 32-mer d(T32):d(A32) double 

helix (DS TA) and d(T32) single-stranded form (SS TA). 

Set point 0.1 nA, 0.1 V, measured in both voltage directions. 


Figure 3. Typical I(V ) curves of DNA 32-mer with mixed G, A, C, T 

sequences: Double helical d(GACT).d(CTGA) (DS MIX) 

and the single-stranded d(GACT) form (SS MIX). Set point 

0.1 nA, 0.1 V, measured in both voltage directions. 

Two channels can significantly contribute to the charge 

transport along the DNA double helix; they include electronic 

conduction along the base pair sequences and ionic 

conduction associated with the counterions. 

In this work, DNA molecules were synthesized as TEA 

salts to minimize the concentration of small, and therefore 

highly mobile, cations as sodium or potassium but ionic 

conduction cannot be ruled out due to water and solvated

Irena Kratochvílová et al. 

Figure 4. Comparison of I(V ) curves of double helical DNA 32-mers 

with mixed G, A, C, T sequences d(GACT).d(CTGA) (DS 

MIX) and d(T32):d(A32) (DS TA). Set point 0.1 nA, 0.1 V, 

measured in both voltage directions. 

ions used to dissolve and subsequently deposited on the 

DNA molecules. However, an ionic conduction mechanism 

would not require just presence the presence of mobile 

ions, such as in a liquid or a molten phase, but also their 

macroscopic reservoir to maintain the observed stable current 

flow for as long as the voltage was applied. Neither of 

the two conditions were completely satisfied in our experiments. 

Thus, in our case, the ionic conduction mechanism 

should not be a strong source of the DNA conductivity. 

On the other hand, any molecule or ion associated with 

DNA via ionic or covalent bonding might in principle affect 

the DNA electronic structure, the π-electron distribution 

of the stacked bases with their energetic states, 

and hence its electrical conductivity. Ions can act in the 

molecular system like dopants-supplying the system by 

charge carrier – electron or hole. The electronic interactions 

between the π-electron systems of the bases may 

generate a molecular energy band with electronic states 

delocalized over the entire length of the molecule. We assume 

the impurity concentrations from sample to sample 

to be approximately the same, therefore we did not expect 

the impurity concentration to be a source of differences in 

the conductivity between samples. 

The question arises, what can be the main origin of the different 

conductivity of our molecular samples? Besides the 

charge-carrier concentration, the explanation for the measured 

conductivity differences in the DNA samples may 

relate to the the specific electronic structure, molecular 

chains structural differences and electron-phonon interactions. 

Single strands of both investigated sequences can 

be considered to be much less structurally regular than the 

double helices because of their local and especially longscale 

deviations from the regular helical arrangement [14]. 

Reduced stacking interactions can decrease the potential 

overlap of the π-electron systems. Furthermore, a more 

regular structure may promote better long range ordering 

resulting in a decrease in the dispersion of the polarization 

energy and narrowing in the distribution of hopping 

states. Under these conditions, the charge carrier mobility, 

and thus conductivity, in regular systems increases. 

Based on our experimental results we propose that electrical 

conductivity in DNA strands is higher for the welldefined 

right-handed double helical forms due to their 

smaller structural deviations resulting in larger π-electron 

potential overlap and smaller dispersion of the polarization 

energy (Figs. 2, 3). 

Guanine base is the most easily oxidized. This allows 

the generation of a charge carrier (hole). Once charges, 

and especially holes, are created on the uniform DNA 

chain, the hopping charge transport phenomena can occur 

among discrete guanine sites or delocalized (e.g., polaron) 

domains [12]. Furthermore, the stacking distance of 

the adjacent base pairs also affects the π-electron overlap. 

The crystal structure analysis of oligonucleotides 

indicates that the axial rise of residue is 2.88 Å for 

poly(dG).poly(dC) and 3.22 Å for poly(dA).poly(dT) [15]. 

The more compact the base stacking is, the more favorable 

the charge transport is expected to be. Charge transport 

enhancement in tighter stacked compact samples is 

in agreement with our results showing higher conductivity 

of double helical mixed d(GACT).d(CTGA) sequences than 

d(T32).d(A32) samples (Fig. 4). 

Based on our theoretical expectations and experimental 

data, we can say that the d(GACT).d(CTGA) is the better 

conductor of all the DNA samples investigated due to the 

regular structural double helical form with compact base 

(G-C) stacking. 


Obviously, the DNA conductivity is a very complex problem 

and requires further attention. Detailed understanding 

of the conduction mechanism remains a challenge and, 

once achieved, it will undoubtedly provide a better insight 

into the biological, chemical and physical properties of 

DNA molecules. 


This work was supported by the Grant Agency of the 

Academy of Sciences of the Czech Republic (grants 

KAN400720701, KAN401770651, KAN 200100801 and 

COST OC 137) and by institutional project AVOZ 

10100520. The authors thank the scientists participating 

in BIMORE (Bio-inspired Molecular Optoelectronics) 

425

426 

project for valuable discussions. 

References 

[1] B. Rezek, D. Shin, T. Nakamura, C.E Nebel, JACS 

Com. 844, 128 (2006) 

[2] D.T. Odom, E.A. Dill, J.K. Barton, Chem. Biol. 7, 475 

(2000) 

[3] H. Cohen, C. Nogues, R. Naaman, D. Porath, P. Natl. 

Acad. Sci. USA 102, 11589 (2005) 

[4] H. Cohen et al., Faraday Discuss. 131, 367 (2006) 

[5] D. Ullien, H. Cohen, D. Porath, Nanotechnology 18, 

424015 (2007) 

[6] R.G. Enders, D.L. Cox, R.R.P. Singh, Rev. Mod. Phys. 

Scanning tunneling spectrosopy study of DNA conductivity 

76, 195 (2004) 

[7] E.B. Starikov et al., Eur. Phys. J. E 18, 437 (2005) 

[8] M. Taniguchi , T. Kawai, Physica E 33, 1 (2006) 

[9] A.I. Onipko et al., Phys. Rev. B 61, 11118 (2000) 

[10] J.J.W.M. Rosnik, M.A. Blauw, L.J. Geerlings, E. van der 

Drift, S. Radelaar, Phys. Rev. B 62, 10459 (2000) 

[11] C. Schoenenberger , J.A.M. Sondag-Huethorst, J. Jorritsma, 

L.G.J. Fokkink, Langmuir 10, 611 (1994) 

[12] J.J.W.M Rosink et al., Opt. Mater. 9, 416 (1998) 

[13] S. Datta et al., Phys. Rev. Lett. 79, 2530 (1997) 

[14] S. Neidle, Nucleic acid structure and recognition (Oxford 

University Press, 2002) 

[15] L. Cai, H. Tabata, T. Kawai, Appl. Phys. Let. 77, 3105 

(2000) 

Author copy

Macromol. Symp. 2008, 268, 125–128 DOI: 10.1002/masy.200850826 125 

Light-Induced Change of Charge Carrier Mobility in 

Semiconducting Polymers 

Martin Vala,* 1 Martin Weiter, 1 Oldrˇich Zmesˇkal, 1 Stanislav Nesˇpu˚rek, 1,2 

Petr Toman 2 

Summary: Light-driven devices based on reversible change of carrier mobility in 

semiconducting polymers were investigated. The mobility was altered using a 

photochromic spiropyran capable of a reversible change of permanent dipole 

moment and ionization potential. While the latter attribute may result in formation 

of chemical traps and is more important for matrices with similar ionization potential 

such as PVK, the former phenomenon results in formation of polar traps and is more 

pronounced in the case of lower-band-gap materials. 

Keywords: charge transport; conducting polymers; poly(phenylenevinylene); 

poly(vinylcarbazole); supramolecular structures 

Introduction 

This contribution deals with the concept of 

a current switch built from polymer materials 

doped by photochromic compounds 

capable of reversible switching between 

ON and OFF states by changing the charge 

carrier mobility in the semiconducting 

polymers. [1,2] The colour changes due to 

the photochromic transformations are also 

accompanied by changes of other chemical 

and physical properties, such as emission 

spectra, refractive index, dielectric permittivity 

and enthalpy. These modifications are 

intrinsic in photochromic phenomena and 

thus offer wider possibilities for practical 

applications of photochromic compounds. 

6-nitro substituted spiropyrans, which can 

change their dipole moment from ca. 6 D to 

12 20 D due to a photochromic reaction, 

[3–5] can be mentioned as examples. 

The changes in physical or chemical properties 

transferred to the microenvironment or 

supramolecular structure further induce 

1 Faculty of Chemistry, Brno University of Technology, 

Purkyňova 118, 612 00 Brno, Czech Republic 

Fax: þ420 541 149 398; 

E-mail: vala@fch.vutbr.cz 

2 Institute of Macromolecular Chemistry, v.v.i., Academy 

of Sciences of the Czech Republic, Heyrovsky´ 

Sq. 2, 162 06 Prague, Czech Republic 

Copyright ß 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 

modification in the surrounding environment. 

It has been shown that dopants added to 

a surrounding charge-transporting material 

can produce: (i) chemical traps based on the 

formation of local centres by the dopant 

with ionization energy lower and/or electron 

affinity higher than in the virgin 

material (for further discussion, see e.g. 

ref. [6] and references therein), and (ii) dipolar 

traps created by dopant with high dipole 

moments. Dipolar traps are based on 

modification of local values of polarization 

energy (leading to modification of ionisation 

energy and/or electron affinity) and 

broadening of the hopping-states distribution 

due to the charge-dipole interactions in 

the environment. [7] Other types of traps, 

such as traps produced by structure defects 

will not be discussed in this paper. Based on 

the calculations performed on model systems, 

a concept of optoelectrical switch was 

put forward. The proposed device consists 

of bistable polar species capable of switching 

between low-dipole and high-dipole 

states. In consequence, the created polar 

traps modify the effective mobility of 

charge carriers in a reversible and controlled 

manner. [1,2,8,9] This contribution 

extends the research to another semiconducting 

polymer poly(vinylcarbazole).

126 

Macromol. Symp. 2008, 268, 125–128 

Since the structure of the polymer differs 

from those previously reported, a different 

switching mechanism is expected. 

Experimental Part 

All the samples were prepared in the form of 

sandwich cell of the diode type. The samples 

were fabricated on a transparent ITO 

(indium tin oxide) electrode using the spincoating 

technique. As a polymer matrix, 

poly(vinylcarbazole) (PVK) was used. 

As the active photochromic unit 1 0 ,3 0 - 

dihydro-1 0 ,3 0 ,3 0 -trimethyl-6-nitrospiro[2H- 

1-benzopyran-2,2 0 -[2H]-indole] (SP) was 

used. All the chemicals were supplied by 

Aldrich and were used as recieved. The 

preparation conditions of the active materials 

were optimised to obtain typically 

150 nm thick layers. The structures were 

finished by vacuum evaporation of 100 nm 

thick top aluminium electrode. The average 

device area was 3 mm 2 . The current-voltage 

characteristics were measured with a Keithley 

6517A electrometer. All electric measurements 

were performed at room temperature 

under vacuum. Absorption and 

photoluminescence spectroscopies were 

used to monitor the photochromic reaction. 

For optical measurements, thin layers of the 

same thickness were spin-coated on quartz 

glass substrates. A xenon arc lamp (450 W) 

with selected wavelength (360 20 nm) and 

IR filter were used to switch the photochromic 

moiety from the stable to metastable 

state. 

Results and Discussion 

The photochromic behaviour of spiropyrans 

was first reported in 1952. [10] Since that time 

it has been intensively studied for their use 

as a binary element for computer memories 

(for further information, see [3] ). Absorption 

of UV light by the spiropyran results in a 

cleavage of the oxygen-spiro carbon bond 

leading to the formation of the coloured 

open-form (lmax ¼ 600 nm) isomer having a 

high dipole moment as opposed to the closed 

form, which is colourless and possess a lower 

dipole moment. The open form is often 

called (photo)merocyanine (MC) because it 

is similar to merocyanine dyes. The MC 

form reverts thermally to the closed form, 

which manifests itself as bleaching of the 

samples. The reverse reaction can be 

accelerated by absorption of visible light. 

The reaction scheme and the absorbance 

change during the reaction is depicted in 

Figure 1 and 2. It can be seen that, even 

before the photochromic conversion, some 

MC forms are present as the system is in its 

thermodynamic equilibrium (note the logarithmic 

scale on the y axis). The change of 

the absorbance is only neat. The electric 

properties, however, were modified dramatically. 

Figure 2 shows the photoswitching of the 

electric current of the PVK:SP samples with 

various concentrations of the photochromic 

SP. It can be seen that addition of a higher 

amount of SP already led to a decrease in 

current before the photochromic conversion. 

The photochromic reaction caused a 

further reversible decrease in all cases. This 

behaviour differs from our previous observations 

where we investigated the influence 

Figure 1. 

The absorbance spectra of the PVK:SP 5% (by weight) 

before (&) and after the photochromic reaction (*). 

The reverse reaction can be accelerated by illumination 

with VIS light (longer wavelength absorption 

band of MC). 

Copyright ß 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.ms-journal.de

Macromol. Symp. 2008, 268, 125–128 127 

Figure 2. 

Current-voltage characteristics of the PVK:SP blends measured before (open symbols) and after (full symbols) 

the photochromic reaction. Circles represent 2.5%, squares 5% and triangles 10% (by weight) mixtures. The 

inset shows the photochromic reaction: under illumination of UV light the spiropyran (SP) converts to the 

metastable (photo)merocyanine (MC) form. 

of SP on a series of poly(phenylenevinylene) 

(PPV) derivatives. [4,9] The addition of 

SP molecules up to 30% (by wt.) into the 

PPV matrix does not lead to such decrease. 

The carbazole units in the polymer act as 

individual molecules [11] and the electronic 

coupling is weaker compared with the PPV 

polymers. The addition of dopant (SP) led 

to a more pronounced disorder and thus 

lowered charge carrier mobility in comparison 

with the PPV-based systems where few 

percent of dopant hardly influenced the 

transport. This results in a lowering of the 

electric current after addition of SP. 

Another remarkable difference is in the 

behaviour after photochromic conversion. 

In the case of PPV-based system, the yield 

of the photochromic reaction was poor [12] 

and also the reversibility of the current 

switching was unsatisfactory. [4] These drawbacks 

are improved in the system based on 

the PVK matrix. 

Figure 2 shows a drop of the current and a 

change of the shape of the current-voltage 

characteristics after photochromic reaction. 

The shape can be interpreted in terms of the 

space-charge-limitedcurrent(SCLC)theory. 

When the applied electric field is increased, 

the traps are filled, which is equivalent to a 

shift of the quasi-Fermi level with electric 

field. This causes the occupancy of electronic 

states to change and enables the scanning of 

the distribution of energy from the current 

changes. In terms of the present work, the 

distribution of charge traps describes those 

induced by the spiropyran–merocyanine 

photochromic conversion. At a certain 

voltage the Fermi level crosses over the trap 

level and the current is no more influenced by 

this trapping level, approaching the values 

similar to those before the photochromic 

conversion (for further discussion, see [13] ). 

In our previous papers the current 

switching was explained as a reversible 

decrease in hole mobility due to the 

increased trap concentration caused by 

the presence of an additive with permanent 

dipole moment forming polar traps. [4] 

Using the Hoesterey-Letson formalism, [14] 

it has been shown that the carrier mobility 

with relative trap concentration c is the 

product of mobility of the trap-free system 

m0 and trapping factor: 

mðcÞ ¼m 0 1 þ c exp Et 

kT 

1 

; (1) 

where Et is the energy of trapping level, k is 

the Boltzmann constant and T is the 

temperature. It follows that the current 

flowing through the sample is reduced when 

the concentration of traps is increased. 

Table 1 shows calculated ionization 

potentials (IP) and electron affinities (EA) 

reported in literature for the SP and 


128 

Macromol. Symp. 2008, 268, 125–128 

Table 1. 

Energy levels of the compounds. 

EA [eV] IP [eV] Ref. 

SP – closed 1.10 8.79 [15] 

SP – opened (MC) 1.76 7.09 [16] 

PVK 1.50 7.60 [11] 

MEH-PPV 1.87 4.57 [17] 

polymers considered in this study. It should 

be noted that these IP and EA values are for 

isolated molecules. Therefore they differ 

from the IP and EA values of the corresponding 

solid films because of the large 

solid-state polarization corrections. Since 

there are no data on SP values of EA and IP 

in the solid state, we will use these gas phase 

values to explain the observations. 

After the photochromic conversion, the 

SP molecules change the electronic properties 

and the IP gain value higher than PVK 

matrix. This new energetic level inside the 

PVK band-gap can acts as a trapping level 

for holes. The photoproduct (MC) also 

possesses a higher dipole moment and, 

therefore, also polar traps are produced. 

The concentration of SP dopant can thus 

drop to several percent compared with 

several tenths of percent for the PPV-based 

systems to achieve current switching withing 

two orders of magnitude. 

The situation in PPV-based systems is 

different. Since the calculated IP of MEH- 

PPV is higher than that of the MC form, it is 

unlikely that the photochromic conversion 

produces a new trapping level in the MEH- 

PPV band-gap. Even for rough estimation 

of the gas-phase IP from the widely used 

solid-state value (ca. 5.35 eV [18] ) considering 

polarization effect ca. 1.5 eV, we 

obtain a higher value than the IP of MC. 

Therefore, the formation of chemical traps 

is less likely to occur and only polar traps 

are present. 

Conclusions 

Charge mobility switching in semiconducting 

polymers using a photochromic spiropyran 

was demonstrated. It has been 

shown that the PVK:SP-based devices 

allow high performance with a ten-timeslower 

concentration of the active units 

compared with the PPV-based devices 

where the switching process is rather 

inefficient. However, the actual switching 

mechanism differs since also the formation 

of chemical traps is likely to occur as 

opposed to the PPV-based devices where 

the position of IP does not allow such 

behaviour. 

Acknowledgements: The presented research has 

been supported by the Academy of Sciences of 

the Czech Republic (project KAN 401770651). 

[1] S. Nesˇpu˚rek, J. Sworakowski, Thin Solid Films 2001, 

393, 168. 

[2] S. Nesˇpu˚rek, P. Toman, J. Sworakowski, Thin Solid 

Films 2003, 438–439, 268. 

[3] H. Dürr, H. B. Laurent, Photochromism: Molecules 

and Systems, 2 nd ed., Elsevier Science B.V., Amsterdam 

2003. 

[4] M. Weiter, M. Vala, O. Zmesˇkal, S. Nesˇpu˚rek, P. 

Toman, Macromol. Symp. 2007, 247, 318. 

[5] M. Bletz, U. Pfeifer-Fukumura, U. Kolb, W. 

Baumann, J. Phys. Chem A 2002, 106, 2232. 

[6] J. Sworakowski, K. Janus, S. Nesˇpu˚rek, M. Vala, IEEE 

Trans. Dielectr. Eetrl. Insul. 2006, 13, 1001. 

[7] J. Sworakowski, IEEE Trans. Diel. Elet. Insul. 2000, 7, 

531. 

[8] S. Nesˇpu˚rek, J. Sworakowski, C. Cambellas, G. Wang, 

M. Weiter, Appl. Surf. Sci. 2004, 234, 395. 

[9] M. Weiter, M. Vala, O. Salyk, O. Zmesˇkal, S. 

Nesˇpu˚rek, J. Sworakowski, Mol. Cryst. Liq. Cryst. 

2005, 430, 227. 

[10] E. Fischer, Y. Hirshberg, J. Chem. Soc. 1952, 4522. 

[11] M. Pope, C. E. Swenbrg, Electronic Processes in 

Organic Crystals and Polymers, 2 nd ed., Oxford University 

Press, Oxford 1999. 

[12] M. Vala, M. Weiter, G. Rajtrová, S. Nesˇpu˚rek, P. 

Toman, J. Sworakowski, Nonlinear Opt. Quantum Opt. 

accepted. 

[13] to be published. 

[14] D. C. Hoesterey, G. M. Letson, J. Phys. Solids 1963, 

24, 1069. 

[15] M. Yurtsever, B. Ustamehmetoglu, A. S. Sarac, A. 

Mannschreck, Int. J. Quantum Chem. 1999, 75, 111. 

[16] Y. Kawanishi, K. Seiki, T. Tamaki, M. Sakuragi, Y. 

Suzuki, J. Photochem. Photobiol. A: Chem. 1997, 109, 

237. 

[17] Y. Li, Y. Sun, Y. Li, F. Ma, Comput. Mater. Sci. 2007, 

39, 575. 

[18] I. H. Campbell, T. W. Hagler, D. L. Smith, J. P. 

Ferraris, Phys. Rev. Lett. 1996, 76, 1900. 


nloqo_E1_vala Nonlinear Optics and Quantum Optics December 11, 2006 17:38 

Nonlinear Optics and Quantum Optics, Vol. X, pp. 01–11 

Reprints available directly from the publisher 

Photocopying permitted by license only 

○2007 c Old City Publishing, Inc. 

Published by license under the OCP Science imprint, 

a member of the Old City Publishing Group 

Photochromic Properties of Spiropyran in 

Polymeric π–Conjugated Matrices 

MARTIN VALA (a) ,MARTIN WEITER (a) ,GABRIELA RAJTROVÁ (a) , 

STANISLAV NEˇSP?REK (a,b) ,PETR TOMAN (b) , AND 

JULIUSZUSZ SWORAKOWSKI (c) 

(a) Faculty of Chemistry, Brno University of Technology, 

Purkyòova 118, 612 00, Brno, Czech Republic 

(b) Institute of Macromolecular Chemistry, 

Academy of Sciences of the Czech Republic, Heyrovsk´y Sq. 2, 


(c) Institute of Physical and Theoretical Chemistry, Wroclaw University of Technology, 

Wyb. Wyspianskiego 27, 50-370 Wroclaw, Poland 

The contribution reports the results of studies of the photochromic reaction 

of 6-nitro-1 ′ ,3 ′ ,3 ′ -trimethylspiro[2H-1-benzopyran-2,2 ′ -indoline] (SP) in 

poly(methyl methacrylate) and in πconjugated photoconductive polymer 

matrices based on poly( p-phenylene vinylene) derivatives. The polymer 

matrix strongly influences the reaction rate, lifetime of coloured species 

and the value and distribution of activation energies of the bleaching 

process. It was also found that the activation energy depends on the 

intensity of light used for photochromic conversion and the exposure 

time. Photochromic reaction is influenced by energy transfer processes 

between the conjugated chain and photochromic additive. 

Key words: Spiropyran, photochromism, decolouration, kinetics, molecular switch 

INTRODUCTION 

Photochromic molecules have received much attention over the past decades 

for their potential applications in optoelectronic devices, like switches and 

memories. Among photochromic dyes, spiro-compounds play an important 

role because of high dipole moments of metastable coloured forms [1, 2]. 

This feature was used in the design of a special type of optoelectrical 

switch [3, 4], based on modulation of “on-chain” charge carrier mobility 

by a light-induced reversible change of dipole moments. Spiropyrans (SP) 

consist of two heterocyclic moieties linked together by a common spiro 

1


2 MARTIN VALA ET AL. 

carbon atom. The two parts of the molecule are oriented in two orthogonal 

planes. The absorption of UV light results in a cleavage of the oxygen–spiro 

carbon atom bond leading to the formation of a coloured open form isomer 

possessing high dipole moment as opposed to the closed form, which is 

colourless. The open form is often called photomerocyanine (MC) because 

it is similar to merocyanine dye. The MC form reverts thermally to the 

closed form which manifests itself in bleaching of the samples. 

In this paper we investigate the photochromism of 6-nitro-1 ′ ,3 ′ ,3 ′ - 

trimethylspiro[2H -1-benzopyran-2, 2 ′ -indoline] (SP) incorporated in 

poly(methyl methacrylate) and in three derivatives of poly(pphenylenevinylene) 

(PPV). Absorption and luminescence spectra and 

the kinetics of their changes on the course of the thermally driven 

photochromic reaction are examined. The kinetic results are investigated in 

the framework of the distribution model and the matrix relaxation model. 

EXPERIMENT 

Three types of π-conjugated polymer matrices were used: 

poly[2-methoxy-5-(2 ′ -ethylhexyloxy)-1, 4-phenylenevinylene] (MEH-PPV), 

poly[2-methoxy-5-(3 ′ ,7 ′ -dimethyloctyloxy)-1, 4-phenylenevinylene] (MD 

MO-PPV) and poly[(p-phenylenevinylene)-alt-(2-methoxy-5-(2-ethylhexy 

loxy)-p-phenylenevinylene)] P(MEHPV-alt-PV). 

In order to study photochromism in a optically transparent polymeric 

medium poly(methyl methacrylate) (PMMA) was used. All the chemicals 

were used as supplied by Aldrich, with no further purification. The samples 

were prepared as thin films by spin-coating method from chloroform/toluene 

(1:1) solutions of the polymers. For optical measurements quartz substrates 

were used. The substrates were thoroughly cleaned using ultrasonic stirring 

in liquid detergent solution, de-ionised water, acetone and chloroform. The 

thickness of the layers was typically between 80 and 120 nm. The reaction 

converting SP into merocyanine (MC) form was activated using discharge 

lamp HBO 200 with a (360 ± 20) nm band filter. 


Absorption spectra 

The absorption spectra of the PMMA/SP sample prior to and after illumination 

with UV light are shown in Figure 1. Upon illumination, a new absorption 

band appears in the 500 – 650 nm region, and the spectrum also changes in 

350–450 nm region. The former wavelength region consists of a main peak 

at 583 nm and a shoulder at 545 nm. Such spectrum is often explained


PHOTOCHROMIC PROPERTIES OF SPIROPYRAN IN POLYMERIC π–CONJUGATED MATRICES 3 

FIGURE 1 

The change in absorption of spiropyrane after the photochromic conversion in PMMA/SP 

samples. The inset depicts the structures of spiropyrane (SP) and merocyanine (MC) forms. 

in terms of aggregation behaviour of MC in solutions used for the thin 

film preparation [1, 5]. According to the model, the monomer absorbance 

(545 nm) is accompanied with aggregate absorbance at longer wavelengths 

(583 nm). 

Figure 2 shows absorption spectra of three PPV derivatives used in 

the experiments reported in this paper. The positions of the lowest-energy 

absorption bands depend on the nature of the side groups. No vibronic 

FIGURE 2 

Absorption spectra of three PPV derivatives. The absorbances have been normalised to the 

lowest energy bands.



FIGURE 3 

Differential spectra of the SP/MC photochromic system in three derivatives of PPV. The 

samples were exposed to the same UV radiation dose. 

structure was observed. The second (weaker) absorption band at about 

330 nm is assigned to the π → π* transitions of π–electrons delocalised 

along the polymer main chain [6]. The positions of the bands of the PPV 

derivatives coincide with those of the SP/MC system, hence the spectra of 

the photochromic system dispersed in the polymer matrix are quite complex 

superpositions of bands originating from excitations of both components. 

It is therefore more instructive to use differential spectra depicting changes 

of the absorbance due to the photochromic reaction; a comparison of such 

spectra is shown in Figure 3. The spectra in Figure 3 were determined after 

the samples had been exposed to the same dose of the UV radiation. Two 

features can be noticed: (i) a difference between the positions of the maxima 

of the low-energy bands, and (ii) a marked difference in the intensities 

of the bands. While the former feature can be rationalised as due to the 

solvatochromic effect [7] associated with different polarities of the polymer 

matrices (playing in this case the role of solvents), the source of the latter 

one is unclear and should probable be sought in a competition between 

the absorption of the photochromic system and the polymer matrices. Inner 

filter effect can also play a significant role. The absorption of the polymers 

at 365 nm used for the SP → MC conversion correlate with intensity of 

the change. Creation of thinner layers led to higher changes but due to the 

low values of measured absorbance also to high measurement errors. As a 

result, the kinetics of the photochromic reaction could be investigated with 

a satisfactory accuracy only in the MEH-PPV/SP and PMMA/SP systems.



FIGURE 4 

Normalised PL spectrum of the PMMA/MC sample after irradiation (15 and 120 s respectively) 

by UV light (discharge lamp HBO 200 with a (360±20) nm band filter). 

Photoluminescence 

The stable form of spiropyran (SP) does not show any luminescence 

contrary to its MC form. The photoluminescence (PL) band of thin film of 

PMMA/MC is shown in Figure 4. The PL spectrum is broad and featureless 

peaking at approximately 660 nm. Samples with a high SP → gC conversion 

repeatedly exhibited a slight narrowing of the PL band (cf. Figure 4). 

No noticeable vibrational progression was observed. Photoluminescence 

excitation (PLE) experiment showed two components corresponding to 

those observed in the absorption spectrum. 

The situation is different for the PPV/SP samples. The polymers show 

their own luminescence and creation of MC form via the photochromic 

reaction therefore could result in the appearance of new PL bands. However, 

MC possesses a high dipole moment [2] which generally causes a quenching 

of luminescence. Such behaviour was indeed observed in all three PPV 

matrices. The quenching was found to be strong even in the case when 

the SP → MC conversion was very weak (sometimes not observable in 

absorption spectra). After the reverse (MC → SP) reaction was completed, 

the polymer PL was recovered, the reversibility of the process was, however, 

unsatisfactory because of a strong photodegradation of the polymer matrices. 

Interestingly, the PL band of MC excited through its own absorption 

could not be found in the samples. This effect is not fully clear yet 

and its understanding needs further studies. Instead, the PL of MC could 

be triggered through the polymer excitation. This means that the energy



FIGURE 5 

Normalised absorbance and luminescence spectra of P(MEHPV-alt-PV) with dispersed 

spiropyran. 

absorbed by polymer (donor) is transferred to MC molecules (acceptor). 

According to the Forster-Dexter theory the dipole-dipole energy transfer 

probability is, among other, related to the overlap of donor emission and 

acceptor absorption. For all samples the polymer PL completely overlap 

the MC absorption, compare Figure 3 and Figure 5. 

Determination of kinetic parameters of the photochromic reaction 

Many models have been proposed so far to accurately describe the 

decolouration kinetics behaviour in solid matrices (see, e.g., [1] and 

references therein). It is usually stressed that physical and steric effects 

restrict the internal rotation needed for isomerization and therefore can 

play a significant role. The photochromic molecules are surrounded by 

microheterogenous matrix and therefore experience statistically different 

environment. This results in a distribution of activation energies Ea (assumed 

to be Gaussian), which control the reaction rates. Such processes can be 

described by so-called ‘stretched exponential’ function [8] 

n R(t) = n R(0) exp � −(t/τ) α� , (1) 

where α is a parameter describing the deviation from a purely exponential 

decay (α



completely ‘frozen’ medium during the decay. Based on a similar physical 

model (a statistical distribution of activation energies and/or pre-exponential 

factors of reacting molecules in an otherwise frozen matrix) is the method 

put forward in [9, 10] which additionally allows for estimation of the width 

of the distribution. 

The other extreme case is based on the assumption that the modification 

of the first-order rate constant is caused by the relaxation of the surrounding 

matrix from a nonequilibrium state immediately after the probe reorientation 

into relaxed state (therefore referred to as the relaxation model) in a 

comparable time scale as the probe decay kinetics [11]. The initial value 

of the first order rate constant k0 is thus modified by the matrix relaxation 

into its final (relaxed) value k∞ and the rate of the change is governed by 

a matrix mean relaxation time τm. The dependence of probe concentration 

decay in time is given by the relation [11] 

n R(t) = n R(0) exp � −k∞t − [k0 − k∞]τm[1 − exp(−t/τm)] � . (2) 

The kinetics of the decays (i.e., of the thermally driven MC → SP reaction) 

can be determined by following changes of the absorbance at a fixed 

wavelength. 

The experimental decays were nonexponential in the whole measured 

temperature region, being dependent on the dose of UV radiation to which 

the samples had been exposed. Figure 6 shows two decays for different 

irradiation times at the same temperature for MEH-PPV/SP sample. Different 

doses of delivered light convert different fraction of SP molecules into MC 

but this should not affect the rate of the thermal MC → SP reaction which 

is a first order process. However, by analysis of our samples by the two 

methods considered, such dependence was found. A possible explanation 

is a formation of other MC isomers at longer exposure time as it follows 

from the spectroscopic studies [12]. Assuming a statistical distribution of 

microenvironments in a frozen matrix (resulting in a Gaussian distribution 

of activation energies), one obtains the following result: longer times of 

exposition of UV radiation resulted in higher values of the activation energy 

and in broader distributions σ of the activation energies. Moreover, the 

latter parameter was found to decrease with increasing temperature (see 

Figure 7). Similar conclusions may be drawn if the relaxation model is 

employed to interpret our data (Figure 8). Exposure to higher irradiation 

(longer conversion times) led to lower values of k0, k∞ and km = 1/τm 

and consequently to higher Ea. All the samples analysed showed a similar 

behaviour, the exact values of the parameters slightly differing between the 

samples but exhibiting the same trends. The Arrhenius parameters obtained 

from absorbance decays are listed in Table 1.



FIGURE 6 

Normalised absorbance decay of MC measured at 30 o C in MEH-PPV for two different 

irradiation times (15s – (a), 120 s – (b)). The dotted lines represent the slope of k∞, (see 

Eq. (2)).



FIGURE 7 

Top: Arrhenius plot for k(E0) of the MC form decay obtained for different irradiation 

times. The Ea slightly increases with exposure time; see Table 1 for the values. Bottom: 

Distribution of the Ea at different temperatures parametric in irradiation time.



FIGURE 8 

Arrhenius plot for the kinetics parameters of Eq. (2) (• k0, ◦ k∞, �1/τm) of the MC 

decays after 15 s (top) and 120 s (bottom) irradiation by UV light. 

CONCLUSION 

The experiments reported in this contribution seem to demonstrate that 

the SP ↔ MC reaction is a complex process occurring probably via 

intermediate states, their relative importance depending on the conversion. 

One of plausible explanation may be sought in assuming a co-existence of 

several forms of MC which may interconvert during the reaction [2, 13]. 

TABLE 1 

Kinetic parameters for the decay of the MC form of SP in PMMA/SP and MEH-PPV/SP 

samples for different irradiation dose. 

conversion E0 Ea(k0) Ea(k∞) Ea(τ m) 

time (s) (kJ/mol) (kJ/mol) (kJ/mol) (kJ/mol) 

PMMA/SP 15 127 ± 6 92 ± 10 128 ± 11 69 ± 10 

30 131 ± 4 105 ± 6 133 ± 10 93 ± 22 

60 132 ± 4 112 ± 3 137 ± 14 95 ± 9 

120 130 ± 7 117 ± 8 149 ± 28 99 ± 19 

MEH-PPV/SP 15 67 ± 40 – – – 

30 137 ± 15 111 ± 5 128 ± 11 88 ± 14 

60 169 ± 11 – – – 

120 142 ± 20 159 ± 6 179 ± 10 168 ± 15



ACKNOWLEDGMENTS 

This work was supported by the grant 3446/2005/G1 from the Development 

Fund of Universities, by the project No. 203/03/133 from the Czech Science 

Foundation, by project No. 0021630501 from the Ministry of Education, 

Youth and Sports, by the Academy of Sciences of the Czech Republic 

(Project T400500402 in the program “Information Society”), and by the 

Wroclaw University of Technology. 

REFERENCES 

[1] Such, G., Evans, R. A., Yee, L. H., and Davis T. P. (2003). Factors influencing 

photochromism of spiro-compound within polymeric matrices. Journal of Macromolecular 

Science, Part C-Polymer Reviews, 43, 547–579. 

[2] Toman, P., Bartkowiak, W., Neˇspu¸rek, S., Sworakowski, J., Zale´sny, R. (2005). 

Quantum-chemical insight into the design of molecular optoelectrical switch. Chem. 

Phys., 316, 267–278. 

[3] Neˇspu¸rek, S., Sworakowski, J., Combellas, C., Wang, G., and Weiter, M. (2004). A 

molecular device based on light controlled charge carrier mobility. Appl. Surf. Sci., 

234, 395–402. 

[4] Neˇspu¸rek, S., and Sworakowski, J. (2001). Molecular current modulator consisting 

of conjugated polymer chain with chemically attached photoactive side groups. Thin 

Solid Films, 393, 168–176. 

[5] Uznanski, P., (2000). From spontaneously formed aggregates to J-aggregates of 

photochromic spiropyran. Synthetic Metals, 109, 281–285. 

[6] Yang, L. G., Yhang, Q. H., Peng, W., Huang, T. C., Yeng, L. C., Gu, P. F., 

and Liu, X. (2005). Concentration dependence of photoluminescence properties in 

poly[(2-methoxy,5-octoxy)1,4-phenzlenevinylene] thin films. Journal of Luminescence, 

114, 31–38. 

[7] Reichardt, Ch. (1988). Solvents and Solvent Effects in Organic Chemistry, VCH, 

Weinheim. 

[8] Richert, R., and Bassler, H. (1985). Merocyanine ↔ spiropyran transformation in a 

polymer matrix: An example of a dispersive chemical reaction. Chem. Phys. Lett., 

116, 302–306. 

[9] Sworakowski, J., and Neˇspu¸rek, S. (1998). A straightforward method of analysis of 

first-order processes with distributed parameters. Chem. Phys. Letters, 298, 21–26. 

[10] Janus, K., and Sworakowski, J. (2004). Analysis of first-order reactions with distributed 

parameters. Struct. Chem. 15, 461–468. 

[11] Levitus, M., and Aramendía, P. F. (1999). Photochromism and thermochromism of 

phenantrospirooxazine in poly(alkylmehacrylates). J. Phys. Chem. B, 103, 1864–1870. 

[12] To be published. 

[13] Toman, P., Neˇspu¸rek, S., Weiter, M., Vala, M., Sworakowski, J., Bartkowiak, W., and 

Menˇsík, M. (2005). Photoswitching in Polymers with Photochromic Dipolar Species. 

This volume.

318 

Macromol. Symp. 2007, 247, 318–325 DOI: 10.1002/masy.200750136 

A Molecular Photosensor Based on Photoswitching 

of Charge Carrier Mobility 

Martin Weiter,* 1 Martin Vala, 1 Oldrˇch Zmesˇkal, 1 Stanislav Nesˇpu˚rek, 1,2 Petr Toman 2 

Summary: Polymer photoelectronic device based on interaction between 

p-conjugated polymer matrices and photochromic molecules was fabricated. The 

theoretical and experimental studies proved that the photochromic reaction in 

studied devices should eventuate in changes of optical and electrical properties 

of polymers such as luminescence and conductivity. The quantum chemical calculations 

showed that the presence of dipolar species in the vicinity of a polymer chain 

modifies the on-chain site energies and consequently increases the width of the 

distribution of hopping transport states. Optical switching was studied using 

standard absorption and photoluminescence spectroscopy. A strong photoluminescence 

quenching after the photochromic conversion caused by radiative energy 

transfer was observed. The influence of photoswitchable charge carrier traps on 

charge transport were evaluated by Space Charge Limited Current (SCLC) method. It 

was shown that deep traps may significantly affect the energy of the transport level, 

and thus modulate the transport of charge carriers. 

Keywords: charge transport; conjugated polymers; quantum chemistry 

Introduction 

Polymer materials are poised as never 

before to transform the world of circuit 

and display technology. Nowadays, various 

polymers and polymer composites are used 

in xerography and laser printers, electroluminescent 

diodes and flat displays, the 

functional polymers are applied even in the 

logical circuits, which give rise to a new 

branch – ‘Plastic Logic’. Multistable molecular 

systems attract much attention 

because of their potential use in optical 

and electro-optic devices such as broadband 

optical modulators, holographic and 

image forming media, rectifiers, sensors 

and switching devices. [1–3] New polymer 

1 Faculty of Chemistry, Brno University of Technology, 

Purkyňova 118, 612 00, Brno, Czech Republic 

Fax: þ420 541 211 697 

E-mail: weiter@fch.vutbr.cz 

2 Institute of Macromolecular Chemistry, Academy of 

Sciences of the Czech Republic, Heyrovsky´ Sq. 2, 


Copyright ß 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 

materials are able not only to substitute the 

expensive crystalline semiconductors in 

these devices, but their specific properties 

originate the essentially new devices and 

technologies. 

Due to their electronic structure, 

p-conjugated polymers are one of the most 

utilized materials in organic optoelectronic 

devices. The essential property which 

comes out from conjugation is that the 

p-electrons are much more mobile than the 

s-electrons; they can jump from site to site 

between carbon atoms with a low potential 

energy barrier as compared to the ionization 

potential. The p-electron system has 

all the essential electronic features of 

organic materials: light absorption and 

emission, charge generation and transport. 

As the conductivity mechanism in these 

materials, a variable-range hopping in a 

positionaly random and energetically disordered 

system of localized states is widely 

accepted. [4,5] Over the last decades, hopping 

in random systems was extensively

Macromol. Symp. 2007, 247, 318–325 319 

studied. Among these studies, the approach 

based on so-called effective transport 

energy level was shown to be especially 

efficient. [6,7] When the effective transport 

energy is established, the variable range 

hopping problem is virtually reduced to 

trap controlled transport model. According 

to this model, the transport of charge 

carriers in molecular solids is strongly 

influenced by the presence of centres 

capable of localizing charge carriers (traps). 

It was shown that deep traps may significantly 

affect the energy of the transport 

level and mobility of charge carriers [8] and 

thus control their transport. 

The molecular photosensor suggested in 

this paper is based on the control of charge 

carrier transport in p-conjugated polymers 

by photochromic additive. In a photochromic 

molecule the absorption of a light 

quantum leads to reversible conformational 

changes and the process follows displacements 

of the optical absorption bands. 

Examples of such photochromic molecules 

utilized in optical and optoelectronic 

switches are spiropyran and spirooxazine 

derivatives. In these materials a photochromic 

transformation between low and 

high energy state is accompanied by change 

of conjugation lengths resulting in control 

of the electronic structure along the 

molecule. The photochromic conversion 

can also results in the change of the dipole 

moment of the molecule, which consequently 

act as charge trap. This feature has 

been used in the design of a special type of 

optoelectrical sensor. 

