Coordinated regulation of gene expression by E ... - Jacobs University

Coordinated regulation of gene expression by E.coli
chromatin proteins FIS and H-NS
A Dissertation Presented
by
Ramesh Mavathur Nanjundaiah
A thesis Submitted in partial fulfillment
of the requirements for the degree of
DOCTOR OF PHILOSOPHY
in Biochemistry
School of Engineering and Science
Jacobs University Bremen

Coordinated regulation of gene expression by E.coli
chromatin proteins FIS and H-NS
by
Ramesh Mavathur Nanjundaiah
A thesis Submitted in partial fulfillment
of the requirements for the degree of
DOCTOR OF PHILOSOPHY
in Biochemistry
Approved as to style and content by:
_________________________________________
Prof. Dr.Georgi Muskhelishvili
___________________________________
Prof. Dr. Albert Jeltsch
___________________________________
Prof. Dr. Sebastian Springer
___________________________________
Prof. Dr. Andrew Travers
Date of Defense: August 29 th 2007
School of Engineering and Science

Parts of this work has been published in:
Auner, H., Buckle, M., Deufel, A., Kutateladze, T., Lazarus, L., Mavathur, R.,
Muskhelishvili, G., Pemberton, I., Schneider, R., and Travers, A. (2003)
Mechanism of transcriptional activation by FIS: role of core promoter structure
and DNA topology. J Mol Biol 331: 331-344.
Blot, N., Mavathur, R., Geertz, M., Travers, A., and Muskhelishvili, G. (2006)
Homeostatic regulation of supercoiling sensitivity coordinates transcription of
the bacterial genome. EMBO Rep 7: 710-715.
Lang, B., Madan Babu, M., Blot, N., Bouffartigues, E., Buckle, M., Geertz, M.,
Gualerzi, C., Mavathur, R., Muskhelshvili, G., Pon, C., Rimsky, S., Stella, S.,
Travers, A., (2007) High affinity DNA binding sites for H-NS provide a
molecular basis for selective silencing within proteobacterial genomes. Nucleic
Acids Res: 35(18): 6330-7.
Geertz, M., Mavathur, R., Travers, A., Shimamoto, N., Muskhelishvili, G. RNA
polymerase composition is homeostatically coupled with DNA topology in E. coli
Submitted to EMBO reports.

ABSTRACT
Abstract
Bacteria are omnipresent small organisms that posses impressive ability to adapt to their
environment. Adaptation, a universal phenomenon seen at all different levels of
organizational complexity of life, is accomplished mainly by adjustment of the gene
expression pattern. Studies using microarray-mediated transcript profiling in E.coli
demonstrated the existence of direct correlations between the global gene expression
patterns and different phases [Tao, 1999; Weber, 2005; Wei, 2001]. Previous work from
our and other laboratories indicated that in E.coli the cellular transcription is under the
control of a global regulatory network whose main components are - DNA
topoisomerases, chromatin proteins modulating the supercoil dynamics of DNA and, the
RNA polymerase. The aim of this project was to understand the basic structural
mechanism of interaction of two of the components (DNA supercoiling and chromatin
proteins) and the underlying functional coordination of gene expression in E.coli.
To understand the coordination of the components, the problem was
approached at two levels of complexity, (1) global – for this purpose we developed a
novel DNA microarray-based approach combining mutations in the genes of chromatin
proteins with directional changes of DNA superhelicity and (2)local - at the level of
individual gene promoter, using as a model tyrT promoter system, to understand the
molecular mechanism of the interplay between supercoiling and transcriptional
regulators. The study has led us to propose that the global transcription regulation is
spatiotemporally coordinated by the differential distribution of two types of information,
‘analog’ and ‘digital’. The digital or discontinous property of an information is manifest
in the pattern of expressed genes at all times depending on the distribution of the analog
component - DNA supercoiling - distribution of supercoiling in different parts of the
genome. The analog component is continuously converted in the pattern of expressed
genes and vice versa, thereby modulates the physiology to a dynamic equilibrium,
which can be readjusted in response to changes in both the digital (mutation) and
analog (growth phase or stress induced changes of supercoiling) information. On the
example of tyrT promoter we demonstrate how the sequence organization of the

ABSTRACT
promoter region determines the supercoiling sensitivity of the promoters. Our data
indicate that the transcription from a strong promoter, like tyrT, is a consequence of two
phenomena, the local effect of binding of chromatin protein FIS at the promoter region
and the general effect of FIS on the average superhelical density of the DNA.

ACKNOWLEDGEMENTS
Acknowledgements
I would like to express my appreciation, gratitude and thanks to the following people
who have supported this work in many ways.
I am indepted to Prof. Dr. Georgi Muskhelishvili not just for guiding my PhD work but
for inspiring scientific temper in me, for being a mentor to whom I always looked up to
during predicament and have very rarely been not satisfied by his suggestions and
opinions to problems both scientific and general.
Sincere thanks to Jacobs University Bremen (formerely International University
Bremen) and Max Planck Institute for Terrestrial Microbiology at Marburg for giving
me an opportunity to pursue my PhD work.
I thank my doctoral examination committee, Prof. AndrewTravers, Prof. Albert Jeltsch
and Prof. Sebastian Springer for support and motivation during my time at Jacobs
University and for their thorough appraisal of this dissertation.
I also take this opportunity to thank my family: my father, my mother, my sister Rohini,
my borther-in-law Prakash, my nephew Varun, my niece Varsha, my brother Prasad,
my sister-in-law Shvetha and my twin nieces Anagha and Anusha. The love showered
by these people has always provided inspiration and motivation for me.
A special thanks to my group members Marci, Michi, Sebastian, Nico and Claudia who
made working in the lab an enjoyable experience. I will always cherish the time I spent
with these intelligent people. And also thanks to Sissi for inducing and offering
creative inputs on improving the appearance of my thesis and presentation beside being
a good friend. Thanks also to all my friends in Marburg all of whom gave a very nice

ACKNOWLEDGEMENTS
first impression of Germany, so much so that I feel Marburg as my home town in
Germany.
The time at the university was pleasant because of my friends all of whom I wish to
thank. And friends from IGC, Sanjay, Arun, Abhishek (more popularly known as
‘Badiya’) and Nandu for organizing and participating in the weekend parties.

TABLE OF CONTENTS
1 Introduction ………………………………………………………………….. 1
1.1 Is there a common coordinating factor? ………………………………... 2
1.1.1 Is there a common coordinating mechanism? ………………………… 3
1.2 Global transcription coordination - current knowledge …………….. 4
1.2.1 Gene promoters ………………………………………………………. 5
1.2.2’Gene promoters respond distinctly to changes of supercoiling ………… 7
1.2.3 DNA Supercoiling and mechanisms regulating it ……………………. 9
1.2.4 Supercoiling and growth transitions …………………………………. 11
1.2.5 The nucleoid associated proteins – major players in global gene expression
regulation …………………………………………………………….. 12
1.2.6 Composition of RNAP also changes with growth …………………… 14
1.3 Organisation of global transcription - coordinated view …………… 15
2 Materials and methods ……………………………………………………… 18
2.1 Materials ……………………………………………………………….. 18
2.1.1 Enzymes & chemicals ………………………………………………… 18
2.1.2 Antibiotics ……………………………………………………………. 19
2.1.3 Media …………………………………………………………………. 19
2.1.4 Buffers and stock solutions …………………………………………… 20
2.1.5 Bacterial strains ………………………………………………………. 21
2.1.6 Plasmids ……………………………………………………………… 22
2.1.7 Primers ……………………………………………………………….. 23
2.2 Methods ………………………………………………………………… 24
2.2.1 Agarose gel electrophoresis ………………………………………….. 24
2.2.2 Small and medium scale isolation of plasmid DNA using Qiagen kit … 24
2.2.3 Restriction Digestion ………………………………………………… 25
2.2.4 Polymerase chain reaction …………………………………………… 25
I

TABLE OF CONTENTS
2.2.5 Preparation of competent E.coli cells using calcium chloride ……….. 25
2.2.6 Transformation of E.coli cells ………………………………………… 25
2.2.7 Purification of nucleic acids by Phenol:Chloroform extraction ……… 26
2.2.8 Concentrating and quantification of nucleic acids …………………… 26
2.2.9 Polyacrylamide sequencing gels ……………………………………… 26
2.2.10 Growth curves and norfloxacin treatment ……………………………. 27
2.2.11 Extraction and quality check of total RNA …………………………… 27
2.2.12 Microarray hybridization …………………………………………….. 28
2.2.13 Microarray analysis …………………………………………………… 29
2.2.14 Real-time PCR ……………………………………………………….. 30
2.2.15 High resolution agarose gel electrophoresis and determination of sigma (σ)
……………………………………………………………………….. 30
2.2.16 In vitro transcription …………………………………………………. 31
2.2.17 Primer extension ……………………………………………………… 32
2.2.18 Potassium permanganate footpriniting ……………………………….. 32
2.2.19 β-galactosidase assay ………………………………………………… 33
3 Results ……………………………………………………………………….. 34
3.1 Growth phase dependent global transcriptional regulation ………… 34
3.1.1 Growth of CSH50 and LZ strains ……………………………………. 34
3.1.2 A novel microarray based approach to derive growth phase-specific
transcript profiles organized by supercoiling and chromatin proteins
………………………………………………………………………….. 36
3.1.3 Changes of supercoiling during growth ……………………………… 38
3.1.4 Genomic wheels of supercoiling sensitivity …………………………. 39
3.1.5 Variations of supercoiling-associated transcripts …………………….. 42
3.1.6 Supercoiling sensitivity of biosynthesis and degradation pathways …. 45
3.1.7 Coordination of metabolic pathways by supercoiling sensitivity …….. 45
3.2 Role of supercoiling and chromatin protein FIS in transcriptional
regulation of an individual promoter ………………………………… 49
3.2.1 Mechanism of transcriptional regulation by FIS & supercoiling: tyrT
promoter paradigm
…………….…………………………………………………………… 49
II

TABLE OF CONTENTS
3.2.2 In vivo expression of tyrT in CSH50 Wt & fis mutant ………………. 50
3.2.3 Dependence of promoter activity on superhelical density in vivo …… 51
3.2.4 Dependence of promoter activity on superhelical density in vitro …... 53
3.2.5 Effects of promoter mutations on the function ………………………. 54
4 Discussion …………………………………………………………………… 58
4.1 Interdependency of supercoiling and NAPs …………………………. 59
4.2 Supercoiling coordinates metabolic functions ……………………….. 61
4.3 Activity of tyrT promoter - Interaction of supercoiling and FIS at the
promoter level …………………………………………………………. 63
4.3.1 Promoter structure and function ……………………………………… 64
4.3.2 Mechanism of transcriptional activation of the tyrT promoter ………. 66
5 Conclusion …………………………………………………………………… 68
6 References ……………………………………………………………………. 69
7 Appendix I - Supplementary data: Gene lists from microarray experiments. .. 81
III

LIST OF TABLES
List of tables
Table 1 Bacterial strains used …………………………………………. 21
Table 2
Table 3
Table 4
Number of single and double-coded transcripts in fis and hns
transcript profiles ……………………………………………… 43
Supercoiling sensitivity of genes of biosynthesis and degradation
pathways ..………………………………………………………. 45
RT-PCR analysis of some of the genes from TCA cycle and purine
biosynthesis ..……………………………………………………. 48
Supplementary table I
Supplementary table II
Supplementary table III
Supplementary table IV
Supplementary table V
Supplementary table VI
CSH50 wild-type Vs CSH50 ∆fis, Midexponential
phase ….……………………….. 81
CSH50 wild-type Vs CSH50 ∆fis, Transition
to stationary phase ...……………………….. 89
CSH50 wild-type Vs CSH50 ∆fis, Late stationary
phase ………………………………………. 92
CSH50 wild-type Vs CSH50 ∆hns, Midexponential
phase …………………….. 97
CSH50 wild-type Vs CSH50 ∆hns, Transition to
stationary phase ………………....………….. 104
CSH50 wild-type Vs CSH50 ∆hns, Late
stationary phase …………………………….. 107
Supplementary table VII : LZ41 wild-type Vs LZ54 wild-type .……….. 110
Supplementary table VIII LZ41 ∆fis Vs LZ54 ∆fis ……...…………….. 123
Supplementary table IX LZ41 ∆hns Vs LZ54 ∆hns ..…………............ 136
Supplementary table X LZ41 wild-type Vs LZ41 ∆fis …..…………. 150
IV

LIST OF TABLES
Supplementary table XI LZ54 wild-type Vs LZ54 ∆fis …...…………. 160
Supplementary table XII LZ41 wild-type Vs LZ41 ∆hns ……….. .….. 167
Supplementary table XIII LZ54 wild-type Vs LZ54 ∆hns ……….. .….. 179
V

LIST OF FIGURES
List of Figures
Figure 1: Schematic illustration of operation of the genetic system involving an
alternation of the digital (discontinuous) and analog (continuous) information. ... 4
Figure 2: Structure of consensus Eσ70 promoter showing functionally important
region. ……………………………………………………………………………… 6
Figure 3: Structural profiles of Sigma70 and Sigma54 promoter regions. …….. 7
Figure 4: In vitro transcription from fis & bla promoters at different superhelical
densities …………………………………………………………………………….. 8
Figure 5: Schematic representation of core promoters with different spacer
length. ……………………………………………………………...………………... 9
Figure 6: Graphical representation of global DNA topology changing with growth
......................................................................................................................................... 12
Figure 7: Abundance of NAPs during different phases of growth . ........................ 13
Figure 8: Growth phase-dependent change in the level of different forms of the
RNA polymerase.. ......................................................................................................... 15
Figure 9: Overview of comparative gene expression of wild-type & fis (example)
analysis using microarrays. .......................................................................................... 29
Figure 10: Growth curves of CSH50 wild-type and the mutants. ........................... 35
Figure 11: Design of DNA microarray experiments. ................................................ 37
VI

LIST OF FIGURES
Figure 12: Topoisomer distributions of plasmids (pUC18) isolated from growing
cells. ................................................................................................................................ 39
Figure 13: Genomic wheels showing spatiotemporal distribution of supercoiling
associated transcripts.................................................................................................... 41
Figure 14: Changes of supercoiling associated genes during growth in fis & hns
mutants compared to wild-type . ................................................................................. 44
Figure 15: Coordination of essential metabolic pathways by supercoiling sensitivity.
......................................................................................................................................... 47
Figure 16: Schematic representation of tyrT promoter. ............................................ 50
Figure 17: The relative β-galactosidase activity from different ptyrT derivatives. 51
Figure 18: In vivo expression of tyrT promoter constructs. ..................................... 52
Figure 19: In vitro transcription of ∆61 constructs of wild type and derivatives. . 54
Figure 20: in vitro transcription from tyrTwild-type and tyrTD at different
supercoiling. ................................................................................................................... 55
Figure 21: Pottassium permanganate footprinting of ptyrT and its derivatives. .. 56
VII

ABBREVIATIONS
Abbreviations
∆61
∆fis
∆hns
Act
bp
CTP
Cy3
Cy5
Promoter constructs with upstream sequence beyond
position -61 deleted.
strain with mutation in fis gene
strain with mutation in hns gene
genes activated under a stated condition
base-pairs
cytidine triphosphate
Cyanine 3 dye
Cyanine 5 dye
o C
degree Celsius
dCTP
dNTP
DTT
EDTA
E.coli
deoxycytidine triphosphate
deoxynucleoside triphosphate
Dithiothreitol
ethylenediamine tetraacetic acid
Escherichia coli
Eσ 70 RNAP polymerase holoeenzyme with sigma 70
subunit
GTP
guanosine triphosphate
VIII

ABBREVIATIONS
Hyp
kbp
LS
Mbp
ME
mg
ml
mM
μM
μg
NAP
NTP
PCR
ppGpp
Rel
Rep
RNAP
RT-PCR
SDS
TAE
hypernegative supercoiling associated genes
kilo base-pairs
late sationary growth phase
million base-pairs
mid-exponential growth phase
Milligram
Mililitre
Milimolar
Micromolar
Microgram
nucleoid associated protein
nucleoside tri-phosphae
polymerase chain reaction
guanosine-3’,5’(bis)pyrophosphate
relaxation associated genes
genes repressed under a stated condition
RNA polymerase
Real-time PCR
Sodium dodecyl sulphate
Tris-acetate EDTA
IX

ABBREVIATIONS
TBE
Tris
TS
tyrT35U
tyrTD
tyrTS
tyrTWt
UAS
V/cm
ω
μg
μl
σ
Tris-borate EDTA
Tris-(hydroxymethyl)-aminomethane
transition to stationary growth phase
tyrT plasmid with a mutation in the -35 hexamer
tyrT plasmid with a mutation in the discriminator
tyrT plasmid with a mutation in the spacer
plasmid with wild-type tyrT prmoter
upstream activating sequence
volts per centimeter
omega subunit of RNAP
Microgram
Microlitre
sigma subunit of RNAP
X

INTRODUCTION
1 Introduction
Cellular division, differentiation and development implicate gene expression programs,
which are coordinated in time and space both in prokaryotes and eukaryotes. In
prokaryotes, control of transcriptional initiation is the most pervasive form of gene
regulation whereby recent development of high-throughput technologies allow to
analyze simultaneously the activities of thousands of genes. Prokaryotes like E.coli K12
(non-pathogenic laboratory strain) give us in addition a possibility to study genetic
regulation under wide range of variation in external physical and chemical parameters
such as temperature, pH, barometric pressure, osmolarity, oxygen availability, nutrient
supply and presence of toxic substances. Furthermore in this classical model organism a
large amount of genetic information has already been accumulated, providing a unique
opportunity for genome-wide analyses of global gene expression patterns.
E.coli is a facultative anaerobic, gram-negative bacterium growing at rates
varying from 20 minutes to 24 hours depending on the environment. This organism thus
shows an impressive ability to grow and divide rapidly but can grow slowly for
prolonged times as well. E.coli growing in rich medium reproduces fast and does so
primarily by elevating the expression levels of genes for ribosomal proteins and stable
RNA, and other translation machinery factors. In contrast, in minimal medium
expression levels of genes involved in biosynthesis of building blocks, notably amino
acid biosynthesis are elevated [Wei et al., 2001; Tao et al., 1999; Weber et al., 2005].
Both these conditions are also associated with numerous subtle changes like redirection
of intermediary metabolism, changes in electron transport chain composition and
concentration of different metabolic enzymes [Murray et al., 1996; Neidhardt et al.,
1987). During the growth, also a number of morphological and physiological attributes
change. Investigation of gene expression patterns under different growth conditions
reveals a distinct arrangement of expressed functions, indicating that E.coli possess
proprietary over a multitude of gene expression programs. Heterogeneity of E.coli’s
response is exemplified as follows in the classical book Escherichia coli and
1

INTRODUCTION
Salmonella: “In more than just a figurative sense, bacteria invented gene regulation,
and the bacterial cell’s style of growth uniquely involves second-by-second adjustment
in the flow of information from the genome to ribosomes. Individual mRNA molecules
function for only a few minutes before being destroyed and replaced by newer, more
timely information”.
The fundamental problem addressed is not so much the understanding
particular gene expression programs but rather the mechanistic basis of the concerted
rearrangements of these programs. One incentive of this work therefore is to reveal the
mechanism coordinating the growth phase-dependent transcription in E.coli. for this we
have developed a holistic approach, using microarrays and a combination of other in
vitro and in vivo techniques, to demonstrate how differential spatio-temporal
distributions of supercoiling sensitivity in the genome effected by NAPs coordinate
growth phase dependent transcription patterns.
1.1 Is there a common coordinating factor?
A typical growth cycle of E.coli growing in batch culture when plotted against time
describes a sigmoidal curve with three clearly discernible stages. Correlations have been
observed between different stages along the sigmoidal curve, called phases of growth,
and the global gene expression patterns [Wei et al., 2001; Tao et al., 1999; Weber et al.,
2005]. To better understand this correlation it is essential to identify those factors which
have global impact on the transcription process. In E.coli the transitions between the
different growth phases are associated with remarkable alterations of three parameters
that can affect cellular transcription: the protein composition of the nucleoid, the global
supercoiling level of DNA and the composition of transcriptional machinery.
The two predominant RNA polymerase (RNAP) holoenzyme forms (based on
number of genes they are known to transcribe) operating in E.coli, Eσ 70 and Eσ s (RNAP
holoenzyme associated with sigma subunit 70 and sigma s) differ in their DNA
topology requirements. The topological state of cellular promoters depends on the
partitioning of unconstrained (i.e. free) and constrained (i.e. fixed by interactions with
2

INTRODUCTION
binding proteins) DNA supercoils and thus, on the composition of DNA-constraining
nucleoid proteins (also termed Nucleoid Associated Proteins, NAPs). This composition
substantially changes with the growth phase and affects the availability of gene
promoters [Ali Azam et al., and Ishihama et al., 1999; McLeod et al., 2001]. Some of
the nucleoid-associated proteins modulate the activities of cellular topoisomerases and
can therefore also exert indirect effects on the growth phase-dependent gene
transcription [Dorman et al., 2003; Muskhelishvili and Travers, 2003; Browning et al.,
2004].
Alterations of global DNA topology are known to strongly affect the
transcription initiation [Travers et al., 2001; Hatfield et al., 2002]. Experimentally
induced changes of global DNA superhelicity in E.coli revealed that at least 300 genes
are explicitly sensitive to these changes [Peter et al., 2004]. The alterations of global
DNA superhelicity have been observed both during growth phase transitions and also in
response to environmental challenges, thus implicating DNA supercoiling in
coordination of gene expression with physiological demands [Balke and Gralla, 1987;
Dorman et al., 1996; Tse-Dinh et al., 1997; Cheung et al., 2003; Travers and
Muskhelishvili, 2005b]. Another switch of the growth phase-dependent gene expression
pattern is accomplished by the growth phase-dependent modulation of RNAP by
increased concentration of “stringent factor” ppGpp (guanosine-3',5'-
(bis)pyrophosphate) and the competition between initiation sigma (σ) subunits, which
confer different promoter specificities on the RNAP holoenzyme [Heinemann et al.,
1997; Ishihama, 1999 and 2000]. Recently it was also proposed that the composition of
the RNAP core is also subject to growth related changes [Geertz et al., 2007]
1.1.1 Is there a common coordinating mechanism?
Almost five decades ago, John von Neumann proposed that the flow of genetic
information is coordinated by an alternation between the ‘digital’ (discontinuous)
properties of unique genes and ‘analog’ (continuous) properties of the gene products
[von Neumann, 1958].
3

INTRODUCTION
Figure 1: Schematic illustration of operation of the genetic system involving an alternation of the
digital (discontinuous) and analog (continuous) information.
Global transcriptional response, represented as a corsstalk between ‘analog’
and ‘digital’ signals points towards a mechanism in which regulation of the gene
expression does not function as an on-off switch but rather is the result of
interdependent actions of several partially redundant pathways translating into varying
analog output. This mode of transcriptional response is termed ‘Rheostatic control’
[Travers and Muskhelishvili, 2005b]. The inter-conversions between digital and analog
properties offer multiple possibilities for cellular response, which can explain the
dynamism manifest in the transcriptome of E.coli. Though the interplay of coordinating
factors (superhelicity of DNA, NAPs & RNAP composition) has been uncovered for
some gene promoters, the mechanistic basis for explaining the spatial and temporal
coordination of transcription in the genome still remains elusive.
1.2 Global transcription coordination - current knowledge
In this section, the current knowledge of transcriptional regulation is briefly outlined to
elucidate mechanisms that form the basis of the hypothesis explaining global
coordination of transcription in the genome. Starting from individual gene promoter
4

INTRODUCTION
characteristics, the amount of variability in response that can be brought about by
factors like NAPs and DNA supercoiling is described, and a brief introduction into how
the factors themselves are modulated during growth is outlined.
1.2.1 Gene promoters
Transcription initiation is the predominant step in the gene regulation and promoter
regions provide binding sites for the different regulatory factors to interact and initiate
or repress transcription. The amount of gene product synthesized is primarily
determined by the rate of productive initiation. The initiation rates can vary between
1.5X10 3 transcripts per generation to as low as 1 transcript per generation [McClure et
al., 1985]. What determines the heterogeneity in the rate of transcription initiation? One
of the principal determinants is the promoter sequence itself.
Important elements of the promoter sequence are the positions where a change
in sequence affects the rate of initiation of transcription from the specified start site.
Sequences recognized by Eσ70, the most abundant form of RNA polymerase
holoenzyme, are shown in Figure 2. There are at least three features within the “core”
region of the promoter DNA: two conserved 6-bp (base pair) DNA sequences centered
approximately 10 and 33 bp upstream from the start site of transcription (+1), called the
“–10” and “–35” hexamers; and the sequence of DNA that separates them, called the
“spacer” region, which is most commonly 17 bp in length but can vary from 15 to 21
bp. Figure 2 summarizes the primary structure of the core promoter, specified by
convention in the 5’ to 3’ direction as the sequence of the non-transcribed strand, which
corresponds to the transcript sequence. When optimally aligned, the sequences of most
promoters match at least 7 of the 12 bp in the consensus –35 (TTGACA) and –10
(TATAAT) hexamers [Lisser et al., 1993]. At many promoters, the primary start site
(+1; specified by the same convention) is an A and the flanking bases are C(–1) and
T(+2).
5

INTRODUCTION
UP element
-35 -10
Spacer
17bp
Discriminator
+1 start
Core promoter
Figure 2: Structure of consensus Eσ 70 promoter showing functionally important regions.
It is now generally accepted that promoter structure and geometry is used by
bacteria as a key regulatory element [Perez-Martin et al., 1997]. Computational studies
on promoter sequences have corroborated the experimental findings that the promoter
regions are more curved and less stable than the average genomic DNA. Observation by
Ozoline et al., of the positioning of the highly deformable TA dinucleotide
approximately every 5.6 bp, also indicate the distinct flexibility of the promoters
[Ozoline et al., 1999]. Analysis of curvature and deformability of the promoters based
on their predicted sigma (σ) factor preference also demonstrate variability. From Figure
3, it is evident that the σ 54 class promoters are less deformable compared to σ 70 class.
Sigma 54 protein is known to be structurally unrelated to σ 70 , and it also utilizes a
different pathway to form open complexes during transcription initiation, which in the
case of σ54 requires ATP [Gruber et al., 2003]. It is thought, that the core promoter -35
& -10 hexamer sequences, the discriminator sequence and the spacer region also have
evolved to posses regulatory potential. Molecular genetic examinations of stable RNA
promoters in E.coli have attributed some of the important regulatory events, like
stringent regulation and growth-phase regulation to the core promoter elements [Travers
et al., 1980; Josaitis et al., 1995; Auner et al., 2003].
6

INTRODUCTION
Figure 3: Structural profiles of sigma70 and sigma54 promoter regions.
Comparison of sigma70 specific promoter regions with sigma54 regions show that sigma70 promoters
have more intrinsic curvature and are also more easily deformable than sigma54 promoters [Pedersen,
2000 ].
1.2.2 Gene promoters respond distinctly to changes of
supercoiling
One of the extrinsic determinants of the promoter activity is the superhelical density of
the DNA. Negative supercoiling of the DNA provides the thermodynamic driving force
that is required for unwinding the DNA double helix during the initiation process and it
7

INTRODUCTION
can also influence elongation and termination [Lim et al., 2003]. Variations in
promoter’s core sequence combined with a range of negative supercoiling bring in an
opportunity for a very wide transcriptional response.
Promoters respond distinctly to supercoiling changes. The in vitro response of
promoters of fis (encoding chromatin protein FIS) and bla (beta lactamase) genes to
varying supercoiling is shown in Figure 4. The two promoters are quite different in their
architecture. The fis promoter has a non-consensus -35 hexamer sequence and a GC rich
discriminator which makes it more strictly dependent on supercoiling. Even promoters
that are quite similar, for example, ‘stringent’ promoters of fis and tyrT (tyrosyl tRNA)
genes deviate in their response to supercoiling. The core promoter sequences of tyrT
also comprise a non-consensus -35 hexamer and a GC rich discriminator, but the
distinction is due to the requirement of UP element and the upstream activating
sequence (UAS) in the case of tyrT promoter [Auner et al., 2003]. The activating
protein binding at the UAS (FIS in the case of tyrT) essentially wraps the DNA around
itself to buffer the promoter against any variations in the global superhelical density
[Maurer et al., 2006]. This superhelical density that is fostered at the local promoter
region through binding of protein is described as ‘effective supercoiling’ [Travers,
2005b], which is a local parameter that is recognized by the polymerase. Effective
supercoiling can be considerably different from the ‘global supercoiling’ prevailing at a
particular instant.
Figure 4: In vitro transcription from fis & bla promoters at different superhelical densities
[Modified with permission from Schneider, 2000].
8

INTRODUCTION
Unwinding of the -10 hexamer and downstream sequences towards the start
point is strongly facilitated by negative supercoiling. Furthermore, the necessity for
supercoiling is seen in the geometry of arrangement of -10 & -35 hexamer sequences,
the principal recognition elements for RNAP holoenzyme. The consensus spacer length
of 17bp aligns the two hexamer sequences in an optimal orientation for RNAP binding.
Variations in the spacer length would require changes of twist (Figure 5) for optimal
alignment of the –10 and –35 elements.
Figure 5: Schematic representation of core promoters with different spacer length.
1.2.3 DNA Supercoiling and mechanisms regulating it
The DNA inside the cell adopts many different structural forms to suit differenet
processes like transcription, replication, recombination etc. All the different processes
pose a challenge to maintain the lengthy polymer (DNA) intact and compact. Since the
movements of individual nucleotides in the polymer have only certain degrees of
freedom, the compensatory adjustments to relieve the helical tension are realized by
coiling of one double helix over the other, at which the DNA is said to be ‘supercoiled’.
The supercoiling can either be positive or negative. The supercoiling is said to be
negative when the DNA strands are under-wound, that is, each 360 o twist of DNA will
9

INTRODUCTION
have more base-pairs than there would be in a relaxed molecule of DNA (10.4 bp/turn).
The superhelical tension can be relieved by nicking one of the strands of DNA, rotating
and re-ligating the strands. The other option would be to convert the helical tension of
the twist into writhe, by which the DNA attains the supercoiled form. The writhe in the
case of negative supercoiling will be right-handed. The DNA is said to be positively
supercoiled when there are fewer base-pairs per helical turn compared to a relaxed
molecule. The superhelical tension of twist in this case can be relieved by introducing
left-handed writhe.
The supercoiling of the DNA can be described using three parameters: [1]
Linking number (Lk) – an integer value which refers to the number of times the two
strands make a 360 o turn [2] Twist (Tw) – a real number denoting the winding of
strands around the helical axis [3] Writhe (Wr) – a real number which denotes the
supercoils in the DNA. The three parameters are related as follows: Linking number =
Twist + Writhe (Lk = Tw + Wr). As said before, most DNA in vivo is negatively
supercoiled. The relative degree to which a molecule is supercoiled can be expressed as
the specific linking difference or superhelical density (σ). This quantity gives a lengthindependent
measure of the level of supercoiling, σ = (Lk - Lk o )/Lk o .
According to ‘twin supercoiled domain’ model, transcription generates positive
supercoils in front of the transcribing RNAP complex and negative supercoiling behind
it [Liu and Wang, 1987; Wu et al., 1988]. Topoisomerases are the enzymes which take
care of these two domains of superhelical tension. There are four topoisomerases in
E.coli. Topoisomerase II (gyrase, product of gyrA and gyrB genes) introduces negative
supercoils while the other three topoisomerases, topoisomerase I (topA gene product),
III (topB gene product) and IV (parC and parE gene product) relax negative supercoils.
Gyrase, topoisomerase I & IV are held responsible for maintaining the supercoiled state
of the DNA while topoisomerases III mainly manages decatenation reactions [Hiasa and
Marians, 1994].
The negatively supercoiled DNA inside the cell is maintained at a steady state
level by the actions of gyrase, topoisomerases I and topoisomerase IV [ Menzel et al.,
1983; Zechiedrich et al., 2000] within + 15% range of normal mean value [Drlica et al.,
1992]. The feedback mechanisms involved in the expression of gyrA, gyrB (active at
10

INTRODUCTION
low negative supercoiling) [Menzel et al., 1983] and topA (active at high supercoiling
levels) [Tse-Dinh, 1985] and the requirement of ATP for gyrase activity can be
considered as two mechanisms by which homeostasis is conferred. Among these two
mechanisms, activity of the enzyme as compared to expression of the enzyme was
shown to be more decisive for homeostatic control of supercoiling [Snoep et al., 2002].
The discussed control primarily pertains to regulation of the unrestrained
supercoiling inside the cell which engages about 50% of the total DNA. The other half
is restrained by chromatin proteins and RNAP. Most of our understanding of the
physiology of supercoiling comes from modulation of activity or mutational studies of
topoisomerases, which predominantly work with unrestrained fraction of the DNA
supercoils. A proper understanding of the role of supercoiling in global gene expression
requires the understanding of mechanisms that determine the partitioning between
constrained and unconstrained supercoils.
1.2.4 Supercoiling and growth transitions
In E.coli different growth phases are characterized by different global supercoiling
levels of DNA, whereby the unconstrained supercoiling levels are maintained at a
constant level by the topoisomerases during a particular growth phase. The transitions
between growth phases, accompanied by changes in metabolism modulate supercoiling
levels to a new equilibrium. Also conspicuous in modulating the supercoiling changes is
the binding of abundant chromatin proteins [Balke et al., 1987; Schneider et al., 1997].
Chromatin proteins acting as transcriptional regulators are also implicated in
regulating the transcription of topoisomerase genes [Schneider et al., 1999; Gomez-
Eichelmann & Camacho-Carranza, 1995]. Notably, stressful stimuli like osmotic or
temperature shifts in the external environment are also known to elicit rapid changes in
the superhelical density of DNA within the cell [Cheung et al., 2003; Tse-Dinh et al.,
1997].
11

INTRODUCTION
Figure 6: Graphical representation of global DNA topology changing with growth.
The dotted line traces the typical growth curve of E.coli in batch culture. Electron microscopy pictures of
plasmids with different supercoiling are shown. ME, TS and LS stands for phases of growth - mid
exponential, transition to stationary and late stationary phase respectively.
1.2.5 The nucleoid associated proteins – major players in global
gene expression regulation
Histones are the predominant structural proteins of the eukaryotic chromatin, while in
E.coli there are a dozen so-called “histone-like” proteins involved in spatial
organization of the nucleoid. About half of them are considered to be important in
shaping the nucleoid based on their abundance. The difference between the core group
of NAPs and the other proteins that bind to DNA is in the lack of clear consensus
binding sequence for the NAPs. Some of the NAPs do have a reasonable consensus
binding sequence, while binding of the others is dependent on inexplicit sequence
organization combined with topological parameter, like bent/curved DNA. In addition
to providing spatial organization of the nucleoid, NAPs also contribute to DNA
transactions such as replication, recombination and transcription.
The regulatory roles of nucleoid proteins in DNA functions thus include
modulation of the genome conformation as a whole but also more direct effect on the
local conformation of specific DNA regions or even direct interaction with other protein
components. For instance, the three FIS dimers binding at the tyrT promoter, may act as
12

INTRODUCTION
a trap for the bound RNAP directing it to the transcription start site [Muskhelishvili et
al., 1995]. In addition, FIS directly interacts with the α subunit of polymerase [Bokal et
al., 1995].
Figure 7: Abundance of NAP during different phases of growth [Ali Azam et al., 1999].
Growth phase-dependent change in the NAP composition of the nucleoid
translates into alterations in the chromatin structure and corresponding growth phasespecific
gene expression. About 50 thousand FIS molecules present in the exponential
phase bind throughout the genome. By wrapping the DNA around it [Maurer et al.,
2006] FIS mimics high negative superhelicity, thereby redirecting the DNA tension to
individual gene promoters. FIS can also indirectly modulate the activity of gyrase
[Muskhelishvili & Travers, 2003] which introduces hypernegative supercoiling
depending on the ATP/ADP ratio which is highest during exponential growth
[Lockshon & Morris, 1983; Balke et al., 1987]. FIS also stimulates chromosome
replication form oriC [Gille et al., 1991] and transcription from rRNA and tRNA (stable
RNA) promoters [Nachaliel et al., 1989]. H-NS is another well-charecterised chromatin
protein whose overproduction leads to condensation of chromosome and decreases the
availability of supercoils to RNAP [Dame et al., 2001] by binding to curved DNA
sequences and thereby effectively repressing gene transcription. Ali Azam et al., have
13

INTRODUCTION
shown that H-NS reaches a maximum of 20,000 molecules per cell during exponential
phase of growth and thereafter decreases to 40% of the maximum at the late stationary
phase. Another NAP, HU, considered as prokaryotic counterpart of HMG box proteins
of eukaryotes is comparable in abundance to FIS during early exponential growth. HU
bends DNA substantially and it has been proposed that replacing of H-NS by HU on a
plectonemic DNA would change it to more untwisted form, making the DNA more
transcriptionally active [Travers & Muskhelishvili, 2007].
Changing of the concentration of NAPs represents one of the mechanisms to
regulate the growth transitions. It also brings in more versatility by virtue of its
coordination with other global mechanisms modulating the growth.
1.2.6 Composition of RNAP also changes with growth
The major enzyme for E.coli gene expression, DNA dependent RNA polymerase is one
of the functionally best studied enzymes. The core enzyme contains five subunits: β’
(1407 amino acids), β (1342 amino acids), a dimer of α (329 amino acids each) and an
ω subunit (91 amino acids). The β’ & β subunits appear to be responsible for the
catalytic function of the enzyme. The two α subunits are involved in the stabilization of
promoter binding and the ω subunit is implicated in the core enzyme assembly [Burgess
et al., 1969]. Though the core enzyme is catalytically proficient, initiation is only
possible when the core associates with one of the 7 specificity factors, the sigma (σ)
subunit, to form the holoenzyme.
The association of different σ subunits is modulated by concentration of
growth dependent regulatory nucleotide ppGpp and production of anti-sigma factors.
While Eσ 70 predominate the transcription during exponential phase of growth, Eσ S
transcribes most of the genes during stationary phase. The differences in gene selection
by different holoenzymes can be attributed to the templates topology [Kusano et al.,
1996], Eσ 70 preferring more supercoiled templates than Eσ S [Bordes et al., 2003]. Also,
the expression of different sigma factors depends on supercoiling [Peter et al., 2004].
14

INTRODUCTION
Furthermore, expression of a σ factor (σ 70 ) can in turn affect the global topology of
DNA [Geertz et al., 2007].
Figure 8: Growth phase-coupled change in the level of different forms of the RNA polymerase.
(RpoD: sigma70; RpoN: sigma54; RpoS: sigma35; RpoH: sigma32 ; RpoF: sigma28; RpoE: sigma24;
FecI: sigma19)[Ishihama et al., 1999].
1.3 Organization of global transcription - coordinated view
The previous sections addressed the growth dependent alterations in factors having a
global influence including DNA superhelical density, abundant DNA binding proteins
and the transcription machinery. The present section describes interactions between
these global regulators under variety of conditions where they exert their control.
The E.coli genome compacted ~1000 times inside the cell manages to
coordinate gene expression with growth phase by forming spatially differentiated
domains. Domains, defined as topological barriers preventing diffusion of supercoiling,
are dynamic entities. Reported domain sizes vary from 10 to 100 kb (kilo base-pairs)
per domain [Postow et al., 2004; Sinden & Pettijohn, 1981]. The topological barriers
15

INTRODUCTION
formed as a repercussion of active transcription from highly transcribed gene by
removing any previously established DNA attachments would generate barriers near the
transcription terminus [Deng et al., 2005]. Barrier formation is also altered by abnormal
activities of gyrase and topoisomerase IV enzymes [Staczek & Higgins, 1998].
Scattered binding sites for NAPs in the genome may also act as regions where proteins
bind to prevent the diffusion of supercoiling.
DNA supercoiling itself might act as a principal coordinator of global gene
expression [Balke & Gralla, 1987; Dorman, 1996; Tse-Dinh et al., 1997; Cheung et al.,
2003; Travers & Muskhelishvili, 2005b]. Recent enumeration of number of supercoiling
sensitive genes in the E.coli genome found only 8% of the total genes to be associated
with supercoiling [Peter et al., 2004]. However the observed role of supercoiling in
many distinct processes such as sigma factor recognition, transcription termination,
sensing of stress and nutritional status appeal to a much wider influence of supercoiling.
Furthermore, recent study of the experimental evolution of E.coli populations identified
supercoiling as a key target for evolution and mutations in topA & fis genes were found
to conferred increased fitness [Crozat et al., 2005].
The supercoiling transitions during growth are tightly coupled to the changing
NAP composition and abundance. During early exponential phase the nucleoid is
composed of FIS, HUα2 and H-NS proteins, to be succeeded by HUαβ and H-NS in the
transition between exponential and stationary phase, and finally by IHF and Dps in late
stationary phase. Among these FIS, HU, HNS constrain different amounts of
supercoiling [Travers & Muskhelishvili, 2005a], resulting in a change of plasmid DNA
supercoiling when the constraining proteins are eliminated [Schneider et al., 1997;
Berger M et al., unpublished; Blot et al., 2006]. FIS binds to the DNA as a dimer and
can bend DNA by 50-90 o [Pan et al., 1996]. Low amount of FIS binding has a distinct
effect on the architecture of DNA compared to multiple FIS binding. Low amounts of
FIS lead to the formation of branches on the supercoiled DNA, while binding in large
amounts it compacts the DNA [Schneider et al., 2001]. HU present in comparable
amounts to FIS binds non-specifically to supercoiled DNA and to structurally distorted
DNA [Pontiggia et al., 1993]. H-NS present in 20,000 copies binds patches of DNA
with a preference for A/T rich tracts and functions as a general repressor of transcription
16

INTRODUCTION
[Rimsky et al., 2001]. At similar superhelical density HU and H-NS can exert opposite
effect on the transcription. HU binds and bends DNA resulting in a decrease in pitch
angle (the angle between two adjacent major grooves), while H-NS binding leads to an
increase in pitch angle. Replacing HU by H-NS on a plectonemic DNA would lead to
over twisting of the DNA rendering it less transcriptionally active [Travers &
Muskhelishvili, 2007].
The transcription of stable RNA genes is one of the determining elements of
growth rate. The promoters of tyrT and rrnA P1 (exemplary stable RNA promoters) are
an excellent model systems to fathom the intricacies of the interactions among the
global regulators on a miniaturized location. The unique promoter architecture
involving a GC rich discriminator confers ‘stringent response’ and ‘growth-rate control’
[Travers, 1980] imposing a need for negative superhelicity for promoter activity
[Pemberton et al., 2000]. During stringent response, a result of amino acid starvation,
the regulatory nucleotide ppGpp accumulates and inhibits the synthesis of rRNA
operons by blocking the RNAP at the initiation step. Growth-rate control is essentially a
phenomenon of balanced exponential growth controlled by a combination of promoter
elements (a suboptimal spacer region and -35 hexamer sequences) and a need for UAS
bound by activator protein, FIS. Binding of H-NS counteracts activation by FIS
[Tippner et al., 1994]. Thus it appears that the NAPs on binding DNA exert both global
and local effects. It was of interest therefore to investigate, whether the growth phasedependent
patterns of transcription are associated with NAP-dependent changes in
distributions of effective superhelicity.
17

MATERIALS AND METHODS
2 Materials and methods
2.1 Materials
2.1.1 Enzymes & chemicals
Unless otherwise stated, chemicals were procured from Applichem GmbH and Sigma-
Aldrich.
Lysozyme (100 000 U/mg)
Restriction & nicking enzymes
Taq polymerase
Reverse transcriptase:
Superscript II & MLV-RT
Random primers (3 μg/μl)
DNase I
Vaccinia Topoisomerase I
RNA polymerase
Cyanine 3 and Cyanine 5 dyes
Merck
New England Biolabs
New England Biolabs
Invitrogen
Invitrogen
Qiagen & Ambion
EPICENTRE ® Biotechnologies
Bohreinger Manhein & Purified in house
(Geertz, M)
Cy3-dCTP and Cy5-dCTP from GE healthcare
UK limited.
CyDye3 dCTP and CyDye5 dCTP from
Amersham Biosciences UK limited.
18

MATERIALS AND METHODS
dNTPs (25 μmol)
NTPs
Agarose
Roche
Roche
Roti ® garose from Carl Roth GmbH, Germany.
2.1.2 Antibiotics
The following antibiotics were prepared as described by Sambrook et al. [Sambrook
and Russell 2001]. The concentration of their stock solution and final working
concentrations used are indicated below.
Stock solution
Working concentration
Ampicillin 50 mg/ml in water 20 μg/ml
Chloremphinicol 34 mg/ml in ethanol 25 μg/ml
Tetracyclin 5 mg/ml in ethanol 10 μg/ml
Kanamycin 10 mg/ml in water 10 μg/ml
2.1.3 Media
The media were prepared as described by Sambrook et al. Composition to prepare one
liter of media is given below.
2x YT medium:
Tryptone
Yeast extract
NaCl
16 gm
10 gm
5 gm
LB medium:
Tryptone
Yeast extract
10 gm
5 gm
19

MATERIALS AND METHODS
NaCl
10 gm
YT agar plates:
Tryptone
Yeast extract
NaCl
Agar
8 gm
5 gm
5 gm
15 gm
2.1.4 Buffers and stock solutions
TE buffer (pH 8.0):
10mM Tris/HCl
1mM EDTA
TAE buffer (50X):
242 gm of Tris base
57.1 ml of glacial acetic acid
100 ml of 0.5M EDTA (pH 8.0)
TBE buffer (5X):
54 gm of Tris base
27.5 gm of boric acid
20 ml of 0.5M EDTA (pH 8.0)
Killing buffer:
20 mM Tris-Cl (pH 7.5)
5 mM MgCl 2
20 mM Sodium azide
10X in vitro transcription buffer:
100 mM Tris-HCl (pH 8.0)
2 M NaCl
100 mM MgCl 2
10 mM DTT
20

MATERIALS AND METHODS
1X in vitro transcription stop solution:
1 mM EDTA
50 mM sodium acetate
0.2% SDS
1X primer extension stop solution:
50% (v/v) glycerol
10 mM EDTA (pH 8.0)
0.25% (w/v) bromophenol blue
0.25% (w/v) xylene cyanol FF
Lysozyme:
10 mg/ml in 10 mM Tris-Cl (pH 8.0)
6X gel loading solution:
0.25% (w/v) bromophenol blue
0.25% (w/v) xylene cyanol FF
40% (w/v) sucrose in water
Norfloxacin:
20 mg/ml stock prepared in 0.5M sodium hydroxide solution.
2.1.5 Bacterial strains
Table 1: Bacterial strains used
Strain Genotype Reference
CSH50 1
ara ∆(lac pro) thi
Miller, JH (1972), cold
spring hrbr prs.
CSH50 ∆fis CSH50 fis::kan (rpsL) Koch et al., 1988
CSH50 ∆hns CSH50 hns-205::Tn10 P1 transduction of
CSH50 with hns-
205::Tn10 from
MC4100 2 hns-205::Tn10
21

MATERIALS AND METHODS
LZ41 3
pyrF287 nirA trpR72 iclR7 gal25 Zechiedrich et al., 2000
rpsL195 top10 ∆ (P80 xis1 cI857)
parC K84 Kan R
LZ54 3
pyrF287 nirA trpR72 iclR7 gal25
rpsL195 top10 ∆ (P80 xis1 cI857)
gyrA L83 zei-723::Tn10Kan
Zechiedrich et al., 2000
LZ23 4
F- thr-1 leu-6 thi-1 lacY1 supE44 Khodursky et al., 1995
tonA21 gyrA L83 zei-723::Tn10 Tet
Kan R
LZ41 ∆fis LZ41 ∆fis::Cm P1 transduction of LZ41
with ∆fis::Cm from
CSH50 ∆fis::Cm
LZ54 ∆fis LZ54 ∆fis::Cm P1 transduction of LZ54
with ∆fis::Cm from
CSH50 ∆fis::Cm
LZ23 ∆fis LZ23 ∆fis::Cm P1 transduction of LZ23
with ∆fis::Cm from
CSH50 ∆fis::Cm
LZ41 ∆hns LZ41 hns-205::Tn10 P1 transduction of LZ41
with hns-205::Tn10 from
MC4100 hns-205::Tn10
LZ54 ∆hns LZ54 hns-205::Tn10 P1 transduction of LZ54
with hns-205::Tn10 from
MC4100 hns-205::Tn10
1 E.coli K12 derivative
2 F- araD139 D (argF-lac) U169 deoC1 rpsL150 ralA1 flbB5301 ptsF25 rbsR
3 Derivative of RS2λ (pyrF287 nirA trpR72 iclR7 gal25 rpsL195 top10 ∆ (P80 xis1 cI857))
4 Derivative of C600 (F- thr-1 leu-6 thi-1 lacY1 supE44 tonA21)
2.1.6 Plasmids
ptyrTlac [Lazarus & Travers, 1993]
ptyrTD [Lazarus & Travers, 1993]
ptyrT35U [Lazarus & Travers, 1993]
22

MATERIALS AND METHODS
ptyrTS [Schneider et al., 2000b]
∆61 constructs of ptyrTlac, ptyrTD, ptyrT35U, ptyrTS [Auner et al., 2003]
pUC18 [Yanisch-Perron et al., 1985]
2.1.7 Primers
Primers for RT-PCR:
Forward
Reverse
aceB CGAGCAGGAGAAGCAAATTC GCGCTGCCAGAAGTTTATTG
glcB TATACGGCAGCGACATCATC CAGCGGTAGAGATTCATCGAG
purC TGATCGCAAAGGTATGGTGA
AGCAGACGCTCCATTTGAGT
purF ATGCCTTAACGGTGCTTCAG GGCGAGCTTCAAATACATCG
purK AAAGCGTGATTACCGCTGAG
sdhD CGTTCACCAAAGTGTTCACC
GGTCAGCAATAATCGGGAAC
CCAGCGGTTTAACGTAGTCG
sucC CAAAGTGAAAGCCGTTCTGG AACACCCACTTCTGCTACCG
Primers for primer extension:
Ex103 GGAATGTGTAAGAGCGGGG
G11
bla
GAGCAGTGCCGCTTCGC
CAGGAAGGCAAAATGCCCC
23

MATERIALS AND METHODS
2.2 Methods
2.2.1 Agarose gel electrophoresis
Electrophoretic separation of DNA was carried out using 0.8-1.5% (w/v) agarose gels
prepared in 1X Tris-borate (TBE) or Tris-acetate buffer (TAE). The gel buffer and
running buffer are identical. For all applications (except for topology gels) ethidium
bromide (0.3 μg/ml) was mixed with the gel before casting. Various size of gel
chambers (8 X 10 to 19.5 X 19.5 cm) were used to cast the gel and the DNA to be
separated was mixed with 1/6 th the volume of loading dye, with size markers (λ pst, see
below) when necessary. Separation was carried out at 0.5 V/cm for topology gels and at
1-5 V/cm for other purposes. Subsequently gels were observed under UV light in gel
documentation equipment (Biodoc analyze from Biometra ® ) and photographed when
necessary.
DNA ladder for size marker was obtained by digesting overnight 25 μg of λ
DNA (New England Biolabs) with PstI restriction enzyme in an appropriate buffer at
37 o C.
2.2.2 Small and medium scale isolation of plasmid DNA using
Qiagen kit
Small and medium scale plasmid isolation was performed using QIAprep Spin
Miniprep Kit and QIAGEN Plasmid Maxi Kit respectively by following the
manufacturer’s instruction. The E.coli cultured in 2X YT and LB has been used for
extracting plasmid.
24