In our earlier papers [9–11] the concept of 

an electroactive molecular modulator was 

put forward. The molecular sensor should 

be based on the electronic function of a 

polymer matrix which contains photochromic 

groups able to modulate the transport 

of charge carriers. Guest molecules will in 

general have different energy levels from 

the host. In particular, if ionization energies 

and electron affinities are suitably different, 

charge carrier traps can be formed. A 

special type of traps may occur if guest 

molecules possess a permanent dipole 

moment. The dipole moment contributes 

to the field acting on surrounding molecules 

and shifts polymer transport levels. These 

dipolar traps are formed on neighbouring 

host molecules, even though the impurity 

itself does not necessarily form a chemical 

trap. For practical sensing applications, one 

can easy monitor either the steady-state or 

alternating conductivity of thin polymeric 

films prepared by low-cost manufacturing 

by common printing techniques. [12] 

In 

principle, the spectral and kinetic parameters 

of the sensor should be tuned by the 

selection of polymeric matrix and/or 

photochromic additive. The purpose of 

the present work is to examine by quantum 

chemistry modeling and experimental 

characterization the optical and electrical 

switching properties of the suggested 

sensor. For the study the p-conjugated 

photoconductive polymers poly[2-methoxy- 

5-(2 0 -ethylhexyloxy)-p-phenylenevinylene] 

(MEH-PPV) and poly[(p-phenylenevinylene)alt-(2-methoxy-5-(2 

0 -ethylhexyloxy)- p-phenylenevinylene)] 

P(MEHPV-alt-PV) doped by 

photochromic spiropyran 6-nitro- 1 0 ,3 0 ,3 0 ,trimethylspiro[2H-1-benzopyran- 

2,2 0 -indoline] 

(SP), which can be converted to a 

higher dipole moment possessing form 

referred to as (photo)merocyanine (MC), 

were used. 

Theoretical Modeling 

The presence of polar additives in the 

vicinity of a MEH-PPV chain modifies the 

polymer transport levels due to the charge–dipole 

interactions. MEH-PPV is a hole 

transporting material, hence the energy " n 

of a charge carrier located on an n-th 

repeating unit (phenylene or vinylene) is 

essentially equal to the negative of its first 

ionization potential In. For a doped polymer, 

the value of In is shifted by the sum of 

the electrostatic potentials describing the 

charge–dipole interactions of this charge 

carrier with all surrounding polar additive 

molecules. Since the positions and orientations 

of the additive with respect to the 

polymer chain are essentially random, this 

effect leads to an increase of the width s(") 


320 

Macromol. Symp. 2007, 247, 318–325 

of distribution of hopping transport states 

(energetic disorder). If point dipoles are 

assumed, s(") is proportional to the additive 

dipole moment m, i.e. sMC(")/ 

sSP(") ¼ mMC/mSP. The dipole moments of 

SP and MC forms calculated by the 

Hartree-Fock method are 5.5 and 11.9 D, 

respectively. While the value obtained for 

SP is close to reality, the dipole moment of 

MC is probably underestimated since the 

polar environment increases the zwitterionic 

character of MC. Bletz et al. [13] 

reported the dipole moment of MC measured 

in a polar environment to amount to 

15 20 D. For these reasons, one can 

expect two- or three-fold increase of the 

energetic disorder during the SP ! MC 

reaction. 

The influence of energetic disorder on 

the hole mobility was calculated by means 

of a tight-binding approximation model. 

The polymer chain is modeled by a 

sequence of N ¼ 4000 sites corresponding 

to the repeating units (phenylenes and 

vinylenes). The hole motion on such a chain 

can be described by the Hamiltonian 

H ¼ XN 

n¼1 

½"na þ n an bn;nþ1ða þ 

nþ1 an þ a þ n anþ1ÞŠ; 

where an and a þ n 

(1) 

are annihilation and 

creation operators of a hole at an n-th site, 

"n is the energy of a charge carrier localized 

at this site, and bn,n þ 1 is the transfer integral 

between the sites n and n þ 1. Both 

quantities " n and b n,n þ 1 are influenced by 

the random structure of the polymer chain 

and its surrounding. For transfer integrals 

bn,n þ 1, the random distribution suggested 

by Grozema et al. [14] was used. In order to 

get the "n distribution, randomly oriented 

additive molecules, modeled as point 

dipoles, were randomly placed in the 

vicinity of the chain. It was assumed that 

no additive molecule was placed at a 

distance shorter than 10A ˚ from the chain. 

This value was estimated from the chemical 

structures of the studied molecules. The 

concentration of the additive was taken to 

be c ¼ 4 10 4 A ˚ 3 . For each repeating 

unit, "n was calculated as a sum of In and 

Coulombic electrostatic potentials from all 

additive molecules. 

Using the Hamiltonian (1) with the 

molecular parameters "n and bn,n þ 1 and 

the hole wave function |c(t)h taken in the 

form of a linear combination of the states 

located at the individual sites, the timedependent 

Schrödinger equation was 

numerically integrated. Getting the wave 

function in the site representation, it is easy 

to calculate the frequency dependent 

intramolecular (‘‘on-chain’’) charge carrier 

mobility m(v) by the well-known Kubo 

formula [15] 

mðvÞ ¼ ev2 

2kBT Re 

2 

4 

Z 1 

0 

3 

D 2 ðtÞ expð ivtÞdt5; 

(2) 

where e is the elementary charge, kB is the 

Boltzmann constant, T is temperature, 

v ¼ 2pf is frequency of the external field, 

and D 2 (t) is the mean-square displacement 

of the hole defined by the relation 

D 2 ðtÞ ¼hcðtÞjn 2 jcðtÞil 2 ; (3) 

where l ¼ 3.35 A˚ is the inter-unit distance. 

The charge carrier mobility m(v) calculated 

for the undoped polymer chain and 

the chains doped by additives with different 

dipole moments up to 12 D are shown in 

Figure 1. For m > 12 D the mobility m(v) is 

so small that it is difficult to achieve the 

numerical stability. The presented data 

were obtained by averaging over 3000 

realizations of the transfer integral and 

energetic disorder. The results show monotonic 

decrease of m(v) with increasing m in 

the whole frequency range. The change of 

the additive dipole moment from ca. 6 D to 

12 D (corresponding to the calculated 

change of the dipole moment during the 

studied photochromic reaction) should 

result in an almost five-fold decrease of 

the on-chain mobility. The effect would be 

even more pronounced if the experimental 

value of the MC dipole moment ( 18 D, 

see ref. [13] ) is considered. 

Although our simple model is neglecting 

several other effects like dynamical fluctua- 


Macromol. Symp. 2007, 247, 318–325 321 

tions of disorder or polaron formation that 

influence the mobility values, we believe 

the calculated mobility ratio is essentially 

correct, since the photochromic mobility 

switching arises from the change of the 

levels of the static disorder. 

Experimental Part 

µ [cm 2 /Vs] 

100 

Polymer devices were manufactured as a 

sandwich cell with a dielectric multilayer. 

Samples consisted of transparent indium tin 

oxide (ITO) electrode on a glass substrate 

on to which the 15 nm thin layer of poly(2,3dihydrothieno-1,4-dioxin) 

(PEDOT) was 

spin cast from water solution to decrease 

the injection barrier for holes. Then, the 

active polymer layer, typically 150 nm 

thick, was spin coated from chloroform 

solutions of P(MEHPV-alt-PV) with 

5 30% wt. of spiropyran. To decrease 

the contact injection barrier for electrons a 

thin 10 nm layer of Alq3 (8-hydroxyquinoline, 

aluminium salt) was vacuum evaporated 

and the structure was completed by 

evaporation of aluminium top electrode 

100 nm thick. Average device area was 

3mm 2 . 

The photochromic reaction of SP was 

activated using a mercury discharge lamp 

HBO 200 with band filter (360 20) nm. 

Optical switching was studied using standard 

absorption and photoluminescence 

10 

1 

0.1 

0.01 

0.001 

m = 0 D 

m = 3 D 

m = 6 D 

m = 9 D 

m = 12 D 

0.1 1 10 100 

frequency [GHz] 

Figure 1. 

The charge carrier mobility m calculated for different additive dipole moments m. For frequencies lower than ca. 

0.5 GHz mobility is almost frequency-independent because of the diffusive charge carrier motion. 

spectroscopy (PL). The electric response 

was studied by measuring the current-voltage 

(I-V) characteristics of the samples 

in the dark with Keithley 6517A 

electrometer. 


The photochromic behaviour of spiropyran 

derivatives has been investigated by many 

researchers. [16–18] Under irradiation of an 

appropriate light energy, the spiropyran 

exhibits photochromism as shown in 

Figure 2. The photochromic reaction is 

accompanied by a charge redistribution 

resulting in a significant increase of the 

dipole moment of the molecule. 

The studied spiropyran (SP) is stable in 

its colourless closed ring isomeric form, 

while UV irradiation produces a metastable 

open ring isomer (photo)merocyanine 

(MC) absorbing at 550–600 nm. The maximum 

of the absorption band of P(MEHP- 

V-alt-PV) is situated at 455 nm, the addition 

of SP increases the absorption of the 

sample in the UV region. Since the neat SP 

do not absorb in the VIS region, the absorbance 

of the doped samples is not affected 

by the presence of the SP molecules and 

can be seen in the top part of the Figure 3. 

The basic absorption spectra of the 30% 

mixtures and their relative changes after 

1 minute illumination at 360 nm (conversion 


322 

Macromol. Symp. 2007, 247, 318–325 

C 

H 3 

CH 3 

CH 3 

N O 

Figure 2. 

Photochromism of the spiropyran molecule. 

NO2 

C 

H 3 

CH 3 

CH 3 

N O 

Figure 3. 

Top: Normalised absorbance of P(MEHPV-alt-PV) with dispersed spiropyran (full line) and its relative change 

(scattered) after 1 minute illumination at 360 nm. New absorption band coming from the (photo)merocyanine 

(MC) can be observed. Bottom: Normalised photoluminescence (PL) of the P(MEHPV-alt-PV):SP mixture (full line). 

The scattered line represents a change in the spectrum after the MC formation. Decrease in the photoluminescence 

of the polymer accompanied by the formation of new band belonging to the MC can be observed. 

The excitation wavelength used was 455 nm. The energy was therefore absorbed by the P(MEHPV-alt-PV) and 

subsequently transferred to the MC molecules. 

Copyright ß 2007 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.ms-journal.de 

NO2

of SP to MC form) are also depicted in 

Figure 3. The photoinduced colour change 

of SP is caused by the extension of 

conjugation in the MC isomer compared 

to the orthogonal structure of the SP 

form. [19] Annealing in the dark or irradiation 

with a He-Ne laser gradually restores 

the original spectrum, the change being 

reversible. 

Bottom graph of the Figure 3 shows the 

normalized photoluminescence (PL) spectra 

of P(MEHPV-alt-PV):SP mixtures and 

their relative changes after 1 minute 

illumination at 360 nm. The stable form 

of spiropyran (SP) does not show any 

luminescence contrary to its MC form. The 

polymer shows its own luminescence 

(Figure 3 bottom) and creation of MC 

form via the photochromic reaction therefore 

could result in the appearance of new 

PL bands. However, MC possesses a high 

dipole moment that generally causes 

quenching of luminescence. The quenching 

was found to be strong even in the case 

when the SP ! MC conversion was very 

weak (sometimes not observable in absorption 

spectra, typically for

324 

Macromol. Symp. 2007, 247, 318–325 

Figure 4. 

Top: the current-voltage characteristics of the ITO/ 

PEDOT/MEH-PPV:SP/Al (30% by wt.) sample before 

(&) and after ( ) the photochromic conversion of 

spiropyran molecules by irradiation of UV light. 

Decrease in the current flowing accompanied by 

the change of the shape can be clearly seen. Bottom: 

The normalised distribution of energy states on the 

shift of the Fermi level centred around the common 

trapping level DEF ¼ EF Et. The arrows depict the 

decrease of the density of traps introduced by the 

spiropyran molecules and the creation of new trapping 

level due to the formation of metastable (photo)merocyanine. 

See text for further discussion. 

mð2m 1Þðm 1ÞŠ reflects the influence of 

the second derivative of the I(V) on the total 

charge carrier concentration nsL. The h(E) 

function is called density of states (DOS) 

and can be obtained after the deconvolution 

of the integral in (4). In the case of 

gradual changes in the density of states one 

can assume that dnsL/dEF h(E). Since this 

condition is fulfilled we will use this 

simplification in further discussion. 

Figure 4 shows the influence of the 

spiropyran photochromic conversion on the 

current flowing. The top of the figure shows 

the experimental I(V) characteristic in the 

bilogarithmic scale. It can be seen that the 

current is decreased and also that the shape 

of the dependence has changed. In the first 

region (0–4 V) the slope of the two 

characteristics approaches identically to 

m ¼ 2, suggesting that the currents are 

governed by the presence of one shallow 

trapping level with concentration Nt at the 

position Et. Above this region the slope 

increases differently according to their 

respective density of energy states. 

The bottom of the Figure 4 reveals the 

distribution of the energetic levels normalised 

to the maximum of the most populated 

trapping level h(E)/N t common to both of 

the systems on the shift of the Fermi level 

DEF. It has to be noted that the thermodynamic 

Fermi level after the spiropyran 

conversion was shifted by about 0.02 eV 

towards the LUMO orbital. The figure uses 

recalculated energy axis centred on the 

common trapping level DEF ¼ EF Et, 

which is the most populated. It can be 

clearly seen that the minor trapping level 

situated at 0.06 eV under the reference E t 

was reduced after the photochromic conversion. 

On the other hand new level 

appeared at about 0.02 eV. Since this effect 

is reversible, we attribute this switching to 

the creation of the metastable (photo)merocyanine 

and extinction of spiropyran 

molecules, respectively. 

Conclusions 

The new molecular photosensor based on 

photoswitching of charge carrier mobility 

was demonstrated. The quantum chemistry 

calculations showed that the presence of 

polar additive in the vicinity of polymeric 

chain modifies its transport levels. This 

increase in the energetic disorder eventuates 

in the decrease of the hole mobility. 

The change of the additive dipole moment 


Macromol. Symp. 2007, 247, 318–325 325 

from ca. 6 D to 12 D, which corresponds to 

the studied photochromic reaction, results 

in an almost five-fold decrease of the 

on-chain mobility. The experimental behaviour 

of the system explored by means of 

SCLC method showed a change of the 

density of states in the bandgap of the 

polymer. Reversible creation of new trapping 

level during the photochromic conversion 

was observed. According to the trap 

controlled hopping model for the description 

of charge transport, the presence of 

new trapping level results in the decrease of 

the charge carrier mobility as predicted by 

the theoretical calculations. 

Furthermore, the presence of polar 

centres produced by photochromic conversion 

of the spiropyran molecules led to a 

quenching of the polymer photoluminescence 

and in the case of high concentration 

of SP (30% wt.) in a P(MEHPV-alt-PV), 

radiative energy transfer was observed. This 

is in agreement with our previous work, [20] 

where the switching was demonstrated as a 

drop of polymer photoconductivity. 

Acknowledgements: This work was supported by 

the projects 203/03/D133 and 203/06/0285 from 

the Czech Science Foundation. 

[1] L. R. Dalton, W. H. Steier, B. H. Robinson, et al., 

J. Mater. Chem. 1999, 9, 119. 

[2] K. S. West, D. P. West, M. D. Rahn, et al., J. Appl. 

Phys. 1998, 84, 5893. 

[3] R. M. Metzger, Acc. Chem. Res. 1999, 32, 950. 

[4] M. Pope, C. E. Swenberg, Electronic Processes in 

Organic Crystals and polymers, 2 nd ed.,Oxford University 

Press, Oxford, 1999. 

[5] H. Bässler, Phys. Stat. Solidi B 1993, 175, 15. 

[6] V. I. Arkhipov, E. V. Emelianova, G. J. Adriaenssens, 

Phys. Rev. B 2001, 64, 125125. 

[7] V. I. Arkhipov, P. Heremans, E. V. Emelianova, G. J. 

Adriaenssens, H. Bässler, J. Phys. Condens matter 2002, 

42, 9899 

[8] V. I. Arkhipov, J. Ryenaert, Y. D. jin, P. Heremans, 

E. V. Emelianova, G. J. Adriaenssens, H. Bässler, Synt. 

Met. 2003, 138, 209. 

[9] S. Nesˇpu˚rek, J. Sworakowski, Thin Solid Films 2001, 

393, 168. 

[10] S. Nesˇpu˚rek, P. Toman, P. J. Sworakowski, Thin 

Solid Films 2003, 438-439, 268. 

[11] S. Nesˇpu˚rek, J. Sworakowski, C. Combellas, G. 

Wang, M. Weiter, Appl. Surf. Sci. 2004, 234, 

395. 

[12] Y. Yoshioka, G. E. Jabbour, Synth Met. 2006, 

accepted. 

[13] M. Bletz, U. Pfeifer-Fukumura, U. Kolb, W. 

Baumann, J. Phys. Chem. A 2002, 106, 2232. 

[14] F. C. Grozema, P. T. van Duijnen, Y. A. Berlin, M. A. 

Ratner, L. D. A. Siebbeles, J. Phys. Chem. B 2002, 106, 

7791. 

[15] R. Kubo, J. Phys. Soc. Japan 1957, 12, 570. 

[16] E. Berman, R. E. Fox, F. D. Thomson, J. Am. Chem. 

Soc. 1959, 81, 5605. 

[17] J. P. Desvergne, H. Bouast, A. Deffieux, Mol. Cryst. 

Liq. Cryst. 1994, 246, 111. 

[18] X. Li, J. Li, Y Wang, T Matsuura, J Meng, 

J. Photochem. Photobiol. 2004, 161, 201. 

[19] J. F. Zhi, R. Baba, K. Hashimoto, A. Fujishima, 

J. Photochem. Photobiol. 1995, 92, 91. 

[20] M. Weiter, M. Vala, S. Nesˇpu˚rek, J. Sworakowski, 

O. Salyk, O. Zmesˇkal, Mol. Cryst. Liq. Cryst. 2005, 430, 

227. 

[21] M. Vala, M. Weiter, G. Rajtrová, S. Nesˇpu˚rek, P. 

Toman, J. Sworakowski, Nonlinear Optics, Quantum 

Optics: Concepts in Modern Optics, accepted. 

[22] O. Zmesˇkal, F. Schauer, S. Nesˇpu˚rek, J. Phys. C: 

Solid State Phys. 1985, 18, 1873. 

[23] F. Schauer, S. Nesˇpu˚rek, O. Zmesˇkal, J. Phys. C: 

Solid State Phys. 1986, 19, 7231. 


Polymer optical sensor based on photochromic switching of charge 

carrier mobility 

Martin Weiter a , Martin Vala ,a , Oldřich Zmeškal a , Jiří Navrátil a , Petr Toman b , Stanislav Nešpůrek a,b , , 

a Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech 

republic; 

b Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic,Heyrovský Sq. 

2, 162 06 Prague 6, Czech Republic 

ABSTRACT 

Polymer photoelectronic device based on interaction between π-conjugated polymer matrices and photochromic 

molecules was fabricated. The theoretical and experimental studies proved that the photochromic reaction in studied 

devices should eventuate in changes of optical and electrical properties of polymers such as luminescence and 

conductivity. The quantum chemical calculations showed that the presence of dipolar species in the vicinity of a polymer 

chain modifies the on-chain site energies and consequently increases the width of the distribution of hopping transport 

states. Optical switching was studied using standard absorption and photoluminescence spectroscopy. A strong 

photoluminescence quenching after the photochromic conversion caused by radiative energy transfer was observed. The 

influence of photoswitchable charge carrier traps on charge transport was evaluated by current-voltage measurement and 

by Impedance spectroscopy method. It was shown that deep traps may significantly affect energy of the transport level, 

and thus control the transport of charge carriers. Based on these findings, polymer optical sensor was proposed. 

Keywords: optical sensor, organic semiconductors, charge transport, photochromic switching 

1 INTRODUCTION 

1.1 Organic semiconductors for optical sensing applications 

Traditionally, photosensitive optoelectronic devices have been constructed of a number of inorganic semiconductors, 

e.g., crystalline, polycrystalline and amorphous silicon, gallium arsenide and others. Nowadays, after more than 15 years 

of academic and industrial research worldwide, the class of organic materials, conjugated polymers and organic 

molecular systems, has reached a very high level of outstanding material properties and the potential for different 

industrial applications is now emerging. Various polymers and molecular materials are used in organic light-emitting 

diodes (OLED) and flat organic displays equipped with organic field-effect transistors, some other foreseen applications 

including optical sensors are very close to industrial applications. Printing technology is currently enabling the 

production of these high-efficiency organic devices. Given the need for very low-cost circuits for everything from smart 

cards carrying personal information, to building entry cards, to inventory control, it is reasonable to assume that within 

10 years, the square footage of organic circuitry might exceed that of silicon electronics, though one expects that silicon 

transistors would still vastly outnumber and outperform those fabricated from organic materials [1]. 

Polymers, oligomers, dendrimers, dyes, pigments, liquid crystals, organo-mineral hybrid materials, all organic 

semiconductors share in common part of their electronic structure. It is based on conjugated π electrons. By definition, a 

conjugated system is made of an alternation between single and double bonds. The essential property which comes out 

from conjugation is that the π electrons are much more mobile than the σ electrons; they can jump from site to site 

between carbon atoms with a low potential energy barrier as compared to the ionisation potential. As π-orbitals overlap 

is weaker than σ-orbitals overlap, the energy spacing (band gap) between bounding and antibounding molecular orbitals 

is larger for the π–π ∗ difference than for the σ –σ ∗ one. One can thus, in a first approach, limit the band study to the π–π ∗ 

molecular orbitals. Those are respectively the HOMO (Highest Occupied Molecular Orbital) and LUMO (Lowest 

Unoccupied Molecular Orbital), in terms of molecular physics. There are also the usual valance (VB) and conduction 

bands (CB) terms used in semiconductor physics, respectively. 

Optical Sensing Technology and Applications, edited by 

Francesco Baldini, Jiri Homola, Robert A. Lieberman, Miroslav Miler, 

Proc. of SPIE Vol. 6585, 658519, (2007) · 0277-786X/07/$18 · doi: 10.1117/12.722907 

Proc. of SPIE Vol. 6585 658519-1

The π electron system has all the essential electronic features of organic semiconductors: light absorption and emission, 

charge generation and transport. In addition, most conjugated polymers have semiconductor band gaps of 1.5–3.5 eV, 

which means that they are ideal for optoelectronic devices such as OLEDs, light sensors and photovoltaic panels. When 

electromagnetic radiation of an appropriate energy is incident upon a semiconductive organic material, a photon can be 

absorbed to produce an excited molecular state. In organic thin-film photoconductive materials, the generated molecular 

state is generally believed to be an exciton, i.e., an electron-hole pair in a bound state, which is transported as a quasiparticle. 

Due to the low dielectric constant in organics the Coulomb interaction between the electron in the LUMO and 

the hole in the HOMO is strong and the exciton is of the Frenkel type. The binding energy of an optical excitation, Eexc, 

is a key parameter for the understanding of the opto-electronic properties of organic solids [2, 3]. It determines the 

energy of the dissociation of an exciton and the reverse process, that is, the recombination of an electron–hole pair 

yielding an excitation, which can decay either radiatively or non-radiatively. If Eexc, is large, photogeneration of charge 

carriers is an endothermic, i.e. inefficient process. Obviously, in a photovoltaic device, one would like Eexc, to be as small 

as possible, whereas in a light emitting diode (LED) it is the opposite. 

In order to produce a photocurrent, the exciton ought to dissociate into a pair of free charges. The separated charges then 

need to travel to the respective device electrodes, holes to the anode and electrodes to the cathode to provide voltage and 

be available for injection into an external circuit. The transport of charges is affected by recombination during the 

journey to the electrodes - particularly if the same material serves as transport medium for both electrons and holes. 

Also, interaction with atoms or other charges may slow down the transport speed and thereby limit the current. 

Therefore, a carrier mobility is significant property of organic semiconductors. Mobility expresses the easiness with 

which a charge carrier can move through a conducting material responding an electric field. Recent photosensitive 

devices can be distributed into three classes. Solar cells, also called photovoltaic (PV) devices, are a type of 

photosensitive optoelectronic devices that are specifically used to generate electrical power. Photoconductor cells consist 

of active layer and signal detection circuitry, which monitors the resistance of the device to detect changes due to the 

light absorption. Another type of photosensitive optoelectronic device is a photodetector. In operation, a photodetector is 

used in conjunction with a current detecting circuit, which measures the current generated when the photodetector is 

exposed to an electromagnetic radiation and may have an applied bias voltage. As a general rule, a photovoltaic cell 

provides power to a circuit, device or equipment, but does not provide a signal or current to control detection circuitry, or 

the output of information from the detection circuitry. In contrast, a photodetector or photoconductor provides a signal or 

current to control detection circuitry, or the output of information from the detection circuitry but does not provide power 

to the circuitry, device or equipment. 

1.2 Concept of molecular optical sensor 

The concept of the optical polymer sensor presented in this paper differs from the principles described above. It is based 

on the photochromic control of charge carrier transport in polymers. As the conductivity mechanism in these materials, a 

variable-range hopping in a positionaly random and energetically disordered system of localized states is widely 

accepted [4, 5]. Over the last decades, hopping in random systems was extensively studied. Among these studies, the 

approach based on so-called effective transport energy level was shown to be especially efficient [6, 7]. When the 

effective transport energy is established, the variable range hopping problem is virtually reduced to trap controlled 

transport model. According to this model, the transport of charge carriers in molecular solids is strongly influenced by 

the presence of centres capable of localizing charge carriers (traps). It was shown that deep traps may significantly affect 

the energy of the transport level and mobility of charge carriers [8] and thus control their transport. 

Proposed polymer optical sensor is based on switching of charge carrier mobility by photochromic species distributed in 

polymer matrix. Photochromic reactions, in addition to the changes in electronic spectra, are also accompanied by 

variations in refractive index, dielectric constant, enthalpy etc [9]. Moreover, the reversible changes in physical or 

chemical properties of the photochromic species can be transferred to the microenvironment and supramolecular 

structure, and thus, can induce rich modifications in the surroundings. In a molecular solid build of non-polar polarizable 

units, e.g. polymer segments, containing a small amount of polar guest species, its dipole moment contributes to the field 

acting on surrounding molecules and modifies the local values of the polarization energy. This modification can cause a 

local decrease of the ionisation energy in an otherwise perfect crystal lattice, which represents a trap for hole. Thus, the 

presence of polar species may result in production of local states (charge traps) - in their vicinity; even thus they are not 

necessarily trapping sites themselves [10], [11]. Reversible creation of such polar species can be obtained by e.g. suitable 

photochromic molecules. The induced change of electrostatic potential due to the charge-dipole interactions also shifts 

the site energies of individual polymer repeating units, and consequently the polymer transport levels are modified. Since 


the position and orientation of the additive with respect of the polymer chain are essentially random the effect results in 

broadening of the distribution of the transport states and consequently to the lowering of the charge carriers mobility. In 

the case of reversible formation and annihilation of such traps the electric charge transport can be even changed from 

space-charge limited to trap limited [12]. 

All of the effects mentioned above affect reduction of charge carrier mobility and thereby lowering of the current 

flowing through the device. The reversible transformation of the optical signal into electrical one can be thus achieved 

and optoelectronic sensor can be constructed. The purpose of the present work is to examine by quantum chemistry 

modeling and experimental characterization the optical and electrical switching properties of the suggested sensor. For 

the study the π-conjugated photoconductive polymers poly[2-methoxy-5-(2'-ethylhexyloxy)-p-phenylenevinylene] 

(MEH-PPV) doped by photochromic spiropyran 6-nitro-1',3',3',-trimethylspiro[2H-1-benzopyran-2,2'-indoline] (SP), 

which can be converted to a higher dipole moment possessing form referred to as (photo)merocyanine (MC), were used. 

2 THEORETICAL MODELING 

The polymer chain is modeled by a sequence of N=4000 sites corresponding to the repeat units (alternating phenylenes 

and vinylenes). Each site n is described by the energy εn of a hole located at this site. The hole transport between the sites 

n and m is described by the transfer integral bn,m. Because of linear character of the MEH–PPV chain and the size of the 

repeat units only the transfer integrals between the neighboring repeat units are important and the other can be neglected 

(tight-binding approximation). Thus, hole motion on such a chain can be described by the Hamiltonian 

N 

∑ 

n= 

1 

H = ε 

+ 

+ 

+ 

[ a a − b ( a a + a a ) ], 

n 

n 

n 

n, 

n+ 

1 

n+ 

1 n 

where an and an + are annihilation and creation operators of a hole at an n-th site. Both quantities εn and bn,n+1 are 

influenced by the random structure of the polymer chain and its surrounding. The energy εn is essentially equal to the 

negative of the first ionization potential of the corresponding repeat unit. Grozema et al. [14] developed a continuous 

disorder type model of the transfer integral bn,n+1 distribution, showing that the hole mobility in a pure MEH–PPV is 

limited by the torsional disorder. We assume that the influence of the additives on the electronic coupling between the 

polymer repeat units is small in comparison with the electrostatic charge–dipole interaction modulating the site energies 

εn. Hence, we have used in our model the same distribution of the transfer integrals bn,n+1 as Grozema et al. also for the 

description of the hole transport on MEH–PPV chain influenced by polar additives. 

Polar species in the polymer chain vicinity modify the on-chain electrostatic potential due to the charge–dipole 

interactions between a hole moving on the chain and dipole moments of individual additive molecules dispersed in the 

polymer (see Fig. 1). It is easy to show that the sum of these electrostatic potential changes shifts the hole site energies εn 

by the value < ∑ ∆ φi|HOMO 

> , where ∆φi are the changes of the electrostatic potential describing the charge– 

HOMO| i 

dipole interactions of a charge carrier localized at |HOMO> with all surrounding polar additive molecules. The change 

of the shape of the highest molecular orbital |HOMO> of the corresponding repeat unit induced by the additive is 

neglected (frozen orbital approximation) [15]. Since the positions and orientations of the additive molecules with respect 

to the polymer chain are essentially random, the effect results in broadening of the distribution of transport states. The 

most important parameter of this distribution is its half-width σ(εn). 

In order to model the charge–dipole interactions, randomly oriented additive molecules, represented by point dipoles, 

were randomly placed in the vicinity of the chain. It was assumed that no additive molecule was placed at a distance 

shorter than 10 Å from the chain (this value was estimated from the chemical structures of MEH-PPV and SP/MR). On 

the other hand, the influence of the additive molecules distant more than 50 Å from the polymer chain was neglected. 

The additive molecules were placed also beyond the chain ends in order to ensure the homogeneity of the εn distribution 

along the whole chain. The concentration of the additive was taken to be c = 4 × 10 -4 Å -3 . For each center representing a 

repeat unit, the energetic disorder was calculated as a sum of Coulombic electrostatic potentials from all additive 

molecules. With regard to the value of the minimal distance of an additive molecule from the chain the size of the 

polymer repeat units was neglected. The energetic disorder of εn was calculated according to the above-described model 

for several values of the dipole moment of the additive m. The resulting εn distribution is a Gaussian-type distribution 

with a high site to site εn correlation. For a typical value of m = 12 D the half-width σ(εn) = 0.37 eV. If the mutual 

interaction of the additive molecules is neglected, the half-width σ(εn) is proportional to the dipole moment m of the 

n 

n+ 

1 

Proc. of SPIE Vol. 6585 658519-3 

(1)

additive and to the square root of the additive concentration c . The εn values show a strong correlation between up to 

about 10 th nearest neighboring sites. The correlation coefficient between the nearest neighbor εn values is 0.97. This fact 

can be explained by the long-range character of the charge–dipole interactions and the size of the MEH–PPV 

substituents hindering from close contact between additive molecules and the main chain. 

∆φ [eV] 

0.5 

0.4 

0.3 

0.2 

0.1 

-2 -1 0 

Repeat unit 

1 2 

Fig. 1. The change of the on-chain electrostatic potential of a MEH–PPV chain caused by one individual additive molecule 

(MR) in a particular position. 

The dipole moments of SP and MR forms calculated by the Hartree-Fock method are 5.5 and 11.9 D, respectively. These 

values suggest that the SP → MR reaction results in approximately doubling the energetic disorder. Moreover, one 

should take into account that, while the value obtained for SP is close to reality, the dipole moment of MR is probably 

underestimated since the polar environment increases the zwitterionic character of MR. Bletz et al. [16] reported the 

dipole moment of MR measured in a polar environment to amount to 15÷20 D. Thus the real switching effect may be 

more effective than that estimated using the calculated values. 

Using the Hamiltonian (1) with the calculated molecular parameters εn and βn,n+1 and the hole wave function |ψ(t)〉 taken 

in the site representation 

ψ 

( t) 

c( 

t) 

n , 

= ∑ 

n= 

1 

where |n> is the state located on n-th site, the time-dependent Schrödinger equation 

∂ 

ih ψ () t = H ψ () t 

(3) 

∂t 


(2)

was numerically integrated. At t = 0, the hole was assumed localized on a single unit in the middle of the chain. 

Obtaining the wave function, one may calculate the mean-square displacement ∆ 2 (t) of the charge carrier defined by the 

relation 

2 

2 

() t = ψ ( t) 

n ψ ( t) 

d 

2 

∆ , (4) 

where d = 3.35 Å is the inter-unit distance. The calculated data were averaged over 3000 Monte Carlo realizations of the 

Hamiltonian (1) in order to achieve numerical stability. According to fluctuation–dissipation theorem, this quantity is 

related to the frequency dependent intramolecular hole mobility µ(ω) by the Kubo formula [17] 

2 ∞ 

− eω 

⎡ 

⎤ 

µ , (5) 

2 

( ω ) = Re⎢∫ 

∆ ( t) 

exp( −iωt) 

dt⎥ 

2k 

BT 

⎣ 0 

⎦ 

where e is the elementary charge, kB is the Boltzmann constant, and T is temperature. 

The hole on-chain mobilities µ(ω), calculated for different values of the additive dipole moments, are shown in Fig. 2. 

All curves exhibit a saturation of µ(ω) at low frequencies corresponding to the diffusive charge carrier motion in the 

long-time limit (t > 25 ps), and a rapid increase for higher frequencies related to the fast initial hole delocalization 

(t < 10 ps). This increase is mainly induced by the effective reduction of the number of disordered sites visited by a 

charge carrier during its oscillations induced by the electric filed. In both regions, the mobility decreases with the 

increasing additive dipole moment. It follows from Fig. 2 that the change of the additive dipole moment from ca. 6 D to 

12 D (corresponding to the calculated change of the dipole moment during the photochromic reaction SP ↔ MR) should 

result in an about five-fold decrease of the on-chain mobility. The effect would be even more pronounced if the 

experimental value of the MR dipole moment (≈18 D [16]) is considered. 

mobility [cm 2 /Vs] 

1000 

100 

10 

1 

0.1 

0.01 

no additive (0 D) 

SP (6 D) 

MR (12 D) 

0.001 

0.1 1 10 100 1000 

frequency [GHz] 

Fig. 2. The calculated frequency-dependent mobility for different additive dipole moments. The additive concentration was 

c = 4 × 10 -4 Å -3 . 

It should be noted that the results may be influenced by several other effects not taken into account by our model, namely 

dynamical fluctuations of both types of disorder and polaron formation. While the former effect results in a thermally 

activated diffusive charge carrier motion, the latter one increases charge localization. We assumed an ideal chemical 

structure, but the presence of polymerization defects decreases the on-chain mobility. The effect of the substituents was 

considered only in the modeling of the energetic disorder arising from the charge – additive dipole interaction. However, 

the presence of substituents has some influence also on the torsional and energetic disorder of undoped polymer chains. 

These phenomena will alter the mobility values but they should not significantly alter the mobility ratio since the 

photochromic mobility switching arises from the change of the levels of the static disorder. 


3 EXPERIMENTAL 

Polymer devices were manufactured as a sandwich cell with a dielectric layer of MEH-PPV (poly[2-methoxy-5-(2'ethylhexyloxy)-p-phenylenevinylene]) 

containing 0-30% wt. of admixed spiropyrane (6-nitro-1',3',3',-trimethylspiro[2H- 

1-benzopyran-2,2'-indoline]). The device and material structure is depicted in Fig. 3 and Fig. 4, respectively. The active 

polymer layer was spin coated from chloroform solutions on transparent indium tin oxide (ITO) electrode covering part 

of the glass substrate. The thickness of the active layer was about 150 nm. The structure was completed by evaporation 

of aluminium top electrode typically 100 nm thick. Average electrode area that delimitate the active area of the device 

was 3 mm 2 . The same solutions of active materials were spin cast on quartz substrates for optical measurements. The 

photochromic reaction of spiropyrane was activated using a Nd:YAG laser with third harmonic generation at 355 nm in 

order to measure the irradiation of the sample precisely. Optical switching was studied using standard absorption and 

photoluminescence spectroscopy (PL). The electric response was studied by measuring the current-voltage j(V) 

characteristics of the samples in the dark with Keithley 6517A electrometer. Dielectric properties were studied using a 

Hewlett Packard 4192A impedance analyzer. The measurements were performed in vacuum cryostat at room 

temperature. 

+ 

External 

Circuit 

Al 

Organic Film 

ITO 

Glass Substrate 

Incident Light 

Fig. 3. Schematic structure the devices used for characterization. 

4 RESULTS AND DISCUSSION 

4.1 Optical switchning 

Under irradiation of an appropriate light energy, the spiropyran exhibits photochromism as shown in Fig. 4. The 

photochromic reaction is accompanied by a charge redistribution resulting in a significant increase of the dipole moment 

of the molecule. The studied spiropyran (SP) is stable in its colourless closed ring isomeric form, while UV irradiation 

produces a metastable open ring isomer merocyanine (MC) absorbing at 550-600 nm. The maximum of absorption band 

of MEH-PPV is situated at 445 nm, the addition of SP increases the absorption of the sample in the UV region as shown 

in Fig.4. After irradiation with UV light the spectra exhibit a significant absorption band at 590 nm caused by the colored 

merocyanine form. Annealing in dark or irradiation with a red light gradually restores the original spectrum, the change 

is fully reversible. 

A strong photoluminescence (PL) quenching after the photochromic conversion caused by radiative energy transfer was 

observed as figured in Fig. 5. The stable form of spiropyran does not show any luminescence contrary to its MC form. 

MEH-PPV show their own luminescence and creation of MC form via the photochromic reaction therefore could result 

in the appearance of new PL bands. However, MC possesses a high dipole moment which generally causes a quenching 

of luminescence. The quenching was found to be strong even in the case when the SP → MC conversion was very weak, 

even not observable in absorption spectra. Furthermore the PL of MC could be triggered through the polymer excitation. 

This means that the energy absorbed by polymer (donor) is transferred to MC molecules (acceptor). According to the 

Forster-Dexter theory the dipole-dipole energy transfer probability is, among other, related to the overlap of donor 

emission and acceptor absorption. After the reverse (MC → SP) reaction was completed, the polymer PL was recovered, 

the reversibility of the process was, however, influenced by photodegradation of the polymer matrix. 


- 

External 

Circuit

Absorbance (a.u.) 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

spiropyran (SP) merocyanine (MC) 

MEH-PPV+SP 

MEH-PPV+MC 

MEH-PPV 

) CH3 n 

0.0 

200 300 400 500 600 700 

C 

H 3 


Fig. 4. The photochromic reaction of the spiropyran (SP) into (photo)merocyanine (MC) manifests itself as color change of 

the system. The dotted line shows the UV-VIS absorbance spectrum of MEH-PPV polymeric matrix. Full line 

represents the absorbance spectrum of MEH-PPV:SP mixture. The spectrum after the photochromic conversion (dashed 

line) shows distinct appearance of a band peaking at 590 nm. The insets show the chemical formulas and the 

photochromic reaction of the materials used. The R 1 stands for methyl and the R 2 for 2-ethylhexyl. 

photoluminiscence (arb. u.) 

6 

5 

4 

3 

2 

1 

0 

( 

OR 1 

OR 2 

MEH-PPV 

450 500 550 600 650 700 750 


MEH-PPV:SP 

MEH-PPV:MC 

Fig. 5. The full line represents photoluminescence spectrum of the MEH-PPV:SP thin layer. The spectrum after the 

photochromic conversion changes as can bee seen from the dotted line. 


As was described above, the operation of the proposed sensor is based on incidence of merocyanine, which influence the 

charge transport in MEH-PPV matrix. Therefore the samples with different concentration of spiropyrane were prepared. 

For precise study of the sensitivity, the samples were irradiated by Nd:YAG laser pulses at 355 nm, each laser pulse 

represents a dose of 1.5·10 14 photons. The changes of the merocyanine concentration were determined after irradiation 

following the absorbance at λmax=590 nm. The situation is depicted in Fig. 6 for samples with 10%, 20% and 30% 

concentration of SP. The results show that the absorbance is proportional to SP/MC concentration and exponentially 

follows the irradiation dose, which is demonstrated by linear slope of the dependency in logarithmic scale of x-axes. At 

high irradiation dose, the concentration of merocyanine tends to saturate, as demonstrated in the inset of the Figure. 

Since each one MC molecule poses potential charge trap, the sensitivity of the sensor thus can be designated by its 

concentration. Thus, the optical and electronic properties of studied sensor can be related. The relationship between 

optical and electrical properties of proposed sensor will be described hereafter. 

∆ Absorbance 

0.20 

0.15 

0.10 

0.05 

0.00 


0,15 

0,10 

0,05 

10 % 

20 % 

30 % 

0 100 200 300 400 500 

Number of pulses 

100 


10% 

20% 

30% 

Fig. 6. The dependence of the MEH-PPV:SP samples absorption monitored at 590 nm on the light dose represented by 

number of NdYAG laser pulses at 355 nm. Each pulse represents dose of 1.5·10 14 photons. 

4.2 Current-voltage measurements 

The photoswitching of charge carrier mobility was studied by standard current-voltage j(V) measurement. The results for 

typical devices are shown as log-log plot in Fig. 7 and Fig. 8. The variation of the current with increasing irradiation dose 

is depicted in Fig. 7for sample doped by 20% of spiropyrane, whereas the variation of the current at the irradiation dose 

corresponding to the merocyanine concentration saturation for different spiropyrane concentration is shown in Fig. 8. In 

organic thin film devices the current is typically contact limited in low field region, whereas at higher field region spacecharge 

or charge-trap limited conductivity are commonly accepted [18]. The results show this behavior. At low forwardbias 

voltages below 7-10 V the increase of j with V is relatively small, whereas in the higher field region the slope of the 

dependence is more pronounced, which is in accordance with Space-charge limited current (SCLC) theory. This theory 

proposes that the space charge which limits conduction is stored in the traps. In the case of energetically discrete trapping 

level, the SCL current can be expressed as 

j SCL 

2 

9 V 

= εε 0µθ 

, 

(7) 

3 

8 L 

where , ε and ε0 is the relative permitivity and permitivity of vacuum, µ is the charge carrier mobility, V is the applied 

voltage, L is the electrode distance and θ is the ratio of free to total charge carriers. 


Current (A) 

10 -4 

10 -5 

10 -6 

10 -7 

10 -8 

10 -9 

0% 

2% 

5% 

10% 

2 4 6 8 10 12 14 

Voltage (V) 

Fig. 7. Current-voltage- characteristics for various concentration of spiropyran after the photochromic conversion induced 

by high photon dose corresponding to the merocyanine absorbance saturation. 

Current (A) 

10 -4 

10 -6 

10 -8 


0,14 

0,12 

0,10 

0,08 

0,06 

0,04 

0,02 

0,00 

0 100 200 300 400 500 


10 

1 10 

-10 

Voltage (V) 

Fig. 8. Current-voltage characteristics of the 20 % mixture of the MEH-PPV:SP for different light dose. The dose chosen 

can be seen in the inset depicting the absorbance change. The selected numbers of pulses are highlighted. 


0 

50 

100 

200 

400

However, in cases of practical interest traps are usually distributed in energy. In that case traps will be filled from the 

bottom to the top of the distribution as applied electric field increases. This is equivalent to an upward-shift in the quasi- 

Fermi level with electric field. As a consequence, θ increases with electric field and the j(V) characteristics becomes 

steeper. In terms of present work, the distribution of charge traps describes those induced by spiropyrane to merocyanine 

photochromic conversion. The presence of distribution of traps opens additional pathways to the relaxation of charge 

carriers towards steeper states. A zero order analytic description of the effect can be based on the Hoesterey and Letson 

formalism [19]. The latter is premised on the argument that the carrier mobility in a system with relative trap 

concentration c is the product of the mobility in the trap-free system µ0 multiplied by trapping factor: 

⎡ ⎛ Et 

⎞⎤ 

µ ( c) 

= µ 0 ⎢1 

+ c exp⎜ 

⎟⎥ 

, 

(8) 

⎣ ⎝ kT ⎠⎦ 

where Et is the energy of trapping level, k is the Boltzmann constant and T is the temperature. Consequently, the current 

flowing in a sample with enhanced number of trap states will be less than in sample without traps. 

Figures 7 and 8 prove this notion. Figure 7 shows the decrease of the current with increasing photon dose demonstrated 

by number of laser pulses. As the merocyanine concentration increase exponentially with photon dose and tends to 

saturate at high irradiation (see Fig. 6), the decrease of the current limits by about two orders of magnitude. 

Complementary, Fig. 8 shows the decrease of the photocurrent with increasing concentration of spiropyrane at the 

irradiation dose corresponding to the merocyanine absorbance saturation (see Fig. 6. for details). In both cases the 

decrease is fully reversible after thermal fading in the dark or irradiation with a red light. The essential message of 

Figures 7 and 8 is that the current thorough the irradiated device is significantly lowered by the presence of polar charge 

traps caused by photochromic conversion of spiropyrane to merocyanine. In another words the presence of traps lowers 

the mobility of charge carriers as expected from theoretical calculations. 

4.3 Impedance analysis 

To provide better insight into studied phenomena the real and complex part of the impedance ZRe and ZIm were recorded 

at test frequencies between 10 and 5·10 6 Hz. The measured data were analyzed in the form of Cole-Cole diagram (Real 

part of Z vs. imaginary part of Z) wherein the frequency increases from right to left. The variations of ZIm with ZRe as a 

function of photon dose at constant bias of 5 V for the device with 20% of spiropyrane are shown in Fig. 9. 

Z Im (Ω) 

2x10 6 

1x10 6 

0 

0 

50 

100 

200 

400 

0 1x10 6 

2x10 6 

Z Re (Ω) 

Fig. 9. Cole-cole plot of the 20 % mixture of the MEH-PPV:SP before (0 pulses) and after the photochromic conversion for 

four light doses (50, 100, 200, 400 laser pulses). 

−1 

3x10 6 


4x10 6 

5x10 6

All the ZIm versus ZRe dependency shows a single semicircle which increases in size with increasing photon dose. This 

single semicircle could be fitted very well to a parallel combination of bulk resistance Rp and capacitance Cp in series 

with a resistance Rs, which is probably caused by the Ohmic contact at hole injecting ITO/MEH-PPV interface. From 

Fig. 9 the bulk parallel resistance can be evaluated as the virtual intercept point of each Cole-Cole plot with ZRe axis. 

Following this evaluation, Fig. 9 clearly demonstrates the increasing parallel resistance of the sample with increasing 

photon dose, which is in accordance with previous results. The comparison of data obtained by impedance analysis and 

steady-state j(V) characterization is depicted in Fig. 10 for samples doped by 20%.of spiropyrane after irradiation. Herein 

the results are related to the absorption of the samples at 590 nm, which is proportional to merocyanine concentration as 

was described above. In this figure the left y-axis represents the relative increase of the parallel resistance obtained by 

impedance analysis, whereas the reverse value of the relative decrease of the current evaluated form the j(V) 

characteristics is marked on right y-axis. It is shown that the dependencies which manifest the influence of merocyanine 

charge traps on the charge transport in MEH-PPV matrix are both almost linear. 

R i /R 0 

7 

6 

5 

4 

3 

2 

1 

0 

paralel resistance change 

current change 

0,04 0,06 0,08 0,10 0,12 


Fig. 10. The dependence of ratio of parallel resistance after the photochromic conversion to the value before conversion on 

the change of absorbance (left y-axis) and the ratio of the current before the photochromic conversion and after for 

different light dose (50, 100, 200, 400 laser pulses) at 4.2 V of the 20% mixture of the MEH-PPV:SP. 

5 CONCLUSIONS 

The new molecular photosensor based on photoswitching of charge carrier mobility was demonstrated. The quantum 

chemistry calculations showed that the presence of polar additive in the vicinity of polymeric chain modifies its transport 

levels. This increase in the energetic disorder eventuates in the decrease of the hole mobility. The change of the additive 

dipole moment from ca. 6 D to 12 D, which corresponds to the studied photochromic reaction, results in an almost fivefold 

decrease of the on-chain mobility. The experimental behaviour of the system explored by means of current-voltage 

characterization showed a significant decrease of the current thorough the sample after irradiation. The current decrease 

is proportional either to the concentration of spiropyrane in the sample or to the irradiation dose. The increase of parallel 

resistance of the sample with irradiation dose obtained by impedance analysis confirms this outcome. According to the 

trap controlled hopping model for the description of charge transport it was stated that the presence of new trapping level 

results in the decrease of the charge carrier mobility and thereby lowering the current as predicted by the theoretical 

calculations. 


18 

16 

14 

12 

10 

8 

6 

4 

2 

0 

I 0 /I i

6 ACKNOWLEDGMENTS 

This work was supported by project KAN401770651 from The Academy of Sciences of the Czech Republic, project 

203/06/0285 from the Czech Science Foundation, and by project No. 0021630501 from Ministry of Education, Youth 

and Sports. A possibility of using computer time in MetaCenter (Prague and Brno) is gratefully acknowledged. 

REFERENCES 

1. P. Harrop, R. Das, Organic Electronics: Forecasts, Players & Opportunities 2005-2025, IDtechEx, New 

York, 2005. 

2. A. J. Heeger, in: N. S. Sariciffci, (Ed.), Primary Photoexcitations in Conjugated Polymers: Molecular Excitons 

Versus Semiconductor Band Model, World Scientific, Singapore, 1997. 

3. H. Baessler, in: N.S. Sariciftci (Ed.), Primary Photoexcitations in Conjugated Polymers: Molecular Excitons 

Versus Semiconductor Band Model, World Scientific, Singapore, 1997. 

4. M. Pope, C. E. Swenberg, Electronic Processes in Organic Crystals and polymers, 2nd ed., Oxford University 


5. H. Bässler, Phys. Stat. Solidi B 15,175 (1993). 

6. V. I. Arkhipov, E. V. Emelianova, G. J. Adriaenssens, Phys. Rev. B 64, 125125, (2001). 

7. V. I. Arkhipov, P. Heremans, E. V. Emelianova, G. J. Adriaenssens, H. Bässler, J. Phys.: Condens matter 42, 9899 

(2002). 

8. V. I. Arkhipov, J. Ryenaert, Y. D. Jin, P. Heremans, E. V. Emelianova, G. J. Adriaenssens, H. Bässler, Synt. Met. 

138, 209, (2003). 

9. H. Durr, H. Bouas-Laurent, (eds.) Photochromism: molecules and systems, Elsevier, Amsterdam, 2003. 

10. S. Nešpůrek, J Sworakowski, Thin Solid Films 393, 168 (2001). 

11. M. Weiter, M. Vala, S. Nešpůrek, J. Sworakowski, O. Salyk, O. Zmeškal, Mol. Cryst. Liq. Cryst. 430, 227 (2005). 

12. P. Anderson, N. D. Robinson, M. Berggren, Adv. Matter. 17, 1798 (2005). 

13. T. Tsuioka, H. Kondo, Appl. Phys. Lett. 83, 937 (2003). 

14. F. C. Grozema, P. T. van Duijnen, Y. A. Berlin, M. A. Ratner, L. D. A., Siebbeles, J. Phys. Chem. B 106, 7791, 

(2002) 

15. P. Toman, W. Bartkowiak, S. Nešpůrek, J. Sworakowski, R. Zaleśny, Chem. Phys. 316, 267 (2005). 

16. M. Bletz, U. Pfeifer-Fukumura, U. Kolb, W. Baumann, J. Phys. Chem. A 106, 2232, (2002). 

17. R. Kubo, J. Phys. Soc. Japan 12, 570 (1957). 

18. P. W. M. Blom, M. J. M. deJong, J. J. M. Vleggaar, Apl. Phys. Lett. 68, 3308 (1996). 

19. D. C. Hoesterey, G. M . Letson, J. Phys. Solids 24, 1609 (1963). 

Proc. of SPIE Vol. 6585 658519-12

Space-charge-limited currents: An E-infinity 

Cantorian approach 

Oldrich Zmeskal a, *, Stanislav Nespurek a,b , Martin Weiter a 

a Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech Republic 

b Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovsky Sq. 2, 162 06 Prague 6, Czech Republic 

Abstract 

Accepted 31 March 2006 

The theory of space-charge-limited currents for trap-free insulator, insulator with single trap level and exponential 

trap distribution in energy is presented using fractal analysis. It is shown that independent of the electrode configuration 

it is possible to write a general equation for current–voltage characteristic changing only the parameter of fractal dimension. 

On the basis of cylindrical electrode configuration the expression for the current–voltage dependence on the surface 

gap sample was derived. 




The knowledge of parameters of local states existing in all real dielectrics and wide band-gap semiconductors, e.g., 

their densities, energetic and spatial distributions and cross-section, is a crucial requirement in characterization of the 

transport and storage of charge carriers in low-conductivity materials. Various methods [1–10] have been employed to 

study the localization (‘‘trapping’’) of charge carriers and the parameters of traps. Until the mid-seventies, the determination 

of parameters of local states was considered to be largely of pure academic interest. The number of papers dealing 

with the problem has increased rapidly due to the growing demand for reliable methods for characterization of local 

states in amorphous and polycrystalline semiconductors (cf., e.g., Ref. [11] and references therein). In practice, it is 

impossible to determine all trapping parameters from measurements using a simple method. Thus a complex characterization 

requires that several methods be employed independently. Among the methods commonly used to study 

the parameters of local states, the technique of space-charge-limited (SCL) currents occupies a prominent place. Both 

steady-state and transient SCL currents have been studied by several authors for over 30 years (cf., e.g., Refs. [1,3] and 

literature therein). 

The forms of the equations describing SCL currents strongly depend on the electrode configuration. Many authors 

presented different equations for SCL currents in different devices with various electrode shapes. At present, there is a 

strong interest in the construction of thin film (TF) field-effect transistors (FET), where the surface (gap) electrode configuration 

is important, and solar cells are based on the sandwich type structures. The spectroscopic character of SCL 


* Corresponding author. Tel.: +420 541 149 406; fax: +420 541 211 697. 

E-mail address: zmeskal@fch.vutbr.cz (O. Zmeskal). 

0960-0779/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. 

doi:10.1016/j.chaos.2006.04.006 

www.elsevier.com/locate/chaos


current–voltage characteristics [12–21] allows determination of the electronic structure of local states and therefore to 

get some details concerning charge carrier transport. However, for the surface electrode configuration (FET) the theory 

of SCL currents is not fully developed. Stöckmann [22] first derived a simplified equation for surface SCL currents; later 

on this equation was modified with more precision for three different electrode configurations [24]. As the theory of SCL 

currents and their thermomodulated (TM) spectroscopic version were developed for sandwich sample configuration, it 

would be useful to find transformations of these relations for the cases of surface samples, i.e. FET structures, and generally 

also for other different shapes of electrodes. In this paper an attempt is made to find a general SCL current equation 

independent of the electrode configuration using E-Infinity theory [25–27]. 

2. Ohmic current 

2.1. Classical approach 

Let us consider a planar sample of a homogeneous wide band-gap semiconductor or insulator devoid of any local 

states. According to the commonly accepted band model, the concentration of thermally generated electrons can be 

described within the Boltzmann statistics (cf. Fig. 1) 

nf0 ¼ N c exp Ec0 EF0 

: ð1Þ 

kT 

Here, Nc is the effective density of states in the band (density of extended states), Ec0 is the energy of the band edge in 

an isolated sample and EF0 is the energy of the ‘‘thermodynamic’’ Fermi level; both energies are measured with respect 

to an external reference level (vacuum level, in this case), k is the Boltzmann constant and T is temperature. Note that at 

equilibrium, nf0, Ec0 and EF0 are all constant within the sample. The electric current should therefore obey the wellknown 

Ohm’s law 

I X ¼ elnf0F LA ¼ jXA; ð2Þ 

where e = 1.602 · 10 19 C is the unit (elementary) charge, l is the charge carrier mobility, FL is the electric field 

strength, A is the sample area and jX = elnf0FL is the current density. Generally, the electric field strength strongly depends 

on electrode configuration, shape and sample dimensions. Thus, for the special cases of the sample configuration 

the term for electric field must be modified. To write one expression for the electric field of samples of various geometries, 

it seems to be of advantage to use a fractal analysis. 


Fig. 1. Energy diagram of a molecular solid: A g is the electron affinity of the molecule, A s is the electron affinity of the solid and P e is 

the polarisation energy of the solid by electron; Ig is the ionisation energy of the molecule, Ic is the ionisation energy of the solid and Ph 

is the polarisation energy of the solid by hole; other symbols are explained in the text.

Eq. (2) presents a general current equation for three electrode configurations given in Fig. 2, where A is the area of 

the anode. Thus, for the case 

(A) plane-parallel geometry (cross-section area is A = Z · W, where Z and W are sizes of rectangle electrode), the 

current is I = ZWj, 

(B) cylindrical geometry (A =2pLW, where W is the length and L is the diameter of the cylinder – electrode distance), 

the current is I =2pLWj, 

(C) spherical geometry (A =4pL 2 ) the current is I =4pL 2 j. 

The electric field must be determined independently for each case. 

2.2. Fractal approach 


Fig. 2. Current flow geometry: (A) plane-parallel, (B) cylindrical, (C) spherical and their fractal dimensions D for (a) Ohmic regime, 

(b) monoenergetic space charge regime, (c) real space charge regime with exponential distribution of localized states in energy, 

l is the distribution parameter. See text for details. 

The density distribution of a fractal physical quantity q(r) based on fractals [28] and Elnaschie’s E-Infinity Cantorian 

space time theory [26] can be written in the form [29,30] 

qðrÞ ¼Kr D E ¼ NðrÞ 

; ð3Þ 

rE where E is the Euclidean dimension, N(r) is the count of coverings of radius r by an elementary quantity, K is the fractal 

measure and D is the fractal dimension. Thus, for the electric charge density one can write 

qeðrÞ ¼eqðrÞ ¼eKr D E ; ð4Þ 

where K is the number of elementary electric charge in unit volume (r = 1). Using Eq. (4) we can calculate the overall 

charge Q(r) as 

Z 

Z 

QðrÞ ¼ qe dV ¼ eKr 

V 

r 

D E dðr E Þ¼eK ErD 

; ð5Þ 

D 

where dV * =d(r E ) is an elementary volume in E-dimensional space. 

The mean value of the density of the electric charge characterizes the change of the electric field over size r. Thus, we 

will be using the Gauss–Ostrogradsky law 

divF ¼ qeðrÞ ; ð6Þ 

e0er 

where e0er is the permittivity of the material (e0 = 8.854 · 10 12 Fm 1 is the electric permittivity of vacuum). 


The vector F(r) defines the intensity of the electric field using the scalar qe(r). The radial component of the intensity 

Fr (when the field is point-symmetric) can be written as 

D 

D dF r 

E þ 1 dr ¼ qeðrÞ : 

e0er 

ð7Þ 

The electric field F and the potential V are related by the expression 

F ¼ gradV ; ð8Þ


Table 1 

Parameters of fractal structures for various marginal conditions 

Q(r)= qe(r)= Fr(r)= Vr(r)= eK ErD 

E D 

D eKr 

eKr D 

eK[E(D E +2)r D 

K * = K/(e 0e r). 

so that both quantities can be determined by the density qe(r) distribution 

DV ¼ divF ¼ qeðrÞ ; ð9Þ 

e0er 

where D is the Laplace operator. This equation can be rewritten for the radial distribution of the density of physical field 

qe(r) as 

D 

D d 

E þ 1 

2 V r 

dr2 ¼ qeðrÞ : 

e0er 

ð10Þ 

From the density qe(r) we can determine the radial electric field strength Fr and the corresponding potential Vr in the 

forms 

F r ¼ eK D Eþ1 r 

e0er D ; V r ¼ eK D r 

e0er DðD 

Eþ2 

: 

E þ 2Þ 

ð11Þ 

The applied voltage is represented by the quantity e/e0er. From Eq. (11) follows the relation 

F r ¼ ðD E þ 2ÞV r=r: ð12Þ 

Table 1 summarizes the parameters of fractal structures for various marginal conditions, Table 2 gives fractal dimensions 

in E-dimensional space under various electrode configurations (Euclidean dimensions). The fractal dimensions for 

various electrode configurations are summarized in Fig. 2. Thus, for our planar sample and Ohmic current, one finds 

E = 1 (one-dimensional line of force multiplied by sample area) and D = E 

regard to the zero potential point can be written as 

1 = 0. The lateral electric field (12) with 

F L ¼ðV0 V LÞ=L ¼ U L=L; ð13Þ 

where L is the electrode distance and UL is the applied voltage. 

3. Space-charge-limited currents (SCLC) 

3.1. Classical approach 


It should be realized that the situation described above is seldom met in real insulators and wide band-gap semiconductors 

where the concentration of thermally generated carriers (nf0) is small. In many cases, most carriers come from 

external sources, i.e., they are injected from suitable contacts or are, e.g., generated by photons of suitable energy. The 

efficient injection of charge carriers needs an ‘‘injecting’’ contact, i.e., a contact which allows increasing the bulk carrier 

concentration (n f(x)>n f0). This contact, the so-called ‘‘Ohmic’’ contact, does not limit the current density in the sample. 

This condition is normally formulated by setting 

eK 

E DrD eK E eK 

eK[D(D E + 2)]r 

D E 

rD Eþ1 

D eK 

rD Eþ1 

E eK 

eK * (D E +2)r 

D E+1 

rD Eþ2 

D Eþ2 

rD Eþ2 

EðD Eþ2Þ 

eK * D E+2 

r 

Table 2 

Notable fractal dimension in E-dimensional space 

D E =3 

0 D =0 Q = const. Point charge (quantity) 

E 2 D =1 Vr = const. Equipotential field (of fractal structure) 

E 1 D =2 Er = const. Homogenous intensity of field (of fractal structure) 

E D =3 qe = const. Homogenous density of charge (fractal structure)

nfð0Þ !1 and; consequently; F ð0Þ ¼0: ð14Þ 

In this case the contact can act as a reservoir of carriers. With Ohmic contact, the current–voltage relationship 

should be superlinear; its course depends on many factors as will be shown below. Suppose that the sample is contacted 

with a planar electrode. The metal is characterized by its work function / e – energy difference between the 

Fermi level of the electrons in the metal EFM and the vacuum level (Fig. 3). In the sample, the Fermi level EF0 is 

located within the energy band-gap (except for the degenerate condition of extrinsic semiconductors) and the work 

function / s is defined similarly as in the metal. When an electric contact is formed between the electrode and the 

insulator, electron transfer by diffusion takes place and, as a rule, a contact potential barrier is formed, D/ = 

/s /e. The thermal equilibrium is achieved when the energy of the Fermi level (measured again with respect to 

an external reference level) is constant over the whole system. This in turn means that the concentration of carriers 

in sample (and, consequently, the energy difference between the band edge and the Fermi level) should change. Of 

particular interest is the situation where either /e /s or /e /s. In the former case, the concentration of holes at 

the interface is much greater than in the sample bulk, hence a reservoir of excess holes is formed near the interface. 

In the latter case, shown schematically in Fig. 3b, a space charge of excess electrons is built up in the interface region 

(space-charge region) which may now serve as a reservoir of injected electrons (in subsequent discussion, we shall 

limit ourselves to the case of electron injection only). It should be noted that the energy of the band edge and hence 

the concentration of free carriers are now position-dependent (the positive direction pointing towards increasing carrier 

energy, i.e. towards the band-gap in the case of electron injection; the vacuum level is taken as zero reference 

level). Thus, for free charge carrier concentration, we can write (cf. Eq. (1)) 

nfðxÞ ¼N c exp EcðxÞ EFðxÞ 

kT 


: ð15Þ 

Let us consider now a system consisting of a wide band-gap sample and two electrodes, one of them being able to 

supply the sample with any number of carriers (injecting contact) and the other just serving as an exit electrode (extracting 

contact). If the system is suitably biased so as to facilitate the transport of injected carriers, the resulting current is 

controlled by the space charge built up in the vicinity of the injecting contact. 

Since the injected space charge density decreases with increasing distance from x = 0 and reaches nearly nf0 in the 

bulk of a sufficiently thick sample at x = z 0 (see Fig. 4), the internal field created by this accumulated space charge 

therefore decreases with increasing distance. On applying an external voltage UL = U1, the internal field at x = z1 is 

equal and opposite to the applied field, i.e., the effective field equals zero. The point where dw/dx = 0, where w stands 

for electrostatic potential, is called the ‘‘virtual injecting electrode‘‘. Under equilibrium conditions, the negative 

potential gradient at x < z1 tends to send back to the contact all the electrons that represent the excess over the 

SCL current permitted by the insulator (semiconductor). Thus, at x = z1 we can assume that the electrons are 

released without initial velocity. When the applied voltage is increased (U L = U 2,U 3,...), this field balances a higher 

internal field at x = z2,z3,... This also implies that the electron density of the virtual electrode at U2 is higher than 

that at U1, which can support a higher SCL current. The higher the applied field, the closer is the virtual cathode to 

the contact [31]. 


Fig. 3. The electrode – weakly conducting sample system before contact (a) and after contact (b), at thermal equilibrium. I c stands for 

the solid-state ionization energy, Ac for the electron affinity of a molecule in the solid-state sample; meanings of other symbols have 

been explained in the text. Local levels often present in samples have not been shown for the sake of simplicity.


Fig. 4. Energy diagram for an Ohmic contact of the system electrode – weakly conducting sample – electrode. (0) without bias; (1)–(3) 

with bias. The curves show the influence of the applied voltage on the width of the accumulated region w, and the height of the barrier 

wmax. /e and /s are the work functions of the electrode and sample, respectively. Ac is the electron affinity of a molecule in the solid 

state sample. In this case /e < /s. 

The problem of SCL current may be mathematically treated by solving simultaneously the set of equations: 

(i) the current equation 

j ¼ el nfðxÞF ðxÞ 

kT dnfðxÞ 

e dx 

; ð16Þ 

(ii) the Poisson equation 

dF ðxÞ 

dx ¼ 

e 

½nsðxÞ ns0Š: ð17Þ 

e0er 

In the above equations, ns(x)=nt(x)+nf(x) and ns0 = nt0 + nf0 are the total density of charge carriers in the sample 

(density of free and trapped carriers) after the voltage is applied and at the thermodynamic equilibrium, respectively. 

Let us now briefly discuss some particular solutions of the SCL current–voltage characteristics. We shall assume the 

injection level to be sufficiently high; thus, the concentration of thermally generated carriers will be negligibly small 

compared with that of injected ones. We shall also neglect the contribution of the diffusion current (second term in 

Eq. (16)); the other simplification is justified [32] in homogeneous samples for biasing voltages exceeding kT/e. 

In this case, ns0 =0,ns = nf, and from Eqs. (16) and (17) one obtains 

F ðxÞ ¼ 

2j 

le0er 

1=2 

x 1=2 : ð18Þ 

Since F(x) = dw/dx and UL = w0 wL, where w0 and wL are virtual electrostatic potentials on cathode and anode, 

respectively, one finally arrives at 

j ¼ 9 

8 le0er 

U 2 

L 

: 3 

L 

This basic equation, describing the current–voltage characteristic in insulator, is often called Child’s law. 

ð19Þ 


3.1.1. Profile of the physical parameters over the sample thickness 

Let us now calculate the spatial profiles of the electric field, concentration of free carriers and the position of the 

quasi-Fermi level in the sample. Inserting (19) into (18), one gets 

F ðxÞ ¼ 3 

2 

U L 

L 

x 

L 

1=2 

and, with (17), one obtains 

ð20Þ

nfðxÞ ¼ 3e0er 

4e 

U L 

L 2 

x 

L 

1=2 

: ð21Þ 

Finally, inserting (21) into (15), one arrives at 

EFðxÞ ¼EcðxÞþkT ln 3e0er 

4N ce 

U L 

L 2 

x 

L 

1=2 

: ð22Þ 

From the above equations which are particular cases of a general solution, the following conclusions can be drawn: 

(i) At the collector (x = L), the electric field and the concentration of carriers differ from their average values (U L/L 

and e0erUL/eL 2 ) by factors 3/2 and 3/4, respectively. 

(ii) As the injection level increases (i.e. on increasing the voltage), the position of the quasi-Fermi level shifts from its 

‘‘thermodynamic’’ value towards the band. 

From Eq. (20), for x = L follows FL = (3/2)(UL/L). This expression can also be written using fractal parameters. It is 

very useful to introduce the parameter c = d(lnUL)/d(lnj), a reciprocal value of the derivative of the current–voltage 

(j U) characteristic in the double-logarithmic coordinates (note that c values are related to the energetic structure 

of electronic states [12,18]). The parameter c can be written using the fractal dimension D. For trap-free case, simple 

monoenergetic level and exponential distribution of traps c are constants in the space-charge-limited region; thus we 

have the fractals with constant dimension. 

3.2. Fractal approach 

From the theory of semiconductors [18,19,22] and using Eqs. (12) and (13) it follows for the electric field that 

F L ¼ð2 EcÞU L=L: ð23Þ 

Thus, using the parameters of the fractal structures and comparing Eqs. (12) and (23) the parameter c can be written as 

c =(E D)/E. The space charge in the semiconductor is formed when fractal dimension D 2h0,Ei, i.e. coefficient c, 

changes in the interval c 2h0,1i. The parameter c can be generally defined by the Fisher’s scaling [23] which connects 

the anomalous dimension g = E D = cE and dimension of corresponding random walk of charge m = D. 

Using Eqs. (4) and (11) we can define the energy density 

w ¼ q eV r ¼ ½DðD E þ 2ÞŠ 

and the energy flow 

i ¼ q eF r ¼ q2 e r 

e0erF 2 

2 

e0erV r 

r 

; ð24Þ 

r ¼ ¼ðD 

De0er r 

E þ 2Þw: ð25Þ 

The energy density can be rewritten in the form 

Eð1 

w ¼ ensLU L ¼ 

2 

cÞð2 EcÞe0erU L 

L 2 : ð26Þ 

Energy flow then immediately correlates with the SCL current density 

j ¼ li ¼ lqeF L ¼ le0erEð1 cÞð2 EcÞ 2 U 2 

L 

L 

3 ; ð27Þ 

where qe = enfL is the density of free charge. In this equation the term 

f E ¼ mð2 gÞ 2 ¼ Eð1 cÞð2 EcÞ 2 


can be specified as multiplication term (cf. 9/8 in Eq. (19)). This multiplication factor can be written using Fisher’s scaling 

[23] by the anomalous dimension g = cE and geometry of random walk of charge m = D = E(1 c). 

3.2.1. Profile of free carrier concentration over the sample thickness 

From Eqs. (16) and (17) one can obtain a nonlinear integral equation for the charge carrier density 

nfðxÞ 

Z L 

0 


nfðx 0 Þdx 0 ¼ je0er 

e2 : ð29Þ 

l 

ð28Þ


Introducing dimensionless variables [24] 

mfðnÞ ¼ 

e2lL je0er 

1=2 

nfðnÞ; ð30Þ 

where n = x/L one can rewrite Eq. (29) in the form 

mfðnÞ 

Z 1 

0 

mfðn 0 Þdn 0 ¼ 1: ð31Þ 

From Eq. (16) (without diffusion current) and (30), the current density can be written in the form [24] 

Z 1 

U 

j ¼ le0er 

2 

L 

L 3 

dn 

0 

0 

mfðn 0 2 

: ð32Þ 

Þ 

Comparing Eqs. (27) and (32) one can get the dependence of the dimensionless concentration on the slope of the 

current–voltage characteristic 

Z 1 

2 

Eð1 cÞð2 EcÞ 2 ¼ 

0 

dn 0 

mfðn 0 Þ 

ð33Þ 

and from Eqs. (26), (27) and (30), the equivalent equation for dimensionless concentration of the electric charge 

Z 1 

dn 

mfðnÞ 

0 

0 

mfðn 0 1 

¼ ; 

Þ 2 Ec 

where mfðnÞ ¼ 

ð34Þ 

ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi p 

Eð1 cÞ. 

For one-dimensional case, E = 1, for SCL condition, c = 1/2, the term E(1 c)(2 Ec) 2 

in Eq. (27) is equal 9/8, which is in agreement with Eq. (19). The term (2 Ec) in Eq. (23) is equal 3/2, which is in 

agreement with Eq. (20) and the term E(1 c)(2 Ec) in Eq. (26) is equal 3/4, which is in agreement with Eq. (21). 

Comparing the last terms one can get the nonlinear integral equation from which one can get the dependence mf(n) Z 1 

dn 

0 

0 

mfðn 0 Þ ¼ 

1 

mfðnÞ 2 E þ m2 f ðnÞ 

ð35Þ 

½ Š; 

where E = 1 for one-dimensional transport of charge carriers (bulk regime). 

Solution of this equation can be written in the form [24] 

mfðnÞ ¼bn a ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi p 

Eð1 cÞn 

Ec 1 ; ð36Þ 

where coefficient b ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi p 

Eð1 cÞ characterizes the relative concentration of the charge at the extracting contact (n =1) 

and coefficient a = Ec 1 characterizes the profile of the free charge concentration across the sample. The solution is 

valid for Eqs. (32)–(34) and for Child’s law (E =1,c = 1/2), Eq. (31), where mf(n)=(2n) 1/2 , see Eq. (21). 

The fractal dimensions for SCLC regime for various electrode configurations are presented in Fig. 2b. 

4. Space-charge-limited currents: realistic case 

4.1. Monoenergetic traps 

In real samples one should expect the local states to influence the concentration of free carriers. Consequently, the 

set of equations (16) and (17) can be solved if the dependence between the densities of free and localized carriers is 

known. If one considers a steady-state situation, these two parameters are coupled via the position of the quasisteady-state 

Fermi level, the free carriers density being given by Eq. (15), and the trapped carrier density by the 

Fermi–Dirac statistics 

ntðxÞ ¼N tf ½EFðxÞ EtŠ; ð37Þ 

where 


1 

f ½EFðxÞ EtŠ ¼ 1 þ exp EFðxÞ Et 

ð38Þ 

kT 

is the Fermi–Dirac function and Ht is the concentration of local states. It is convenient to introduce a free-to-total ratio 

parameter H (H 6 1)

H ¼ nfðxÞ 

nsðxÞ ¼ 

nfðxÞ 

: ð39Þ 

nfðxÞþntðxÞ 

Combining Eqs. (37)–(39) one obtains 

1 ntðxÞ 

¼ 1 þ 

H nfðxÞ 

¼ 1 þ 

N c exp 

N t 

EcðxÞ EFðxÞ 

1 þ exp kT EFðxÞ 

h i: ð40Þ 

Et 

kT 

Let us note that the SCL current–voltage characteristic depends on the position of the quasi-Fermi level near the collecting 

electrode EF(L) with respect to energies of the distribution of local states [1]. For the sample with local states 

situated above the quasi-Fermi level, E F(L)>E t, all traps (for electrons) are shallow, and it follows from Eq. (40) that 

the parameter H is practically independent of the position of EF and, consequently, of the voltage applied to the sample 

(Et > Ec) 

H ¼ N c 

exp 

N t 

Et Ec 

kT 

< 1: ð41Þ 

Upon solving Eqs. (16) and (17), one finally obtains (the diffusion current being neglected) 

j ¼ 9 

2 

U L le0erH : 3 8 L 

ð42Þ 

Whilst the current is still proportional to the square of the applied voltage, it is, however, smaller than Child’s current 

(Eq. (19)). It should be stressed that H, although independent of voltage in the voltage range under consideration, does 

depend on the concentration of local states Nt [33]. The results of the fractal dimensions in the SCLC regime for various 

electrode configurations and monoenergetic states are presented in Fig. 2b. 

For H 1, the sample should behave as a trap-free insulator, and should conform to Child’s law (Eq. (19)). The 

voltage at which filling of all traps is achieved is usually called ‘‘trap-filled-limit voltage’’ (UTFL, here c ! 0), and 

can be shown [34,35] to amount to 

U TFL ¼ eN tL 2 

; 

2e0er 

where Nt is the overall concentration of local states. 

ð43Þ 


From Eqs. (16), (17) and (39) one can obtain (analogously to (29)) a nonlinear integral equation for the charge carrier 

density 

je0er 

e 2 l 

¼ nfðxÞ 

Z L 

0 

nsðx 0 Þdx 0 ¼ nfðxÞ 

Z L 

which can be rewritten (analogously to Eq. (31)) in the form 

mfðnÞ 

Z 1 

0 

0 

nfðx 0 Þ 

H dx0 ; ð44Þ 

mfðn 0 Þdn 0 ¼ H: ð45Þ 

The dependence of dimensionless charge concentration on the slope of the current–voltage characteristics (Eq. (33)) can 

be rewritten as 

Z 1 

HEð1 cÞð2 EcÞ 2 ¼ 

0 

dn 0 

mfðn 0 Þ 

2 

: ð46Þ 

From Eqs. (26) and (27) one can get similar equation to Eq. (34) 

Z 1 


dn 

mfðnÞ 

0 

0 

mfðn 0 1 

¼ ; ð47Þ 

Þ 2 Ec 

where mfðnÞ ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

HEð1 cÞ for n = 1. Comparing the last terms one can get the nonlinear integral equation from which 

the dependence mf(n) can be obtained 

Z 1 

0 

dn 0 

mfðn 0 Þ ¼ 


H 

mfðnÞ Hð2 EÞþm2 f ðnÞ 

ð48Þ 

½ Š;


where E = 1 for one-dimensional transport of charge carriers (bulk regime). The solution of this equation can be written 

in the form [24] 

mfðnÞ ¼bn a ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

HEð1 cÞn 

Ec 1 ; ð49Þ 

where coefficient b ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

HEð1 cÞ characterizes the relative concentration of space charge in monoenergetic trap at the 

extraction contact (n = 1) and coefficient a = Ec 1 characterizes the profile of free charge across the sample. The solution 

is valid for Eqs. (46)–(48) and also for monoenergetic trap (E =1,c = 1/2) (45), where mf(n)=(2Hn) 1/2 , see Eq. 

(21). 

4.2. Exponential distribution of local states 

Further we will pay more attention to the insulator with exponential distributions h(E) of local states in energy. 

Due to a relatively straightforward derivation, equations describing this distribution have often been employed to fit 

experimental data, although no physical justification can be offered for this shape of the DOS function. Thus we 

assume 

hðEÞ ¼H t exp 

E Ec 

kT c 

; ð50Þ 

where Tc is the temperature of the exponential distribution Tc > T. 

In real samples one should expect the local states to influence the concentrations of free carriers. Consequently, similar 

to the previous case, the set of equations (16) and (17) can be solved if the dependence between the densities of free 

and localized carriers is known. If one considers a steady-state situation, these two parameters are coupled via the position 

of the quasi-steady-state Fermi level, the density of free carriers being given by Eq. (15), and the density of trapped 

carriers of the Fermi–Dirac statistics 

where 

ntðxÞ ¼ 

Z EU 

EL 

hðE; xÞf ½EFðxÞ EŠdE; ð51Þ 

1 

f ½EFðxÞ EŠ ¼ 1 þ exp EFðxÞ E 

ð52Þ 

kT 

is the Fermi–Dirac function and h(E,x) is the density-of-states (DOS) function, i.e. a function describing the energetic 

and spatial distribution of local states between the lower and upper limits (EL and EU, respectively). It is convenient to 

introduce a free-to-total ratio parameter H (H 6 1) (39). 

Combining Eqs. (51), (52) and (39) one obtains 

Z EU 

1 ntðxÞ 

hðEÞdE 

¼ 1 þ ¼ 1 þ 

H nfðxÞ EcðxÞ EFðxÞ 

EL N b exp 1 þ exp kT EFðxÞ 

h i: ð53Þ 

E 

kT 

Let us note that the SCL current–voltage characteristic depends on the position of the quasi-Fermi level near the collecting 

electrode EF(L) with respect to energies of distribution of local states [1]. For the sample with local states situated 

above the quasi-Fermi level, all traps are shallow, and it follows from Eq. (40) that the parameter H is practically 

independent of the position of EF and, consequently, of the voltage applied to the sample (E > Ec) 

N b 

H ¼ R EU 

E Ec 

hðEÞ exp EL kT 

< 1: 

dE 

ð54Þ 

Equations describing the field intensity and the density of localized carriers at the collecting electrode can be derived 

as [33] 

F ðLÞ ¼ 

2l þ 1 

l þ 1 

U L 

; 

L 

ð55Þ 

ntðLÞ ¼ 

2l þ 1 

l þ 1 

l 

l þ 1 

eU L 

; 2 

eL 

ð56Þ 

where l = Tc/T > 1 (note that for the exponential distribution c = 1/(l + 1) is independent of voltage). For the exponential 

distribution of local states, the current–voltage characteristics for sandwich sample can be written in the form [1] 

Author's personal copy

Table 3 

SCL current–voltage characteristics insulator with shallow traps and traps distributed in energy 

Current flow 

Shallow traps: 

Exponential distribution of traps: 

geometry 

H = Nc/Ntexp[(Et Ec)/kT] 

h(E)=Htexp[(E Ec)/kTc], l = Tc/T >1 

D = E/2 D = El/(l +1) 

Eð4 EÞ2 U 

j ¼ le0erH 8 

2 

L 

L3 h il e0erEl 

j ¼ elN c eH tðlþ1Þ 

ðlþ1Þ ðlþ1Þ 

E U L 

2 lþ1 Lð2lþ1Þ Plane-parallel E =1 j ¼ 9 

2 U L 

8 le0erH 

L3 h il e0erl 



2lþ1 U L 

lþ1 Lð2lþ1Þ Cylindrical E =2 

2 U L 

j ¼ le0erH 

L3 h il e0er2l 



2l U L 

lþ1 Lð2lþ1Þ Spherical E =3 j ¼ 3 

2 U L 

8 le0erH 

h il e0er3l 

j ¼ elN c 

2l 1 

lþ1 

j ¼ leN c 

e0er 

eH t 

l 

l 

l þ 1 

l 

2l þ 1 

l þ 1 


U L 

: ð2lþ1Þ 

L 

ð57Þ 

Utilizing the parameters of fractal structures and c = 1/(l + 1) one can rewrite Eq. (27) in the form: 

j ¼ le0erH El 

l þ 1 

2l þ 2 

l þ 1 

E 

2 2 

U L 

: 3 

L 

ð58Þ 

Using for the free carrier concentration (Eqs. (15) and (50)), nfL = Nb(nsL/Ht) l and for parameter H ¼ðNb=H l 1Þ 

tÞnðl sL 

(see (Eq. (54)), where l = Tc/T > 1 we finally get the expression 

l 

l ðlþ1Þ ðlþ1Þ 

e0er El 2l þ 2 E U L 

j ¼ leN c 

: ð59Þ 

eH t l þ 1 l þ 1 

ð2lþ1Þ 

L 

The integral appearing in the denominator of Eq. (53) can be solved only if the DOS function is specified a priori, 

thus no general equation exists describing the SCL current–voltage characteristics in this case. One can, however, obtain 

approximate solutions for typical distributions applying the zero-temperature approach, i.e., replacing the Fermi–Dirac 

function (Eq. (52)) by the Heaviside (step) function 

f ðEF EÞ ¼vðEF EÞ: ð60Þ 

In other words, one assumes the concentration of carriers in shallow states to be negligibly small compared with 

those in deep states. Eqs. (46)–(49) are also valid in this case too, but Eq. (45) must be rewritten in the form 

Z 1 

mfðnÞ mfðn 

0 

0 Þdn 0 Hð1 cÞ 

¼ ¼ Hl: ð61Þ 

c 

Eq. (59) represents a general equation of SCL currents for insulator with exponential distribution of local states in energy 

independently of electrode geometry. The exact solutions for plane-parallel, cylindrical and spherical electrode 

geometries (not simple ones) were derived by Lampert and Mark [1]. Eq. (59) allows to write these solutions in a simple 

way, to change only the value of the Euclidean dimension E. The results are given for the insulator with shallow traps 

and traps distributed exponentially in energy in Table 3. 