MATERIALS AND METHODS
2.2.3 Restriction Digestion
Digestions of DNA with restriction enzymes were performed according to
manufacturer’s instructions using recommended buffer systems and at the appropriate
reaction temperatures. Generally, 2-10 units of enzymes were used per μg of DNA.
Plasmid DNA was usually digested for 1-3 hours and the completion of the reaction
monitored by gel electrophoresis.
2.2.4 Polymerase chain reaction
PCR was primarily employed to extend the labeled primer (2 pmol) from a footprinted
DNA template (around 1 μg). In a reaction volume of 20 μl, using Taq polymerase and
1mM final concentration of dNTP mix, the reaction was performed for 6-9 cycles. The
reaction conditions were as follows: Denaturation at 94 o C for 30 seconds, annealing at
52 o C for 1 minute, elongation at 72 o C for 1 minute.
2.2.5 Preparation of competent E.coli cells using calcium chloride
Calcium chloride competent cells used for transforming plasmids into E.coli were
prepared following the protocol described by Sambrook et al. [Sambrook and Russell
2001]. The competent cells prepared was stored at -80 o C in aliquots of 100 μl.
2.2.6 Transformation of E.coli cells
Transformation of plasmids into E.coli was performed as described by Sambrook et al.
[Sambrook and Russell 2001] using calcium chloride competent cells. The standard
protocol was followed except for different heat shock temperature. Heat shock was
25

MATERIALS AND METHODS
given using a heating block (Eppendorf® Thermomixer Compact T1442) at 37 o C for
LZ strains and at 42 o C for CSH50 strains.
2.2.7 Purification of nucleic acids by Phenol: Chloroform
extraction
Purification of nucleic acids by phenol: chloroform was performed as described in
Sambrook et al [Sambrook and Russell 2001].
2.2.8 Concentrating and quantification of nucleic acids
The DNA and RNA were concentrated by ethanol precipitation method as described by
Sambrook et al., [Sambrook and Russell 2001] differing from the standard protocol in
the salts used and the final drying step. When concentrating DNA the salt solution used
was 1/10 th volume of sodium acetate (pH 5.2) and in the case of RNA 1/5 th the volume
of ammonium acetate was used. Finally the pellet of nucleic acid was either air dried by
keeping the tube open at room temperature or dried using a speedvac (Eppendorf ®
Vacufuge concentrator 5301). Quantification of the nucleic acids was done using
Nanodrop (ND-1000 Spectrophotometer).
2.2.9 Polyacrylamide sequencing gels
The preparation and resolving, of DNA probes and sequencing reaction products, was
performed as described by Sambrook et al., using 6% polyacrylamide gels (composition
for 500 ml: 210 gm urea, 50 ml 5X TBE, 74 ml Rotiphorex 40 (Carl Roth GmbH).
26

MATERIALS AND METHODS
2.2.10 Growth curves and norfloxacin treatment
The growth curves for CSH50 and LZ strains were generated from two overnight
cultures; the first one was in LB and the second in 2X YT medium. The second
overnight culture was diluted 1:200 times in appropriate volume of 2X YT and
incubated at 37 o C in the case of CSH50 strains and at 30 o C for LZ strains, with shaking
at 150rpm. The optical density measurements (OD) were recorded at 600nm wavelength
(using Eppendorf ® Biophotometer). Sampling of cultures was carried out by pipetting
the required volume of culture into frozen falcon tubes pre-filled with 1/3 volume of
killing buffer in it. The tubes were centrifuged at 5000 rpm for 5 minutes to obtain the
pellets of bacteria which was immediately frozen using liquid nitrogen and
subsequently stored in -80 o C until further use.
Norfloxacin treatment of LZ strains was performed as described below.
Norfloxacin at a final concentration of 20 μg/ml was added to mid exponentially
growing cells at OD600 around 0.6 to induce the supercoiling changes. After addition
of norfloxacin the cultures were incubated for another 5 minutes at 30 o C with shaking,
before being sampled as described above.
2.2.11 Extraction and quality check of total RNA
Total RNA from E.coli cells, used here mainly for synthesis of cDNA for various
applications such as microarray hybridization, PCR and for primer extension
experiments, was extracted using RNeasy Mini kit following the manufacturers
instruction. To eliminate even small DNA contamination from RNA preparations,
DNase treatment was performed twice. The first DNase treatment was done on the
RNeasy column (part of the RNeasy kit protocol) and once after the final elution from
the column, using DNA-free from Ambion. Handling of RNA was done using
nuclease free tips and tubes from Ambion. All the buffers and water used were RNase
free procured either as a part of the kit or from Ambion (Buffer kit, catalog number
9010). After the second DNase treatment, the RNA solution was extracted once by
27

MATERIALS AND METHODS
phenol: chloroform method as described above to get rid of DNase removal reagent.
The RNA was then quantified and precipitated by ethanol precipitation and then redissolved
in appropriate volume of nuclease free water so as to obtain a RNA
concentration appropriate for the application (for microarrays the concentration was
maintained at around 6 μg/ml and for all other applications at 1 μg/ml). The quality of
the RNA was checked by agarose gel electrophoresis and Agilent 2100 Bioanalyzer.
2.2.12 Microarray hybridization
Whole genome E.coli K12 cDNA microarrays used in this study were purchased from
MWG biotech (E.coli K12 arrays) & Ocimum biosolutions (E.coli K12 OciChip). The
cDNA synthesis was performed as described in the MWG/Ocimum’s standardized
protocols. After cDNA synthesis, the hybridization was performed in a moist chamber,
at a temperature of 42 o C and with a mild shaking (40 rpm) for 16 to 18 hours. After
hybridization the microarray slides are subjected to three consecutive washing steps as
describe in the manual. Then the slides were dried and scanned at two wavelengths,
550nm for Cy3 and 640nm for Cy5, using ScanExpress confocal laser scanner
(PerkinElmer). The scanner generates TIFF images of the microarray with individual
spots showing relative amounts of Cy3 and Cy5 in each spot. Images were quantified
using freely available Spotfinder software from TIGR [Saeed et al., 2003]. Figure 9
shows a schematic representation of the microarray experiment.
The experiment was always carried out with two biological and technical
replicates. The wild-type and the fis comparison shown below when repeated by
interchanging the Cy3 to fis mutant and Cy5 to wild-type forms a technical replicate
while a biological replicate is when the whole microarray experiment is repeated anew
staring from the bacterial culture. Each biological replicate consists of at least one
technical replicate.
28

MATERIALS AND METHODS
Figure 9: Overview of comparative gene expression of wild-type & fis (example) analysis using
microarrays.
2.2.13 Microarray analysis
The scanned images of the spots on the arrays after quantification have to be subjected
to normalization before any comparison of the gene expression is possible.
Normalization of the spot intensity for a particular dye (Cy3 or Cy5) to the combined
total intensity of that dye in all the spots of the array has to be performed for several
reasons. It allows for comparison between microarray slides & between experiments
and is necessary to eliminate the inherent difference in the intensities of Cy3 & Cy5
fluorophores.
Scanned array images were analyzed using the TM4 software package from
TIGR [Saeed et al., 2003]. The first step in the analysis, to quantify the spots and to do a
quality check on the spots, was carried out using TIGR spotfinder software. Briefly,
spot intensities were quantified and quality of each spot was verified by calculating a
quality control (QC) score depending on signal-to-noise ratio of both Cy3 and Cy5
channels in the spot and shape quality of the spot. Then the p-values were calculated for
each channel as result of a t-test comparing the spot pixel set and surrounding
background pixel set still using the TIGR Spotfinder software.
29

MATERIALS AND METHODS
Filtered (by spot intensity and spot quality) data was normalized by locally
weighted linear regression [Cleveland and Devlin, 1988] and, a one-class t-test [Pan et
al., 2002] was applied to the mean ratios (of wild-type to mutant or relaxed to
hypernegative) from replicated experiments to obtain differentially regulated genes with
significant p-values (p < 0.05) using the TIGR MIDAS software.
Representation of regulated genes in the form of genome wheels was
accomplished using a web-based visualization tool called the Genome viewer. The webbased
program can be accessed at the web site- http://www.cmbi.ru.nl/MGV/
[Kerkhoven, 2004].
2.2.14 Real-time PCR
Each RT-PCR reaction was carried out in triplicates from the purified total RNA using
QantiTect ® SYBR ® Green one-step Real-Time PCR reactions (Qiagen GmbH, Hilden,
Germany) following the manual of manufacturer, using the instrument Mx3000P Real-
Time cycler (Stratagene ® , La jolla, CA, USA).
2.2.15 High resolution agarose gel electrophoresis and
determination of sigma (σ)
Separation of the pUC18 plasmid topoisomers and their supercoiling (σ) determination,
by comparing with a plasmid topoisomer ladder, was performed using high-resolution
agarose gel electrophoresis. Electrophoresis was carried out in 1% agarose gel with 1X
TBE buffer and chloroquine in both the gel and the buffer. Different amount of
chloroquine (0.5μg/ml to 20μg/ml) was used for resolution of different topoisomers.
The electrophoresis was performed at 4 o C for 24 hours at 40V. After electrophoresis,
the gels were stained in ethidium bromide (0.5 μg/ml in water) and photographed.
For the determination of sigma (σ), a ladder of plasmids with overlapping
topoisomer distribution was generated by nicking the pUC18 plasmid DNA and then re-
30

MATERIALS AND METHODS
ligating them in the presence of different amount of ethidium bromide. Initially the
plasmid was nicked using 20 units of Nt.BstNBI, for every 20μg of DNA in a reaction
volume of 50μl according to manufacturers specification The nicked plasmids (2.5μg
for each reaction) were then ligated using T4 DNA ligase in the presence of different
amount of ethidium bromide (concentrations ranging from 800μg/ml to 2.5μg/ml were
used) in an overnight reaction. The reaction products were then extracted twice with
phenol: chloroform mixture, the DNA precipitated, pelleted and re-dissolved in 10μl of
TE pH 8.0. The σ values of the generated topoisomers were quantified by band counting
method [Keller et al., 1975]. Briefly, mid-point of a completely relaxed plasmid (nicked
and ligated without ethidium bromide) population was taken as a σ value of zero. Then
by determining the mid-point of other plasmid topoisomers (ladder) and comparing it
with the relaxed gives the linking number difference (∆Lk). From this the σ is
calculated using the formula σ = ∆Lk / ∆Lk o , where ∆Lk o for pUC18 = 2686 bp / (10.4
bp / turn) = 258. The σ values of the plasmids from different growth phase and LZ
strains were determined by comparing with the ladder.
2.2.16 In vitro transcription
In vitro transcription was performed from supercoiled plasmids with distinct σ (ptyrT &
ptyrTD) and linearized (∆61tyrT) plasmids. Linearized plasmids were obtained by
cutting the plasmid with 10 units of BamHI for every microgram of DNA for 1 hr. The
different topoisomer of ptyrT & ptyrTD were obtained by incubating 20μg of
supercoiled plasmid with 25 units Vaccinia topoisomerase I in the presence of different
ethidium bromide concentrations in topoisomerase buffer (10mM Tris (pH 8.0), 100mM
NaCl, 20mM EDTA) for two hours at 37 o C.
After obtaining the template, in vitro transcription was performed as described
before [Lazarus & Travers, 1993] with 1μg of plasmid DNA, 1μl of 1 unit/μl RNAP
(Bohreinger), 44nM FIS when indicated and 2.0mM NTP mix in a 50μl reaction
volume. After the reaction, the RNA synthesized was extracted with phenol: chloroform
and precipitated as described above. The pellet is dissolved in 10 or 20 μl of nuclease
31

MATERIALS AND METHODS
free water (Ambion) for subsequent use in the primer extension reaction (10 μl for each
primer).
2.2.17 Primer extension
The mRNA from in vitro transcription of ∆61 tyrT constructs and from tyrT with
different supercoiling was divided into two 10 μl parts to be used for primer extension
with Ex103 (for tyrT transcript) and bla primers. Primer extension from total RNA from
LZ strains transformed with different tyrT plasmids was performed with Ex103 and a
collective primer for chromosomal rrn operon’s P1 promoter, G11, as described by
Nasser et al.,[Nasser et al., 2001].
The primers (200 pmol) to be extended were radioactively labeled using 50 μci
of P32 γ-ATP (Amersham Biosciences now a part of GE Healthcare) and T4
polynucleotide kinase (PNK) (Invitrogen) in a reaction volume of 20μl and the labeled
primer purified using G25 spin columns (GE healthcare, formerly Amersham
Biosciences). Primer extension reaction was performed from 3 μg of total RNA or
mRNA from in vitro transcription both in a volume of 10 μl, 2 mM final concentration
of dNTP mix, 2 pmol of labeled primer, 2 μl of 0.1M DTT, 4 μl of 5X reverse
transcriptase buffer and 1 μl of LMV-reverse transcriptase. The primer extension
products were separated on a 6% polyacrylamide gel and visualized by
phosphorimaging (FUJI film FLA-3000 phosphorimager).
2.2.18 Potassium permanganate footprinting
The components of the footprinting reaction are the same as the in vitro transcription
reaction. The footprinting was carried out as described earlier [Nasser et al., 2001]. The
addition of potassium permanganate (KMnO4), which oxidize preferentially the
thymine nucleotide (cytosine can also be oxidized) of an open double helix, gives a
32

MATERIALS AND METHODS
measure of opening of the two strands of DNA during processes such as initiation of
transcription.
All the components (except KMnO4) are mixed on ice and equilibrated at
37oC for 5 minutes before adding 2 μl of 100 mM KMnO4. After exactly 30 seconds,
the footprint is stopped by the addition of 2 μl of β-mercaptoethanol (14M). To this 100
μl of TE (pH 8.0) is added and then the DNA is extracted with phenol: chloroform and
precipitated as described above. The pellet of footprinted DNA is dissolved in 15 μl of
water and is subjected to primer extension with labeled primer using Taq polymerase
and 1 mM final concentration of dNTP mix for six cycles in a PCR machine (Peltier
Thermal Cycler PTC 100 & PTC 200 from MJ research). The product is resolved on
a 6% polyacrylamide gel along with a sequencing reaction and visualized by
phosphorimaging. The di-deoxynucleotide termination sequencing reaction of the
plasmid DNA and the primer used for footprinting and PCR was performed using
commercially available sequencing kit from USB (Sequenase Version 2.0 DNA
Sequencing Kit) following the manufacturers instruction.
2.2.19 β-Galactosidase assay
Beta-galactosidase assay was performed following the protocol of Sadler & Novick
[Sadler & Novick, 1965]. The β-Galactosidase assay was performed on freshly diluted
(1:30) overnight cultures after one hour of dilution cultures in exponential phase. β-
Galactosidase activity is calculated as a function of, colorless ONPG substrate turning
to yellow nitro phenol product (measured at OD420) and the time it takes to turn yellow
by using the formula:
β-Galactosidase activity = OD420 X 8.5 X 100
OD600 X time (minutes)
33

RESULTS
3 Results
Growth phase-dependent transcription regulation has been studied in the current work at
two levels of complexity, global and the local. Global regulation, explained in the first
section details the effects of DNA supercoiling and chromatin proteins FIS and H-NS in
coordinating the growth phase dependent transcription. In the second section the
mechanism of transcriptional regulation by chromatin protein FIS and supercoiling is
studied at the molecular level in a model system of a stable RNA promoter.
3.1 Growth phase dependent global transcriptional
regulation
Regulation of growth is managed by the interplay of chromatin proteins, topology of the
DNA and the transcription machinery. Using DNA microarrays we have tried to address
the relationship between the organization of chromosomal supercoiling and growth
phase dependent gene expression patterns. Since chromosomal supercoiling is tightly
connected to the function of abundant chromatin proteins, we used mutants of fis and
hns genes known as global transcriptional regulators. We compared the expression
profiles of wild-type with each mutant separately during three different phases of
growth and at different superhelicities induced by addition of a topoisomerase poison.
Our experimental design enabled us to reveal the relationships between the effects of
chromatin proteins and supercoiling in global transcriptional regulation.
3.1.1 Growth of CSH50 and LZ strains
All the strains, CSH50 wild-type, CSH50 fis::kan and CSH50 hns-205::Tn10 mutants
and LZ41, LZ54 and their fis::cm and hns-205::Tn10 derivatives were grown in double
YT medium. The CSH50 strains were grown for 24 hours during which three time
34

RESULTS
points were sampled based on the optical density (OD) whereby the mid-exponential
phase sample corresponds to an OD of 0.6 (Figure 10)
The LZ strains which harbor drug resistant alleles of topoisomerases, gyrase
(gyrA L83 ) and topoisomerase IV (parC K84 ) genes were treated with quinolone
norfloxacin during mid-exponential growth before sampling. Norfloxacin used at sublethal
concentration in LZ41 and LZ54 strains selectively inhibits DNA gyrase or
topoisomerase IV activity thereby inducing relaxation or hypernegative supercoiling
respectively. In these strains, the cells are exposed to norfloxacin for 5 minutes and
RNA is then extracted [Rochman et al., 2002]. This allows the variation of transcription
with overall superhelical density to be monitored from almost fully relaxed (σ = - 0.015,
strain LZ41) to near physiological (σ = - 0.073, strain LZ23) to hypernegatively
supercoiled (σ = - 0.095, strain LZ54) state [Zechiedrich et al., 1997].
Figure 10: Growth curves of CSH50 wild-type and the mutants.
The three phases sampled for the microarray- based comparison of differential gene expression. (A)
Growth curves of wild-type and fis mutant. (B) Growth curves of wild-type and hns mutant. The dots
indicate the time of sampling.
35

RESULTS
Neither the fis nor the hns mutations in the CSH50 or in the LZ strains affected
the overall growth pattern but the growth rates of the fis and hns mutants of CSH50
were slightly different from the wild-type (data not shown). The growth rate
comparisons showed differences during exponential growth stage and early stages of
stationary phase. In comparison to wild-type cells the fis mutants had lower and hns
mutants had higher growth rates during exponential phase. These differences are not
clearly understood but correspond to the global repressing effect of H-NS and general
growth-stimulatory effect of FIS (due to activation of stable RNA promoters).
3.1.2 A novel microarray based approach to derive growth phasespecific
transcript profiles organized by supercoiling and
chromatin proteins
Two sets of microarray experiments were performed, the design of which is
schematically represented in figure 11. Briefly, in set A, comparison of the transcript
profiles of wild type and mutant at each growth phase allowed the identification of FIS
and H-NS regulated genes during the three phases of growth (ME, TS and LS). In the
second set (set B) of microarray experiments combinations of LZ strains were used to
derive supercoiling associated genes (Exp.1 in Figure 11) and genes modulated by FIS
and H-NS at different supercoiling (Exp.2 in Figure 11). Comparison of LZ41, LZ54
and their mutants in different combinations was performed during the mid-exponential
phase, when effect of the topoisomerase inhibitory drug norfloxacin was most
pervading.
In set B the transcript profiles of LZ41 (norfloxacin-induced DNA relaxation),
LZ54 (norfloxacin-induced hypernegative DNA) and their fis and hns mutants were
compared in different combination, which is divided into experiment 1 and experiment
2 for the sake of clarity in Figure 11. Experiment 1 compares LZ41 with LZ54 and
mutant (either fis or hns) of LZ41 with mutant (either fis or hns) of LZ54. The genes
upregulated in LZ41 background (compared to LZ54) and mutant LZ41 background
36

RESULTS
Set A
Set B
CSH50 CSH50mut Exp.1 Exp.2
ME ME ME ME ME ME
TS TS LZ41 LZ54
LZ41 LZ41mut
LS LS LZ41mut LZ54mut
LZ54
LZ54mut
(compared to mutant LZ54) are those that are associated with DNA relaxation.
Similarly genes upregulated in LZ54 and mutant LZ54 background are those that are
associated with hypernegatively supercoiled DNA. In the experiment 2 of set B, the
wild-type transcript profile of LZ41 and LZ54 was compared to their respective mutant
(either fis or hns). In this comparison the upregulated genes in wild-type LZ41
background are those that are activated by DNA relaxation in the presence of FIS/H-
NS. And the upregulated genes in LZ41 mutant are those that are otherwise repressed
by FIS/H-NS under relaxed DNA conditions. Similarly, comparisons of LZ54 with
mutants identified genes that are activated and repressed under hypernegative DNA
supercoiling conditions. The differentially expressed genes derived from the microarray
experiments are those that appear consistently in at least two biological replicates and
three technical replicates of the microarray experiment (see section 2.2.12 for details of
biological & technical replicates).
Growth
phaseregulated
genes
Rel
Hyp
Act
Rep
Figure 11: Design of DNA microarray experiments.
Set A defines the regulated genes during three phases of growth. ME, TS and LS stand for midexponential,
transition to stationary and late stationary phase of growth respectively. From experiment 1
of set B, the genes associated with relaxation (Rel) and hypernegative (Hyp) supercoiling were derived,
while experiment 2 was used to derive genes either activated (Act) or repressed (Rep) by FIS & H-NS
under both relaxation (LZ41) and hypernegative superhelicities (LZ54).
The novelty of this experimental design is in the identification of growth phase
regulated genes (from set A) and simultaneous derivation of supercoiling sensitivity of
37

RESULTS
these identified genes (by mapping the set B gene pools on set A). The repertoire of
reported supercoiling associated genes [Peter et al., 2004] was increased 5 fold by
including fis & hns mutants in addition to wild-type. This experimental setup also
allows the estimation of the role of chromatin proteins in distributions of effective
superhelicity and organization of supercoiling-sensitive transcription.
3.1.3 Changes of supercoiling during growth
In parallel to microarray experiments, high-resolution agarose gel electrophoresis was
used to keep track of supercoiling changes during different growth phases of CSH50
strains and also after norfloxacin treatment in LZ strains. The global supercoiling level
of DNA was determined using pUC18 reporter plasmid (Figure 12) by band counting
method as previously described [Keller et al., 1975]. The mean σ values (+/- 15%) were
calculated using a range of chloroquine concentrations from 0.5 to 20 μg/ml in 1%
agarose gels. In the LZ strains, the relaxed topoisomers of the samples isolated from
LZ41 and its derivatives demonstrated a complex pattern making it difficult to define
precisely the superhelical density. During growth cycle the plasmids showed a decrease
in negative supercoiling with time, consistent with the previous finding [Balke and
Gralla, 1987]. The reason for such a decrease in supercoiling is attributed to the
decrease in [ATP/ADP] ratio which influences the gyrase activity directly. Also
consistent with the earlier reports is the increased supercoiling in hns mutant [Mojica et
al., 1997] during mid-exponential phase compared to the wild-type CSH50.
38

RESULTS
Figure 12: Topoisomer distributions of plasmids (pUC18) isolated from growing cells.
(A) Topoisomer distributions in LZ54 and LZ41 strains and their mutant derivatives (as indicated) 5 min
after norfloxacin addition. (B) and (C) Topoisomer distributions of plasmids isolated from CSH50 strains
and its mutant derivatives during the growth cycle. In (C) all topoisomers migrate as negatively
supercoiled species except for the late stationary (LS) phase samples, which migrate as positively
supercoiled species The σ values for each population (except for transition stage where no significant
differences were observed) are indicated. High-resolution gel-electrophoresis was carried out in presence
of 1.0μg/ml (A), 0.5μg/ml (B) and 2μg/ml (C) of chloroquine.
3.1.4 Genomic wheels of supercoiling sensitivity
The differentially regulated genes were deduced from the relative intensities of Cy3 and
Cy5 incorporated in cDNA after hybridization to spotted genes on a microarray. After
quantification, any gene can be classified as up or down regulated (activated or
repressed) in relation to the other hybridizing partner. The genomic wheels in figure 13
represent the up-regulated genes in the wild-type (outer circles) or the mutant
background (inner circles), marked as lines by their position in the genome. The three
layers show the three phases of growth (ME, TS, LS). Furthermore the colour of the
lines indicate the supercoiling sensitivity and the inducibility by the presence (Act) or
absence (Rep) of FIS (circle A) or H-NS (circle B) (see the figure legend for the colour
codes). For example, a gene upregulated in wild-type background during ME phase is
represented by a line in the outer circle (wild-type) of outermost layer (ME phase) and
39

RESULTS
furthermore the colour of the line shows the mode of regulation (activated / repressed
and sensitive to hypernegative / relaxed DNA conditions) of the particular gene. A line
coloured by two colours is a gene (will be referred to as ‘double coded’) which was
associated with more than one regulatory condition (for example, a gene repressed at
hypernegative supercoiling can be seen as line coloured yellow and blue).
The genomic wheel representation allows visualization of growth phase
dependent transcription of genes together with corresponding supercoiling sensitivity.
Figure 13 A and B, show respectively the effect of fis and hns on the spatiotemporal
organization of transcription throughout the growth cycle (compare the outer circle to
inner circle for differences between wild-type & mutant during each growth phase). The
fis mutation most clearly affects the distribution of transcripts in the domains of the
origin and terminus of replication during the exponential and stationary phases. Effect
of hns as a global repressor is evident from the high proportion of repressed genes
throughout the growth (see below). Both FIS & H-NS are proteins most abundant
during early exponential growth [Ali Azam et al., 1999]. Afterwards the FIS
concentration drops sharply, whereas H-NS is present at relatively high levels
throughout the growth cycle. From the genomic wheels it can be seen that strong effects
of FIS and H-NS on transcription are observed even in stationary phase. It is important
to note that FIS is capable of exerting an effect on transcription either by direct binding
to the promoters or by modulating the global topology of DNA. The latter effect could
be the basis for regulation by FIS during the later stages of growth. About 50% of the fis
and hns regulated genes were found to be sensitive to supercoiling (see below),
suggesting a central role of supercoiling in organizing the growth phase dependent
transcription. The observed changing genomic patterns of supercoiling sensitivity (seen
as cluster of blue [Hyp] or red [Rel]coloured lines) agree with the previous findings of
fluid short range [Postow et al., 2004; Stein et al., 2005] and long range domains of
transcription [Jeong et al., 2004].
40

RESULTS
Figure 13: Genomic wheels showing spatiotemporal distribution of supercoiling associated
transcripts.
Rel (red), Hyp (blue), Act (green) and Rep (yellow) transcripts among the growth-phase-dependent genes
(grey) in CSH50 wild-type (outer wheels) and fis (A) or hns (B) (inner wheels). ME- mid-exponential
phase; TS-transition phase; LS-late stationary phase; Ori-origin of replication; Ter-terminus of replication.
41

RESULTS
During the entire growth cycle, 820 genes were found to be regulated by fis
and 611 by hns. From the former, 371 genes were activated (up-regulated in the wildtype
background) and 475 repressed (up-regulated in the mutant background) by fis.
The corresponding numbers for hns are 292 activated and 327 repressed genes. From
experiment 1 of set B, 1,596 genes were identified to be associated with supercoiling
(either hypernegative or relaxed DNA), exceeding by five times the number identified
previously [Peter et al., 2004]. Out of 1,596 Hyp and Rel transcripts identified, only 145
were common to wild-type, fis and hns backgrounds indicating that the supercoiling
response depends on genetic context and explaining the expanded repertoire of
supercoiling sensitive genes identified. The growth phase dependent genes were then
mapped on the supercoiling associated genes (see Figure 11). Among all the growth
phase dependent genes, 397 out of 820 (fis experiment) and 329 out of 611 (hns
experiment) were found by mapping to be associated with either Rel or Hyp condition.
The dependence of supercoiling response on genetic context and high proportion
(almost 50%) of supercoiling sensitive genes in each genetic background indicate that
regulation involves a cross talk between the chromatin proteins and supercoiling,
wherein both change in an interdependent manner.
3.1.5 Variations of supercoiling-associated transcripts
The growth phase dependent genes were further analyzed based on their distribution in
four classes of supercoiling associated genes. Out of total of 302 unique genes upregulated
from all the 3 growth phases in hns mutant, 210 could be mapped as
supercoiling associated genes. From the table 2 we can see that, among these 70% (148
genes) were associated with the Rep group, while the corresponding number in fis
mutant is 39% only (94 out of total 239 mapped). The wild-type strain compared to fis
had similar proportion of Act & Rep genes while the fis mutant from the same
experiment had approximately three times more Rep than Act genes. In the hns
experiment the distribution of growth phase dependent genes is different compared to
42

RESULTS
fis experiment. The wild-type from this experiment shows three times more Act genes
and in the mutant the Rep genes are about nine times more abundant than the Act genes.
Table 2: Numbers of transcripts in four classes and double-coded transcripts in fis and hns
transcript profiles.
Also indicated inside the parentheses is the corresponding percentage taking total mapped genes as 100%.
The double-coded transcripts are those responding to specific combinations of supercoiling and genetic
background.
Single-coded
Double-coded
Fis
experiment
Total
mapped
Rel Hyp Act Rep
Rel/
Act
Rel/
Rep
Hyp/
Act
Hyp/
Rep
more in
CSH50
175
62
(35)
69
(39)
38
(21)
38
(21)
6
(3)
5
(2)
12
(6)
8
(4)
more in
CSH50 fis
239
74
(30)
94
(39)
35
(14)
95
(39)
11
(4)
13
(5)
9
(3)
24
(10)
total unique 397
129
(32)
158
(39)
71
(17)
125
(31)
16
(4)
17
(4)
21
(5)
29
(7)
hns
experiment
more in
CSH50
123
42
(34)
33
(26)
55
(44)
18
(14)
12
(9)
5
(4)
6
(4)
2
(1)
more in
CSH50 hns
210
48
(22)
68
(32)
15
(7)
148
(70)
1
(0.4)
25
(11)
4
(1)
38
(18)
total unique 329
89
(27)
100
(30)
68
(20)
165
(50)
13
(3)
30
(9)
9
(2)
40
(12)
The presented numbers indicate that the effect of hns is predominantly repressive while
also activating certain genes, whereas fis is acting, as expected as a dual regulator.
Figure 14 represents the distributions of supercoiling associated genes
according to the growth phase. The sums of total mapped Hyp+Rel or Act+Rep
43

RESULTS
transcripts of a growth phase and cell type (wild-type or mutant) were set at 100%.
While in the case of double-coded, the sum of total mapped double-coded transcripts for
the entire growth cycle was set at 100%. The exponentially growing fis mutant showed
Figure 14: Changes of supercoiling associated genes during growth in fis (A) & hns (B) mutants
compared to their wild-types.
Phase wise distributions of Hyp (blue), Rel (red), Act (green) and Rep (yellow) gene transcripts are shown.
The distinct ‘double-coded’ transcripts—Hyp/Act, Hyp/Rep, Rel/Act and Rel/Rep—are ordered from left
to right for each bar. The number of genes is indicated within the bars. fis- CSH50 fis; hns- CSH50 hns;
ME- mid-exponential phase; TS- transition phase; LS- late stationary phase.
an increase of both the Hyp and Rel transcripts compared with those in wild-type (69
and 47 compared with 36 and 24 of wild-type respectively), whereas in the hns mutant
the relative proportion of Hyp transcripts increased, in keeping with the observed
increase of global negative superhelicity (Figure 12 B,C). Furthermore, on transition to
the stationary phase, a lower proportion of Rel genes were observed in the fis mutant
than in the wild-type, but not in the stationary phase itself. As expected, the effect of
hns mutation was most pronounced for Rep genes. In the fis mutant, the Rep genes
increased only during the exponential phase, whereas in the hns mutant, the Rep genes
predominated during the entire growth cycle. Also the ‘double-coded’ transcripts
responding to specific combination of supercoiling and genetic background were
enriched for Rep/Hyp and Rep/Rel genes, especially in hns cells. Taken together, these
44

RESULTS
observations are in excellent agreement with different abundance of FIS and H-NS
during the growth cycle and the general repressor role of H-NS [Ball et al., 1992;
Dorman, 2004].
3.1.6 Supercoiling sensitivity of biosynthesis and degradation
pathways
Interestingly the analysis of the distribution of Hyp and Rel genes among the functional
groups involved in essential cellular metabolism demonstrated a substantially higher
proportion of Hyp genes in anabolic than in catabolic pathways, which was especially
remarkable in wild-type cells (Table 3). It was therefore of interest to investigate some
essential metabolic pathways in more detail.
Table 3: Supercoiling sensitivity of genes of biosynthesis and degradation pathways.
The metabolic pathways comprising 421 genes for biosynthesis and 233 genes from degradation were
derived from http://EcoCyc.org. The Hyp to Rel transcript ratios are derived from the data set B for 148,
111 and 134 metabolic genes expressed in the wild-type, fis and hns mutants, respectively.
Biosynthesis (Hyp/Rel)
Degradation (Hyp/Rel)
Wild type 4.29 0.54
fis 2.07 0.87
hns 1.91 1.0
3.1.7 Coordination of metabolic pathways by supercoiling
sensitivity
Analysis of a pathway of exceptional importance for vitality – the citric acid cycle –
demonstrated that the crucial steps producing combustible fuel in the form of reducing
equivalents NADH and FADH2, which are required for generation of ATP by oxidative
45

RESULTS
phosphorylation, are associated with DNA relaxation. In contrast, the glyoxylate
bypass, which is predominantly utilized in aerobically growing cultures where most of
the energy is derived by glycolysis is activated by negative superhelicity (Figure 15 A
and Table 3). This suggests that high ATP/ADP ratios favouring supercoiling of DNA
by gyrase would facilitate glyoxylate bypass and plastic substrate synthesis, whereas
DNA relaxation would favour the production of ATP required to maintain gyrase
activity. Furthermore we found that the de novo pathway of nucleotide biosynthesis
explicitly involves the Hyp genes (Figure 15 B). Purine nucleotides are required during
fast growth and the dependence of this pathway on supercoiling levels is in keeping
with the prevailing conditions during fast growth. The data presented here thus shows
that supercoiling has a role not only in regulation of important individual genes but also
in coordinating the activity of metabolic pathways.
46

RESULTS
Figure 15: Coordination of essential metabolic pathways by supercoiling sensitivity.
The Rel (red) or Hyp (blue) preference of the genes in the regulation of oxaloacetate production and
glyoxylate bypass in citric acid cycle (A) and coordination of de novo biosynthesis of purine nucleotides
(B) are indicated.
Certain relevant genes which were missing in the microarray data like aceB,
glcB, sucC and sdhD were investigated by performing Real-time PCR (RT-PCR) (Table
3). In addition randomly selected genes of purine biosynthesis pathway were
investigated to validate the quality of the microarray results. These results are in
keeping with the inferences from the analyses of microarray data.
47

RESULTS
Table 4: RT-PCR analysis of some of the genes from TCA cycle and purine biosynthesis.
The numbers indicate significant (p

RESULTS
3.2 Role of supercoiling and chromatin protein FIS in
transcriptional regulation of an individual promoter
The current section describes the role of supercoiling and FIS in activation of the
promoter of one of the stable RNA promoters, tyrT. The obtained results give an insight
into the mechanistic basis of interplay of these regulators at the molecular level.
3.2.1 Mechanism of transcriptional regulation by FIS &
supercoiling: tyrT promoter paradigm
It is known that the tyrT and other stable RNA promoters are regulated by FIS and
negative supercoiling [Lazarus & Travers, 1993; Muskhelishvili et al., 1995 and 1997;
Free & Dorman, 1994; Bowater et al., 1994]. Figure 16A shows the sequence
organization of tyrT promoter. To address the role of the core promoter structure in the
response of the tyrT promoter to activation by FIS and regulation by supercoiling, three
different “up” mutations were introduced in the tyrT core promoter region: a -35 “up”
mutation (35U), a discriminator mutation (D), and an A-T base-pair insertion at position
-22 in the spacer region between the -10 and -35 elements (S) (Figure 16B). The
mutations in the -35 region and in the spacer (35U and S) increase the homology of the
promoter to the consensus polymerase binding sequence and the discriminator mutation
(D) relieves the block imposed by the G/C-rich discriminator. Both the wild-type and
truncated promoter constructs lacking sequences beyond position -61 and thus devoid of
UAS with all three FIS binding sites were used for the study. These latter promoter
constructs are designated ∆61 promoters.
49

RESULTS
Figure 16: Schematic representation of tyrT promoter.
(A) Shows the position of three upstream FIS binding sites (I, II & III) and the other core promoter
elements. (B) The Sequences of core regions of tyrT and its derivatives are shown. The spacer region and
the – 35 and – 10 and discriminator elements are indicated. The substitutions in the discriminator and –
35 hexamer regions and the insertion in the spacer region are highlighted in bold. The consensus – 35 and
– 10 elements are shown for reference below.
3.2.2 In vivo expression of tyrT in CSH50 Wt & fis mutant
The in vivo activity of tyrT promoter was investigated by transforming the tyrT
promoter – lacZ fusion construct ptyrT (Wt) and its derivatives ptyrTD (D), ptyrTS (S),
ptyrT35U (35U) into CSH50 wild-type and CSH50 fis::kan cells. The corresponding
UAS truncated versions (∆61 constructs) of all the core promoter mutants and the wildtype
were also investigated to distinguish the effects of core promoter from those of FIS
and the UAS region. Figure 17 shows the averaged β-Galactosidase activities from two
independent experiments normalized to the activity of full length wild-type promoter set
at 100%. The higher activities of the mutant promoters compared to both the full length
and ∆61 wild-type constructs can be explained by the introduced up mutations. The
observed absence of difference between wild-type and fis cells in the case of full length
promoters is consistent with previous finding which suggests a de-repression
mechanism of stable RNA promoters operating in fis cells [Lazarus & Travers, 1993].
50

RESULTS
Figure 17: The relative β-Galactosidase activity from different ptyrT derivatives.
The relative (activity of full length ptyrT Wt taken as 100%) activities of ptyrT derivatives transformed
into CSH50 Wt (Wt) & CSH50 fis::kan (fis) from full length and UAS truncated (∆61) promoters is
shown.
Increased global superhelicity in the fis cells [Schneider et al., 1997] could be
one of the reasons of de-repression of stable RNA promoters, while in wild-type cells,
suboptimal supercoiling at the stable RNA promoters has been shown to be
compensated by binding of FIS at the UAS [Rochman et al., 2002]. The lack of this
compensatory mechanism is clearly seen only in the wild-type ∆61 promoter expressed
in wild type cells (Figure 17). These results confirm the findings that regulatability of
tyrT promoter is inherent in its core promoter [Travers et al., 1980; Lamond & Travers,
1985] and that FIS plays compensatory role [Lazarus & Travers, 1993].
3.2.3 Dependence of promoter activity on superhelical density in
vivo
To test whether the mutations in the core promoter altered the transcriptional response
to supercoiling in vivo we used LZ strains LZ41, LZ54 and LZ23. LZ23 harbors drug
resistant gyrase gene (gyrA L83 ) with the wild-type topoisomerase I & IV genes (topA &
51

RESULTS
parC) which allows the supercoiling in this strain to be maintained after norfloxacin
treatment at near physiological levels (σ = - 0.073) [Zechiedrich et al., 1997]. In
contrast, the same treatment induces DNA relaxation in LZ41 and hypernegative
supercoiling in LZ54 (Figure 12A). Under these conditions the response of the rrnA P1
promoter is dependent on the fis genotype, implying that there are no significant
variations in FIS levels during the norfloxacin treatment [Rochman et al., 2002]. All the
strains used in the experiment shown in Figure 18 contain FIS. In this genetic
background the activities of ∆61 derivatives of the wild-type and discriminator mutant
promoters both exhibited a strong dependence on superhelical density (Figure 18).
Figure 18: In vivo expression of tyrT promoter constructs.
(A) In vivo expression from tyrT promoter at different superhelical densities. Primer extension product of
transcription from genomic total ribosomal RNA P1 promoters (rrn P1), used as a control, is also shown.
(B) Graphical representation of tyrT transcript intensities.
52

RESULTS
Both ∆61 wild-type and ∆61 D constructs had low activity at low superhelical
density, about tenfold higher activity at near physiological density and a lower, but
intermediate, activity on hypernegatively supercoiled plasmid. However the two
promoters differed in their response to varying superhelicity in the presence of the UAS.
The wild-type promoter had an enhanced response to superhelicity. Again the promoter
lacked significant activity at low superhelicity but was strongly activated at nearphysiological
superhelical density and notably, activity was further increased with the
hypernegatively supercoiled plasmid, similar to the effect observed by Bowater et al
[Bowater et al., 1994]. However, with the discriminator mutant the presence UAS
substantially increased promoter activity at all superhelical densities tested but did not
alter the profile of the response. In sharp contrast the activities of the tyrTS and tyrT35U
mutant promoters lacking the UAS were much less dependent on variations in
superhelicity with both of these promoters exhibiting high activity in vivo at low
superhelical density. Thus the loss of dependence on supercoiling was accompanied by
a comparable loss of dependence on the UAS containing FIS binding sites. The relative
activities of the promoters in this genetic background differ somewhat from those
observed in CSH50 as also did the dependence of the activity of the discriminator
mutant on the UAS.
3.2.4 Dependence of promoter activity on superhelical density in
vitro
The in vivo results on the supercoiling sensitivity of promoter constructs were verified
by in vitro transcription assays with truncated wild-type and mutant promoter
constructs. Transcription was performed using supercoiled and linearized templates. We
observed higher levels of transcription from mutants compared to the wild-type on
linearized template, while transcription of supercoiled template is comparable between
the wild-type and the mutants (Figure 19). Of all the mutants, 35U shows highest
activity on the linear template and is also least sensitive to changes of supercoiling as
seen in the in vivo experiments (Figure 18).
53

RESULTS
Figure 19: In vitro transcription of ∆61 constructs of wild type and derivatives.
In vitro transcription assay was performed from supercoiled (σ = -0.075) and linearized templates.
Transcripts originating from bla gene on the same plasmid is also shown. SC – supercoiled templates; lin
– linear templates.
The tyrT wild-type and tyrTD promoter constructs, which clearly showed
sensitivity to supercoiling, were investigated in more detail to elucidate the extent of
activation by FIS at different superhelical densities. The activity of the wild-type
promoter showed a more strict dependence on supercoiling level for its activity, while
tyrTD was active under a broader range of superhelical densities (Figure 20A). Presence
of FIS was seen to activate the transcription at all supercoiling levels in both wild-type
and the discriminator mutant, but the activation of the wild-type was more significant
under non-optimal supercoiling levels (σ = - 0.036 & -0.068) (Figure 20B).
3.2.5 Effects of promoter mutations on the function
Since the data obtained implicated the mutations in the core promoter region in the
altered sensitivity to both supercoiling and FIS we next investigated the effects of these
mutations on promoter function by using potassium permanganate footprinting
54

RESULTS
techniques. Potassium permanganate reacts with bases, especially thymine, where the
base-stacking in the DNA duplex is disrupted [Gralla et al., 1993]. In these experiments
Figure 20: in vitro transcription from tyrTwild-type and tyrTD at different supercoiling.
(A) In vitro transcription at different superhelical densities from tyrT wild-type, tyrTD and reference bla
promoters is shown. (B) Fold activation of transcription by FIS from tyrT wild-type and tyrT D at
different superhelical densities.
RNA polymerase was used in large excess to promoter DNA and the complexes were
equilibrated for 30 minutes prior to a short exposure to permanganate ion. Figure 21A
(lanes 1 and 2) shows that addition of RNA polymerase to the wild-type promoter did
not alter the reactivity pattern on native supercoiled plasmid DNA (σ = −0.068). By
55

RESULTS
contrast the tyrTD promoter mutant showed significantly increased reactivity within the
−10 region at positions T-8, A-10, T-11 and A-12 (lanes 4, 5). In addition bases T-3 and
T-4 within the discriminator as well as bases T+3 and T+4 were reactive suggesting that
DNA unwinding had extended from the −10 region to the start point in this mutant. No
enhanced signals were observed in the other mutants in these positions (C-3, C-4). For
both the tyrTS and tyrT35U increased reactivity was observed within the −10 region at
positions T-8, A-10, T-11 and A-12 (lanes 7, 8 and 10, 11) although the effect was
much for the former mutant. Unlike the tyrTD mutant neither of the tyrTS nor the
tyrT35U mutant promoters exhibited increased reactivity at positions T+3, T+4.
Figure 21: Potassium permanganate footprinting of ptyrT and its derivatives.
(A) Footprinting performed in the absence of nucleoside triphosphates. The positions of permanganate
reactive thymine bases are indicated. (B) Footprinting performed in the presence of initiating nucleoside
triphosphates GTP and CTP. FIS and RNAP when added is indicated by a ‘+’. Wt, D, S and 35U are the
wild-type and mutants of ptyrT.
56

RESULTS
Addition of FIS increased the reactivity of bases T-8 and T-11 at the wild-type
promoter (lanes 1–3). Also, in the presence of FIS the permanganate reactivity for all
promoter derivatives was further increased, the tyrTS and tyrT35 mutants exhibiting a
greater response than tyrTD. These observations show that at all promoters, albeit to
varying degrees, FIS enhances the interaction with the −10 region. The formation of
initiation (open) complex at the wild-type tyrT promoter requires the presence of GTP
and CTP to allow the synthesis of the dinucleotide pppGpC [Muskhelishvili et al.,
1997]. Figure 21B shows that under these conditions enhanced permanganate reactivity
was observed at the wild-type promoter principally at positions T+3, T+4, T+10, T+26
and addition of FIS had very small, if any, effect (lanes 1–3). The reactivity at positions
+3 and +4, and possibly that at +10, corresponds to the transcription “bubble” in the
DNA. The cleavage patterns observed in the mutant promoters differ from the wild-type
in one major respect, permanganate cleavage being apparent in all of them in the −10
and/or discriminator regions. For all the mutant promoters FIS enhances cleavage
significantly suggesting that in these cases FIS can facilitate initiation complex
formation. A similar effect of FIS on the wild-type promoter has previously been
observed on a linear DNA template [Muskhelishvili et al., 1997].
57

DISCUSSION
4 Discussion
The idea of this work was to integrate the effects of fis and hns genes, representing the
‘digital’ components of genetic information, and variations in DNA superhelicity
forming the ‘analog’ component in order to understand the logics of concerted
rearrangement of global transcription. In a review by Travers and Muskhelishvili
[Travers & Muskhelishvili, 2005b], it is argued that the transcription initiation is
predominantly determined by the topology of the initiation complex and the intrinsic
twist of the DNA, which strongly depends on the mode of DNA packaging. This later
property of the DNA is determined by the chromatin proteins. A high amount of
variability is seen in DNA packaging by different chromatin proteins. FIS has been
shown to stabilize both the toroidal and plectonemic forms of DNA, while H-NS
stabilizes a tight plectoneme [Maurer et al., 2006; Schneider et al., 2001]. Further,
repression or activation of individual gene promoters can also be a result of differential
binding of chromatin proteins. H-NS is known to be a global repressor of transcription
[Dorman, 2004] and manages to do so by occluding the polymerase binding site or by
trapping the polymerase in abortive cycle [Schroder & Wagner, 2000]. H-NS can also
silence a gene by DNA oligomerization of two intrinsically bent, AT rich, remotely
placed upstream and downstream binding sites as observed in the case of bgl operon
[Ueguchi & Mizuno, 1993]. FIS also represses promoters by promoter occlusion (gyrA
promoter) and polymerase trapping (gyrB promoter) [Schneider et al., 1999]. Activation
by FIS, a more widely studied phenomenon, is accomplished by direct interaction with
RNAP and also by trapping the supercoils and directing them to facilitate promoter
opening. The ability of FIS in regulating multiple steps of transcription is evident from
the study of different tyrT promoter mutants in the current work, a detailed discussion
of which will follow in the subsequent sections. The effects exerted by global regulators
like FIS and H-NS are complex and require investigation on both global (genome) and
local (single promoter) levels. However, both of these phenomena are associated with
58

DISCUSSION
topological deformation of DNA, underscoring the importance of understanding the
relationships between DNA topology and DNA architectural proteins.
4.1 Interdependency of supercoiling and NAPs
Supercoiling in E.coli is predominantly controlled by gene products of gyrA, gyrB and
topA. While gyrA & gyrB promoters are repressed by FIS [Schneider et al., 1999], in
vitro studies on binding of FIS at topA promoter has been shown to activate its
expression depending on the concentration of FIS [Weinstein-Fischer & Altuvia, 2007].
Since supercoiling in vivo is maintained by the opposing actions of these enzymes
[DiNardo et al., and Pruss et al., 1982], their relative activities could be regulated to
produce various levels of supercoiling which also has been shown to be modulated by
FIS [Schneider et al., 1997]. Thus FIS affects both the activity and the expression of
topoisomerases and helps in maintaining a constant superhelical energy during
exponential growth in E.coli. Part of this homeostatic control is also due to the
regulation of topoisomerase expression in response to supercoiling [Menzel et al., 1983;
Tse-Dinh et al., 1985]. H-NS mutant has been reported to show an increase in
unconstrained supercoiling [Mojica & Higgins, 1997].
Homeostatic control of supercoiling is exerted by topoisomerases responding
to a change in the number of unrestrained supercoils, which is a consequence of change
in binding of NAPs or change in external environment. The only known effector for
DNA gyrase to sense the nutritional richness of the environment is the in vivo ATP
level. The ATP level has been implicated in the recovery of supercoils after starvation,
but the relaxation of DNA was seen to be not directly correlated with the cellular ATP
levels [Balke and Gralla, 1987]. Transcription and RNAP binding also change the
dynamics of supercoiling [Gamper & Hearst, 1982]. In spite of different perturbations,
the bacteria during steady-state growth strive to maintain a constant level of
superhelical energy. Hence a fundamental question that arises is how the cell
determines the level of supercoiling that is appropriate to each physiological situation?
59

DISCUSSION
In a study by Balke & Gralla, the changes in supercoiling has been shown to be
dependent on the growth phase rather than on the growth rate [Balke & Gralla, 1987].
In the current work, though there are differences in the growth rates of wild-type, fis
(lower growth rate compared to wild-type) & hns (higher growth rate compared to wildtype)
mutants the supercoiling does not differ much (Figure 12). Since it is known that
in slower-growing cells, transcription from stable RNA promoters is decreased relative
to that in fast-growing cells, the decrease in growth rate in the fis mutant or the increase
in the growth rate of hns mutant can be a direct effect of these proteins on the stable
RNA transcription. The molecular basis of this type of growth control and the role of
FIS will be discussed later. H-NS, the other NAP studied here forms a filament like
structure bridging two DNA duplexes and acting as a zipper [Dame, 2005]. The
increase in negative supercoiling shown here is consistent with the previous reports
[Mojica et al., 1997]. The reason for this increase is not clearly understood. The role derepression
of transcription in hns mutant leading to an increased global supercoiling
(according to twin-domain model of supercoiling distribution) has been ruled out
[Mojica et al., 1997]. Our recent study identified a 10bp AT-rich consensus recognized
by H-NS and serving as a nucleation site to restrain negative supercoiling [Lang et al.,
2007].
FIS protein (1 FIS molecule per 450bp of E.coli genome) is more abundant
than H-NS (1 H-NS dimer per 1400bp) during exponential growth. These two proteins
are known to compete for binding to DNA and their binding also depends on the
supercoiling. FIS is known to preferentially bind DNA with intermediate superhelical
density and it also has been shown to protect DNA of intermediate superhelical density
from relaxation by topoisomerases I [Schneider et al., 1997]. Most of the effect of FIS is
in fine tuning of transcription according to the prevailing situation, as it can both
activate and repress the expression of a certain gene based on the growth phase. An
example for this phenomenon can been seen in a work with osmE promoter by Bordes
et al., [Bordes et al., 2002]. The effect of H-NS on transcription is more straightforward,
it mainly acts as global repressor. In hns mutant 70% of the regulated genes are
associated with Rep group while in fis mutant the Rep genes increased transiently only
during exponential phase (Table 1 & Figure 14). Double-coded genes (Figure 14) from
60

DISCUSSION
fis experiment show both activation and repression by FIS especially under conditions
of relaxation. Whilst, as expected the effect of hns mutation was most pronounced for
the Rep genes, these Rep genes predominated the entire growth cycle and were equally
enriched under both hypernegative and relaxed conditions.
In summary variable distribution of supercoiling sensitivity of transcripts as
seen from the genomic wheels (Figure 13) reflect a compound effect of several
cooperating factors, including chromatin proteins FIS and H-NS. The genomic wheel
picture of transcript profile gives an idea of (1) the supercoiling distribution during
different growth phases throughout the genome (2) the effect of different chromatin
proteins on such distribution, and (3) also can help in defining the domain boundaries,
formation of which is probably a result of differential supercoiling sensitivity or
differential NAPs binding in the genome. The data so far supports the idea that
transcription is governed by “effective” superhelicity – a parameter reflecting the
dynamic nature of competition between topoisomerases, NAPs and also the
transcription machinery itself [Travers & Muskhelishvili, 2005b; Geertz et al., 2007].
4.2 Supercoiling coordinates metabolic functions
The changes of supercoiling levels inside the cell not only affect global genome
structure and the formation of supercoiling domains with the help of NAPs, but also
mediate the change of metabolic preferences. Supercoiling is known to act as a sensor
of external environment, whereby the supercoiling level changes in response to
nutrition, stress, temperature and ionic content [Balke & Gralla, 1987; Cheung et al.,
2003; Dorman, 1996; Travers & Muskhelishvili, 2005a]. It is feasible to imagine the
bacterial cell accumulating the energy during exponential growth when nutrition is
freely available and storing it in the form of increased torsional tension in the DNA. Put
other way, an increase in nutrition leading to increase in ATP/ADP ratio will increase
gyrase activity making the DNA more negatively supercoiled. Also increased cell
division during exponential growth will have to match with increased requirement for
biosynthesis functions. During unfavourable conditions when the nutrition is sparse the
61

DISCUSSION
cells maintain viability by deriving energy from degradation of macromolecules. The
current work provides evidence for the first time of a relation between the genes
involved in biosynthetic and degradation pathways and supercoiling preference of gene
activities. Table 2 illustrates that the biosynthetic pathways are made up predominantly
of Hyp genes while the degradation pathways prefer Rel genes, implicating the
supercoiling as global regulator of metabolic functions. A more detailed analysis of the
gene promoters with respect to their sequence organization, their topological properties,
their preference of sigma factors and any NAP binding can help to better understand the
mechanistic basis of the functional switch from biosynthesis to degradation.
The tricaboxylic acid (TCA) cycle and the glyoxylate bypass provide an
example for coupling of supercoiling sensitivity to metabolic function. The TCA cycle
(Figure 15A) plays two essential roles in metabolism. First, the cycle is responsible for
the total oxidation of acetyl coenzyme A (CoA), derived mainly from the pyruvate
produced by glycolysis. Second, TCA cycle intermediates are required in the
biosynthesis of several amino acids. For long the TCA cycle was considered as
housekeeping pathway, but of lately evidences show that it is an inducible pathway
[Iuchi & lin, 1988; Iuchi et al., 1989; Guest & Russell, 1992]. The full TCA cycle in
E.coli is seen only during aerobic growth on acetate or fatty acid and under anaerobic
conditions the cycle is not used for energy production but used more as a biosynthetic
pathway. The growth on acetate or fatty acids also results in the induction of the
glyoxylate shunt, which is the biosynthetic pathway to replenish the intermediates for
amino acid biosynthesis. The gene icdA which codes for IDH (isocitrate dehydogenase)
plays a key role in partition of carbon between TCA cycle and glyoxylate shunt. The
switch is controlled by phosphorylation of IDH which inactivates IDH and activates the
glyoxylate bypass. The genes in the bypass show preference for hypernegative
supercoiling while the suc and sdh genes of the TCA cycle are more active under
relaxation of DNA. Thus hypernegative supercoiling reflecting increased gyrase activity
resulting from a high ATP/ADP ratio favours the glyoxylate bypass and substrate
synthesis. Activation of the suc and sdh gene operons under conditions of DNA
relaxation (low ATP/ADP ratio) helps in capturing the energy released by carbon
metabolism. The switching gene icdA itself is also sensitive to hypernegative
62

DISCUSSION
supercoiling, and so is the gene for its phosporylation (aceK) in the same ace operon of
the bypass genes. Interestingly the icdA mutants can be readily isolated by selecting for
nalidixic acid resistance (gyrase inhibitor) [Helling & Kukora, 1971].
Furthermore, we found that the de novo pathway of nucleotide biosynthesis
explicitly involves the Hyp genes (Figure 15B). Most of these genes have promoters
with a GC-rich ‘discriminator’ sequence, which confers sensitivity to both high negative
supercoiling and the regulatory nucleotide ppGpp [Neidhardt, F.C. et al., 1987; Nygaard
et al., 1996]. Notably, both the superhelicity and ppGpp concentration are elevated in fis
cells [Travers & Muskhelishvili, 2005b], indicating a homeostatic regulation
mechanism. The observed coupling of distinct supercoiling sensitivities to essential
metabolic pathways provides new insights into the mechanisms that coordinate central
metabolism, and also sheds light on the puzzling observation that mutations in
metabolic genes can affect DNA topology [Hardy & Cozzarelli, 2005].
4.3 Activity of tyrT promoter - Interaction of supercoiling
and FIS at the promoter level
We also investigated the molecular mechanism of regulation of an individual gene
transcription and an interplay between supercoiling and transcriptional regulator FIS
using the tyrT promoter system as a model.
The promoters of stable RNA operons are subject to a complex regulatory
network which coordinates the activity of translation machinery with the metabolic
demands of the cell. Our data indicate that the effects of fis on tyrT transcription in vivo
are a consequence of at least two phenomena, one local and one global: a direct
activation by binding of FIS to UAS and interaction with RNA polymerase at the
promoter [Bokal et al., 1995; Muskhelishvili et al., 1995] and general FIS dependent
reduction in the average superhelical density of the DNA template [this work and
Schneider et al., 1997]. These effects would be expected, respectively, to increase and
decrease tyrT transcription consistent with the homeostatic mode of regulation.
Recently Rochman et al. [Rochman et al., 2002] have shown that stabilization of local
63

DISCUSSION
writhe in the UAS by FIS protects rrnA P1 promoters from inactivation at sub-optimal
superhelical densities. This compensatory effect is also apparent with wild-type tyrT in
vivo when expressed from hyperhegatively supercoiled plasmid DNA. We see here that
the mutations in the core promoter that alter the sensitivity to supercoiling also alter the
response to FIS, although the UAS region containing the FIS binding sites remain
intact. Also the increased supercoiling of the wild-type promoter template in the fis cells
[Auner et al., 2003] may, in principle compensate for the absence of FIS. The distinct
roles of core promoter and UAS in sensing the supercoiling and FIS revealed in this
work, together describe the extent of regulatability built into the stringently controlled
tyrT promoter.
4.3.1 Promoter structure and function
We have studied the effects of the three mutations of tyrT core promoter: a change in
the -35 region to the consensus sequence TTGACA, an increase in the spacing between
the –10 and –35 hexamers from a suboptimal 16bp to the consensus 17bp [Lisser et al.,
1993], and a 4bp substitution in the discriminator region (TTAA in place of CCCC,
Figure 16B). The mutations towards the consensus exhibit substantially increased
activity in vivo (Figure 17).
The permanganate reactivity of promoter mutants’ show that all the core
promoter mutants studied in the absence of FIS and NTPs have enhanced interactions
with polymerase relative to the wild-type promoter in the TG of the extended –10
region and the –10 region itself (Figure 21A). The mutation in the spacer and –35
hexamer also result in the loss of dependence on negative superhelicity, showing that
the sensitivity of the tyrT promoter to this parameter is determined by more than one
aspect of sequence organization. A further similarity is that both these mutations act in
vitro to enhance interactions with the –10 region (Figure 21). Notably, neither of these
mutations enhanced permanganate reactivity in the vicinity of the transcription start
point in the absence of NTPs. We infer that a major effect of these mutations is to
promote untwisting of DNA within the –10 hexamer. The inference we draw is that a
64

DISCUSSION
primary effect of negative superhelicity on the tyrT promoter is to drive the untwisting
of the –10 region.
The discriminator region has previously been implicated as an important
determinant of transcriptional response to negative supercoiling at hisR and tyrT
promoters [Figueroa-Bossi et al., 1998; Pemberton et al., 2000]. In the experiments
described here we have shown that in the absence of the initiating NTPs a discriminator
mutation enhances contacts around – 10 region and the transcription start point,
implying that the mutation relieves a discriminator-dependent block on open complex
formation. Also, the tyrTD mutation reduces the optimum superhelical density for
transcription in vitro. However, in the LZ strains the discriminator mutant is still
strongly activated by negative superhelicity and is less active at hypernegative sigma
values (Figure 18). Taken together these observations suggest that an intact
discriminator enhances the response of a promoter to a negative superhelicity and that
overall its mutation attenuates, but does not abolish, the response.
We found that mutation of the –35 region or the spacer region to the consensus
abolishes dependence of expression on negative superhelicity in vivo while mutation of
the discriminator does not. We infer that the response to superhelicity is modulated by
the primary promoter elements (-35 hexamer, spacer, -10 hexamer). These elements
individually or together, determine the torque available for nucleation, the polymerasedependent
untwisting of the –10 region. The role of the discriminator element is
different. This element blocks the subsequent propagation of untwisting from the –10
region to the transcription start point and hence constitutes a barrier to open complex
formation. Even when nucleation was promoted by mutation of the spacer or the –35
region no further progression of the untwisted region to the start point was observed
(Figure 21A) presumably because these variant promoters still contained an intact
discriminator. One explanation for the partial alleviation of the response to supercoiling
by the tyrTD mutation would be lowering of the activation energy for untwisting of the
–10 region by virtue of its proximity [Drew et al., 1985].
65

DISCUSSION
4.3.2 Mechanism of transcriptional activation of the tyrT promoter
Stable RNA promoters in E. coli are both highly regulated and show a high maximal
rate of transcription initiation. The tyrT UAS is necessary for optimal expression in vivo
[Lamond & Travers, 1983] and can activate transcription in both FIS-dependent and
independent modes. In vitro the tyrT UAS increases the affinity of the polymerase for
the promoter [Sander et al., 1993] and has been inferred to make a contact with RNA
polymerase at positions around -120 to -130 on a negatively supercoiled DNA template
[Pemberton et al., 2002]. We note that using conditions where we would expect this
contact to be formed efficiently we do not observe untwisting of the -10 region in the
wild-type promoter (Figure 21A), although the -10 hexamer is contacted prior to the
formation of the upstream contact [Pemberton et al., 2002]. However, untwisting does
occur in the presence of FIS (Figure 21A). This is consistent with both previous
observation that FIS facilitates DNA untwisting in the -10 region in the presence of the
initiating NTPs [Muskhelishvili et al., 1997] and also with other observations that FIS
can rescue the impaired activity of a promoter with down mutation in the -10 region
[Lazarus & Travers, 1993] and of a mutant RNA polymerase whose binding to the rrnB
P1 promoter is destabilized [Bartlett et al., 2000]. The finding that the -35U and spacer
mutants simultaneously lose the dependence on negative superhelicity and the
requirement for the UAS in vivo suggests that these mutations overcome wholly or
partially the barrier imposed by the wild-type promoter organization and hence abolish
the requirement for activation by the UAS alone or by FIS bound to the UAS. The UAS
thus acts primarily as a regulatory region with a distinct DNA geometry that is sensitive
to the superhelical density of the DNA template [Travers & Muskhelishvili, 1998].
Stabilization of this geometry by FIS buffers polymerase function against variations in
negative superhelicity. Provision of such a buffer by FIS operates both for the tyrT
promoter (this work) and also for the rrnA P1 promoter [Rochman et al., 2002]. We
would expect this mechanism to be common to all promoters of similar organization.
From the data here we infer that the regulated step in transcription initiation at the tyrT
and possibly other stable RNA promoters is the untwisting of the -10 region, a step
66

DISCUSSION
which both stabilizes the polymerase–promoter interaction and provides a nucleation
point for strand separation during promoter opening. At the tyrT promoter contacts in
the -10 region are facilitated by negative supercoiling [Pemberton et al., 2002] and
untwisting by FIS binding to the UAS [Muskhelishvili et al., 1997 and this work]. FIS
can also alleviate the inhibitory effect of ppGpp on transcription from the wild-type tyrT
promoter in vitro [Lazarus & Travers, 1993]. One, at least, of the mutations tested,
tyrTD, is insensitive to inhibition by ppGpp in vivo and in vitro [Lamond & Travers,
1985; Travers, 1980]. Taken as a whole these observations imply that for transcription
initiation at stable RNA promoters there is a mechanistic connection involving not only
high negative superhelicity and ppGpp levels, as previously suggested by Ohlsen &
Gralla [Ohlsen and Gralla, 1992] and by Figueroa-Bossi et al. [Figueroa-Bossi et al.,
1998] but also FIS. Together these parameters act to maintain tightly controlled levels
of transcription.
67

CONCLUSION
5 Conclusion
Regulation of cellular growth involves coordinated gene expression programs. An
essential question is, how during growth the global transcription is organized in the
genome. We demonstrate in unicellular organism E.coli that the coordination of growth
phase-dependent transcription involves spatiotemporal organization of supercoiling
sensitivity in the genome. On the example of tyrT promoter we demonstrate how the
sequence organization of a promoter can determine supercoiling sensitivity. We show
that the distributions of supercoiling sensitivity are modulated by chromatin proteins -
both at global and local promoter levels - involved in organizing cellular metabolism
during successive stages of growth. More compellingly, our approach identifies a tight
coupling between unique genes and the ubiquitous torsional properties of the genomic
DNA in coordinating essential metabolic functions. Global regulation thus appears to
act as a genuine device converting the “analog” information of torsional energy
distributions into “digital” patterns of genomic activity (and vice versa). This work thus
not only validates the John von Neumann notion on the coordination of genetic
information at a most basic level, but also offers a novel strategy for further
investigations. Notably, it is now evident that DNA supercoiling plays an increasingly
important role in regulation of eukaryotic transcription [Dunaway & Ostrander, 1993],
suggesting that this type of approach may facilitate the understanding of fundamental
mechanisms coordinating the gene expression.
68

REFERENCES
6 References
Ali Azam, T., Iwata, A., Nishimura, A., Ueda, S., and Ishihama, A. (1999) Growth
phase-dependent variation in protein composition of the Escherichia coli nucleoid.
J Bacteriol 181: 6361-6370.
Auner, H., Buckle, M., Deufel, A., Kutateladze, T., Lazarus, L., Mavathur, R.,
Muskhelishvili, G., Pemberton, I., Schneider, R., and Travers, A. (2003)
Mechanism of transcriptional activation by FIS: role of core promoter structure
and DNA topology. J Mol Biol 331: 331-344.
Azam, T.A., and Ishihama, A. (1999) Twelve species of the nucleoid-associated protein
from Escherichia coli. Sequence recognition specificity and DNA binding affinity.
J Biol Chem 274: 33105-33113.
Balke, V.L., and Gralla, J.D. (1987) Changes in the linking number of supercoiled DNA
accompany growth transitions in Escherichia coli. J Bacteriol 169: 4499-4506.
Ball, C.A., Osuna, R., Ferguson, K.C., and Johnson, R.C. (1992) Dramatic changes in
Fis levels upon nutrient upshift in Escherichia coli. J Bacteriol 174: 8043-8056.
Bartlett, M.S., Gaal, T., Ross, W., and Gourse, R.L. (2000) Regulation of rRNA
transcription is remarkably robust: FIS compensates for altered nucleoside
triphosphate sensing by mutant RNA polymerases at Escherichia coli rrn P1
promoters. J Bacteriol 182: 1969-1977.
Blot, N., Mavathur, R., Geertz, M., Travers, A., and Muskhelishvili, G. (2006)
Homeostatic regulation of supercoiling sensitivity coordinates transcription of the
bacterial genome. EMBO Rep 7: 710-715.
Bokal, A.J.t., Ross, W., and Gourse, R.L. (1995) The transcriptional activator protein
FIS: DNA interactions and cooperative interactions with RNA polymerase at the
Escherichia coli rrnB P1 promoter. J Mol Biol 245: 197-207.
69

REFERENCES
Bordes, P., Conter, A., Morales, V., Bouvier, J., Kolb, A., and Gutierrez, C. (2003)
DNA supercoiling contributes to disconnect sigmaS accumulation from sigmaSdependent
transcription in Escherichia coli. Mol Microbiol 48: 561-571.
Bowater, R.P., Chen, D., and Lilley, D.M. (1994) Modulation of tyrT promoter activity
by template supercoiling in vivo. Embo J 13: 5647-5655.
Browning, D.F., and Busby, S.J. (2004) The regulation of bacterial transcription
initiation. Nat Rev Microbiol 2: 57-65.
Burgess, R.R. (1969) Separation and characterization of the subunits of ribonucleic acid
polymerase. J Biol Chem 244: 6168-6176.
Cheung, K.J., Badarinarayana, V., Selinger, D.W., Janse, D., and Church, G.M. (2003)
A microarray-based antibiotic screen identifies a regulatory role for supercoiling
in the osmotic stress response of Escherichia coli. Genome Res 13: 206-215.
Crozat, E., Philippe, N., Lenski, R.E., Geiselmann, J., and Schneider, D. (2005) Longterm
experimental evolution in Escherichia coli. XII. DNA topology as a key
target of selection. Genetics 169: 523-532.
Dame, R.T., Wyman, C., and Goosen, N. (2001) Structural basis for preferential
binding of H-NS to curved DNA. Biochimie 83: 231-234.
Dame, R.T. (2005) The role of nucleoid-associated proteins in the organization and
compaction of bacterial chromatin. Mol Microbiol 56: 858-870.
Deng, S., Stein, R.A., and Higgins, N.P. (2005) Organization of supercoil domains and
their reorganization by transcription. Mol Microbiol 57: 1511-1521.
DiNardo, S., Voelkel, K.A., Sternglanz, R., Reynolds, A.E., and Wright, A. (1982)
Escherichia coli DNA topoisomerase I mutants have compensatory mutations in
DNA gyrase genes. Cell 31: 43-51.
Dorman, C.J. (1996) Flexible response: DNA supercoiling, transcription and bacterial
adaptation to environmental stress. Trends Microbiol 4: 214-216.
Dorman, C.J., and Deighan, P. (2003) Regulation of gene expression by histone-like
proteins in bacteria. Curr Opin Genet Dev 13: 179-184.
70

REFERENCES
Dorman, C.J. (2004) H-NS: a universal regulator for a dynamic genome. Nat Rev
Microbiol 2: 391-400.
Drew, H.R., Weeks, J.R., and Travers, A.A. (1985) Negative supercoiling induces
spontaneous unwinding of a bacterial promoter. Embo J 4: 1025-1032.
Drlica, K. (1992) Control of bacterial DNA supercoiling. Mol Microbiol 6: 425-433.
Dunaway, M., and Ostrander, E.A. (1993) Local domains of supercoiling activate a
eukaryotic promoter in vivo. Nature 361: 746-748.
Figueroa-Bossi, N., Guerin, M., Rahmouni, R., Leng, M., and Bossi, L. (1998) The
supercoiling sensitivity of a bacterial tRNA promoter parallels its responsiveness
to stringent control. Embo J 17: 2359-2367.
Free, A., and Dorman, C.J. (1994) Escherichia coli tyrT gene transcription is sensitive
to DNA supercoiling in its native chromosomal context: effect of DNA
topoisomerase IV overexpression on tyrT promoter function. Mol Microbiol 14:
151-161.
Gamper, H.B., and Hearst, J.E. (1982) A topological model for transcription based on
unwinding angle analysis of E. coli RNA polymerase binary, initiation and ternary
complexes. Cell 29: 81-90.
Geertz, M., Mavathur, R., Travers, A., Muskhelishvili, G. (2007) RNA polymerase
composition is homeostatically coupled with DNA topology in E. coli. Submitted
to EMBO reports.
Gille, H., Egan, J.B., Roth, A. and Messer, W. (1991) The FIS protein binds and bends
the origin of chromosomal DNA replication, oriC, of Escherichia coli. Nucleic
Acids Res, 19, 4167-4172.
Gomez-Eichelmann, M.C., and Camacho-Carranza, R. (1995) [DNA supercoiling and
topoisomerases in Escherichia coli]. Rev Latinoam Microbiol 37: 291-304.
Gralla, J.D., Hsieh, M. & Wong, C. (1993) Permanganate probing. In Footprinting
Techniques for Studying Nucleic Acid-Protein complexes (Revzin, A., ed.)
pp.107-128, Academic Press, Orlando, FL.
71

REFERENCES
Gruber, T.M., and Gross, C.A. (2003) Multiple sigma subunits and the partitioning of
bacterial transcription space. Annu Rev Microbiol 57: 441-466.
Guest, J.R., and Russell, G.C. (1992) Complexes and complexities of the citric acid
cycle in Escherichia coli. Curr Top Cell Regul 33: 231-247.
Hardy, C.D., and Cozzarelli, N.R. (2005) A genetic selection for supercoiling mutants
of Escherichia coli reveals proteins implicated in chromosome structure. Mol
Microbiol 57: 1636-1652.
Hatfield, G.W., and Benham, C.J. (2002) DNA topology-mediated control of global
gene expression in Escherichia coli. Annu Rev Genet 36: 175-203.
Heinemann, M., and Wagner, R. (1997) Guanosine 3',5'-bis(diphosphate) (ppGpp)-
dependent inhibition of transcription from stringently controlled Escherichia coli
promoters can be explained by an altered initiation pathway that traps RNA
polymerase. Eur J Biochem 247: 990-999.
Helling, R.B., and Kukora, J.S. (1971) Nalidixic Acid-Resistant Mutants of Escherichia
coli Deficient in Isocitrate Dehydrogenase. J. Bacteriol. 105: 1224-1226.
Hengge-Aronis, R. (2002) Recent insights into the general stress response regulatory
network in Escherichia coli. J Mol Microbiol Biotechnol 4: 341-346.
Hiasa, H., and Marians, K.J. (1994) Topoisomerase III, but not topoisomerase I, can
support nascent chain elongation during theta-type DNA replication. J Biol Chem
269: 32655-32659.
Ishihama, A. (1999) Modulation of the nucleoid, the transcription apparatus, and the
translation machinery in bacteria for stationary phase survival. Genes Cells 4:
135-143.
Ishihama, A. (2000) Functional modulation of Escherichia coli RNA polymerase. Annu
Rev Microbiol 54: 499-518.
Iuchi, S., and Lin, E.C. (1988) arcA (dye), a global regulatory gene in Escherichia coli
mediating repression of enzymes in aerobic pathways. Proc Natl Acad Sci U S A
85: 1888-1892.
72

REFERENCES
Iuchi, S., Cameron, D.C., and Lin, E.C. (1989) A second global regulator gene (arcB)
mediating repression of enzymes in aerobic pathways of Escherichia coli. J
Bacteriol 171: 868-873.
Jeong, K.S., Ahn, J., and Khodursky, A.B. (2004) Spatial patterns of transcriptional
activity in the chromosome of Escherichia coli. Genome Biol 5: R86.
Josaitis, C.A., Gaal, T., and Gourse, R.L. (1995) Stringent control and growth-ratedependent
control have nonidentical promoter sequence requirements. Proc Natl
Acad Sci U S A 92: 1117-1121.
Keller, W. (1975) Determination of the number of superhelical turns in simian virus 40
DNA by gel electrophoresis. Proc Natl Acad Sci U S A 72: 4876-4880.
Kerkhoven, R., van Enckevort, F.H., Boekhorst, J., Molenaar, D., and Siezen, R.J.
(2004) Visualization for genomics: the Microbial Genome Viewer. Bioinformatics
20: 1812-1814.
Khodursky, A.B., Zechiedrich, E.L., and Cozzarelli, N.R. (1995) Topoisomerase IV is a
target of quinolones in Escherichia coli. Proc Natl Acad Sci U S A 92: 11801-
11805.
Koch, C., Vandekerckhove, J., and Kahmann, R. (1988) Escherichia coli host factor for
site-specific DNA inversion: cloning and characterization of the fis gene. Proc
Natl Acad Sci U S A 85: 4237-4241.
Kusano, S., Ding, Q., Fujita, N., and Ishihama, A. (1996) Promoter selectivity of
Escherichia coli RNA polymerase E sigma 70 and E sigma 38 holoenzymes.
Effect of DNA supercoiling. J Biol Chem 271: 1998-2004.
Lamond, A.I., and Travers, A.A. (1983) Requirement for an upstream element for
optimal transcription of a bacterial tRNA gene. Nature 305: 248-250.
Lamond, A.I., and Travers, A.A. (1985) Stringent control of bacterial transcription. Cell
41: 6-8.
Lang, B., Madan Babu, M., Blot, N., Bouffartigues, E., Buckle, M., Geertz, M.,
Gualerzi, C., Mavathur, R., Muskhelshvili, G., Pon, C., Rimsky, S., Stella, S.,
Travers, A., (2007) High affinity DNA binding sites for H-NS provide a
73

REFERENCES
molecular basis for selective silencing within proteobacterial genomes. Submitted
to PNAS.
Lazarus, L.R., and Travers, A.A. (1993) The Escherichia coli FIS protein is not required
for the activation of tyrT transcription on entry into exponential growth. Embo J
12: 2483-2494.
Lim, H.M., Lewis, D.E., Lee, H.J., Liu, M., and Adhya, S. (2003) Effect of varying the
supercoiling of DNA on transcription and its regulation. Biochemistry 42: 10718-
10725.
Lisser, S., and Margalit, H. (1993) Compilation of E. coli mRNA promoter sequences.
Nucleic Acids Res 21: 1507-1516.
Liu, L.F., and Wang, J.C. (1987) Supercoiling of the DNA template during
transcription. Proc Natl Acad Sci U S A 84: 7024-7027.
Lockshon, D., and Morris, D.R. (1983) Positively supercoiled plasmid DNA is
produced by treatment of Escherichia coli with DNA gyrase inhibitors. Nucleic
Acids Res 11: 2999-3017.
Maurer, S., Fritz, J., Muskhelishvili, G., and Travers, A. (2006) RNA polymerase and
an activator form discrete subcomplexes in a transcription initiation complex.
Embo J 25: 3784-3790.
McClure, W.R. (1985) Mechanism and control of transcription initiation in prokaryotes.
Annu Rev Biochem 54: 171-204.
McLeod, S.M., and Johnson, R.C. (2001) Control of transcription by nucleoid proteins.
Curr Opin Microbiol 4: 152-159.
Menzel, R., and Gellert, M. (1983) Regulation of the genes for E. coli DNA gyrase:
homeostatic control of DNA supercoiling. Cell 34: 105-113.
Mojica, F.J., and Higgins, C.F. (1997) In vivo supercoiling of plasmid and
chromosomal DNA in an Escherichia coli hns mutant. J Bacteriol 179: 3528-
3533.
74

REFERENCES
Murray, K.D., and Bremer, H. (1996) Control of spoT-dependent ppGpp synthesis and
degradation in Escherichia coli. J Mol Biol 259: 41-57.
Muskhelishvili, G., Travers, A.A., Heumann, H., and Kahmann, R. (1995) FIS and
RNA polymerase holoenzyme form a specific nucleoprotein complex at a stable
RNA promoter. Embo J 14: 1446-1452.
Muskhelishvili, G., Buckle, M., Heumann, H., Kahmann, R., and Travers, A.A. (1997)
FIS activates sequential steps during transcription initiation at a stable RNA
promoter. Embo J 16: 3655-3665.
Muskhelishvili, G., and Travers, A. (2003) Transcription factor as a topological
homeostat. Front Biosci 8: d279-285.
Nachaliel, N., Melnick, J., Gafny, R. and Glaser, G. (1989) Ribosome associated
protein(s) specifically bind(s) to the upstream activator sequence of the E. coli
rrnA P1 promoter. Nucl. Acids Res., 17, 9811-9822.
Nasser, W., Schneider, R., Travers, A., and Muskhelishvili, G. (2001) CRP modulates
fis transcription by alternate formation of activating and repressing nucleoprotein
complexes. J Biol Chem 276: 17878-17886.
Neidhardt, F.C. et al. (1987) Escherichia coli and Salmonella typhimurium: Cellular and
Molecular Biology Vol. 2. American Society for Microbiology.
Nygaard, P., Duckert, P., and Saxild, H.H. (1996) Role of adenine deaminase in purine
salvage and nitrogen metabolism and characterization of the ade gene in Bacillus
subtilis. J Bacteriol 178: 846-853.
Nystrom, T. (2004) Stationary-phase physiology. Annu Rev Microbiol 58: 161-181.
Ohlsen, K.L., and Gralla, J.D. (1992) DNA melting within stable closed complexes at
the Escherichia coli rrnB P1 promoter. J Biol Chem 267: 19813-19818.
Ozoline, O.N., Deev, A.A., and Trifonov, E.N. (1999) DNA bendability--a novel
feature in E. coli promoter recognition. J Biomol Struct Dyn 16: 825-831.
75

REFERENCES
Pan, C.Q., Finkel, S.E., Cramton, S.E., Feng, J.A., Sigman, D.S., and Johnson, R.C.
(1996) Variable structures of Fis-DNA complexes determined by flanking DNAprotein
contacts. J Mol Biol 264: 675-695.
Pan, W. (2002) A comparative review of statistical methods for discovering
differentially expressed genes in replicated microarray experiments.
Bioinformatics 18: 546-554.
Pedersen, A.G., Jensen, L.J., Brunak, S., Staerfeldt, H.H., and Ussery, D.W. (2000) A
DNA structural atlas for Escherichia coli. J Mol Biol 299: 907-930.
Pemberton, I.K., Muskhelishvili, G., Travers, A.A., and Buckle, M. (2000) The G+Crich
discriminator region of the tyrT promoter antagonises the formation of stable
preinitiation complexes. J Mol Biol 299: 859-864.
Pemberton, I.K., Muskhelishvili, G., Travers, A.A., and Buckle, M. (2002) FIS
modulates the kinetics of successive interactions of RNA polymerase with the
core and upstream regions of the tyrT promoter. J Mol Biol 318: 651-663.
Perez-Martin, J., and de Lorenzo, V. (1997) Clues and consequences of DNA bending
in transcription. Annu Rev Microbiol 51: 593-628.
Peter, B.J., Arsuaga, J., Breier, A.M., Khodursky, A.B., Brown, P.O., and Cozzarelli,
N.R. (2004) Genomic transcriptional response to loss of chromosomal
supercoiling in Escherichia coli. Genome Biol 5: R87.
Pontiggia, A., Negri, A., Beltrame, M., and Bianchi, M.E. (1993) Protein HU binds
specifically to kinked DNA. Mol Microbiol 7: 343-350.
Postow, L., Hardy, C.D., Arsuaga, J., and Cozzarelli, N.R. (2004) Topological domain
structure of the Escherichia coli chromosome. Genes Dev 18: 1766-1779.
Pruss, G.J., Manes, S.H., and Drlica, K. (1982) Escherichia coli DNA topoisomerase I
mutants: increased supercoiling is corrected by mutations near gyrase genes. Cell
31: 35-42.
Rimsky, S., Zuber, F., Buckle, M., and Buc, H. (2001) A molecular mechanism for the
repression of transcription by the H-NS protein. Mol Microbiol 42: 1311-1323.
76

REFERENCES
Rochman, M., Aviv, M., Glaser, G., and Muskhelishvili, G. (2002) Promoter protection
by a transcription factor acting as a local topological homeostat. EMBO Rep 3:
355-360.
Ryals, J., Little, R., and Bremer, H. (1982) Control of rRNA and tRNA syntheses in
Escherichia coli by guanosine tetraphosphate. J Bacteriol 151: 1261-1268.
Sadler, J.R., and Novick, A. (1965) The Properties of Repressor and the Kinetics of Its
Action. J Mol Biol 12: 305-327.
Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa,
M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D.,
Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V.,
and Quackenbush, J. (2003) TM4: a free, open-source system for microarray data
management and analysis. Biotechniques 34: 374-378.
Sambrook, J. and Russell, D.W. (2001) Molecular cloning : a laboratory manual. Third
edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Sander, P., Langert, W., and Mueller, K. (1993) Mechanisms of upstream activation of
the rrnD promoter P1 of Escherichia coli. J Biol Chem 268: 16907-16916.
Schneider, R., Travers, A., and Muskhelishvili, G. (1997) FIS modulates growth phasedependent
topological transitions of DNA in Escherichia coli. Mol Microbiol 26:
519-530.
Schneider, R., Travers, A., Kutateladze, T., and Muskhelishvili, G. (1999) A DNA
architectural protein couples cellular physiology and DNA topology in
Escherichia coli. Mol Microbiol 34: 953-964.
Schneider, R., Travers, A., and Muskhelishvili, G. (2000) The expression of the
Escherichia coli fis gene is strongly dependent on the superhelical density of
DNA. Mol Microbiol 38: 167-175.
Schneider, R., Lurz, R., Luder, G., Tolksdorf, C., Travers, A., and Muskhelishvili, G.
(2001) An architectural role of the Escherichia coli chromatin protein FIS in
organising DNA. Nucleic Acids Res 29: 5107-5114.
77

REFERENCES
Schroder, O., and Wagner, R. (2000) The bacterial DNA-binding protein H-NS
represses ribosomal RNA transcription by trapping RNA polymerase in the
initiation complex. J Mol Biol 298: 737-748.
Sinden, R.R., and Pettijohn, D.E. (1981) Chromosomes in living Escherichia coli cells
are segregated into domains of supercoiling. Proc Natl Acad Sci U S A 78: 224-
228.
Snoep, J.L., van der Weijden, C.C., Andersen, H.W., Westerhoff, H.V., and Jensen,
P.R. (2002) DNA supercoiling in Escherichia coli is under tight and subtle
homeostatic control, involving gene-expression and metabolic regulation of both
topoisomerase I and DNA gyrase. Eur J Biochem 269: 1662-1669.
Staczek, P., and Higgins, N.P. (1998) Gyrase and Topo IV modulate chromosome
domain size in vivo. Mol Microbiol 29: 1435-1448.
Stein, R.A., Deng, S., and Higgins, N.P. (2005) Measuring chromosome dynamics on
different time scales using resolvases with varying half-lives. Mol Microbiol 56:
1049-1061.
Tao, H., Bausch, C., Richmond, C., Blattner, F.R., and Conway, T. (1999) Functional
genomics: expression analysis of Escherichia coli growing on minimal and rich
media. J Bacteriol 181: 6425-6440.
Thanbichler, M., Viollier, P.H., and Shapiro, L. (2005) The structure and function of the
bacterial chromosome. Curr Opin Genet Dev 15: 153-162.
Tippner, D., Afflerbach, H., Bradaczek, C., and Wagner, R. (1994) Evidence for a
regulatory function of the histone-like Escherichia coli protein H-NS in ribosomal
RNA synthesis. Mol Microbiol 11: 589-604.
Travers, A.A. (1980) Promoter sequence for stringent control of bacterial ribonucleic
acid synthesis. J Bacteriol 141: 973-976.
Travers, A., and Muskhelishvili, G. (1998) DNA microloops and microdomains: a
general mechanism for transcription activation by torsional transmission. J Mol
Biol 279: 1027-1043.
78

REFERENCES
Travers, A., Schneider, R., and Muskhelishvili, G. (2001) DNA supercoiling and
transcription in Escherichia coli: The FIS connection. Biochimie 83: 213-217.
Travers, A., and Muskhelishvili, G. (2005) Bacterial chromatin. Curr Opin Genet Dev
15: 507-514.
Travers, A., and Muskhelishvili, G. (2005) DNA supercoiling - a global transcriptional
regulator for enterobacterial growth? Nat Rev Microbiol 3: 157-169.
Travers, A., and Muskhelishvili, G. (2007) A common topology for bacterial and
eukaryotic transcription initiation? EMBO Rep 8: 147-151.
Tse-Dinh, Y.C. (1985) Regulation of the Escherichia coli DNA topoisomerase I gene by
DNA supercoiling. Nucleic Acids Res 13: 4751-4763.
Tse-Dinh, Y.C., Qi, H., and Menzel, R. (1997) DNA supercoiling and bacterial
adaptation: thermotolerance and thermoresistance. Trends Microbiol 5: 323-326.
Ueguchi, C., and Mizuno, T. (1993) The Escherichia coli nucleoid protein H-NS
functions directly as a transcriptional repressor. Embo J 12: 1039-1046.
Valens, M., Penaud, S., Rossignol, M., Cornet, F., and Boccard, F. (2004)
Macrodomain organization of the Escherichia coli chromosome. Embo J 23: 4330-
4341.
von Neumann, J., (1958) The Computer and the Brain. New Haven, CT, USA: Yale
University Press
Weber, H., Polen, T., Heuveling, J., Wendisch, V.F., and Hengge, R. (2005) Genomewide
analysis of the general stress response network in Escherichia coli: sigmaSdependent
genes, promoters, and sigma factor selectivity. J Bacteriol 187: 1591-
1603.
Wei, Y., Lee, J.M., Richmond, C., Blattner, F.R., Rafalski, J.A., and LaRossa, R.A.
(2001) High-density microarray-mediated gene expression profiling of
Escherichia coli. J Bacteriol 183: 545-556.
Weinstein-Fischer, D., and Altuvia, S. (2007) Differential regulation of Escherichia coli
topoisomerase I by Fis. Mol Microbiol 63: 1131-1144.
79

REFERENCES
Willenbrock, H., and Ussery, D.W. (2004) Chromatin architecture and gene expression
in Escherichia coli. Genome Biol 5: 252.
Wu, H.Y., Shyy, S.H., Wang, J.C., and Liu, L.F. (1988) Transcription generates
positively and negatively supercoiled domains in the template. Cell 53: 433-440.
Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage cloning
vectors and host strains: nucleotide sequences of the M13mp18 and pUC19
vectors. Gene 33: 103-119.
Zechiedrich, E.L., Khodursky, A.B., and Cozzarelli, N.R. (1997) Topoisomerase IV, not
gyrase, decatenates products of site-specific recombination in Escherichia coli.
Genes Dev 11: 2580-2592.
Zechiedrich, E.L., Khodursky, A.B., Bachellier, S., Schneider, R., Chen, D., Lilley,
D.M., and Cozzarelli, N.R. (2000) Roles of topoisomerases in maintaining steadystate
DNA supercoiling in Escherichia coli. J Biol Chem 275: 8103-8113.
80

APPENDIX I
7 Appendix I - Supplementary data: Gene lists from
microarray experiments.
Supplementary table -I: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Mid-exponential phase
gene blattner ratio p-value Function
A/B
aceA b4015 0.4993 0.0399 isocitrate lyase monomer
acnA b1276 0.5979 0.0220 aconitase
add b1623 0.7825 0.0299 deoxyadenosine deaminase / adenosine deaminase
adhP b1478 0.5912 0.0138 ethanol dehydrogenase
adk b0474 0.7212 0.0042 adenylate kinase
allR b0506 0.5111 0.0224 AllR transcriptional regulator
ansA b1767 0.5233 0.0335 asparaginase I
araC b0064 0.6958 0.0157 AraC transcriptional dual regulator
argC b3958 1.8029 0.0027 N-acetylglutamylphosphate reductase
argR b3237 0.5625 0.0105 ArgR transcriptional dual regulator
argS b1876 0.6906 0.0296 arginyl-tRNA synthetase
aroG b0754 2.9967 0.0372 2-dehydro-3-deoxyphosphoheptonate aldolase
arsB b3502 0.4948 0.0219 arsenite Ars transporter
artP b0864 1.7795 0.0024 arginine ABC transporter
atoS b2219 2.3222 0.0346 AtoS-Phis
b0259 b0259 1.7818 0.0203 IS5 protein
b0538 b0538 0.4888 0.0102 putative sensory transduction regulator
b1146 b1146 0.4913 0.0184 hypothetical protein
b3044 b3044 1.8424 0.0245 IS21 protein
bax b3570 2.0569 0.0470 putative ATP-binding protein
bcsC b3530 1.9134 0.0035 oxidase involved in cellulose synthesis
bcsE b3536 2.7434 0.0002 putative protease
bcsF b3537 2.2031 0.0199 hypothetical protein
bdm b1481 0.4743 0.0212 hypothetical protein
bfd b3337 3.4231 0.0057 bacterioferritin-associated ferredoxin
blc b4149 1.5094 0.0488 Blc outer membrane lipoprotein (lipocalin)
bolA b0435 3.8179 0.0135 BolA transcriptional regulator
caiB b0038 0.5712 0.0445 CaiB monomer
carB b0033 2.0837 0.0268 carbamoyl phosphate synthetase
chaC b1218 0.5220 0.0378 cation transport regulator
cls b1249 2.0209 0.0254 cardiolipin synthase
cmk b0910 0.5068 0.0341 cytidylate kinase
codB b0336 0.4890 0.0263 CodB cytosine NCS1 transporter
corA b3816 0.6579 0.0224 CorA magnesium ion MIT transporter
csgA b1042 0.4427 0.0472 curlin, major subunit
cspD b0880 0.5276 0.0343 DNA replication inhibitor
cspF b1558 0.4512 0.0391 cold shock protein CspF
cusF b0573 1.4877 0.0197 periplasmic copper-binding protein
cusS b0570 0.5047 0.0393 putative 2-component sensor protein
cyoB b0431 1.9982 0.0279 cytochrome bo terminal oxidase subunit I
dcp b1538 0.7555 0.0449 dipeptidyl carboxypeptidase II
dcuA b4138 1.7199 0.0185 DcuA dicarboxylate Dcu transporter
dcuR b4124 2.1501 0.0059 DcuR-Pasp56
dcuS b4125 2.3146 0.0461 DcuS-Phis349
deoC b4381 3.0453 0.0075 deoxyribose-phosphate aldolase
deoD b4384 1.9030 0.0058 purine nucleoside phosphorylase
81

APPENDIX I
gene blattner ratio p-value Function
A/B
dgkA b4042 1.3606 0.0128 diacylglycerol kinase
dgoA b3692 0.1024 0.0302
dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD
3871021-3869873 : galactonate dehydratase
dgoR b3694 0.2442 0.0306 regulator protein for dgo operon
dhaL b1199 2.4480 0.0354 dihydroxyacetone kinase subunit L
dinB b0231 0.5647 0.0273 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis)
dinI b1061 0.5985 0.0137 damage-inducible protein I
dld b2133 0.4244 0.0262 D-lactate:Quinone Oxidoreductase
dmsA b0894 3.0559 0.0473 dimethyl sulfoxide reductase, chain A
dnaC b4361 0.6833 0.0209 chromosome replication; initiation and chain elongation
dnaN b3701 0.4388 0.0203 DNA polymerase III, beta-subunit
dos b1489 0.4681 0.0009 heme-regulated phosphodiesterase monomer
dpiB b0619 0.6938 0.0436 DpiB
dppA b3544 2.6873 0.0270 dipeptide ABC transporter
dusB b3260 0.1200 0.0055 tRNA dihydrouridine synthase
ecfL b3095 1.4210 0.0186 putative integral membrane protein with possible extracytoplasmic function
eco b2209 0.5356 0.0195 ecotin monomer; serine protease inhibitor
efp b4147 1.6592 0.0497 elongation factor P (EF-P)
emrD b3673 0.6508 0.0203 EmrD multidrug MFS transporter
eutD b2458 0.4733 0.0002 putative phosphate acetyltransferase, ethanolamine utilization
eutK b2438 0.4006 0.0142 hypothetical protein
exbB b3006 3.7552 0.0314 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins
exbD b3005 3.8008 0.0007 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins
fadL b2344 0.1834 0.0089 transport of long-chain fatty acids; sensitivity to phage T2
fbaB b2097 0.1653 0.0131 fructose bisphosphate aldolase monomer
fbp b4232 0.5580 0.0352 fructose 1,6 bisphosphatase monomer
fdx b2525 0.5482 0.0090 oxidized ferredoxin
fecB b4290 8.6991 0.0075 ferric dicitrate uptake system
fepD b0590 8.7158 0.0041 Ferric Enterobactin Transport System
fhuF b4367 4.4704 0.0311 acts in reduction of ferrioxamine B iron
fimC b4316 0.4695 0.0364 periplasmic chaperone, required for type 1 fimbriae
fimI b4315 0.4942 0.0141 fimbrial protein
flgJ b1081 3.8116 0.0170 FlgJ
flgK b1082 2.4424 0.0026 flagellar biosynthesis, hook-filament junction protein 1
fliM b1945 19.0270 0.0382
flagellar motor switch protein FliM; component of motor switch and energizing,
enabling rotation and determining its direction
fliQ b1949 8.8017 0.0425 flagellar biosynthesis protein FliQ
fliS b1925 9.2416 0.0232 flagellar biosynthesis protein FliS
fnr b1334 0.4432 0.0445 FNR transcriptional dual regulator
folD b0529 0.6351 0.0380
methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase /
methylenetetrahydrofolate dehydrogenase-(NADP+)
folK b0142 0.7061 0.0168 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase
folP b3177 0.3301 0.0096 dihydropteroate synthase
fpr b3924 1.3795 0.0274 flavodoxin NADP+ reductase
frdC b4152 2.7825 0.0397 fumarate reductase membrane protein
frlC b3373 0.5854 0.0174 fructoselysine and psicoselysine degradation
ftnA b1905 0.2818 0.0240 cytoplasmic ferritin, an iron storage protein)
ftsY b3464 1.3557 0.0167 SRP receptor
fucR b2805 1.7855 0.0380 FucR transcriptional activator
gadC b1492 0.3529 0.0477 XasA GABA APC transporter
galK b0757 0.5451 0.0491 Galactokinase
galR b2837 4.4098 0.0315 GalR-galactose
garK b3124 2.4698 0.0490 glycerate kinase I
gatD b2091 0.7554 0.0174 galactitol-1-phosphate dehydrogenase
gatY b2096 1.6866 0.0090 tagatose-1,6-bisphosphate aldolase 2
gcvH b2904 4.5473 0.0091 dihydrolipoyl-GcvH-protein
gcvT b2905 5.7601 0.0109 Aminomethyltransferase
82

APPENDIX I
gene blattner ratio p-value Function
A/B
gidB b3740 0.4856 0.0237 protein with a methyltransferase fold; possible role in chromosome replication
glcB b2976 0.6190 0.0452 malate synthase G
glmU b3730 1.6033 0.0469
N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate
acetyltransferase
glnH b0811 0.4352 0.0140 glutamine ABC transporter
gloB b0212 3.5188 0.0181 glyoxalase II
glpA b2241 1.9558 0.0214 glycerol-3-phosphate-dehydrogenase, anaerobic
gnsA b0991 4.7811 0.0050 YmcE
gntY b3414 0.5552 0.0419
predicted membrane-bound protein that is involved in high-affinity gluconate
transport
gspF b3327 1.6223 0.0056 putative protein secretion protein for export
gssA b2988 0.6968 0.0024 glutathionylspermidine synthetase / glutathionylspermidine amidase
guaA b2507 0.3639 0.0040 GMP synthase / GMP synthase (ammonia dependent)
gutQ b2708 2.2100 0.0352 protein with a sugar isomerase domain
hcaR b2537 0.7416 0.0402 HcaR transcriptional activator
hchA b1967 0.5528 0.0128 heat shock protein (Hsp) 31
hdhA b1619 2.5786 0.0216 7-alpha-hydroxysteroid dehydrogenase
helD b0962 0.5183 0.0290 DNA helicase IV
hepA b0059 0.3051 0.0412 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor
hflD b1132 0.3468 0.0048 membrane protein in operon with purB
hisC b2021 0.3221 0.0144 histidine-phosphate aminotransferase
hisD b2020 0.3608 0.0326 histidinal dehydrogenase / histidinol dehydrogenase
hisF b2025 0.6098 0.0314 imidazole glycerol phosphate synthase, HisF subunit
hns b1237 2.0288 0.0189 H-NS transcriptional dual regulator
holB b1099 0.7617 0.0287 DNA polymerase III, delta prime subunit
holD b4372 0.6747 0.0191 DNA polymerase III, psi subunit
holE b1842 0.5413 0.0155 DNA polymerase III, theta subunit
hslR b3400 0.4968 0.0137 heat shock protein Hsp15
hslU b3931 0.6792 0.0167 ATPase component of the HslVU protease
hslV b3932 0.6182 0.0469 peptidase component of the HslVU protease
hupA b4000 2.5232 0.0026 DNA-binding protein HU-alpha (HU-2)
hybO b2997 1.6217 0.0148 Hyb0
hycF b2720 0.4798 0.0143 formate hydrogenlyase complex
hypB b2727 1.4176 0.0207
guanine-nucleotide binding protein, functions as nickel donor for large subunit of
hydrogenase 3
hypC b2728 1.8523 0.0443 pleiotrophic effects on 3 hydrogenase isozymes
ibpA b3687 0.2895 0.0047 small heat shock protein IbpA
intA b2622 0.3133 0.0364 prophage CP4-57 integrase
intB b4271 1.5659 0.0241 prophage P4 integrase
intD b0537 2.1932 0.0097 prophage DLP12 integrase
iscA b2528 0.4418 0.0028 iron-sulfur cluster assembly protein
iscS b2530 0.3669 0.0026 cysteine desulfurase monomer
iscU b2529 0.4176 0.0013 scaffold protein involved in iron-sulfur cluster assembly
iscX b2524 0.6472 0.0250 protein with possible role in iron-sulfur cluster biogenesis
ispB b3187 0.6536 0.0347 octaprenyl diphosphate synthase
ispE b1208 0.4973 0.0499 4-diphosphocytidyl-2C-methyl-D-erythritol kinase
ivy b0220 0.4552 0.0028 YkfE
kch b1250 6.5771 0.0023 potassium VIC channel
kdgK b3526 2.9680 0.0423 2-dehydro-3-deoxygluconokinase
kdgR b1827 1.3175 0.0072 putative ICLR-type transcriptional regulator
kduD b2842 1.7440 0.0252 2-deoxy-D-gluconate 3-dehydrogenase
kduI b2843 1.5739 0.0360 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase
lepA b2569 0.4578 0.0106 GTP-binding elongation factor, may be inner membrane protein
leuA b0074 0.4198 0.0265 2-isopropylmalate synthase
leuC b0072 0.7154 0.0284 isopropylmalate isomerase
lspA b0027 0.5391 0.0442 prolipoprotein signal peptidase (SPase II)
lsrB b1516 0.5142 0.0288 YneA
83