5. Surface (gap) electrode configuration 

At present there is a strong interest in the construction of thin film field-effect transistors operating in the both 

Ohmic and SCL regime. In this case two electrodes (source-drain) with spacing L (channel length) are applied onto thin 

film of the thickness a (and vice versa). Because of a specific profile of the electric field in these samples, the expressions 

for the SCL currents will differ from those for the bulk sample. 


5.1. Monoenergetic and exponentially distributed traps 


L 3 

This problem was tackled only for a trap-free case or for the currents controlled by shallow traps. According to Ref. 

[36], Eq. (42) should in this case be modified to 

I G ¼ 2 

2 

U L 

le0erH W ; ð62Þ 

2 p L 

eH tðlþ1Þ 

ðlþ1Þ U ðlþ1Þ 

L 

L ð2lþ1Þ


Fig. 5. Sample geometry discussed in this paper: (a) thick and thin sandwich (bulk) structure, (b) thick (u = p/2) and thin 

(u = arctan(a/L)) cylindrical segment (arc) structure, (c) gap (film) structure, p/2 > u * > arctan(2a/L). 

where W is the channel width (see Fig. 5c) and prefactor (2/p here) depends on the contact shape. The problem was 

solved for the thickness limit (a ! 0). Note that in TF FET experiments the active thin film is usually deposited on 

the electrode system or thin metal electrodes are deposited on the active semiconductor thin film. Here, the film thickness 

a differs from the electrode distance channel length L. On the basis of this analysis Geurst [37] was able to construct 

an analytical model of an FET, which goes beyond the usual gradual channel approximation. Later on, Grinberg et al. 

[24] solved the SCL currents in thin films for the electrode configuration given in Fig. 5b. They developed the expression 

similar to Eq. (62) with factor 0.57 instead of 2/p = 0.63. Note, that in this case the total current is independent of film 

thickness a because the decreasing film thickness is compensated by increasing injection. 

The results for sandwich bulk (plane-parallel) sample structures were discussed in the last paragraphs for the case of 

monoenergetic trap (c = 1/2) or exponential distribution of traps (c =(E D)/E = 1/(l + 1)). The final current terms 

were calculated for one-dimensional case (E = 1). The fractal dimensions were ranging in interval D 2h0,1i The ohmic 

case was characterized by the fractal dimension D = 1 (paragraph 2), Child’s law and the case of the monoenergetic 

shallow trap by D = 1/2 (paragraphs 3 and 4), exponential trap distribution by D = l/(l + 1), and the trap-field-limit 

by D ! 1 (paragraph 4). On the basis of the expressions mentioned above one can use for the bulk current 

I M 

B 

¼ Aj ¼ ZWj, where j is the current density (Eq. (42)). 

Similarly, for the current of the insulator with traps exponentially distributed in energy one can write 

I E 

B ¼ jA ¼ le0erHð1 cÞð2 cÞ 2 U 2 

L 

L 3 ZW ð63Þ 

(cf. Eq. (27) for the current density; here E = 1). 

The similar situation exists for cylindrical segment sample structures. The final terms for the currents can be 

expressed for two-dimensional (cylindrical) case (E =2)as 


(i) for insulator with traps monoenergetic distributed in energy 

I M 

2 

U L 

C ¼ uLWj ¼ le0erH uLW ; ð64Þ 

3 

L 

(ii) for insulator with exponentially traps 

I E 

C ¼ uLWj ¼ 8le0erHð1 cÞ 3 U 2 

L 

L 3 uLW ; ð65Þ

where u (cf. Fig. 5b) is the angle at which the current is flowing from surface contact to the sample (for the full cylindrical 

case u =2p). 

Combining Eqs. (42) and (64) we can get for monoenergetic traps 

I M 

B 

I M ¼ 

C 

9 a 

; ð66Þ 

8 ðuLÞ 

combining Eqs. (63) and (65) we can get for the insulator with traps exponentially distributed in energy 

I E 

B 

I E 

ð2 cÞ2 

¼ 

C 8ð1 cÞ 2 

a 

: ð67Þ 

ðuLÞ 

For very thin samples, i.e. for small angles, u = arctan(a/L) ! 0, a/(uL) 6 1 and the expression for the current is similar 

to that presented in Ref. [24]. 

The case of the gap sample structure represents the combination of two cylindrical cases (see Fig. 5c). The final term 

for current will depend on the type of surface contacts (e.g. edge contact, coplanar strip contact, perpendicular plane 

contact, see Ref. [24]). In this case the angle u * P u = arctan[a/(L/2)] and Eqs. (64) and (65) can be rewritten as 

I M 

G 

2 

U L 2a 

¼ u LWj le0erH arctan 2 

L L 

I E 

G ¼ u LWj 

8le0erHð1 cÞ 3 U 2 

L 

L 

2 arctan 2a 

L 

In these equations the terms 

arctanð2a=LÞ ¼f M 

G and 8ð1 cÞ 3 arctanð2a=LÞ ¼f E 

G 

W ; ð68Þ 

W : ð69Þ 

can be taken as multiplication factor (see [24], cf. 2/p in Eq. (62)). 

Using Eq. (69) one can write the terms for the current of the gap sample of the insulator with exponentially distributed 

traps in energy (here E =1) 

l 

ð2lþ1Þ U ðlþ1Þ 

I E 

G ¼ leN c 

e0er 

eH t 

2l 

l þ 1 

L 

arctan ð2lþ1Þ 

L 

2a 

L 

W ; ð71Þ 

where c =(E D)/E = 1/(l + 1) and L is the channel length (see Fig. 5c). 


From Eqs. (16), (17) and (39) one obtains (analogously to Eq. (29)) the nonlinear integral equation for the carrier 

density 

je0er 

e 2 l 

¼ nfðxÞ 

Z L 

0 

nfðx 0 Þ 

uH dx0 ; ð72Þ 

which can be rewritten (analogously to Eq. (31)) in the form 

mfðnÞ 

Z 1 

0 

mfðn 0 Þdn 0 ¼ uH: ð73Þ 

From Eqs. (26) and (27), one can get equivalent equation to Eq. (34) 

Z 1 

dn 

mfðnÞ 

0 

0 

mfðn 0 1 

¼ 

Þ 2 Ec ; where mfðnÞ ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

uHEð1 cÞ: 

ð74Þ 

Comparing the last terms one can get the nonlinear integral equation from the dependence mf(n) can be obtained 

Z 1 



0 

dn 0 

mfðn 0 Þ ¼ 

mfðnÞ½ð2 

uH 

EÞuH þ m2 ; 

f ðnÞŠ 

ð75Þ 

where E = 2 for two-dimensional transport of carrier (cylindrical segment regime, see Fig. 5b). Solution of this equation 

can be obtained in the form [24] 

mfðnÞ ¼bn a ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

uHEð1 cÞn 

Ec 1 ; ð76Þ 

ð70Þ


where coefficient b ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

uHEð1 cÞ characterizes the relative concentration of space charge in trap at the end of the 

sample (n = 1) and coefficient a = Ec 1 characterizes the free charge profile across the sample. 

For the gap regime situation, the relative concentration (Eq. (36)) must be rewritten as 

mfðnÞ ¼bn a ð1 nÞ b ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

uHEð1 cÞ 

n 

1 n 

Ec 1 

; ð77Þ 

where the first exponent (a) describes the efficiency of the injecting contact and the second exponent (b) the efficiency of 

the extracting contact properties. For the special case, when a = b = Ec 1 the profile of free charge relative concentration 

across the sample can be obtained. The general coefficient fE of SCLC characteristics can be in this case written 

as 

fE ¼ 

bCð2 a bÞ 

Cð1 aÞCð1 bÞ 

2 

; ð78Þ 

where C(a,b) is the gamma function. 

For b ¼ ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi 

p 

uHEð1 cÞ, 

a = Ec 

uHE(1 c)(2 Ec) 

1 and b = 0 we can get by simple calculation the coefficient fE = 

2 (see Eq. (28)). 

For the case with extracting contact (see Eq. (77) with the parameters a = Ec 

similarly 

1 and b =1 Ec), we can get 

fE ¼ b sinðpaÞ 

pa 

2 

¼ uHEð1 

sin pðEc 

cÞ 

pðEc 

1Þ 

1Þ 

2 

; ð79Þ 

where the second term is the error function. For the monoenergetic trap in the gap sample (E =1,c = 1/2 and u 6 p) 

the coefficient fE=1 6 2/p. The general equation for SCL current can be then written as 

I M 

2 

2 U L 

G 6 le0erH W : 2 p L 

Eq. (62) given by Guerst [36] is the limiting case of this equation. 

ð80Þ 

The dependences of the dimensioneless free carrier concentration on the relative coordinate for all the discussed situations 

are shown in Fig. 6. For the bulk regime the dependences for Child’s law, monoenergetic traps and exponential 

trap distributions were calculated. There are differences in the concentration of free charge carrier near the cathode. For 

the gap electrode configuration the anode was taken as non-Ohmic extracting contact. 

6. Conclusion 

log [n f (ξ)] 

100.0 

10.0 

1.0 

0.1 

0.0 

0.0 0.2 0.4 0.6 0.8 1.0 

Cathode ξ Anode 

Fig. 6. Dependences of dimensionless free carrier concentration on the relative coordinate for (a) plane-parallel bulk regimes: Child’s 

law ( ), monoenergetic trap (m) and traps exponentially distributed in energy (j), (b) cylindrical bulk regime (traps exponentially 

distributed in energy) (d) (full line) and (c) gap thin film regime (traps exponentially distributed in energy (d) (dashed line). 


Using the methodology of E-Infinity the general equations for space-charge-limited currents in trap-free insulators 

or wide band-gap semiconductors and in materials with monoenergetic traps and trap distributed exponentially in

energy was derived. The multiplication term of current–voltage characteristic was determined using Fisher’s scaling [23] 

and Elnaschie’s E-Infinity Cantorian space time theory as 

f E ¼ mð2 gÞ 2 ¼ Eð1 cÞð2 cEÞ 2 ; ð81Þ 

where m = D = E(1 c) is the dimension of random walk and g = cE is the anomalous dimension. 

This allows us writing one common equation independently of electrode configuration changing only the fractal 

dimension D and Euclidean dimension E. By the combination of two cylindrical cases it was possible to derive the 

expression for space-charge-limited currents in insulator with monoenergetic traps for the case of samples with surface 

(gap) electrode configuration in the form 

I M 

2 

U L 2a 

G ¼ u LWj aWj le0erH arctan W ; ð82Þ 

2 

L L 

where l is the charge carrier mobility, e0er is the permittivity of the material, H is the free-to-total ratio parameter, UL is 

the applied voltage, L is the electrode distance, the W is width of rectangle electrode and a is the sample thickness. For 

trap free case the H =1. 

For the insulator with traps exponentially distributed in energy the current is 

I E 

8le0erð1 cÞ 

G ¼ u LWj 

3 U 2 

L 

L 2 arctan 2a 

W ; ð83Þ 

L 

where c is the reciprocal value of the current–voltage characteristics slope in the double logarithmic coordinates, 

c = d(lnUL)/d(ln j). This experimental parameter can be expressed as c =(E D)/E, where D is the fractal dimension 

of the space charge distribution in the sample and E is the topological (Euclidean) dimension of the contact 

configuration. 


The financial supports by grant FT-TA/036 from the Ministry of Industry and Trade of the Czech Republic and by 

the grant A100100622 from the Grant Agency of the Academy of Sciences of the Czech Republic are gratefully 

appreciated. 

References 


[1] Lampert AM, Mark P. Current injection in solids. New York: Academic Press; 1970. 

[2] Milnes AG. Deep impurities in semiconductors. New York: J. Wiley; 1973. 

[3] Kao KC, Hwang W. Electrical transport in solids. Pergamon Press; 1981. 

[4] Chen R, Kirsh Y. Analysis of thermally stimulated processes. Oxford: Pergamon Press; 1981. 

[5] Many A, Goldstein Y, Grover NB. Semiconductors surfaces. Amsterdam: North Holland; 1965. 

[6] Mort J, Pai DM, editors. Photoconductivity and related phenomena. Amsterdam: Elsevier; 1976. 

[7] Abeles F, editor. Optical properties of solids. Amsterdam: North Holland; 1972. 

[8] Belkind AI. Photoemission from organic solids. Riga: Zinatne; 1979 [in Russian]. 

[9] Bredsky MH, editor. Amorphous semiconductors. Berlin: Springer; 1979. 

[10] Joannopoulos JD, Lecovsky G, editors. The physics of hydrogenated amorphous silicon, vol. I and II. Berlin: Springer; 1979. 

[11] Mott NF, Davis EA. Electron processes in non-crystalline materials. Oxford: Clarendon Press; 1979. 

[12] Nesˇpu˚rek S, Sworakowski J. Use of space-charge-limited current measurements to determine the properties of energetic 

distributions of bulk traps. J Appl Phys 1980;51:2098–102. 

[13] Nesˇpu˚rek S, Silinsh EA. Space-charge-limited current theory for molecular crystals with Gaussian distribution of local trapping 

states. Phys Status Solidi (A) 1976;34:747–59. 

[14] Nesˇpu˚rek S, Smejtek P. Space-charge limited currents in insulators with the Gaussian distribution of traps. Czech J Phys 

1972;B22:160–75. 

[15] Sworakowski J, Nesˇpu˚rek S. Determination of the parameters of traps for current carriers from space-charge-limited currents. J 

Electrostat 1979;8:97–101. 

[16] Nesˇpu˚rek S, Sworakowski J. A differential method of analysis of steady-state space-charge-limited current–voltage characteristics. 

Phys Status Solidi (A) 1977;41:619–27. 

[17] Nesˇpu˚rek S, Sworakowski J. A differential method of analysis of steady-state-charge-limited currents: an extension. Phys Status 

Solidi (A) 1978;49:K149–52. 



[18] Zmeskal O, Schauer F, Nespurek S. The bulk trap spectroscopy of solids by temperature modulated space-charge-limited currents 

(TMSCLC) in the steady state. J Phys C: Solid State Phys 1985;18:1873–84. 

[19] Schauer F, Nespurek S, Zmeskal O. The bulk trap spectroscopy of solids by temperature modulated space-charge-limited currents 

(TMSCLC): Application to real crystalline and amorphous semiconductors. J Phys C: Solid State Phys 1986;19:7231–46. 

[20] Schauer F. Space-charge-limited currents for organic solar cells optimisation. Solar Energy Mater Solar Cells 2005;87:235–50. 

[21] Nesˇpu˚rek S. Space-charge-limited currents in N,N 0 /diphenyl-p-phenylemediamine and Gaussian distribution of traps. Czech J 

Phys 1974;B24:660–70. 

[22] Stöckmann F. An exact evaluation of steady-state space-charge limited currents for arbitrary trap distribution. Phys Status Solidi 

A 1981;64:475–83. 

[23] El Naschie MS. Fisher’s scaling and dualities at high energy E-Infinity spaces. Chaos, Solitons & Fractals 2001;12:1557–61. 

[24] Grinberg AA, Luryi S, Pinto MR, Schryer NL. Space-charge-limited-current in a film. IEEE Trans Electron Dev 1989;36:1162–70. 

[25] El Naschie MS. Non-Euclidean spacetime structure and two-slit experiment. Chaos, Solitons & Fractals 2005;26:1–6. 

[26] El Naschie MS. Elementary number theory in superstrings, loop quantum mechanics, twistors and E-infinity hygh energy physics. 

Chaos, Solitons & Fractals 2006;27:297–330. 

[27] El Naschie MS. The Feynman path integral and E-infinity from the two-slit Gedanken experiment. Int J Nonlinear Sci Numer 

Simul 2005;6:335–42. 

[28] Mandelbrot BB. Fractal geometry of nature. New York: W.H. Freeman and Co.; 1983. 

[29] Zmeskal O, Nezadal M, Buchnicek M. Fractal-Cantorian geometry, Hausdorff dimension and the fundamental laws of physics. 

Chaos, Solitons & Fractals 2003;17:113–9. 

[30] Zmeskal O, Nezadal M, Buchnicek M. Field and potential of fractal–Cantorian structures and El Naschie’s E ð1Þ theory. Chaos, 

Solitons & Fractals 2004;19:1013–22. 

[31] Wright GT. Mechanism of space-charge-limited current in solids. Solid-State Electron 1961;2:165–89. 

[32] Helfrich W. In: Fox D, Labes MM, Weissberger A, editors. Physics and chemistry of the organic solid state. New York: 

Interscience; 1967. 

[33] Nesˇpu˚rek S, Sworakowski J. Spectroscopy of local states in molecular materials using space-charge-limited currents. Rad Phys 

Chem 1990;36:3–12. 

[34] Lampert MA. Simplified theory of space-charge-limited currents in an insulator with traps. Phys Rev 1956;103:1648–56. 

[35] Müller RS. A unified approach to the theory of space-charge-limited currents in an insulator with traps. Solid-State Electron 

1963;6:25–32. 

[36] Guerst JA. Theory of space-charged-limited currents in thin semiconductor layers. Phys Status Solidi 1966;15:107–18. 

[37] Guerst JA. Theory of insulated-gate field-effect transistors near and beyond pinch-off. Solid-State Electron 1966;9:129–42. 


POLYMERS FOR ADVANCED TECHNOLOGIES 

Polym. Adv. Technol. 2006; 17: 673–678 

Published online 3 October 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/pat.764 

Influence of dipolar species on charge transport 

in poly[2-methoxy-5-(2 0 -ethylhexyloxy)-p-phenylene 

vinylene] y 

Petr Toman 1 *, Stanislav Nesˇpu˚ rek 1,2 , Martin Weiter 2 , Martin Vala 2 , 

Juliusz Sworakowski 3 , Wojciech Bartkowiak 3 and Miroslav Mensˇík 1 

1 Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovsky´ Sq. 2, 162 06 Prague 6, Czech Republic 

2 Faculty of Chemistry, Brno University of Technology, Purkynova 118, 612 00 Brno, Czech Republic 

3 Institute of Physical and Theoretical Chemistry, Wroclaw University of Technology, Wyb. Wyspianskiego 27, 50-370 Wroclaw, Poland 

Received 30 November 2005; Revised 13 April 2006; Accepted 13 April 2006 

A theoretical study and experimental evidence for a decrease of the charge carrier mobility in poly[2methoxy-5-(2(-ethylhexyloxy)-p-phenylene 

vinylene] (MEH-PPV) under the influence of dipolar 

species are presented in this paper. The presence of polar species in the vicinity of an MEH-PPV 

chain modifies the on-chain site energies and consequently, due to random mutual positions and 

orientations, increases the width of the energy distribution of the chain transport states. The 

influence of energetic disorder of these states on the charge carrier mobility was modeled by means 

of the Monte Carlo method, based on a numerical solution of the time-dependent Schrödinger 

equation in the tight-binding approximation. It was shown that the increasing disorder destroys the 

resonance between charge carrier energies on adjacent sites and, therefore, limits the diffusive charge 

carrier motion. Copyright # 2006 John Wiley & Sons, Ltd. 

KEYWORDS: charge transport; conducting polymers; photochromism; Monte Carlo simulation; quantum chemistry 

INTRODUCTION 

In the past decades, a great deal of scientific interest has been 

devoted to the research into different types of polymer-based 

photoswitching systems because of their potential use as 

elements of future logic and memory devices. 1–5 Poly(pphenylene 

vinylene) (PPV) derivatives possess excellent 

semiconducting and luminescent properties accompanied by 

relatively easy processing. 6,7 Charge carrier transport in 

these materials proceeds predominantly along the conjugated 

polymer backbones with the participation of the 

interchain hopping. The charge transport along the PPV 

chain was theoretically described by Grozema and coworkers 

8,9 using the tight-binding approximation model. 

They found that the on-chain charge carrier mobility was 

governed by the structural (torsional) disorder of the main 

chain, giving rise to a broadening of the distribution of 

transfer integrals among polymer repeat units. It is known 

that the main chain transport in conjugated macromolecules 

may be influenced by attaching polar side groups or by 

admixing polar additives. 10–12 The introduction of polar 

species results in a broadening of the distribution of charge 

carrier transport states 13,14 and in creating charge carrier 

*Correspondence to: P. Toman, Institute of Macromolecular Chemistry, 

Academy of Sciences of the Czech Republic, Máchova St. 7, 

120 00 Praha 2, Czech Republic. 

E-mail: toman@imc.cas.cz 

y 8th International Symposium on Polymers for Advanced Technologies 

2005 (PAT 2005), Budapest, 13–16 September, 2005, Part 1. 

traps. 15 Both these effects result in a decrease of the charge 

carrier mobility. 

In this paper, the results of theoretical and experimental 

studies on the modulation of charge carrier (hole) transport 

in poly[2-methoxy-5-(2 0 -ethylhexyloxy)-p-phenylene vinylene] 

(MEH-PPV) doped with the photochromic additive 

6-nitro-1 0 ,3 0 ,3 0 -trimethylspiro[2H-1-benzopyran-2,2 0 -indoline] 

are presented (Scheme 1). Upon irradiation with light of 

an appropriate wavelength, the photochromic additive 

undergoes a ring-opening reaction from the closed form of 

spiropyran (SP) to the open merocyanine (MR) form. 16,17 The 

reversible SP$MR reaction is accompanied by a charge 

redistribution resulting in a significant increase of the dipole 

moment of the molecule. The interaction of the polar additive 

and a hole moving along the polymer chain (charge–dipole 

interaction) results in the broadening of the distribution of 

local hole energies along the chain; in this way the on-chain 

mobility of holes decreases. 

EXPERIMENTAL 

Thin films of MEH-PPV with SP, typically 150 nm thick, were 

prepared by spin coating of chloroform solution onto indium 

tin oxide (ITO) electrodes (for electrical measurements) or 

onto quartz glass substrates (for optical measurements). 

Copyright # 2006 John Wiley & Sons, Ltd.

674 P. Toman et al. 

Scheme 1. Photochromic reaction in the SP$MR system. 

Vacuum evaporated top Al electrode completed the 

sandwich structure for the electrical measurements which 

were performed using a Hewlett Packard 4192A impedance 

analyzer. The time dependences of conductance and 

capacitance were recorded at a constant frequency (1 kHz). 

The reaction converting SP into its colored unstable form 

(MR) was activated by light (360 20) nm generated by the 

mercury discharge lamp HBO-200. The optical decay was 

measured in a vacuum in the temperature range 298–350 K. 

The maximum of the long wavelength absorption band of 

MEH-PPV is situated at 445 nm; an addition of SP increases 

the absorption of the sample in the UV region. After the 

irradiation of an MEH-PPV sample containing admixed SP 

(referred to as MEH-PPV/SP) with UV light, an intense 

absorption band appears at 590 nm, associated with the 

appearance of the colored MR species. Thermal bleaching in 

the dark or during the irradiation of the sample with a He-Ne 

laser gradually restores the original spectrum. The kinetics of 

coloring and bleaching processes was investigated by 

following the temporal evolution of the 590 nm peak. It 

was found that the rate of the thermal bleaching process can 

be described by the ‘‘stretched exponential’’ function. 18 Time 

constants of the decay processes followed the Arrhenius 

relation with the activation energy, Ea¼107 kJ/mol, and 

frequency factor, 2.9 10 13 sec 1 . 

The results of electrical measurements are presented in 

Fig. 1. Because MEH-PPV is photoconductive, the conductance 

strongly increases under UV illumination due to the 

increase of the free charge carrier concentration. However, 

the UV light simultaneously triggers the SP> MR reaction, 

with high dipole moment of MR species (the dipole moment 

changes from 5 D to 12 D, see Ref. 12). The dipolar species 

create new charge carrier traps and made the distribution of 

transport hopping states broaden. These effects lead to a 

decrease of the charge carrier mobility and free charge carrier 

Figure 1. Temporal evolution of the conductance and capacitance 

of an MEH-PPV sample containing the photochromic 

SP. The vertical arrows at times t1 and t2 indicate ‘‘switching 

on’’ and ‘‘switching off’’ of the UV illumination, respectively. 

concentration. The slow decay of the conductance with time 

can be ascribed to the formation of local states due to the SP> 

MR transformation. After the ‘‘switch off’’ of light (see time t2 

in Fig. 1) the conductance strongly decreases due to the 

termination of the number of free charge carriers. 

The formation of highly polar species during the UV 

illumination was simultaneously checked by the capacitance 

measurements (see Fig. 1). After the fast increase from 878 to 

893 nF at the beginning of the UV illumination, which can be 

ascribed to the photodielectric effect due to light generation 

of free and trapped charge carriers, a slower increase was 

observed. This part of the capacitance kinetics can be 

explained by the formation of polar MR species 11 and the 

increase of the orientational polarizability. After the ‘‘switch 

off’’ of light, a fast decay of the capacitance was observed 

followed again by a slow component. The rate of the slow 

process was found to approximately follow the rate of the 

photochromic reaction detected optically: the Ea value was 

found to be 88 kJ/mol, the frequency factor amounting to 

1.9 10 11 sec 1 . 

MODEL OF CHARGE CARRIER 

TRANSPORT 

Polar species in the polymer chain vicinity modify the 

electrostatic potential due to the charge–dipole interactions. 

The change of the electrostatic potential shifts the site 

energies of individual polymer repeating units, and consequently 

the polymer transport levels are modified. MEH- 

PPV is a hole transporting material, hence the energy, en,ofa charge carrier located on an n-th repeat unit (phenylene or 

vinylene) is essentially equal to the negative of its first 

ionization potential, In, corresponding to the highest 

occupied molecular orbital jHOMO>. For the undoped 

polymer, the units are treated as separated molecules capped 

by hydrogens, then it is possible to calculate their In0 by the 

Hartree–Fock (HF) method utilizing the Koopmans’ theorem. 

Koopmans’ ionization potential In of a unit interacting 

with a polar additive can be expressed as: 

In ¼ "n ¼ In0 < HOMOj X 

DfijHOMO > (1) 

where In0 is the ionization potential of an isolated repeat unit 

and Dfi are the changes of the electrostatic potential 

describing the charge–dipole interactions of a charge carrier 

localized at jHOMO> with all surrounding polar additive 

molecules. The change of the shape of jHOMO> induced by 

the additive is neglected (frozen orbital approximation). 

Since the positions and orientations of the additive with 

respect to the polymer chain are essentially random, the 

effect results in a broadening of the distribution of transport 

states. The most important parameter of this distribution is 

its half-width, proportional to the standard deviation s(e) of 

the site energies from its average value. 

In order to estimate the change of s(e) during the SP$MR 

reaction, the equilibrium molecular conformations of SP and 

MR were calculated by means of the HF/3-21G (*) method. 

The molecules were considered to be isolated. While the 

closed form SP assumes only one stable conformation, there 

are four almost planar metastable MR forms, differing by 

Copyright # 2006 John Wiley & Sons, Ltd. Polym. Adv. Technol. 2006; 17: 673–678 

DOI: 10.1002/pat 

i

three dihedral angles along the ‘‘bridge’’ connecting the 

conjugated rings of the open form, whose values are close to 

08 or 1808 (see Ref. 12). The photochromic reaction SP$MR is 

accompanied by a redistribution of the atomic charges and 

consequently by a change of the dipole moment from 5.5 D 

(SP form) to 11–12 D (four possible MR forms). It was found 

that there is no significant dependence of the calculated 

dipole moments and other electronic properties on the basis 

set of atomic orbitals. Since the atomic electronic density 

distribution is only slightly influenced by the values of the 

dihedral angles, the differences in the electronic properties, 

including total energy, of four metastable MR forms are small 

and arise mainly from the different positions of the NO 2 

group. For this reason, further calculations only for SP and 

lowest-energy isomer of MR are considered. While the value 

obtained for SP is close to reality, the dipole moment of MR is 

probably underestimated since the polar environment 

increases the zwitterionic character of MR. Bletz et al. 19 

reported the dipole moment of MR measured in a polar 

environment to amount to 15–20 D. 

The change of the electrostatic potential Df i was calculated 

for four different mutual positions of the MEH-PPV tetramer 

and an SP/MR additive (above, below, in front of, and 

behind the chain, which is assumed to be oriented from left to 

right). For each position the distance between the chain and 

additive was determined on the basis of the van der Waals 

atomic radii. Furthermore, in each position, six main 

orientations of the additive molecule were considered. The 

orientations were fixed by the additive dipole moment being 

Influence of dipolar species on charge transport in MEH-PPV 675 

perpendicular, parallel, or skew to the chain. On the whole, 

24 calculations were done for each form. The HOMO orbital 

of MEH-PPV as well as HOMO orbitals of its oligomers of 

any length are localized along the main chain. For this 

reason, it is believed that to calculate electrostatic potentials 

Df i only ‘‘on-chain’’ is enough, i.e. along a line going through 

C–C bonds of vinylenes and crossing phenylenes through 

their centers. Figure 2(a) and 2(b) illustrates the on-chain 

electrostatic potential changes Dfi for the additive in a 

specific position oriented perpendicular and parallel to the 

chain, respectively. From all 24 resulting potential curves, 

each consisting of 342 calculated points, the standard 

deviations s SP(e)¼0.08 eV and s MR(e)¼0.14 eV of the site 

energies were calculated. These values provide an estimate 

of the broadening of the site energy distribution caused by an 

individual randomly placed and oriented additive molecule 

(taken as a non-point dipole). The HF calculation gives the 

ratio r¼sMR(e)/sSP(e) of the standard deviations of the en 

distributions for MR and SP around 1.75 (the estimate for 

point dipoles 11.9 and 5.5 D yields the ratio equal to 2.16). 

However, it is possible to expect that the real broadening of 

the site-energy distribution is for MR even higher than the 

calculated one because of its above-mentioned increased 

zwitterionic character due to polar environment. Taking into 

account both effects one can expect about 2.5-fold increase of 

the energetic disorder during the SP> MR reaction. 

The charge carrier mobility model of Grozema et al. 8 was 

modified in order to describe the charge transport along a 

polymer chain under the influence of photochromic polar 

Figure 2. The change of the on-chain electrostatic potential of tetramer caused by the one additive 

molecule oriented perpendicular (a) and parallel (b) to the chain. Mutual position of the tetramer and 

additive molecule is shown in the top part of the figure. 


DOI: 10.1002/pat


additives. According to the tight-binding approximation, the 

polymer chain is modeled by a sequence of N sites 

corresponding to the repeat units. The charge carrier motion 

on such a chain, in a non-dissipative model, can be described 

by the Hamiltonian 

H ¼ XN 

n¼1 

"na þ n an bn;nþ1ða þ nþ1 an þ a þ n anþ1Þ (2) 

where an and an þ are annihilation and creation operators of a 

charge carrier at an n-th site, en is the energy of a charge 

carrier localized at this site, and bn,nþ1 is the transfer integral 

between the sites n and nþ1. Both quantities en and bn,nþ1 are 

influenced by the random structure of the polymer chain and 

its surrounding. It is assumed that the influence of the 

additives on the electronic coupling between the polymer 

repeat units is small in comparison with the electrostatic 

charge–dipole interaction modulating the site energies en. 

Hence, for the model in this study the same distribution of 

the transfer integrals bn,nþ1 are used as Grozema et al. 8 for the 

description of the charge transport on PPV chain. The 

influence of substituents on bn,nþ1 distribution was neglected, 

but it was considered in the modeling of the en distribution. 

In the charge carrier mobility calculations reported in this 

paper, the polymer chain consisted of 4000 point centers. 

These centers represent alternatively bound phenylenes and 

vinylenes, i.e. the model chain consisted of 2000 phenylenevinylene 

units. In the case under study, this length is large 

enough for the chain to be considered infinite. Randomly 

oriented additive molecules, modeled as point dipoles, were 

randomly placed in the vicinity of the chain. It was assumed 

that no additive molecule was placed at a distance shorter 

than 10 A˚ from the chain. This value was estimated from the 

chemical structures of MEH-PPV and SP/MR, taking into 

account the presence of polymer substituents. The influence 

of the additive molecules at a distance more than 50 A˚ from 

the polymer chain was neglected. The additive molecules 

were placed also beyond the chain ends in order to ensure the 

homogeneity of the en distribution along the whole chain. 

The concentration of the additive was taken to be 

c¼4 10 4 A˚ 3 

. For each center representing a repeat unit, 

the energetic disorder was calculated as a sum of Coulombic 

electrostatic potentials from all additive molecules (cf. 

second term on the right side of eqn (1)). With regard to 

the value of the minimal distance of an additive molecule 

from the chain the size of the polymer repeat units was 

neglected. It should be pointed out that the In0 value of a 

vinylene unit was calculated to be 1.1 eV higher than that of a 

phenylene unit. 

The energetic disorder of en was calculated according to 

the above-described model for several values of the dipole 

moment of the additive m. For a typical value of m¼12 D the 

standard deviation of the en distribution is 0.37 eV. Note that 

this en distribution arises from the interaction of the hole with 

all considered additive molecules. If the mutual interaction 

of the additive molecules is neglected, the standard deviation 

of the en distribution is proportional to the dipole moment 

m of the additive and to the square root of the additive 

p ffiffi 

concentration, c. 

The concentration dependence of the level 

of the energetic disorder can be used to adjust the effective 

mobility switching. For example, if the additive concentration 

is four times lower, then the same degree of energetic 

disorder, and consequently the same on-chain mobility, 

would require an additive having twice the higher dipole 

moment. It should be noted that this model provides a 

realistic description of the very strong site to site correlation 

of en, which follows from the long-range character of the 

Coulombic interaction. 

Using the Hamiltonian (eqn (2)) with the molecular 

parameters en and bn,nþ1 generated according to the above 

described procedure and the hole wave function jC(t)i taken 

in the form of a linear combination of the states located at the 

individual sites, the time-dependent Schrödinger equation 

was numerically integrated. At t¼0, the hole was assumed 

localized on a single unit in the middle of the chain. Getting 

the wave function in the site representation, it is easy to 

calculate the mean-square displacement D 2 (t) of the charge 

carrier defined by the relation: 

D 2 ðtÞ ¼ cðtÞjn 2 jcðtÞ l 2 

(3) 

where l¼3.35 A˚ is the inter-unit distance. This quantity is 

related to the frequency dependent intramolecular ("onchain") 

charge carrier mobility m(v) by the well-known Kubo 

formula 20 

mðvÞ ¼ ev2 

2kBT Re 

Z1 D 2 2 

3 

4 ðtÞ expð ivtÞdt5 

(4) 

0 

where e is the elementary charge, kB is the Boltzmann 

constant, T is temperature, and v¼2pf is frequency of the 

external field. For the diffusive motion, which is expected in 

the long time limit due to the destructive interference even in 

the non-dissipative model, D 2 (t)/t. In this case the Kubo 

formula can be rewritten to the form of the Einstein relation: 

mðv ! 0Þ ¼ e 

2kBT 


D 2 ðtÞ 

t 

The dimensionless mean-square displacements D 2 (t)/l 2 

calculated for the undoped polymer chain and the chains 

doped by additives with dipole moments 6, 12, and 18 D are 

shown in Fig. 3. The presented data were obtained by 

averaging over 3000 realizations of the transfer integral and 

energetic disorder. The time evolution of D 2 (t) shows an 

initial rapid increase, which changes after about 10–25 psec to 

essentially linear time dependence, corresponding to the 

normal diffusive motion. For m¼18 D, D 2 (t) seems to be 

constant for t > 20 psec within the accuracy of the model, 

which means very small low-frequency mobility for this 

value of the additive dipole moment. For this reason, only 

dipole moments up to 12 D were considered for further 

calculations. 

Using the linear fit of D 2 (t) for the time range 25–70 psec, 

the mobility values extrapolated to the zero frequency 

m(v!0) were calculated according to eqn (5). It follows from 

Table 1 that the change of the additive dipole moment from 

ca. 6 D to 12 D (corresponding to the calculated change of the 

dipole moment during the photochromic reaction SP$MR) 


DOI: 10.1002/pat 

(5)

Figure 3. The dimensionless mean-square displacement calculated as a function of time for the 

undoped polymer chain (a) and the polymer chain doped by additives with different dipole 

moments m: (b) 6 D, (c) 12 D, (d) 18 D. 

should result in an almost five-fold decrease of the on-chain 

mobility. The effect would be even more pronounced if 

the experimental value of the MR dipole moment ( 18 D, 

see Ref. 19) is considered. 

The frequency-dependent hole on-chain mobilities m, 

calculated using eqn (4) for different values of the dipole 

moments of the additive, are shown in Fig. 4. All curves 

exhibit a saturation of m at low frequencies corresponding to 

the diffusive charge carrier motion in the long-time limit 

(t>25 psec), and a rapid increase for higher frequencies 

related to the fast initial hole delocalization (t


energies on adjacent sites, and therefore limits the diffusive 

charge carrier motion. Thus, the transport properties of a 

polymer chain can be reversibly changed by a photochromic 

reaction of the additive. The theoretical results were 

supported by the measurements of the photochromic change 

of conductance and capacitance. 


This work was supported by the Grant Agency of the Academy 

of Sciences of the Czech Republic (Project No. KJB1050301), 

by the Academy of Sciences of the Czech Republic (Project 

No. T400500402 in the program ‘‘Information Society"), by 

the Ministry of Education, Youth, and Sports (Project Nos. 

49/2004/CZ and 50/2004/CZ), by the Polish Committee for 

Scientific Research (Project Nos. 18/2004/CZ and 19/2004/ 

CZ), and by the Wroclaw University of Technology. 

REFERENCES 

1. Carter FL (ed.). Molecular Electronic Devices. Marcel Dekker: 

New York, 1982. 

2. Carter FL, Siatkowski RE, Wohltien H (eds). Molecular 

Electronic Devices. North-Holland: Amsterdam, 1988. 

3. Kawai T, Kunitake T, Irie M. Novel photochromic conducting 

polymer having diarylethene derivative in the main 

chain. Chem. Lett. 1999; 905–906. 

4. Kawai T, Nakashima Y, Irie M. A novel photoresponsive pconjugated 

polymer based on diarylethene and its photoswitching 

effect in electrical conductivity. Adv. Mater. 2005; 

17: 309–314. 

5. Delaire JA, Nakatani K. Linear and nonlinear optical properties 

of photochromic molecules and materials. Chem. Rev. 

2000; 100: 1817–1845. 

6. Skotheim TA, Elsenbaumer RL, Reynolds JR (eds). Handbook 

of Conducting Polymers (2nd edn). Marcel Dekker: New York, 

1998. 

7. Burroughes JH, Bradley DDC, Brown AR, Marks RN, 

Mackay K, Friend RH, Burns PL, Holmes AB. Light-emitting-diodes 

based on conjugated polymers. Nature 1990; 347: 

539–541. 

8. Grozema FC, van Duijnen PT, Berlin YA, Ratner MA, Siebbeles 

LDA. Intramolecular charge transport along isolated 

chains of conjugated polymers: effect of torsional disorder 

and polymerization defects. J. Phys. Chem. B 2002; 106: 7791– 

7795. 

9. Siebbeles LDA, Grozema FC, de Haas MP, Warman JM. 

Effect of backbone structure on charge transport along isolated 

conjugated polymer chains. Radiat. Phys. Chem. 2005; 

72: 85–91. 

10. Nesˇpu˚ rek S, Toman P, Sworakowski J. Charge carrier transport 

on molecular wire controlled by dipolar species: 

towards light-driven molecular switch. Thin Solid Films 

2003; 438: 268–278. 

11. Sworakowski J, Nesˇpu˚ rek S, Toman P, Wang G, Bartkowiak 

W. Reversible mobility switching in molecular materials 

controlled by photochromic reactions. Synth. Metals 2004; 

147: 241–246. 

12. Toman P, Bartkowiak W, Nesˇpu˚ rek S, Sworakowski J, 

Zales´ny R. Quantum-chemical insight into the design of 

molecular optoelectrical switch. Chem. Phys. 2005; 316: 

267–278. 

13. Valerián H, Brynda E, Nesˇpu˚ rek S, Schnabel W. The effect of 

polar additives on charge-carrier transport in polysilylenes. 

J. Appl. Phys. 1995; 78: 6071–6078. 

14. Nesˇpu˚ rek S, Valerián H, Eckhardt A, Herden V, Schnabel W. 

Charge carrier transport in poly(methylphenyl silylene): the 

effect of additives. Polym. Adv. Technol. 2001; 12: 306–318. 

15. Sworakowski J. Effect of dipolar arrays on the localization of 

charge carriers in molecular materials. IEEE Trans. Diel. El. 

Insul. 2000; 7: 531–536. 

16. Dürr H, Bouas-Laurent H. Photochromism. Molecules and 

Systems. Elsevier: Amsterdam, 1990. 

17. Broo A. Theoretical characterization of a multifunctional 

electrooptical molecular device: photochemical ring-opening 

mechanism of indolinospirobenzopyran. Int. J. Quant. 

Chem. 2000; 77: 454–467. 

18. Berlin YA, Miller JR, Plonka A, Hochstrasser RM, Hofacker 

GL (eds). Special Issue: rate processes with kinetic 

parameters distributed over time and space. Chem. Phys. 

1996; 212(1). 

19. Bletz M, Pfeifer-Fukumura U, Kolb U, Baumann W. Groundand 

first-excited-singlet-state electric dipole moments of 

some photochromic spirobenzopyrans in their spiropyran 

and merocyanine form. J. Phys. Chem. A 2002; 106: 2232–2236. 

20. Kubo R. Statistical-mechanical theory of irreversible processes. 

I. General theory and simple applications to magnetic 

and conduction problems. J. Phys. Soc. Jpn 1957; 12: 570–586. 


DOI: 10.1002/pat

Journal of Luminescence 112 (2005) 363–367 

Transient photoconductivity and charge generation in thin 

films of p-conjugated polymers 

Abstract 

Martin Weiter a,b, , Heinz Bässler b 

a Institute of Physical, Macromolecular and Nuclear Chemistry, Philipps University, Hans-Meerwein-Strasse, 

D-35032 Marburg, Germany 

b Faculty of Chemistry, Brno University of Technology, Purkynova 118, 61200 Brno, Czech Republic 

Available online 23 November 2004 

Transient photocurrents in thin films of methyl-substituted poly-phenylene (MeLPPP) and in phenyl-substituted 

poly-phenylenevinylene-type copolymer (PhPPV) were observed upon excitation by a laser flash. The questions on the 

origin of the optical charge generation and following charge transport in these materials are addressed. It has been 

argued that the observed current transient is a convolution of time-dependent charge carrier generation and their 

motion. By comparingthe field-dependent photogeneration yield in MeLPPP and PhPPV, transient absorption and 

double shot photogeneration, the rate-limiting steps for photoionization in studied polymers were identified. 

r 2004 Elsevier B.V. All rights reserved. 