APPENDIX I
gene blattner ratio p-value Function
A/B
malP b3417 5.2986 0.0307 maltodextrin phosphorylase monomer
malX b1621 0.4991 0.0496 EIIBCMalX
manA b1613 0.5555 0.0306 mannose-6-phosphate isomerase
mcrB b4346 2.7084 0.0157 MrcB subunit of 5-methylcytosine restriction system
menD b2264 0.7410 0.0203
putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate
decarboxylase
metA b4013 0.2076 0.0209 homoserine O-succinyltransferase
metG b2114 0.2830 0.0418 methionyl-tRNA synthetase
mgsA b0963 2.1172 0.0134 methylglyoxal synthase
mhpB b0348 0.4036 0.0047 3-(2,3-dihydroxyphenyl)propionate dioxygenase
mhpC b0349 0.4068 0.0080 2-hydroxy-6-ketonona-2,4-dienedioate hydrolase
mhpD b0350 0.4575 0.0138 2-keto-4-pentenoate hydratase
mhpE b0352 0.4565 0.0376 4-hydroxy-2-ketovalerate aldolase
mhpF b0351 0.3457 0.0134 acetaldehyde dehydrogenase 2
mhpT b0353 0.5565 0.0186 MhpT MFS transporter
miaB b0661 0.2939 0.0013 hypothetical protein
mltA b2813 0.6359 0.0136 membrane-bound lytic murein transglycosylase A
mltB b2701 0.4337 0.0025 membrane-bound lytic murein transglycosylase B
mltD b0211 0.3196 0.0035 membrane-bound lytic murein transglycosylase D
motB b1889 6.4289 0.0485 MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall
mppA b1329 4.3955 0.0068 periplasmic murein tripeptide binding protein
mrcA b3396 0.3396 0.0054 peptidoglycan synthetase; penicillin-binding protein 1A
msrB b1778 0.3349 0.0304
methionine sulfoxide reductase B / protein-methionine-S-oxide reductase /
methionine sulfoxide reductase
mtn b0159 0.5806 0.0469 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase monomer
mtr b3161 0.7656 0.0287 Mtr tryptophan ArAAP transporter
mug b3068 0.4290 0.0023 stationary phase mismatch/uracil DNA glycosylase
mukE b0923 1.6643 0.0073 protein involved in chromosome partitioning
murP b2429 2.5027 0.0181 MurP
mutH b2831 0.5136 0.0241 MutHLS complex, methyl-directed mismatch repair
mutS b2733 0.4971 0.0195 MutHLS complex, methyl-directed mismatch repair
mutY b2961 0.6703 0.0423 adenine glycosylase; G.C --> T.A transversions
nadE b1740 1.4861 0.0474 NAD+ synthase, glutamine dependent / NAD+ synthase, NH3-dependent
napD b2207 9.3356 0.0037 NapD protein
napF b2208 9.2025 0.0031 ferredoxin-type protein
nfi b3998 0.5850 0.0224 endonuclease V (deoxyinosine 3'endoduclease)
nfrA b0568 0.3170 0.0069 bacteriophage N4 receptor, outer membrane protein
nfrB b0569 0.2637 0.0048 bacteriophage N4 receptor, outer membrane protein
nlpB b2477 0.6974 0.0180 lipoprotein-34
nlpD b2742 0.5841 0.0371 NlpD putative outer membrane lipoprotein
nmpC b0553 5.5836 0.0159 outer membrane porin protein; locus of qsr prophage
nrfA b4070 34.1708 0.0111 cytochrome C552
nudC b3996 0.7120 0.0330 putative NAD+ diphosphatase
nupG b2964 3.7936 0.0032 NupG nucleoside MFS transporter
nusB b0416 0.4621 0.0462 transcription termination; L factor
obgE b3183 0.6444 0.0244 GTPase involved in chromosomal partitioning
ogrK b2082 0.7617 0.0475 OgrK transcriptional regulator
ompN b1377 0.6915 0.0136 putative outer membrane protein
ompT b0565 3.4380 0.0014 outer membrane protein 3b (a), protease VII
osmB b1283 0.2709 0.0014 OsmB osmotically inducible lipoprotein
paaB b1389 0.3814 0.0222 putative subunit of phenylacetate-CoA oxygenase
paaJ b1397 0.4901 0.0419 putative beta-keto-thiolase of phenylacetate degradation
paaX b1399 0.6229 0.0058 PaaX transcriptional regulator
paaY b1400 0.4875 0.0220 putative transferase
pabA b3360 0.4832 0.0070 para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate synthase
pcnB b0143 0.6447 0.0227 poly(A) polymerase I
pflA b0902 0.5773 0.0124 pyruvate formate-lyase activating enzyme
84

APPENDIX I
gene blattner ratio p-value Function
A/B
pgl b0767 3.8773 0.0103 6-phosphogluconolactonase
phnK b4097 1.4585 0.0490 PhnK
pldA b3821 0.4974 0.0146 phospholipase A1
pldB b3825 0.5697 0.0157 lysophospholipase L(2)
ppsA b1702 0.4317 0.0283 phosphoenolpyruvate synthase
prmB b2330 0.5513 0.0253 protein-(glutamine-N5) methyltransferase
prmC b1212 0.4252 0.0039 protein-(glutamine-N5) methyltransferase
proP b4111 1.6762 0.0033 ProP proline/betaine MFS transporter
proQ b1831 0.8210 0.0472 protein that affects osmoregulation of ProP transporter
prsA b1207 0.6550 0.0030 ribose-phosphate diphosphokinase
pstS b3728 0.7215 0.0114 phosphate ABC transporter
ptrA b2821 0.2729 0.0069 protease III
ptsG b1101 0.6082 0.0302 EIIGlc
ptsP b2829 1.9101 0.0202 PTS system, enzyme I, transcriptional regulator (with NPR and NTR proteins)
purB b1131 0.3871 0.0008
5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase /
adenylosuccinate lyase
purU b1232 1.8188 0.0292 formyltetrahydrofolate deformylase
puuD b1298 0.6260 0.0406 probable amidotransferase subunit
pyrF b1281 0.5616 0.0387 orotidine-5'-phosphate-decarboxylase
pyrI b4244 1.8211 0.0362 aspartate carbamoyltransferase, PyrI subunit
rbn b3886 2.4777 0.0058 tRNA processing exoribonuclease BN
rbsC b3750 0.4430 0.0301 ribose ABC transporter
rbsD b3748 0.3530 0.0401 D-ribose utilization
rcsD b2216 0.8244 0.0460 putative 2-component sensor protein
recB b2820 0.2328 0.0023
RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit,
ssDNA endonuclease
recD b2819 0.4974 0.0325
DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA
endonuclease
recJ b2892 0.6227 0.0299 RecJ
recN b2616 0.5404 0.0348 protein used in recombination and DNA repair
recT b1349 0.6541 0.0142 recombinase, DNA renaturation
relE b1563 0.9013 0.0436 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome
rep b3778 0.5157 0.0285 rep helicase, a single-stranded DNA dependent ATPase
rfaC b3621 1.7935 0.0235 lipopolysaccharide core biosynthesis; heptosyl transferase I
rfaL b3622 1.6061 0.0258 lipopolysaccharide core biosynthesis; O-antigen ligase
rfe b3784 3.5759 0.0000 undecaprenyl-phosphate &alpha;-N-acetylglucosaminyl transferase
ribD b0414 0.6197 0.0299 pyrimidine reductase / pyrimidine deaminase
rihA b0651 1.3869 0.0492 ribonucleoside hydrolase 1 (pyrimidine-specific)
rimI b4373 0.6086 0.0452
acetylates N-terminal alanine of 30S ribosomal subunit protein S18 / ribosomalprotein-alanine
N-acetyltransferase
rlmB b4180 2.2471 0.0024 23S rRNA methyltransferase monomer
rluA b0058 0.1900 0.0293 23S rRNA and tRNA pseudouridine synthase
rnhB b0183 0.6624 0.0303 RNAse HII, degrades RNA of DNA-RNA hybrids
rnk b0610 0.5074 0.0130 regulator of nucleoside diphosphate kinase
rplP b3313 1.4719 0.0001 50S ribosomal subunit protein L16
rplV b3315 1.9726 0.0393 50S ribosomal subunit protein L22
rpoE b2573 0.7058 0.0079 sigmaE
rpsE b3303 1.4454 0.0390 30S ribosomal subunit protein S5
rsmB b3289 0.6882 0.0279 16S rRNA m5C967 methyltransferase
ruvA b1861 0.5638 0.0057 branch migration of Holliday structures; repair
sbcD b0398 0.6260 0.0422 ATP-dependent dsDNA exonuclease
sdaA b1814 0.5675 0.0065 L-threonine deaminase I / L-serine ammonia-lyase
sdaB b2797 0.2485 0.0242 L-threonine deaminase II / L-serine deaminase 2
sdaC b2796 0.2639 0.0054 SdaC serine STP transporter
selA b3591 2.5277 0.0308 selenocysteine synthase monomer
seqA b0687 1.4974 0.0332 SeqA, negative modulator of initiation of replication
setB b2170 0.5500 0.0214 YeiO MFS transporter
setC b3659 1.3277 0.0467 YicK MFS Transporter
85

APPENDIX I
gene blattner ratio p-value Function
A/B
shiA b1981 2.3089 0.0071 ShiA shikimate MFS transporter
smtA b0921 1.8104 0.0156 S-adenosylmethionine-dependent methyltransferase
sodA b3908 2.2699 0.0356 superoxide dismutase (Mn)
soxS b4062 4.6091 0.0238 SoxS transcriptional activator
speC b2965 0.2222 0.0023 ornithine decarboxylase, biosynthetic
speD b0120 0.2969 0.0050 adenosylmethionine decarboxylase, proenzyme
speE b0121 0.2562 0.0023 spermidine synthase
speG b1584 0.7323 0.0129 spermidine acetyltransferase
spr b2175 1.9225 0.0066 putative lipoprotein
srmB b2576 0.5873 0.0118 SrmB, DEAD-box RNA helicase
ssuD b0935 0.5883 0.0008 alkanesulfonate monooxygenase
sufA b1684 2.7742 0.0160 scaffold protein for iron-sulfur cluster assembly
sufB b1683 2.7088 0.0255 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex
sulA b0958 0.5115 0.0067 suppressor of lon; inhibits cell division and ftsZ ring formation
tdcB b3117 5.9813 0.0139 threonine dehydratase (catabolic)
thiG b3991 0.8279 0.0346 ThiG
thiI b0423 0.7960 0.0033 ThiI protein
thrC b0004 4.5667 0.0131 threonine synthase
tldD b3244 1.4990 0.0262
protease involved in Microcin B17 maturation and in sensitivity to the DNA gyrase
inhibitor LetD
tolC b3035 0.7151 0.0164 TolC outer membrane channel
tra5-5 b2089 1.7159 0.0251 IS3 element protein InsF
trpA b1260 1.4667 0.0156 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase
trpS b3384 1.4491 0.0196 tryptophanyl-tRNA synthetase
tsgA b3364 0.4974 0.0401 YhfC MFS transporter
tsr b4355 2.1465 0.0180 MCP-I
ttk b3641 0.6578 0.0296 Ttk transcriptional regulator
typA b3871 0.5679 0.0271 protein possibly involved in LPS biosynthesis and host colonization
tyrR b1323 1.8233 0.0206 TyrR-Phenylalanine transcriptional repressor
ubiX b2311 0.4366 0.0267 3-octaprenyl-4-hydroxybenzoate decarboxylase 2
udk b2066 0.6047 0.0102 uridine kinase / cytidine kinase
udp b3831 2.1987 0.0472 uridine phosphorylase
ugpC b3450 1.9691 0.0027 glycerol-3-P ABC transporter / tranport
ulaB b4194 0.8937 0.0050 eiisga
ulaD b4196 0.5940 0.0354 3-keto-L-gulonate 6-phosphate decarboxylase
ulaF b4198 0.7134 0.0268 L-ribulose 5-phosphate 4-epimerase
uvrC b1913 2.5330 0.0055 excinuclease ABC, subunit C; repair of UV damage to DNA
wbbK b2032 1.1787 0.0066 putative transferase
wrbA b1004 1.8606 0.0149 WrbA
wzxE b3792 1.6853 0.0279 lipid III flippase
xthA b1749 0.4507 0.0112 exonuclease III
xylR b3569 2.2681 0.0011 XylR-Xylose transcriptional activator
yafK b0224 0.6195 0.0023
conserved protein; in enteroaggregative E. coli, YafK is required for development of
biofilms
yagN b0280 0.6952 0.0146 hypothetical protein
yagT b0286 1.7860 0.0035 putative oxidoreductase, Fe-S subunit
yagV b0289 1.9412 0.0102 conserved hypothetical protein
yaiV b0375 0.5910 0.0075 putative outer membrane protein, cAMP-binding
ybaD b0413 0.6397 0.0464 conserved protein
ybaE b0445 2.2337 0.0166 hypothetical protein
ybaN b0468 2.0803 0.0260 hypothetical protein
ybeB b0637 0.7033 0.0126 conserved hypothetical protein
ybeD b0631 0.2523 0.0005 conserved hypothetical protein
ybeH b0625 0.5572 0.0439 hypothetical protein
ybfD b0706 0.3122 0.0215 conserved protein
ybhH b0769 0.4829 0.0154 conserved hypothetical protein
ybiJ b0802 0.4837 0.0237 conserved hypothetical protein
86

APPENDIX I
gene blattner ratio p-value Function
A/B
ybiM b0806 0.3863 0.0240 conserved hypothetical protein
ybjI b0844 1.9181 0.0193 conserved protein with a phophatase-like domain
ycaM b0899 0.3822 0.0104 YcaM APC amino acid transporter
ycaO b0905 0.5753 0.0151 conserved hypothetical protein
ycbJ b0919 0.5051 0.0363 conserved hypothetical protein
ycbX b0947 2.2239 0.0044 putative Fe-S protein
yccK b0969 0.5751 0.0496 putative sulfite reductase (EC 1.8.-.-)
yccS b0960 0.5639 0.0338 hypothetical protein
yccV b0966 0.5070 0.0014 hemimethylated DNA-binding protein
yceP b1060 2.4225 0.0246 conserved hypothetical protein
ycfD b1128 0.5605 0.0362 putative enzyme
ycgK b1178 1.8393 0.0309 hypothetical protein
ycgV b1202 0.3754 0.0210 putative adhesion and penetration protein
ychE b1242 0.6093 0.0360 putative membrane protein
yciB b1254 0.5700 0.0437 hypothetical protein
yciC b1255 0.6624 0.0484 hypothetical protein
yciS b1279 0.6175 0.0026 conserved hypothetical protein
ydbK b1378 0.6806 0.0083 putative pyruvate synthase
ydcF b1414 0.2689 0.0238 conserved hypothetical protein
ydcP b1435 0.2487 0.0276 putative collagenase
ydgK b1626 0.4982 0.0446 putative oxidoreductase
ydhF b1647 2.1014 0.0131 putative oxidoreductase, NAD(P)-linked
ydiA b1703 0.4022 0.0020 conserved protein
ydiH b1685 0.0411 0.0002 hypothetical protein
ydiI b1686 0.6335 0.0373 conserved hypothetical protein
ydiO b1695 0.4899 0.0220 putative acyl-CoA dehydrogenase
ydiU b1706 0.7123 0.0018 conserved protein
ydiY b1722 0.2336 0.0097 conserved hypothetical protein
yeaC b1777 0.2907 0.0234 conserved hypothetical protein
yeaD b1780 0.8053 0.0485 conserved hypothetical protein
yeaK b1787 0.4458 0.0020 conserved hypothetical protein
yeaL b1789 0.4155 0.0189 hypothetical protein
yeaT b1799 3.0720 0.0141 putative transcriptional regulator LYSR-type
yebE b1846 0.6028 0.0479 conserved hypothetical protein
yebR b1832 3.1582 0.0092 conserved hypothetical protein
yebU b1835 0.5220 0.0183 hypothetical protein
yecN b1869 0.3001 0.0013 putative membrane protein
yecP b1871 0.4509 0.0069 putative enzyme
yedE b1929 0.5180 0.0037 putative transport system permease protein
yedF b1930 0.6433 0.0118 conserved hypothetical protein; might bind RNA
yedL b1932 0.7679 0.0407 putative acyl-CoA N-acyltransferase
yeeZ b2016 0.7112 0.0403 putative enzyme of sugar metabolism
yehU b2126 1.3634 0.0204 putative 2-component sensor protein
yeiC b2166 0.5199 0.0069 putative kinase
yeiH b2158 0.5810 0.0329 putative membrane protein
yeiN b2165 0.6223 0.0224 conserved protein
yeiP b2171 0.4453 0.0110 putative elongation factor
yeiQ b2172 1.6577 0.0089 putative oxidoreductase
yejE b2179 1.2788 0.0062 YejA/YejB/YejE/YejF ABC transporter
yejM b2188 0.6919 0.0221 putative sulfatase
yfbV b2295 0.1983 0.0066 conserved hypothetical protein
yfcE b2300 0.5028 0.0272 putative metallo-dependent phosphatase
yfeC b2398 3.6524 0.0085 hypothetical protein
yfeD b2399 4.6195 0.0073 hypothetical protein
yfeU b2428 2.5545 0.0178 putative regulator
yfeZ b2433 0.8288 0.0423 putative membrane protein
87

APPENDIX I
gene blattner ratio p-value Function
A/B
yfgD b2495 1.3436 0.0280 putative oxidoreductase
yfhQ b2532 0.7396 0.0351 putative ATP synthase beta subunit
yfiD b2579 2.1520 0.0130 stress-induced alternate pyruvate formate-lyase subunit
yfiF b2581 0.7263 0.0437 hypothetical protein
yfjD b4461 0.6709 0.0382 putative membrane protein, hemolysin-like
yfjF b2618 0.8164 0.0194 conserved hypothetical protein
yfjK b2627 1.8469 0.0067 hypothetical protein
yfjW b2642 2.9798 0.0025 hypothetical protein
ygaH b2683 2.3469 0.0029 putative transport protein
ygaW b2670 0.2097 0.0395 putative membrane protein
ygbT b2755 1.5803 0.0209 conserved hypothetical protein
ygcE b2776 0.6769 0.0395 putative kinase
ygcO b2767 2.1793 0.0250 putative ferredoxin
ygeY b2872 0.3333 0.0367 putative deacetylase
yggE b2922 0.7072 0.0229 putative actin-like protein
yghU b2989 0.6145 0.0305
glutathione transferase-like protein possibly involved in glutathionylspermidine
metabolism
ygiR b3015 0.1712 0.0020 conserved protein
yhaI b3104 1.8901 0.0167 putative cytochrome
yhbG b3201 0.7306 0.0489 YhbG/YhbN ABC transporter
yhbW b3160 2.5842 0.0205 putative enzyme
yhcE b3217 1.8476 0.0321 hypothetical protein
yhcH b3221 1.4134 0.0166 conserved hypothetical protein; gene is in sialic acid catabolic operon
yhdE b3248 1.4099 0.0332 conserved hypothetical protein
yhdN b3293 0.3490 0.0092 conserved hypothetical protein
yhfG b3362 2.0525 0.0319 conserved hypothetical protein
yhfT b3377 0.5275 0.0096 putative transport protein
yhfX b3381 0.8420 0.0430 conserved protein
yhjK b3529 0.8141 0.0360 conserved protein
yhjR b3535 3.3058 0.0027 hypothetical protein
yhjV b3539 0.4101 0.0312 YhjV STP transporter
yiaJ b3574 0.4842 0.0009 YiaJ transcriptional repressor
yibG b3596 0.9825 0.0318 conserved hypothetical protein
yibI b3598 1.7891 0.0258 hypothetical protein
yidI b3677 3.0250 0.0389 hypothetical protein
yidZ b3711 0.5369 0.0092 putative transcriptional regulator LysR-type
yifE b3764 1.9633 0.0245 hypothetical protein
yifK b3795 2.3518 0.0138 YifK APC transporter
yjcG b4067 0.7076 0.0091 YjcG SSS transporter
yjcZ b4110 1.5987 0.0010 hypothetical protein
yjdF b4121 1.6223 0.0050 putative membrane protein
yjeI b4144 1.6231 0.0306 conserved protein
yjeO b4158 0.7234 0.0164 conserved hypothetical protein
yjgM b4256 1.3106 0.0028 putative acyltransferase
yjhB b4279 0.2981 0.0096 YjhB MFS transporter
yjhC b4280 0.3673 0.0052 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase
yjhP b4306 0.6759 0.0413 putative methyltransferase
yjhT b4310 0.4662 0.0446 putative enzyme contains galactose oxidase-like domain
yjiA b4352 1.7339 0.0199 P-loop guanosine triphosphatase
yjiG b4329 0.5318 0.0394 putative membrane protein
yjiT b4342 10.7703 0.0111 conserved protein
yjiX b4353 1.7994 0.0423 hypothetical protein
yjiY b4354 15.2032 0.0105 putative carbon starvation protein
yjjI b4380 1.3283 0.0003 conserved hypothetical protein
yjjK b4391 0.6653 0.0186 YjjK
yjjM b4357 2.3936 0.0179 hypothetical protein
88

APPENDIX I
gene blattner ratio p-value Function
A/B
ykiA b0392 1.7064 0.0390 hypothetical protein
ylaB b0457 1.5530 0.0301 conserved protein
yliC b0831 1.4983 0.0007 YliA/YliB/YliC/YliD ABC transporter
yliH b0836 0.1439 0.0035 putative receptor; induced in stationary phase
ymcD b0987 1.7643 0.0439 hypothetical protein
ymfE b1138 0.1571 0.0060 hypothetical protein
ymgA b1165 0.1361 0.0148 hypothetical protein
ymjA b1295 0.5853 0.0312 hypothetical protein
yoaA b1808 0.6334 0.0318 putative enzyme
yoaB b1809 0.5757 0.0165 conserved protein
yoaG b1796 2.4294 0.0346 hypothetical protein
ypfJ b2475 1.4938 0.0049 conserved protein
yphF b2548 0.4557 0.0415 YphD/YphE/YphF ABC transporter
yqaB b2690 0.6835 0.0377 putative phosphoglucomutase that contains a phophatase-like domain
yqcD b2794 0.6211 0.0481 conserved hypothetical protein
yqeH b2846 0.8070 0.0380 conserved protein
yqgE b2948 0.6944 0.0062 conserved protein
yqiI b3048 0.9092 0.0276 conserved protein
yraN b3148 0.6869 0.0193 conserved hypothetical protein
yrbA b3190 0.6820 0.0270 hypothetical protein
yrfG b3399 0.4865 0.0216 putative hydrolase with a phophatase-like domain
ytfL b4218 0.4845 0.0258 putative transport protein
ytfN b4221 0.7948 0.0361 conserved protein
ytjB b4387 0.7147 0.0043 membrane protein
zwf b1852 1.3295 0.0490 glucose 6-phosphate-1-dehydrogenase
b3837 0.6879 0.0253
b0322 0.8183 0.0423
b2391 0.5201 0.0434
b3948 0.7383 0.0244
Supplementary table - II: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Transition to stationary
phase
gene blattner ratio p-value Function
A/B
aat b0885 1.5610 0.0387 leucyl, phenylalanyl-tRNA-protein transferase
abrB b0715 0.4795 0.0092 putative transport protein; mutation affects aidB expression
ampH b0376 0.6790 0.0417 putative enzyme
aphA b4055 0.4046 0.0303 acid phosphatase/phosphotransferase
apt b0469 0.8461 0.0496 adenine phosphoribosyltransferase
arcA b4401 1.1326 0.0030 ArcA-Phosphorylated transcriptional dual regulator
argB b3959 0.7534 0.0093 N-acetylglutamate kinase
asr b1597 0.6179 0.0119 acid shock protein
astD b1746 0.7371 0.0469 succinylglutamic semialdehyde dehydrogenase
btuF b0158 0.5590 0.0133 periplasmic vitamin B12 binding protein
chaA b1216 1.5703 0.0273 ChaA calcium CaCA transporter
cls b1249 1.8397 0.0135 cardiolipin synthase
csgF b1038 2.6963 0.0232 curli assembly component
csiD b2659 0.7824 0.0300 hypothetical protein; gene expression is induced by carbon starvation
cyaY b3807 1.1582 0.0458 iron-binding frataxin homolog
dctR b3507 3.5342 0.0231 protein involved in metabolism of C4-dicarboxylates
ddlA b0381 1.3455 0.0452 D-alanine-D-alanine ligase A
ddpB b1486 0.7867 0.0321 YddR
89

APPENDIX I
gene blattner ratio p-value Function
A/B
dicA b1570 1.5452 0.0082 DicA transcriptional regulator
dmsA b0894 1.3291 0.0290 dimethyl sulfoxide reductase, chain A
dnaQ b0215 1.5304 0.0205 DNA polymerase III, epsilon subunit
dpiA b0620 0.7592 0.0156 CitB transcriptional regulator
dsbA b3860 1.3750 0.0408 disulfide oxidoreductase
dusB b3260 0.3858 0.0382 tRNA dihydrouridine synthase
entA b0596 4.4954 0.0362 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
envY b0566 1.7235 0.0175 EnvY transcriptional activator
eutL b2439 0.6545 0.0455 hypothetical protein
eutM b2457 0.6548 0.0414 putative detox protein, ethanolamine utilization
exuT b3093 0.7604 0.0156 ExuT hexuronate MFS transporter
fliK b1943 0.7529 0.0246 flagellar hook-length control protein FliK
frlC b3372 1.6858 0.0348 fructoselysine and psicoselysine degradation
fruB b2169 3.2743 0.0351 EIIFru
fruK b2168 1.4091 0.0251 1-phosphofructokinase monomer
fsaA b0825 1.2606 0.0464 Fsa
gadC b1492 22.0335 0.0374 XasA GABA APC transporter
gadE b3512 14.1482 0.0012 GadE transcriptional activator
gadW b3515 5.4482 0.0241 GadWtranscriptional repressor
gatR_1 b2087 1.2194 0.0338
negative DNA-binding transcriptional regulator of galactitol metabolism, subunit of
GatR transcriptional repressor
glpF b3927 0.4719 0.0301 GlpF - glycerol MIP channel
hchA b1967 1.3473 0.0385 heat shock protein (Hsp) 31
hdeD b3511 8.1344 0.0428 protein involved in acid resistance
hemY b3802 0.6097 0.0422 a late step of protoheme IX synthesis
hisC b2021 0.3625 0.0199 histidine-phosphate aminotransferase
hisD b2020 0.6774 0.0110 histidinal dehydrogenase / histidinol dehydrogenase
htrA b0161 0.3838 0.0164 DegP
hyi b0508 0.5405 0.0469 hydroxypyruvate isomerase
hypB b2727 1.4330 0.0072
guanine-nucleotide binding protein, functions as nickel donor for large subunit of
hydrogenase 3
inaA b2237 1.1707 0.0448 pH-inducible protein involved in stress response
lplA b4386 0.5894 0.0042 lipoyl-protein ligase A
mcrB b4346 3.7015 0.0154 MrcB subunit of 5-methylcytosine restriction system
mdtG b1053 2.7845 0.0406 YceE drug MFS transporter
mraZ b0081 0.6347 0.0132
protein encoded by an operon involved in formation of the cell envelope and cell
division
mtlA b3599 1.6503 0.0315 EIIMtl
nanA b3225 1.2989 0.0251 N-acetylneuraminate lyase
nikD b3479 1.4297 0.0492 nickel ABC transporter
norR b2709 1.2152 0.0376 transcriptional regulator of the anaerobic response to reactive nitrogen species
nudE b3397 1.3014 0.0258 ADP-ribose diphosphatase
obgE b3183 0.6501 0.0090 GTPase involved in chromosomal partitioning
ogrK b2082 1.3568 0.0499 OgrK transcriptional regulator
ompF b0929 0.4480 0.0442 outer membrane porin OmpF
orn b4162 1.8637 0.0289 oligoribonuclease monomer
pdhR b0113 0.7167 0.0089 PdhR-pyruvate
polB b0060 1.7041 0.0257 DNA polymerase II
proW b2678 0.8448 0.0427 proline ABC transporter
prpD b0334 0.4135 0.0183 2-methylcitrate dehydratase
purC b2476 1.4330 0.0212 phosphoribosylaminoimidazole-succinocarboxamide synthase
purH b4006 1.1431 0.0481 AICAR transformylase / IMP cyclohydrolase
puuA b1297 3.7881 0.0276 putative glutamine synthetase (EC 6.3.1.2)
qor b4051 1.4220 0.0378 quinone oxidoreductase
qseB b3025 0.6844 0.0099 putative 2-component transcriptional regulator
rbsA b3749 0.3311 0.0281 ribose ABC transporter
rbsC b3750 0.2093 0.0265 ribose ABC transporter
90

APPENDIX I
gene blattner ratio p-value Function
A/B
rbsD b3748 0.2205 0.0061 D-ribose utilization
rem b1561 1.8185 0.0457 hypothetical protein
rhaS b3905 0.7904 0.0441 RhaS transcriptional activator
rhaT b3907 1.2690 0.0108 rhamnose RhaT transporter
rihB b2162 1.7911 0.0339 ribonuceloside hydrolase 2 (pyrimidine-specific)
rof b0189 1.8022 0.0294 Rho-binding antiterminator
rplT b1716 1.7302 0.0078 50S ribosomal subunit protein L20, and regulator
rpsQ b3311 0.5968 0.0243 30S ribosomal subunit protein S17
rrmA b1822 1.4094 0.0108 23S rRNA m1G745 methyltransferase
rseA b2572 0.5825 0.0476 anti-sigma factor that inhibits sigmaE
rseB b2571 0.6315 0.0494
negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA to
sigmaE
rseC b2570 0.7732 0.0251 protein involved in reduction of the SoxR iron-sulfur cluster
ruvB b1860 0.6261 0.0271 branch migration of Holliday structures; repair helicase
sapB b1293 1.8571 0.0076 peptide uptake ABC transporter
setC b3659 2.8429 0.0171 YicK MFS Transporter
slp b3506 6.4852 0.0424 outer membrane protein induced after carbon starvation
sohB b1272 1.1729 0.0025 putative protease
sufB b1683 2.3472 0.0139 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex
sufC b1682 2.0037 0.0305 ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex
sufS b1680 2.0407 0.0269 L-selenocysteine lyase (and L-cysteine desulfurase) monomer
suhB b2533 0.4978 0.0185 inositol monophosphatase
thiI b0423 1.5919 0.0034 ThiI protein
thiL b0417 1.2963 0.0475 thiamine phosphate kinase
trg b1421 0.6236 0.0473 MCP-III
ugpE b3451 1.9577 0.0269 glycerol-3-P ABC transporter / tranport
upp b2498 1.5767 0.0345 uracil phosphoribosyltransferase
uvrB b0779 1.9383 0.0152 DNA repair; excision nuclease subunit B
uvrY b1914 1.6618 0.0311 UvrY- Phosphorylated transcriptional regulator
xapR b2405 1.7821 0.0157 XapR transcriptional activator
yafU b0218 0.6355 0.0350 conserved hypothetical protein
ybaP b0482 1.8267 0.0130 putative ligase
ybaT b0486 2.9386 0.0011 YbaT APC transporter
ybbA b0495 0.4183 0.0451 YbbA/YbbP ABC transporter
ybcH b0567 1.8118 0.0067 conserved hypothetical protein
ybcM b0546 1.8831 0.0318 putative ARAC-type regulatory protein
ybcN b0547 0.6267 0.0456 hypothetical protein
ybeF b0629 0.7562 0.0180 putative transcriptional regulator LYSR-type
ybgA b0707 1.6805 0.0206 conserved protein
ybgH b0709 0.5997 0.0112 YbgH peptide POT Transporter
ybhF b0794 1.3972 0.0497 YbhF/YbhR/YbhS ABC transporter
ybiH b0796 1.5534 0.0028 hypothetical protein
ycbB b0925 1.9207 0.0065 putative amidase
yceP b1060 2.1087 0.0460 conserved hypothetical protein
ycfR b1112 1.2233 0.0181 conserved hypothetical protein
ycgJ b1177 1.4740 0.0088 hypothetical protein
ycgX b1161 1.4886 0.0341 hypothetical protein
ydeI b1536 4.9897 0.0403 conserved hypothetical protein
ydeU b1509 0.6562 0.0419 conserved protein
ydhS b1668 2.5603 0.0370 putative oxidoreductase
ydjK b1775 1.7556 0.0281 YdjK
yebW b1837 1.9443 0.0270 hypothetical protein
yedR b1963 1.6135 0.0135 hypothetical protein
yedW b1969 2.2168 0.0108 putative 2-component transcriptional response regulator
yeeO b1985 1.1961 0.0398 YeeO MATE Transporter
yfbN b2273 0.5362 0.0182 conserved hypothetical protein
yfeC b2398 1.9649 0.0396 hypothetical protein
91

APPENDIX I
gene blattner ratio p-value Function
A/B
yfgH b2505 1.5726 0.0020 putative outer membrane lipoprotein
yfiE b2577 1.2464 0.0464 putative transcriptional regulator LYSR-type
yfjP b2632 0.7520 0.0345 putative GTP-binding protein
yfjS b2636 1.7083 0.0099 inner membrane lipoprotein YfjS
ygcU b2772 1.4215 0.0019 hypothetical protein
ygdQ b2832 0.6766 0.0377 putative transport protein
ygjG b3073 2.1750 0.0476 putrescine:2-oxoglutaric acid aminotransferase
yhdX b3269 0.7823 0.0343 YhdW/YhdX/YhdY/YhdZ ABC transporter
yibA b3594 5.6513 0.0212 putative lyase
yieP b3755 1.9745 0.0106 hypothetical protein
yjgG b4247 0.5699 0.0215 hypothetical protein
yjhE b4282 1.3314 0.0382 KpLE2 phage-like element
yjhF b4296 1.7197 0.0391 YjhF Gnt tranporter
ykfB b0250 0.5364 0.0047 hypothetical protein
ynaI b1330 1.3820 0.0261 YnaI
yneE b1520 2.2054 0.0150 conserved hypothetical protein
yneK b1527 1.7412 0.0171 conserved protein
yphF b2548 0.4656 0.0111 YphD/YphE/YphF ABC transporter
yqiJ b3050 1.6472 0.0159 putative oxidoreductase
ytfL b4218 0.6187 0.0431 putative transport protein
ytfM b4220 0.6059 0.0406 hypothetical protein
Supplementary table - III: CSH50 wild-type (A) Vs CSH50 fis::kan (B), Late stationary phase
gene blattner ratio p-value Function
A/B
aaeX b3242 0.1162 0.0119 hypothetical protein
aceK b4016 0.7802 0.0399 isocitrate dehydrogenase phosphatase / isocitrate dehydrogenase kinase
ada b2213 0.5369 0.0145 Ada transcriptional dual regulator / O-6-methylguanine-DNA methyltransferase
alaS b2697 0.7352 0.0016 alanyl-tRNA synthetase
alr b4053 1.8816 0.0448 alanine racemase, minor
amiC b2817 3.3668 0.0494 N-acetylmuramyl-L-alanine amidase
ampC b4150 1.4236 0.0158 beta-lactamase; penicillin resistance
amtB b0451 0.9258 0.0243 AmtB ammonium Amt transporter
araJ b0396 0.5228 0.0297 AraJ MFS transporter
argG b3172 0.5972 0.0146 argininosuccinate synthase
argH b3960 3.5282 0.0064 argininosuccinate lyase
aroK b3390 0.5174 0.0094 shikimate kinase I
asnA b3744 0.8519 0.0127 aspartate-ammonia ligase
astC b1748 9.1016 0.0329 acetylornithine transaminase, catabolic / succinylornithine transaminase
b1578 b1578 3.2990 0.0187 hypothetical protein
b2191 b2191 3.0472 0.0497 hypothetical protein
betA b0311 0.6126 0.0046 choline dehydrogenase
betT b0314 0.5842 0.0485 BetT choline BCCT transporter
borD b0557 1.2137 0.0192 bacteriophage lambda Bor protein homolog
citT b0612 1.4968 0.0388 CitT citrate DASS Transporter
clcA b0155 2.5182 0.0325 EriC chloride ion ClC channel
clcB b1592 0.7312 0.0360 YnfJ chloride ion ClC transporter
clpB b2592 0.3280 0.0079 ClpB chaperone
cobS b1992 0.7962 0.0307 cobalamin 5'-phosphate synthase / cobalamin synthase
codB b0336 0.3742 0.0051 CodB cytosine NCS1 transporter
cpxP b3913 0.2235 0.0170
regulator of the Cpx response and possible chaperone involved in resistance to
extracytoplasmic stress
92

APPENDIX I
gene blattner ratio p-value Function
A/B
creB b4398 0.4846 0.0434 CreB- Phosphorylated transcriptional regulator
creC b4399 0.3937 0.0326 CreC-Phis
csdA b2810 0.5874 0.0365 cysteine sulfinate desulfinase
csgC b1043 1.2044 0.0112 putative curli production protein
cspD b0880 16.0799 0.0280 DNA replication inhibitor
cspE b0623 8.6680 0.0365 CspE transcriptional repressor
cspG b0990 0.6140 0.0016 cold shock protein CspG
csrA b2696 3.9886 0.0476
carbon storage regulator; controls glycogen synthesis, gluconeogenesis, cell size and
surface properties
cusF b0573 0.7829 0.0248 periplasmic copper-binding protein
cynS b0340 0.3529 0.0120 cyanase monomer
cysW b2423 0.6881 0.0280 sulfate ABC transporter
cysZ b2413 0.4629 0.0035 required for sulfate transport
ddpX b1488 0.5345 0.0362 D-Ala-D-Ala dipeptidase
deoC b4381 9.0692 0.0321 deoxyribose-phosphate aldolase
dhaR b1201 0.6436 0.0124 putative 2-component regulator
dksA b0145 1.6863 0.0313 DksA
dnaE b0184 0.5435 0.0106 DNA polymerase III, alpha subunit
dnaG b3066 0.4222 0.0495 DNA biosynthesis; DNA primase
dppA b3544 1.7303 0.0446 dipeptide ABC transporter
dsbA b3860 1.1918 0.0084 disulfide oxidoreductase
ecpD b0140 0.4814 0.0137 probable pilin chaperone similar to PapD
elbB b3209 1.9231 0.0350 sigma cross-reacting protein 27A (SCRP-27A)
eutL b2439 0.6724 0.0490 hypothetical protein
exuR b3094 0.8492 0.0144 ExuR transcriptional repressor
fabF b1095 0.6295 0.0460 beta-ketoacyl-ACP synthase II
fdrA b0518 0.5497 0.0092
involved in protein transport; multicopy suppressor of dominant negative ftsH
mutants
fecA b4291 0.8222 0.0069 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor
fimC b4316 0.4900 0.0315 periplasmic chaperone, required for type 1 fimbriae
flgB b1073 0.5473 0.0051 flagellar basal-body rod protein FlgB
fliD b1924 0.5664 0.0104 flagellar cap protein FliD; filament capping protein; enables filament assembly
fliK b1943 2.0042 0.0318 flagellar hook-length control protein FliK
fliY b1920 4.1059 0.0296
periplasmic cystine-binding protein; member of extracellular bacterial solute-binding
protein family III
frlC b3372 1.1884 0.0410 fructoselysine and psicoselysine degradation
fruA b2167 1.6009 0.0416 EIIFru
frvX b3898 0.6284 0.0373 frv operon protein
fsaB b3946 0.5115 0.0025 fructose 6-phosphate aldolase 2
ftsW b0089 1.6371 0.0330 essential cell division protein FtsW
fumB b4122 1.4742 0.0092 fumarase B monomer
fumC b1611 4.5730 0.0410 fumarase C monomer
fusA b3340 7.4644 0.0072 elongation factor G
g30K b1088 4.4609 0.0486 hypothetical protein
gatY b2096 7.4188 0.0456 tagatose-1,6-bisphosphate aldolase 2
glgS b3049 12.4340 0.0183 glycogen biosynthesis, rpoS dependent
glk b2388 2.4011 0.0080 glucokinase
glnA b3870 0.6508 0.0408 adenylyl-[glutamine synthetase]
gloB b0212 0.7455 0.0328 glyoxalase II
glpA b2241 1.8004 0.0339 glycerol-3-phosphate-dehydrogenase, anaerobic
gntU b4476 0.6904 0.0450 GntU gluconate Gnt transporter
greA b3181 0.5847 0.0466
transcription elongation factor; stimulates the mRNA cleavage activity of RNA
polymerase
groL b4143 0.1600 0.0302 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein
grxB b1064 3.0152 0.0423 oxidized glutaredoxin 2
gyrA b2231 1.2523 0.0381 DNA gyrase, subunit A
hemC b3805 0.7502 0.0425 hydroxymethylbilane synthase
hemH b0475 1.2367 0.0211 ferrochelatase
93

APPENDIX I
gene blattner ratio p-value Function
A/B
hflX b4173 1.1608 0.0414 putative GTPase; possible regulator of HflKC
htrA b0161 0.3477 0.0251 DegP
htrL b3618 0.4161 0.0089 involved in lipopolysaccharide biosynthesis
hyfI b2489 0.6981 0.0143 hydrogenase 4, small subunit
ibpB b3686 0.1277 0.0168 small heat shock protein IbpB
iscU b2529 4.5133 0.0350 scaffold protein involved in iron-sulfur cluster assembly
kch b1250 0.6951 0.0255 potassium VIC channel
kgtP b2587 2.2993 0.0011 KgtP &alpha;-ketoglutarate MFS transporter
lpxC b0096 2.7942 0.0029 UDP-3-O-acyl-N-acetylglucosamine deacetylase
lrhA b2289 0.3796 0.0348 LrhA transcriptional repressor
lsrB b1516 0.7399 0.0208 YneA
lysC b4024 0.8123 0.0155 aspartate kinase III
lyxK b3580 0.6681 0.0402 L-xylulose kinase
macB b0879 0.1409 0.0120 MacAB macrolide efflux transporter complex
manZ b1819 2.2877 0.0294 EIIMan
mdtA b2074 1.2909 0.0336 MdtABC RND-type Drug Exporter
metI b0198 0.8178 0.0151 L- and D-methionine uptake ABC permease
modF b0760 0.8025 0.0038 ModF
mqo b2210 0.6329 0.0302 malate dehydrogenase
mutT b0099 0.7175 0.0241 dGTP pyrophosphohydrolase
mviM b1068 2.0452 0.0053 putative virulence factor
napG b2205 1.8609 0.0363 ferredoxin-type protein
narG b1224 2.2871 0.0317 nitrate reductase A, &alpha; subunit
narJ b1226 0.6000 0.0278 NarJ, private chaperone for NarG nitrate reductase subunit
nlpA b3661 0.6811 0.0025 lipoprotein-28
nlpD b2742 4.4441 0.0000 NlpD putative outer membrane lipoprotein
nrdI b2674 0.5413 0.0160 stimulates ribonucleotide reduction
nuoE b2285 0.9495 0.0379 NADH dehydrogenase I
nuoM b2277 1.8342 0.0080 NADH dehydrogenase I
ompA b0957 10.3993 0.0496 outer membrane protein 3a (II*;G;d)
osmY b4376 4.2860 0.0255 hyperosmotically inducible periplasmic protein
pbpC b2519 5.9984 0.0419 putative peptidoglycan enzyme
pckA b3403 2.7797 0.0438 phosphoenolpyruvate carboxykinase (ATP)
pepD b0237 0.5596 0.0476 peptidase D
pgaB b1023 0.3651 0.0064 putative membrane protein
pgpA b0418 0.3457 0.0195 phosphatidylglycerophosphatase A
pheT b1713 16.3765 0.0495 phenylalanyl-tRNA synthetase &beta;-chain
phnP b4092 0.7634 0.0242 phosphonate metabolism
polB b0060 0.6608 0.0120 DNA polymerase II
ppa b4226 2.0727 0.0063 inorganic pyrophosphatase
proY b0402 0.6754 0.0227 ProY cryptic proline APC transporter
pspA b1304 0.3241 0.0349 negative transcriptional regulator of the psp operon
pstB b3725 0.9267 0.0131 phosphate ABC transporter
ptsI b2416 5.6371 0.0485 PTS enzyme I
pykA b1854 0.8489 0.0169 pyruvate kinase II monomer
rfaI b3627 0.4462 0.0388 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase
rhsD b0497 1.6558 0.0321 RhsD protein in rhs element
rhsE b1456 1.1728 0.0329 RhsE protein in rhs element
ribD b0414 0.6515 0.0084 pyrimidine reductase / pyrimidine deaminase
rimJ b1066 1.7516 0.0255
acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
rimM b2608 3.7205 0.0153 protein required for wild-type 16S rRNA processing
rluA b0058 0.4039 0.0494 23S rRNA and tRNA pseudouridine synthase
rnhB b0183 0.4660 0.0478 RNAse HII, degrades RNA of DNA-RNA hybrids
rplE b3308 5.5781 0.0305 50S ribosomal subunit protein L5
rplI b4203 2.4184 0.0300 50S ribosomal subunit protein L9
rplR b3304 7.8773 0.0179 50S ribosomal subunit protein L18
94

APPENDIX I
gene blattner ratio p-value Function
A/B
rplX b3309 3.5468 0.0478 50S ribosomal subunit protein L24
rpmA b3185 0.4113 0.0210 50S ribosomal subunit protein L27
rpmI b1717 6.8633 0.0383 50S ribosomal subunit protein A
rpoA b3295 2.8507 0.0294 RNA polymerase, alpha subunit
rpsD b3296 5.2826 0.0441 30S ribosomal subunit protein S4
rpsE b3303 12.4222 0.0115 30S ribosomal subunit protein S5
rpsH b3306 4.2597 0.0254 30S ribosomal subunit protein S8, and regulator
rpsN b3307 6.6163 0.0259 30S ribosomal subunit protein S14
rpsR b4202 1.8126 0.0017 30S ribosomal subunit protein S18
rsd b3995 0.6020 0.0268 regulator of sigma D
rseB b2571 0.2066 0.0278
negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA to
sigmaE
rusA b0550 0.6409 0.0385 endodeoxyribonuclease RUS (Holliday junction resolvase)
sdhB b0724 1.7743 0.0237 succinate dehydrogenase iron-sulfur protein
sfsA b0146 3.3885 0.0017 SfsA
sgrR b0069 0.5711 0.0195 SgrR transcriptional regulator
slp b3506 1.8331 0.0144 outer membrane protein induced after carbon starvation
slyA b1642 4.5810 0.0274 SlyA transcriptional activator
smf b4473 1.0372 0.0064 hypothetical protein
sohB b1272 0.5393 0.0272 putative protease
somA b0877 0.7299 0.0121 putative enzyme
speD b0120 0.5703 0.0350 adenosylmethionine decarboxylase, proenzyme
speE b0121 1.3579 0.0421 spermidine synthase
speG b1584 0.4922 0.0388 spermidine acetyltransferase
spoT b3650 0.4810 0.0407 GDP diphosphokinase / guanosine-3',5'-bis(diphosphate) 3'-diphosphatase
sucA b0726 8.0970 0.0066 subunit of E1(0) component of 2-oxoglutarate dehydrogenase
surE b2744 1.5675 0.0023 phosphatase with broad substrate specificity / 3'-nucleotidase / 5'-nucleotidase
talA b2464 7.9764 0.0051 transaldolase A
tauA b0365 1.1408 0.0442 TauA/TauB/TauC ABC transporter
tfaQ b1546 4.3804 0.0443 hypothetical protein
trkA b3290 0.8203 0.0039 TrkA
trmD b2607 8.9475 0.0351 tRNA (guanine-1-)-methyltransferase
trmU b1133 0.5271 0.0381 catalyzes 2-thiouridine modification of tRNA
ttk b3641 3.3439 0.0494 Ttk transcriptional regulator
ubiE b3833 0.8435 0.0494
S-adenosylmethionine:2-DMK methyltransferase / 2-octaprenyl-6-methoxy-1,4-
benzoquinone methylase
upp b2498 0.5649 0.0007 uracil phosphoribosyltransferase
uspG b0607 2.9614 0.0340 universal stress protein of the UspA family
uxuA b4322 0.8406 0.0459 mannonate dehydratase
uxuR b4324 0.7367 0.0352 UxuR transcriptional regulator
wrbA b1004 4.9428 0.0377 WrbA
xapA b2407 0.7936 0.0468 xanthosine phosphorylase
xylA b3565 2.0099 0.0081 xylose isomerase
xylB b3564 0.5746 0.0049 xylulokinase
xylF b3566 0.7195 0.0419 xylose ABC transporter
yaaH b0010 0.6869 0.0271 putative transport protein
yabI b0065 1.8964 0.0149 putative integral membrane protein
yadH b0128 3.3596 0.0418 YadG/YadH ABC transporter
yadR b0156 2.8838 0.0285 conserved hypothetical protein
yafS b0213 0.6999 0.0147 putative methyltransferase
yahC b0317 0.8078 0.0212 putative membrane protein
yahK b0325 1.3928 0.0045 putative oxidoreductase
ybbP b0496 0.7792 0.0036 YbbA/YbbP ABC transporter
ybcO b0549 0.6231 0.0253 hypothetical protein
ybdL b0600 0.4618 0.0229 methionine aminotransferase
ybeB b0637 1.7480 0.0389 conserved hypothetical protein
ybeR b0645 0.5813 0.0326 conserved hypothetical protein
95

APPENDIX I
gene blattner ratio p-value Function
A/B
ybhA b0766 0.7300 0.0055 putative phosphatase
ybhL b0786 2.1462 0.0351 putative transport protein
ybhN b0788 0.7033 0.0260 hypothetical protein
ycbU b0942 0.7402 0.0421 putative fimbrial-like protein
yccJ b1003 5.6972 0.0370 hypothetical protein
ycdF b1005 3.8775 0.0307 hypothetical protein
ycdJ b1009 2.2829 0.0227 putative acetyltransferase
ycdN b1016 1.7264 0.0325 hypothetical protein of the OFeT transport family
yceK b1050 0.9386 0.0468 hypothetical protein
ycjF b1322 2.8255 0.0176 putative membrane protein
ycjO b1311 0.5416 0.0001 YcjN/YcjO/YcjP ABC transporter
yddL b1472 0.6258 0.0181 putative outer membrane porin protein
ydeI b1536 3.2270 0.0014 conserved hypothetical protein
ydfJ b1543 0.2900 0.0231 YdfJ
yeaK b1787 1.5080 0.0319 conserved hypothetical protein
yebQ b1828 0.8734 0.0441 YebQ
yebS b1833 0.8160 0.0391 putative membrane protein
yecC b1917 0.7788 0.0141 putative ATP-binding component of a transport system
yeeA b2008 0.6257 0.0087 putative membrane protein, transport
yeeL_2 b1979 0.6176 0.0176 putative transport protein
yeeO b1985 0.5128 0.0485 YeeO MATE Transporter
yeeT b2003 0.5966 0.0348 hypothetical protein
yejB b2178 1.2896 0.0364 YejA/YejB/YejE/YejF ABC transporter
yfbE b2253 0.5801 0.0012 UDP-L-Ara4O C-4" transaminase
yfeC b2398 0.3352 0.0137 hypothetical protein
yfeK b2419 0.6148 0.0371 conserved protein
yfgM b2513 0.4685 0.0406 conserved protein
yfhG b2555 0.9007 0.0264 conserved protein
yfhR b2534 0.8297 0.0101 putative methylase or hydrolase
yfiP b2583 1.7964 0.0494 conserved hypothetical protein
yfjX b2643 0.7308 0.0082 hypothetical protein
ygdQ b2832 0.6379 0.0085 putative transport protein
ygeF b2850 0.8063 0.0120 conserved hypothetical protein
yggC b2928 6.2501 0.0187 putative kinase
yggN b2958 0.7475 0.0321 conserved hypothetical protein
yghJ b2974 1.1108 0.0216 predicted inner membrane lipoprotein
yghU b2989 1.1448 0.0338
glutathione transferase-like protein possibly involved in glutathionylspermidine
metabolism
ygiH b3059 0.6438 0.0454 putative membrane protein
ygiU b3022 3.8905 0.0267 putative cyanide hydratase
ygjJ b3079 0.9097 0.0041 hypothetical protein
yhaK b3106 2.4963 0.0437 conserved hypothetical protein
yhbN b3200 0.6192 0.0050 YhbG/YhbN ABC transporter
yhfX b3381 1.2679 0.0037 conserved protein
yhhX b3440 0.7634 0.0300 putative galactose 1-dehydrogenase
yhjD b3522 2.7084 0.0452 putative membrane protein
yiaD b3552 2.3769 0.0160 putative outer membrane protein
yiaV b3586 0.5516 0.0468 putative membrane protein
yicH b3655 1.5065 0.0436 conserved protein
yifN b3777 0.5132 0.0378 conserved hypothetical protein
yigF b3817 0.4341 0.0171 conserved hypothetical protein
yiiX b3937 0.6653 0.0054 conserved hypothetical protein of the NlpC/P60 peptidase superfamily
yjdK b4128 0.6048 0.0143 hypothetical protein
yjeQ b4161 0.9234 0.0275 GTPase and putative translation factor / GTPase
yjgR b4263 0.7614 0.0369 putative enzyme with P-loop containing nucleotide triphosphate hydrolase domain
yjhB b4279 4.7570 0.0247 YjhB MFS transporter
yjhT b4310 0.8659 0.0460 putative enzyme contains galactose oxidase-like domain
96

APPENDIX I
gene blattner ratio p-value Function
A/B
ykgJ b0288 0.5411 0.0198 putative ferredoxin
ymgA b1165 1.8693 0.0273 hypothetical protein
ymgC b1167 13.1366 0.0366 hypothetical protein
ymgD b1171 0.3867 0.0100 hypothetical protein
ynaA b1368 0.9570 0.0079 putative alpha helix protein
yncA b1448 1.1679 0.0391 putative N-acetyltransferase
yneG b1523 1.1135 0.0464 conserved hypothetical protein
ynfA b1582 5.9471 0.0110 inner membrane protein
yniB b1726 3.4656 0.0443 hypothetical protein
yoaG b1796 0.5357 0.0394 hypothetical protein
yobB b1843 0.7096 0.0410 conserved hypothetical protein
yohC b2135 3.0037 0.0304 putative transport protein
yohD b2136 0.6268 0.0385 hypothetical protein
yohJ b2141 0.8408 0.0481 putative transmembrane protein
yphA b2543 2.8374 0.0476 hypothetical protein
yqjE b3099 1.9245 0.0368 conserved protein
yraM b3147 0.8763 0.0122 putative glycosylase
yrbD b3193 1.2481 0.0359 YrbD
yrdA b3279 0.4732 0.0240 putative transferase
yrfG b3399 0.5282 0.0267 putative hydrolase with a phophatase-like domain
ytfF b4210 0.4613 0.0484 putative transmembrane subunit
ytfK b4217 11.1610 0.0296 hypothetical protein
ytjB b4387 0.5306 0.0382 membrane protein
znuA b1857 0.4613 0.0187 ZnuA/ZnuB/ZnuC ABC transporter
zraP b4002 0.2157 0.0093 zinc homeostasis protein
b0395 2.2058 0.0439
b0322 1.4431 0.0208
b3948 0.7342 0.0285
Supplementary table - IV: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Mid-exponential
phase
gene blattner ratio p-value Function
A/B
acrE b3265 0.4232 0.0319 transmembrane protein affects septum formation and cell membrane permeability
ade b3665 0.0880 0.0027 cryptic adenine deaminase monomer
agaB b3138 0.5821 0.0060 EIIAga
agaC b3139 0.5600 0.0258 EIIAga
allD b0517 0.3467 0.0295 ureidoglycolate dehydrogenase
alsA b4087 1.4648 0.0056 YjcW
alsK b4084 1.6686 0.0186 putative D-allose kinase
aniC b4115 0.1952 0.0013 AdiC Arginine:Agmatine Antiporter
artJ b0860 1.3014 0.0092 arginine ABC transporter
asnA b3744 4.5645 0.0110 aspartate-ammonia ligase
azoR b1412 1.7670 0.0328 acyl carrier protein phosphodiesterase
b0501 b0501 0.3204 0.0148 hypothetical protein
b1172 b1172 0.3230 0.0046 conserved hypothetical protein
b1364 b1364 1.7953 0.0104 hypothetical protein
b1437 b1437 2.0579 0.0149 hypothetical protein
b2084 b2084 0.2573 0.0018 hypothetical protein
b2680 b2680 0.2973 0.0151 YgaY MFS transporter
b4283 b4283 0.7779 0.0431 IS911 protein
basR b4113 0.5152 0.0269 BasR-Phosphorylated transcriptional regulator
bcsE b3536 0.7416 0.0435 putative protease
97

APPENDIX I
gene blattner ratio p-value Function
A/B
bglG b3723 0.3084 0.0458 BglG monomer
bioF b0776 0.5910 0.0182 8-amino-7-oxononanoate synthase
cadA b4131 0.4186 0.0251 lysine decarboxylase
cfa b1661 1.7766 0.0466 cyclopropane fatty acid synthase
chaC b1218 0.6361 0.0124 cation transport regulator
chbB b1738 0.7761 0.0260 EIIChb
chbR b1735 0.6426 0.0292 ChbR transcriptional regulator
citC b0618 0.4542 0.0028 citrate lyase ligase
citD b0617 0.4617 0.0403 subunit of acyl carrier protein
clpA b0882 2.1712 0.0279 ATP-binding component of serine protease
clpB b2592 1.8746 0.0335 ClpB chaperone
copA b0484 2.0211 0.0020 YbaR
csgA b1042 0.3262 0.0123 curlin, major subunit
csgB b1041 0.3223 0.0205 curlin, minor subunit precursor
csgD b1040 0.2580 0.0060 CsgD transcriptional activator
csgF b1038 0.3660 0.0143 curli assembly component
csiE b2535 2.3439 0.0459 hypothetical protein
cspC b1823 0.5094 0.0463 cold shock protein CspC
cspI b1552 0.1583 0.0104 cold shock protein CspI
cutC b1874 0.6803 0.0402 copper homeostasis protein
cysH b2762 1.3960 0.0442 3'-phospho-adenylylsulfate reductase
cysP b2425 1.7696 0.0110 thiosulfate ABC transporter
dcrB b3472 1.7334 0.0438 conserved protein involved in bacteriophage adsorption
dctR b3507 0.4226 0.0328 protein involved in metabolism of C4-dicarboxylates
dcuS b4125 1.6044 0.0224 DcuS-Phis349
ddpC b1485 1.3826 0.0444 YddQ
dgoR b3694 1.6453 0.0106 regulator protein for dgo operon
djlC b0649 0.6688 0.0445 Hsc56; a DnaJ-like protein that activates ATPase activity of Hsc62
dmsB b0895 1.5182 0.0340 dimethyl sulfoxide reductase, chain B
dmsC b0896 1.4176 0.0279 dimethyl sulfoxide reductase, chain C
dmsD b1591 1.3281 0.0123 DMS reductase maturation protein
dpiA b0620 0.2993 0.0020 CitB transcriptional regulator
dpiB b0619 0.2370 0.0054 DpiB
dsbC b2893 0.3743 0.0137 DsbCoxidized
elaD b2269 0.7119 0.0344 putative sulfatase / phosphatase
entA b0596 1.8924 0.0444 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
exbB b3006 3.9960 0.0236 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins
exbD b3005 3.9950 0.0076 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins
fdoG b3894 1.9381 0.0090 formate dehydrogenase-O, &alpha; subunit
fecR b4292 3.3052 0.0019 regulator for fec operon, periplasmic
feoB b3409 8.1963 0.0108 FeoB ferrous iron transporter
fepC b0588 2.0669 0.0123 Ferric Enterobactin Transport System
fhuA b0150 3.0188 0.0173
FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1,
T5, and phi80
fhuB b0153 1.7527 0.0468 ferrichrome uptake system
fhuC b0151 2.1582 0.0127 ferrichrome uptake system
fic b3361 1.3570 0.0403 stationary-phase protein with possible role in p-aminobenzoate or folate biosynthesis
fimB b4312 0.1579 0.0019 regulator for fimA
fimC b4316 0.2925 0.0204 periplasmic chaperone, required for type 1 fimbriae
fimD b4317 0.2625 0.0115 outer membrane protein; export and assembly of type 1 fimbriae, interrupted
fimE b4313 0.4518 0.0341 regulator for fimA
fimF b4318 0.1795 0.0195 fimbrial morphology
fimG b4319 0.3289 0.0425 fimbrial morphology
fimH b4320 0.3630 0.0420 minor fimbrial subunit, D-mannose specific adhesin
fixA b0041 0.2419 0.0368 probable flavoprotein subunit required for anaerobic carnitine metabolism
flgA b1072 5.3030 0.0410 flagellar biosynthesis; assembly of basal-body periplasmic P ring
flgC b1074 13.7652 0.0406 flagellar basal-body rod protein FlgC
98

APPENDIX I
gene blattner ratio p-value Function
A/B
flgD b1075 11.0115 0.0367 flagellar biosynthesis, initiation of hook assembly
flgG b1078 5.4828 0.0333 flagellar basal-body rod protein FlgG
flgI b1080 2.4887 0.0470 flagellar P-ring protein FlgI
fliE b1937 1.6564 0.0329 flagellar basal-body protein FliE
fliH b1940 1.5432 0.0196 flagellar biosynthesis protein FliH
fliL b1944 5.3308 0.0268 flagellar biosynthesis
fliN b1946 4.7917 0.0295
flagellar motor switch protein FliN; component of motor switch and energizing,
enabling rotation and determining its direction
fliZ b1921 4.2696 0.0330 possible cell-density responsive regulator of sigmaF
folC b2315 0.7311 0.0443 folylpoly-&gamma;-glutamate synthetase / dihydrofolate synthetase
fpr b3924 2.5348 0.0149 flavodoxin NADP+ reductase
frdD b4151 1.6186 0.0382 fumarate reductase membrane protein
frlB b3371 2.2009 0.0184 fructoselysine 6-phosphate deglycase monomer
fruB b2169 0.3434 0.0332 EIIFru
fruK b2168 0.4896 0.0376 1-phosphofructokinase monomer
fsaA b0825 7.7628 0.0036 Fsa
ftnA b1905 0.5763 0.0388 cytoplasmic ferritin, an iron storage protein)
gadA b3517 0.0773 0.0039 glutamate decarboxylase A subunit
gadC b1492 0.1005 0.0061 XasA GABA APC transporter
gadE b3512 0.1805 0.0075 GadE transcriptional activator
gadW b3515 0.2415 0.0112 GadWtranscriptional repressor
gadX b3516 0.2187 0.0018 GadX transcriptional activator
gcl b0507 1.3668 0.0281 glyoxylate carboligase
glf b2036 0.8672 0.0128 UDP-galactopyranose mutase
glk b2388 1.8333 0.0429 glucokinase
glnB b2553 1.3692 0.0068 PII-UMP
glnQ b0809 1.7145 0.0305 glutamine ABC transporter
glpK b3926 1.4158 0.0147 glycerol kinase
gltF b3214 0.3892 0.0017 regulator of gltBDF operon, induction of Ntr enzymes
gltJ b0654 1.5962 0.0062 glutamate ABC transporter
gor b3500 1.5677 0.0412 glutathione reductase (NADPH)
groE b4142 1.7003 0.0104
GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase
activity
groL b4143 1.6506 0.0412 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein
grpE b2614 2.1870 0.0236 phage lambda replication; host DNA synthesis; heat shock protein; protein repair
hdeD b3511 0.1890 0.0048 protein involved in acid resistance
hemA b1210 0.5195 0.0126 glutamyl-tRNA reductase
hlyE b1182 0.1049 0.0060 hemolysin E
hofB b0107 1.8089 0.0424 protein involved in plasmid replication
hsdS b4348 1.3534 0.0115 specificity determinant for hsdM and hsdR
htrL b3618 0.3544 0.0428 involved in lipopolysaccharide biosynthesis
hycF b2720 1.3712 0.0000 formate hydrogenlyase complex
hyfA b2481 1.4088 0.0450 hydrogenase 4, component A
hyfI b2489 1.2438 0.0144 hydrogenase 4, small subunit
hypB b2727 1.7286 0.0223
guanine-nucleotide binding protein, functions as nickel donor for large subunit of
hydrogenase 3
iaaA b0828 1.6736 0.0020 beta cleavage product of IaaA
idnD b4267 0.5169 0.0436 L-idonate 5-dehydrogenase
idnR b4264 1.1480 0.0279 IdnR-5-ketogluconate
ilvC b3774 1.6530 0.0410 acetohydroxy acid isomeroreductase
ilvY b3773 1.7029 0.0090 IlvY transcriptional dual regulator
infB b3168 0.8211 0.0337 protein chain initiation factor IF-2
intG b1936 0.3431 0.0453 hypothetical protein
katG b3942 1.3880 0.0202 hydroperoxidase I
kdsB b0918 1.5677 0.0297 3-deoxy-D-manno-octulosonate-cytidylyltransferase
ldhA b1380 2.9107 0.0129 D-lactate dehydrogenase
lrhA b2289 0.4409 0.0449 LrhA transcriptional repressor
99

APPENDIX I
gene blattner ratio p-value Function
A/B
mak b0394 1.4938 0.0390 manno(fructo)kinase
malQ b3416 1.2649 0.0206 maltose degrading enzyme 2 / maltose degrading enzyme / amylomaltase
map b0168 2.1116 0.0092 methionine aminopeptidase
mcrC b4345 0.7384 0.0462 MrcC subunit of 5-methylcytosine restriction system
mdtC b2076 0.7845 0.0383 MdtABC RND-type Drug Exporter
mdtF b3514 0.4998 0.0195 YhiV
mdtM b4337 0.6514 0.0140 YjiO drug MFS transporter
menF b2265 0.6845 0.0468 isochorismate synthase, menaquinone-specific
menG b3929 1.4163 0.0172 inhibitor of ribonuclease E (RNase E) activity
mfd b1114 1.2470 0.0009 transcription-repair coupling factor; mutation frequency decline
mntH b2392 2.1445 0.0446 MntH manganese ion NRAMP transporter
mobA b3857 2.0022 0.0164 molybdopterin guanine dinucleotide synthase
molR_1 b2115 0.5716 0.0391 molybdate metabolism regulator, interrupted
mppA b1329 0.3284 0.0002 periplasmic murein tripeptide binding protein
msbA b0914 0.7297 0.0302 ATP-binding transport protein; multicopy suppressor of htrB
mtlA b3599 1.2772 0.0244 EIIMtl
murA b3189 0.6703 0.0265 UDP-N-acetylglucosamine enolpyruvoyl transferase
mutS b2733 0.7424 0.0275 MutHLS complex, methyl-directed mismatch repair
nrdH b2673 4.4358 0.0460 glutaredoxin-like protein; hydrogen donor
nrdI b2674 2.8928 0.0050 stimulates ribonucleotide reduction
nuoB b2287 1.3211 0.0440 NADH dehydrogenase I
ompF b0929 2.0493 0.0041 outer membrane porin OmpF
ompR b3405 1.5638 0.0031 OmpR transcriptional dual regulator
ompW b1256 1.5536 0.0299 OmpW, outer membrane protein
osmC b1482 0.3366 0.0477 osmotically inducible peroxidase OsmC
paaH b1395 1.6745 0.0471 putative 3-hydroxy-acyl-CoA dehydrogenase of phenylacetate degradation
paaI b1396 1.5659 0.0497 hypothetical protein with some similarity to thioesterases
pagP b0622 0.2030 0.0037 PagP monomer
pfkA b3916 2.4655 0.0114 6-phosphofructokinase-1 monomer / putative NAD+ kinase
pflB b0903 2.0318 0.0371 pyruvate formate-lyase (inactive)
pflD b3951 1.4252 0.0361 formate acetyltransferase 2
pflE b0824 4.1008 0.0376 putative pyruvate formate-lyase 2 activating enzyme
pgaA b1024 1.9171 0.0243 putative outer membrane protein
pgaB b1023 0.5469 0.0305 putative membrane protein
pgk b2926 1.3537 0.0305 phosphoglycerate kinase
pinR b1374 0.2637 0.0145 putative transposon resolvase
pmrF b2254 0.3626 0.0319 undecaprenyl phosphate-L-Ara4FN transferase
pptA b1461 0.5373 0.0206 probable 4-oxalocrotonate tautomerase (4-OT) monomer
prlC b3498 1.6015 0.0034 oligopeptidase A
proV b2677 0.1318 0.0010 proline ABC transporter
proW b2678 0.1876 0.0048 proline ABC transporter
pspF b1303 1.5821 0.0168 PspF transcriptional activator
pspG b4050 0.7424 0.0314 phage shock protein PspG
pta b2297 1.5264 0.0118 phosphate acetyltransferase
pyrB b4245 2.0111 0.0261 aspartate carbamoyltransferase, PyrB subunit
rdgC b0393 0.7189 0.0182 nonspecific DNA binding protein; nucleoid component
recA b2699 0.7639 0.0133
DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and ATPdependent
coprotease
recN b2616 0.2723 0.0087 protein used in recombination and DNA repair
recX b2698 0.4849 0.0425 inhibitor of RecA
relE b1563 0.7927 0.0031 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome
rfaG b3631 0.6527 0.0257 lipopolysaccharide core biosynthesis; glucosyltransferase I
rfaQ b3632 0.5460 0.0077 lipopolysaccharide core biosynthesis
rhsA b3593 0.4066 0.0429 RhsA protein in rhs element
rhsD b0497 0.1528 0.0099 RhsD protein in rhs element
rihB b2162 0.4066 0.0069 ribonuceloside hydrolase 2 (pyrimidine-specific)
rihC b0030 2.2156 0.0351 ribonucleoside hydrolase 3
100

APPENDIX I
gene blattner ratio p-value Function
A/B
rna b0611 1.9534 0.0081 RNase I, cleaves phosphodiester bond between any two nucleotides
rnhA b0214 0.8180 0.0094 RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication
rpmH b3703 0.5985 0.0307 50S ribosomal subunit protein L34
rsmC b4371 0.6908 0.0180 putative enzyme
rsxB b1628 0.4784 0.0272 member of SoxR-reducing complex
ruvA b1861 0.5930 0.0118 branch migration of Holliday structures; repair
secA b0098 1.7377 0.0270 Sec Protein Secretion Complex
selA b3591 1.4733 0.0470 selenocysteine synthase monomer
sfmA b0530 1.3127 0.0420 putative fimbrial-like protein
sgcR b4300 1.3635 0.0167 SgcR transcriptional regulator
slp b3506 0.2034 0.0108 outer membrane protein induced after carbon starvation
soxS b4062 7.4619 0.0398 SoxS transcriptional activator
stpA b2669 0.2808 0.0208 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing?
sufA b1684 2.0899 0.0341 scaffold protein for iron-sulfur cluster assembly
sufC b1682 1.4335 0.0368
ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator
complex
suhB b2533 0.7121 0.0469 inositol monophosphatase
tdcR b3119 1.3440 0.0327 TdcR transcriptional activator
tdk b1238 0.2845 0.0028 thymidine kinase / deoxyuridine kinase
torT b0994 1.5195 0.0473 TorT-unknown inducer
torZ b1872 0.4520 0.0239 trimethylamine N-oxide reductase III, TorZ subunit
treB b4240 1.3851 0.0394 EIITre
treC b4239 1.5854 0.0202 trehalose-6-phosphate hydrolase
trpD b1263 1.4240 0.0122 anthranilate synthase component II
trpE b1264 1.3868 0.0296 anthranilate synthase component I
ubiD b3843 1.3999 0.0173 3-octaprenyl-4-hydroxybenzoate decarboxylase monomer
ugd b2028 0.5278 0.0277 UDP-glucose 6-dehydrogenase
ulaG b4192 1.1945 0.0340 putative L-ascorbate 6-phosphate lactonase
uspA b3495 2.2175 0.0364 universal stress protein; broad regulatory function?
wcaD b2056 0.2374 0.0250 putative colanic acid polymerase
wzyE b3793 1.4246 0.0304 4-&alpha;-fucosyltransferase
xapR b2405 0.1865 0.0024 XapR transcriptional activator
xerC b3811 1.3838 0.0440
site-specific recombinase, acts on cer sequence of ColE1, effects chromosome
segregation at cell division
yabP b0056 0.4273 0.0003 conserved hypothetical protein
yacH b0117 1.3658 0.0346 putative membrane protein
yadK b0136 0.2247 0.0062 putative adhesin-like protein
yadL b0137 0.4099 0.0151 putative adhesin-like protein
yafD b0209 1.4773 0.0349 conserved hypothetical protein
yafW b0246 1.8615 0.0241 antitoxin of the YkfI-YafW toxin-antitoxin pair
yaiB b0382 0.5256 0.0360 conserved hypothetical protein
yaiW b0378 0.8394 0.0355 conserved hypothetical protein
yajD b0410 1.3406 0.0194 conserved hypothetical protein
ybaD b0413 1.5654 0.0479 conserved protein
ybaK b0481 1.3718 0.0213 conserved hypothetical protein
ybaW b0443 1.1589 0.0085 conserved hypothetical protein
ybbD b0500 0.3702 0.0301 conserved hypothetical protein
ybcM b0546 0.2015 0.0007 putative ARAC-type regulatory protein
ybdG b0577 0.5999 0.0390 putative transport protein
ybfH b0691 0.8192 0.0421 conserved hypothetical protein
ybgO b0716 1.2872 0.0428 conserved hypothetical protein
ybiF b0813 0.3984 0.0307 Threonine and Homoserine Exporter
ybiW b0823 4.0177 0.0341 putative formate acetyltransferase
ybjL b0847 0.7609 0.0095 putative transport protein
ycaK b0901 0.6234 0.0102 YcaK
ycaL b0909 1.2929 0.0439 putative heat shock protein
ycaM b0899 0.3732 0.0035 YcaM APC amino acid transporter
101

APPENDIX I
gene blattner ratio p-value Function
A/B
ycbQ b0938 0.2233 0.0046 putative fimbrial-like protein
ycbS b0940 0.4473 0.0081 putative outer membrane protein
ycbT b0941 0.5092 0.0133 homolog of Salmonella FimH protein
yccU b0965 1.4442 0.0412 putative NAD(P)-binding enzyme
ycdN b1016 1.2686 0.0288 hypothetical protein of the OFeT transport family
ycdU b1029 0.3114 0.0236 putative enzyme
yceI b1056 0.6004 0.0350 periplasmic protein; possibly secreted
ycfR b1112 0.3049 0.0045 conserved hypothetical protein
ycgH_1 b1169 0.2603 0.0228 conserved protein; member of the Autotransporter family
ycgV b1202 0.1758 0.0031 putative adhesion and penetration protein
yciE b1257 0.5250 0.0110 conserved protein
ycjN b1310 0.4274 0.0070 YcjN/YcjO/YcjP ABC transporter
ycjO b1311 1.4055 0.0364 YcjN/YcjO/YcjP ABC transporter
ycjP b1312 0.5766 0.0237 YcjN/YcjO/YcjP ABC transporter
ycjQ b1313 0.5545 0.0251 putative oxidoreductase
ydbH b1381 1.4568 0.0176 conserved protein
ydcA b1419 0.7482 0.0460 hypothetical protein
yddJ b1470 0.7674 0.0421 hypothetical protein
yddV b1490 0.4204 0.0091 conserved protein
ydeH b1535 0.2575 0.0002 hypothetical protein
ydeI b1536 0.3455 0.0164 conserved hypothetical protein
ydeM b1497 0.7525 0.0152 putative enzyme
ydeO b1499 0.3105 0.0065 putative ARAC-type regulatory protein
ydeP b1501 0.5015 0.0287 acid resistance protein
ydeS b1504 0.4386 0.0418 putative fimbrial-like protein
ydeT b1505 0.5607 0.0195 putative outer membrane protein
ydfJ b1543 1.4099 0.0448 YdfJ
YdgE b1599 0.1355 0.0016 YdgE SMR Protein
YdgF b1600 0.0941 0.0008 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydgK b1626 0.5783 0.0429 putative oxidoreductase
ydgT b1625 0.3754 0.0341 conserved hypothetical protein
ydhT b1669 0.6822 0.0135 conserved protein
ydhY b1674 0.5117 0.0365 putative oxidoreductase, Fe-S subunit
ydiA b1703 0.4514 0.0302 conserved protein
ydiT b1700 0.5051 0.0079 putative ferredoxin
ydjI b1773 0.5134 0.0380 putative aldolase
ydjJ b1774 0.5684 0.0403 putative oxidoreductase
yeaD b1780 2.3475 0.0375 conserved hypothetical protein
yeaJ b1786 0.3536 0.0274 putative membrane protein
yeaU b1800 0.6621 0.0455 putative tartrate dehydrogenase
yebN b1821 0.3605 0.0299 putative membrane protein, terpenoid synthase-like
yecT b1877 0.7868 0.0119 hypothetical protein
yedL b1932 0.7234 0.0377 putative acyl-CoA N-acyltransferase
yedW b1969 0.2224 0.0277 putative 2-component transcriptional response regulator
yeeP b1999 1.5217 0.0256 putative histone
yeeR b2001 3.3879 0.0270 hypothetical protein
yegI b2070 0.5059 0.0139 putative chaperonin
yegJ b2071 0.4400 0.0002 hypothetical protein
yegZ b2083 0.4459 0.0458 hypothetical protein
yehD b2111 1.2074 0.0153 putative fimbrial-like protein
yehZ b2131 1.4371 0.0308 YehW/YehX/YehY/YehZ ABC transporter
yeiC b2166 0.1058 0.0054 putative kinase
yeiL b2163 0.2356 0.0045 yeiL transcriptional activator
yeiS b2145 0.3579 0.0009 hypothetical protein
yfaO b2251 0.6774 0.0483 putative enzyme (Nudix hydrolase)
yfbE b2253 0.5011 0.0326 UDP-L-Ara4O C-4" transaminase
102

APPENDIX I
gene blattner ratio p-value Function
A/B
yfbT b2293 1.7768 0.0251 putative phosphatase, contains a phophatase-like domain
yfcV b2339 0.2396 0.0363 putative fimbrial-like protein
yfcZ b2343 1.9842 0.0309 conserved hypothetical protein
yfdY b2377 1.9172 0.0152 hypothetical protein
yfeH b2410 2.5659 0.0020 putative cytochrome oxidase
yfeO b2389 1.3810 0.0219 hypothetical protein
yfgH b2505 0.3998 0.0112 putative outer membrane lipoprotein
yfgI b2506 0.3691 0.0138 putative membrane protein
yfiC b2575 0.5114 0.0115 putative enzyme
yfiR b2603 0.4214 0.0315 conserved protein
yfjT b2637 1.2855 0.0166 hypothetical protein
ygaD b2700 1.5905 0.0380 conserved protein
ygaQ b2654 0.5771 0.0145 hypothetical protein
ygcG b2778 0.5541 0.0426 putative membrane protein
ygcI b2757 0.2705 0.0485 hypothetical protein
ygcK b2759 0.1525 0.0146 hypothetical protein
ygeH b2852 1.2703 0.0166 putative invasion protein
ygfJ b2877 0.5915 0.0145 conserved protein
ygiD b3039 1.7851 0.0438 putative enzyme with dioxygenase domain
ygiL b3043 0.1979 0.0050 putative fimbrial-like protein
ygiP b3060 0.3869 0.0138 putative transcriptional regulator LYSR-type
ygjG b3073 0.7150 0.0032 putrescine:2-oxoglutaric acid aminotransferase
ygjR b3087 1.7341 0.0151 putative NAD(P)-binding dehydrogenase
yhaC b3121 0.7029 0.0259 conserved protein
yhaH b3103 1.4810 0.0409 putative cytochrome
yheT b3353 0.9395 0.0476 putative hydrolase with an alpha/beta-hydrolase domain
yhgG b3410 8.7789 0.0083 putative transcriptional regulator
yhhS b3473 1.9023 0.0214 YhhS MFS transporter
yhiM b3491 0.3980 0.0150 conserved inner membrane protein
yhiS b3504 0.4148 0.0135 conserved protein
yhjB b3520 1.6281 0.0425 putative regulator
yhjD b3522 1.3548 0.0218 putative membrane protein
yhjH b3525 1.9821 0.0096 protein involved in flagellar function
yhjX b3547 2.3356 0.0409 YhjX MFS transporter
yiaU b3585 0.4160 0.0154 putative transcriptional regulator LYSR-type
yibA b3594 0.2851 0.0477 putative lyase
yicO b3664 0.2533 0.0165
putative membrane protein with possible relationship to novobiocin and
deoxycholate resistance
yieI b3716 1.7977 0.0144 putative membrane protein
yigF b3817 0.4178 0.0439 conserved hypothetical protein
yigL b3826 1.3312 0.0472 conserved protein with a phosphatase-like domain
yigZ b3848 1.4946 0.0135 putative elongation factor
yihF b3861 0.6315 0.0205 conserved protein
yjaG b3999 1.5544 0.0152 conserved protein
yjbB b4020 1.4828 0.0113 putative alpha helix protein
yjbM b4048 0.5829 0.0309 conserved hypothetical protein
yjcZ b4110 0.6510 0.0102 hypothetical protein
yjdA b4109 0.3357 0.0151 hypothetical protein
yjdL b4130 0.7255 0.0483 YjdL peptide POT transporter
yjeJ b4145 0.5658 0.0365 conserved protein
yjeN b4157 0.4976 0.0199 conserved hypothetical protein
yjeS b4166 1.9051 0.0114 conserved ferredoxin-like protein
yjfM b4185 1.4600 0.0495 conserved hypothetical protein
yjgK b4252 1.5575 0.0381 conserved hypothetical protein
yjgN b4257 0.6494 0.0031 putative membrane protein possible involved in transport
yjhE b4282 0.6011 0.0270 KpLE2 phage-like element
yjhH b4298 0.2791 0.0089 putative lyase/synthase
103

APPENDIX I
gene blattner ratio p-value Function
A/B
yjhI b4299 0.3015 0.0021 putative regulator
yjiP b4338 0.2074 0.0198 hypothetical protein
yjiW b4347 0.3864 0.0124 hypothetical protein
yjjI b4380 1.2300 0.0003 conserved hypothetical protein
yjjN b4358 0.7146 0.0214 putative oxidoreductase
yliH b0836 1.4511 0.0323 putative receptor; induced in stationary phase
ymdA b1044 1.3743 0.0405 conserved hypothetical protein
ymdE b1028 1.2439 0.0093 putative malonyl-CoA:Acyl carrier protein transacylase
ymfM b1148 1.3536 0.0483 hypothetical protein
ymgD b1171 0.4644 0.0021 hypothetical protein
ynaE b1375 0.2665 0.0186 hypothetical protein
ynaI b1330 0.5285 0.0218 YnaI
ynbD b1411 1.4997 0.0330 putative enzyme
yncC b1450 0.6862 0.0367 hypothetical protein
yncD b1451 1.5934 0.0332 Probable TonB-dependent receptor
yncI b1458 0.1672 0.0266 conserved protein
yneI b1525 3.7228 0.0368 putative aldehyde dehydrogenase
yneK b1527 0.9040 0.0285 conserved protein
ynfN b1551 0.2403 0.0063 hypothetical protein
yohJ b2141 2.9847 0.0353 putative transmembrane protein
yohN b2107 0.6686 0.0265 hypothetical protein
ypfJ b2475 1.4122 0.0100 conserved protein
ypjF b2646 1.6516 0.0435 member of the YeeV, YkfI, YpjF family of toxin proteins
yqaC b2657 0.3850 0.0243 putative enzyme
yqeC b2876 0.6850 0.0170 conserved protein
yqeI b2847 0.3106 0.0215 putative sensory transducer
yqeJ b2848 0.3761 0.0379 conserved hypothetical protein
yqgA b2966 2.0839 0.0160 putative transport protein
yrhA b3443 0.7276 0.0181 conserved hypothetical protein
ytfR b4485 1.7393 0.0402 subunit of YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter
ytfT b4230 1.5937 0.0012 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter
zraS b4003 2.0921 0.0305 ZraS-Phis
Supplementary table – V: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Transition to
stationary phase
gene blattner ratio p-value Function
A/B
aaeB b3240 1.1872 0.0075 hypothetical protein
aceE b0114 0.2646 0.0654 subunit of E1p component of pyruvate dehydrogenase complex
acrD b2470 1.3042 0.1589 AcrD
ade b3665 0.0725 0.0088 cryptic adenine deaminase monomer
adiA b4117 0.9019 0.0328 Adi
agaB b3138 1.1736 0.1822 EIIAga
alsC b4086 1.2567 0.1129 YjcV
ansB b2957 0.2992 0.0537 asparaginase II
arpB_2 b1721 0.9159 0.1043 hypothetical protein
artJ b0860 0.8070 0.0643 arginine ABC transporter
b1367 b1367 1.2731 0.0856 hypothetical protein
b1567 b1567 0.7688 0.1747 hypothetical protein
b3808 b3808 1.2642 0.0697 hypothetical protein
b4103 b4103 1.4344 0.0818 putative C terminus of split phnE gene product
betA b0311 1.2923 0.0890 choline dehydrogenase
104

APPENDIX I
gene blattner ratio p-value Function
A/B
caiF b0034 0.2262 0.0374 CaiF transcriptional activator
cheY b1882 1.4371 0.1824 CheY-Pasp
csgD b1040 0.6260 0.1715 CsgD transcriptional activator
cusB b0574 1.8915 0.0232 membrane fusion protein of the CusCFBA copper efflux system
cydA b0733 0.4010 0.0979 cytochrome bd-I terminal oxidase subunit I
cysS b0526 0.8028 0.2224 cysteinyl-tRNA synthetase
dapB b0031 0.5764 0.1246 dihydrodipicolinate reductase
degS b3235 1.4438 0.2115
inner membrane serine protease required for the extracytoplasmic stress response
mediated by sigmaE
ebgC b3077 1.1456 0.1104 evolved beta-D-galactosidase, beta subunit; cryptic gene
entA b0596 1.2670 0.1112 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
entC b0593 0.7369 0.0692 isochorismate synthase, enterobactin specific
eutJ b2454 0.8315 0.0043 putative ethanolamine utilization protein
fabB b2323 0.4887 0.0554 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase
fadI b2342 1.5169 0.2349 FadI monomer
fdrA b0518 0.8147 0.1193
involved in protein transport; multicopy suppressor of dominant negative ftsH
mutants
fhuB b0153 1.3218 0.2319 ferrichrome uptake system
fimD b4317 0.5627 0.2047 outer membrane protein; export and assembly of type 1 fimbriae, interrupted
fixA b0041 0.0756 0.1450 probable flavoprotein subunit required for anaerobic carnitine metabolism
fixC b0043 0.2155 0.2179
flavoprotein (electron transport), possibly involved in anaerobic carnitine
metabolism
flgB b1073 0.8033 0.0745 flagellar basal-body rod protein FlgB
folC b2315 1.3627 0.0775 folylpoly-&gamma;-glutamate synthetase / dihydrofolate synthetase
folP b3177 1.2314 0.1694 dihydropteroate synthase
frlB b3371 2.0432 0.0360 fructoselysine 6-phosphate deglycase monomer
frlC b3372 1.2382 0.2287 fructoselysine and psicoselysine degradation
frmA b0356 1.3302 0.0420 formaldehyde dehydrogenase, glutathione-dependent
fucA b2800 0.2508 0.0258 L-fuculose-phosphate aldolase
garD b3128 0.3928 0.2088 galactarate dehydratase
gloA b1651 1.3030 0.0348 glyoxalase I
gltJ b0654 1.2726 0.0202 glutamate ABC transporter
gnd b2029 0.2673 0.1255 6-phosphogluconate dehydrogenase (decarboxylating)
gspF b3327 1.1553 0.2132 putative protein secretion protein for export
hemG b3850 1.3439 0.1949 protoporphyrinogen oxidase
insB b0264 1.2537 0.0298 IS1 protein InsB (B0264)
iscA b2528 1.4368 0.0689 iron-sulfur cluster assembly protein
iscS b2530 2.5506 0.1524 cysteine desulfurase monomer
kdsB b0918 0.6326 0.0429 3-deoxy-D-manno-octulosonate-cytidylyltransferase
kdtA b3633 1.3532 0.1040 KDO transferase
kefG b3351 1.3412 0.1984 KefG
lepB b2568 1.1466 0.0947 leader peptidase (signal peptidase I)
mdtF b3514 0.2922 0.2011 YhiV
menD b2264 0.5481 0.0119
putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate
decarboxylase
moaC b0783 0.7275 0.0123 molybdopterin biosynthesis, protein C
nanA b3225 1.7915 0.0363 N-acetylneuraminate lyase
nfnB b0578 0.6237 0.0070 dihydropteridine reductase
nrdH b2673 1.4711 0.2098 glutaredoxin-like protein; hydrogen donor
ompF b0929 1.7917 0.1439 outer membrane porin OmpF
oppF b1247 0.8461 0.0600 oligopeptide ABC transporter
osmC b1482 0.6061 0.1300 osmotically inducible peroxidase OsmC
paaE b1392 1.6951 0.1043 putative oxygenase reductase of phenylacetate degradation
paaY b1400 1.4811 0.0096 putative transferase
pgaC b1022 0.6851 0.0781 predicted N-glycosyltransferase
potH b0856 1.3620 0.0482 putrescine ABC transporter
ppsA b1702 0.6429 0.1319 phosphoenolpyruvate synthase
proP b4111 1.3631 0.1790 ProP proline/betaine MFS transporter
105

APPENDIX I
gene blattner ratio p-value Function
A/B
proV b2677 0.4218 0.1799 proline ABC transporter
puuC b1300 1.6935 0.1184 aldehyde dehydrogenase
pykA b1854 0.7604 0.0838 pyruvate kinase II monomer
pyrB b4245 1.1503 0.1874 aspartate carbamoyltransferase, PyrB subunit
rbsC b3750 0.6695 0.0468 ribose ABC transporter
recA b2699 0.3452 0.1832
DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and ATPdependent
coprotease
relA b2784 1.2742 0.1110 GDP pyrophosphokinase / GTP pyrophosphokinase
rfe b3784 1.3370 0.2082 undecaprenyl-phosphate &alpha;-N-acetylglucosaminyl transferase
rluF b4022 1.3140 0.1201 23S rRNA pseudouridine synthase
rusA b0550 1.4113 0.1436 endodeoxyribonuclease RUS (Holliday junction resolvase)
serB b4388 0.7904 0.0773 phosphoserine phosphatase
sieB b1353 0.8383 0.1178 phage superinfection exclusion protein
slp b3506 0.4025 0.1450 outer membrane protein induced after carbon starvation
sra b1480 1.6764 0.1726
30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal
component
srlB b2704 1.2552 0.1276 GutB
tdcD b3115 0.1894 0.1458 propionate kinase / acetate kinase C
tfaS b2353 1.2824 0.0709 hypothetical protein
thiC b3994 0.9357 0.1591 thiC protein
thiE b3993 1.2669 0.1306 thiamine phosphate synthase
thiL b0417 1.2068 0.0179 thiamine phosphate kinase
torY b1873 0.4910 0.1241 trimethylamine N-oxide reductase III, c-type cytochrome subunit
torZ b1872 0.5350 0.0783 trimethylamine N-oxide reductase III, TorZ subunit
trmE b3706 1.3641 0.0940 GTP-binding protein with a role in modification of tRNA
udk b2066 1.1984 0.1082 uridine kinase / cytidine kinase
uppP b3057 0.9220 0.0886 undecaprenyl diphosphatase; bacitracin resistance
uxuA b4322 1.5879 0.1280 mannonate dehydratase
xapB b2406 0.7826 0.0813 XapB xanthosine MFS transporter
xylH b3568 0.2488 0.1621 xylose ABC transporter
xylR b3569 0.5185 0.1010 XylR-Xylose transcriptional activator
ybbV b0510 0.8643 0.0029 hypothetical protein
ybgH b0709 1.2353 0.1593 YbgH peptide POT Transporter
ycbY b0948 1.4626 0.2285 putative methyltransferase
yccA b0970 0.8900 0.1984
putative carrier/transport protein; substrate or modulator of FtsH-mediated
proteolysis
yccU b0965 1.6297 0.1818 putative NAD(P)-binding enzyme
yceH b1067 0.7620 0.2327 conserved hypothetical protein
ycgH_1 b1169 0.3656 0.1003 conserved protein; member of the Autotransporter family
ycgV b1202 0.5050 0.0863 putative adhesion and penetration protein
yciQ b1268 1.0958 0.0693 putative membrane protein
ycjS b1315 1.2033 0.2091 putative galactose 1-dehydrogenase
ycjX b1321 0.8771 0.2180 putative EC 2.1 enzyme
ydaV b1360 1.2315 0.1919 putative DNA replication factor
ydcF b1414 1.3872 0.0086 conserved hypothetical protein
ydcL b1431 1.3586 0.0134 conserved hypothetical protein
YdgF b1600 0.4729 0.0174 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydgR b1634 1.3701 0.0111 YdgR putative peptide POT Transporter
ydiQ b1697 0.7378 0.0072 putative subunit of YdiQ-YdiR flavoprotein
ydjI b1773 0.6874 0.0303 putative aldolase
yeaC b1777 1.2788 0.0410 conserved hypothetical protein
yegK b2072 0.7214 0.0032 conserved hypothetical protein
yegS b2086 1.2631 0.0064 conserved protein
yeiC b2166 0.3541 0.2324 putative kinase
yfdT b2363 1.1129 0.0883 hypothetical protein
yfeX b2431 0.7909 0.0108 conserved protein
yfiP b2583 0.7684 0.0969 conserved hypothetical protein
106

APPENDIX I
gene blattner ratio p-value Function
A/B
yfiR b2603 0.6636 0.1282 conserved protein
yfjP b2632 1.3077 0.1930 putative GTP-binding protein
ygcB b2761 0.4844 0.2032 putative enzyme
ygcI b2757 0.2748 0.2013 hypothetical protein
ygcS b2771 0.7026 0.1397 YgcS MFS transporter
ygeG b2851 0.5939 0.1993 conserved hypothetical protein
yhbG b3201 1.0641 0.0935 YhbG/YhbN ABC transporter
yhbW b3160 1.4346 0.0533 putative enzyme
yhdX b3269 0.8973 0.1366 YhdW/YhdX/YhdY/YhdZ ABC transporter
yhgE b3402 1.3316 0.1019 putative transport
yhhA b3448 1.3377 0.1710 conserved protein
yhhJ b3485 1.1309 0.1809 YhiH/YhhJ ABC transporter
yhhW b3439 1.1799 0.2435 conserved hypothetical protein
yhiM b3491 0.1095 0.0552 conserved inner membrane protein
yhiP b3496 1.1708 0.1262 YhiP peptide POT transporter
yhjD b3522 1.4333 0.0321 putative membrane protein
yicI b3656 1.8297 0.1437 putative alpha-xylosidase
yidC b3705 1.4704 0.1123 inner-membrane protein insertion factor
yihW b3884 0.8220 0.0407 putative DEOR-type transcriptional regulator
yjeM b4156 0.7016 0.1081 YjeM APC transporter
yjhC b4280 0.5790 0.1944 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase
yjhE b4282 1.2886 0.0221 KpLE2 phage-like element
yjhI b4299 0.5334 0.0761 putative regulator
yjhS b4309 1.2490 0.1765 conserved protein
yjiP b4338 0.2190 0.0587 hypothetical protein
ymfL b1147 1.2231 0.1027 hypothetical protein
ynaI b1330 0.3691 0.1029 YnaI
yneK b1527 1.2307 0.0945 conserved protein
ynjH b1760 1.2650 0.1545 conserved hypothetical protein
yphF b2548 0.8131 0.1404 YphD/YphE/YphF ABC transporter
yqaA b2689 1.5094 0.1026 putative integral membrane protein
yqcE b2775 0.3813 0.0410 YqcE MFS transporter
yqeA b2874 0.6119 0.2140 putative carbamate kinase
yqgF b2949 1.1217 0.0662 possible Holliday junction resolvase
yraR b3152 0.8804 0.0477 putative NADH dehydrogenase
yrbD b3193 1.2804 0.0766 YrbD
yrhA b3443 1.4004 0.1317 conserved hypothetical protein
ytfL b4218 0.6807 0.0752 putative transport protein
Supplementary table – VI: CSH50 wild-type (A) Vs CSH50 hns-205::Tn10 (B), Late stationary
phase
gene blattner ratio p-value Function
A/B
aas b2836 0.8153 0.0200 2-acylglycerophosphoethanolamine acyltransferase / acyl-ACP synthetase
accA b0185 0.6328 0.0126 acetyl CoA carboxylase
asnC b3743 2.7539 0.0441 AsnC transcriptional dual regulator
astA b1747 0.3481 0.0052 arginine succinyltransferase
astC b1748 0.6661 0.0099 acetylornithine transaminase, catabolic / succinylornithine transaminase
b1567 b1567 0.7803 0.0356 hypothetical protein
b3975 b3975 1.3034 0.0341 hypothetical protein
bdm b1481 0.2891 0.0268 hypothetical protein
ccmA b2201 1.4349 0.0053 CcmABCDEFGH cytochrome c biogenesis system
clpS b0881 1.4414 0.0407 specificity factor for ClpA-ClpP chaperone-protease complex
107

APPENDIX I
gene blattner ratio p-value Function
A/B
csgG b1037 0.6187 0.0112 curli production component
cspI b1552 0.2912 0.0302 cold shock protein CspI
cutC b1874 0.7767 0.0309 copper homeostasis protein
dcm b1961 0.6512 0.0238 DNA cytosine methylase
ddlA b0381 0.7805 0.0467 D-alanine-D-alanine ligase A
degS b3235 2.0142 0.0342
inner membrane serine protease required for the extracytoplasmic stress response
mediated by sigmaE
dkgA b3012 0.6653 0.0108 beta-keto ester reductase / 2,5-diketo-D-gluconate reductase A
ebgC b3077 1.2066 0.0412 evolved beta-D-galactosidase, beta subunit; cryptic gene
essQ b1556 1.3096 0.0194 hypothetical protein
fabZ b0180 1.3977 0.0405 beta-hydroxyacyl-ACP dehydratase
fdnI b1476 0.8282 0.0127 formate dehydrogenase N, &gamma; subunit
fimI b4315 0.6913 0.0188 fimbrial protein
fiu b0805 0.7727 0.0214 putative outer membrane receptor for iron transport
fixX b0044 0.8813 0.0500 putative ferredoxin possibly involved in anaerobic carnitine metabolism
folK b0142 0.7003 0.0449 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase
fruR b0080 1.5732 0.0110 FruR transcriptional dual regulator
frwD b3953 1.3246 0.0112 PTS system fructose-like IIB component 2
gadA b3517 0.1073 0.0024 glutamate decarboxylase A subunit
gadC b1492 0.2366 0.0330 XasA GABA APC transporter
galU b1236 0.5670 0.0482 UTP-glucose-1-phosphate uridylyltransferase
glgP b3428 0.7249 0.0159 glycogen phosphorylase / glycogen-maltotetraose phosphorylase
gntX b3413 1.4099 0.0310 gluconate periplasmic binding protein
grxA b0849 0.5770 0.0229 oxidized glutaredoxin
hcaT b2536 1.3120 0.0486 HcaT MFS transporter
hdeA b3510 0.0575 0.0020 acid-resistance protein, possible chaperone
hdeB b3509 0.0572 0.0013 10K-L protein, related to acid resistance protein of Shigella flexneri
hflC b4175 1.6656 0.0464 regulator of FtsH protease
hlyE b1182 0.4334 0.0228 hemolysin E
hpt b0125 1.4604 0.0051 guanine phosphoribosyltransferase / hypoxanthine phosphoribosyltransferase
hybE b2992 1.5741 0.0491 chaperone in Tat protein export
ibpA b3687 4.8015 0.0454 small heat shock protein IbpA
ibpB b3686 27.0211 0.0196 small heat shock protein IbpB
ilvG_1 b3767 0.6880 0.0458 IlvG_1
intB b4271 1.1609 0.0338 prophage P4 integrase
intZ b2442 0.6336 0.0499 putative prophage integrase
kefF b0046 0.7476 0.0460 regulator of KefC-mediated potassium transport
lexA b4043 1.2491 0.0064 LexA transcriptional repressor
mdtD b2077 0.7885 0.0485 YegB
metR b3828 1.2459 0.0091 MetR-Homocysteine transcriptional activator
mntH b2392 1.3722 0.0434 MntH manganese ion NRAMP transporter
mtn b0159 1.8303 0.0211 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase monomer
mviN b1069 1.2873 0.0435 putative virulence factor
nudC b3996 0.8052 0.0060 putative NAD+ diphosphatase
osmC b1482 0.7078 0.0028 osmotically inducible peroxidase OsmC
pdxB b2320 1.2874 0.0306 erythronate-4-phosphate dehydrogenase
pepD b0237 0.8060 0.0340 peptidase D
phnI b4099 0.8943 0.0064 phosphonate metabolism
phoA b0383 0.5971 0.0243 alkaline phosphatase
proY b0402 0.7097 0.0303 ProY cryptic proline APC transporter
rcsA b1951 0.6183 0.0022
positive DNA-binding transcriptional regulator of capsular polysaccharide
synthesis, activates its own expression
rfbA b2039 1.4182 0.0327 dTDP-glucose pyrophosphorylase
rhaD b3902 1.1347 0.0373 rhamnulose-1-phosphate aldolase monomer
rsxG b1631 1.0943 0.0407 member of SoxR-reducing complex
rzpD b0556 1.2441 0.0411 bacteriophage lambda endopeptidase homolog
serB b4388 0.6533 0.0326 phosphoserine phosphatase
108