PACS: 73.50.Gr 

Keywords: Transient photoconductivity; Exciton dissociation; Charge generation 


Photoinduced charge generation and transport 

are key elementary processes underlyingthe 

function of conjugated polymers. Frequently the 

photoionization in conjugated polymers are assumed 

to be tractable in terms of Onsager theory 

Correspondingauthor. Faculty of Chemistry, Brno University 

of Technology, Purkynova 118, 61200 Brno, Czech 

Republic. Tel.: +420 541 149 407; fax: +420 541 211 697. 

E-mail address: weiter@fch.vutbr.cz (M. Weiter). 

ARTICLE IN PRESS 

0022-2313/$ - see front matter r 2004 Elsevier B.V. All rights reserved. 

doi:10.1016/j.jlumin.2004.09.090 

www.elsevier.com/locate/jlumin 

[1–3]. It implies that intrinsic photogeneration is a 

multi-step process, the initial event beingeither 

the autoionization of a higher excited optical 

Franck–Condon singlet state yielding a coulombically 

bound geminate electron–hole pair (GP) or 

direct charge transfer [4]. Subsequently, the pair 

can recombine geminately or fully dissociate in the 

course of temperature and field-assisted diffusive 

escape process. Tactially, it has always been 

implied that in a bulk system the initial event that 

generate GPs is exothermic, i.e. not requiring any 

temperature or field assistance. Therefore, the

364 

measured field and temperature dependence of the 

photogeneration has solely to been attributed to 

the diffusive escape of the GP rather than its initial 

generation. However, since electric field assisted 

dissociation is at least quadratic in field it tends to 

vanish at moderate fields. This is at variance with 

photoconductivity studies that bear out a roughly 

linear field dependence at moderate field. The 

straightforward conclusion is that this residual 

effect is due to exciton dissociation at impurities 

actingas electron scavengers [5]. Based upon 

delayed field collection of optically generated 

charge carriers in a MeLPPP, it has been argued 

that the traditional Onsager approach fails to 

describe optical charge carrier generation because 

the essential field-assisted step is the primary 

dissociation rather than the secondary escape 

of the pairs from the coulombic well [6]. Experiments 

described in this paper performed with 

a broad temperature range will support these 

conclusions. 

2. Experiments 

In our study we focus on the charge carrier 

generation in methyl-substituted poly-phenylene 

(MeLPPP) and in phenyl-substituted poly-phenylenevinylene-type 

copolymer (PhPPV). Transient 

photocurrent measurements utilizingtime-of-flight 

method were performed on a sandwich cell with a 

dielectric layer. It was prepared by spin coatinga 

1% (by weight) polymer solution in chloroform 

onto an ITO (indium tin oxide) electrode. Some 

PhPPV samples were doped with 1% (by weight) 

of trinitrofluorene (TNF) as an electron acceptor. 

The thickness of the layer was typically 100 nm 

(MeLPPP) and 150 nm (PhPPV), respectively. In 

order to prevent hole injection, the ITO electrode 

was covered by a semitransparent aluminium 

layer. As a top electrode a 100 nm thick aluminium 

layer was evaporated. Transient photocurrents 

were observed upon excitation by a 5 ns flash of 

frequency doubled NdYaglaser at photon energy 

3.49 eV (355 nm) and/or by a 10 ns flash of dye 

laser at photon energy 2.74 eV (453 nm). The 

sample was mounted in a cryostat, which allowed 

coolingdown to 150 K. 


M. Weiter, H. Bässler / Journal of Luminescence 112 (2005) 363–367 

3. Results 

The efficiency of the charge generation was 

measured as a function of electric field, temperature, 

photon dose and polarity of irradiated 

electrode. Fig. 1a shows photocurrent transients 

in MeLPPP film at an incident photon dose of 

40 mJ pulse 1 at different external electric fields. 

The rise time of the photocurrent is determined by 

the RC time constant of the circuit which is about 

30 ns. At times, shorter than 1 ms and at low electric 

fields, the current features a plateau in a double 

logarithmic representative. At higher fields an 

algebraic decay followed by an almost exponential 

decay at t41 ms is observed. Fig. 1b shows 

complementary data on a PhPPV film at an electric 

field of 3.5 10 5 Vcm 1 and different light intensities. 

Data representation in double logarithmic 

Fig. 1. Transient photocurrents measured at room temperature 

(a) on MeLPPP at different electric field at incident photon dose 

40 mJ pulse 1 , (b) on PhPPV at different photon dose at electric 

field 3.5 10 5 Vcm 1 .

scale reveals a non-exponential decay extending 

into the 10 ms region. The shape of the j(t) time 

dependence is virtually invariant with light intensity. 

The additional measurements also confirm 

that the photocurrent is basically independent of 

polarity of the diode. The number of collected 

charges Q was calculated by integration of the 

current. The quantum yield of the photogeneration 

was calculated as the ratio of Q and the 

number of absorbed photons. Fig. 2 compares the 

quantum yield in undoped and doped PhPPV films 

and in MeLPPP film at the same incident light 

intensity. 

To elucidate whether or not there are longerlived 

GP we introduce a double-shot technique. 

After the initial single-shot excitation (hn1exc ¼ 

3:49 eV; 35 mJ pulse 1 ), the sample was reexcited 

by the second 5 ns pulse (hn2exc ¼ 2:74 eV; 

0.7 mJ pulse 1 ) with time delay ranging from 

200 ns to 50 ms. The photocurrents measured with 

different delay of the second excitation at electric 


M. Weiter, H. Bässler / Journal of Luminescence 112 (2005) 363–367 365 

field 7.3 10 5 Vcm 1 are depicted in Fig. 3. In the inset the currents are depicted in double logarithmic 

scale. Despite the fact that the photon dose of 

the second pulse is 50 times lower than the photon 

dose of the first one, the second photocurrent 

maximum is much higher than one would expect 

from the comparison of the number of absorbed 

photons at each pulse. Time relations of the 

second photocurrent maximum at different electric 

field are shown in Fig. 4, which exhibits a strong 

influence of the electric field on the delayed 

photogeneration. 

Fig. 2. A comparison of the for MeLPPP, PhPPV and PhPPV 

doped with 1% TNF at low photon dose (full symbols—ITO 

positive bias, open symbols—ITO negative bias). 

Fig. 3. Double shots photocurrents with eight different time 

delays of the second pulse at electric field 7.3 10 5 Vcm 1 . The 

energy of the first pulse at 3.49 eV was 35 mJ pulse 1 , the energy 

of the second pulse at 2.74 eV was 0.7 mJ pulse 1 . In the inset the 

same situation is depicted in double logarithmic scale. 

4. Discussion 

A transient current can be either transport or 

generation limited. From previous results it is 

known that electron transport has never been 

observed in these materials in time-of-flight 

experiment indicatingthat electrons are trapped 

within the time scale of the experiment. In 

MeLPPP films hole transport is trap-free yielding 

a hole mobility of 2 10 3 cm 2 V 1 s 1 with an 

exceptionally weak temperature and field dependence 

[7]. InFig. 1a, the expected transit time of 

holes is 25 ns, i.e. about three orders of magnitude 

shorter than the duration of the photocurrent

366 

Fig. 4. Time dependence of the maximum of the second peak of 

the photocurrent at different electric field intensities. The 

energy of the first pulse at 3.49 eV was 35 mJ pulse 1 , the energy 

of the second pulse at 2.74 eV was 0.7 mJ pulse 1 . 

pulse. Obviously, the observed transient photocurrent 

must be controlled by charge carrier 

generation rather than by their transport. This 

concurs with the fact that the duration of the 

signal is virtually independent at the electric field. 

Based upon a value of m ¼ 2 10 6 cm 2 V 1 s 1 

for mobility of holes in PhPPV [8], one could 

estimate the mean transit time of holes at Fig. 1b 

to be 4–40 ms. This could, indeed, be comparable 

to the measured duration of the current transient 

implyingit to be entirely transport limited. 

However, not observingany significant shortening 

the current pulse at higher fields cast doubt in this 

assignment. In any event, the observed current 

transient is a convolution of time-dependent 

charge carrier generation, transport and discharge. 

Since the measured current transient must 

involve dissociation after pulse excitation, the 

dissociatingentity has to be a metastable electron–hole 

pair produced from a short-lived initial 

optical absorption. However, it is open to con- 


M. Weiter, H. Bässler / Journal of Luminescence 112 (2005) 363–367 

jecture as to what the rate-determiningstep for 

generation of mobile carrier is. It is the primary 

field-dependent dissociation of a singlet exciton 

into a Coulombically bound GP or its subsequent 

escape from its initial potential. In order to 

distinguish the above possibilities additional experimental 

information is required. In the case of 

MeLPPP this was field-modulated picosecond 

transient absorption of charge carriers and excitons 

simultaneously. By comparingthe field 

dependence of the evaluation of the transient 

absorption of geminately bound positive polarons 

with the microsecond transient photocurrent 

signal, we could ascertain that it must be the 

field-assisted initial dissociation event which is rate 

controlling [9]. 

In the case of PhPPV the situation is different. 

Previous spectroscopic and cw-photoconduction 

[10] work on PhPPV without and with controlled 

dopingwith TNF showed that a neat PhPPV 

contains about 0.04% of dopants, which quench 

about 50% of excitations forms on electron–hole 

pairs on TNF and PhPPV already. Intentional 

dopingby 1% TNF can therefore increase the 

photogeneration of charge carriers by about a 

factor of 2 only, in agreement with Fig. 2. This 

proves that in this case the field assisted step for 

photogeneration must be the subsequent escape of 

the pair, i.e. an exciton, from its coulombic well 

while the initial event is the exciton diffusion 

towards the sensitizes followingthe charge transfer 

efficiency close to unity. Since this process is 

exothermic it does not require an electric field. 

Additional support for this argument is that in 

PhPPV the photoresponse is larger than in 

MeLPPP (Fig. 2) and is associated with a weaker 

field dependence although the field quenching of 

prompt fluorescence in MeLPPP and PhPPV turns 

out to be virtually identical. 

Additional probe of longer-lived GP was done 

usingdouble-shot technique. The question is 

whether or not there are geminate pairs that can 

be dissociated optically by a second laser pulse 

rather than decay by geminate pair recombination. 

After the re-excitation of the sample by the second 

laser pulse, the unusually substantial photoresponse 

is observed (see Fig. 3). The obvious source 

of this enhanced photogeneration must be the

dissociation of the GPs produced by the first pulse. 

Since the dissociation of GPs is field enhanced, the 

concentration of undissociated GPs has to be 

much higher at lower intensities of electric fields. 

The slope gradient of the time dependence of the 

delayed photocurrent maximum (Fig. 4) at low 

field intensities, which corresponds with lifetime of 

the bound GPs, proves this notion. This is also in 

accordance with the previous delayed fluorescence 

experiments on PhPPV that showed that delayed 

fluorescence in time scale up to microsecond 

originates from the radiative decay of GPs [11]. 

On the other hand, the concentration of free 

carriers increase with increasingfield. Thus, the 

influence of the recombination at increasing 

intensities of electric field of bimolecular recombination 

is enhanced, as it is demonstrated by the 

decreasingslope and followingincrease of the 

delayed photocurrent maximum in Fig. 4. 

5. Conclusion 

It is obvious that there are two processes 

occurringin the bulk of conjugated polymer that 

can give rise to photogeneration within the 

spectral range of the S 1 S 0 transition. One of 

them is the field-assisted dissociation into geminate 

pairs that subsequently can separate fully. This is a 

generic process but requires a strong electric field. 

The other one is sensitized photogeneration at 

either non-intentional or intentional dopants that 

can act as electron scavengers. The double-shot 


M. Weiter, H. Bässler / Journal of Luminescence 112 (2005) 363–367 367 

experiment proves that after the photoexcitation, 

the GP are created and consequently they can 

decay in time interval up to 10 ms. 

Acknowledgment 

We are indebted to V.I. Arkhipov for a 

clarifyingdiscussion. We thank U. Scherf for 

providingMeLPPP and Covion Organic Semiconductors 

for providingPhPPV. This work was 

supported by the EU project LAMINATE. 

References 

[1] L. Onsager, Phys. Rev. 54 (1938) 554. 

[2] M. Pope, E. Swenberg, Electronic Processes in Organic 

Crystals and Polymers, Oxford University Press, Oxford, 

1999. 

[3] See K. Mu¨ llen, G. Wegner (Eds.), Electronic Materials, the 

Oligomer Approach, Wiley-VCH, Weinheim, 1998. 

[4] L. Sebastian, G. Weiser, G. Peter, H. Bässler, Chem. Phys. 

95 (1983) 13. 

[5] C. Im, E.V. Emelianova, H. Ba¨ ssler, H. Spreitzer, J. Chem. 

Phys. 117 (2002) 2961. 

[6] D. Hertel, E.V. Soh, H. Bässler, L.J. Rothberg, Chem. 

Phys. Lett. 361 (2002) 99. 

[7] D. Hertel, H. Ba¨ ssler, U. Scherf, H.H. Horhold, J. Chem. 

Phys. 110 (1999) 9214. 

[8] J. Veres, C. Juhasz, Phil. Magn. B 75 (1997) 377. 

[9] M. Weiter, H. Bässler, V. Gulbinas, U. Scherf, Chem. 

Phys. Lett. 379 (2003) 177. 

[10] C. Im, E.V. Emelianova, H. Ba¨ ssler, H. Spreitzer, J. Chem. 

Phys. 117 (2002) 2961. 

[11] A. Gerhard, H. Ba¨ ssler, J. Chem. Phys. 117 (2002) 7350.

Mol. Cryst. Liq. Cryst., Vol. 430, pp. 227–233, 2005 

Copyright # Taylor & Francis Inc. 

ISSN: 1542-1406 print=1563-5287 online 

DOI: 10.1080/15421400590946433 

Reversible Formation of Charge Carrier Traps in 

Poly(Phenylenevinylene) Derivative due to the 

Phototransformation of a Photochromic Additive 

Martin Weiter 

Martin Vala 

Ota Salyk 

Oldrˇich Zmeskal 

Faculty of Chemistry, Brno University of Technology, Purkynova, 


Stanislav Nespu˚ rek 

Faculty of Chemistry, Brno University of Technology, Purkynova Brno, 

Czech Republic and Institute of Macromolecular Chemistry, Academy 

of Sciences of the Czech Republic, Prague, Czech Republic 

Juliusz Sworakowski 

Institute of Physical and Theoretical Chemistry, Wroclaw University 

of Technology, Wyb. Wyspianskiego, Wroclaw, Poland 

Kinetics of photochromic reaction of spiropyran dissolved in a poly(phenylenevinylene) 

derivative MEH-PPV was studied by optical and impedance spectroscopy. 

Spiropyran forms metastable, highly polar merocyanine under illumination with 

light of an appropriate wavelength. Due to charge-dipole interactions, charge 

carrier traps are formed and affect electrical properties of the polymer matrix, 

namely capacitance and photoconductivity. 

Keywords: electrical properties; photoconductivity; photochromism; spiropyran 

This work was supported by the grant 203=03=133 from the Czech Science 

Foundation and by the grant 4 T09A 132 22 from the Polish Committee for Scientific 

Research. 

Address correspondence to Martin Weiter, Faculty of Chemistry, Brno University of 

Technology, Purkynova 118, 612 00, Brno, Czech Republic. E-mail: weiter@fch.vutbr.cz 

227

228 M. Weiter et al. 

INTRODUCTION 

Nowadays multistable molecular systems attract much attention 

because of their potential use in optical and electro-optic devices such 

as broadband optical modulators, holographic and image-forming 

media, rectifiers and switching devices [1–3]. Molecular materials 

offer good processibility, low cost and easy modification of mechanical, 

optical and electrical properties by minor modification of their chemical 

structure. Current research has been mainly focused on systematic 

synthesis of novel chromophores in order to prepare doped polymeric 

matrices with enhanced electro-optic coefficients. Relatively little 

attention has been paid to the examination of electrical properties of 

such systems. 

Guest molecules will in general have different energy levels from 

the host. In particular, if ionization energies and electron affinities 

are suitably different, charge carrier traps can be formed. A special 

type of traps may occur if guest molecules possess a permanent dipole 

moment. The dipole moment contributes to the field acting on surrounding 

molecules and influences polarization energy. These dipolar 

traps are formed on neighboring host molecules, even though the 

impurity itself does not necessarily form a chemical trap. In our earlier 

papers [4–6] the concept of an electroactive molecular material was 

put forward whose electrical properties would be controlled by optical 

switching of photochromic species, either admixed into the polymer 

matrix or chemically attached to the polymer chain. The purpose of 

the present work is to examine the influence of charge carrier traps 

formed by photochromic additive on electrical properties of a pconjugated 

polymer matrix. 

EXPERIMENT 

The studied system consisted of p-conjugated photoconductive poly[2methoxy, 

5-(2 0 -ethyl-hexyloxy)-1,4-phenylenevinylene] (MEH-PPV) 

doped with 5 wt.% of photochromic spiropyran (SP): 6-nitro-1 0 ,3 0 ,3 0 ,trimethylspiro[2H-1-benzopyran-2,2 

0 -indoline]. The films, typically 

150 nm thick, were prepared by spin coating of chloroform solutions 

onto an indium tin oxide (ITO) electrode or quartz glass substrate. 

Vacuum evaporated 100 nm thick top Al electrodes completed the 

sandwich structures for electrical measurements. Dielectric properties 

were studied using a Hewlett Packard 4192 A impedance analyzer. 

The time dependences of capacitance and conductance were recorded 

at constant frequency (1 kHz). The reaction converting SP into its merocyanine 

(M) colored form was activated using a mercury discharge

lamp HBO-200 with band filter (360 20) nm. The measurements 

were performed in vacuum in the temperature range 298–350 K. 

RESULTS 

Reversible Formation of Charge Carrier Traps 229 

The photochromic behavior of spiropyran derivatives has been investigated 

by many researchers [7–9]. Under irradiation spiropyran exhibits 

photochromism as shown in Fig. 1. The compound is stable in 

its colorless closed-ring isomeric form, while UV irradiation produces 

a metastable open-ring isomer (M) absorbing at 550–600 nm. The 

absorption spectra of molecules constituting the studied system are 

shown in Fig. 2. The maximum of absorption band of MEH-PPV is 

situated at 445 nm, the addition of SP increases the absorption of 

the sample in the UV region. After irradiation with UV light the spectra 

exhibit a significant absorption band at 590 nm caused by the 

colored merocyanine form. The photoinduced color change of SP is 

caused by the extension of conjugation in the M isomer [10]. Thermal 

fading in the dark or irradiation with a He-Ne laser gradually restores 

the original spectrum, the change being fully reversible. The thermal 

ring-closure for different temperatures is shown in Fig. 3. The changes 

of the reactant concentration were determined following the 

absorbance at kmax ¼ 590 nm. The thermal reaction in solutions is a 

first-order process; in our experiments the decays were clearly nonexponential, 

being better fitted with so-called ‘stretched exponential’ 

function [11] in which the concentration of active species (nR) decays 

with time according to the equation 

nRðtÞ ¼nRð0Þ exp ð t=sÞ a ; ð1Þ 

where a is a parameter describing the deviation from a purely exponential 

decay (a < 1), nR(t) and nR(0) is the concentration of colored 

species at time t and s is a time constant presumed to be described 

FIGURE 1 Photochromism of the spiropyran molecule.


FIGURE 2 Absorption spectra of the MEH-PPV (dash-dot line), MEH-PPV 

mixed with spiropyran before (dashed line) and after UV irradiation (full line). 

In the inset the chemical structure of MEH-PPV is depicted (R1 ¼ methyl, 

R 2 ¼ 2-ethylhexyl). 

by the Arrhenius equation 

s A 1 expðEa=RTÞ: ð2Þ 

In this equation Ea is the activation energy and A is the pre-exponential 

(frequency) factor. Such a behavior can be rationalized assuming that 

the process is controlled by a distribution of rate constants. Using the 

method previously described [12], we determined the parameters of 

the Arrhenius equation. The analysis of the data depicted in Fig. 3 gives 

107 kJ=mol for the activation energy of the dominant process and 

2.9 10 13 s 1 for the frequency factor. 

Dipole moments of stable forms of spiro molecules ranges typically 

within (2 5) D depending on substituents attached to their backbones, 

whereas the moments of the merocyanine form may exceed 

10 D. Thus, during the SP!M photochromic reaction dipolar species 

are formed. As was mentioned above, in polymer matrix they can 

generate dipolar traps reducing the charge carrier mobility. Consequently, 

a decrease of the dark current and=or photocurrent can be 

observed [6]. The formation of traps during the irradiation was 

checked by impedance measurements. The result is depicted in Fig. 4.

During the illumination of the sample a photocurrent decay was 

observed instead of expected current saturation; we attribute the 

phenomenon to the formation of the metastable species during the 

photochromic reaction. Simultaneously, the capacitance of the system 

was found to increase due to the formation of dipolar species. When 

the light was switched off, the rapid decrease of the photocurrent 

was observed, whereas the capacitance of the system was found to 

decrease slowly following the kinetics of the the back ring closure reaction, 

M ! SP. The rate constant of the process follows the Arrhenius 

equation with Ea ¼ 88 kJ=mol and A ¼ 1.9 10 11 s 1 . The values are 

in a qualitatively good agreement with the results obtained from the 

optical measurements. 

CONCLUSIONS 


FIGURE 3 Time evolution of normalized absorbance at 585 nm due to the 

dark M!SP reaction. The quotient on the vertical axis is proportional to the 

concentration of the reactant. Inset: (concentration time) vs. time dependence. 

The position of the maxima correspond to the inverse of the dominant 

rate constants [12]. 

The kinetics of the reversible photochromic reaction merocyanine ! 

spiropyran, i.e. the slow disappearance of the open-form dipolar species, 

was studied using the optical and impedance methods. The rates


FIGURE 4 Time evolution of the conductance and capacitance of the sample 

measured by impedance spectroscopy at room temperature. The vertical 

arrows indicate the time when the UV irradiation was switched on and off, 

respectively. 

and characteristic parameters of the photochromic processes detected 

from changes in the capacitance by impedance spectroscopy qualitatively 

follow the parameters of photochromic changes detected optically. 

We can conclude that photochromic transformation of 

spiropyran produced charge carrier traps affecting the electrical 

properties of the polymer matrix, capacitance and photoconductivity 

in particular. Thus, an optical signal can be transformed into an electrical 

one and a polymeric optron can be, in principle, constructed. 

REFERENCES 

[1] Dalton, L. R., Steier, W. H., & Robinson, B. H. (1999). J. Mater. Chem., 9, 119. 

[2] West, K. S., West, D. P., & Rahn, M. D. (1998). J. Appl. Phys., 84, 5893. 

[3] Metzger, R. M. (1999). Acc. Chem. Res., 32, 950. 

[4] Nespu˚ rek, S. & Sworakowski, J. (2001). Thin Solid Films, 393, 168. 

[5] Nespu˚ rek, S., Toman, P. & Sworakowski, J. (2003). Thin Solid Films, 268, 438–439. 

[6] Nespu˚ rek, S., Sworakowski, J., Combellas, C., Wang, G., & Weiter, M. (2004). Appl. 

Surf. Sci., 234, 395. 

[7] Brown, G. A. (Ed.) (1971). Photochromism, Wiley-Interscience: New York. 

[8] Dürr, H. & Bouas-Laurent, H. (Eds.) (1994). Photochromism. Molecules and 

Systems, Elsevier: Amsterdam.


[9] Crano, J. C. & Guglielmetti, R. J. (Eds.) (1999). Organic Thermochromic and Photochromic 

Compounds, Kluwer: Dordrecht. 

[10] Zhi., J. F., Baba, R., Hashimoto, K., & Fujishima, A. (1995). J. Photochem. Photobiol., 

92, 91. 

[11] Berlin, Yu., A., Miller, J. R., & Plonka., A. (Eds.) (1996). Special Issue: Rate 

Processes with Kinetic Parameters Distributed over Time and Space, Chem. 

Phys., 212, 1–246. 

[12] Sworakowski, J. & Nespu˚ rek, S. (1998). Chem. Phys. Lett., 298, 21.

Abstract 

Plasma polymerisation of methylphenylsilane 

O. Salyk a, T, P. Broza a , N. Dokoupil a , R. Herrmann a , I. Kuritka b , J. Prycek a , M. Weiter a 

a Faculty of Chemistry, Brno University of Technology, Purkynova 118, Brno, Czech Republic 

b Faculty of Technology, Tomas Bata University in Zlin, T. G. Masaryk sq. 275, Zlin, Czech Republic 

Available online 12 March 2005 

Microwave electron cyclotron resonance plasma afterglow chemical vapour deposition (MW ECR PA CVD) and radio frequency plasma 

enhanced CVD (RF PE CVD) of plasma-poly(methylphenylsilane) (p-PMPS) were examined according to plasma composition and resulting 

thin film properties. Direct mass spectrometry monitoring and gas chromatography and mass spectroscopy (GC MS) of cold-trapped plasma 

products were used. Deposited samples were measured mainly on luminescence. The low pressure MW ECR plasma creates species for layer 

growth by a smaller average number of inelastic collisions per origin of monomer molecule. The exploitation of monomer reaches 23% in 

comparison with RF plasma (5–7%) and the deposition rate is larger (1.5 nm s 1 ) in comparison with RF plasma (0.2 nm s 1 ). The inelastic 

collision rate is primarily more important for growing layers than the power introduced into plasma. The luminescence spectra of both MW 

and RF samples are compared. 

D 2005 Elsevier B.V. All rights reserved. 

Keywords: Polysilane; PMPS; Plasma deposition; Mass spectroscopy 


Polysilanes are potential materials for both UV and VIS 

luminescence application, so they are frequently studied [1]. 

Their linear j-conjugated chains can be easily broken and 

cross-linked and their luminous properties deteriorated by 

this way. Short chains of corresponding oligomers exhibit 

very similar optical properties [2], as they can be stabilized in 

any rigid matrix. Horvath et al. [3] proved the preservation of 

luminous centres in an amorphous matrix of surrounding 

plasma polymer. Their samples were prepared by radio 

frequency plasma enhanced chemical vapour deposition (RF 

PE CVD) method. It is known that microwave electron 

cyclotron resonance plasma afterglow CVD (MW ECR PA 

CVD) method is friendlier to the growing film because of its 

less disordering. The difference can be found on luminescence 

properties because the IR and UV-VIS absorption 

spectroscopy are not sufficiently sensitive in respect to the 

low concentration of luminous centres in examined material. 

T Corresponding author. 

E-mail address: salyk@fch.vutbr.cz (O. Salyk). 

Surface & Coatings Technology 200 (2005) 486–489 

0257-8972/$ - see front matter D 2005 Elsevier B.V. All rights reserved. 

doi:10.1016/j.surfcoat.2005.02.054 

This study is devoted to the comparison of both plasma 

depositions resulting in plasma polymer films with 

luminous properties. 


www.elsevier.com/locate/surfcoat 

Plasma poly(methyl phenyl silane) (p-PMPS) was 

deposited in both MW ECR (2.45 GHz) and RF (13.56 

MHz) discharge chambers from the methyl-phenylsilane 

monomer. 

MW apparatus consists of a remote plasma source and the 

substrates are placed in the afterglow region. Also monomer 

vapour is introduced by a gas bshowerQ in the afterglow 

towards the substrate surfaces. Operating pressure is in 

principle at the vicinity and below 1 Pa, so the mean free path 

of the monomer molecule is comparable to the characteristic 

dimension of MW apparatus and monomer molecule can 

undergo only few inelastic collisions on its path. The 

deposition conditions in the MW ECR PA CVD chamber 

were matched on optimum discharge stability and thin film 

deposition rate. Hydrogen (30 sccm H2, 1 Pa) in the 

mixture with monomer (0.25 Pa) should passivate dangling

Fig. 1. PMPS fragments power dependence of species created in MW 

afterglow discharge. Species of 121 mu is molecule depleted by hydrogen 

atom, species of 78 mu is benzene and species of 26 mu is acetylene. Dot 

lines in no discharge region are only intuitive guides for the eyes. 

bonds in the growing layer. The power was varied by 

magnetron current set up. The dwelling time of the 

reaction mixture is estimated and sustained at 8 s by 

setting the valve on the pump inlet. One series of samples 

was prepared in a stepwise set up power from 17 to 66 W, 

while the substrates were replaced using a carousel holder 

without vacuum break. The deposition rate at 17 W was 

0.4 nm s 1 , and at other powers remained constant at 1.5 

nm s 1 to a finishing thickness of 300 nm. 

The RF deposition chamber contains symmetric configuration 

with a central hot electrode and two opposite 

grounded electrodes with positioned substrates, which are 

in direct contact with plasma. The operating pressure/flow 

rate was kept in range from 10 to 60 Pa at 30 sccm H2 and 

10–40 Pa monomer, so the mean free path of the monomer 

molecule can undergo much more inelastic collisions on its 

path compared with the previous case. Diffusion is regarded 

as prevailing transport mechanism in plasma discharge. The 

deposition conditions in the RF PE CVD chamber were not 

too far from the volume powder creation regime. The power 

was varied by the RF generator set up. One series of 

samples was prepared in stepwise set up power from 75 to 

140 W. 

The fragmentation of monomer was observed by a mass 

spectrometer directly connected to the reaction chamber in 

both deposition processes. Mass spectra were picked up 

during steady conditions at various powers introduced into 

the plasma including the state without the discharge. Also, 

operation parameters of used apparatuses were controlled in 

this manner. The conditions in the discharge were stabilized 

after about 10 s after the monomer valve opening. Opening 

the shutter started each deposition in order to avoid layer 

profile inhomogeneities. In the other case the transient effect 

in plasma composition can influence initial growing layer 

properties. 

A cryogenic trap was used in order to collect plasma 

species for further analysis by gas chromatography and 

O. Salyk et al. / Surface & Coatings Technology 200 (2005) 486–489 487 

mass spectroscopy (GC MS) method described in [4]. For 

this purpose we devised the liquid nitrogen cryogenic trap. 

It consists of a cylindrical steel vessel immerged in liquid 

nitrogen and attached directly to the discharge chamber by a 

valve. To adjust the pumping speed the cryogenic trap was 

provided with a small and varying aperture diaphragm. 

After sample collection, defined volume of pure argon was 

injected into the trap trough the chromatographic septum. 

Argon was used as a marker and internal standard for 

quantification in GC-MS measurements. For the analysis of 

trapped volatile gas species the GC MS chromatograph 

TRIO 1000, FISONS INSTRUMENTS with the column 

DB-5MSITD ( 30 m, 0.25 mm, 0.25 Am) was used as a 

detector of species separated by column served by the 

quadruple mass spectrometer. Both gas and liquid phases of 

collected sample were analysed. 

The films were deposited on Si wafers for IR absorption 

and luminescence measurements and quartz glass plates for 

UV-VIS spectra picking up. 


The mass spectroscopic analysis of reaction gases is 

depicted in Figs. 1 and 2 for significant species in both 

MW and RF discharges. The most of heavier species 

(molecule MPS depleted by H atom—121 mu) are 

decomposed stepwise with power and their concentration 

decreased, but the highest breakthrough occurred at the 

beginning at the transition from non-discharge to the 

weakest discharge conditions. In case of MW it can be 

explained by the inelastic collision rate, which is at low 

pressure early saturated. Also, the deposition rate is early 

saturated and remains practically constant in the region 

25–70 W. The important splitting products of monomer 

molecule were detected benzene (78 mu) and acetylene (26 

mu). Benzene is considered as the product of phenyl (77 

mu) hydrogenation on the relative long path of species 

Fig. 2. PMPS fragments power dependence of species created in RF 

discharge.

488 

from the reaction chamber to the quadrupole analyzer and 

dominates comparing with phenyl. Dissociated hydrogen 

for that is available both like the dissociation product of 

feeding gas and product of splitting monomer itself. The 

power development of benzene and acetylene concentration 

can be explained by cascaded decomposition (benzene 

and phenyl splits to acetylene) but the power effect is not 

so apparent because of statistically low collision rate. In 

RF plasma inelastic collision rate due to higher pressure 

furthermore continues and acetylene peak is still growing 

with power. Toluene (tropylium-mass 91) was observed 

both in RF and MW plasmas; i.e. under high and low 

pressure condition. 

GC MS chromatography enabled analysis of the trapped 

plasma reaction products. The phenylsilane is the reminder 

of monomer molecule after demethylation. The assumption 

of important role of methyl group transfers in polymerisation 

processes is supported by the presence of dimethyland 

trimethylphenylsilane in the gas phase chromatogram. 

Various disilanes and heavier species were detected, which 

fact testifies the presence of synthetic reactions in collected 

samples. Unfortunately we are not able at present to 

interpret GC-MS signals of all detected species unambiguously. 

Most of the species detected in samples were trapped 

Table 1 

Representatives of species detected by GC MS in collected samples both 

from RF and MW plasmas 

Comments to molecule 

identification (highest 

m/z + Detected in 

of MS spectrum, 

significant fragments, 

structural units and groups) 

RF MW 

Benzene + + 

Toluene + + 

Phenylsilane + + 

Methylpenylsilane Monomer (also the only 

one relevant peak in 

blank samples) 

+ + 

Dimethylfenylsilane + + 

Phenyltrimethylsilane + 

Ethyphenyldimethylsilane + 

Diphenylsilane + + 

Unidentified species 241, Disilane, 

dimethyldiphenyl, 

+ + 

342, Methylphenylsilanyl, 

phenylsilane, 

methyl, phenyl 

+ 

295, Phenylsilanyl, 

biphenyl, alkyl 

+ 


phenyl, alkyl 

(4 or more carbons) 

+ 


phenyl, alkyl 

(4 or more carbons) 

+ 

389, Phenylsilanyl, phenyl, 

alkyl 

+ 


phenyl, alkyl 

+ 

O. Salyk et al. / Surface & Coatings Technology 200 (2005) 486–489 

Fig. 3. Excitation and emission spectra of MW ECR CVD films of p-PMPS 

for 17 and 66 W of introduced power. 

from RF plasma contained Si-phenyl structural unit (see 

Table 1). 

Let us touch the question of conversion efficiency 

measured by GC MS method. In the RF apparatus working 

in the optimal regime (from the point of thin film quality) 

only small conversions about (5.0F2.0)% were reached, 

testifying suppression of the monomer unit destruction by 

the high feed gas flow rate. The monomer conversion in 

MW ECR PE CVD is approximately three or four times 

higher, in this analysis (23.0F5.0)%. The long period of 

remaining molecules in the discharge region and its quick 

condensation after inelastic collision leads to higher conversion 

efficiency and the simpler reaction product composition. 

Generally, the observed monomer conversion is 

usually above 20% in MW ECR PE CVD in comparison 

of common 5–7% in RF PE CVD. 

The samples were tested on UV VIS and IR absorption 

measurement, but the results were very uniform and cannot 

be distinguished from both deposition methods and power 

effect. They do not differ from those presented in [3]. The 

difference occurred in luminescence measurements. The 

Fig. 4. Excitation and emission spectra of RF CVD films of p-PMPS for 

140 W introduced power.

comparison of both MW and RF samples is in Figs. 3 and 4. 

The excitation spectra of MW samples show excitation peak 

at 290 nm corresponding to j–j* transition in dimethylsilane 

chain measured at evaporated films [5] and 325 nm of 

methylphenylsilane chain at spin coated films (e.g. [6]), 

which confirms the presence of such short chains like 

luminescent centres. Their measurements did not allow 

extension to the larger wavelengths at set emission of 347 

nm but existence of 325 nm absorption is apparent. 

Emission parts are more complicated, but also contain 

corresponding peaks at 350 nm region. Moreover, stronger 

luminescence belonging probably to more complicated 

luminous centres occurs in the blue region. Emission 

intensity was only slightly dependent on mw power until 

the power exceeded 50 W. The 66 W case showing the 

luminous deterioration is depicted in Fig. 3. All the emission 

spectra were measured at the same excitation wavelength 

293 nm (of supposed j–j* exciton absorption) and 

intensity. 

The RF samples exhibit more complicated excitation and 

emission spectra in Fig. 4 but the previous mechanism can 

also be distinguished. The luminous intensity was usually 

comparably weaker. 


The power dependence of the plasma composition was 

monitored by direct mass spectroscopy and by GC MS 

spectroscopy of cold trapped plasma products. An effect of 

inelastic collision rate was concluded. The low pressure 

MW ECR plasma products lower number of species for 

layer growth than it is in the case of RF plasma; the 

exploitation of the monomer and deposition rate is larger in 

comparison with RF plasma. The inelastic collision rate is 

primarily more important for growing layers than the power 

introduced into plasma. In RF plasma, the pressure up to 

tens Pa causes many collisions on monomer molecule path 

and the number of inelastic ones depends on the power 

introduced. 

It was observed that the RF PE CVD is a system 

producing a large variety of species at used polymerisation 

pressure. This fact is reflected in the complicated system of 

reactions that lead to disordered bonding for RF plasma 

deposited thin film. It is obvious that under such conditions, 

only using the regimes of small monomer conversion gives 

material with preserved 1D silicon chains [7,8]—see model 

in Fig. 5. 

O. Salyk et al. / Surface & Coatings Technology 200 (2005) 486–489 489 

Fig. 5. Model of short chain in amorphous plasma polysilane matrix. 

A sensitive luminescence measurement can detect the 

power deterioration. It was demonstrated that the plasmapoly(methylphenylsilane) 

p-PMPS exhibits luminescence in 

a near UV region similarly as a standard polymer prepared 

by chemical synthesis. At the highest power of the 

excitation beam the luminescence intensity falls, probably 

due to radiation damage of the polymer-like components in 

deposited films. UV luminescence together with good 

adhesion and degradation resistance made from plasma 

polysilanes are feasible and perspective materials for device 

construction. 


The support of the following grant is acknowledged: 

Czech Grant agency contract 202/00/518. 

I. Kuritkas’ work in Zlin was supported by the project of 

the Ministry of Education, Youth and Sports of the Czech 

Republic No. MSM 265200015. 

References 

[1] S. Hayase, Prog. Polym. Sci. 28 (3) (2003) 359. 

[2] H. Usui, Thin Solid Films 365 (2000) 22. 

[3] P. Horvath, F. Schauer, I. Kuritka, O. Salyk, M. Weiter, N. Dokoupil, S. 

Nespurek, V. Fidler, Monatsh. Chem. 132 (1) (2001) 177. 

[4] A.M. Wrobel, G. Czeremuszkin, H. Szymanowski, J. Kowalski, Plasma 

Chem. Plasma Process. 10 (2) (1990) 277. 

[5] N. Tanigaki, H. Kyotani, M. Wada, A. Kaito, Y. Yoshida, Eun-Mi Han, 

K. Abe, K. Yase, Thin Solid Films 331 (1-2) (1998) 229. 

[6] S. Nespurek, Macromol. Symp. 104 (1996) 285. 

[7] F. Schauer, S. Nespurek, P. Horvath, J. Zemek, V. Fidler, Synth. Met. 

109 (1–3) (2000) 321. 

[8] S. Nespurek, P. Toman, J. Sworakowski, Thin Solid Films 438 (2003) 

268.

PROOF COPY 056402JAP 

JOURNAL OF APPLIED PHYSICS VOLUME 95, NUMBER 2 15 JANUARY 2004 

Charge transport in highly efficient iridium cored 

electrophosphorescent dendrimers 


Jonathan P. J. Markham and Ifor D. W. Samuel a) 

School of Physics and Astronomy, University of St Andrews, North Haugh, St Andrews, 

Fife, KY16 9SS, United Kingdom 

Shih-Chun Lo and Paul L. Burn 

The Dyson Perrins Laboratory, Oxford University, South Parks Road, Oxford, OX1 3QY, United Kingdom 

Martin Weiter and Heinz Bässler 

Institute of Physical, Nuclear and Macromolecular Chemistry and Material Science Center, 

Philipps-Universität Marburg, Hans-Meerwein-Strasse, D-35032 Marburg, Germany 

�Received 5 August 2003; accepted 23 October 2003� 

Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. 