APPENDIX I
gene blattner ratio p-value Function
A/B
srmB b2576 0.6931 0.0163 SrmB, DEAD-box RNA helicase
sufB b1683 0.7379 0.0307 component of SufB-SufC-SufD cysteine desulfurase (SufS) activator complex
tdcC b3116 0.5550 0.0418 TdcC threonine STP transporter
thiQ b0066 1.1434 0.0110 SfuC
trpS b3384 0.7488 0.0006 tryptophanyl-tRNA synthetase
ubiG b2232 0.7729 0.0299
3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol
methylase
ulaA b4193 0.8742 0.0352 eiisga
wcaF b2054 1.2259 0.0176 putative transferase
wza b2062 0.7309 0.0460
Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export
protein
xapR b2405 0.3692 0.0027 XapR transcriptional activator
xylA b3565 0.8740 0.0471 xylose isomerase
yaiY b0379 0.5364 0.0026 putative membrane protein
ybbJ b0488 2.0666 0.0366 conserved protein
ybdJ b0580 0.7815 0.0459 conserved hypothetical protein
ybdO b0603 0.6554 0.0450 putative transcriptional regulator LYSR-type
ybfC b0704 0.8179 0.0148 hypothetical protein
ybfD b0706 0.4459 0.0407 conserved protein
ybfH b0691 1.2496 0.0152 conserved hypothetical protein
ybhA b0766 0.8134 0.0431 putative phosphatase
yccV b0966 2.5767 0.0377 hemimethylated DNA-binding protein
ycfL b1104 1.3666 0.0057 conserved hypothetical protein
ycfR b1112 3.1414 0.0148 conserved hypothetical protein
ycfZ b1121 0.6103 0.0092 homolog of virulence factor
ydcL b1431 1.4454 0.0141 conserved hypothetical protein
ydcT b1441 2.1704 0.0408 YdcS/YdcT/YdcV/YdcU ABC transporter
yddE b1464 1.6330 0.0327 conserved protein
yddL b1472 0.6888 0.0412 putative outer membrane porin protein
ydeI b1536 0.2094 0.0105 conserved hypothetical protein
ydiE b1705 1.3842 0.0087 conserved hypothetical protein
ydiN b1691 0.7914 0.0208 YdiN MFS transporter
yeaU b1800 0.8373 0.0483 putative tartrate dehydrogenase
yeaY b1806 1.6602 0.0487 YeaY-outer membrane lipoprotein
yeiC b2166 0.6387 0.0344 putative kinase
yeiN b2165 0.7083 0.0244 conserved protein
yejH b2184 0.6928 0.0353 putative ATP-dependent helicase
yfdM b2356 0.8862 0.0233 hypothetical protein
yfdN b2357 0.5394 0.0352 hypothetical protein
yfdP b2359 0.8135 0.0108 hypothetical protein
ygaZ b2682 1.2508 0.0420 hypothetical protein
ygbE b2749 0.6796 0.0222 putative cytochrome oxidase subunit
ygdQ b2832 0.6987 0.0374 putative transport protein
ygdR b2833 1.8619 0.0313 conserved hypothetical protein
ygjJ b3079 0.8702 0.0362 hypothetical protein
yhdX b3269 0.8459 0.0481 YhdW/YhdX/YhdY/YhdZ ABC transporter
yhhH b3483 1.2967 0.0413 hypothetical protein
yhhJ b3485 1.4754 0.0452 YhiH/YhhJ ABC transporter
yhiK b3489 0.7613 0.0013 hypothetical protein
yhiM b3491 0.7525 0.0431 conserved inner membrane protein
yijP b3955 0.8397 0.0421 hypothetical protein; related to invasion protein of pathogenic E. coli
yjjX b4394 1.2584 0.0451 conserved hypothetical protein
ypfI b2474 0.6593 0.0264 putative acyl-CoA N-acyltransferase
yqeA b2874 0.6229 0.0368 putative carbamate kinase
yqjI b3071 0.5697 0.0445 conserved hypothetical protein
ytfM b4220 2.1209 0.0146 hypothetical protein
b0671 1.2936 0.0166
109

APPENDIX I
Supplementary table – VII: LZ41 wild-type (A) Vs LZ54 wild-type (B)
gene blattner ratio p-value Function
A/B
acrA b0463 0.6308 0.0443 AcrA Membrane Fusion Protein
adiA b4117 1.5642 0.0083 Adi
adk b0474 0.5809 0.0178 adenylate kinase
agn43 b2000 1.4617 0.0017 outer membrane fluffing protein, sim. to adhesin
apaH b0049 2.1825 0.0030 diadenosine tetraphosphatase
appC b0978 1.6125 0.0146 cytochrome bd-II terminal oxidase subunit I
apt b0469 0.3410 0.0071 adenine phosphoribosyltransferase
argO b2923 0.5996 0.0187 arginine export protein
argR b3237 0.8031 0.0265 ArgR transcriptional dual regulator
aroA b0908 0.5593 0.0075 3-phosphoshikimate-1-carboxyvinyltransferase
aroH b1704 0.3961 0.0044 2-dehydro-3-deoxyphosphoheptonate aldolase
aroK b3390 0.7329 0.0170 shikimate kinase I
aroL b0388 0.5122 0.0004 shikimate kinase II
arsR b3501 1.5818 0.0001 ArsR transcriptional regulator
artQ b0862 2.3631 0.0195 arginine ABC transporter
asd b3433 0.4470 0.0376 aspartate semialdehyde dehydrogenase
asnC b3743 2.1877 0.0338 AsnC transcriptional dual regulator
aspC b0928 0.7245 0.0228 aspartate transaminase
aspS b1866 1.7817 0.0499 aspartyl-tRNA synthetase
astD b1746 1.3761 0.0106 succinylglutamic semialdehyde dehydrogenase
astE b1744 1.5726 0.0411 succinylglutamate desuccinylase
atoA b2222 1.7283 0.0293 AtoA / putative acetate CoA-transferase
atpC b3731 1.4794 0.0280 ATP synthase, F1 complex, epsilon subunit
atpI b3739 0.5296 0.0433 AtpI
b0165 b0165 0.5418 0.0021 hypothetical protein
b0373 b0373 0.5146 0.0463 hypothetical protein
b0501 b0501 1.1869 0.0303 hypothetical protein
b1354 b1354 1.2688 0.0397 hypothetical protein
b1402 b1402 0.4643 0.0317 IS22 protein
b1500 b1500 0.6253 0.0088 hypothetical protein; gene is in an operon associated with acid resistance
b1578 b1578 0.4580 0.0067 hypothetical protein
b2651 b2651 1.4453 0.0116 hypothetical protein
b3007 b3007 0.6589 0.0484 hypothetical protein
b3044 b3044 0.4584 0.0042 IS21 protein
basS b4112 1.3828 0.0283 BasS-Phis
bcp b2480 0.5107 0.0453 thiol peroxidase
bcsC b3530 0.7130 0.0351 oxidase involved in cellulose synthesis
betI b0313 0.5288 0.0174 BetI-choline
bglF b3722 1.3763 0.0041 EIIBgl
bglH b3720 1.9505 0.0053 putative receptor protein
caiE b0035 1.6717 0.0488 caiE protein
carB b0033 0.4703 0.0049 carbamoyl phosphate synthetase
ccmB b2200 0.8787 0.0430 CcmABCDEFGH cytochrome c biogenesis system
cdd b2143 1.7025 0.0128 cytidine deaminase
cheR b1884 1.5095 0.0383 chemotaxis protein methyltransferase
cheW b1887 1.5265 0.0097 MCP-II
cheY b1882 1.5736 0.0050 CheY-Pasp
chiA b3338 1.7647 0.0006 Endochitinase
citC b0618 1.5867 0.0360 citrate lyase ligase
clcA b0155 0.5353 0.0200 EriC chloride ion ClC channel
clpB b2592 3.6839 0.0280 ClpB chaperone
110

APPENDIX I
cmr b0842 0.3146 0.0056 MdfA/Cmr MFS multidrug transporter
coaE b0103 0.4061 0.0235 dephospho-CoA kinase
cobS b1992 0.7606 0.0094 cobalamin 5'-phosphate synthase / cobalamin synthase
codA b0337 0.2755 0.0046 cytosine deaminase
codB b0336 0.1651 0.0003 CodB cytosine NCS1 transporter
corA b3816 0.2820 0.0025 CorA magnesium ion MIT transporter
cpdA b3032 0.5229 0.0466 cAMP phosphodiesterase
creB b4398 0.3404 0.0081 CreB- Phosphorylated transcriptional regulator
crl b0240 0.3345 0.0017 Crl transcriptional regulator
crr b2417 1.2769 0.0161 EIIBCMalX
csgF b1038 0.5393 0.0369 curli assembly component
cspB b1557 0.2269 0.0473 cold shock protein CspB
cspF b1558 0.2144 0.0418 cold shock protein CspF
cspG b0990 0.0764 0.0004 cold shock protein CspG
cstA b0598 0.5763 0.0340 peptide transporter induced by carbon starvation
cusC b0572 1.5999 0.0057 outer membrane factor of the CusCFBA copper efflux system
cybB b1418 0.4129 0.0035 cytochrome b561
cynR b0338 1.4489 0.0241 CynR-Cyanate transcriptional activator
cysA b2422 1.4211 0.0004 sulfate ABC transporter
cysG b3368 1.5439 0.0416
uroporphyrinogen methyltransferase / 1,3-dimethyluroporphyrinogen III
dehydrogenase / siroheme ferrochelatase
cysM b2421 0.5164 0.0458 O-acetylserine (thiol)-lyase B
cysP b2425 0.6509 0.0424 thiosulfate ABC transporter
cysS b0526 0.5991 0.0153 cysteinyl-tRNA synthetase
cytR b3934 0.5115 0.0315 CytR-cytidine
dapA b2478 0.3715 0.0309 dihydrodipicolinate synthase
dapF b3809 0.5113 0.0165 diaminopimelate epimerase
ddpX b1488 1.7864 0.0151 D-Ala-D-Ala dipeptidase
deaD b3162 0.4180 0.0153 CsdA, DEAD-box RNA helicase
degS b3235 0.4224 0.0416
inner membrane serine protease required for the extracytoplasmic stress response
mediated by sigmaE
deoA b4382 2.2452 0.0294 thymidine phosphorylase / uracil phosphorylase
deoC b4381 2.9812 0.0289 deoxyribose-phosphate aldolase
deoD b4384 1.5761 0.0146
purine nucleoside phosphorylase / guanosine phosphorylase / deoxyguanosine
phosphorylase / inosine phosphorylase / deoxyinosine phosphorylase / adenine
phosphorylase / deoxyadenosine phosphorylase
dgkA b4042 0.7702 0.0459 diacylglycerol kinase
dnaB b4052 0.1732 0.0010 chromosome replication; chain elongation; part of primosome
dnaJ b0015 2.4637 0.0141 chaperone with DnaK; heat shock protein
dnaK b0014 2.8269 0.0266 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins
dpiB b0619 0.6511 0.0237 DpiB
dsbC b2893 0.4949 0.0056 DsbCoxidized
dusA b4049 0.4059 0.0115 tRNA dihydrouridine synthase
dusB b3260 0.8122 0.0209 tRNA dihydrouridine synthase
dusC b2140 0.5406 0.0092 tRNA dihydrouridine synthase
ecfB b2969 0.7627 0.0191 putative protein exporter (General Secretory Pathway)
ecpD b0140 2.2895 0.0056 probable pilin chaperone similar to PapD
edd b1851 1.2374 0.0468 phosphogluconate dehydratase
elaC b2268 0.5434 0.0212 binuclear zinc phosphodiesterase monomer
endA b2945 1.2107 0.0482 DNA-specific endonuclease I
eno b2779 1.5546 0.0318 enolase
entC b0593 1.4434 0.0295 isochorismate synthase, enterobactin specific
entS b0591 0.4444 0.0291 YbdA MFS transporter
era b2566 0.4194 0.0021 GTP-binding protein
eutD b2458 1.7723 0.0307 putative phosphate acetyltransferase, ethanolamine utilization
eutN b2456 1.2249 0.0189 putative detox protein, ethanolamine utilization
evgA b2369 2.8597 0.0440 EvgA-Phosphorylated transcriptional regulator
exbB b3006 0.4761 0.0222 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins
exuR b3094 0.5125 0.0127 ExuR transcriptional repressor
111

APPENDIX I
fabB b2323 0.6336 0.0043 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase
fadA b3845 1.7143 0.0296 3-ketoacyl-CoA thiolase
fbaA b2925 1.6290 0.0164 fructose bisphosphate aldolase monomer
fdhE b3891 0.5586 0.0161 protein that affects formate dehydrogenase-N activity
fdnG b1474 1.3249 0.0138 formate dehydrogenase N, &alpha; subunit
fdnI b1476 1.2886 0.0205 formate dehydrogenase N, &gamma; subunit
fdx b2525 1.7242 0.0044 oxidized ferredoxin
fecA b4291 1.5609 0.0011
outer membrane receptor; citrate-dependent iron transport, outer membrane
receptor
fecB b4290 1.3416 0.0287 ferric dicitrate uptake system
fecE b4287 1.6438 0.0310 ferric dicitrate uptake system
ffh b2610 1.2699 0.0362 protein component of the signal recognition particle (SRP)
fhuA b0150 0.3657 0.0280
FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1,
T5, and phi80
fhuE b1102 1.2073 0.0239 outer membrane receptor for ferric iron uptake
fis b3261 0.6869 0.0371 Fis transcriptional dual regulator
fixB b0042 1.4473 0.0371 probable flavoprotein subunit required for anaerobic carnitine metabolism
fkpB b0028 0.6004 0.0250 peptidylprolyl isomerase
fldA b0684 1.4242 0.0442 oxidized flavodoxin 1
flgA b1072 4.8974 0.0024 flagellar biosynthesis; assembly of basal-body periplasmic P ring
flgB b1073 3.8020 0.0007 flagellar basal-body rod protein FlgB
flgC b1074 3.0031 0.0070 flagellar basal-body rod protein FlgC
flgD b1075 2.2868 0.0061 flagellar biosynthesis, initiation of hook assembly
flgE b1076 2.0251 0.0033 flagellar hook protein FlgE
flgF b1077 3.8985 0.0053 flagellar basal-body rod protein FlgF
flgG b1078 4.7678 0.0097 flagellar basal-body rod protein FlgG
flgH b1079 4.1712 0.0007
flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide
layer) ring protein
flgI b1080 3.1896 0.0062 flagellar P-ring protein FlgI
flgJ b1081 2.6426 0.0051 FlgJ
flgM b1071 3.2776 0.0167 anti-FliA (anti-sigma) factor; also known as RflB protein
flhD b1892 0.3694 0.0068 FlhD transcriptional dual regulator
fliJ b1942 3.5076 0.0196 flagellar biosynthesis protein FliJ
fliY b1920 1.4499 0.0446
periplasmic cystine-binding protein; member of extracellular bacterial solutebinding
protein family III
folA b0048 0.2448 0.0312 dihydrofolate reductase, type I
folD b0529 0.6301 0.0126
methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase /
methylenetetrahydrofolate dehydrogenase-(NADP+)
folE b2153 0.7792 0.0323 GTP cyclohydrolase I
fre b3844 1.6941 0.0218 FMN reductase
frlD b3374 1.3997 0.0269 fructoselysine 6-kinase
frmA b0356 1.4216 0.0269 formaldehyde dehydrogenase, glutathione-dependent
frsA b0239 0.3476 0.0375 fermentation/respiration switch protein
fruA b2167 1.9402 0.0169 EIIFru
fruB b2169 3.0732 0.0052 EIIFru
fruK b2168 2.8047 0.0036 1-phosphofructokinase monomer
frvA b3900 1.6136 0.0067 EIIABCFrv
ftsL b0083 0.6861 0.0288 essential cell division protein FtsL
ftsY b3464 1.3341 0.0141 SRP receptor
ftsZ b0095 1.2673 0.0362 essential cell division protein FtsZ
fumB b4122 1.5703 0.0144 fumarase B monomer
fxsA b4140 1.7993 0.0107 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7
gabT b2662 1.3938 0.0210 4-aminobutyrate aminotransferase monomer
galM b0756 0.4417 0.0141 aldose-1-epimerase
galU b1236 0.9245 0.0435 UTP-glucose-1-phosphate uridylyltransferase
gapA b1779 1.5277 0.0455 glyceraldehyde 3-phosphate dehydrogenase-A monomer
gapC_1 b1417 0.3207 0.0054 split glyceraldehyde 3-phosphate dehydrogenase C
gapC_2 b1416 0.3808 0.0072 glyceraldehyde 3-phosphate dehydrogenase C, interrupted
gatA b2094 1.8580 0.0319 EIIGat
gcvA b2808 0.6508 0.0371 GcvA transcriptional dual regulator
112

APPENDIX I
gcvH b2904 0.3188 0.0137 dihydrolipoyl-GcvH-protein
gcvR b2479 0.2239 0.0056 GcvR-gly
gcvT b2905 0.3352 0.0343 aminomethyltransferase
gidA b3741 1.8465 0.0137 protein involved in a tRNA modification pathway
gidB b3740 1.4613 0.0164
protein with a methyltransferase fold and a possible role in chromosome
replication
glgS b3049 1.4156 0.0496 glycogen biosynthesis, rpoS dependent
glmS b3729 0.4371 0.0445 L-glutamine:D-fructose-6-phosphate aminotransferase
glmU b3730 0.2036 0.0015
N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate
acetyltransferase
glnD b0167 1.5034 0.0024 uridylyltransferase / uridylyl-removing enzyme
glnH b0811 3.3975 0.0027 glutamine ABC transporter
glnL b3869 0.6764 0.0331 NtrB
glnP b0810 2.5879 0.0108 glutamine ABC transporter
glnQ b0809 2.8329 0.0290 glutamine ABC transporter
glpD b3426 0.5911 0.0107 glycerol 3-phosphate dehydrogenase, aerobic
glpG b3424 0.4628 0.0143 inner membrane-associated protein of glp regulon
gltJ b0654 1.6394 0.0293 glutamate ABC transporter
gltS b3653 0.4306 0.0171 glutamate GltS transporter
glvB b3682 0.6799 0.0498 subunit of EIIBCGlv
glyA b2551 0.4848 0.0252 glycine hydroxymethyltransferase
gnd b2029 1.3868 0.0122 6-phosphogluconate dehydrogenase (decarboxylating)
gntR b3438 1.6774 0.0056 GntR-gluconate
gntY b3414 2.1327 0.0397
predicted membrane-bound protein that is involved in high-affinity gluconate
transport
gph b3385 2.2255 0.0008 phosphoglycolate phosphatase
gpt b0238 0.2560 0.0022
xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase /
hypoxanthine phosphoribosyltransferase
groL b4143 4.0315 0.0048 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein
grpE b2614 2.5774 0.0005 phage lambda replication; host DNA synthesis; heat shock protein; protein repair
gshB b2947 0.5455 0.0014 glutathione synthetase subunit
gspL b3333 1.6779 0.0357 putative protein secretion protein for export
gssA b2988 1.2719 0.0207 glutathionylspermidine synthetase / glutathionylspermidine amidase
guaB b2508 0.4094 0.0161 IMP dehydrogenase
gutQ b2708 0.8036 0.0386 protein with a sugar isomerase domain
gyrA b2231 2.0736 0.0147 DNA gyrase, subunit A
gyrB b3699 2.3694 0.0125 DNA gyrase, subunit B
hdeA b3510 1.5879 0.0430 acid-resistance protein, possible chaperone
hdeB b3509 1.4411 0.0245 10K-L protein, related to acid resistance protein of Shigella flexneri
hemC b3805 0.2280 0.0041 hydroxymethylbilane synthase
hemD b3804 0.3594 0.0026 uroporphyrinogen III synthase
hemN b3867 0.5050 0.0222 coproporphyrinogen III oxidase, anaerobic
hisC b2021 0.4224 0.0011 histidine-phosphate aminotransferase
hisD b2020 0.2929 0.0068 histidinal dehydrogenase / histidinol dehydrogenase
hisS b2514 0.4605 0.0043 histidyl-tRNA synthetase
holA b0640 1.5856 0.0127 DNA polymerase III, delta subunit
holC b4259 0.3684 0.0138 DNA polymerase III, chi subunit
holD b4372 1.2748 0.0169 DNA polymerase III, psi subunit
holE b1842 0.3028 0.0133 DNA polymerase III, theta subunit
hscA b2526 1.3123 0.0271 chaperone, member of Hsp70 protein family
hslO b3401 2.2344 0.0459 molecular chaperone Hsp33
hslR b3400 2.1711 0.0238 heat shock protein Hsp15
hslU b3931 2.3896 0.0292 ATPase component of the HslVU protease
htrA b0161 1.4630 0.0500 DegP
htrL b3618 6.3708 0.0079 involved in lipopolysaccharide biosynthesis
hupA b4000 1.7633 0.0170 DNA-binding protein HU-alpha (HU-2)
hyaA b0972 3.0036 0.0427 hydrogenase I, HyaA subunit
hycC b2723 1.5122 0.0284 HycC
hypF b2712 1.3499 0.0196 hydrogenase maturation protein
113

APPENDIX I
ibpA b3687 2.4960 0.0181 small heat shock protein IbpA
icdA b1136 0.4590 0.0372 Icd
ilvB b3671 0.2982 0.0162 IlvB / putative 2-hydroxyglutarate synthase
ilvD b3771 0.4038 0.0384 dihydroxy-acid dehydratase
ilvE b3770 0.6301 0.0172 branched chain amino acid aminotransferase
ilvG_1 b3767 0.1723 0.0016 IlvG_1
ilvM b3769 0.2445 0.0021 acetohydroxybutanoate synthase II / acetolactate synthase II
imp b0054 0.4662 0.0012 organic solvent tolerance
inaA b2237 0.3959 0.0046 pH-inducible protein involved in stress response
intR b1345 0.2726 0.0058 putative transposase
iscA b2528 1.4419 0.0027 iron-sulfur cluster assembly protein
iscR b2531 1.4496 0.0114 IscR transcriptional regulator
iscS b2530 1.4231 0.0277 cysteine desulfurase monomer
iscX b2524 1.5162 0.0325 protein with possible role in iron-sulfur cluster biogenesis
ispA b0421 0.1884 0.0089 geranyl diphosphate synthase / farnesyl diphosphate synthase
ispB b3187 0.5571 0.0115 octaprenyl diphosphate synthase
ispD b2747 0.5815 0.0136 4-diphosphocytidyl-2C-methyl-D-erythritol synthetase monomer
ispG b2515 0.3474 0.0431 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase
kdgT b3909 0.3451 0.0140 KdgT 2-keto-3-deoxygluconate transporter
kdpA b0698 1.6937 0.0216 potassium ion P-type ATPase transporter
kdpB b0697 0.8031 0.0119 potassium ion P-type ATPase transporter
kdpD b0695 1.5142 0.0271 KdpD-Phis
kdsC b3198 0.4227 0.0092 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase monomer
kdtA b3633 0.4096 0.0361 KDO transferase
lamB b4036 2.1449 0.0483 phage lambda receptor protein; maltose high-affinity receptor
ldcA b1192 0.6533 0.0323 L,D-carboxypeptidase A
lepA b2569 0.3884 0.0089 GTP-binding elongation factor, may be inner membrane protein
leuA b0074 0.5502 0.0232 2-isopropylmalate synthase
leuD b0071 0.8324 0.0343 isopropylmalate isomerase
leuO b0076 0.4671 0.0383 LeuO transcriptional activator
ligT b0147 0.3612 0.0043 hypothetical protein
lipB b0630 1.8242 0.0342 lipoyl-protein ligase
lolB b1209 0.4537 0.0046 outer membrane lipoprotein, localization of lipoproteins in the outer membrane
lolC b1116 0.4315 0.0356 LolCDE ABC lipoprotein transporter
lolD b1117 0.6023 0.0038 LolCDE ABC lipoprotein transporter
lolE b1118 0.4199 0.0393 LolCDE ABC lipoprotein transporter
lon b0439 2.0180 0.0071 DNA-binding, ATP-dependent protease La
lpcA b0222 0.3721 0.0282 lipopolysaccharide core biosynthesis; phosphoheptose isomerase
lpxK b0915 1.3126 0.0035 tetraacyldisaccharide 4'-kinase
lrhA b2289 0.7251 0.0129 LrhA transcriptional repressor
lspA b0027 0.5579 0.0203 prolipoprotein signal peptidase (SPase II)
maa b0459 0.6307 0.0483 maltose acetyltransferase
macB b0879 1.5831 0.0121 MacAB macrolide efflux transporter complex
manA b1613 0.5844 0.0131 mannose-6-phosphate isomerase
mdtK b1663 0.4735 0.0183 NorE multidrug efflux MATE transporter
menD b2264 0.4174 0.0067
putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate
decarboxylase
menF b2265 0.2973 0.0031 isochorismate synthase, menaquinone-specific
mepA b2328 1.3493 0.0164 murein DD-endopeptidase, penicillin-insensitive
metB b3939 0.4626 0.0078 O-succinylhomoserine lyase / O-succinylhomoserine(thiol)-lyase
metL b3940 1.7369 0.0443 aspartate kinase II / homoserine dehydrogenase II
mfd b1114 0.8365 0.0468 transcription-repair coupling factor; mutation frequency decline
mhpD b0350 1.8046 0.0472 2-keto-4-pentenoate hydratase
mhpE b0352 1.4561 0.0483 4-hydroxy-2-ketovalerate aldolase
miaA b4171 0.7647 0.0368 delta(2)-isopentenylpyrophosphate tRNA-adenosine transferase
minC b1176 0.2576 0.0099
cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that
regulate septum placement
membrane ATPase of the MinC-MinD-MinE system that regulates septum
minD b1175 0.3669 0.0070 placement
114

APPENDIX I
minE b1174 0.3218 0.0180
cell division topological specificity factor and inhibitory component of the MinC-
MinD-MinE system that regulates septum placement
mioC b3742 2.8032 0.0061 flavoprotein involved in biotin synthesis
mltC b2963 0.3174 0.0208 membrane-bound lytic murein transglycosylase C
mngB b0732 1.4808 0.0136 alpha-mannosidase
moaA b0781 0.3113 0.0250 molybdopterin biosynthesis, protein A
modE b0761 0.5883 0.0400 Molybdate-responsive transcription factor monomer
mokC b0018 1.6023 0.0201 regulatory peptide whose translation enables hokC (gef) expression
mraW b0082 0.6100 0.0309 S-adenosyl-dependent methyltransferase
mrdB b0634 0.6931 0.0113 rod shape-determining membrane protein; sensitivity to radiation and drugs
mreB b3251 0.4151 0.0130 rod shape-determining protein
mreC b3250 0.5547 0.0187 rod shape-determining protein
mreD b3249 0.4030 0.0041 rod shape-determining protein
msbB b1855 0.2631 0.0138 myristoyl acyltransferase
mukE b0923 0.2778 0.0005 protein involved in chromosome partitioning
mukF b0922 0.2472 0.0062 Ca2+-binding protein involved in chromosome partitioning
mutY b2961 0.2826 0.0046 adenine glycosylase; G.C --> T.A transversions
nadA b0750 1.2867 0.0026 quinolinate synthetase A
nagZ b1107 0.3709 0.0144 &beta;-N-acetylglucosaminidase
nanR b3226 0.6046 0.0191 NanR transcriptional regulator
narG b1224 1.4419 0.0422 nitrate reductase A, &alpha; subunit
narP b2193 0.4244 0.0046 NarP-Phosphorylated transcriptional regulator
ndh b1109 0.2794 0.0021 NADH cupric reductase / NADH dehydrogenase II
ndk b2518 0.5490 0.0297
nucleoside diphosphate kinase / UDP kinase / CDP kinase / dUDP kinase / dCDP
kinase / dTDP kinase / dADP kinase / dGDP kinase / GDP kinase
nhaA b0019 2.7531 0.0189 sodium/proton NhaA transporter
nhaR b0020 1.8006 0.0051 NhaR-Na+ transcriptional activator
nirD b3366 1.2750 0.0385 nitrite reductase, small subunit
nlpB b2477 0.3204 0.0188 lipoprotein-34
nlpC b1708 0.8276 0.0132 NlpC-putative lipoprotein hydrolase
nlpD b2742 0.4725 0.0091 NlpD putative outer membrane lipoprotein
npr b3206 1.1115 0.0239
phosphocarrier protein HPr-like NPr, nitrogen related, exchanges phosphate with
Enzyme I, Hpr
nth b1633 2.1070 0.0198 endonuclease III; specific for apurinic and/or apyrimidinic sites
nudF b3034 0.4112 0.0010 hypothetical protein
nudG b1759 0.6794 0.0394 CTP pyrophosphohydrolase
nudH b2830 0.4781 0.0025 putative invasion protein
nuoA b2288 1.6603 0.0436 NADH dehydrogenase I
nuoB b2287 2.1552 0.0017 NADH dehydrogenase I
nuoC b2286 1.5429 0.0056 NADH dehydrogenase I
nuoE b2285 1.4073 0.0195 NADH dehydrogenase I
nuoF b2284 1.6783 0.0075 NADH dehydrogenase I
nusB b0416 0.5649 0.0227 transcription termination; L factor
nusG b3982 0.1716 0.0023 component in transcription antitermination
ogrK b2082 1.8738 0.0121 OgrK transcriptional regulator
ompX b0814 1.3900 0.0297 outer membrane protein X
osmB b1283 1.9992 0.0416 OsmB osmotically inducible lipoprotein
oxyR b3961 3.1506 0.0058 OxyR transcriptional dual regulator
paaJ b1397 1.4298 0.0499 putative beta-keto-thiolase of phenylacetate degradation
pabA b3360 1.4655 0.0359
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
pabC b1096 0.3015 0.0413
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
pagP b0622 2.7254 0.0221 PagP monomer
panB b0134 0.5034 0.0001 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer
panF b3258 0.6070 0.0178 PanF sodium/pantothenate SSS transporter
parC b3019 0.3991 0.0037 Topoisomerase IV subunit A
pcnB b0143 0.5626 0.0040 poly(A) polymerase I
pdxH b1638 0.5820 0.0297 pyridoxine 5'-phosphate oxidase / pyridoxamine 5'-phosphate oxidase
pepB b2523 1.8383 0.0128 aminopeptidase (AP)
115

APPENDIX I
pepP b2908 1.2182 0.0368 proline aminopeptidase P II
pepQ b3847 2.4602 0.0335 proline dipeptidase
pfkB b1723 1.4328 0.0085 6-phosphofructokinase-2 monomer
pflA b0902 2.1225 0.0090 pyruvate formate-lyase activating enzyme
pgaC b1022 1.4003 0.0250 predicted N-glycosyltransferase
pgi b4025 0.7116 0.0462 phosphoglucose isomerase
pgpA b0418 0.5727 0.0094 phosphatidylglycerophosphatase A
pheP b0576 0.4252 0.0250 PheP phenylalanine APC transporter
phoE b0241 1.3013 0.0094 PhoE
phoH b1020 1.4888 0.0191
PhoB-dependent, ATP-binding pho regulon component; may be helicase; induced
by P starvation
phoP b1130 0.4417 0.0115 PhoP-Phosphorylated transcriptional dual regulator
phoQ b1129 0.6685 0.0013 PhoQ-Phis
pitB b2987 1.3798 0.0445 PitB
plsC b3018 0.3763 0.0024 1-acylglycerol-3-phosphate acyltransferase
pmbA b4235 0.5564 0.0213
protease involved in Microcin B17 maturation and in sensitivity to the DNA
gyrase inhibitor LetD
pmrD b2259 0.4652 0.0050 polymyxin resistance protein
pncB b0931 0.2923 0.0110 nicotinate phosphoribosyltransferase
pnp b3164 0.2968 0.0110 polynucleotide phosphorylase
polB b0060 4.3621 0.0499 DNA polymerase II
potB b1125 0.5130 0.0375 putrescine/spermidine ABC transporter
potC b1124 0.5813 0.0046 putrescine/spermidine ABC transporter
poxA b4155 0.5427 0.0338 putative regulator of pyruvate oxidase
ppiD b0441 0.6513 0.0198 peptidyl-prolyl cis-trans isomerase
ppk b2501 0.3301 0.0114 polyphosphate kinase
ppsA b1702 0.7593 0.0328 phosphoenolpyruvate synthase
priC b0467 0.5875 0.0232 primosomal replication protein N''
prmC b1212 0.7663 0.0275 protein-(glutamine-N5) methyltransferase
proP b4111 0.4204 0.0214 ProP proline/betaine MFS transporter
proQ b1831 0.5181 0.0394 protein that affects osmoregulation of ProP transporter
proV b2677 0.3005 0.0108 proline ABC transporter
proW b2678 0.3934 0.0291 proline ABC transporter
psd b4160 0.5710 0.0213 phosphatidylserine decarboxylase, proenzyme
pspB b1305 1.6459 0.0420
stimulates PspC-mediated transcriptional activation of the psp operon; antitoxin of
a PspC-PspB toxin-antitoxin pair
pssA b2585 0.1873 0.0040 phosphatidylserine synthase
purA b4177 0.5024 0.0178 adenylosuccinate synthase
purB b1131 0.6679 0.0119
5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase /
adenylosuccinate lyase
purC b2476 0.1510 0.0007 phosphoribosylaminoimidazole-succinocarboxamide synthase
purE b0523 0.3132 0.0136 N5-carboxyaminoimidazole ribonucleotide mutase
purF b2312 0.2208 0.0011 amidophosphoribosyl transferase
purK b0522 0.2617 0.0039 N5-carboxyaminoimidazole ribonucleotide synthase monomer
purM b2499 0.0976 0.0007 phosphoribosylformylglycinamide cyclo-ligase
purN b2500 0.3565 0.0063 phosphoribosylglycinamide formyltransferase
purR b1658 0.1999 0.0032 PurR transcriptional repressor
purT b1849 0.5923 0.0436 GAR transformylase 2
purU b1232 0.4050 0.0031 formyltetrahydrofolate deformylase
puuD b1298 0.6547 0.0166 probable amidotransferase subunit
pyrB b4245 0.4134 0.0108 aspartate carbamoyltransferase, PyrB subunit
pyrC b1062 0.6009 0.0278 dihydroorotase
pyrD b0945 0.3694 0.0012 dihydroorotate oxidase
radA b4389 0.5088 0.0089 DNA recombination protein
rbfA b3167 0.7704 0.0239 ribosome-binding factor A
rbsB b3751 2.1321 0.0323 ribose ABC transporter
rcsB b2217 0.5589 0.0202 RcsB transcriptional activator
rcsC b2218 0.6588 0.0017 RcsC-Phis
rdgC b0393 0.4658 0.0035 nonspecific DNA binding protein; nucleoid component
116

APPENDIX I
recA b2699 6.1477 0.0006
DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and
ATP-dependent coprotease
recF b3700 1.5026 0.0018 ssDNA and dsDNA binding, ATP binding
recN b2616 5.2322 0.0003 protein used in recombination and DNA repair
recX b2698 3.3785 0.0128 inhibitor of RecA
relA b2784 0.6144 0.0009 GDP pyrophosphokinase / GTP pyrophosphokinase
rfaE b3052 1.6731 0.0393 putative kinase
rfaH b3842 0.6886 0.0257 RfaH transcriptional regulator
rfaI b3627 3.7837 0.0015 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase
rfaJ b3626 3.0420 0.0174 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase
rfaK b3623 3.1584 0.0170 lipopolysaccharide core biosynthesis; probably hexose transferase
rfaS b3629 2.8794 0.0068 lipopolysaccharide core biosynthesis
rfaZ b3624 3.4532 0.0385 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis
rfbB b2041 0.7441 0.0376 RmlB
rhlB b3780 0.5316 0.0049 ATP-dependent RNA helicase of the RNA degradosome
rhlE b0797 0.2790 0.0010 DEAD-box-containing ATP-dependent RNA helicase family member
rhsD b0497 0.5670 0.0166 RhsD protein in rhs element
ribB b3041 0.4644 0.0229 3,4-dihydroxy-2-butanone 4-phosphate synthase
ribC b1662 0.6318 0.0401 riboflavin synthase
ribF b0025 0.1259 0.0103 riboflavin kinase / FMN adenylyltransferase
rihA b0651 1.8484 0.0409 ribonucleoside hydrolase 1 (pyrimidine-specific)
rimJ b1066 0.4103 0.0066
acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
rluC b1086 0.3153 0.0041 23S rRNA pseudouridine synthase
rluD b2594 0.7043 0.0136 23S rRNA pseudouridine synthase
rluE b1135 1.6545 0.0240 23S rRNA pseudouridine synthase
rnc b2567 0.2112 0.0002 RNase III, ds RNA
rng b3247 0.7647 0.0261 ribonuclease G (RNAse G) monomer
rnhA b0214 0.3725 0.0125 RNase HI, degrades RNA of DNA-RNA hybrids, participates in DNA replication
rnr b4179 0.5088 0.0147 RNAse R
rplY b2185 1.4198 0.0156 50S ribosomal subunit protein L25
rpmE b3936 1.9883 0.0287 50S ribosomal subunit protein L31
rpoA b3295 1.7187 0.0281 RNA polymerase, alpha subunit
rpoH b3461 1.5408 0.0047 sigma32 factor
rpsJ b3321 1.7179 0.0451 30S ribosomal subunit protein S10
rpsL b3342 1.3159 0.0319 30S ribosomal subunit protein S12
rpsU b3065 2.0799 0.0248 30S ribosomal subunit protein S21
rspA b1581 2.2521 0.0444 starvation sensing protein RspA
rspB b1580 1.2583 0.0486 putative dehydrogenase RspB
rssA b1234 0.2763 0.0088 hypothetical protein
rsuA b2183 0.3324 0.0011 16S rRNA pseudouridine synthase
rsxE b1632 1.6861 0.0192 integral membrane protein of SoxR-reducing complex
sdaC b2796 0.5269 0.0174 SdaC serine STP transporter
sdhA b0723 1.8472 0.0183 succinate dehydrogenase flavoprotein
sdhB b0724 2.4021 0.0348 succinate dehydrogenase iron-sulfur protein
secE b3981 0.1598 0.0033 Sec Protein Secretion Complex
secF b0409 0.8540 0.0394 Sec Protein Secretion Complex
secG b3175 0.3039 0.0132 Sec Protein Secretion Complex
selA b3591 0.7449 0.0144 selenocysteine synthase monomer
sgbH b3581 1.2423 0.0155 3-keto-L-gulonate 6-phosphate decarboxylase
sieB b1353 0.8425 0.0185 phage superinfection exclusion protein
slt b4392 0.6966 0.0171 soluble lytic murein transglycosylase
slyA b1642 0.4284 0.0138 SlyA transcriptional activator
slyB b1641 0.4100 0.0358 putative outer membrane protein
slyD b3349 1.3580 0.0393 FKBP-type rotamase, peptidyl prolyl cis-trans isomerase
smf b4473 0.6389 0.0144 hypothetical protein
smg b3284 0.3104 0.0016 hypothetical protein
smpA b2617 3.0746 0.0330 SmpA small membrane protein A
smtA b0921 0.1732 0.0009 S-adenosylmethionine-dependent methyltransferase
117

APPENDIX I
speG b1584 0.4151 0.0001 spermidine acetyltransferase
spr b2175 0.1856 0.0008 putative lipoprotein
spy b1743 1.8051 0.0064 periplasmic protein related to spheroblast formation
srmB b2576 0.1828 0.0018 SrmB, DEAD-box RNA helicase
sscR b2765 0.2846 0.0014 putative 6-pyruvoyl tetrahydrobiopterin synthase
sspA b3229 1.7853 0.0360 regulator of transcription; stringent starvation protein A
sspB b3228 1.6995 0.0121 SspB monomer
sthA b3962 1.9483 0.0152 soluble pyridine nucleotide transhydrogenase
sucA b0726 1.7723 0.0282 subunit of E1(0) component of 2-oxoglutarate dehydrogenase
suhB b2533 0.6030 0.0333 inositol monophosphatase
sulA b0958 0.4776 0.0294 suppressor of lon; inhibits cell division and ftsZ ring formation
syd b2793 0.7172 0.0401 interacts with secY
tdcD b3115 1.3690 0.0028 propionate kinase / acetate kinase C
tdcE b3114 1.8820 0.0225 2-ketobutyrate formate-lyase / pyruvate formate-lyase 4
tdh b3616 1.6683 0.0198 threonine dehydrogenase
tesA b0494 0.4861 0.0342 lysophospholipase L1 / thioesterase I
thiI b0423 0.3635 0.0002 ThiI protein
thyA b2827 1.6662 0.0186 thymidylate synthase
tpiA b3919 1.1555 0.0049 triose phosphate isomerase monomer
tra5-5 b2089 0.5946 0.0481
treB b4240 1.9360 0.0274 EIITre
treC b4239 1.8400 0.0022 trehalose-6-phosphate hydrolase
trkA b3290 1.6751 0.0358 TrkA
trkG b1363 1.7115 0.0118 TrkG potassium ion Trk Transporter
trmD b2607 1.4999 0.0322 tRNA (guanine-1-)-methyltransferase
trpB b1261 0.8425 0.0438 tryptophan synthase, beta subunit
trpD b1263 0.5060 0.0140 anthranilate synthase component II
trpE b1264 0.4037 0.0115 anthranilate synthase component I
trpL b1265 0.7864 0.0299 trp operon leader peptide
trpR b4393 1.7569 0.0049 TrpR transcriptional repressor
trpS b3384 2.1106 0.0124 tryptophanyl-tRNA synthetase
tsgA b3364 0.6442 0.0017 YhfC MFS transporter
tsr b4355 0.6068 0.0399 MCP-I
tsx b0411 0.1946 0.0016 nucleoside channel; receptor of phage T6 and colicin K
ttk b3641 0.4174 0.0019 Ttk transcriptional regulator
ubiC b4039 0.2098 0.0001 chorismate pyruvate lyase
ubiF b0662 1.5458 0.0334 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase
ubiG b2232 0.7780 0.0016
3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol
methylase
uhpB b3668 0.5983 0.0403 UhpB-Phis
uidA b1617 1.2711 0.0362 beta-glucuronidase
ulaE b4197 0.7571 0.0368 L-xylulose 5-phosphate 3-epimerase
ulaF b4198 0.7998 0.0198 L-ribulose 5-phosphate 4-epimerase
ung b2580 0.6029 0.0221 uracil-DNA-glycosylase
upp b2498 0.4553 0.0208 uracil phosphoribosyltransferase
uvrB b0779 1.9034 0.0153 DNA repair; excision nuclease subunit B
vacJ b2346 0.6153 0.0168 putative lipoprotein
visC b2906 1.7240 0.0071 hypothetical protein
waaP b3630 1.9894 0.0370 lipopolysaccharide core biosynthesis; phosphorylation of core heptose
wbbI b2034 1.6114 0.0023 hypothetical protein; not required for colanic acid biosynthesis
wbbK b2032 1.3531 0.0045 putative transferase
wcaA b2059 1.5321 0.0226 putative regulator
wcaB b2058 1.4575 0.0374 putative transferase
wcaD b2056 1.6890 0.0022 putative colanic acid polymerase
wcaJ b2047 1.6790 0.0013 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase
wza b2062 1.3425 0.0424
Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export
protein
xapR b2405 0.7902 0.0250 XapR transcriptional activator
xerD b2894 0.4150 0.0016 site-specific recombinase
118

APPENDIX I
xseB b0422 0.1805 0.0061 exonuclease VII, small subunit
xylR b3569 0.5246 0.0295 XylR-Xylose transcriptional activator
yabP b0056 0.4221 0.0292 conserved hypothetical protein
yafK b0224 0.1376 0.0369
conserved protein; in enteroaggregative E. coli, YafK is required for development
of biofilms
yagA b0267 1.6600 0.0302 hypothetical protein
yagI b0272 0.3762 0.0042 putative regulator
yagT b0286 1.5660 0.0376 putative oxidoreductase, Fe-S subunit
yagU b0287 1.2317 0.0268 conserved protein
ybaJ b0461 0.2544 0.0048 conserved hypothetical protein
ybaN b0468 0.3530 0.0019 hypothetical protein
ybaO b0447 1.2709 0.0229 putative LRP-like transcriptional regulator
ybaV b0442 0.5407 0.0434 conserved hypothetical protein
ybbO b0493 0.6285 0.0137 putative oxidoreductase
ybcJ b0528 0.5730 0.0490 putative RNA-binding protein
ybcK b0544 1.1512 0.0052 hypothetical protein
ybeA b0636 0.4138 0.0056 conserved hypothetical protein
ybeB b0637 0.4743 0.0070 conserved hypothetical protein
ybeD b0631 2.5488 0.0424 conserved hypothetical protein
ybeY b0659 3.2204 0.0213 conserved hypothetical protein
ybeZ b0660 3.8440 0.0151 putative ATP-binding protein
ybfF b0686 0.4315 0.0108 putative enzyme
ybhK b0780 0.2522 0.0010 putative structural protein
ybhO b0789 1.6209 0.0479 cardiolipin synthase 2
ybiR b0818 0.5665 0.0479 YbiR
ybjC b0850 0.5750 0.0491 conserved hypothetical protein; gene is within soxRS regulon
ycaL b0909 0.5299 0.0354 putative heat shock protein
ycbG b0956 0.5827 0.0116 putative dehydrogenase
ycbK b0926 0.4469 0.0152 conserved hypothetical protein
ycbQ b0938 1.9263 0.0170 putative fimbrial-like protein
ycbR b0939 1.8020 0.0084 putative chaperone
yccA b0970 0.4983 0.0427
putative carrier/transport protein; substrate or modulator of FtsH-mediated
proteolysis
yccF b0961 0.5456 0.0466 conserved hypothetical protein
yccJ b1003 1.1693 0.0345 hypothetical protein
ycdF b1005 0.5798 0.0023 hypothetical protein
ycdZ b1036 0.8246 0.0257 putative transport protein
yceB b1063 1.4666 0.0413 conserved hypothetical protein
yceG b1097 0.2704 0.0009 putative thymidylate kinase (EC 2.7.4.9)
yceH b1067 0.4580 0.0122 conserved hypothetical protein
yceO b1058 0.6506 0.0348 hypothetical protein
ycfJ b1110 0.4082 0.0338 hypothetical protein
ycfP b1108 0.4708 0.0147 putative hydrolase
ycfR b1112 0.3787 0.0147 conserved hypothetical protein
ycfT b1115 1.5947 0.0302 putative transport protein
ycgH_2 b1170 1.9107 0.0317 conserved protein; member of the Autotransporter family
ycgL b1179 0.3430 0.0036 conserved hypothetical protein
ycgM b1180 0.4324 0.0364 putative isomerase
ycgN b1181 0.2587 0.0108 conserved hypothetical protein
ycgR b1194 1.3756 0.0420 protein involved in flagellar function
ycgZ b1164 0.4255 0.0168 hypothetical protein
ychF b1203 1.6270 0.0442 putative GTP-binding protein
ychJ b1233 0.3905 0.0170 conserved hypothetical protein
ychQ b1213 0.6472 0.0161 hypothetical protein
yciS b1279 0.4349 0.0229 conserved hypothetical protein
ycjD b1289 1.2011 0.0454 conserved hypothetical protein
ycjG b1325 0.4835 0.0125 L-Ala-D/L-Glu epimerase, a muconate lactonizing enzyme
ycjR b1314 1.8315 0.0473 putative epimerase/isomerase
ycjT b1316 1.1203 0.0476 putative enzyme
119

APPENDIX I
ycjX b1321 4.0841 0.0141 putative EC 2.1 enzyme
ydaO b1344 0.2434 0.0148 conserved protein
ydbA_1 b1401 0.7691 0.0006 hypothetical protein product of fragment 1 of a split CDS
ydbA_2 b1405 0.7077 0.0491 hypothetical protein product of fragment 2 of a split CDS
ydcT b1441 0.4358 0.0233 YdcS/YdcT/YdcV/YdcU ABC transporter
ydcX b1445 2.3184 0.0377 hypothetical protein
yddE b1464 0.7336 0.0245 conserved protein
ydeA b1528 0.2041 0.0058 YdeA MFS transporter
ydeJ b1537 1.4392 0.0057 conserved protein
ydeK b1510 0.4875 0.0351 YdeK
ydfN b1547 1.3671 0.0077 hypothetical protein
ydfT b1559 1.3152 0.0336 hypothetical protein
ydfX b1568 1.3846 0.0254 hypothetical protein
ydgH b1604 0.4280 0.0237 conserved hypothetical protein
ydgT b1625 0.1702 0.0097 conserved hypothetical protein
ydhA b1639 0.6550 0.0304 conserved hypothetical protein
ydhH b1640 0.4726 0.0304 conserved hypothetical protein
ydhI b1643 0.3978 0.0137 hypothetical protein
ydiA b1703 0.3178 0.0056 conserved protein
ydiO b1695 1.6655 0.0206 putative acyl-CoA dehydrogenase
ydiR b1698 1.8979 0.0320 putative subunit of YdiQ-YdiR flavoprotein
ydjG b1771 1.3397 0.0169 putative oxidoreductase
yeaD b1780 1.7584 0.0268 conserved hypothetical protein
yeaE b1781 0.4205 0.0018 putative oxidoreductase, NAD(P)-linked
yeaZ b1807 0.4660 0.0019 hypothetical protein
yebC b1864 1.6986 0.0245 conserved protein
yebF b1847 2.0516 0.0108 conserved hypothetical protein
yebG b1848 2.3442 0.0088 hypothetical protein; gene is part of SOS regulon
yebK b1853 0.5355 0.0044 hypothetical protein
yebN b1821 0.4945 0.0468 putative membrane protein, terpenoid synthase-like
yebR b1832 0.2435 0.0027 conserved hypothetical protein
yebY b1839 0.4488 0.0070 conserved hypothetical protein
yebZ b1840 0.5229 0.0048 putative resistance protein
yecD b1867 0.4582 0.0236 putative enzyme
yecN b1869 0.1959 0.0051 putative membrane protein
yecO b1870 0.2973 0.0060 putative methyltransferase
yecP b1871 0.4271 0.0274 putative enzyme
yedF b1930 1.6425 0.0395 conserved hypothetical protein; might bind RNA
yedI b1958 0.5069 0.0041 hypothetical protein
yedK b1931 1.5169 0.0377 conserved hypothetical protein
yedR b1963 0.5416 0.0326 hypothetical protein
yedS_2 b1965 1.4927 0.0201 putative outer membrane protein
yeeE b2013 0.2863 0.0317 putative transport system permease protein
yeeN b1983 9.6166 0.0005 conserved protein
yeeP b1999 0.6937 0.0431 putative histone
yeeT b2003 1.9457 0.0049 hypothetical protein
yeeZ b2016 0.8883 0.0272 putative enzyme of sugar metabolism
yegD b2069 0.2637 0.0019 actin family protein
yegR b2085 1.5686 0.0058 hypothetical protein
yegW b2101 0.6534 0.0191 putative transcriptional regulator
yegX b2102 0.4954 0.0096 putative hydrolase
yegZ b2083 1.3932 0.0173 hypothetical protein
yehM b2120 1.2804 0.0220 conserved hypothetical protein
yeiG b2154 1.0945 0.0217 putative esterase (EC 3.1.1.-).
yeiR b2173 0.5560 0.0087 putative enzyme
yeiU b2174 0.2626 0.0007 putative permease
yfaD b2244 1.4122 0.0462 hypothetical protein
yfaH b2238 1.2445 0.0457 hypothetical protein
120