They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present 

an investigation into the optical and electronic properties of highly efficient phosphorescent 

dendrimers. The effect of a dendrimer structure on charge transport and optical properties is studied 

using temperature-dependent charge-generation-layer time-of-flight measurements and current 

voltage (I – V) analysis. A model is used to explain trends seen in the I – V characteristics. We 

demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and 

show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive 

layers. Power efficiencies of 20 lm/W were measured for a second-generation �G2� Ir(ppy) 3 

dendrimer with a 1,3,5-tris�2-N-phenylbenzimidazolyl�benzene electron transport layer. © 2004 

American Institute of Physics. �DOI: 10.1063/1.1633336� 

I. INTRODUCTION 


Since early reports of organic electroluminescence �EL� 

in small molecules, 1 

polymers, 2 

and conjugated 

dendrimers, 3,4 dramatic improvements in the efficiency and 

stability of these materials have been achieved. Now, external 

quantum efficiencies �EQEs� of organic light-emitting diodes 

�OLEDs� are of the order of 10%–20% 5 and lifetimes 

in excess of 10 000 h �Ref. 6� have been reported. In particular, 

the development of electrophosphorescent devices 7 has 

allowed triplet harvesting and the production of such highly 

efficient devices. In this area, iridium-based phosphors have 

received much attention due to their highly efficient phosphorescence, 

color tunability, and relatively short excited 

state lifetime. Both evaporated 8 and solution processed 9 devices 

have been reported. Our approach to solution processing 

of phosphorescent materials is to use conjugated dendrimers 

and we have developed highly efficient single and 

bilayer devices using this method. 10,11 

Time of flight �TOF� mobility measurements are a powerful 

technique for the investigation of charge transport in 

organic materials. However, they have not yet been applied 

to electrophosphorescent materials. Here, we apply the technique 

in the context of electrophosphorescent dendrimers, 

which give us scope for the tuning of properties, such as 

interchromophore spacing and thus the mobility. An important 

feature of this work is the use of the charge-generationlayer 

time-of-flight �CGL-TOF� method �explained in Sec. 

a� Electronic mail: idws@st-and.ac.uk 

II�. For the conventional, bulk-excitation TOF method, a 

very thick ��m dimensions� film is usually necessary. For 

solution processable materials, this often entails the production 

of a drop cast film. Two problems arise in using this 

technique. One is that the morphology of the sample may be 

very different from that produced by spin coating, and mobility 

in organic materials has been shown to be heavily dependent 

upon the morphological properties of small molecules 

and polymers. The second is that the mobility is 

measured upon a sample that is of much greater thickness 

than that used for OLEDs. In many cases of dispersive transport, 

a thickness dependence of the mobility is observed and 

this may call into question the relevance of such measurements 

to light-emitting device �LED� design. In the present 

work, we overcome both these problems by utilizing a spincoated 

layer of �400 nm thickness and a charge-generation 

layer of absorptive dye. This enables a well-defined charge 

generation point even in a thin sample. It therefore allows the 

study of much thinner samples that can be produced by spin 

casting with morphological properties of direct relevance to 

LED structures. We have recently reported measurements of 

nondispersive hole transport in a fluorescent blue-emitting 

dendrimer film using the above technique. 12 

Conjugated dendrimers consist of a light-emitting core, 

dendrons, and surface groups that control the processing 

properties. One of the great advantages of this molecular 

framework is that each of the components can be tuned independently 

to control the color of emission, degree of intermolecular 

interaction, and solubility as required for different 

applications. Dendrimers can be synthesized in an orderly 

0021-8979/2004/95(2)/1/8/$20.00 1 

© 2004 American Institute of Physics


2 J. Appl. Phys., Vol. 95, No. 2, 15 January 2004 Markham et al. 



manner such that the macromolecules are monodisperse and 

the structure is precisely known. Thus, there is little issue of 

batch to batch reproducibility. It has already been shown that 

a dendrimer consisting of a fluorescent core and wide bandgap 

dendrons behaves very much like a molecularly doped 

polymer albeit with a much more regulated and accurately 

controlled interchromophore separation. 13 

Charge transport has been studied widely in solutionprocessible 

conjugated polymers. It is known for these systems 

that different solvents and spinning conditions can produce 

very different thin-film morphologies. In addition, even 

in relatively ordered materials, such as ladder-type polymers, 

sample history has been shown to have a dramatic effect on 

the measured charge transport and optical properties. 14 This 

may partly explain the wide range of mobilities measured for 

some of these materials. 15 The mobility of carriers along 

polymer chains can be quite high 16 and, in these cases, the 

rate-limiting step is the degree of disorder in the material. 

This makes the optimization of the mobility within a neat 

organic layer relatively challenging for most spin-coated materials. 

However, in contrast, dendrimers allow the precise 

control of the core separation. In this article, we demonstrate 

that by altering the generation number �or branching� and 

attachment point of the dendron to the core we are able to 

fine tune the hole mobility and optical properties of these 

highly efficient iridium-based dendrimers. 

II. EXPERIMENT 

FIG. 1. Structures of the three iridium dendrimer systems �from the left-hand side� G1pIr, G1mIr, and G2mIr. 

The dendrimers studied here are based on a fac tris�2phenylpyridine� 

iridium �Ir(ppy) 3� core, phenylene dendrons 

and 2-ethylhexyloxy surface groups. They are: 

G1-meta-Ir(ppy) 3 �hence referred to as G1mIr), G1-para 

Ir(ppy) 3 (G1pIr), and G2-meta (ppy) 3 (G2mIr). Their 

structures are shown in Fig. 1. All are soluble in organic 

solvents, such as tetrahydrofuran, toluene, and chloroform. 

G1mIr has been previously used to give very high efficiency 

solution processed OLEDs. 10,11 

CGL-TOF measurements were performed on 300–400 

nm thick films spin coated onto cleaned indium-tin oxide 

�ITO� substrates �sheet resistance 20 �/�� from 40 mg/ml 

chloroform solution. Subsequently, 10 nm of perylene diim- 

ide charge-generation layer was evaporated onto the device 

covering the whole substrate. The device was completed by 

deposition of 100 nm of aluminum to give an active pixel 

area of approximately 5 mm 2 . The excitation wavelength was 

chosen to pass through the bulk film under study and to be 

absorbed by the perylene dye. Charge carriers were generated 

within the perylene layer by excitation from a 10 ns 

pulse of a frequency-doubled Nd:Yttrium aluminum garnet 

laser at a wavelength of 532 nm. The packet of charge carriers 

was then swept through the device under an applied 

field, and the time for the packet to travel across the device is 

known as the transit time (t T). The aluminum electrode was 

biased positively and the photocurrent signal detected from 

the ITO using the 50 � input of a digital storage oscilloscope. 

The applied bias led to the electrons photogenerated 

in the perylene diimide layer being removed from the device 

at the aluminum electrode and holes being injected into the 

dendrimer from the perylene dye and consequently swept 

across the device to be annihilated at the ITO electrode. 

Thus, the measured photocurrent transients correspond to 

hole currents. 

Single and bilayer LEDs were fabricated on solution 

etched ITO substrates. The ITO was cleaned in ultrasonic 

baths of acetone and 2-propanol, before oxygen plasma ashing 

under a pressure of 10 �2 mbar at 100 W for 5 min 

�Emitech Model K-1050X�. Dendrimer films were spin 

coated from 20 mg/ml chloroform solutions to give film 

thicknesses of 120 nm for single layer devices and 80 nm for 

bilayer devices. Cathode evaporation of 20 nm of calcium 

capped with 100 nm of aluminum completed the single layer 

devices. Bilayer devices were fabricated by evaporation of 

50 nm of 1,3,5-tris�2-n-phenylbenzimidazolyl�benzene 

�TPBI� as an electron transporting/hole blocking layer and a 

cathode of 1 nm LiF capped with 100 nm aluminum completed 

the device. In both cases, the pixel area was approximately 

8 mm 2 . 

All EL measurements were performed under a vacuum 

using a Keithley 2400 source measure unit and calibrated 

photodiode. Efficiency calculations were performed by measuring 

the light output in the forward direction 17 and bright-


J. Appl. Phys., Vol. 95, No. 2, 15 January 2004 Markham et al. 



FIG. 2. �a� G1mIr transient photocurrent at room temperature and field of 

1.2�10 6 V/cm. �b� The same transient photocurrent plotted in a double 

logarithmic form. 

ness measurements were cross checked with a Minolta 

LS-100 luminance meter. 

III. RESULTS AND DISCUSSION 

A. Mobility measurements 

The CGL-TOF method was used to measure the mobilities 

of G1pIr, G1mIr, and G2mIr iridium cored dendrimers 

shown in Fig. 1. A typical transient for a G1mIr film of 330 

nm thickness at room temperature and an applied field of 

1.2�106 V/cm is shown in Fig. 2�a�. It can be seen that the 

transient is weakly dispersive. After the initial photocurrent 

peak, there is a long photocurrent tail. The shoulder is close 

to the photocurrent peak because the sample is much thinner 

than the micron thicknesses usually used in TOF. The mobility 

can be calculated from the intersection of the asymptotes 

to the two power-law regions of the transients �Fig. 2�b��. 

Using Eq. �1�, we calculate a mobility of 4.5 

�10�5 cm2 /Vs 

�� d2 

. �1� 

Vttr Here � is the mobility, d the device thickness, V the applied 

voltage and t tr the transit time. 

The transients shown here are weakly dispersive at room 

temperature, however an attempt to analyze them in terms of 

the Scher–Montroll 18 theory was not successful. When plotted 

on a double logarithmic scale, this theory relates the two 

power-law regions of the transient before and after the transit 

time by a disorder parameter �, as seen in Eq. �2� 

I�t��t ��1�� 

�t�t tr� 

I�t��t ��1�� 

�t�t tr�. �2� 

Thus, if � is constant before and after the transit time then 

the slopes of the two regions should add to �2. At room 

temperature �298 K� for the iridium dendrimer systems studied 

here, this is not the case, as seen in Fig. 2�b�. All transients 

for all generations add up to between �1.2 and �1.4. 

Deviations from the model have been observed in several 

systems, including molecularly doped polymer 19 and conjugated 

polymer systems. 14 

Monte Carlo simulations 19 have shown that the initial 

decay of the dispersive transient is associated with a certain 

disorder. The slope of the initial decay for G1mIr �before the 

transit time� of �0.08 can be compared with simulated transients 

in Ref. 19 and translates into a Gaussian width of the 

density of states �DOS�, �ˆ of 4.0. �ˆ is related to the experimentally 

accessible � via Eq. �3� 

�ˆ � � 

. �3� 

kT 

From �ˆ of 4.0 and T�298 K, we obtain an estimate of � 

�103 meV for G1mIr. This is much higher than that measured 

for structurally well ordered conjugated polymers, 

where a � of 52 meV was reported, but comparable to some 

molecularly doped polymer systems �typically in the region 

of 80–100 meV� 14 and more disordered conjugated materials, 

such as PPV. 20 

An important parameter in the understanding of charge 

transport is the temperature dependence of the mobility and 

its effect on the shape and the scale of the photocurrent transients. 

The influence of temperature on the transients is 

shown in Fig. 3, measured upon a sample of 430 nm thickness. 

It can be seen from Fig. 3�a� that at high temperatures 

�343 K�, the transit is nondispersive, with a visible plateau 

region characteristic of Gaussian transport, followed by a 

broad tail. The transient was measured at a field of 1.2 

�105 V/cm. However at low temperatures �203 K� �Fig. 

3�b��, the transient is completely dispersive, since carriers do 

not attain dynamic equilibrium. The field in this case was 

3.25�105 V/cm. 

A transition from dispersive to nondispersive transport is 

highly significant and can be interpreted in the framework of 

earlier simulations based on Monte Carlo methods. 19 These 

provide a relation that enables calculation of the temperature 

at which such a transition should occur �Eq. �4�� 

�ˆ 2�� 2 

�44.8�6.7 log d, �4� 

kTc� where � is the width of the DOS, Tc is the transition temperature, 

and d is the sample thickness in cm. The transition 

temperature Tc can be obtained from the change in slope of 

3





FIG. 3. �a� Transient photocurrent for G1mIr measured at 343 K. �b� G1mIr 

transient at 203 K. 

the graph of the mobility at a given field versus (1000/T) 2 . 

Figure 4 shows the temperature dependence of G1mIr at a 

field of 1.2�10 5 V/cm. The experimentally measured T c of 

293 K is much higher than that reported for a phenyl-amino 

substituted PPV where a transition temperature of 153 K was 

measured. 14 For a film thickness of 430 nm and a transition 

temperature of 293�5 K, this translates to a Gaussian width 

of DOS of 99.6�1.7 meV. 

In Fig. 5�a�, transients for G1mIr are shown at two different 

applied fields, scaled to the transit time. The shapes of 

the transients are apparently independent of field, even over 

FIG. 4. Mobility vs (1000/T) 2 for G1mIr. 

FIG. 5. �a� Room-temperature transient photocurrents of G1pIr at high and 

low fields normalized to transit time �b� the same for G1mIr. 

fields differing by more than an order of magnitude. In the 

case of Gaussian charge carrier transport, the dispersion of a 

sheet of carriers migrating through the sample can be calculated 

from Eq. �5�, assuming the validity of the Einstein relation 

eD��kT 

w��kT , �5� 

eU 

where w is the dispersion, T is the temperature in Kelvin, and 

U is the applied voltage in V. Using the values for the data in 

Fig. 2, an applied voltage of 40 V �equivalent to a field of 

1.2�106 V/cm) and a temperature of 298 K leads to w 

�0.045. Experimentally, the dispersion can be obtained from 

Eq. �6� 

w� t1/2�t tr 

, �6� 

t1/2 where ttr is the carrier transit time and t1/2 is the time by 

when the current has decayed to half of the plateau value, 

From Fig. 2, we obtain w�0.399, almost an order of magnitude 

greater. If the tail broadening of the transients were 

due to thermal diffusion as expected for Gaussian transport, a 

change in field by an order of magnitude would result in a 

decrease in w by a factor of over 3. This is clearly not seen 

here. Earlier simulations have shown that the anomalous 

broadening of tails in TOF signals is a characteristic of nondispersive 

transport, due to the Gaussian DOS in these 

materials. 21 These simulations indicate that the degree of disorder 

in the material is closely linked with the dispersion.





FIG. 6. Transient photocurrents for G1pIr, G1mIr, and G2mIr all scaled by 

transit time. 

The observation of nondispersive transport, albeit at higher 

temperatures, is in marked contrast to highly disordered materials 

such as PPV. 22 

We have so far examined the transport properties of a 

first generation iridium cored phosphorescent dendrimer in 

detail. We next consider the effect of changing generation, 

which changes the dendrimer core spacing, and investigate 

its impact on charge transport. Figure 6 shows traces of 

G1mIr and G2mIr normalized to the transit time. G1pIr is 

also shown and will be discussed later. Remarkably, the photocurrent 

transients are the same for both generations and 

overlap when scaled by transit time. This shows that the role 

of the dendrons is to simply slow the carrier packet by separating 

the core regions, and they have little effect on the tail 

broadening of the packet. This is a highly significant result 

that illustrates the power of the dendrimer concept to independently 

modify material parameters for individual applications. 

It can be seen from Fig. 5�b� that transients from 

G1pIr at different fields also scale by transit time, however 

the tails to these transients are much broader than those seen 

for G1mIr. This may indicate a greater level of disorder to 

the transport in this material. This can be seen more clearly 

when compared to the meta-linked dendrimers in Fig. 6. 

The electric-field dependence plotted in the Poole– 

Frenkel formalism 23 of the mobility versus E 1/2 is shown in 

Fig. 7�a� for all three dendrimer structures. It can be seen that 

all three materials give a good fit to this functional form. The 

generation number and core configuration allow a fine control 

of the mobility. G1pIr displays a zero-field mobility 

(� 0) �calculated by extrapolating the fit to the data to zero 

field�, of1.9�10 �6 cm 2 /V s. G1mIr has � 0 a factor of 2 

lower at 9.7�10 �7 cm 2 /V s. G2mIr is three times lower still 

with � 0 of 3.5�10 �7 cm 2 /V s. However, the field dependence 

of the three systems is different. Despite having the 

highest zero-field mobility, the field dependence of G1pIr is 

much lower than G1mIr, resulting in mobility values that 

cross at higher fields. G2mIr has a slightly lower field dependence 

than G1mIr. Yu et al. 24,25 have used a geometrical 

model to explain the origins of field dependence in conjugated 

materials. Lower field dependence �correlating with an 

increased value of E 0) is borne of a more rigid geometrical 

FIG. 7. �a� Poole–Frenkel plot of mobility vs E 1/2 for all three dendrimer 

structures. �b� Mobility vs E for all three dendrimer structures. The lines 

depict fits to I – V data �discussed in Sec. III C�. 

structure, which allows less perturbation to the morphology 

under an applied field. The field dependence of the mobility 

versus E is plotted in Fig. 7�b�. The line fits are from a 

computational model that will be discussed in Sec. III B. 

B. Device modeling 

As the charge transport measurements using CGL-TOF 

are made on films of thickness relevant to LEDs, it is instructive 

to compare those results with measurements of current– 

voltage (I – V) characteristics made on actual devices. Conjugated 

dendrimers provide excellent systems upon which to 

study microscopic charge transport properties due to the ability 

to fine tune the mobility and the independence of morphology 

on preparation conditions. This can be used to test 

device models of OLEDs. 26–31 A widely used model has 

been developed by Davids et al. 28 This model is different 

from the Gaussian disorder model, however, we use it here 

because it is simpler and still offers useful insight. A combined 

treatment of thermionic emission over a barrier and 

tunneling is used to describe the injection of charge into the 

organic material, which yields the charge-carrier density at 

the electrode. The coupled Poisson, drift, and continuity 

equations are then solved through the device using a Poole– 

Frenkel field dependent mobility of the form shown in 

Eq. �7� 

5





FIG. 8. I – V curves and model fits for G1pIr, G1mIr, and G2mIr hole only 

devices. 

��E�� 0e�E/E 0, �7� 

where �0 and E0 are the field independent mobility and field 

dependence of the mobility, respectively. In our implementation, 

the model is simplified by not accounting for the diffusion 

of carriers, and we have previously shown good quality 

fits using this model on both a conjugated polymer 29 and 

fluorescent conjugated dendrimers. 12 Mobility parameters 

determined in both of these cases were found to agree with 

experimental measurements using TOF at room 

temperature. 27 This model has also been used to calculate the 

temperature dependence of OLEDs as well as the effect of 

oxidation on the mobility values. 29 It has been shown previously 

that injection occurs into the core of the dendrimer 12 

and thus the barrier to injection is constant for all 

generations. 

In order to study hole transport in LEDs, we have prepared 

hole only devices of neat films of each of the three 

dendrimers with ITO and gold electrodes. A positive voltage 

was applied to the ITO and the measured current must be due 

to holes as the barrier to electron injection is around 2.5 eV 

from the gold electrode. Figure 8 shows the I – V characteristics 

of 100 nm thick devices. It can be seen that for fields 

above 0.8 MV/cm, a given current density requires higher 

fields in the sequence G1mIr, G1pIr, G2mIr. The lines indicate 

the model fits to the data using the barrier height and 

the material parameters �0 and E0 as the fitting parameters. 

The fits to the data qualitatively follow the experimental I – V 

curves. At lower fields, there are some deviations and this is 

believed to be due to the influence of space charge on the 

injection, which is not incorporated into the model. 12 

The mobility parameters obtained by the model for Eq. 

�7� agree very well with the CGL-TOF data. The fits are 

shown as the solid lines in Fig. 7�b�, and the mobility measured 

by CGL-TOF as point data. This suggests that the 

model can provide useful information on charge transport in 

dendrimer LEDs. The mobility parameters obtained are 

shown in Table I. The barrier height is essentially similar for 

all three materials, at �0.47 eV. ITO is reported to have a 

work function in the region of 4.8–5.2 eV, 32 depending upon 

TABLE I. Fitting parameters for modelling the I–V characteristics of hole 

only devices. 

Material 

Barrier height 

�eV� � 0 �cm 2 /V s� E 0 �V/cm� 

G1mIr 0.47 9.3�10 �7 8.7�10 4 

G1pIr 0.47 2.0�10 �6 1.5�10 5 

G2mIr 0.48 3.5�10 �7 1.1�10 5 

the exact treatment conditions. The highest occupied molecular 

orbital �HOMO� levels for all three dendrimers have been 

determined from cyclic voltammetry measurements to be 

close to 5.6 eV. 11 Hence, the barrier deduced is consistent 

with plasma treated ITO and the measured dendrimer 

HOMO. 

The EL spectra of the three dendrimers are shown in Fig. 

9. Systematic studies of the effect of conjugation on iridium 

complexes have also shown that substitution onto the pyridine 

ring affects the position of the lowest unoccupied molecular 

orbital �LUMO�, while the HOMO level has largely 

metal character. 33 Thus, one possible explanation as to the 

origin of the 17 nm redshift for G1pIr may be explained by 

the lowering of the LUMO level by 0.08 eV, with the HOMO 

unaffected. The difference in I – V characteristics is then attributable 

to the morphology of the samples and the effects 

of the dendron substitution to the core. The values for � 0 

obtained using the model are in very good agreement with 

those measured by the Poole–Frenkel fits to the CGL-TOF 

data. The model also correctly shows the reduced field dependence 

of G1pIr. 

C. Controlling device performance 

by chemical structure 

The three materials studied here allow subtle control of 

charge transport without major changes to the energy levels 

of the system. We achieve this by use of a single molecule 

and so avoid the potential risk of phase separation that is 

common in blend systems. Single layer devices were fabricated 

with 120 nm of neat dendrimer between plasma etched 

ITO and calcium/aluminum electrodes. The EQEs are shown 

FIG. 9. EL spectra of each of the dendrimers under study.





FIG. 10. EQE vs current density for G1pIr, G1mIr, and G2mIr single layer 

devices with Ca/Al cathodes. 

in Fig. 10, in both semi-logarithmic �Fig. 10�a�� and double 

logarithmic plots �Fig. 10�b��. It can be seen that the quantum 

efficiency of G2mIr is the highest, while G1mIr is 

greater than G1pIr at low current densities but not at higher 

ones. It appears, therefore, that for a single layer device, the 

lower the mobility of the carriers, the higher the quantum 

efficiency. A single layer device has no confinement mechanism 

for charge carriers thus it is logical to reason that the 

lower mobility of holes gives them more opportunity to recombine 

with electrons before they reach the cathode. This 

has been shown by Blom and co-workers 34 on a family of 

PPV derivatives, where the increased quantum efficiency of 

the lower mobility materials is attributed to a reduction in 

quenching from the cathode. 

It can also be seen from Fig. 10�b� that for both firstgeneration 

dendrimers, the EQE does not saturate with current 

density. This continual increase implies that the chargecarrier 

balance improves with increasing field. Thus, not only 

is the effect of increased generation to slow the mobility of 

the majority carriers, but also to aid carrier balance. This has 

been observed previously in a family of fluorescent dendrimers, 

and the increase in efficiency with generation was attributed 

to the improved balance of carrier transport, allowing 

relatively mobile holes more opportunity to meet with 

trapped electrons. 35 

FIG. 11. EQE and power efficiency for dendrimer bilayer devices with 

TPBI. 

In order to improve the efficiency of OLEDs a heterostructure 

of hole and electron transporting materials is often 

used. 1 In addition to the greater charge carrier confinement 

afforded by such a structure, a build up of charge at the 

interface between the two materials leads to a feedback 

mechanism allowing easier injection of carriers into the device. 

Thus, we fabricated bilayer devices from an 80 nm hole 

transporting layer of neat dendrimer and 50 nm of electron 

transporting material, TPBI. A LiF/Al cathode completed the 

device in this case. The EQEs and power efficiencies of these 

devices are shown in Fig. 11. Again, it can be seen that the 

dendrimer generation has a large effect on the performance 

of these devices. G2mIr shows double the EQE and power 

efficiency of the G1 devices. However, in this instance, the 

difference between the two first generation dendrimers is 

smaller. Excellent power efficiencies of 20 lm/W for neat 

G2mIr-based bilayers and 10 lm/W for neat G1mIr-based 

devices render these high efficiencies for solution processed 

OLEDs with neat emissive layers. This shows that the ability 

to fine tune the charge transport by dendrimer generation and 

structure is a useful tool for making balanced and efficient 

devices. 

IV. CONCLUSION 

We have reported a detailed study of charge transport in 

electrophosphorescent organic semiconductors. The materials 

studied here are dendrimers closely related to fac tris�2phenylpyridine� 

iridium �Ir(ppy) 3� which is widely used in 

OLEDs. We find that we can fine tune the mobility by den- 

7



drimer generation, and that the transport dynamics can be 

related to the structural configuration of the dendrimers. In 

addition, we have investigated both the field and the temperature 

dependence of these unique materials. The TOF indicates 

that energetic disorder can account for the general 

transport properties in these materials. A � of 100 meV corresponds 

well with that measured for some molecularly 

doped polymers and some of the more disordered conjugated 

polymers. The transport is weakly dispersive at room temperature, 

and a transition to nondispersive transport is seen at 

elevated temperatures. A measured transition temperature Tc of 293 K is much higher than that measured for conjugated 

polymers. This may be due to specific properties of the metal 



complex core or disorder introduced by the morphological 

properties of the dendrimer. We show that by increasing the 

generation of the dendrimer, we simply lower the mobility 

and do not increase the level of disorder in the film, as reflected 

in identical levels of tail broadening for the first- and 

second-generation material. By increasing the generation, we 

are able to improve the balance of charge carriers and are 

able to create efficient single layer LEDs. In addition, even 

higher efficiencies can be obtained in a bilayer structure, 

with the dendrimer architecture having a large impact on the 

performance of the device. 

ACKNOWLEDGMENTS 

The authors thank Dr. J. M. Lupton for supplying the 

charge transport model and for helpful advice. They are very 

grateful to Professor K. Müllen for providing the perylene 

derivative. The authors acknowledge financial support from 

EPSRC, SHEFC, CDT Oxford Ltd, the EU project LAMI- 

NATE, and the Fond der Chemischen Industrie. One of the 

authors �I. D. W. S.� is a Royal Society University Research 

Fellow. 

1 

C. W. Tang and S. A. Van Slyke, Appl. Phys. Lett. 51, 913 �1987�. 

2 

J. H. Burroughes, D. D. C. Bradley, A. R. Brown, R. N. Marks, K. 

Mackay, R. H. Friend, P. L. Burn, and A. B. Holmes, Nature �London� 

347, 539�1990�. 

3 

M. Halim, J. N. G. Pillow, I. D. W. Samuel, and P. L. Burn, Adv. Mater. 

�Weinheim, Ger.� 11, 371 �1999�. 

4 

P. W. Wang, Y. J. Liu, C. Devadoss, P. Bharathi, and J. S. Moore, Adv. 

Mater. �Weinheim, Ger.� 8, 237�1996�. 

5 

M. Ikai, S. Tokito, Y. Sakamoto, T. Suzuki, and Y. Taga, Appl. Phys. Lett. 

79, 156�2001�. 

6 

C. W. Tang, Inf. Disp. 12, 16�1996�. 

7 M. A. Baldo, D. F. O’Brien, Y. You, A. Shoustikov, S. Sibley, M. E. 

Thompson, and S. R. Forrest, Nature �London� 395, 151�1998�. 

8 M. A. Baldo, S. Lamansky, P. E. Burrows, M. E. Thompson, and S. R. 

Forrest, Appl. Phys. Lett. 75, 4�1999�. 

9 C.-L. Lee, K. B. Lee, and J-J. Kim, Appl. Phys. Lett. 77, 2280 �2000�. 

10 J. P. J. Markham, S.-C. Lo, S. W. Magennis, P. L. Burn, and I. D. W. 

Samuel, Appl. Phys. Lett. 18, 13�2002�. 

11 S.-C. Lo, N. A. H. Male, J. P. J. Markham, S. W. Magennis, P. L. Burn, O. 

V. Salata, and I. D. W. Samuel, Adv. Mater. �Weinheim, Ger.� 13, 975 

�2002�. 

12 J. P. J. Markham, T. D. Anthopoulos, I. D. W. Samuel, G. J. Richards, P. L. 

Burn, C. Im, and H. Bässler, Appl. Phys. Lett. 81, 3266 �2002�. 

13 J. M. Lupton, I. D. W. Samuel, R. Beavington, M. J. Frampton, P. L. Burn, 

and H. Bässler, Phys. Rev. B 63, 155206 �2001�. 

14 D. Hertel, H. Bässler, U. Scherf, and H. H. Hörhold, J. Chem. Phys. 110, 

9214 �1999�. 

15 H. C. F. Martens, P. W. M. Blom, and H. F. M. Schoo, Phys. Rev. B 61, 

7489 �2000�. 

16 R. J. O. M. Hoofman, M. P. de Haas, L. D. A. Siebbeles, and J. M. 

Warman, Nature �London� 392, 54�1998�. 

17 N. C. Greenham, R. H. Friend, and D. D. C. Bradley, Adv. Mater. �Wein- 

heim, Ger.� 6, 491 �1994�. 

18 H. Scher and E. W. Montroll, Phys. Rev. B 12, 2455 �1975�. 

19 P. M. Borsenberger, L. T. Pautmeier, and H. Bässler, Phys. Rev. B 46, 

12145 �1992�. 

20 E. Lebedev, T. Dittrich, V. Petrova-Koch, S. Karg, and W. Brütting, Appl. 

Phys. Lett. 71, 2686 �1997�. 

21 P. M. Borsenberger and H. Baessler, J. Appl. Phys. 75, 967�1994�. 

22 P. W. M. Blom and M. C. J. M. Vissenberg, Phys. Rev. Lett. 80, 3819 

�1998�. 

23 H. Bässler, Phys. Status Solidi B 15, 175 �1993�. 

24 Z. G. Yu, D. L. Smith, A. Saxena, R. L. Martin, and A. R. Bishop, Phys. 

Rev. Lett. 84, 721 �2000�. 

25 Z. G. Yu, D. L. Smith, A. Saxena, R. L. Martin, and A. R. Bishop, Phys. 

Rev. B 63, 085202 �2001�. 

26 B. K. Crone, I. H. Campbell, P. S. Davids, D. L. Smith, C. J. Neef, and J. 

P. Ferraris, J. Appl. Phys. 86, 5767 �1999�. 

27 I. H. Campbell, D. L. Smith, C. J. Neef, and J. P. Ferraris, Appl. Phys. 

Lett. 74, 2809 �1999�. 

28 P. S. Davids, I. H. Campbell, and D. L. Smith, J. Appl. Phys. 82, 6319 

�1997�. 

29 J. M. Lupton and I. D. W. Samuel, J. Phys. D 32, 2973�1999�. 

30 I. H. Campbell, P. S. Davids, D. L. Smith, N. N. Barashkov, and J. P. 

Ferraris, Appl. Phys. Lett. 72, 1863 �1998�. 

31 I. H. Campbell, D. L. Smith, C. J. Neef, and J. P. Ferraris, Appl. Phys. 

Lett. 75, 841 �1999�. 

32 D. J. Milliron, I. G. Hill, C. Shen, A. Kahn, and J. Schwartz, J. Appl. Phys. 

87, 572�2000�. 

33 S. Lamansky, P. Djurovich, D. Murphy, F. Abdel-Razzaq, H-E. Lee, C. 

Adachi, P. E. Burrows, S. R. Forrest, and M. E. Thompson, J. Am. Chem. 

Soc. 123, 4304 �2001�. 

34 P. W. M. Blom, M. C. J. M. Vissenberg, J. N. Huiberts, H. C. F. Martens, 

and H. F. M. Schoo, Appl. Phys. Lett. 77, 2057 �2000�. 

35 J. M. Lupton, I. D. W. Samuel, R. Beavington, P. L. Burn, and H. Bässler, 

Adv. Mater. �Weinheim, Ger.� 13, 258 �2001�.

Abstract 

A molecular device based on light controlled charge 

carrier mobility 

Stanislav Nesˇpu˚rek a,b , Juliusz Sworakowski c,* , Catherine Combellas d , 

Geng Wang a , Martin Weiter b 

a Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovsky Sq. 2, 


b Technical University of Brno, Purkyòova 118, 612 00 Brno, Czech Republic 

c Institute of Physical and Theoretical Chemistry, Wroclaw University of Technology, 

Wyb. Wyspianskiego 27, 50-370 Wroclaw, Poland 

d Environnement et Chimie Analytique, ESPCI, 10 rue Vauquelin, 75231 Paris Cedex 05, France 

Available online 25 June 2004 

Electrical properties of binary samples containing photoconducting poly[methyl(phenyl)silylene] with admixed photochromic 

spiropyran were investigated. A reversible chemical reaction of the photochromic system, driven by light and producing 

highly polar metastable species, manifests itself in a reversible modification of dark currents and photocurrents. The behaviour 

of the samples is explained assuming a reversible production and annihilation of dipolar traps associated with the polar 

molecules produced in the photochromic process. Use of similar materials as elements of molecular electroactive systems is 

postulated. 

# 2004 Published by Elsevier B.V. 

PACS: 72.20.Jv; 72.80.Le; 73.50.Gr 

Keywords: Electrical properties; Photoconductivity; Photochromism; Poly(silylene); Spiropyran 


Applied Surface Science 234 (2004) 395–402 

A characteristic feature of molecular materials is 

their almost infinite susceptibility to modification of 

their physical properties due to minor modifications 

of their chemical structures. Among the materials of 

interest, multistable molecular systems have recently 

* 

Corresponding author. Tel.: þ48 71 3203468; 

fax: þ48 71 3203364. 

E-mail addresses: nespurek@imc.cas.cz (S. Nesˇpu˚rek), 

sworakowski@pwr.wroc.pl (J. Sworakowski), 

catherine.combellas@espci.fr (C. Combellas). 

0169-4332/$ – see front matter # 2004 Published by Elsevier B.V. 

doi:10.1016/j.apsusc.2004.05.056 

attracted much attention because of emerging prospects 

of their application. On the microscopic scale, 

their use as elements of logic in molecular-scale 

devices was first envisaged by Carter [1]. 

An example of bistable molecular systems are 

photochromic molecules undergoing reversible 

changes of the absorption spectra when exposed to 

certain types of irradiation and reverting to their 

original colours when stored in the dark or irradiated 

light of a different wavelength (see, e.g., [2–4]). The 

simplest detection of a photochromic reaction is the 

optical one as temporal changes in the optical absorption 

or reflection can be measured in a straightforward

396 S. Nesˇpu˚rek et al. / Applied Surface Science 234 (2004) 395–402 

way. In this way many optical devices can be constructed, 

e.g. radiation flux modulators and controllers, 

holographic and image-forming media, optical 

storages and data display systems. However, in some 

devices an electrical response is more desirable; in this 

case use of opto-electronic transducers is necessary, 

making any device more complex. 

An alternative approach is to develop a material 

whose electrical properties would be modified in a 

controlled way by incident light. Such a material could 

be used as a kind of simple and direct ‘opto-electronic 

transducer’, on both, micro- and macroscopic scale. In 

our earlier papers [5–7], a concept of an electroactive 

molecular material has been put forward, whose electrical 

properties would be controlled by optical switching 

of photochromic species, either admixed into the 

polymer matrix or chemically attached to the polymer 

chain. The earlier papers [5–7] were focused on properties 

of an isolated polymer chain and its potential use as 

a molecular switch. In this paper we concentrate on 

electrical properties of macroscopic samples built of 

such molecules, presenting a direct method to transfer 

the photochromic reaction into an electrical response. 

2. Theoretical background 

2.1. Photochromism 

A photochromic process can be schematically 

described as a photoreversible reaction which, in its 

simplest form, can be written as: 

SP @ hn1 

hn2;kT M 

In general, hn1, the activating radiation (typically from 

the UV and/or visible regions), causes a chemically 

stable molecule SP (absorbing at a wavelength 

l1 ¼ c=n1) to convert to a product M (absorbing at 

l2 ¼ c=n2). The product M is thermodynamically less 

stable and can revert to the original form SP via a 

thermal excitation or upon photoexcitation with l2. In 

most systems, the photochromic cycle is usually a 

multi-stage process involving several elementary processes 

depending on the nature of the system (see, e.g., 

[2–4]). 

For the purpose of this paper, photochromic systems 

of interest should be selected so as to ensure an 

important difference between the dipole moments 1 

of the stable and metastable forms or between their 

ionisation energies (see the following sections). Spirooxazines 

[8,9] and spiropyrans [10,11] (whose dipole 

moments are higher in their metastable forms), and 

aminoazobenzenes [12] (whose dipole moments are 

lower in the metastable forms), can be mentioned in 

this context. In the following, we shall focus on 

systems containing spiropyran as a photochromic 

component. The dipole moments of stable forms of 

spiro-molecules amount typically to 2–5 D depending 

on substituents attached to their backbones, whereas 

the moments of respective metastable forms may 

exceed 10 D. 

2.2. Transport and trapping of charge carriers 

The equation relating the dark current or photocurrent 

(j) flowing in a plane-parallel macroscopic 

(isotropic) sample can be written as 

j ¼ enmFA (1) 

where e is the unit charge, n the free charge carrier 

concentration, m the effective charge carrier mobility, 

F the electric field and A the electroded area of the 

sample. Upon changing the concentration of charge 

carrier traps one can modify the nm product. Similar 

changes can also be seen in the photoconductivity: 

illumination of a photoconducting sample results in an 

increase of the carrier concentration to n ph , where 

nph ¼ gt is the concentration of free carriers generated 

by light (g is the number of carriers produced by light 

and t the lifetime of charge carriers). The formation of 

traps modifies the charge carrier range tmF, and hence 

the photocurrent. 

Important for a proper design of electroactive molecular 

materials is a question concerning the nature of 

local centres (traps) capable of localising charge 

carriers. Lyons [13,14] demonstrated that in perfect 

molecular crystals, the energies of bands for excess 

charge carriers, measured with respect to the vacuum 

level, are determined by ionisation energies and electron 

affinities of constituent molecules, and by the 

energy of electrostatic interactions of a carrier 

(momentally residing on a given molecule) with elec- 

1 Dipole moments will be expressed in Debye units (D) 

throughout this paper. 1 D ¼ 3.33 10 30 Cm.

trically neutral surrounding molecules. The latter 

parameter is referred to as the polarisation energy 

P. Traps for charge carriers occur on sites where, 

locally, the molecular ionisation energy or electron 

affinity, and/or polarisation energy are different from 

the respective values characterising the perfect solid 

[15,16]. 

A particular type of traps may occur if guest molecules 

possess a permanent dipole moment. These 

molecules may themselves act as chemical traps if 

their energy levels fulfil at least one of the relations 

mentioned above. Moreover, independently of the 

position of the energy levels of the polar dopant, its 

dipole moment contributes to the field acting on 

surrounding molecules and modifies the local values 

of the polarisation energy. Thus the presence of a polar 

molecule in a non-polar environment results in producing 

local states (dipolar traps) on neighbouring host 

molecules, even though the impurity itself does not 

necessarily form a chemical trap. Calculations [17,18] 

demonstrate, in agreement with results of experiments 

performed by several groups [19–24], that parameters 

of such traps (their depths, cross-sections, etc.) depend 

on the dipole moment of the dopant, as well as on the 

concentration and mutual orientation of the dipoles. 

The depths of dipolar traps for strongly polar guest 

molecules (the dipole moment larger than 10 D) may 

exceed 0.5 eV. 

The trap-controlled mobilities (m) are reduced with 

respect to those measured in perfect solids (m0)bya factor Y expressing the free-to-total charge density 

ratio: 

m 

¼ Y ¼ 

m0 n 

(2) 

n þ nt 

where nt stands for the density of trapped carriers. In 

the simplest case of a nearly perfect solid containing 

one set of discrete traps [25] the parameter Y amounts 

to 

Y ¼ 1 þ M 

exp 

Nc 

Et 

(3) 

kBT 

where Nc is the effective density of transport states, M 

the concentration of traps and Et their depth. Note that 

the decrease of the mobility is equivalent to a decrease 

of the current flowing in the sample. 

In disordered solids, apart from the modification of 

the trap depths (cf., e.g., [26]), one should also expect 

1 

S. Nesˇpu˚rek et al. / Applied Surface Science 234 (2004) 395–402 397 

a modification of the shapes of the density-of-states 

(DOS) functions. The importance of the latter effect 

can be estimated basing on the model put forward by 

Bässler [27,28]. The model, confirmed by results of 

numerous experiments, predicts that the mobilities 

should exhibit non-Arrhenius temperature dependences, 

their magnitudes decreasing with increasing 

widths of the DOS functions. The latter parameter is 

related to the concentration and the dipole moments of 

the dopant [20–22]. 

The above discussion demonstrates that the presence 

of dipolar species in molecular solids should 

result in a reduction of the effective mobilities of 

charge carriers due to trap formation and/or broadening 

of the distribution of hopping states. The trends 

in both cases are similar, though their relative importance 

depends on the parameters of the material and 

polar additives. 


Poly[methyl(phenyl)silylene] (PMPSi) ((a) in 

Scheme 1) was prepared by sodium-mediated Wurtz 

coupling polymerisation [29,30] (Mw ¼ 4 

10 4 g mol 1 ). Metal-free phthalocyanine (H2Pc) ((b) 

in Scheme 1) was obtained from Tokyo Kasei and 

purified by sublimation in a temperature gradient. 

Photochromic spiropyran, 6-nitro-1 0 ,3 0 ,3 0 -trimethylspiro[2H-1-bezopyran-2,2 

0 -indoline] (SP), ((c) in 

Scheme 1) was obtained from Aldrich Co. and used 

without further purification. 

Films of PMPSi with admixed SP (PMPSi-SP) for 

electrical measurements were prepared by spin coating 

a toluene solution on conductive ITO glasses or 

glass substrates. The thicknesses of the films ranged 

between 500 nm and 1 mm. The concentration of 

admixed SP in the samples used in the experiments 

reported in this paper amounted to 5 wt.%. After 

deposition, the films were dried at 0.1 Pa and 330 K 

for at least 4 h. Top Al electrodes, 40–60 nm thick, and 

in some cases H2Pc films, were deposited by vacuum 

evaporation. 

Current–voltage (j–U) characteristics were measured 

in a sandwich configuration using a Keithley 

6175A electrometer. For photoconductivity measurements, 

the samples were irradiated with a quartz 

tungsten halogen lamp equipped with a monochroma-


tor. The reaction converting SP into its coloured form, 

merocyanine (M), was activated using a Hg mercury 

discharge lamp HBO-200 with water and band (340 

20 nm) filters. The measurements were performed at 

room temperature. 

4. Results 

The spectra of molecules constituting the system 

studied in this work are shown in Fig. 1. The spectrum 

of SP in its stable (non-coloured) form contains four 

bands in the UV region peaking at 345, 299, 275 and 

240 nm. Illumination of spiropyran with 340 nm light 

results in a shift of the 345 nm peak to 375 nm, and in 

the appearance of a new band with the maximum at 

590 nm. This change is fully reversible: our experiments 

showed that the band in the visible region could 

be bleached thermally in ca. 80% within ca. 1 h at 

room temperature, and completely in ca. 24 h. 

In the spectral range covered by our measurements, 

the spectrum of neat PMPSi consists of two bands 

Scheme 1. Chemical formulae of the materials used in this work. 

peaking at 332 and 270 nm. Unfortunately, the positions 

of the bands of SP and PMPSi almost coincide, 

hence one cannot unequivocally separate effects due 

to the photoexcitation of charge carriers in the polymer, 

and those associated with the SP ! M photochromic 

reaction, as will be shown later. 

Fig. 1. Absorption spectra of the materials used in this work. Dashdotted 

line: PMPSi in toluene solution; solid line: stable form of SP 

(before UV illumination); dashed line: SP after the UV illumination.

Fig. 2. Dark current–voltage characteristics of an ITO/PMPSi-SP/ 

Al sandwich sample before and after UV illumination. Curve 1— 

pristine sample, curve 2—measured immediately after UV 

illumination, curves 3 and 4—measured after 3 and 24 h, 

respectively, relaxation in vacuum, at room temperature. 