APPENDIX I
yfaV b2246 1.1332 0.0162 YfaV
yfbP b2275 1.5584 0.0337 hypothetical protein
yfcE b2300 1.5089 0.0198 putative metallo-dependent phosphatase
yfcF b2301 1.2969 0.0213 putative glutathione S-transferase
yfdK b2354 1.7437 0.0090 hypothetical protein
yfdS b2362 1.4456 0.0350 hypothetical protein
yfeA b2395 0.4562 0.0281 putative membrane protein
yfeR b2409 0.9066 0.0367 putative transcriptional regulator LYSR-type
yfgA b2516 0.3313 0.0004 putative membrane protein
yfgB b2517 0.5090 0.0150 putative pyruvate formate lyase activating enzyme 2
yfgM b2513 0.5801 0.0186 conserved protein
yfhG b2555 0.2721 0.0038 conserved protein
yfhL b2562 0.2394 0.0380 putative ferredoxin
yfiC b2575 0.0971 0.0043 putative enzyme
yfiF b2581 0.3560 0.0086 hypothetical protein
yfiH b2593 0.6179 0.0045 conserved hypothetical protein
yfjG b2619 1.8649 0.0277 toxin of a putative toxin-antitoxin pair
yfjH b2623 0.8041 0.0238 putative histone
yfjM b2629 0.7850 0.0144 hypothetical protein
ygaH b2683 0.2149 0.0002 putative transport protein
ygaZ b2682 0.2232 0.0059 hypothetical protein
ygcG b2778 1.3701 0.0023 putative membrane protein
ygcL b2760 1.1770 0.0296
hypothetical protein with possible relationship to novobiocin and deoxycholate
resistance
ygdD b2807 0.3655 0.0005 conserved hypothetical protein
ygdK b2811 0.5579 0.0386 conserved hypothetical protein
ygeA b2840 0.6668 0.0082 putative resistance protein
ygeW b2870 1.5976 0.0306 putative carbamoyl transferase
ygfS b2886 1.6634 0.0453 putative oxidoreductase, Fe-S subunit
ygfZ b2898 0.4766 0.0063 conserved protein
yggD b2929 0.6247 0.0483 putative transcriptional regulator
yggH b2960 0.3658 0.0154 tRNA (m7G46) methyltransferase
yggJ b2946 0.5829 0.0022 conserved hypothetical protein
yggL b2959 0.3754 0.0018 conserved hypothetical protein
yggN b2958 0.4816 0.0155 conserved hypothetical protein
yggR b2950 1.3249 0.0011 putative protein transport
yggT b2952 0.6371 0.0193 putative resistance protein
yggU b2953 0.6630 0.0123 conserved hypothetical protein
yggX b2962 0.2253 0.0002
conserved hypothetical protein with role in oxidation-resistance of iron-sulfur
clusters
yghQ b2983 1.1911 0.0240 putative serine protease
ygiD b3039 1.3052 0.0295 putative enzyme with dioxygenase domain
ygiR b3015 0.5716 0.0207
ygjD b3064 0.5170 0.0195 putative O-sialoglycoprotein endopeptidase
ygjK b3080 1.6347 0.0393 putative isomerase
ygjO b3084 0.2990 0.0067 hypothetical methyltransferase
ygjR b3087 0.7899 0.0217 putative NAD(P)-binding dehydrogenase
yhaC b3121 1.3252 0.0082 conserved protein
yhaL b3107 1.5740 0.0103 hypothetical protein
yhbY b3180 1.3778 0.0003 possible RNA-binding protein
yhcB b3233 0.3045 0.0076 conserved hypothetical protein
yhcD b3216 1.2268 0.0167 putative outer membrane protein
yhcM b3232 0.5048 0.0277 hypothetical protein
yhdA b3252 0.2359 0.0129 conserved protein
yhdJ b3262 1.4149 0.0321 cell cycle-regulated methyltransferase
yheN b3345 0.7700 0.0372 conserved hypothetical protein
yheO b3346 0.6517 0.0156 hypothetical protein
yhfK b3358 1.2451 0.0042 hypothetical protein
yhfP b3372 1.6321 0.0166
121

APPENDIX I
yhfY b3382 1.4063 0.0453 conserved protein
yhhF b3465 0.5337 0.0473 putative methyltransferase
yhhQ b3471 0.5279 0.0413 hypothetical protein; gene is a predicted member of the purine regulon
yhhW b3439 1.2975 0.0352 conserved hypothetical protein
yhiQ b3497 1.2301 0.0328 putative methyltransferase
yhjE b3523 1.3547 0.0178 YhjE MFS transporter
yhjW b3546 0.4600 0.0499 putative transmembrane protein
yhjY b3548 1.4042 0.0366 putative lipase
yiaU b3585 1.7518 0.0059 putative transcriptional regulator LYSR-type
yibJ b3595 1.6482 0.0413 hypothetical protein
yibK b3606 0.6207 0.0426 hypothetical protein
yicE b3654 0.1109 0.0096 YicE NCS2 tranporter
yidB b3698 0.6946 0.0443 conserved hypothetical protein
yieG b3714 0.1975 0.0106 putative membrane / transport protein
yieH b3715 0.3625 0.0303 putative enzyme with a phophatase-like domain
yieK b3718 1.6885 0.0200 putative 6-phosphogluconolactonase
yifK b3795 0.5430 0.0211 YifK APC transporter
yihI b3866 0.2921 0.0024 conserved protein
yihL b3872 1.4923 0.0255 YihL transcriptional regulator
yihO b3876 1.6352 0.0233 YihO GPH transporter
yihU b3882 1.3139 0.0204 putative dehydrogenase
yjaH b4001 0.7337 0.0240 conserved protein
yjbE b4026 1.7450 0.0047 conserved hypothetical protein
yjdA b4109 0.1906 0.0022 hypothetical protein
yjeB b4178 0.2074 0.0020 conserved protein with a Winged helix domain
yjeH b4141 0.5607 0.0389 YjeH APC transporter
yjeK b4146 0.3898 0.0150 hypothetical protein
yjgA b4234 0.4405 0.0253 putative transport protein (ABC superfamily, atp_bind)
yjgP b4261 0.3739 0.0266 putative transmembrane protein possibly involved in transport
yjiA b4352 1.5128 0.0062 P-loop guanosine triphosphatase
yjjW b4379 1.3791 0.0400 putative activating enzyme
ykfG b0247 1.6946 0.0353 putative DNA repair protein
ykgE b0306 0.7957 0.0470 putative dehydrogenase subunit
ykgH b0310 1.6076 0.0086 conserved protein
ylaC b0458 3.0304 0.0296 putative membrane protein
ylbE b0519 1.2920 0.0327 conserved protein
yliI b0837 1.4805 0.0023 putative dehydrogenase
ymcD b0987 1.4309 0.0262 hypothetical protein
ymjA b1295 0.3256 0.0039 hypothetical protein
yncD b1451 1.8939 0.0328 Probable TonB-dependent receptor
yneG b1523 1.1789 0.0050 conserved hypothetical protein
ynfB b1583 0.3934 0.0061 conserved hypothetical protein
ynfD b1586 2.2054 0.0346 conserved hypothetical protein
ynfN b1551 0.8465 0.0196 hypothetical protein
ynhG b1678 1.3503 0.0343 putative ATP synthase subunit
yoaB b1809 0.6240 0.0129 conserved protein
yobA b1841 0.3019 0.0058 hypothetical protein
yobF b1824 2.0754 0.0274 hypothetical protein
ypdF b2385 1.4856 0.0415 putative peptidase
ypfJ b2475 0.2824 0.0036 conserved protein
ypjC b2650 1.8240 0.0458 hypothetical protein
ypjE b2613 1.5857 0.0110
yqaA b2689 0.4979 0.0431 putative integral membrane protein
yqaB b2690 0.4069 0.0160 putative phosphoglucomutase that contains a phophatase-like domain
yqcD b2794 0.6900 0.0288 conserved hypothetical protein
yqfA b2899 0.6159 0.0239 putative oxidoreductase
yqfB b2900 0.4738 0.0088 conserved hypothetical protein
yqiA b3031 0.5976 0.0359 putative hydrolase
122

APPENDIX I
yqiB b3033 0.4189 0.0462 putative enzyme
yqiH b3047 2.4661 0.0276 putative membrane protein
yqjC b3097 1.5209 0.0227 conserved protein
yqjD b3098 1.5220 0.0102 conserved hypothetical protein
yraI b3143 1.3222 0.0262 putative chaperone
yraM b3147 0.5303 0.0388 putative glycosylase
yrbH b3197 0.5469 0.0155 arabinose 5-phosphate isomerase monomer
yrbL b3207 0.2776 0.0169 conserved hypothetical protein; transcription is regulated by Mg2+
yrdD b3283 0.4003 0.0038 putative DNA topoisomerase
ytfK b4217 0.6795 0.0081 hypothetical protein
zipA b2412 0.3991 0.0357 essential cell division protein ZipA
zitB b0752 1.9751 0.0090 ZitB zinc CDF transporter
znuA b1857 0.5007 0.0149 ZnuA/ZnuB/ZnuC ABC transporter
znuC b1858 1.5621 0.0156 ZnuA/ZnuB/ZnuC ABC transporter
Supplementary table – VIII: LZ41 fis::cm (A) Vs LZ54 fis::cm (B)
gene blattner ratio p-value Function
A/B
aaeB b3240 1.2701 0.0129 hypothetical protein
adk b0474 0.5852 0.0267 adenylate kinase
adrA b0385 1.5751 0.0281 putative membrane protein
agaB b3138 1.6067 0.0201 EIIAga
agaD b3140 2.4760 0.0490 EIIAga
agn43 b2000 1.9466 0.0365 outer membrane fluffing protein, sim. to adhesin
allC b0516 2.6899 0.0373 allantoate amidohydrolase
alpA b2624 0.5764 0.0288 AlpA transcriptional activator
alr b4053 0.2726 0.0082 alanine racemase, minor
alsK b4084 1.8614 0.0254 putative D-allose kinase
apaH b0049 1.3196 0.0053 diadenosine tetraphosphatase
appC b0978 1.8506 0.0232 cytochrome bd-II terminal oxidase subunit I
aqpZ b0875 0.4831 0.0077 AqpZ - water MIP channel
aroA b0908 0.6666 0.0280 3-phosphoshikimate-1-carboxyvinyltransferase
aroB b3389 0.6970 0.0352 3-dehydroquinate synthase
arsR b3501 2.0062 0.0043 ArsR transcriptional regulator
artI b0863 2.0420 0.0102 arginine ABC transporter
artP b0864 1.6630 0.0391 arginine ABC transporter
ascB b2716 0.4567 0.0314 6-phospho-beta-glucosidase; cryptic
ascF b2715 0.3701 0.0083 EIIAsc
ascG b2714 0.2203 0.0292 AscG transcriptional regulator
asd b3433 0.3109 0.0249 aspartate semialdehyde dehydrogenase
astE b1744 1.9337 0.0209 succinylglutamate desuccinylase
atpB b3738 0.5641 0.0218 ATP synthase, F0 complex, a subunit
atpC b3731 1.8372 0.0366 ATP synthase, F1 complex, epsilon subunit
atpI b3739 0.5233 0.0310 AtpI
b0165 b0165 0.4909 0.0269 hypothetical protein
b0255 b0255 0.3208 0.0410 hypothetical protein
b1172 b1172 2.5087 0.0177 conserved hypothetical protein
b1364 b1364 1.8486 0.0389 hypothetical protein
b1402 b1402 0.6370 0.0207 IS22 protein
b2084 b2084 2.3089 0.0387 hypothetical protein
b2680 b2680 0.6069 0.0111 YgaY MFS transporter
b3808 b3808 0.4513 0.0034 hypothetical protein
b4283 b4283 0.3477 0.0343 IS911 protein
b4339 b4339 0.4301 0.0234 hypothetical protein
123

APPENDIX I
gene blattner ratio p-value Function
A/B
bax b3570 0.4668 0.0105 putative ATP-binding protein
bcp b2480 0.3972 0.0258 thiol peroxidase
bcsG b3538 1.5125 0.0251 putative membrane protein
bdm b1481 0.4571 0.0254 hypothetical protein
betI b0313 0.4422 0.0145 BetI-choline
bglF b3722 2.3222 0.0326 EIIBgl
btuD b1709 0.4855 0.0190 vitamin B12 transport system
caiC b0037 2.6932 0.0083 carnitine-CoA ligase / crotonobetaine-CoA ligase
caiT b0040 1.9407 0.0255 CaiT carnitine BCCT transporter
carA b0032 0.1987 0.0003 carbamoyl phosphate synthetase
carB b0033 0.5195 0.0297 carbamoyl phosphate synthetase
cbpM b0999 0.7011 0.0474 chaperone-modulator protein CbpM
cdaR b0162 0.2974 0.0285 SdaR transcriptional regulator
chaA b1216 1.8253 0.0435 ChaA calcium CaCA transporter
cheW b1887 1.4429 0.0031 MCP-II
cheY b1882 1.4736 0.0153 CheY-Pasp
citD b0617 2.1690 0.0098 subunit of acyl carrier protein
citE b0616 1.3927 0.0367 subunit of citryl-ACP lyase
citF b0615 1.5300 0.0418 subunit of citrate-ACP transferase
clcA b0155 0.5515 0.0298 EriC chloride ion ClC channel
clpB b2592 1.6744 0.0098 ClpB chaperone
clpS b0881 0.5757 0.0045 specificity factor for ClpA-ClpP chaperone-protease complex
cmr b0842 0.3828 0.0352 MdfA/Cmr MFS multidrug transporter
coaA b3974 0.2063 0.0077 pantothenate kinase monomer
cobC b0638 2.5183 0.0233 alpha-ribazole-5'-P phosphatase
cobT b1991 0.6766 0.0163 dimethylbenzimidazole phosphoribosyltransferase
cpsG b2048 1.7548 0.0421 phosphomannomutase
cpxR b3912 0.3442 0.0296 CpxR-Phosphorylated transcriptional dual regulator
creA b4397 0.2676 0.0054 hypothetical protein
creB b4398 0.1607 0.0018 CreB- Phosphorylated transcriptional regulator
creC b4399 0.4234 0.0038 CreC-Phis
crl b0240 0.2018 0.0046 Crl transcriptional regulator
csgA b1042 1.4150 0.0203 curlin, major subunit
csgC b1043 0.4527 0.0035 putative curli production protein
csgD b1040 0.5255 0.0417 CsgD transcriptional activator
csiE b2535 0.1601 0.0201 hypothetical protein
cspA b3556 0.1189 0.0043 cold shock protein CspA
cspB b1557 0.0902 0.0121 cold shock protein CspB
cspF b1558 0.0878 0.0007 cold shock protein CspF
cspG b0990 0.1566 0.0211 cold shock protein CspG
cusR b0571 0.2240 0.0067 CusR transcriptional activator
cusS b0570 0.3579 0.0313 putative 2-component sensor protein
cutE b0657 2.6030 0.0037 apolipoprotein N-acyltransferase
cvpA b2313 0.1480 0.0030 membrane protein required for colicin V production
cyaY b3807 0.6324 0.0031 iron-binding frataxin homolog
cysE b3607 0.5219 0.0143 cysteine synthase
cysM b2421 0.3365 0.0109 O-acetylserine (thiol)-lyase B
cytR b3934 0.2132 0.0070 CytR-cytidine
dam b3387 1.5263 0.0296 DNA adenine methylase
dapF b3809 0.3456 0.0309 diaminopimelate epimerase
dcm b1961 0.3666 0.0421 DNA cytosine methylase
dcuS b4125 0.5027 0.0194 DcuS-Phis349
degQ b3234 0.4658 0.0158 serine endoprotease
degS b3235 0.3105 0.0028
inner membrane serine protease required for the extracytoplasmic stress response
mediated by sigmaE
deoR b0840 0.2578 0.0132 DeoR transcriptional repressor
dgkA b4042 0.4758 0.0169 diacylglycerol kinase
124

APPENDIX I
gene blattner ratio
A/B
p-value
Function
dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD
3871021-3869873 : galactonate dehydratase
dgoA b3692 1.8315 0.0260
dgt b0160 0.1774 0.0119 deoxyguanosinetriphosphate triphosphohydrolase
dhaK b1200 0.4352 0.0455 dihydroxyacetone kinase subunit K
dhaR b1201 0.2678 0.0011 putative 2-component regulator
diaA b3149 0.2334 0.0190 DiaA protein
dinB b0231 1.7171 0.0272 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis)
dmsA b0894 2.2635 0.0076 dimethyl sulfoxide reductase, chain A
dnaB b4052 0.1982 0.0057 chromosome replication; chain elongation; part of primosome
dnaG b3066 2.1643 0.0067 DNA biosynthesis; DNA primase
dnaJ b0015 2.9351 0.0192 chaperone with DnaK; heat shock protein
dsbC b2893 0.4666 0.0342 DsbCoxidized
dusB b3260 0.2969 0.0469 tRNA dihydrouridine synthase
dxr b0173 1.4221 0.0086 DXP reductoisomerase
dxs b0420 0.3652 0.0190 1-deoxyxylulose-5-phosphate synthase
ecfB b2969 0.5313 0.0451 putative protein exporter (General Secretory Pathway)
ecfI b3688 0.3510 0.0497 conserved hypothetical protein with possible extracytoplasmic function
oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2-
eda b1850 1.7908 0.0038 keto-4-hydroxyglutarate aldolase
elaC b2268 0.6163 0.0010 binuclear zinc phosphodiesterase monomer
emrE b0543 1.6186 0.0068 EmrE SMR transporter
epd b2927 0.5294 0.0315 erythrose 4-phosphate dehydrogenase
eutB b2441 1.2809 0.0329 ethanolamine ammonia-lyase, probable regulatory subunit
eutH b2452 1.4972 0.0336 putative transport protein, ethanolamine utilization
eutT b2459 1.3095 0.0136 putative cobalamine adenosyltransferase, ethanolamine utilization
evgA b2369 0.3168 0.0144 EvgA-Phosphorylated transcriptional regulator
exoX b1844 0.5678 0.0038 exonuclease X
exuR b3094 0.3228 0.0132 ExuR transcriptional repressor
enoyl-ACP reductase (NAD[P]H) / enoyl-ACP reductase (NADPH) / enoyl-ACP
fabI b1288 1.6863 0.0303 reductase (NADH)
fadJ b2341 0.3121 0.0367 FadJ monomer
fdnI b1476 1.7767 0.0053 formate dehydrogenase N, &gamma; subunit
fhiA b0229 1.5449 0.0317 flagellar biosynthesis
fhuB b0153 2.1649 0.0409 ferrichrome uptake system
fhuF b4367 1.7515 0.0482 acts in reduction of ferrioxamine B iron
stationary-phase protein with possible role in p-aminobenzoate or folate
fic b3361 1.4568 0.0439 biosynthesis
fimE b4313 1.7756 0.0279 regulator for fimA
fixB b0042 2.0297 0.0368 probable flavoprotein subunit required for anaerobic carnitine metabolism
flgF b1077 2.2351 0.0239 flagellar basal-body rod protein FlgF
flgG b1078 1.9647 0.0136 flagellar basal-body rod protein FlgG
flgI b1080 1.7273 0.0119 flagellar P-ring protein FlgI
flgJ b1081 2.1703 0.0020 FlgJ
flgN b1070 2.3245 0.0287 flagellar biosynthesis protein FlgN
flhB b1880 1.8348 0.0063 flagellar biosynthesis protein FlhB
flhC b1891 0.1181 0.0079 FlhC transcriptional regulator
flhD b1892 0.0774 0.0260 FlhD transcriptional dual regulator
fliC b1923 0.5536 0.0223 flagellar biosynthesis; flagellin, filament structural protein
fliD b1924 0.3745 0.0118 flagellar cap protein FliD; filament capping protein; enables filament assembly
flagellar motor switch protein FliG; component of motor switching and
fliG b1939 1.9682 0.0326 energizing, enabling rotation and determining its direction
fliI b1941 2.4306 0.0107 flagellum-specific ATP synthase FliI
fliK b1943 2.1579 0.0307 flagellar hook-length control protein FliK
fliR b1950 5.8099 0.0221 flagellar biosynthesis protein FliR
fliS b1925 0.5073 0.0341 flagellar biosynthesis protein FliS
fnr b1334 3.9209 0.0118 FNR transcriptional dual regulator
focA b0904 0.6551 0.0243 FocA formate FNT transporter
focB b2492 0.2494 0.0129 FocB formate FNT transporter
125

APPENDIX I
gene blattner ratio p-value Function
A/B
folA b0048 0.2106 0.0098 dihydrofolate reductase, type I
frdD b4151 2.4605 0.0058 fumarate reductase membrane protein
frlA b3370 1.6878 0.0011 YhfM methione APC transporter
frlB b3371 1.7603 0.0228 fructoselysine 6-phosphate deglycase monomer
frlR b3375 0.5910 0.0107 putative transcriptional regulator
frmA b0356 1.7397 0.0295 formaldehyde dehydrogenase, glutathione-dependent
frmB b0355 2.7771 0.0194 putative S-formylglutathione hydrolase
frsA b0239 0.3854 0.0052 fermentation/respiration switch protein
fruR b0080 0.2985 0.0085 FruR transcriptional dual regulator
frwD b3953 1.4822 0.0450 PTS system fructose-like IIB component 2
fryA b2383 1.3141 0.0080 putative PTS system enzyme IIA component, enzyme I
fsaB b3946 1.4734 0.0059 fructose 6-phosphate aldolase 2
ftsB b2748 0.2075 0.0061 essential cell division protein FtsB
ftsQ b0093 1.2917 0.0493 essential cell division protein FtsQ
ftsW b0089 1.9956 0.0151 essential cell division protein FtsW
fxsA b4140 1.9361 0.0366 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7
gadE b3512 1.2316 0.0070 GadE transcriptional activator
gadW b3515 1.9617 0.0376 GadWtranscriptional repressor
gadX b3516 2.3498 0.0110 GadX transcriptional activator
galE b0759 1.3965 0.0349 UDP-glucose 4-epimerase monomer
galM b0756 0.5556 0.0412 aldose-1-epimerase
galR b2837 0.3381 0.0120 GalR-galactose
gatY b2096 0.2247 0.0190 tagatose-1,6-bisphosphate aldolase 2
gcvH b2904 0.1838 0.0232 dihydrolipoyl-GcvH-protein
gcvR b2479 0.2803 0.0150 GcvR-gly
gcvT b2905 0.1397 0.0379 aminomethyltransferase
glcD b2979 1.4604 0.0131 glycolate oxidase subunit D
glf b2036 1.4061 0.0231 UDP-galactopyranose mutase
glgA b3429 2.0868 0.0462 glycogen synthase
glmS b3729 0.6548 0.0257 L-glutamine:D-fructose-6-phosphate aminotransferase
glnD b0167 1.4223 0.0065 uridylyltransferase / uridylyl-removing enzyme
glnE b3053 0.7644 0.0097
glutamine synthetase adenylyltransferase / glutamine synthetase deadenylylating
enzyme
gloA b1651 1.7203 0.0236 glyoxalase I
glpD b3426 0.6000 0.0106 glycerol 3-phosphate dehydrogenase, aerobic
glpE b3425 0.3290 0.0046 thiosulfate sulfurtransferase
glpF b3927 0.5645 0.0474 GlpF - glycerol MIP channel
glpG b3424 0.2077 0.0184 inner membrane-associated protein of glp regulon
gltF b3214 1.8806 0.0235 regulator of gltBDF operon, induction of Ntr enzymes
gltL b0652 1.8842 0.0056 glutamate ABC transporter
gltP b4077 0.7136 0.0418 GltP glutamate/aspartate DAACS transporter
glyA b2551 0.3875 0.0034 glycine hydroxymethyltransferase
gntY b3414 2.7979 0.0384
predicted membrane-bound protein that is involved in high-affinity gluconate
transport
gpp b3779 0.4360 0.0260 guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase
groL b4143 2.3507 0.0471 GroEL, chaperone Hsp60, peptide-dependent ATPase, heat shock protein
grpE b2614 2.3641 0.0303 phage lambda replication; host DNA synthesis; heat shock protein; protein repair
grxC b3610 0.4843 0.0071 oxidized glutaredoxin 3
gshB b2947 0.5134 0.0198 glutathione synthetase subunit
gspE b3326 1.8012 0.0127 putative protein secretion protein for export
gspH b3329 1.2960 0.0067 putative protein secretion protein for export
gspI b3330 1.3340 0.0008 putative protein secretion protein for export
gspJ b3331 2.1075 0.0087 putative protein secretion protein for export
gssA b2988 1.7232 0.0036 glutathionylspermidine synthetase / glutathionylspermidine amidase
guaA b2507 0.7222 0.0199 GMP synthase / GMP synthase (ammonia dependent)
gyrB b3699 2.5880 0.0017 DNA gyrase, subunit B
hcaB b2541 1.2806 0.0246 3-phenylpropionate-2',3'-dihydrodiol dehydrogenase
126

APPENDIX I
gene blattner ratio p-value Function
A/B
hcaD b2542 1.6383 0.0207 ferredoxin NAD+ reductase
hcaE b2538 0.5174 0.0278 3-phenylpropionate dioxygenase, alpha subunit
hcr b0872 2.8116 0.0329 NADH oxidoreductase
hdeD b3511 2.0630 0.0226 protein involved in acid resistance
hdfR b4480 0.3225 0.0184 transcriptional regulator
hemC b3805 0.4388 0.0311 hydroxymethylbilane synthase
hemG b3850 0.4767 0.0075 protoporphyrinogen oxidase
hemH b0475 1.6086 0.0151 ferrochelatase
hemN b3867 0.4698 0.0211 coproporphyrinogen III oxidase, anaerobic
hflD b1132 0.4773 0.0130 membrane protein in operon with purB
hha b0460 0.3786 0.0126 haemolysin expression modulating protein
hipB b1508 0.0870 0.0061 HipB transcriptional activator
hmp b2552 1.8564 0.0046 nitric oxide dioxygenase / dihydropteridine reductase 2
hofN b3394 0.3123 0.0307 conserved protein
holA b0640 2.0348 0.0021 DNA polymerase III, delta subunit
holB b1099 1.5205 0.0029 DNA polymerase III, delta prime subunit
holC b4259 0.5840 0.0321 DNA polymerase III, chi subunit
holE b1842 0.2431 0.0003 DNA polymerase III, theta subunit
hscC b0650 1.6203 0.0217
Hsc62; an Hsp70-family ATPase that negatively regulates sigma70 / nonchaperonin
molecular chaperone ATPase
hslU b3931 4.1300 0.0123 ATPase component of the HslVU protease
htpG b0473 1.8306 0.0130 HtpG monomer
htrL b3618 6.9782 0.0063 involved in lipopolysaccharide biosynthesis
hyaA b0972 2.2684 0.0027 hydrogenase I, HyaA subunit
hybF b2991 1.6921 0.0285 protein involved with the maturation of hydrogenases 1 and 2
hycE b2721 2.0488 0.0454 formate hydrogenlyase complex
iaaA b0828 0.1133 0.0019 beta cleavage product of IaaA
ibpA b3687 4.2244 0.0016 small heat shock protein IbpA
ibpB b3686 7.6875 0.0014 small heat shock protein IbpB
icdA b1136 0.3462 0.0100 Icd
iclR b4018 0.2325 0.0125 IclR-PEP
idnR b4264 0.2909 0.0338 IdnR-5-ketogluconate
idnT b4265 0.3169 0.0249 IdnT idonate Gnt tranporter
ihfB b0912 1.9863 0.0061 IHF transcriptional dual regulator
ilvA b3772 0.4362 0.0424 threonine dehydratase (biosynthetic)
inaA b2237 0.2907 0.0071 pH-inducible protein involved in stress response
insA_5 b1894 0.3935 0.0446
insA_5 1977239-1976964 : IS1 protein InsA / insA_1 20508-20233 : IS1 protein
InsA / insA_6 3581506-3581781 : IS1 protein InsA
intR b1345 0.2551 0.0239 putative transposase
intS b2349 1.9457 0.0169 putative prophage Sf6-like integrase
iscU b2529 1.8083 0.0053 scaffold protein involved in iron-sulfur cluster assembly
ispA b0421 0.1813 0.0151 geranyl diphosphate synthase / farnesyl diphosphate synthase
ispD b2747 0.4908 0.0411 4-diphosphocytidyl-2C-methyl-D-erythritol synthetase monomer
katE b1732 1.7021 0.0305 hydroperoxidase II
kdtA b3633 0.3601 0.0028 KDO transferase
kduD b2842 1.5255 0.0331 2-deoxy-D-gluconate 3-dehydrogenase
kefG b3351 1.3584 0.0057 KefG
ldcA b1192 1.7002 0.0372 L,D-carboxypeptidase A
leuB b0073 1.7972 0.0055 3-isopropylmalate dehydrogenase
leuC b0072 1.6773 0.0000 isopropylmalate isomerase
leuD b0071 2.0207 0.0112 isopropylmalate isomerase
ligT b0147 0.1852 0.0026 hypothetical protein
lipB b0630 2.1877 0.0000 lipoyl-protein ligase
livH b3457 1.9033 0.0131 leucine ABC transporter
livM b3456 1.6094 0.0498 leucine ABC transporter
lolA b0891 0.7885 0.0361
periplasmic chaperone, effects translocation of lipoproteins from inner membrane
to outer
127

APPENDIX I
gene blattner ratio p-value Function
A/B
lolB b1209 0.4806 0.0227 outer membrane lipoprotein, localization of lipoproteins in the outer membrane
lolE b1118 0.4575 0.0420 LolCDE ABC lipoprotein transporter
lon b0439 2.6981 0.0091 DNA-binding, ATP-dependent protease La
lpcA b0222 0.2400 0.0125 lipopolysaccharide core biosynthesis; phosphoheptose isomerase
lrp b0889 0.4179 0.0402 Lrp-Leucine transcriptional activator
lsrG b1518 1.4543 0.0022 conserved hypothetical protein
lysA b2838 1.7920 0.0487 diaminopimelate decarboxylase
macB b0879 2.0724 0.0127 MacAB macrolide efflux transporter complex
malT b3418 0.1905 0.0107 MalT-MalK
malY b1622 0.4203 0.0185 bifunctional: repressor of maltose regulon / cystathionine beta-lyase
mdl b0449 2.7100 0.0423 MdlB
mdoC b1047 0.1432 0.0145 protein required for succinyl modification of osmoregulated periplasmic glucans
mdoH b1049 1.6043 0.0230
membrane glycosyltransferase; synthesis of membrane-derived oligosaccharide
(MDO)
mdtF b3514 1.8716 0.0244 YhiV
mdtN b4082 2.2488 0.0020 putative membrane protein
mdtO b4081 1.5951 0.0435 YjcQ
menD b2264 0.3726 0.0138
putative 2-hydroxyglutarate synthase / SHCHC synthase / 2-oxoglutarate
decarboxylase
menF b2265 0.3477 0.0276 isochorismate synthase, menaquinone-specific
mfd b1114 0.5650 0.0126 transcription-repair coupling factor; mutation frequency decline
mhpF b0351 1.8446 0.0238 acetaldehyde dehydrogenase 2
minC b1176 0.2414 0.0115
cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that
regulate septum placement
minD b1175 0.4152 0.0065
membrane ATPase of the MinC-MinD-MinE system that regulates septum
placement
minE b1174 0.3703 0.0160
cell division topological specificity factor and inhibitory component of the MinC-
MinD-MinE system that regulates septum placement
mioC b3742 1.6938 0.0341 flavoprotein involved in biotin synthesis
mltC b2963 0.4421 0.0091 membrane-bound lytic murein transglycosylase C
mmuP b0260 0.3741 0.0038 MmuP APC transporter
mnmC b2324 0.5136 0.0357 bifunctional enzyme catalyzing the formation of mnm5s2U in tRNA
mntH b2392 0.3161 0.0066 MntH manganese ion NRAMP transporter
moaA b0781 0.2797 0.0039 molybdopterin biosynthesis, protein A
mobA b3857 0.2268 0.0063 molybdopterin guanine dinucleotide synthase
mobB b3856 0.7633 0.0125 molybdopterin-guanine dinucleotide biosynthesis protein B
modE b0761 0.3788 0.0052 Molybdate-responsive transcription factor monomer
moeB b0826 2.0014 0.0025 molybdopterin biosynthesis
mpaA b1326 0.4207 0.0207 murein peptide amidase A
mrr b4351 0.4108 0.0084 restriction of methylated adenine
msbB b1855 0.2154 0.0023 myristoyl acyltransferase
mtlD b3600 0.3066 0.0272 mannitol-1-phosphate 5-dehydrogenase
mukE b0923 0.3600 0.0166 protein involved in chromosome partitioning
mukF b0922 0.2126 0.0048 Ca2+-binding protein involved in chromosome partitioning
murI b3967 2.6898 0.0094 glutamate racemase
murP b2429 0.3862 0.0083 MurP
mutY b2961 0.3526 0.0252 adenine glycosylase; G.C --> T.A transversions
mviM b1068 0.7293 0.0284 putative virulence factor
nadD b0639 2.8386 0.0006 nicotinate-mononucleotide adenylyltransferase
nadR b4390 0.5652 0.0094 NadR transcriptional repressor / NMN adenylyltransferase
nanR b3226 0.2529 0.0184 NanR transcriptional regulator
narQ b2469 1.8665 0.0482 NarQ-Phis
narV b1465 1.9002 0.0087 nitrate reductase Z, &gamma; subunit
nfnB b0578 0.7030 0.0451 dihydropteridine reductase
nfrB b0569 0.4153 0.0012 bacteriophage N4 receptor, outer membrane protein
nhaA b0019 1.9281 0.0447 sodium/proton NhaA transporter
nhaR b0020 2.4259 0.0270 NhaR-Na+ transcriptional activator
nikA b3476 2.3805 0.0063 nickel ABC transporter
128

APPENDIX I
gene blattner ratio p-value Function
A/B
nikR b3481 1.4287 0.0386 NikR-Ni
nirB b3365 1.6021 0.0034 nitrite reductase, large subunit
nth b1633 2.2184 0.0022 endonuclease III; specific for apurinic and/or apyrimidinic sites
nudD b2051 1.8515 0.0395 GDP-mannose mannosyl hydrolase
nudF b3034 0.3009 0.0092 hypothetical protein
nuoL b2278 2.3112 0.0467 NADH dehydrogenase I
osmC b1482 1.9756 0.0398 osmotically inducible peroxidase OsmC
osmE b1739 1.3600 0.0369 OsmE-osmotically inducible protein
pabB b1812 0.1391 0.0082
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
panE b0425 0.4718 0.0353 2-dehydropantoate reductase
parC b3019 0.5366 0.0439 Topoisomerase IV subunit A
pbpG b2134 0.2733 0.0252 penicillin-binding protein 7
pepB b2523 2.0445 0.0308 aminopeptidase (AP)
pflA b0902 2.2414 0.0213 pyruvate formate-lyase activating enzyme
pgsA b1912 0.5084 0.0407 phosphatidylglycerophosphate synthase
phnE b4104 1.3120 0.0044 alkylphosphonate ABC transporter
phnG b4101 2.1147 0.0227 phosphonate metabolism
phnK b4097 1.6222 0.0319 PhnK
phoH b1020 1.3684 0.0361
PhoB-dependent, ATP-binding pho regulon component; may be helicase; induced
by P starvation
pitA b3493 0.6222 0.0296 PitA
pitB b2987 1.2746 0.0137 PitB
plsB b4041 1.6234 0.0168 glycerol-3-phosphate acyltransferase
plsC b3018 0.3811 0.0229 1-acylglycerol-3-phosphate acyltransferase
plsX b1090 0.3719 0.0337 glycerolphosphate auxotrophy in plsB background
pmrF b2254 1.6010 0.0321 undecaprenyl phosphate-L-Ara4FN transferase
pncB b0931 0.2520 0.0142 nicotinate phosphoribosyltransferase
polB b0060 3.1483 0.0221 DNA polymerase II
ppk b2501 0.2034 0.0093 polyphosphate kinase
prmC b1212 1.4586 0.0477 protein-(glutamine-N5) methyltransferase
proS b0194 1.7249 0.0261 prolyl-tRNA synthetase
proV b2677 0.4042 0.0250 proline ABC transporter
pspF b1303 0.1755 0.0002 PspF transcriptional activator
pstB b3725 0.6518 0.0392 phosphate ABC transporter
ptsA b3947 1.8352 0.0003 PEP-protein phosphotransferase system enzyme I
purB b1131 0.7366 0.0390
5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase /
adenylosuccinate lyase
purC b2476 0.2064 0.0057 phosphoribosylaminoimidazole-succinocarboxamide synthase
purE b0523 0.1169 0.0008 N5-carboxyaminoimidazole ribonucleotide mutase
purF b2312 0.1474 0.0009 amidophosphoribosyl transferase
purH b4006 0.4496 0.0475 AICAR transformylase / IMP cyclohydrolase
purK b0522 0.1805 0.0075 N5-carboxyaminoimidazole ribonucleotide synthase monomer
purM b2499 0.2023 0.0208 phosphoribosylformylglycinamide cyclo-ligase
purN b2500 0.3009 0.0412 phosphoribosylglycinamide formyltransferase
purR b1658 0.2390 0.0090 PurR transcriptional repressor
purT b1849 0.1801 0.0082 GAR transformylase 2
puuA b1297 0.1427 0.0155 putative glutamine synthetase (EC 6.3.1.2)
pykA b1854 1.4726 0.0128 pyruvate kinase II monomer
pykF b1676 1.2394 0.0301 pyruvate kinase I monomer
pyrB b4245 0.4807 0.0207 aspartate carbamoyltransferase, PyrB subunit
pyrI b4244 0.6993 0.0415 aspartate carbamoyltransferase, PyrI subunit
qseB b3025 0.2860 0.0050 putative 2-component transcriptional regulator
racR b1356 0.3752 0.0040 hypothetical protein
rbsK b3752 0.7165 0.0029 ribokinase
rcsA b1951 3.6667 0.0186
positive DNA-binding transcriptional regulator of capsular polysaccharide
synthesis, activates its own expression
rcsD b2216 0.4726 0.0181 putative 2-component sensor protein
129

APPENDIX I
gene blattner ratio p-value Function
A/B
rdoA b3859 0.5228 0.0406 cytoplasmic protein of low abundance
recA b2699 3.2066 0.0263
DNA strand exchange and renaturation, DNA-dependent ATPase, DNA- and
ATP-dependent coprotease
recD b2819 2.0842 0.0351
DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA
endonuclease
recE b1350 1.9766 0.0078 exonuclease VIII, ds DNA exonuclease, 5' --> 3' specific
recN b2616 5.3559 0.0008 protein used in recombination and DNA repair
recT b1349 1.3586 0.0348 recombinase, DNA renaturation
rfaB b3628 2.5413 0.0011 UDP-D-galactose:(glucosyl)lipopolysaccharide-1,6-D-galactosyltransferase
rfaG b3631 3.0643 0.0002 lipopolysaccharide core biosynthesis; glucosyltransferase I
rfaI b3627 4.1170 0.0163 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase
rfaJ b3626 4.3983 0.0081 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase
rfaK b3623 3.1484 0.0132 lipopolysaccharide core biosynthesis; probably hexose transferase
rfaQ b3632 2.4984 0.0107 lipopolysaccharide core biosynthesis
rfaS b3629 3.0101 0.0025 lipopolysaccharide core biosynthesis
rfaY b3625 4.7308 0.0194 lipopolysaccharide core biosynthesis
rfaZ b3624 4.3286 0.0096 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis
rfc b2035 1.8291 0.0009 O-antigen polymerase
rfe b3784 0.2683 0.0097 undecaprenyl-phosphate &alpha;-N-acetylglucosaminyl transferase
rffA b3791 1.6016 0.0227 TDP-4-oxo-6-deoxy-D-glucose transaminase
rffT b3792.1 2.4442 0.0046 4-acetamido-4,6-dideoxy-D-galactose transferase
rhaA b3903 2.4561 0.0417 L-rhamnose isomerase / L-lyxose isomerase
rho b3783 0.5828 0.0440 transcription termination factor Rho monomer; polarity suppressor
rhsD b0497 0.1966 0.0113 RhsD protein in rhs element
rhtC b3823 0.4390 0.0253 RhtC threonine Rht Transporter
ribB b3041 0.6220 0.0498 3,4-dihydroxy-2-butanone 4-phosphate synthase
ribF b0025 0.1784 0.0073 riboflavin kinase / FMN adenylyltransferase
rimJ b1066 0.4039 0.0138
acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
rimK b0852 1.5209 0.0253 ribosomal protein S6 modification protein
rimL b1427 0.5475 0.0053
acetylation of N-terminal serine of 30S ribosomal subunit protein L7; acetyl
transferase
rlmB b4180 1.7133 0.0062 23S rRNA methyltransferase monomer
rlpB b0641 1.9134 0.0175 rare lipoprotein RlpB
rmuC b3832 0.4993 0.0038 conserved protein
rph b3643 1.1124 0.0148 RNase PH monomer
rplS b2606 2.4571 0.0178 50S ribosomal subunit protein L19
rplT b1716 2.5117 0.0282 50S ribosomal subunit protein L20, and regulator
rpoD b3067 3.0416 0.0132 sigma70 factor
rpoE b2573 0.6493 0.0378 sigmaE
rpoZ b3649 0.5481 0.0118 RNA polymerase, omega subunit
rpsQ b3311 1.9759 0.0388 30S ribosomal subunit protein S17
rrmJ b3179 1.3369 0.0240 23S rRNA m2U2552 methyltransferase
rseA b2572 0.3836 0.0167 anti-sigma factor that inhibits sigmaE
rseB b2571 0.5258 0.0112
negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA
to sigmaE
rseC b2570 0.4367 0.0061 protein involved in reduction of the SoxR iron-sulfur cluster
rspA b1581 1.7883 0.0421 starvation sensing protein RspA
rspB b1580 1.8606 0.0395 putative dehydrogenase RspB
rsxD b1630 1.4943 0.0285 integral membrane protein of SoxR-reducing complex
rsxE b1632 2.6850 0.0103 integral membrane protein of SoxR-reducing complex
rsxG b1631 3.0731 0.0067 member of SoxR-reducing complex
sapB b1293 1.7823 0.0146 peptide uptake ABC transporter
secG b3175 0.5156 0.0209 Sec Protein Secretion Complex
seqA b0687 0.3340 0.0283 SeqA, negative modulator of initiation of replication
serB b4388 0.3970 0.0271 phosphoserine phosphatase
setC b3659 1.3102 0.0144 YicK MFS Transporter
sfmC b0531 2.1401 0.0045 putative chaperone
130

APPENDIX I
gene blattner ratio p-value Function
A/B
sgcE b4301 1.6837 0.0317 putative epimerase
sgcX b4305 0.3168 0.0116 SgcB
slt b4392 0.5759 0.0147 soluble lytic murein transglycosylase
slyA b1642 0.4451 0.0416 SlyA transcriptional activator
smf b4473 0.3130 0.0254 hypothetical protein
smg b3284 0.1539 0.0006 hypothetical protein
smpA b2617 1.8755 0.0132 SmpA small membrane protein A
smtA b0921 0.1256 0.0007 S-adenosylmethionine-dependent methyltransferase
sohB b1272 1.8038 0.0119 putative protease
speA b2938 2.2897 0.0138 arginine decarboxylase, biosynthetic
speD b0120 1.2622 0.0360 adenosylmethionine decarboxylase, proenzyme
spr b2175 0.1527 0.0041 putative lipoprotein
spy b1743 1.6568 0.0122 periplasmic protein related to spheroblast formation
srmB b2576 0.3930 0.0324 SrmB, DEAD-box RNA helicase
sscR b2765 0.3470 0.0259 putative 6-pyruvoyl tetrahydrobiopterin synthase
sspA b3229 1.7662 0.0298 regulator of transcription; stringent starvation protein A
ssuD b0935 2.1101 0.0410 alkanesulfonate monooxygenase
sucB b0727 1.7606 0.0413 SucB-lipoate
sucD b0729 2.0786 0.0326 succinyl-CoA synthetase, alpha subunit
sufE b1679 1.4500 0.0180 sulfur acceptor that activates SufS cysteine desulfurase
sufS b1680 1.9117 0.0189 L-selenocysteine lyase (and L-cysteine desulfurase) monomer
sulA b0958 0.4846 0.0244 suppressor of lon; inhibits cell division and ftsZ ring formation
surE b2744 0.6982 0.0147 phosphatase with broad substrate specificity / 3'-nucleotidase / 5'-nucleotidase
talB b0008 0.7356 0.0361 transaldolase B
tatE b0627 1.3041 0.0170 TatABCE protein export complex
tdcF b3113 2.0890 0.0324 hypothetical protein
thyA b2827 1.5495 0.0232 thymidylate synthase
tolC b3035 0.4953 0.0287 TolC outer membrane channel
torZ b1872 0.5113 0.0085 trimethylamine N-oxide reductase III, TorZ subunit
trmE b3706 1.6715 0.0450 GTP-binding protein with a role in modification of tRNA
trpE b1264 0.2196 0.0041 anthranilate synthase component I
trpH b1266 1.2995 0.0096 putative enzyme
trpR b4393 1.8827 0.0116 TrpR transcriptional repressor
truD b2745 0.5425 0.0108 tRNA pseudouridine 13 synthase
trxA b3781 0.6949 0.0406 oxidized thioredoxin
ubiC b4039 0.1951 0.0166 chorismate pyruvate lyase
ugpC b3450 1.3303 0.0342 glycerol-3-P ABC transporter / tranport
ulaB b4194 1.8991 0.0096 eiisga
umuC b1184 1.4019 0.0198 SOS mutagenesis and repair
uup b0949 1.5046 0.0356 Uup
uvrA b4058 3.2580 0.0017 excision nuclease subunit A
uvrB b0779 1.5440 0.0191 DNA repair; excision nuclease subunit B
valS b4258 1.3789 0.0229 valyl-tRNA synthetase
vsr b1960 0.4472 0.0407
DNA mismatch endonuclease of the very short patch (VSP) mismatch repair
pathway
waaP b3630 2.8880 0.0034 lipopolysaccharide core biosynthesis; phosphorylation of core heptose
wbbI b2034 2.0928 0.0325 hypothetical protein; not required for colanic acid biosynthesis
wbbK b2032 1.5888 0.0445 putative transferase
wcaI b2050 1.4786 0.0422 putative colanic biosynthesis glycosyl transferase
wecB b3786 1.9582 0.0212 UDP-N-acetylglucosamine-2-epimerase
xerD b2894 0.2913 0.0334 site-specific recombinase
xseB b0422 0.1745 0.0055 exonuclease VII, small subunit
yabP b0056 0.5265 0.0390 conserved hypothetical protein
yacC b0122 0.1421 0.0092 conserved hypothetical protein
yadE b0130 1.9353 0.0038 conserved hypothetical protein
yadF b0126 0.5334 0.0299 carbonic anhydrase
yadH b0128 0.5583 0.0088 YadG/YadH ABC transporter
131

APPENDIX I
gene blattner ratio p-value Function
A/B
yadL b0137 2.6672 0.0200 putative adhesin-like protein
yaeI b0164 1.6713 0.0162 conserved protein
yaeR b0187 0.3976 0.0325 putative enzyme
yafJ b0223 0.1911 0.0015 putative amidotransferase
yafK b0224 0.2183 0.0034
conserved protein; in enteroaggregative E. coli, YafK is required for development
of biofilms
yafQ b0225 0.3068 0.0158 conserved hypothetical protein
yafS b0213 1.5738 0.0014 putative methyltransferase
yagB b0266 0.1046 0.0003 hypothetical protein
yagN b0280 0.2692 0.0237 hypothetical protein
yahF b0320 1.8661 0.0118 putative oxidoreductase subunit
yahJ b0324 1.4514 0.0167 putative deaminase
yajC b0407 0.5517 0.0123 Sec Protein Secretion Complex
yajI b0412 0.6979 0.0356 conserved hypothetical protein
ybaJ b0461 0.1803 0.0125 conserved hypothetical protein
ybaK b0481 1.4925 0.0073 conserved hypothetical protein
ybaN b0468 0.4393 0.0017 hypothetical protein
ybaQ b0483 0.1888 0.0099 conserved protein with a DNA-binding domain
ybaY b0453 2.1228 0.0458 glycoprotein/polysaccharide metabolism
ybbB b0503 0.6974 0.0351 tRNA 2-selenouridine synthase
ybdJ b0580 0.3651 0.0026 conserved hypothetical protein
ybeD b0631 3.2155 0.0247 conserved hypothetical protein
ybeX b0658 2.4451 0.0016 putative transport protein
ybeY b0659 3.1107 0.0068 conserved hypothetical protein
ybeZ b0660 3.0813 0.0018 putative ATP-binding protein
ybfF b0686 0.4851 0.0234 putative enzyme
ybfH b0691 2.0652 0.0161 conserved hypothetical protein
ybgA b0707 1.5050 0.0370 conserved protein
ybgC b0736 0.5182 0.0269 Tol-Pal Cell Envelope Complex
ybgI b0710 0.5520 0.0236 conserved protein, putative hydrolase-oxidase monomer
ybgS b0753 1.6386 0.0415 putative homeobox protein
ybhI b0770 1.6162 0.0084 YbhI DASS Transporter
ybiF b0813 0.4910 0.0351 Threonine and Homoserine Exporter
ybiH b0796 0.1350 0.0012 hypothetical protein
ybjJ b0845 1.8338 0.0024 putative DEOR-type transcriptional regulator
ybjN b0853 0.4973 0.0357 putative sensory transduction regulator
ybjO b0858 0.7793 0.0239 putative membrane protein
ybjS b0868 0.5267 0.0068 putative nucleotide di-P-sugar epimerase or dehydratase
ycaK b0901 2.4091 0.0338 YcaK
ycaL b0909 0.4133 0.0127 putative heat shock protein
ycbB b0925 0.4752 0.0426 putative amidase
ycbK b0926 0.2670 0.0090 conserved hypothetical protein
ycbQ b0938 1.6913 0.0497 putative fimbrial-like protein
ycbW b0946 0.8124 0.0000 conserved hypothetical protein
yccM b0992 1.6258 0.0274 hypothetical protein
yccR b0959 0.4415 0.0330 conserved protein
yccV b0966 1.9670 0.0301 hemimethylated DNA-binding protein
yceA b1055 0.5663 0.0415 hypothetical protein
yceH b1067 0.5404 0.0358 conserved hypothetical protein
ycfH b1100 2.0582 0.0168 putative hydrolase
ycfJ b1110 0.6676 0.0447 hypothetical protein
ycfP b1108 0.5438 0.0176 putative hydrolase
ycfQ b1111 2.2543 0.0293 hypothetical protein
ycfX b1119 0.5776 0.0347 putative sugar kinase, ROK family protein
ycgG b1168 2.7312 0.0499 conserved protein
ycgL b1179 0.3957 0.0211 conserved hypothetical protein
ycgM b1180 0.3111 0.0120 putative isomerase
132