Fig. 2 shows a family of dark j–U characteristics 

measured on a 600 nm thick sandwich sample ITO/ 

PMPSi-SP/Al. The characteristics measured on a pristine 

sample (curve 1) was ohmic up to 2 V turning to a 

superlinear dependence at higher voltages. After the 

sample was illuminated for 10 min with a 340 nm 

radiation activating the photochromic reaction and 

resulting in the formation of a highly polar metastable 

form (M) of the photochromic system, the j–U characteristics 

(curve 2) exhibited a similar character but 


the current was ca. one order of magnitude lower. 

When the sample was kept in the dark under vacuum at 

room temperature, the current increased (curves 3 and 

4), asymptotically reverting to the values measured 

before the illumination. It should be noted that this 

electrical relaxation qualitatively followed the optical 

one. 

The results of measurements of the rise and decay of 

the photocurrent, carried out on surface samples Al/ 

PMPSi-SP/Al are shown in Fig. 3a. After the illumination 

of the sample with a low-intensity 340 nm 

radiation (f ¼ 10 4 Wcm 2 ), a photocurrent was 

observed, attaining its steady state value after a few 

minutes (curve 1). The photocurrent was found to 

increase with the light intensity (curve 2, f ¼ 4 

10 4 Wcm 2 ). The photocurrent was also generated 

upon illumination of the sample with a more intense 

UV light used for the photochromic SP ! M transformation 

(curve 3, f ¼ 3 10 2 Wcm 2 ). In this 

case, however, the photocurrent kinetics was quite 

different: after an abrupt initial rise, the photocurrent 

decreased with time, as is shown in the inset to Fig. 3a. 

A repeated experiment, performed on the same sample 

after formation of the coloured M species, is shown in 

the right part of Fig. 3a: the currents 1 0 and 2 0 are ca. 5– 

10 times lower than 1 and 2, measured under the same 

conditions. A discussion of the results obtained, based 

on a simple model, will be given in the following 

section of this paper. 

Fig. 3. (a) Photocurrent kinetics measured on a surface-type sample Al/PMPSi-SP/Al, in vacuum. Inset: curve 3 re-plotted in double log 

coordinates. (b) temporal variation of the parameter Y (free-to-total carrier density ratio) calculated from Eqs. (3) and (6). The curves have 

been normalised at t ¼ 0 (i.e., at Y ¼ Y0). The parameter g is proportional to the intensity of absorbed light. Other input parameters are: M0/ 

N c ¼ 10 5 ; M 0/S ¼ 10 3 ; E t ¼ 0.6 eV; T ¼ 293 K.


Since the optical absorption of SP in the UValmost 

coincides with that of PMPSi, the 340 nm light used 

in our experiments excites both, PMPSi and SP, 

resulting simultaneously in the photocarrier generation 

and in the dipolar trap formation. To separate the 

effects, and also to test the long-range effect of 

charge–dipole interactions, similar photoconductivity 

measurements were performed on a surface-type 

sample containing a H2Pc film evaporated onto the 

PMPSi-SP film (Fig. 4, illumination through the 

substrate whose cutoff wavelength was 300 nm, the 

geometry is shown in the inset). The samples were 

illuminated with two wavelengths: 340 (curve 2) and 

625 nm (curves 1 and 3). The latter wavelength is 

known to excite the photoconductivity in H2Pc but 

not in PMPSi. Moreover, the 625 nm light does not 

activate the SP ! M reaction. It is thus obvious that 

the photocurrent could be generated only in the H 2Pc 

layer. After the irradiation of the PMPSi-SP layer 

with UV, the repeated illumination with the 625 nm 

light yielded the photocurrent about twice lower that 

that measured under identical conditions prior to 

exposition of the polymer to UV (curve 3 versus 

curve 1 in Fig. 4). 

5. Discussion 

Fig. 4. Photocurrent kinetics in a two-layer sample, measured in vacuum. Inset: structure of the sample. 

The variation of the electrical responses of the 

samples under study, shown in Figs. 3 and 4, is 

consistent with the assumption of traps being generated 

and annihilated upon creation and annihilation of 

polar species, and can be semi-quantitatively discussed 

on the basis of the model presented below 

[31]. We shall consider a system consisting of a 

photoconducting polymer in which traps affecting 

the mobility of charge carriers are formed by polar 

species M, formed upon the photochromic reaction 

from weakly polar molecules SP. The respective concentrations 

of both forms of the system will be denoted 

as M and S. The inspection of the curves 1 and 2 in 

Fig. 3a shows that, at low light intensities, the photocurrents 

increase with time attaining their equilibrium 

values after times of the order of 10 1 to 10 2 s, whereas 

the curve 3 decreases after the initial sharp rise, at a 

much slower rate (cf. the inset to Fig. 3a). This feature 

makes us suppose that the temporal evolution of the 

curves is a superposition of a faster kinetics of transport 

processes and of a slower kinetics of the chemical 

process changing the concentration of traps. Under 

this supposition, kinetic equations describing the temporal 

evolution of the concentrations of free and 

trapped charges can be readily solved assuming that 

the chemical reaction producing or annihilating M is 

slow with respect to the kinetics of the trapping– 

detrapping process (i.e., assuming M ¼ const.). The 

solution yields 

nðtÞ ¼AIp þðB CIpÞ exp 

t 

teff 

(4)

where Ip is the intensity of light exciting the photoconductivity 

in the sample, A, B and C are parameters 

independent of the light intensity, and teff a combination 

of the trapping, detrapping and recombination 

time constants. In the long-time limit, the concentrations 

of trapped and free carriers attain their equilibrium 

values, reducing the (concentration mobility) 

product by the factor Y, defined in Eq. (2). Note that 

n(1) should be proportional to the intensity of the 

exciting light. 

The above equation was derived assuming a constant 

concentration of traps. If, as is the case of our 

samples, the concentration slowly changes, then the 

kinetics of the chemical reaction changing the trap 

concentration can be decoupled from the trapping– 

detrapping process. It is then sufficient to derive an 

expression for the temporal evolution of M and use it 

in Eq. (3). The latter expression can be found upon 

solving the kinetic equation for the concentrations of 

the reacting components of the photochromic system: 

dM 

dt ¼ kM þ bIchðS0 MÞ (5) 

where k is the rate constant of the dark reaction M ! 

SP, Ich the intensity of the incident light driving the 

photochemical reaction SP ! M (note that Ich may, 

but does not necessarily have to, be equal to Ip), b 

stands for the efficiency of the photochemical reaction, 

and the subscript 0 labels the concentrations at 

t ¼ 0. The solution of Eq. (5) yields 

M ¼ M0 expð kefftÞþ S0g expðkefftÞ 1 

(6) 

g þ 1 expðkefftÞ 

where g ¼ bIch=k and keff ¼ kð1 þ gÞ. It is straightforward 

to show that in most cases the solution reduces to 

either an exp( kefft)-type dependence or to a 

[1 expð kefftÞ]-type one. 

Making use of Eqs. (3) and (6), we have calculated 

the temporal evolution of the parameter Y for a few 

physically plausible cases. The results, shown in 

Fig. 3b, reasonably well reproduce the course of the 

curves 1–3 shown in Fig. 3a. In the dark and for low 

light intensities (i.e., for small g), the dark reaction 

prevails. Consequently, the trap concentration 

decreases and the factor Y increases. Under a more 

intense illumination (i.e., for larger g), strongly polar 

metastable species are produced, hence the trap concentration 

increases, reducing Y. 


The results shown in Figs. 2 and 3 provide an 

evidence for the production of traps during illumination 

of the polymer samples with the UV light. The 

above experiments, however, do not determine 

whether these traps are of dipolar nature since it is 

equally conceivable that the metastable M molecules 

might act as chemical traps. The discrimination can be 

sought in differences of the cross sections of the traps 

produced: the chemical traps should occur on the M 

molecules, their cross sections being of the order of 

molecular dimensions [16] whereas the dipolar traps 

are created in the vicinity of the dipoles, at distances 

determined by long range charge–dipole interactions. 

The results shown in Fig. 4 demonstrate that the SP ! 

M reaction occurring in the polymer layer influences 

the transport of charge carriers as far as in the phthalocyanine 

film. After the irradiation of the sample with 

the 340 nm light, the observed photocurrent is generated 

mainly in the PMPSi-SP layer because of a short 

penetration depth of light at this wavelength. Simultaneously, 

the light creates highly polar metastable M 

species, which act as a source of charge carrier traps. 

Consequently, the illumination of the sandwich sample 

with the UV radiation results in a decrease of the 

photocurrent following the kinetics of generation of 

traps (Section 2 of the curve). The lifetime of the 

dipolar traps is of the order of several hours in the dark 

or under illumination with the 625 nm light, hence the 

increased concentration of metastable species is also 

reflected in a decrease of the photoconductivity of the 

pre-irradiated H2Pc film (cf. Sections 1 and 3 in the 

figure) upon illumination with the 625 nm light. This 

behaviour shows that the traps, influencing not only 

the current in the PMPSi-SP layer but also the current 

of the neighbour layer, have been created due to longrange 

charge–dipole interactions. 

6. Final remarks 

The results reported in this paper demonstrate a 

possibility of a reversible formation and annihilation 

of charge carrier traps in molecular materials consisting 

of photoconducting polymer containing photochromic 

species. Both the dark conductivity and 

photoconductivity of PMPSi-SP are reversibly modified 

due to the formation and annihilation of dipolar 

traps The experiments support the results of the


electrostatic model calculations published elsewhere 

[17,18]. Dipolar traps have large cross-sections as 

follows from the photoconductivity measured on a 

double-layer PMPSi-SP/H 2Pc structure. 

It is expected that materials consisting of electroactive 

matrices functionalized with suitably chosen 

photochromic species (admixed molecules or chemically 

attached side groups) may be used as elements of 

electro-optical systems or bistable switches. Moreover, 

one can envisage a construction of a photo- 

FET device in which the gate field is modified by 

dipolar fields associated with centres existing in a 

photoactive polymer layer. 

The stability of the metastable form and the kinetics 

of response of the materials should depend on the 

nature of the photochromic groups used [2–4] but also 

on the polymer matrix, intensity of the exciting light 

and other experimental factors. 

Finally, it should be noted that the aim of this 

contribution was to put forward a general idea allowing 

one to design a bistable molecular device capable 

of acting on a both, microscopic and macroscopic 

scale. A practical realisation of this idea will require a 

thorough optimisation of several operational parameters 

of the device. 


The research was supported by the grant OC D14.30 

from the Ministry of Education, Youth and Sports of 

the Czech Republic, by the grant AV0Z 4050913 from 

the Academy of Sciences of the Czech Republic, and 

by the grant 4 T09A 132 22 from the Polish Committee 

for Scientific Research. The financial support from 

European Graduate College ‘‘Advanced Polymer 

Materials’’ is gratefully appreciated. 

References 

[1] F.L. Carter (Ed.), Molecular Electronic Devices, Marcel 

Dekker, New York, 1982. 

[2] G.H. Brown (Ed.), Photochromism, Wiley, New York, 1971. 

[3] H. Dürr, H. Bouas Laurent (Eds.), Photochromism. Molecules 

and Systems, Elsevier, Amsterdam, 1990. 

[4] J.C. Crano, R.J. Guglielmetti (Eds.), Organic Protochromic 

and Thermochromic Compounds, Plenum Press, New York, 

1999. 

[5] S. Nesˇpu˚rek, J. Sworakowski, Thin Solid Films 393 (2001) 168. 

[6] S. Nesˇpu˚rek, P. Toman, J. Sworakowski, J. Lipiński, Curr. 

Appl. Phys. 2 (2002) 299. 

[7] S. Nesˇpu˚rek, P. Toman, J. Sworakowski, Thin Solid Films 

438–439 (2003) 268. 

[8] N.Y.C. Chu, in: H. Dürr, H. Bouas Laurent (Eds.), Photochromism. 

Molecules and Systems, Elsevier, Amsterdam, 

1990, Chapter 10. 

[9] S. Maeda, in: J.C. Crano, R.J. Guglielmetti (Eds.), Organic 

Protochromic and Thermochromic Compounds, vol. 1, 

Plenum Press, New York, 1999, Chapter 2. 

[10] R. Guglielmetti, in: H. Dürr, H. Bouas Laurent (Eds.), 

Photochromism. Molecules and Systems, Elsevier, Amsterdam, 

1990, Chapter 8. 

[11] R.C. Bertelson, in: J.C. Crano, R.J. Guglielmetti (Eds.), 

Organic Protochromic and Thermochromic Compounds, vol. 

1, Plenum Press, New York, 1999, Chapter 1. 

[12] H. Rau, in: H. Dürr, H. Bouas Laurent (Eds.), Photochromism. 

Molecules and Systems, Elsevier, Amsterdam, 1990, 

Chapter 4 

[13] L.E. Lyons, J. Chem. Soc. (1957) 5001. 

[14] F. Gutman, L.E. Lyons, Organic Semiconductors, Wiley, New 

York, 1967. 

[15] J. Sworakowski, Mol. Cryst. Liq. Cryst. 11 (1970) 1. 

[16] E.A. Silinsh, Phys. Stat. Sol. (a) 3 (1970) 817. 

[17] J. Sworakowski, Proc. SPIE 37DP (1999) 83. 

[18] J. Sworakowski, IEEE Trans. Diel. Electr. Insul. 7 (2000) 531. 

[19] A.K. Kadashchuk, N.I. Ostapenko, Yu.A. Skryshevskii, V.I. 

Sugakov, M.T. Shpak, Pis’ma v ZhETF 46 (1987) 165; 

A.K. Kadashchuk, N.I. Ostapenko, Yu.A. Skryshevskii, V.I. 

Sugakov, M.T. Shpak, JETP Lett. 46 (1987) 207. 

[20] A. Dieckmann, H. Bässler, P.M. Borsenberger, J. Chem. Phys. 

99 (1994) 8136. 

[21] R.H. Young, J.J. Fitzgerald, J. Chem. Phys. 102 (1995) 9380. 

[22] A. Hirao, H. Nishizawa, Phys. Rev. B 56 (1997) R2904. 

[23] S. Nesˇpu˚rek, H. Valerián, A. Eckhardt, V. Herden, W. 

Schnabel, Polym. Adv. Technol. 12 (2001) 306. 

[24] S. Nesˇpu˚rek, J. Sworakowski, A. Kadashchuk, IEEE Trans. 

Diel. Electr. Insul. 8 (2001) 432. 

[25] D.C. Hoesterrey, G.M. Letson, J. Phys. Chem. Solids 24 

(1963) 1609. 

[26] U. Wolf, H. Bässler, P.M. Borsenberger, W.T. Gruenbaum, 

Chem. Phys. 222 (1997) 259. 

[27] H. Bässler, Phys. Stat. Sol. (b) 107 (1981) 9. 


[29] X.-H. Zhang, R. West, J. Polym. Sci. Polym. Chem. Ed. 22 

(1984) 159. 

[30] I. Kmínek, S. Nesˇpu˚rek, E. Brynda, J. Pfleger, V. Cimrová,W. 

Schnabel, Collect. Czech. Chem. Commun. 58 (1993) 2337. 

[31] J. Sworakowski, W. Bartkowiak, S. Nesˇpu˚rek, P. Tomon, G. 

Wang, Thin Solid Films, to be published.

Abstract 

Synthetic Metals 141 (2004) 165–170 

Transient photoconductivity in a thin film of a 

poly-phenylenevinylene-type conjugated polymer 

M. Weiter a,b,∗ , V.I. Arkhipov c,d , H. Bässler a 

a Institute of Physical, Macromolecular and Nuclear Chemistry, Philipps University, Hans-Meerwein-Strasse, D-35032 Marburg, Germany 

b Faculty of Chemistry, Brno University of Technology, Purkynova 118, 61200 Brno, Czech Republic 

c IMEC, Kapeldreef 75, B-3001 Heverlee-Leuven, Belgium 

d Institute of Material Science, Darmstadt University of Technology, Petersenstrasse 23, 64281 Darmstadt, Germany 

Received 6 August 2003; received in revised form 25 September 2003; accepted 25 September 2003 

Dedicated to the memory of Dr. Michael Rice 

Transient photocurrents in a 150 nm thick film of a copolymer of a phenyl-substituted poly-phenylenevinylene were observed upon 

excitation by a 10 ns laser flash. The signal is due to a superposition of time-dependent generation of mobile holes and their motion. The 

essential quantity considered was the number of holes transported in either the neat sample or a film doped with trinitrofluorene as a function 

of electric field, temperature, photon dose at different photon energies, and polarity of the irradiated electrode. Based upon complementary 

spectroscopic evidence it has been argued that the rate limiting step for charge generation is the dissociation of geminate pairs forming an 

electron at an either unintentional or intentional electron acceptor and hole at an adjacent chain. The field and temperature dependence can 

be fitted by a recent theory by Arkhipov et al. that differs from the conventional Onsager description. 


Keywords: Conjugated polymer; Photoconductivity; Charge generation 


In the early days of research into conjugated polymers, 

it was believed that the commencement of photoconductivity 

right at the onset of optical absorption is a signature of 

those materials behaving like an inorganic semiconductor in 

which the optical and electrical gap are identical [1]. Meanwhile, 

there is abundant evidence against this notion. Most 

experimentalists [2,3] and theoreticians [4–6] concur that the 

binding energy of a singlet exciton, i.e. the energy needed to 

split an exciton to a Coulumbically unbound charges, is no 

less than 0.5 eV. The ubiquitous increase of the photoconductive 

yield at about 1 eV above the absorption threshold 

[2,7] is analogous to the behavior of conventional molecular 

crystals such an anthracene [8]. It indicates that the excess 

electronic energy can be used to overcome the coulombic 

binding energy of a Frenkel-type neutral exciton via either 

autoionization or dissociation while the excited chain segment 

is still vibrationally “hot” [7,9]. 

∗ Corresponding author. Tel.: +420-541-149-407; 

fax: +420-541-211-697. 



doi:10.1016/j.synthmet.2003.09.018 

This article focuses on photoconductivity within the spectral 

range of the S1 ← S0 transition, i.e. below the energy 

at which instantaneous dissociation of a singlet (S1) exciton 

prior to vibrational cooling occurs [10]. There is clear 

evidence, though, that also vibrationally relaxed excitons 

can dissociate, provided that the required excess energy is 

supplied by either a strong electric field or a sensitizer. The 

realization of the former case has been proven by (i) field 

quenching of the fluorescence [11], (ii) transient absorption 

under an electric field that can monitor the correlated decrease 

of the population of S1 excitons and the growth of 

the polaron signal [12] and (iii) transient photoconductivity 

in a ladder-type poly(para-phenylene) (MeLPPP) that is 

characterized by an exceptionally low degree of disorder 

and high degree of chemical purity [13]. However, since 

electric field assisted dissociation is at least quadratic in 

field it tends to vanish at moderate fields. This is at variance 

with photoconductivity studies that bear out a roughly 

linear field dependence at moderate field. The straightforward 

conclusion is that this residual effect is due to exciton 

dissociation at impurities acting as electron scavengers 

[14]. At times, it is difficult to distinguish both phenomena. 

By comparing results of transient photoconductivity in

166 M. Weiter et al. / Synthetic Metals 141 (2004) 165–170 

a poly-phenylenevinylene-based copolymer (PhPPV) and 

previous results on MeLPPP, we delineate characteristic 

features of both processes paying special attention to the 

properties of PhPPV that has been used before when studying 

sensitized photogeneration with the spectral range of 

the S1 ← S0 transition [14]. 

2. Experiment 

PhPPV was synthesized via GILCH polymerization by 

COVION Organic Semiconductor GmbH [15]. The structure 

formula of the studied PhPPV derivative is shown in Fig. 1 

together with the optical density of a PhPPV film. Transient 

photocurrent measurements were performed on a sandwich 

cell with a polymer layer of a thickness of ca 150 nm. It 

was prepared by spin coating of a 1% polymer solution in 

chloroform onto an indium tin oxide (ITO) electrode. In order 

to prevent exciton-induced hole injection the ITO was 

covered by a semitransparent aluminum layer with an optical 

density of 0.46. A 100 nm thick Al-layer served as a 

top electrode. The sample capacitance was typically 2.2 nF. 

Some samples were doped with 1% and 10 wt.% of trinitrofluorene 

(TNF) as an electron acceptor. The experiments 

were done with either a frequency doubled Nd:YAG laser 

at photon energy 3.49 eV (355 nm) or a dye laser at photon 

energy 2.74 eV (453 nm). Since the calculated quantum efficiencies 

for photogeneration did not differ by more than factor 

2, which is the experimental accuracy set by calculating 

the reflection losses at various sample interfaces, most of the 

data were taken upon excitation at hνexc = 3.49 eV where 

hot exciton dissociation was still a small effect. The sample 

was mounted in a cryostat which allowed cooling down to 

150 K. In order to minimize space charge effect that may 

occur upon periodic excitation all experiments were done in 

the single shot regime. 

Optical density 

1.2 

1.0 

0.8 

0.6 

0.4 

0.2 


600 550 500 450 400 350 

0.0 

2.0 2.5 3.0 3.5 

Energy (eV) 

Fig. 1. Absorption spectrum of the PhPPV film. In the inset, the structure 

formula of PhPPV is shown. 

3. Results 

Fig. 2 shows photocurrent transients in a 150 nm PhPPV 

film at 295 K at electric fields of 3.5×10 5 and 1.3×10 6 V/cm 

and different photon doses while Fig. 3 shows equivalent 

data on a PhPPV film doped with 1% of TNF at both polarities 

of the excited ITO:Al electrode. The rise time was 

determined by the RC time constant of the circuit that was 

about 30 ns. Data representation in double logarithmic scale 

reveals a non-exponential decay extending into the 10 �s 

regime. The shape of the j(t) time dependence is virtually 

invariant with light intensity. Regarding the pulse shape the 

Fig. 2. Photocurrent transients measured in a 150 nm thick PhPPV film 

at 295 K at different photon doses (hνexc = 3.5 eV) and an electric field 

of (a) 3.5 × 10 5 V/cm, (b) 1.3 × 10 6 V/cm. 

photocurrent (mA) 

10 0 

10 -1 

10 -2 

10 -8 

10 -3 

F=10 6 Vcm -1 

F=10 5 Vcm -1 

10 -7 

10 -6 

time (s) 

Fig. 3. Photocurrents measured in PhPPV film doped with 1% trinitrofluorene 

at a photon dose 55 �J at different electric fields and polarity. Solid 

(dashed) lines refer to positive (negative) bias to ITO. 

10 -5 

10 -4

Fig. 4. (a) The number of charges collected as a function of electric 

field at different photon doses. (b) The same data but normalized to the 

capacitor charge. 

only field dependence noted is that at higher fields the long 

time tail of the photocurrent is somewhat diminished. Fig. 3 

confirms that the current is basically independent of polarity 

of the diode. 

The number of charges Q, collected by the electric field 

was calculated by integrating the current up to a time, 

Fig. 5. Number of charges collected per pulse at different electric field 

as a function of laser intensity. 

M. Weiter et al. / Synthetic Metals 141 (2004) 165–170 167 

Yield 

10 -1 

10 -2 

10 -3 

10 -4 

MeLPPP 

PhPPV 

PhPPV + 1 % TNF 

10 5 

Field (Vcm -1 ) 

Fig. 6. A comparison of the for MeLPPP, PhPPV and PhPPV doped 

with 1% TNF at low photon dose (full symbols: ITO positive bias; open 

symbols: ITO negative bias). 

typically 20 �s, when the current has decayed to the background 

level. This appears to be a reasonable compromise 

in order to avoid divergence of the integral over an algebraic 

decay function. In Fig. 4a, Q is plotted as a function 

of electric field at different photon doses. It is instructive to 

normalize Q to the calculated capacitor charge (Fig. 4b). It 

is obvious that at a high photon dose the collected charge 

saturates at the capacitor charge. This is also borne out 

by Fig. 5, which shows Q as a function of the incident 

intensity for different electric field. At low intensities Q is 

strictly linear with light intensity. Fig. 6 compares the field 

dependence of Q measured in undoped PhPPV, PhPPV 

doped with 1% TNF film and in MeLPPP film at the same 

incident light intensity. It shows that doping increases photoconduction 

by a factor of 2–3. This is in agreement with 

previous results [14]. The temperature dependence of Q at 

selected values of electric field is presented in Fig. 7. At 

Fig. 7. Temperature dependence of the quantum yield in a PhPPV film 

at different electric field as a function of temperature. Calculated curve 

was taken from [24] (see text). 

10 6


E = 2.2 × 10 5 V/cm, Q is weakly temperature dependent 

features activation energy of about 0.07 eV for T>200 K. 

At lower temperatures, Q tends to saturate. 

4. Discussion 

A transient photocurrent can either be transport or generation 

limited. The former case applies if the generation time of 

is much shorter than the transit time experimental signatures 

being the plateau current of the time of flight signal is proportional 

to the product of n(F)µ(F)F while the transit time 

is given by d/µ(F). Here, n(F) and µ(F) are the field dependent 

number of generated charge carriers and their mobility, 

respectively. In the case of relevant experiments on MeLPPP 

the distinction was straight forwarded because the hole mobility 

could be measured and estimated carrier transit times 

were several orders of magnitude shorter than the response 

time of the transient current. Based upon a value of µ = 2× 

10 −6 cm 2 /(V s) for holes in PhPPV measured on a �m-thick 

sample at a moderate electric field [16] one could estimate 

the mean transit time of holes generated homogenously thorough 

the bulk of a 150 nm thick film at electric fields ranging 

from 10 5 to 10 6 V/cm to be 4–40 �s. This could, indeed, be 

comparable to the measured duration of the current transient 

implying it to be entirely transport limited. However, not 

observing any significant shortening of the current pulse at 

higher fields cast doubt on this assignment. It is known that 

in energetically random dielectric such as a film of PhPPV 

the motion of charges is associated with dispersion, notably 

at early stage of transport when carriers have not reached 

quasi-equilibrium [17]. It may well be that in a sample as thin 

as 150 nm the effective hole mobility is higher. In any event, 

the observed current transient is a convolution of time dependent 

charge carrier generation, transport and discharge. 

In the absence of additional experimental information, only 

the time-integrated photocurrent will be analyzed. As long 

as no bi-molecular recombination of charge carriers occurs 

and the range of carriers is solely given by generation and 

discharge at the electrodes, this quantity is a direct measure 

of the number of charge carriers generated. The first condition 

is fulfilled at low light intensities (see below). That 

the second condition is also met is proven by the fact that 

in time of flight experiments on micrometer thick samples 

[16] a carrier arrival signal is observed. However, this argument 

applies to holes only because the electron mobility 

is trap-limited and, concomitantly, is much lower than the 

hole mobility. This implies that on the time interval 0–10 �s 

only holes contribute to the time integrated current pulse. 

Since the measured current transient must involve dissociation 

after pulse excitation the dissociating entity has to 

be a metastable electron–hole pair produced from a short 

lived initial optical excitation. However, it is open to conjecture 

what the rate-determining step for generation of mobile 

carrier is. Is it the primary field dependent dissociation 

of a singlet exciton into a Coulumbically bound geminate 

electron–hole pair (GP) or is it its subsequent escape from 

its initial potential? Solely, based upon the field dependence 

of the generation yield no unambiguous assignment can be 

made. The reason is that any experimental superlinear field 

dependence of Q could be fitted by the conventional Onsager 

model either in its 1D [18] or 3D [19] version by 

choosing an empirical value for the so-called thermalization 

distance of the GP regardless whether or not the conceptual 

basis of the data analysis is valid. In order to distinguish the 

above possibilities one requires additional experimental information. 

In the case of MeLPPP this was field-modulated 

picosecond transient absorption of charge carriers and excitons 

simultaneously. By comparing the field dependence 

of the evolution of the transient absorption of geminately 

bound positive polarons with the transient photocurent signal 

we could ascertain that it must be the field-assisted initial 

dissociation event which is rate controlling [13]. In this 

case, dissociation create more loosely bound GP that can 

subsequently be ionized quite easily without requiring too 

much of assistance by either electric field or temperature. 

In the case of PhPPV, the situation is different. Previous 

spectroscopic [20] and cw-photoconduction [14] work 

on PhPPV without and with controlled doping with trinitrofluorene 

showed that neat PhPPV contains about 0.04% 

of dopants. They quench already about 50% of excitations 

and form electron hole pairs on TNF and PhPPV. Intentional 

doping by 1% TNF can, therefore, increase the photogeneration 

of charge carriers by about a factor of 2 only. This is 

in agreement with Fig. 6. It proves that in this case the field 

assisted and rate-limiting step for photogeneration must be 

the subsequent escape of the pair from its Coulombic well 

rather than exciton diffusion towards to the sensitizer that 

captures an electron. The latter process is exothermic and it 

does not require a promoting electric field. Additional support 

for this argument is that in PhPPV the photoresponse 

is larger than in MeLPPP (Fig. 6), and in addition, is associated 

with a weaker field dependence although the field 

quenching of prompt fluorescence in MeLPPP and PhPPV 

turns out to be virtually identical [21]. Therefore, the exciton 

binding energy in both systems had also to be the same 

implying that the amount of intrinsic field−assisted exciton 

breaking has to be the same, too, at variance with photogeneration 

at moderate fields as documented by Fig. 4. 

At first glance we should expect that the field dependence 

of Q is tractable in terms of Brown’s [22] adaptation of 

Onsager’s theory of the dissociation/recombination for geminate 

pair with finite lifetime. However, in this theory both 

the field and temperature dependences of the dissociation 

yield are related via the value of the initial intra-pair separation. 

Since the measured activation energy of the yield at 

the lower electric field is as low as 0.07 eV that value should 

be 6 nm. This is incompatible with the fact that there is no 

indication that the photocurrent will saturate, not even at a 

field as large as 2.5 × 10 6 V/cm. At the same time, the extrapolated 

values of the yield at either infinite temperature

and field are different whereas conventional Onsager theory 

predicts limT →∞ϕ = limF→∞ϕ = ϕ0, where ϕ0 is the initial 

yield for GP formation for an optical excitation. This 

problem has been recognized for some time already [23] and 

has been taken as evidence that classic Onsager-type theories 

are inappropriate for conjugated polymers. Recently, 

Arkhipov et al. [24] presented a theory that is able to explain 

this phenomenon. It rests upon the notion that in a 

GP, consisting of a localized electron at a dopant with high 

electron affinity and a hole on the polymer, the latter must 

not be treated as a localized point charge but rather than 

a charge that can execute an oscillatory motion in the potential 

well inside the segment of the polymer determined 

by the Coulombic attraction. Therefore, the hole is not at 

rest but is associated with a kinetic energy, that depends on 

the effective mass of the hole. The situation is analogous 

to the motion a diatomic molecule inside the bottom of a 

Morse potential. Dissociation can occur whenever the hole 

can cross the potential barrier. The predicted temperature 

dependence at a filed of 3×10 5 V/cm of the process is much 

weaker than in a system in which the charges are fully localized 

because the energy needed for dissociation is diminished 

by the kinetic energy and agreement with experiment is 

gratifying. 

In Fig. 8, the Q(F) data for the photogeneration yield 

in the PhPPV film doped with 1% TNF (see Fig. 6) are 

compared with the prediction of theory under the premise 

that all primary excitations will migrate to a dopant. The 

parameter is the relative effective mass of the hole on a 

polymer chain. It turns out that a perfect fit is obtained for 

meff/m0 ≈ 2. Such a value of meff/m0 for a �-conjugated 

polymer is at variance with theory [6] and electro-reflection 

Fig. 8. Comparison of the carrier photogeneration yield at different electric 

fields and parametric in the on-chain effective mass, calculated by 

Arkhipov et al. (Fig. 3 in [24]) and experimental data for PhPPV doped 

with 1% TNF at low photon dose of 4.1 �J. 

M. Weiter et al. / Synthetic Metals 141 (2004) 165–170 169 

experiments on single crystalline poly-diacetylenes featuring 

a Franz-Keldysh effect [25]. On the other hand, there is 

experimental evidence that even the on-chain charge carrier 

mobility, probed via microwave techniques [26] is of the 

order of 0.1 cm 2 /(V s), i.e. comparable with that of molecular 

crystals at 295 K. This implies that meff/m0 must be of 

the order of unity. We conjecture that the low value of the 

effective mass applies only upon instantaneous generation 

of a charge, i.e. at times shorter than the electron-phonon 

time. 

We shall briefly comment on the observation that the 

collected charge saturates at a level given by the capacitor 

charge. The reason is that the generated electrons are 

localized at acceptor sites and established a reservoir of recombination 

centers for holes. As a consequence, the hole 

range becomes less than the film thickness and there is redistribution 

of the internal electric field. This phenomenon 

has already been addressed in [13]. 

5. Conclusion 

It is obvious that there are two processes occurring in 

the bulk of conjugated polymer that can give rise to photogeneration 

within the spectral range of the S1 ← S0 

transition. One of them is the field assisted dissociation 

into geminate pairs that subsequently can separate fully. 

This is a generic process in conjugated polymers but requires 

a strong electric field. The other one is sensitized 

photogeneartion at either non-intentional or intentional 

dopants that can act as electron scavengers. Its magnitude 

depends on the degree of doping although a concentration 

of 0.1% of electron acceptors may be enough to overcompensate 

the intrinsic dissociation at least at moderate 

electric fields. Unfortunately, it is notoriously difficult 

to distinguish both processes unless additional spectroscopic 

information is available. The field dependence of 

the yield alone is insufficient for deciding upon the prevalence 

of either process because data fitting in terms of an 

Onsager-like process is often ambiguous even if values 

for the initial separation of a hypothetic GP may be realistic. 

In summary, we emphasize that in neither case the 

Onsager description is applicable because in the intrinsic 

case the field assistance in the primary event of exciton 

breaking is disregarded in the Onsager formalism, while in 

the other case GP dissociation is aided by the finite energy 

of the charge carrier—usually the hole—that resides on 

a segment of the conjugated polymer next to the counter 

charge. 


We thank Covion Organic Semiconductors for providing 

PhPPV. This work was supported by EU-project LAM- 

INATE and the Fond der Chemishen Industrie.


References 

[1] A.J. Heeger, in: N.S. Sariciftci (Ed.), Primary Photoexcitations in 

Conjugated Polymers: Molecular Excitons versus Semiconductor 

Band Models, World Scientific, Singapore, 1997. 

[2] M. Chandross, S. Mazumdar, S. Jeglinski, X. Wei, Z. Vardeny, E. 

Kwock, T. Miller, Phys. Rev. B 50 (1994) 14702. 

[3] S.F. Alvarado, S. Barth, H. Bussler, U. Scherf, J.W. van der Horst, 

P.A. Bobbert, M.A.J. Michels, Adv. Funct. Mater. 12 (2002) 117. 

[4] P.G. Da Costa, E.M. Conwell, Phys. Rev. B 48 (1993) 1993. 

[5] M. Rohlfing, S.G. Louie, Phys. Rev. Lett. 83 (1999) 856. 

[6] J.W. van der Horst, P.A. Bobbert, M.A.J. Michels, H. Bässler, J. 

Chem. Phys. 114 (2001) 6950. 

[7] V.I. Arkhipov, E.V. Emelianova, H. Bässler, Phys. Rev. Lett 82 (1999) 

1321. 

[8] M. Pope, C.E. Swenberg, Electronic Processes in Organic Crystals 

and Polymers, second ed., Oxford University Press, Oxford, 1999. 

[9] D.M. Basko, E.M. Conwell, Phys. Rev. B 66 (2002) 155210. 

[10] V.I. Arkhipov, E.V. Emelianova, S. Barth, H. Bässler, Phys. Rev. B 

61 (2000) 8207. 

[11] R. Kersting, U. Lemmer, M. Deussen, H. Bakker, R. Mahrt, H. Kurz, 

V.I. Arkhipov, H. Bässler, E.O. Göbel, Phys. Rev. Lett. 73 (1994) 

1440. 

[12] V. Gulbinas, Yu. Zaushitsyn, V. Sundström, D. Hertel, H. Bässler, 

A. Yartsev, Phys. Rev. Lett. 89 (2002) 107401. 

[13] M. Weiter, H. Bässler, V. Gulbinas, U. Scherf, Chem. Phys. Lett. 

379 (2003) 177. 

[14] C. Im, E.V. Emelianova, H. Bässler, H. Spreitzer, H. Becker, J. 

Chem. Phys. 117 (2002) 2961. 

[15] H. Becker, H. Spreitzer, W. Kreuder, E. Kluge, H. Schenk, I. Parker, 

Y. Cao, Adv. Mater. 12 (2000) 42. 

[16] J. Veres, C. Juhasz, Phil. Mag. B 75 (1997) 377. 


[18] R. Haberkorn, M.E. Michel, Chem. Phys. Lett. 23 (1973) 128. 

[19] L. Onsager, Phys. Rev 54 (1938) 534. 

[20] C. Im, J.M. Lupton, P. Schouwink, S. Heun, H. Becker, H. Bässler, 

J. Chem. Phys. 117 (2002) #. 

[21] C. Im, unpublished work. 

[22] C.L. Braun, J. Chem. Phys. 80 (1984) 4157. 

[23] S. Barth, H. Bässler, U. Scherf, K. Müllen, Chem. Phys. Lett. 288 

(1998) 147. 

[24] V.I. Arkhipov, E.V. Emelianova, H. Bässler, Chem. Phys. Lett. 372 

(2003) 886. 

[25] G. Weiser, A. Horvàth, Chem. Phys. 227 (1998) 153. 

[26] A.M. van de Craats, J.M. Warman, P. Schlichting, U. Rohr, Y. Geerts, 

K. Müllen, Synth. Met. 102 (1999) 1550.

Abstract 

Transient photoconductivity in a film of ladder-type 

poly-phenylene: failure of the Onsager approach 

M. Weiter a,*,1 ,H.B€assler a , V. Gulbinas b , U. Scherf c 

a Institute of Physical, Macromolecular and Nuclear Chemistry, Philipps University, Hans-Meerwein-Strasse, 

D-35032, Marburg, Germany 

b Institute of Physics, A. Gostauto 12, LT-2600 Vilnius, Lithuania 

c Bergishe Universit€at Wuppertal, Chemistry Department, Gauss Strase 20, D-42119, Wuppertal, Germany 

Received 20 May 2003; in final form 14 August 2003 

Published online: 6 September 2003 

By comparing the field dependent evolution of the transient absorption of geminate pairs generated of singlet excitons 

in a film of ladder-type poly-phenylene and the field dependent transient photocurrent it is argued that the rate 

limiting step for photoionization is the initial field assisted dissociation into geminately bounded electron–hole pairs 

rather than its ultimate escape from the coulombic well. 

Ó 2003 Elsevier B.V. All rights reserved. 


Chemical Physics Letters 379 (2003) 177–182 

Meanwhile it is widely accepted that, in general, 

the opto-electronic properties of p-conjugated 

polymers resembles those of molecular crystals [1]. 

This does not mean that all relevant features are 

bare replicas of those of molecular crystals. 

Among these is the notion that photoionization is 

tractable in terms of Onsager theory [2,3]. It implies 

that intrinsic photogeneration is a multi-step 

process, the initial event being either the autoionization 

of a higher excited optical Franck–Con- 

* Corresponding author. Fax: +420-541-211-697. 


1 Permanent address: Faculty of Chemistry, Brno University 

of Technology, Purkynova 118, 612 00, Brno, Czech republic. 

0009-2614/$ - see front matter Ó 2003 Elsevier B.V. All rights reserved. 

doi:10.1016/j.cplett.2003.08.043 

www.elsevier.com/locate/cplett 

dom singlet state yielding a coulombically bound 

geminate electron–hole pair (GP) or direct charge 

transfer [4]. Subsequently the pair can recombine 

geminately or fully dissociate in the course of 

temperature and field assisted diffusive escape 

process. The spectroscopically accessible energy 

difference between the lowest charge transport 

state and the singlet excited of the parent molecule 

plays a key role in that process. In conventional 

molecular crystals it is as large as about 0.5 eV [4]. 

This precludes thermal dissociation of the vibrationally 

relaxed singlet excitation unless that excitation 

is generated near an electrode which can act 

as a acceptor of one of the charge comprising the 

initial exciton. Tacitly, it has always been implied 

that in a bulk system the initial event that generate 

GPs is exothermic, i.e., not requiring any

178 M. Weiter et al. / Chemical Physics Letters 379 (2003) 177–182 

temperature or field assistance. Therefore the 

measured field and temperature dependence of the 

photogeneration has solely to been attributed to 

the diffusive escape of the geminate electron–hole 

pair rather than its initial generation. Binary 

charge transfer (CT) systems behave similarly except 

that excited state of the system is the charge 

transfer state with a finite lifetime [5]. 

Based upon delayed field collection of optically 

generated charge carriers in a ladder-type polyphenylene 

(MeLPPP) it has been argued that the 

traditional Onsager approach fails to describe 

optical charge carrier generation because the essential 

field-assisted step is the primary dissociation 

rather than the secondary escape of the pairs 

from the coulombic well [6]. Experiments described 

in this Letter support this conclusion. 

However, the current work avoids the experimentally 

demanding delayed field collection technique. 

Instead we combined transient photoconductivity 

with transient spectroscopy in order to disentangle 

primary and secondary dissociation, the additional 

advantage being that there is no minimal time 

delay between generation of photocarriers and 

their probing. Experiments performed with a 

broad temperature range will support the conclusion 

that the conventional Onsager formalism fails 

to account for photogeneration in p-conjugated 

polymers although the previous notion of sequential 

dissociation of a primary optical excitation 

remains valid. 

2. Experiments 

Transient photocurrent measurements were 

performed on typically 100 nm thick layer of the 

MeLPPP prepared by spin coating of a 1% polymer 

solution in chloroform onto a indium tin oxide 

(ITO) electrode. In order to prevent injection 

the ITO was covered by a semitransparent aluminium 

layer with an optical density 0.46. One 

hundred nanometer thick top layer of aluminium 

completed the sandwich structure with a capacitance 

1.5 nF. Most of the experiments were done 

upon exciting the sample by a frequency-doubled 

Nd/Yag laser (hmexc ¼ 3:5 eV, i.e., kexc ¼ 355 nm). 

Although the hmexc exceeds the energy of the singlet 

exciton (ES1 ¼ 2:7 eV) is it still below the theoretical 

energy at which the efficiency of cw photoconduction 

at low light intensities features a step 

increase due to hot exciton dissociation [7]. 

The sample was mounted in a cryostat which allowed 

cooling down to 150 K. All experiments 

were done in the single shot regime making sure 

that any remaining trapped space charge has been 

erased. 

3. Results 

Fig. 1 shows a photocurrent transients in a 100 

nm thick MeLPPP film at a 295 K at a incident 

photon dose of 40 lJ/pulse, equivalent to an 

absorbed photon dose of 6 10 12 photons, and at 

different external electric fields. The rise time is 

determined by the RC time constant of the circuit 

that was about 30 ns. At times shorter than 1 ls 

and at low electric fields the current features a 

plateau in a double logarithmic representative. At 

higher fields an algebraic decay followed by an 

almost exponential decay at t > 1 ls is observed. 

At t > 10 ls a weak algebraic tail is noticeable. 

The number of collected charges Q was calculated 

by integration of the current. Plots of Q as a 

Fig. 1. Transient photocurrents measured at different external 

electric field and at room temperature. The incident photon 

dose was 40 lJ/pulse equivalent to an absorbed photon dose of 

6 10 12 photons per sample area.

Number of generated charges 

10 11 

10 10 

10 9 

F[Vcm -1 ], Q=C·V/e 

2·10 6 , 1.9·10 11 

1·10 6 , 1.0·10 11 

5·10 5 , 4.7·10 10 

2·10 5 , 1.9·10 10 

0.1 1 10 100 1000 

Fig. 2. Dependence of the number of generated charges on 

photon dose parametric in the electric field at negative bias to 

the ITO electrode. The solid lines indicate the calculated 

number of capacitance charges ðQ ¼ CV Þ. 

Number of generated charges 

10 11 

10 10 

10 9 

10 8 

10 4 

420 µJ/pulse 

44 µJ/pulse 

4,1 µJ/pulse 

10 5 

Q=C·V/e 

10 6 

Fig. 3. Number of generated charges as a function of the 

applied electric field parametric in the excitation intensity. 

The straight line indicates the dependence of the corresponding 

capacitance charge on the electric field. 

function of the photon dose and electric field are 

presented in Figs. 2 and 3. Experiments within 

the temperature range from 310 to 150 K turn 

out that Q is temperature insensitive. This concurs 

with previous experiment on cw photoconductivity 

[7]. 

M. Weiter et al. / Chemical Physics Letters 379 (2003) 177–182 179 

4. Discussion 

A transient current can be either transport or 

generation limited. From previous results is known 

that in freshly prepared MeLPPP films hole 

transport is trap-free, time of flight signals yielding 

a hole mobility of 2 10 3 cm2 V 1 s 1 with an 

exceptionally weak temperature and field dependence 

[8]. This is a consequence of the low degree 

of structural disorder. On the other hand electron 

transport has never been observed in a time of 

flight experiment indicating that electrons are 

trapped. It turns out that at the lowest electric field 

employed for the recording the signals in Fig. 1, 

the expected transit time of holes is 25 ns, i.e., 

comparable to the RC-time of the circuit, i.e., 

about three orders of magnitude shorter than the 

duration of the photocurrent pulse. Obviously, the 

observed transient photocurrent must be controlled 

by charge carrier generation rather than by 

their transport. This concurs with the fact that the 

duration of the signal is virtually independent at 

the electric field, at variance with the notion of it 

being determined by transport. It also indicates 

that this signal decay cannot be limited by electron 

transport. Detrapping of the negative space charge 

must occur on the longer time scale. 

The obvious source of the transient photocurrent 

must be the final dissociation of metastable 

geminately bound electron–hole pairs (GPs) whose 

existence has been well established by (i) delayed 

field collection experiment [6], (ii) delayed fluorescence 

[9], (iii) thermally stimulated luminescence 

[10] and (iv) two color photoconduction [11]. 

At a given time t the photocurrent is determined 

by the product of the number of GPs which survived 

until time t and the rate constant of their 

subsequent escape kesc from the coulombic potential 

iðtÞ ¼eNGPðtÞkesc: ð1Þ 

Q ¼ 

The total number of collected charge is 

Z T 

0 

i dt ¼ g dissg escNph; ð2Þ 

where g diss is the initial yield of dissociation of 

singlet excitations, Nph produced by the laser and 

g esc is the fraction of GP, i.e., g diss Nph is the


number of GP which escape geminate recombination. 

In principle, both g diss and g esc can be 

functions of the applied electric field and temperature. 

In the delayed field experiment this product 

has been disentangled by applying a collecting field 

pulse after a delay time of 100 ns after the generation 

pulse. In the present experiment generated 

charge carriers are collected and their number will 

be compared to the number of GP generated as 

monitored by the transient absorption within time 

domain of 200 fs to 500 ps which is too short 

for their subsequent escape from the coulombic 

potential [12]. This procedure is superior to that 

employed in [6] where the difference between the 

generation and collection field vanished at high 

electric field. Moreover, the currents experiments 

were extended towards lower photon dose thus 

avoiding any possible effect which bimolecular 

annihilation of singlet excitons during the laser 

pulse might have. 

Fig. 2 indicates that the number of charge collected, 

Q, increase linearly until it saturates at high 

intensities at a values close to the value of the 

capacitance charge CV . The linear field dependence 

of Q at high pump intensities bears out this 

more clearly (top curve in Fig. 3). This behavior 

can easily be explained in terms of GP dissociation 

yielding quickly moving holes and trapped electrons. 

The latter create a negative space charge 

that acts as recombination centers. Invoking 

Langevin-type recombination it is easy to show 

that the probability of a hole to recombine with an 

amount of quasi-stationary negative charge of CV , 

is close unity [13]. While at low laser intensity and 

homogenous excitation within the film one dissociating 

GP will contribute 0.5 elementary charge – 

this is because the range of a hole is half of the 

sample thickness – the according range must decrease 

as the number of GPs, having dissociated 

already, approaches the number of capacitor 

charges. A quantitative explanation is presented in 

Appendix A. 

The message derived for the intensity dependence 

of Q is that meaningful information on 

monomolecular dissociation of singlet excitons 

requires experiments with laser intensities sufficiently 

low that bimolecular reaction of neither 

singlet excitons nor charge carrier can occur. 

Based upon earlier studies in the prompt fluorescence 

at variable light intensities this limit is 1 lJ/ 

pulse at photon energy of 2.73 eV [14,15]. Data 

measured at 4.1 lJ/pulse at hmexc ¼ 3:5 eV meet this 

criterion. In Fig. 4 field dependence of the yield of 

holes collected is compared with the yield of generated 

GPs by field-assisted dissociation of relaxed 

singlet excitons as monitored by transient pump– 

probe experiments [12]. Note that in figure the 

yield rather the number of collected charges is 

shown. The proportionality of both dependences is 

striking. It confirms that (i) the rate limiting field 

assisted step is the dissociation of relaxed singlet 

excitons into GPs rather than their subsequent 

escape from coulombic well, (ii) the former process 

proceeds on a 200 fs to 0.5 ns time scale while 

the dwell time of GPs extends to the microsecond 

regime, and (iii) approximately 10% of initially 

Yield 

10 0 

10 -1 

10 -2 

10 -3 

10 4 

10 -4 

10 5 

10 6 

10 1 

10 0 

10 -1 

10 -2 

10 7 

10 -3 

Peak photocurrent [mA] 

Fig. 4. Charge generation efficiency (full symbols, left coordinate) 

and the photocurrent peak (open symbols, right coordinate) 

versus applied electric field, parametric in the excitation 

energy (squares: 4.1 lJ/pulse, circles: 44 lJ/pulse). The stars 

indicate the field dependent evolution of the transient absorption 

of geminate pairs generated by the dissociation of singlet 

excitons at photon dose of 14 lJ/cm 2 [12].

generated GP are liable to complete dissociation at 

a field of 3 MV/cm. 

The field dependence of the yield of fully dissociated 

GPs is weaker at pump intensity beyond 

the threshold at which bimolecular annihilation 

becomes the dominant channel for the decay of 

singlet excitons. In this case the yield has to be 

estimated by normalizing the Q to the number of 

singlet pairs generated. The plot is included in 

Fig. 4. At low electric field the yield g exceeds the 

value measured at low intensity while at high fields 

both dependences intersect. The latter observation 

is due to the onset of bimolecular recombination 

of mobile holes and trapped electrons and shortens 

the hole range (see above). The former effect is 

generic and confirms the notion that if the initially 

dissociating state is a highly excited singlet state 

generated by singlet–singlet annihilation is more 

efficient [16] and requires less stimulation by an 

electric field. 

Recording the time resolved photocurrent allows 

extracting additional information on the escape 

process of the initially generated GPs. Fig. 4 

includes data on the photocurrent maximum at a 

time compared to RC-time constant of the circuit. 

It turns out that the field dependence is very similar 

to the field dependence of the number of 

charges collected. Based upon Eq. (1) this implies 

that within the limit of experimental uncertainty, 

the field dependence of the escape rate of GP from 

initial coulombic well must be vanishingly small. 

Combined with the experimental results that the 

amount of charge collected is independent of 

temperature, it indicates that it is that fraction of 

GPs which have been generated close to the maximum 

of the superimposed coulombic and external 

potential which contributes most to the photocurrent, 

be keeping in mind that conjugated 

polymers are disordered hopping systems. The 

above conclusion can be cast into a schematic diagram 

for photoionization (Fig. 5). Depending 

upon the applied electric field an excitons can 

transfer one its charge to polymer segments within 

the coulombic well. At zero electric field only very 

few excitons can form a tightly bound GP unless 

the initial dissociation event involves bimolecular 

collision of two singlet excitons. Under the latter 

circumstance delayed fluorescence, arising from 

M. Weiter et al. / Chemical Physics Letters 379 (2003) 177–182 181 

Fig. 5. Schematic diagram of the photoionization in organic 

hoping system with a exciton binding energy of 0.7 eV and a 

Gaussian width of the density of states distribution of 0.05 eV 

in a extended electric field of 2 MV/cm and assuming a dielectric 

constant of 3.5. 

geminate pair recombination, can be observed. 

Upon increasing the electric field some excitons 

can dissociate into metastable GPs. Most of them 

recombine nonradiatively because the external 

potential overcompensate the energy difference 

between the GP and singlet exciton but can be 

revitalized and emit delayed fluorescence when the 

electric field is turned off [9]. GPs that managed to 

find an acceptor state close to the transport energy 

of the disordered semiconductor can diffuse and 

have the option of being collected by either the 

applied electric field or the retarding coulombic 

field. According to Eq. (1) the transient photocurrent 

at time t is the product of the number of 

GPs having survived up to time t and their escape 

rate kescðtÞ. At moderate times, i.e., 30 

ns 6 t 6 0:5 ls, when most of the GP are still alive, 

iðtÞ is still controlled by the time dependence of kesc 

whereas at longer times it is the exhaustion of the 

reservoir, the ultimate dissociation rate constant 

being of the order of 10 6 s 1 . It is worth noting 

that the time dependence of kesc is very different 

from the rate for ultimate GP collapse, monitored, 

for instance, by the decay of the delayed fluorescence, 

because the latter refers to metastable GPs 

rather than to those GP that are liable to escape


only. When replotting the data of Fig. 1 on a 

semilogarithmic scale it becomes obvious that the 

photocurrent pulse is almost exponential indicating 

that there is little dispersion in the escape rate 

because MeLPPP is a fairly ordered material. This 

explains why delayed fluorescence features a 

power decay whereas the time dependence of kescðtÞ 

can be rather weak and of an external electric field. 


In summary the experiments prove that the field 

dependence of the intrinsic photogeneration in the 

p-conjugated polymer MeLPPP is controlled by 

the initial step of the dissociation of a relaxed 

singlet exciton into a geminate pair rather than its 

escape from the coulombic potential. Therefore it 

is illegitimate to analyze the field (and temperature) 

dependence of the yield in terms of OnsagerÕs 

theory although the functional form of g can accidentally 

be similar. This conclusion is not specific 

for a conjugated polymer but is generic for organic 

solids in which the energy gap between the geminate 

electron–hole pair state and the parent singlet 

state is sufficiently close so that it can be compensated 

by a large electric field. 


Experimental assistance by Dr. Chan Im is 

greatly appreciated. This work was supported by 

the EU-project LAMINATE, the Volkwagen– 

Stiftung and the Fond der Chemischen Industrie. 

Appendix A 

If a hole is injected from the anode into a dielectric 

containing a negative space charge N (per 

unit area) it can either recombine or get discharged 

at the cathode. The probability for recombination 

is 

Prec ¼ krec=ðkrec þ s 1 

tr Þ; ðA:1Þ 

where str is the transit time of the hole and krec is 

the recombination rate, i.e., krec ¼ cN =d, where c 

is the bimolecular reaction constant and d the 

sample thickness. Since str ¼ d 2 =lV and making 

use of the Langevin ratio c=l ¼ e=ee0 

Prec ¼ 1 þ e0eF 

eN 

1 

: ðA:2Þ 

If N is determined by the capacitor charge, i.e., 

N ¼ ee0F =e, Prec ¼ 1=2. The calculation could 

easily be extended to include spatial dispersion of 

the origin of the hole generation and explains why 

the number of collected holes must saturate at the 

close to capacitor charge. 

References 

[1] see K. M€ullen, G. Wegner, Electronic Materials, the 

Oligomer Approach, Wiley-VCH, Weinheim, 1998. 

[2] L. Onsager, Phys. Rev 54 (1938) 554. 

[3] M. Pope, C.E. Svenberg, Electronic Processes in Organic 

Crystals and Polymers, second ed., Oxford University 


[4] L. Sebastian, G. Weiser, G. Peter, H. B€assler, Chem. Phys. 

95 (1983) 13. 

[5] C.L. Braun, J. Chem. Phys. 80 (1984) 4157. 

[6] D. Hertel, E.V. Soh, H. B€assler, L.J. Rothberg, Chem. 

Phys. Lett. 361 (2002) 99. 

[7] S. Barth, H. B€assler, U. Scherf, K. M€ullen, Chem. Phys. 

Lett. 288 (1998) 147. 

[8] D. Hertel, H. B€assler, U. Scherf, H.H. Horhold, J. Chem. 

Phys. 110 (1999) 9214. 

[9] B. Schweitzer, V.I. Arkhipov, U. Scherf, H. B€assler, Chem. 

Phys. Lett. 313 (1999) 57. 

[10] A. Kadashchuk, Yu. Skryskevski, A. Valkin, N. Ostapenko, 

E.V. Emelianova, V.A. Arkhipov, H. B€assler, 

Phys. Rev. B 63 (2001) 115205. 

[11] J.G. M€uller, U. Scherf, U. Lemmer, Synth. Met. 119 (2001) 

395. 

[12] V. Gulbinas, Yu. Zaushitsyn, V. Sundstr€om, D. Hertel, H. 

B€assler, A. Yartsev, Phys. Rev. Lett. 89 (2002) 107401. 

[13] H. Vestweber, H. B€assler, J. Gr€uner, R.H. Friend, Chem. 

Phys. Lett. 256 (1996) 37. 

[14] D. Hertel, Yu.V. Romanovski, B. Schweitzer, U. Scherf, 

H. B€assler, Synth. Met. 116 (2001) 1391. 

[15] A. Haugeneder, M. Neges, C. Kallinger, W. Spirkl, U. 

Lemmer, J. Feldmann, M.C. Amann, U. Scherf, J. Appl. 

Phys. 85 (1999) 1124. 

[16] C. Silva, A.S. Dhoot, D.M. Russell, M.A. Stevens, A.C. 

Arias, J.D. MacKenzie, N.C. Greenham, R.H. Friend, 

S. Setayesh, K. Mullen, Phys. Rev. B 64 (2001) 125211.

Monatshefte fuÈr Chemie 132, 177±183 (2001) 

Luminescence in Organic Silicons Prepared 

from Organic Precursors in Plasma Discharges 

Pavel HorvaÂth 1 , FrantisÏek Schauer 1; , Ivo KurÏitka 1 , Ota Salyk 1 , Martin 

Weiter 1 , Norbert Dokoupil 1 , Stanislav NesÏpuÊrek 1;2 , and Vlastimil Fidler 3 

1 Faculty of Chemistry, Brno University of Technology, CZ-61200 Brno, Czech Republic 

2 Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, CZ-16206 

Prague, Czech Republic 

3 Faculty of Nuclear Sciences, Czech Technical University, CZ-11519 Prague, Czech Republic 

Summary. The photoluminescence of plasma-prepared polysilanes during the change from linear 

1D Si chains to an amorphous 3D Si network was studied. The excitonic absorption band with a 

maximum at 353 nm in 1D Si experiences a blue shift and broadening upon introduction of 

branching and networking defects. With the gradual transition from 1D to 3D structure, an extensive 

redistribution of oscillator intensity along the absorption edge, accompanied by a decrease of the 

resolution of the - band, was observed. In the short wavelength region of the excitation spectra 

there is an enormous increase of excitonic emission at 328 nm. This effect is tentatively attributed to 

the excitation of the phenyl group or to the phenyl-silicon bond as con®rmed by effusion spectra of 

the phenyl species. 

Keywords. Silicon polymers; Plasma polymers; Luminescence; Effusion. 

Introduction 

Recently, many research groups have concentrated on the preparation of polysilanes 

by unconventional means, trying to produce materials with high ordering and/or 

increased dimensionality. Many attempts have been directed to the preparation of 

oriented ®lms of poly-(dimethylsilanediyl) by vacuum sublimation. Suzuki et al. [1] 

used UV laser ablation to deposit poly-((methyl)-phenylsilanediyl) (PMPSi). 

Watanabe et al. [2] employed laser chemical vapour deposition (CVD) of a 

monomeric chlorosilane for depositing of PMPSi with a laser tuned for attacking the 

Si±Cl bond preferentially (266 nm). Finally, Nagai et al. [3] used radio-frequency 

(RF) CVD for depositing silicon polymers of different dimensionality. In this work, 

emphasis is laid on the in¯uence of the dimensionality changes from 1D to 3D on the 

photoluminescence of radio frequency plasma prepared polysilylanes. 

Corresponding author

178 P. HorvaÂth et al. 


The purpose of this study was the investigation of the effects of structural transition 

from 1D to higher dimensions; therefore, solution-prepared PMPSi was studied 

®rst as the reference. In Fig. 1, absorbance measurements taken from Ref. [4] and 

the corresponding photo luminescence (PL) emission spectrum are shown. The 

absorption spectrum of a solid ®lm of PMPSi as determined from re¯ection 

measurements [4] consists of three main regions with peaks at 332, 270, and 

Fig. 1. Absorption and photoluminescence (PL) emission spectra of a solid ®lm of poly-((methyl)phenylsilanediyl) 

(PMPSi) prepared from solution (PL spectrum excited at ˆ 280 nm at room 

temperature) 

Fig. 2. Absorption and non-corrected excitation PL spectra of a solid ®lm of poly-((methyl)phenylsilanediyl) 

(PMPSi) prepared from solution (PL excitation spectra taken for photo 

luminescence at ˆ 360 nm at room temperature)

Luminescence in Organic Silicons 179 

194 nm. It has been shown [5] that the ®rst long-wavelength electronic transition 

originates mainly from delocalized - transitions. The energy of this transition 

depends strongly on the length of the molecule and its conformation. The peak at 

shorter wavelength ( ˆ 270 nm) is associated with - transitions in the benzene 

ring. The origin of the shortest wavelength peak (around ˆ 200 nm) is not yet 

clear; ®rst calculations point at excitations of -electrons of benzene rings. There is 

also a very weak tail up to 450 nm similar to that observed in Ref. [6]. This could 

arise from the Si-branching structure as follows from model studies. The PL 

emission spectrum (excitation wavelength 280 nm) in Fig. 1 shows two bands: a 

sharp one with a maximum at 353 nm which is of excitonic nature (related to - 

transitions) and a broad one with its maximum situated at about 500 nm. In Fig. 2, 

the corresponding PL excitation spectra for photo luminescence at ˆ 360 nm are 

shown. The optical transitions - ( 345 nm) and - ( 265 nm) are 

visible, as well as the shortest wavelength peak (around ˆ 200 nm) [7]. Besides, a 

very sharp peak occurred at ˆ 223 nm in the PL excitation spectrum; it will be 

dealt with in some detail later. 

The PL of the plasmatically prepared PMPSi depends drastically on the 

preparation conditions. In Fig. 3, typical excitation (a) and emission (b) PL spectra 

taken from Ref. [8] for different ratios of partial pressures of hydrogen and 

dichloromethylphenylsilane monomer are given. Both types of spectra exhibit 

optical transitions typical for both 1D and 3D structures. The excitonic PL is 

observed for samples prepared under partial pressures of monomer above 20 Pa. In 

the emission spectrum of these samples, the exciton band is located at ˆ 360± 

390 nm (Si - ). The optimized sample, prepared under partial pressures of 60 Pa 

for H2 and 20 Pa for the monomeric silane, exhibits excitonic bands at 380 (Si 

- ), 327, and 285 nm (phenyl - ), and also a tail in the long wavelength region; 

these features are typical for disordered materials. In the emission spectrum, an 

exciton band with a maximum at 390 nm (Si - ) and an imperfection centred at 

470 nm can be observed. Excitation spectra were detected for photoluminescence at 

ˆ 480 nm, emission spectra were measured with an excitation wavelength of 

280 nm. The occurrence of the excitonic band supports the assumption of a low ratio 

of Si atoms bound to three further Si moieties in the plasmatically prepared material 

as e.g. found in chemically prepared branched poly-(hexyl-(methyl)-silylanediyl) 

structures [9]. The arti®cially introduced branching points at Si centres lead to a 

total suppression of excitonic luminescence for concentrations above 1±2% due to 

reduction of coherence length along the Si±Si chain and excessive exciton trapping 

and decay at the branching points. 

It is well known [10] that hydrogen surface reactions exert basically twofold 

in¯uence on plasmatically grown materials: ®rst, the hydrogen mediates etching 

during the deposition process, improving the ®nal properties of the ®lms by 

removing the energetically weak bonds and thus leading to more compact and voidfree 

material; second, the increased concentration of hydrogen in the ®lms 

deteriorates the microstructure and forms hydrogen related defects. Thus, usually an 

optimum of microphysical properties at a speci®c hydrogen concentration is 

observed. 

Absorbance and emission PL spectra of a plasmatically prepared sample are 

shown in Fig. 4. A comparison with the corresponding measurements on PMPSi


Fig. 3. Excitation (a) and emission (b) photoluminescence (PL) spectra of plasmatically prepared 

PMPSi at different partial pressures of hydrogen and of the dichloromethylphenylsilane monomer 

(PH2 ‡ Pmono). Excitation spectra were detected for photoluminescence at 480 nm. The excitation 

spectrum of the sample prepared at PH2 ˆ 60 Pa and Pmono ˆ 20 Pa exhibits bands at 380 nm (Si - 

), 327 nm, and 285 nm (phenyl - ); a tail in the long wavelength region is typical for disordered 

materials. In the emission spectrum, an exciton band with a maximum at 390 nm (Si - ) and an 

imperfection PL centred at 470 nm can be observed. Excitation spectra were detected at 480 nm, 

emission spectra were measured for excitation at 280 nm 

prepared from solution (Fig. 2) reveals the presence of all typical optical transitions: 

the excitonic transitions (Si - ) are well visible both in absorption ( ˆ 310 nm) 

and PL emission ( ˆ 325 nm) spectra. In the excitation spectrum, the - 

transition ( ˆ 258 nm) and the short-wavelength peak at ˆ 223 nm are present. 

We also studied in some detail the PL properties of plasmatically prepared 

PMPSi excited in the short wavelength region ( ˆ 210±230 nm). In Fig. 5, the


Fig. 4. Absorption and emission PL spectra of a solid plasma-prepared ®lm of poly-((methyl)phenylsilanediyl) 

(PMPSi) (excitation at 280 nm at room temperature) 

Fig. 5. PL emission spectra for plasmatically prepared PMPSi for excitation wavelengths of 280 and 

210 nm at room temperature 

effect of different excitation wavelengths is given, resulting in two PL emission 

bands. The PL emission spectrum with an excitation wavelength of 280 nm contains 

both the Si main chain - exciton at 325 nm and a broad defect luminescence 

centred at 440 nm as expected from previous experiments. The PL emission 

spectrum obtained with an excitation wavelength of 210 nm differs considerably ± 

the Si main chain - excitonic emission at ˆ 328 nm increases enormously in 

intensity, and the defect luminescence is nearly missing. Figure 6 shows the 

excitation PL spectra recorded at ˆ 338 nm (a) and emission spectra obtained by 

excitation at ˆ 210 nm (b) for plasmatically prepared PMPSi of different ®nal


Fig. 6. PL spectra of plasmatically prepared PMPSi ®lms; (a) excitation spectra recorded at 

ˆ 340 nm, (b) emission spectra excited with ˆ 210 nm; the curves refer to different ®nal 

temperatures of the fractional heating in thermal desorption spectroscopy as described in Ref. [8] 

temperatures of fractional heating in the thermal desorption spectroscopy as 

described in Ref. [8], where the effused species are detected by mass spectroscopy 

under controlled heating. The PL spectra of the virgin samples, measured as 

prepared, are depicted with the parameter 25 C; the subsequent maximum temperatures 

are indicated. It is worth mentioning that the virgin sample exhibits the 

most pronounced luminescence which decreases after annealing (the luminescence 

measurements were performed at room temperature). The effect is strictly


correlated with the effusion of the benzene rings in the range of temperatures of 

350±400 C [8]. Thus, we tentatively attribute the localization of the PL site excited 

at 210±230 nm to the phenyl group or the phenyl-silicon bond. Similar effects have 

been described in connection with spectral narrowing of stimulated mirrorless 

emission in conjugated polymers [12, 13], but effects of super¯uorescence [14] have 

also to be considered. 

Experimental 

The reference PMPSi was prepared by Wurtz coupling polymerization as described by Zhang and 

West [13]. The low-molecular weight fractions were extracted with boiling diethyl ether. The residual 

polymer, obtained in ca. 17% yield, possessed an unimodal but broad molecular mass distribution of 

Mw ˆ 4 104 . Thin ®lms were prepared from toluene solution by casting on borosilicate glass. 

The CVD reactor was an 13.56 MHz capacitively coupled radio-frequency discharge unit with a 

maximum power of 1.5 W cm 2 . For the deposition, a mixture of hydrogen (0±60 Pa) and 

dichloromethylphenylsilane (5±30 Pa) was used. The substrate temperature was kept at 80 C. The 

substrates for IR absorption were silicon polished wafers; for UV absorption and luminescence 

measurements, quartz and borosilicate glass were used. UV/Vis absorption spectra were recorded with 

a Hitachi U300 instrument; for IR spectroscopy, a Nicolet Impact 400 FTIR assembly was used; 

luminescence both in steady-state and transient regimes was measured with an Edinburgh Science FF/ 

FL900 spectrometer, for swelling experiments, a home built apparatus was used; desorption 

measurements were carried out on a mass spectrometer Leybold 200 pumped by a Balzers 

turbomolecular pump; scanning photoelectron spectroscopy was performed on XPS and UPS VG- 

Scienti®c ADES 400 instruments. 


This paper presents results achieved in connection with the COST 518 project. Support from the 

grant A1050901 of the grant agency of the Academy of Sciences of the Czech Republic is 

acknowledged. 

References 

[1] Suzuki M, Nakata Y, Nagai H, Goto K, Nishimura O, Okutani T (1998) Mater Sci Eng A146:36 

[2] Watanabe A, Kawato T, Matsuda M, Fujitsuka M, Ito O (1998) Thin Sol Films 312: 123 

[3] Nagai H, Nakata Y, Suzuki M, Okutani T (1998) J Mater Sci 33: 1897 

[4] NavraÂtil K, SÏik J, HumlicÏek J, NesÏpuÊrek S (1999) Opt Mater 12: 105 

[5] Harrah LA, Zeigler JM (1987) Macromolecules 20: 610 

[6] Ito O, Terazima M, Azumi A, Matsumoto N, Takeda K, Fujino M (1989) Macromolecules 22: 

1718 

[7] NesÏpuÊrek S, Schauer F, Kadashchuk A, this issue 

[8] Schauer F, NesÏpuÊrek S, HorvaÂth P, Zemek J, Fidler V (2000) Synth Metals 109: 321 

[9] Wilson WL, Weideman TW (1991) J Phys Chem 95: 4568 

[10] Cf. e.g. Davis EA: Hydrogen in Silicon (1996) J Non-Crystall Solids 198±200: 1 

[11] Zhang X-H, West R (1984) J Polym Chem Ed 22: 159 

[12] Lemmer U (1998) Polym Adv Technol 9: 476 

[13] Frolov SV, Gellermann W, Ozaki M, Yoshino K, Vardeny ZV (1997) Phys Rev Lett 78: 729 

[14] Siegman AE (1986) Lasers. University Science Books, Mill Valley, CA 

Received July 10, 2000. Accepted (revised) September 8, 2000

Ž . 

Journal of Non-Crystalline Solids 227–230 1998 669–672 

ž / 

Metastable states in poly methylphenylsilylene induced by UV 

radiation and electron beam 

R. Handlir a,) , F. Schauer a , S. Nespurek a,c , I. Kuritka a , M. Weiter a , P. Schauer b 

a 

Faculty of Chemistry, Technical UniÕersity of Brno, Veslarska 230, 637 00 Brno, Czech Republic 

b 

Institute of Scientific Instruments of the Academy of Sciences of the Czech Republic, Brno, Czech Republic, KraloÕopolska 112, 616 00 


c 

Institute of Macromolecular Chemistry of the Academy of Sciences of the Czech Republic, HeyroÕskeho 2, 162 06 Prague 6, Czech 

Republic 

Abstract 

We have examined and measured the density of states Ž DOS. in a prototypical polyŽ silylene. -polyŽ methylphenylsilylene. 

Ž PMPSi. using the method of post-transit hole emission signals from traps using the time of flight Ž TOF. photoconductivity 

method. The main goal of our measurements was to correlate the metastable states produced both by UV radiation and 

electron beam and to determine their basic parameters as to their energies and susceptibility for annealing. In the course of 

measurements we discovered in accordance with our previous observations the fully reversible states around and deeper than 

0.55 eV. q 1998 Elsevier Science B.V. All rights reserved. 

Ž . 

Keywords: Poly methylphenylsilylene ; UV radiation; Electron beam 


Amorphous silicon and polyŽ silylenes. are members 

of the larger class of silicon backbone solids. 

The latter mentioned backbone polymers are of interest 

because of their electrical, photo-electronic, and 

non-linear optical properties. Also, their optical and 

electrical properties differ from structurally analogous 

carbon-based p-conjugated systems such as 

polyŽ ethylene. or polyŽ styrene . , resembling rather 

fully p-conjugated systems such as polyŽ acetylene . . 

The quantum generation efficiency and the charge 

carrier drift mobility of the order of 10 y4 cm 2 V y1 

) 

Corresponding author. Fax: q42 5 4321 1101; e-mail: 

handlir@fch.vutbr.cz. 

0022-3093r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. 

Ž . 

PII: S0022-3093 98 00339-1 

y1 s w1–3 x, 

large for organic polymeric photo conductors, 

stimulated interest in its photo stability and 

electronic structure. In this paper, we report the 

measurements of the metastable states produced both 

by UV radiation and electron beam, and the determination 

of the basic parameters as to their energies 

and susceptibility for annealing in a prototypical 

polyŽ silylene. -polyŽ methylphenylsilylene. Ž PMPSi. 

using the method of post-transit hole emission signals 

from traps using time of flight Ž TOF. photoconductivity. 

2. Material properties and experiment 

Ž . 

PMPSi Scheme 1 was prepared by Wurtz coupling 

polymerization, as described by Zhang and

670 

( ) 

R. Handlir et al.rJournal of Non-Crystalline Solids 227–230 1998 669–672 

Scheme 1. 

West wx 4 . The low-molecular weight fractions were 

extracted with boiling diethyl ether. The residual 

polymer, obtained in ca. 17% yield, possessed an 

unimodal but broad molecular mass distribution, Mw s4.10 4 . 

Thin films for photoconductivity measurements 

Ž thickness ranges from 2 to 4 mm. were prepared 

from a toluene solution by casting on conducting 

indium tin oxide or Au covered borosilicate glasses. 

The top semitransparent Al electrodes were prepared 

by vacuum evaporation. Before deposition the polymers 

were purified three times by precipitation in 

methanol and toluene solution and centrifuged Ž1200 

rpm, 145 min . . After deposition the films were dried 

at 10y3 Pa at 330 K for at least 4 h. 

Infrared absorption spectra are given in Fig. 1. 

Tentative assignments for the vibrational bonds are 

based on the earlier assignments by Zhang and West 

wx 4 and completed by authors. 

Fig. 2 gives data on ultra-violet visible Ž UV-VIS. 

absorption and luminescence spectra in solution and 

Fig. 1. Infrared spectra of PMPSi. 

Fig. 2. Absorption spectra of PMPSi in tetrahydrofurane solution 

Ž curve 1: – P – . and in the solid state Ž curve 2: . . 

Curves 3 Ž – PP – . and 4 Ž — — . represent luminescence spectra in 

tetrahydrofurane solution and in the solid state, respectively. 

in the solid state. The exciton peak at 3.7 eV is a 

consequence of the Ž s–s ) . Žbonding 

and antibonding 

molecular orbitals. absorption of all Ž Si. nseg- ments in the amorphous and polycrystalline sample, 

the fluorescence maximum at 3.5 eV provides a 

better estimate for one-photon absorption of the 

longest segments. The ‘size’ of the excitation is 

;25 bonds from the radiative power measurements 

wx 5 . The second exciton band with peak at about 4.4 

eV occurs in the Ž p–p ) . transitions in the phenyl 

side groups. 

In the transient photoconductivity Nd–YAG laser 

with a dye laser and a doubler were used to produce 

a single shot Ž ls330 nm . . Transient photocurrent 

was detected with low noise converter and digitizing 

oscilloscope. The vacuum temperature controlled 

cryostat was used both for the measurements and 

light-soaking experiments. A pulse modulated electron 

microscope Ž Us10 kV and Is1 nA. provided 

with the spectral electroluminescence apparatus was 

used for the electron induced metastability. For controlled 

light-soaking, both the water filtered Xe lamp 

Ž 75 W. and Hg lamp Ž 200 W. were used. 

3. Results 

The samples were irradiated by UV light around 

l s350 nm Ž using a bandpass filtered Xe lamp. 

inc 

and molecular weight of the polymer was measured

( ) 

R. Handlir et al.rJournal of Non-Crystalline Solids 227–230 1998 669–672 671 

Fig. 3. Reciprocal value of the molecular weight of PMPSI vs. 

irradiation time Ž ls350 nm.Ž B . . fs represents the quantum 

efficiency of polymer main chain scission. The lines are drawn as 

guides for the eyes. 

by means of gel permeation chromatography. It is 

evident from Fig. 3 that the average molecular weight 

decreases with irradiation time. At the same time the 

shift of the position of the maxima of the absorption 

was observed Žfrom 

336 nm to 320 nm after 20 min 

irradiation . . This shift supports the results concerning 

the Si–Si bond scission after UV irradiation. 

From the flash photolysis measurements wx 6 , it 

follows that the induced absorption consists of maximum 

at 360 nm and two broader smaller maxima at 

about 423 and 460 nm. The absorbance in the main 

maximum was determined as 0.009 cmy1 . The 360nm 

absorption is assigned to the radical-cation Žposi- 

tive polaron. on the basis of the spectral data in the 

g-irradiated rigid matrix at 77 K wx 7 . The smaller 

Fig. 4. The time evolution of the degradation both for the UV ŽXe 

filtered, 75 W. radiation Ž I. and electron beam Ž 10 kV, 1 nA. 

Ž n . . The lines are drawn as guides for the eyes. 

absorption at 460 nm is attributed to both silyl 

radical;SiR and silylene biradical wx 

2 

8 . 

The time evolution of the degradation both for the 

UV Ž Xe. radiation and electron beam are in Fig. 4. It 

is necessary to point out that both plots differ in the 

output quantity—in the UV degradation experiments 

it was the amplitude of the TOF photocurrent signal 

and in the electron beam experiment it was an 

integral electroluminescence signal. The recovery of 

both signals after an anneal was, in both cases, at 

nearly original magnitudes. 

4. Discussion 

The main goal of the experiments was to determine 

the properties of the metastable states. For this 

purpose we used the post-transit spectroscopy de- 

scribed in Ref. wx 9 . The light soaking time evolution 

of the total collected charge, Q , the dispersion 

coll 

coefficient, a, and the value of the photocurrent at 

the transit time, I , are depicted in Fig. 5. Also, 

max 

the respective quantities after the anneal at T s370 

a 

K for t s20 min are given. It is obvious that all the 

a 

quantities decrease with the light soaking, but the 

dependencies for Q and a have a similar depencoll 

dence compared to that of the photocurrent at the 

transit time I . Besides, both exhibit different anmax 

nealing behavior as complete recovery of the photocurrent 

at the transit time I is achieved, whereas, 

max 

Fig. 5. The irradiation induced metastable states: time evolution 

the total collected charge Q Ž I . coll , the dispersion coefficient a 

Ž `. and the value of the photocurrent at the transit time I Ž n . max , 

also given are the values after anneal at 370 K for 10 min 

Ž Bv' . . The lines are drawn as guides for the eye.

672 

( ) 

R. Handlir et al.rJournal of Non-Crystalline Solids 227–230 1998 669–672 

Fig. 6. The irradiation induced metastable states: time evolution of 

the metastable DOS function in the time interval tgŽ 0,10. min, 

also given is the DOS after anneal at 370 K for 20 min Ž – PP –. . 

Q and a after anneal do not reach the original 

coll 

magnitudes. 

The irradiation induced metastable states expressed 

by the density of states Ž DOS. function are 

in Fig. 6. The evaluation and results are in accor- 

dance with our previous paper w10 x. 

The progressive 

increases in DOS at the energy, 0.55 eV, with indication 

of some still deeper radiation generated states. 

The remarkable point is that those states after anneal 

at 370 K for 20 min do not anneal completely Žsee 

a 

curve in Fig. 6 . . The light-induced metastable states 

have been previously observed in transient photocur- 

rent hole experiments by Naito et al. w11,12 x. 

They 

interpret the metastable changes by creation of con- 

formational changes in Si backbone. In Ref. w13 x, 

the 

authors calculated and observed photocreated 

metastable states in organopolysilane solids using 

light induced ESR. They found two types of light-induced 

centers, one for lower photo excitation Žca. 

3.5 

eV. due to the Si skeleton stretching forces and the 

other higher photo excitation Ž over 4.8 eV. creates 

weak bonds in several places of the Si skeleton. 


Ž. 

The main conclusions are: 1 the observed phenomena 

are interpreted as the metastability in polysi- 

lylanes connected with the change of the conformation 

length that was correlated with the blue shift of 

the maximum energy of the absorption correspond- 

) Ž. 

ing to s–s Si transitions; 2 the light soaking 

time evolution of the total collected charge, Q , the 

coll 

dispersion coefficient, a, and the value of the pho- 

tocurrent at the transit time, I , causes decrease of 

max 

all the quantities mentioned; Ž. 3 the temperature 

anneal T s370 K for t s20 min recovers the 

a a 

quantity I , whereas only partial recovery of the 

max 

quantities Q and a is achieved. 

coll 


The support of the Czech Grant Agency contract 

102r97r0105 and Grant Agency of the Academy of 

Sciences contract 4050603r1997 is acknowledged. 

References 

wx 1 A. Eckhardt, W. Herden, S. Nespurek, W. Schnabel, Philos. 

Mag. B 71 Ž 1995. 239. 

wx 2 S. Nespurek, Macromol. Symp. 104 Ž 1996. 285. 

wx 3 R.G. Kepler, J.M. Zeigler, L.A. Harrah, S.R. Kurtz, Phys. 

Rev. B 35 Ž 1982. 2819. 

wx 4 X.-H. Zhang, R. West, J. Polym. Sci., Polym. Chem. Ed. 22 

Ž 1984. 159. 

wx 5 L.A. Harrah, J.M. Zeigler, in: C.E. Hoyle, J.M. Torkelson 

Ž Eds. . , Photophysics of Polymer, American Chemical Soc., 

Washington, DC, 1987. 

wx 6 C.P. Penado, T. Wollny, W. Schnabel, Radiat. Phys. Chem. 

40 Ž 1992. 101. 

wx 7 S. Irie, H.H. Horri, M. Irie, Macromolecules 13 Ž 1980. 1355. 

wx 8 Y. Ohsaho, J.R.G. Thorpe, C.M. Phillips, J.M. Zeigler, R.M. 

Hochstrasser, J. Phys. Chem. 13 Ž 1989. 4408. 

wx 9 G.F. Seynhaeve, R.P. Barclay, G.J. Adreaenssens, J.M. Marshall, 

Phys. Rev. B 39 Ž 1989. 10196. 

w10x F. Schauer, R. Handlir, S. Nespurek, Adv. Mater. Opt. 

Electron. 7 Ž 1997. 61. 

w11x H. Naito, S. Zhang, M. Okuda, T. Dohmaru, J. Appl. Phys. 

76 Ž 1994. 3612. 

w12x H. Naito, S. Kodama, Q.Z. Kang, M. Okuda, J. Non-Cryst. 

Solids 198–200 Ž 1996. 653. 

w13x K. Takeda, K. Shiraishi, M. Fujiki, M. Kondo, K. Morigaki, 

Phys. Rev. B 50 Ž 1994. 5171.

Příloha č. 2 – doklady 

dokládající kvalifikaci, způsobilost a kompetence žadatele 

Seznam přiložených dokladů: 

1. Doklad o jmenování docentem 

2. Potvrzení o pedagogické praxi 

3. Jmenování členem vědecké rady FCH VUT v Brně 

4. Jmenování členem oborové rady doktorského studijního programu Chemie, 

technologie a vlastnosti materiálů 

5. Osvědčení o absolvování kurzu Project preparation and project management – 

FP7 

6. Osvědčení o absolvování kurzu hodnotitelů OP VK 

7. Osvědčení o absolvování kurzu EU Funding Academy – 7FP 

8. Osvědčení o absolvování kurzu Řízení kvality 

9. Osvědčení o absolvování studia Doplňující pedagogické studium 

10. Osvědčení o absolvování kurzu pro pracovníky distančního vzdělávání 

11. Osvědčení o absolvování semináře Virtuální vzdělávací prostředí MOODLE 

43

Author's personal copy - Fakulta chemická - Vysoké učení technické ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?