APPENDIX I
gene blattner ratio p-value Function
A/B
ycgN b1181 0.2615 0.0009 conserved hypothetical protein
ycgZ b1164 0.3437 0.0011 hypothetical protein
ychH b1205 0.3360 0.0075 conserved hypothetical protein
yciI b1251 1.8595 0.0266 conserved hypothetical protein
yciQ b1268 2.0023 0.0382 putative membrane protein
ycjD b1289 1.8598 0.0220 conserved hypothetical protein
ycjF b1322 4.5462 0.0002 putative membrane protein
ycjR b1314 2.8426 0.0026 putative epimerase/isomerase
ycjX b1321 5.2223 0.0078 putative EC 2.1 enzyme
ycjZ b1328 0.3330 0.0288 putative transcriptional regulator LYSR-type
ydaC b1347 2.1926 0.0196 hypothetical protein
ydaL b1340 0.4087 0.0084 hypothetical protein
ydaO b1344 0.3090 0.0329 conserved protein
ydbK b1378 1.5381 0.0088 putative pyruvate synthase
ydcD b1457 0.2425 0.0233 hypothetical protein
ydcF b1414 0.3249 0.0248 conserved hypothetical protein
ydcP b1435 0.5182 0.0437 putative collagenase
ydcQ b1438 0.6588 0.0380 hypothetical protein
ydcV b1443 2.3103 0.0430 YdcS/YdcT/YdcV/YdcU ABC transporter
ydcX b1445 1.7926 0.0407 hypothetical protein
ydcZ b1447 0.6629 0.0339 putative transport protein
ydeI b1536 1.4337 0.0167 conserved hypothetical protein
ydeK b1510 0.5430 0.0356 YdeK
ydeP b1501 1.2063 0.0190 acid resistance protein
ydfH b1540 0.4468 0.0056 hypothetical protein
ydfX b1568 1.9527 0.0006 hypothetical protein
ydgK b1626 0.2396 0.0104 putative oxidoreductase
ydgT b1625 0.1619 0.0070 conserved hypothetical protein
ydhA b1639 0.3471 0.0143 conserved hypothetical protein
ydhC b1660 0.5332 0.0469 YdhC drug MFS transporter
ydhF b1647 0.6866 0.0318 putative oxidoreductase, NAD(P)-linked
ydhH b1640 0.5178 0.0331 conserved hypothetical protein
ydhI b1643 0.3395 0.0016 hypothetical protein
ydhX b1671 1.4069 0.0177 putative oxidoreductase, Fe-S subunit
ydiA b1703 0.4230 0.0097 conserved protein
ydiF b1694 2.3786 0.0350 putative enzyme / putative acetate CoA-transferase
ydiU b1706 0.3937 0.0051 conserved protein
ydjA b1765 0.2828 0.0032 conserved protein
ydjE b1769 1.5337 0.0078 YdjE MFS transporter
ydjG b1771 1.5063 0.0105 putative oxidoreductase
ydjI b1773 1.8655 0.0163 putative aldolase
yeaB b1813 0.3894 0.0148 conserved hypothetical protein, MutT-like
yeaD b1780 1.6695 0.0155 conserved hypothetical protein
yeaN b1791 1.5049 0.0207 YeaN
yeaQ b1795 2.2111 0.0082 conserved hypothetical protein
yebF b1847 1.6698 0.0283 conserved hypothetical protein
yebK b1853 0.2495 0.0033 hypothetical protein
yebQ b1828 1.8190 0.0400 YebQ
yebR b1832 0.3530 0.0270 conserved hypothetical protein
yebW b1837 0.4682 0.0099 hypothetical protein
yecD b1867 0.2234 0.0222 putative enzyme
yecN b1869 0.3102 0.0188 putative membrane protein
yecP b1871 0.3399 0.0218 putative enzyme
yecT b1877 1.0931 0.0431 hypothetical protein
yedA b1959 0.5288 0.0316 putative transmembrane subunit
yedR b1963 1.5955 0.0146 hypothetical protein
133

APPENDIX I
gene blattner ratio p-value Function
A/B
yedS_1 b1964 2.2882 0.0042 putative outer membrane protein
yedS_2 b1965 1.7587 0.0236 putative outer membrane protein
yedV b1968 1.8495 0.0385 putative 2-component sensor protein
yeeI b1976 0.0966 0.0010 conserved hypothetical protein
yeeN b1983 4.9594 0.0148 conserved protein
yeeR b2001 2.6686 0.0487 hypothetical protein
yeeT b2003 2.3201 0.0034 hypothetical protein
yeeV b2005 1.3165 0.0457 toxin of the YeeV-YeeU toxin-antitoxin pair
yegK b2072 1.7271 0.0442 conserved hypothetical protein
yegS b2086 2.0901 0.0070 conserved protein
yegZ b2083 2.2403 0.0450 hypothetical protein
yeiB b2152 0.3697 0.0315 putative flavoprotein
yeiE b2157 0.3697 0.0245 LYSR-type transcriptional regulator
yeiH b2158 0.4992 0.0227 putative membrane protein
yeiS b2145 0.4582 0.0020 hypothetical protein
yeiU b2174 0.4647 0.0046 putative permease
yejO b2190 0.7784 0.0168 putative outer membrane protein
yfbE b2253 2.0569 0.0265 UDP-L-Ara4O C-4" transaminase
yfbN b2273 2.3173 0.0063 conserved hypothetical protein
yfbP b2275 1.8398 0.0323 hypothetical protein
yfbS b2292 1.5779 0.0333 putative transport protein
yfdG b2350 0.2271 0.0070 hypothetical protein
yfdT b2363 1.6042 0.0163 hypothetical protein
yfdY b2377 0.3177 0.0340 hypothetical protein
yfdZ b2379 0.4370 0.0356 putative aminotransferase
yfeT b2427 0.3878 0.0370 conserved protein
yffP b2447 0.5387 0.0462 hypothetical protein
yfgA b2516 0.3806 0.0060 putative membrane protein
yfgB b2517 0.5726 0.0383 putative pyruvate formate lyase activating enzyme 2
yfgC b2494 0.5296 0.0021 conserved protein
yfgJ b2510 2.4079 0.0095 putative cytochrome
yfhG b2555 0.2458 0.0032 conserved protein
yfhL b2562 0.2615 0.0411 putative ferredoxin
yfhR b2534 1.6968 0.0195 putative methylase or hydrolase
yfiC b2575 0.1195 0.0045 putative enzyme
yfiR b2603 0.4114 0.0278 conserved protein
yfjD b4461 1.6322 0.0139 putative membrane protein, hemolysin-like
yfjG b2619 1.8502 0.0087 toxin of a putative toxin-antitoxin pair
yfjL b2628 0.1625 0.0098 hypothetical protein
yfjO b2631 0.5072 0.0379 hypothetical protein
yfjS b2636 1.9190 0.0123 inner membrane lipoprotein YfjS
yfjU b2638 0.5267 0.0020 hypothetical protein
ygaD b2700 0.4320 0.0264 conserved protein
ygaH b2683 0.4552 0.0216 putative transport protein
ygbE b2749 0.1583 0.0105 putative cytochrome oxidase subunit
ygcF b2777 2.5383 0.0021 hypothetical protein
ygdI b2809 2.2634 0.0305 hypothetical protein
ygdK b2811 0.3282 0.0174 conserved hypothetical protein
ygdR b2833 0.4614 0.0075 conserved hypothetical protein
ygeG b2851 1.7509 0.0180 conserved hypothetical protein
ygeK b2855 2.0910 0.0188 putative 2-component transcriptional regulator
ygeW b2870 1.8672 0.0031 putative carbamoyl transferase
ygfH b2920 1.5120 0.0087 propionyl-CoA:succinate CoA transferase
ygfS b2886 1.9879 0.0229 putative oxidoreductase, Fe-S subunit
yggH b2960 0.4393 0.0186 tRNA (m7G46) methyltransferase
yggJ b2946 0.5103 0.0052 conserved hypothetical protein
134

APPENDIX I
gene blattner ratio
A/B
p-value
yggX b2962 0.2130 0.0026
Function
conserved hypothetical protein with role in oxidation-resistance of iron-sulfur
clusters
yghQ b2983 1.5927 0.0325 putative serine protease
yghS b2985 2.5090 0.0044 conserved protein
ygiA b3036 0.4378 0.0239 hypothetical protein
ygiF b3054 0.4550 0.0096 conserved hypothetical protein
ygiH b3059 0.3702 0.0081 putative membrane protein
ygiU b3022 0.2603 0.0069 putative cyanide hydratase
ygjG b3073 1.9440 0.0152 putrescine:2-oxoglutaric acid aminotransferase
ygjN b3083 0.4759 0.0137 conserved hypothetical protein
ygjR b3087 0.4817 0.0398 putative NAD(P)-binding dehydrogenase
yhaK b3106 0.6327 0.0013 conserved hypothetical protein
yhbP b3154 0.2861 0.0046 conserved protein
yhcA b3215 1.7828 0.0096 putative chaperone
yhcB b3233 0.4240 0.0252 conserved hypothetical protein
yhcD b3216 2.5320 0.0410 putative outer membrane protein
yhcM b3232 0.2725 0.0003 hypothetical protein
yhdA b3252 0.1678 0.0074 conserved protein
yhdJ b3262 1.4106 0.0325 cell cycle-regulated methyltransferase
yheN b3345 0.6302 0.0272 conserved hypothetical protein
yheO b3346 0.5020 0.0092 hypothetical protein
yhfG b3362 1.9518 0.0284 conserved hypothetical protein
yhfX b3381 1.9848 0.0205 conserved protein
yhhK b3459 0.4123 0.0018 putative acyltransferase
yhhM b3467 0.3265 0.0159 putative receptor
yhhN b3468 0.4588 0.0073 putative enzyme
yhhS b3473 0.3667 0.0188 YhhS MFS transporter
yhhT b3474 0.5527 0.0461 hypothetical protein
yhiL b3490 2.2476 0.0051 hypothetical protein
yhiP b3496 1.3365 0.0190 YhiP peptide POT transporter
yhiS b3504 1.6910 0.0222 conserved protein
yhjA b3518 2.6298 0.0076 putative cytochrome C peroxidase (EC 1.11.1)
yhjC b3521 0.2139 0.0092 putative transcriptional regulator LYSR-type
yhjR b3535 0.2767 0.0243 hypothetical protein
yiaJ b3574 0.3464 0.0228 YiaJ transcriptional repressor
yiaV b3586 2.4422 0.0226 putative membrane protein
yibA b3594 2.4261 0.0343 putative lyase
yicE b3654 0.0934 0.0007 YicE NCS2 tranporter
yidI b3677 0.5721 0.0151 hypothetical protein
yieO b3754 0.5670 0.0417 YieO drug MFS transporter
yifE b3764 1.7605 0.0381 hypothetical protein
yigA b3810 0.4061 0.0291 conserved hypothetical protein
yigL b3826 1.9789 0.0325 conserved protein with a phosphatase-like domain
yihI b3866 0.3969 0.0382 conserved protein
yihN b3874 1.3163 0.0362 YihN MFS transporter
yihW b3884 0.5544 0.0009 putative DEOR-type transcriptional regulator
yihX b3885 0.1479 0.0070 putative phosphatase
yjbE b4026 2.1742 0.0103 conserved hypothetical protein
yjbJ b4045 0.8546 0.0153 highly abundant nonessential protein
yjbQ b4056 0.3680 0.0272 conserved hypothetical protein
yjdA b4109 0.1308 0.0055 hypothetical protein
yjeB b4178 0.1691 0.0045 conserved protein with a Winged helix domain
yjeK b4146 0.2195 0.0017 hypothetical protein
yjeS b4166 5.5584 0.0055 conserved ferredoxin-like protein
yjfY b4199 2.3690 0.0232 conserved hypothetical protein
yjfZ b4204 1.7639 0.0428 hypothetical protein
yjgK b4252 0.7295 0.0143 conserved hypothetical protein
135

APPENDIX I
gene blattner ratio p-value Function
A/B
yjhQ b4307 1.4246 0.0099 hypothetical protein
yjiP b4338 2.4980 0.0122 hypothetical protein
yjjK b4391 1.7150 0.0293 YjjK
yjjV b4378 0.5588 0.0453 putative hydrolase
ykfA b0253 0.6499 0.0241 putative GTP-binding protein
ykfI b0245 1.4478 0.0135 toxin of the YkfI-YafW toxin-antitoxin pair
ymdB b1045 0.3716 0.0228 conserved protein
ymfE b1138 0.3125 0.0102 hypothetical protein
ymfL b1147 2.2281 0.0426 hypothetical protein
ymjA b1295 0.2117 0.0004 hypothetical protein
ynaE b1375 0.3494 0.0151 hypothetical protein
ynaI b1330 2.3789 0.0357 YnaI
yncA b1448 0.2369 0.0176 putative N-acetyltransferase
yncI b1458 0.3663 0.0269 conserved protein
yneE b1520 0.3459 0.0204 conserved hypothetical protein
yneH b1524 0.2425 0.0072 putative glutaminase
yoaB b1809 0.7879 0.0038 conserved protein
yoaG b1796 1.8050 0.0152 hypothetical protein
yoaH b1811 0.4847 0.0212 conserved hypothetical protein
yobA b1841 0.4374 0.0151 hypothetical protein
yodA b1973 1.4017 0.0256 cadmium-induced metal binding protein
ypdA b2380 0.4128 0.0202 putative sensor protein
yphA b2543 0.5045 0.0317 hypothetical protein
ypjA b2647 1.4597 0.0449 putative outer membrane protein
ypjF b2646 2.1806 0.0102 member of the YeeV, YkfI, YpjF family of toxin proteins
yqaA b2689 0.3480 0.0062 putative integral membrane protein
yqeI b2847 0.2786 0.0052 putative sensory transducer
yqgE b2948 0.4450 0.0370 conserved protein
yqgF b2949 0.3997 0.0078 possible Holliday junction resolvase
yqiA b3031 0.4262 0.0079 putative hydrolase
yqiB b3033 0.3117 0.0078 putative enzyme
yqiJ b3050 1.4637 0.0242 putative oxidoreductase
yqjC b3097 1.4751 0.0229 conserved protein
yqjK b3100 1.6055 0.0133 conserved hypothetical protein
yraM b3147 0.3549 0.0084 putative glycosylase
yraN b3148 0.3605 0.0169 conserved hypothetical protein
yrbL b3207 0.3337 0.0259 conserved hypothetical protein; transcription is regulated by Mg2+
yrdD b3283 0.1449 0.0047 putative DNA topoisomerase
ytfA b4205 0.8018 0.0308 hypothetical protein
ytfG b4211 1.9267 0.0219 putative oxidoreductase
ytfN b4221 0.6361 0.0427 conserved protein
ytfP b4222 0.5980 0.0212 conserved hypothetical protein
ytjB b4387 0.5868 0.0341 membrane protein
zapA b2910 0.1619 0.0022 ZapA protein, localizes to the cytokinetic ring
zipA b2412 0.2297 0.0272 essential cell division protein ZipA
zitB b0752 2.0419 0.0407 ZitB zinc CDF transporter
znuA b1857 0.4717 0.0485 ZnuA/ZnuB/ZnuC ABC transporter
zur b4046 0.3387 0.0049 Zur transcriptional regulator
Supplementary table – IX: LZ41 hns-205::Tn10 (A) Vs LZ54 hns-205::Tn10 (B)
gene blattner ratio p-value Function
A/B
acpS b2563 1.5407 0.0218 holo-[acyl-carrier-protein] synthase
136

APPENDIX I
gene blattner ratio p-value Function
A/B
acrE b3265 0.1990 0.0005 transmembrane protein affects septum formation and cell membrane permeability
acrF b3266 0.4401 0.0079 AcrEF-TolC Drug Efflux Transport System
ade b3665 0.4857 0.0346 cryptic adenine deaminase monomer
agaA b3135 1.3368 0.0175 AgaA
agp b1002 1.7053 0.0169 3-phytase / glucose-1-phosphatase
allD b0517 0.8448 0.0140 ureidoglycolate dehydrogenase
alsK b4084 2.0491 0.0034 putative D-allose kinase
amn b1982 0.6066 0.0233 AMP nucleosidase
ampH b0376 0.6290 0.0473 putative enzyme
apt b0469 0.4031 0.0012 adenine phosphoribosyltransferase
arcB b3210 1.3746 0.0005 ArcB-Phis292
argE b3957 0.4469 0.0206 acetylornithine deacetylase
argP b2916 1.8354 0.0114 ArgP transcriptional activator
argR b3237 0.8272 0.0077 ArgR transcriptional dual regulator
aroG b0754 0.4066 0.0018 2-dehydro-3-deoxyphosphoheptonate aldolase
aroL b0388 0.6991 0.0407 shikimate kinase II
aroM b0390 1.2587 0.0066 protein of aro operon, regulated by aroR
arsR b3501 2.1332 0.0342 ArsR transcriptional regulator
artJ b0860 1.4705 0.0115 arginine ABC transporter
ascF b2715 0.6756 0.0021 EIIAsc
asd b3433 0.3715 0.0107 aspartate semialdehyde dehydrogenase
asr b1597 1.4676 0.0477 acid shock protein
atoC b2220 1.4762 0.0173 AtoC-Pasp
b0165 b0165 0.5609 0.0062 hypothetical protein
b0255 b0255 0.4577 0.0292 hypothetical protein
b0501 b0501 1.7323 0.0252 hypothetical protein
b0582 b0582 1.6254 0.0305 IS186 protein
b0609 b0609 1.7352 0.0238 hypothetical protein
b1052 b1052 0.6634 0.0425 hypothetical protein
b1144 b1144 2.3356 0.0306 hypothetical protein
b1371 b1371 1.3289 0.0228 hypothetical protein
b1402 b1402 0.5199 0.0099 IS22 protein
b1578 b1578 0.3596 0.0018 hypothetical protein
b3004 b3004 1.5667 0.0459 hypothetical protein
b3044 b3044 0.4341 0.0020 IS21 protein
b3975 b3975 0.6083 0.0012 hypothetical protein
bcp b2480 0.4248 0.0031 thiol peroxidase
bcsB b3532 1.3097 0.0175 cellulose biosynthesis protein
bcsZ b3531 1.5108 0.0233 endo-1,4-D-glucanase
bfd b3337 1.5485 0.0247 bacterioferritin-associated ferredoxin
bglJ b4366 0.6250 0.0347 BglJ transcriptional regulator
bisC b3551 0.7735 0.0310 biotin sulfoxide reductase / methionine-S-sulfoxide reductase
bolA b0435 1.2797 0.0184 BolA transcriptional regulator
borD b0557 0.3304 0.0257 bacteriophage lambda Bor protein homolog
btuB b3966 2.9792 0.0085
outer membrane receptor for transport of vitamin B12, E colicins, and
bacteriophage BF23
btuF b0158 1.6355 0.0409 periplasmic vitamin B12 binding protein
cadA b4131 1.5715 0.0317 lysine decarboxylase
caiD b0036 1.4534 0.0482 crotonobetainyl-CoA hydratase / carnitine racemase
carA b0032 0.2101 0.0070 carbamoyl phosphate synthetase
ccmA b2201 1.6431 0.0142 CcmABCDEFGH cytochrome c biogenesis system
cfa b1661 0.6266 0.0211 cyclopropane fatty acid synthase
cheY b1882 1.3741 0.0165 CheY-Pasp
citX b0614 1.6215 0.0232 holo-ACP synthase
clpA b0882 1.3076 0.0196 ATP-binding component of serine protease
clpB b2592 1.7953 0.0255 ClpB chaperone
cmr b0842 0.6968 0.0355 MdfA/Cmr MFS multidrug transporter
137

APPENDIX I
gene blattner ratio p-value Function
A/B
cobC b0638 2.3925 0.0065 alpha-ribazole-5'-P phosphatase
codA b0337 0.3324 0.0112 cytosine deaminase
codB b0336 0.3778 0.0284 CodB cytosine NCS1 transporter
corA b3816 0.6187 0.0409 CorA magnesium ion MIT transporter
cpdA b3032 0.6411 0.0141 cAMP phosphodiesterase
cpsB b2049 4.1414 0.0042 mannose-1-phosphate guanylyltransferase-(GDP)
cpsG b2048 3.9546 0.0014 phosphomannomutase
cpxP b3913 2.3448 0.0199
regulator of the Cpx response and possible chaperone involved in resistance to
extracytoplasmic stress
creB b4398 0.3912 0.0063 CreB- Phosphorylated transcriptional regulator
crl b0240 0.3398 0.0058 Crl transcriptional regulator
csgA b1042 1.1757 0.0491 curlin, major subunit
csgD b1040 0.3335 0.0298 CsgD transcriptional activator
csgE b1039 0.3294 0.0116 curli production assembly/transport component
csgG b1037 0.6373 0.0467 curli production component
cspA b3556 0.1595 0.0272 cold shock protein CspA
cspB b1557 0.0804 0.0020 cold shock protein CspB
cspF b1558 0.1563 0.0010 cold shock protein CspF
cspI b1552 0.4222 0.0364 cold shock protein CspI
cvpA b2313 0.4563 0.0323 membrane protein required for colicin V production
cyaY b3807 0.7207 0.0274 iron-binding frataxin homolog
cybB b1418 0.4149 0.0121 cytochrome b561
cybC b4236 0.5877 0.0172 cytochrome b562 (soluble)
cynR b0338 1.4730 0.0246 CynR-Cyanate transcriptional activator
cyoA b0432 1.6203 0.0356 cytochrome bo terminal oxidase subunit II
cyoD b0429 1.2541 0.0388 cytochrome bo terminal oxidase subunit IV
cyoE b0428 1.7729 0.0214 heme O synthase
cysJ b2764 0.8120 0.0324 sulfite reductase flavoprotein subunit
cysM b2421 0.7167 0.0338 O-acetylserine (thiol)-lyase B
cytR b3934 0.3074 0.0076 CytR-cytidine
dapA b2478 0.5629 0.0328 dihydrodipicolinate synthase
dapF b3809 0.5061 0.0428 diaminopimelate epimerase
dcm b1961 0.8273 0.0436 DNA cytosine methylase
dcrB b3472 2.0849 0.0233 conserved protein involved in bacteriophage adsorption
ddpA b1487 1.5696 0.0361 YddS
ddpC b1485 2.0675 0.0310 YddQ
degS b3235 0.4723 0.0130
inner membrane serine protease required for the extracytoplasmic stress response
mediated by sigmaE
dfp b3639 0.4912 0.0038 P-pantothenate cysteine ligase / P-pantothenoylcysteine decarboxylase
dnaB b4052 0.2288 0.0030 chromosome replication; chain elongation; part of primosome
dnaG b3066 2.0680 0.0024 DNA biosynthesis; DNA primase
dppC b3542 1.7014 0.0194 dipeptide ABC transporter
dppF b3540 1.6050 0.0225 dipeptide ABC transporter
dsbB b1185 0.7021 0.0043 dsbB protein
dsbC b2893 0.5304 0.0070 DsbCoxidized
dtd b3887 0.6855 0.0317 D-Tyr-tRNATyr deacylase
dxr b0173 1.5005 0.0195 DXP reductoisomerase
eda b1850 1.6768 0.0060
oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2-
keto-4-hydroxyglutarate aldolase
elaA b2267 0.7645 0.0471 hypothetical protein
elaC b2268 0.6841 0.0220 binuclear zinc phosphodiesterase monomer
emrE b0543 1.4396 0.0395 EmrE SMR transporter
entD b0583 0.7069 0.0132 phosphopantetheinyl transferase
entE b0594 0.5193 0.0155 enterobactin synthase multienzyme complex
envR b3264 0.6510 0.0447 EnvR transcriptional regulator
epd b2927 0.4460 0.0015 erythrose 4-phosphate dehydrogenase
eutN b2456 1.0929 0.0134 putative detox protein, ethanolamine utilization
138

APPENDIX I
gene blattner ratio
A/B
p-value
Function
beta-hydroxyacyl-ACP dehydrase / beta-hydroxydecanoyl-ACP dehydrase / trans-
2-decenoyl-ACP isomerase
fabA b0954 1.3210 0.0488
fabB b2323 0.5971 0.0302 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase
fadE b0221 1.6673 0.0495 acyl-CoA dehydrogenase
fdnI b1476 1.9523 0.0061 formate dehydrogenase N, &gamma; subunit
involved in protein transport; multicopy suppressor of dominant negative ftsH
fdrA b0518 1.2709 0.0284 mutants
outer membrane receptor; citrate-dependent iron transport, outer membrane
fecA b4291 1.7276 0.0273 receptor
fecI b4293 3.0790 0.0101 sigma19 factor
fhuC b0151 0.5705 0.0007 ferrichrome uptake system
fldA b0684 1.1793 0.0126 oxidized flavodoxin 1
flgJ b1081 1.5509 0.0122 FlgJ
flhD b1892 0.3498 0.0204 FlhD transcriptional dual regulator
fliK b1943 1.5668 0.0293 flagellar hook-length control protein FliK
periplasmic cystine-binding protein; member of extracellular bacterial solutebinding
fliY b1920 0.5595 0.0124
protein family III
fmt b3288 1.4785 0.0271 10-formyltetrahydrofolate:L-methionyl-tRNA(fMet) N-formyltransferase
fnr b1334 2.6607 0.0164 FNR transcriptional dual regulator
folB b3058 0.5634 0.0051 dihydroneopterin aldolase
methyleneTHF enzyme / methenyltetrahydrofolate cyclohydrolase /
folD b0529 0.6659 0.0470 methylenetetrahydrofolate dehydrogenase-(NADP+)
fre b3844 1.6805 0.0020 FMN reductase
frlR b3375 0.7577 0.0058 putative transcriptional regulator
frmA b0356 1.5071 0.0219 formaldehyde dehydrogenase, glutathione-dependent
frsA b0239 0.4360 0.0232 fermentation/respiration switch protein
fruR b0080 0.6025 0.0156 FruR transcriptional dual regulator
frvA b3900 1.5012 0.0441 EIIABCFrv
frwB b3950 2.0264 0.0163 EIIBCFrw
frwC b3949 1.7660 0.0430 EIIBCFrw
ftsB b2748 0.3995 0.0032 essential cell division protein FtsB
fumB b4122 1.5288 0.0433 fumarase B monomer
fur b0683 1.5727 0.0358 Fur transcriptional dual regulator
gadX b3516 0.5996 0.0010 GadX transcriptional activator
UDP-glucose-hexose-1-phosphate uridylyltransferase / galactose-1-phosphate
galT b0758 1.5496 0.0183 uridylyltransferase
galU b1236 1.1283 0.0373 UTP-glucose-1-phosphate uridylyltransferase
gapC_1 b1417 0.6328 0.0268 split glyceraldehyde 3-phosphate dehydrogenase C
gapC_2 b1416 0.7832 0.0228 glyceraldehyde 3-phosphate dehydrogenase C, interrupted
gatC b2092 0.5533 0.0229 EIIGat
gatD b2091 0.5303 0.0482 galactitol-1-phosphate dehydrogenase
gatY b2096 0.2303 0.0083 tagatose-1,6-bisphosphate aldolase 2
gatZ b2095 0.3772 0.0024 tagatose-1,6-bisphosphate aldolase 2
gcvH b2904 0.1767 0.0186 dihydrolipoyl-GcvH-protein
gcvR b2479 0.2386 0.0003 GcvR-gly
glcA b2975 1.2470 0.0468 YghK transporter
glf b2036 1.4291 0.0266 UDP-galactopyranose mutase
N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate
glmU b3730 0.2684 0.0006 acetyltransferase
glnD b0167 1.5254 0.0066 uridylyltransferase / uridylyl-removing enzyme
glpB b2242 1.6094 0.0343 glycerol-3-phosphate-dehydrogenase, anaerobic
glpD b3426 0.6947 0.0391 glycerol 3-phosphate dehydrogenase, aerobic
gltI b0655 2.1460 0.0238 putative periplasmic binding transport protein
gltJ b0654 1.8439 0.0084 glutamate ABC transporter
gltL b0652 2.3251 0.0499 glutamate ABC transporter
glyA b2551 0.6522 0.0151 glycine hydroxymethyltransferase
glyQ b3560 0.7048 0.0451 glycine-tRNA synthetase, alpha subunit
gntU b4476 1.5662 0.0354 GntU gluconate Gnt transporter
gntY b3414 2.5638 0.0235 predicted membrane-bound protein that is involved in high-affinity gluconate
139

APPENDIX I
gene blattner ratio
A/B
p-value Function
transport
gpt b0238 0.6101 0.0011
xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase /
hypoxanthine phosphoribosyltransferase
greA b3181 2.0067 0.0017
transcription elongation factor; stimulates the mRNA cleavage activity of RNA
polymerase
grxA b0849 1.5161 0.0008 oxidized glutaredoxin
grxB b1064 0.6716 0.0024 oxidized glutaredoxin 2
gspC b3324 0.6446 0.0495 putative protein secretion protein for export
gspD b3325 0.6169 0.0078 putative protein secretion protein for export
gspG b3328 1.3373 0.0380 putative protein secretion protein for export
gspJ b3331 1.5637 0.0307 putative protein secretion protein for export
gspM b3334 1.6029 0.0266 putative protein secretion protein
gst b1635 0.4622 0.0007 glutathione transferase
guaB b2508 0.4105 0.0135 IMP dehydrogenase
gudX b2788 2.0225 0.0315 putative glucarate dehydratase
gyrB b3699 2.0935 0.0014 DNA gyrase, subunit B
hcaC b2540 0.6918 0.0184 ferredoxin, 3-phenylpropionate dioxygenase system
hcaT b2536 0.7188 0.0131 HcaT MFS transporter
hcr b0872 1.7460 0.0357 NADH oxidoreductase
hdeA b3510 0.6336 0.0024 acid-resistance protein, possible chaperone
hdfR b4480 0.5965 0.0480 transcriptional regulator
hemA b1210 2.4332 0.0162 glutamyl-tRNA reductase
hemC b3805 0.3060 0.0013 hydroxymethylbilane synthase
hemD b3804 0.4619 0.0020 uroporphyrinogen III synthase
hemG b3850 0.6070 0.0126 protoporphyrinogen oxidase
hemH b0475 1.6618 0.0431 ferrochelatase
hflD b1132 0.5428 0.0224 membrane protein in operon with purB
hflX b4173 0.6818 0.0118 putative GTPase; possible regulator of HflKC
hfq b4172 0.5741 0.0397
RNA-binding protein that affects many cellular processes; homolog of
mammalian Sm/Sm-like proteins
hha b0460 0.3066 0.0051 haemolysin expression modulating protein
hisC b2021 0.5274 0.0366 histidine-phosphate aminotransferase
hisD b2020 0.4683 0.0485 histidinal dehydrogenase / histidinol dehydrogenase
hisF b2025 0.8078 0.0189 imidazole glycerol phosphate synthase, HisF subunit
hisS b2514 0.6173 0.0477 histidyl-tRNA synthetase
hns b1237 0.5055 0.0012 H-NS transcriptional dual regulator
hofO b3393 2.0366 0.0008 conserved hypothetical protein
holA b0640 1.8168 0.0002 DNA polymerase III, delta subunit
holC b4259 0.2779 0.0200 DNA polymerase III, chi subunit
holE b1842 0.2376 0.0017 DNA polymerase III, theta subunit
hslR b3400 1.6952 0.0251 heat shock protein Hsp15
htrA b0161 1.3676 0.0489 DegP
htrL b3618 3.3010 0.0333 involved in lipopolysaccharide biosynthesis
hycH b2718 1.3428 0.0378 processing of large subunit (HycE) of hydrogenase 3 (part of the FHL complex)
hypF b2712 1.5597 0.0001 hydrogenase maturation protein
ibpA b3687 1.9972 0.0407 small heat shock protein IbpA
iclR b4018 0.3761 0.0272 IclR-PEP
idnD b4267 0.6061 0.0334 L-idonate 5-dehydrogenase
idnO b4266 0.6120 0.0319 5-keto-D-gluconate 5-reductase / putative acetoin dehydrogenase
ilvG_1 b3767 0.3376 0.0394 IlvG_1
ilvM b3769 0.3697 0.0001 acetohydroxybutanoate synthase II / acetolactate synthase II
imp b0054 0.6460 0.0370 organic solvent tolerance
infA b0884 1.9363 0.0438 protein chain initiation factor IF-1
intR b1345 0.5249 0.0341 putative transposase
intZ b2442 0.7707 0.0220 putative prophage integrase
iscR b2531 3.2160 0.0490 IscR transcriptional regulator
iscU b2529 2.3333 0.0037 scaffold protein involved in iron-sulfur cluster assembly
140

APPENDIX I
gene blattner ratio p-value Function
A/B
iscX b2524 1.9429 0.0374 protein with possible role in iron-sulfur cluster biogenesis
ispA b0421 0.2156 0.0032 geranyl diphosphate synthase / farnesyl diphosphate synthase
ispG b2515 0.4793 0.0372 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate synthase
kdpA b0698 1.4635 0.0082 potassium ion P-type ATPase transporter
kdtA b3633 0.5128 0.0192 KDO transferase
kefC b0047 1.4900 0.0328 KefC potassium CPA2 transporter
lctD b3605 1.5950 0.0088 L-Lactate:Quinone Oxidoreductase
leuA b0074 0.5604 0.0386 2-isopropylmalate synthase
leuO b0076 0.4172 0.0372 LeuO transcriptional activator
ligT b0147 0.3631 0.0028 hypothetical protein
lipB b0630 1.7073 0.0027 lipoyl-protein ligase
lolB b1209 0.5077 0.0232 outer membrane lipoprotein, localization of lipoproteins in the outer membrane
lon b0439 1.7720 0.0416 DNA-binding, ATP-dependent protease La
lpcA b0222 0.5206 0.0283 lipopolysaccharide core biosynthesis; phosphoheptose isomerase
lpxP b2378 1.5961 0.0222 palmitoleoyl acyltransferase
maa b0459 0.4667 0.0368 maltose acetyltransferase
malP b3417 1.6906 0.0124 maltodextrin phosphorylase monomer
malT b3418 0.4985 0.0239 MalT-MalK
marA b1531 0.5442 0.0225 MarA transcriptional activator
mazE b2783 0.8900 0.0434 antitoxin of the MazEF "addiction module"
mcrA b1159 0.4973 0.0172 restriction of DNA at 5-methylcytosine residues
mcrB b4346 1.3712 0.0144 MrcB subunit of 5-methylcytosine restriction system
mdaB b3028 0.5909 0.0179 NADPH quinone reductase
mdoG b1048 1.3670 0.0155 periplasmic glucan (MDO) biosynthesis protein
mdtF b3514 2.2727 0.0041 YhiV
mdtK b1663 0.4631 0.0216 NorE multidrug efflux MATE transporter
mdtN b4082 1.4199 0.0116 putative membrane protein
menF b2265 0.3329 0.0082 isochorismate synthase, menaquinone-specific
metC b3008 1.3616 0.0383 L-cysteine desulfhydrase / cystathionine-beta-lyase
mgrB b1826 0.6490 0.0364 hypothetical protein; product of a gene induced by low magnesium
minC b1176 0.1945 0.0010
cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that
regulate septum placement
minD b1175 0.3435 0.0101
membrane ATPase of the MinC-MinD-MinE system that regulates septum
placement
minE b1174 0.3672 0.0145
cell division topological specificity factor and inhibitory component of the MinC-
MinD-MinE system that regulates septum placement
mltC b2963 0.5062 0.0384 membrane-bound lytic murein transglycosylase C
mnmC b2324 0.5470 0.0326 bifunctional enzyme catalyzing the formation of mnm5s2U in tRNA
mobA b3857 0.6706 0.0302 molybdopterin guanine dinucleotide synthase
motB b1889 0.7051 0.0060
MotB protein, enables flagellar motor rotation, linking torque machinery to cell
wall
mreB b3251 0.5301 0.0235 rod shape-determining protein
msbB b1855 0.3370 0.0177 myristoyl acyltransferase
msrB b1778 1.0943 0.0060
methionine sulfoxide reductase B / protein-methionine-S-oxide reductase /
methionine sulfoxide reductase
mtlD b3600 0.4275 0.0087 mannitol-1-phosphate 5-dehydrogenase
mukE b0923 0.4201 0.0052 protein involved in chromosome partitioning
mukF b0922 0.2947 0.0054 Ca2+-binding protein involved in chromosome partitioning
murC b0091 1.5288 0.0169 UDP-N-acetylmuramate-alanine ligase
murI b3967 2.4431 0.0020 glutamate racemase
mutM b3635 1.4678 0.0408 formamidopyrimidine DNA glycosylase
mutY b2961 0.3818 0.0326 adenine glycosylase; G.C --> T.A transversions
nadD b0639 2.2259 0.0009 nicotinate-mononucleotide adenylyltransferase
nadE b1740 0.7970 0.0374 NAD+ synthase, glutamine dependent / NAD+ synthase, NH3-dependent
nadK b2615 1.2935 0.0461 NAD kinase monomer
nagZ b1107 0.5177 0.0214 &beta;-N-acetylglucosaminidase
nanR b3226 0.3753 0.0253 NanR transcriptional regulator
napC b2202 1.5349 0.0131 cytochrome c protein
141

APPENDIX I
gene blattner ratio p-value Function
A/B
narI b1227 1.4294 0.0314 nitrate reductase A, &gamma; subunit
narP b2193 0.5047 0.0363 NarP-Phosphorylated transcriptional regulator
narX b1222 0.7241 0.0227 NarX-Phis
ndh b1109 0.3534 0.0481 NADH cupric reductase / NADH dehydrogenase II
nfo b2159 0.7313 0.0447 endonuclease IV
nhaA b0019 1.6748 0.0323 sodium/proton NhaA transporter
nhaB b1186 0.7111 0.0329 NhaB sodium/proton transporter
nhaR b0020 1.5626 0.0364 NhaR-Na+ transcriptional activator
nirD b3366 1.2931 0.0487 nitrite reductase, small subunit
nlpB b2477 0.4282 0.0017 lipoprotein-34
nlpD b2742 0.5889 0.0384 NlpD putative outer membrane lipoprotein
nmpC b0553 0.2798 0.0066 outer membrane porin protein; locus of qsr prophage
nrdH b2673 1.5595 0.0197 glutaredoxin-like protein; hydrogen donor
nrfB b4071 1.4551 0.0140 nitrite reductase complex
nrfG b4076 0.7857 0.0445 maturation of formate-dependent nitrite reductase complex
nth b1633 2.1800 0.0177 endonuclease III; specific for apurinic and/or apyrimidinic sites
nudF b3034 0.5025 0.0228 hypothetical protein
nudH b2830 0.4636 0.0223 putative invasion protein
nuoA b2288 1.6995 0.0472 NADH dehydrogenase I
nuoB b2287 1.5197 0.0379 NADH dehydrogenase I
nuoE b2285 1.4198 0.0304 NADH dehydrogenase I
nuoF b2284 1.4220 0.0317 NADH dehydrogenase I
nusG b3982 0.2852 0.0347 component in transcription antitermination
ompX b0814 1.4445 0.0493 outer membrane protein X
osmB b1283 3.4496 0.0098 OsmB osmotically inducible lipoprotein
pabA b3360 1.6781 0.0002
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
pabB b1812 0.5495 0.0354
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
pabC b1096 0.3442 0.0019
para-aminobenzoate synthase multi-enzyme complex / para-aminobenzoate
synthase
panB b0134 0.7353 0.0027 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer
panE b0425 0.5460 0.0418 2-dehydropantoate reductase
parC b3019 0.4320 0.0075 Topoisomerase IV subunit A
pcnB b0143 0.6795 0.0070 poly(A) polymerase I
pdxA b0052 1.3711 0.0238 PdxA dehydrogenase/decarboxylase
pdxK b2418 1.2254 0.0374 pyridoxamine kinase / hydroxymethylpyrimidine kinase / pyridoxal kinase
pepA b4260 0.3097 0.0122 aminopeptidase A/I
pepB b2523 2.2644 0.0239 aminopeptidase (AP)
pepP b2908 1.3593 0.0065 proline aminopeptidase P II
pepT b1127 0.6833 0.0395 peptidase T
pgm b0688 1.5303 0.0417 phosphoglucomutase
pgpB b1278 0.4697 0.0419 phosphatidylglycerophosphatase B
pheA b2599 0.6656 0.0384 chorismate mutase / prephenate dehydratase
pheT b1713 0.7457 0.0492 phenylalanyl-tRNA synthetase &beta;-chain
phoP b1130 0.6028 0.0020 PhoP-Phosphorylated transcriptional dual regulator
pitB b2987 0.4848 0.0403 PitB
plsC b3018 0.4674 0.0213 1-acylglycerol-3-phosphate acyltransferase
pmbA b4235 0.4596 0.0021
protease involved in Microcin B17 maturation and in sensitivity to the DNA
gyrase inhibitor LetD
pmrF b2254 0.5087 0.0075 undecaprenyl phosphate-L-Ara4FN transferase
pncA b1768 1.5147 0.0154 pyrazinamidase / nicotinamidase
polB b0060 3.0331 0.0022 DNA polymerase II
poxA b4155 0.4978 0.0301 putative regulator of pyruvate oxidase
pphB b2734 1.5408 0.0047
protein phosphatase 2 / protein-tyrosine-phosphatase / phosphoprotein
phosphatase
ppk b2501 0.3409 0.0076 polyphosphate kinase
pppA b2972 0.8174 0.0270 prepilin peptidase
142

APPENDIX I
gene blattner ratio p-value Function
A/B
pqqL b1494 2.4892 0.0097 putative zinc peptidase
prkB b3355 0.6558 0.0194 probable phosphoribulokinase
prmA b3259 1.1549 0.0237 methylation of 50S ribosomal subunit protein L11
proB b0242 0.4436 0.0305 gamma-glutamyl kinase-GP-reductase multienzyme complex
proQ b1831 0.4270 0.0085 protein that affects osmoregulation of ProP transporter
prpR b0330 1.3979 0.0217 PrpR transcriptional regulator
pspE b1308 1.3420 0.0120 thiosulfate sulfurtransferase
pssA b2585 0.3090 0.0108 phosphatidylserine synthase
ptsA b3947 1.4554 0.0198 PEP-protein phosphotransferase system enzyme I
purA b4177 0.5294 0.0086 adenylosuccinate synthase
purC b2476 0.1639 0.0003 phosphoribosylaminoimidazole-succinocarboxamide synthase
purE b0523 0.2509 0.0013 N5-carboxyaminoimidazole ribonucleotide mutase
purF b2312 0.2414 0.0192 amidophosphoribosyl transferase
purM b2499 0.1577 0.0004 phosphoribosylformylglycinamide cyclo-ligase
purN b2500 0.5155 0.0120 phosphoribosylglycinamide formyltransferase
purR b1658 0.3655 0.0001 PurR transcriptional repressor
purT b1849 0.6975 0.0250 GAR transformylase 2
purU b1232 0.4724 0.0343 formyltetrahydrofolate deformylase
puuC b1300 1.2759 0.0124 aldehyde dehydrogenase
pykA b1854 1.2788 0.0072 pyruvate kinase II monomer
pykF b1676 0.6019 0.0200 pyruvate kinase I monomer
pyrC b1062 0.5738 0.0154 dihydroorotase
pyrF b1281 0.3505 0.0074 orotidine-5'-phosphate-decarboxylase
qseB b3025 0.5963 0.0366 putative 2-component transcriptional regulator
radC b3638 0.7993 0.0107 hypothetical protein
rarA b0892 1.3775 0.0153 recombination factor
rbsA b3749 1.3686 0.0067 ribose ABC transporter
rdoA b3859 0.3650 0.0037 cytoplasmic protein of low abundance
recB b2820 1.3049 0.0003
RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit,
ssDNA endonuclease
recF b3700 1.8782 0.0203 ssDNA and dsDNA binding, ATP binding
recN b2616 3.2489 0.0013 protein used in recombination and DNA repair
rfaJ b3626 2.9390 0.0359 UDP-D-glucose:(galactosyl)lipopolysaccharide glucosyltransferase
rfaK b3623 2.5429 0.0162 lipopolysaccharide core biosynthesis; probably hexose transferase
rfaS b3629 2.4712 0.0160 lipopolysaccharide core biosynthesis
rfaY b3625 2.7443 0.0257 lipopolysaccharide core biosynthesis
rfaZ b3624 2.8758 0.0135 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis
rfbX b2037 1.5328 0.0192 RfbX lipopolysaccharide PST transporter
rfc b2035 2.1537 0.0085 O-antigen polymerase
rfe b3784 0.2504 0.0025 undecaprenyl-phosphate &alpha;-N-acetylglucosaminyl transferase
rffC b3790 1.8384 0.0174 TDP-fucosamine acetyltransferase
rhaR b3906 1.5371 0.0023 RhaR-L-rhamnose transcriptional activator
rhlE b0797 0.5998 0.0306 DEAD-box-containing ATP-dependent RNA helicase family member
rhsD b0497 0.3038 0.0094 RhsD protein in rhs element
ribB b3041 0.4756 0.0036 3,4-dihydroxy-2-butanone 4-phosphate synthase
ribC b1662 0.6034 0.0484 riboflavin synthase
ribF b0025 0.2311 0.0048 riboflavin kinase / FMN adenylyltransferase
rimI b4373 1.2616 0.0232
acetylates N-terminal alanine of 30S ribosomal subunit protein S18 / ribosomalprotein-alanine
N-acetyltransferase
rimJ b1066 0.3654 0.0033
acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
rluE b1135 1.5925 0.0139 23S rRNA pseudouridine synthase
rnc b2567 0.3545 0.0116 RNase III, ds RNA
rpmA b3185 1.2009 0.0086 50S ribosomal subunit protein L27
rpmB b3637 0.7069 0.0448 50S ribosomal subunit protein L28
rpmF b1089 1.3157 0.0137 50S ribosomal subunit protein L32
rpoD b3067 2.3387 0.0271 sigma70 factor
143

APPENDIX I
gene blattner ratio p-value Function
A/B
rpoE b2573 0.6299 0.0405 sigmaE
rpoH b3461 1.4151 0.0363 sigma32 factor
rseA b2572 0.4158 0.0006 anti-sigma factor that inhibits sigmaE
rseB b2571 0.5185 0.0085
negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA
to sigmaE
rssA b1234 0.5582 0.0116 hypothetical protein
rssB b1235 0.6895 0.0442 RssB-P
rsxA b1627 1.9291 0.0099 integral membrane protein of SoxR-reducing complex
rsxB b1628 1.6538 0.0104 member of SoxR-reducing complex
rsxC b1629 2.0272 0.0303 member of SoxR-reducing complex
rsxD b1630 1.5930 0.0439 integral membrane protein of SoxR-reducing complex
rsxE b1632 2.2544 0.0002 integral membrane protein of SoxR-reducing complex
rsxG b1631 2.4324 0.0084 member of SoxR-reducing complex
rtn b2176 1.1293 0.0298 hypothetical protein
sanA b2144 0.4376 0.0187 vancomycin sensitivity
sbcD b0398 1.3094 0.0159 ATP-dependent dsDNA exonuclease
sdaB b2797 1.2729 0.0279 L-threonine deaminase II / L-serine deaminase 2
sdhA b0723 2.4428 0.0087 succinate dehydrogenase flavoprotein
sdhB b0724 1.8201 0.0024 succinate dehydrogenase iron-sulfur protein
sdhC b0721 2.3445 0.0253 succinate dehydrogenase membrane protein
sdhD b0722 1.9449 0.0060 succinate dehydrogenase membrane protein
sdiA b1916 0.5260 0.0202 SdiA transcriptional activator
secE b3981 0.2013 0.0210 Sec Protein Secretion Complex
secG b3175 0.5355 0.0233 Sec Protein Secretion Complex
sfsB b3188 1.4450 0.0295 Nlp transcriptional regulator
shiA b1981 0.3314 0.0445 ShiA shikimate MFS transporter
skp b0178 1.3482 0.0022 periplasmic chaperone
smg b3284 0.4759 0.0018 hypothetical protein
smpA b2617 2.0368 0.0327 SmpA small membrane protein A
smtA b0921 0.1981 0.0013 S-adenosylmethionine-dependent methyltransferase
sodC b1646 0.5884 0.0295 superoxide dismutase precursor (Cu-Zn)
speC b2965 1.1224 0.0484 ornithine decarboxylase, biosynthetic
speG b1584 0.4098 0.0187 spermidine acetyltransferase
spr b2175 0.3174 0.0244 putative lipoprotein
spy b1743 1.6823 0.0465 periplasmic protein related to spheroblast formation
sra b1480 0.5126 0.0007
30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal
component
srlR b2707 0.4372 0.0018 GutR-sorbitol
srmB b2576 0.2487 0.0347 SrmB, DEAD-box RNA helicase
sscR b2765 0.5881 0.0085 putative 6-pyruvoyl tetrahydrobiopterin synthase
sspA b3229 1.4235 0.0255 regulator of transcription; stringent starvation protein A
sthA b3962 1.4674 0.0398 soluble pyridine nucleotide transhydrogenase
sucA b0726 1.7215 0.0420 subunit of E1(0) component of 2-oxoglutarate dehydrogenase
sufS b1680 1.4919 0.0303 L-selenocysteine lyase (and L-cysteine desulfurase) monomer
sulA b0958 0.3282 0.0018 suppressor of lon; inhibits cell division and ftsZ ring formation
tam b1519 1.3876 0.0359 trans-aconitate methyltransferase
tap b1885 2.0690 0.0425 MCP-IV
tatB b3838 1.3899 0.0436 TatABCE protein export complex
tatC b3839 1.3590 0.0079 TatABCE protein export complex
tdcB b3117 1.5829 0.0012 threonine dehydratase (catabolic)
tdcC b3116 0.6742 0.0130 TdcC threonine STP transporter
tesA b0494 0.4687 0.0017 lysophospholipase L1 / thioesterase I
thyA b2827 2.4688 0.0437 thymidylate synthase
tktA b2935 0.7435 0.0147 transketolase I
tolC b3035 0.6930 0.0345 TolC outer membrane channel
torS b0993 0.8969 0.0128 TorS-Phis850
torY b1873 0.3115 0.0139 trimethylamine N-oxide reductase III, c-type cytochrome subunit
144

APPENDIX I
gene blattner ratio p-value Function
A/B
torZ b1872 0.7072 0.0237 trimethylamine N-oxide reductase III, TorZ subunit
trkH b3849 0.6885 0.0381 TrkH potassium ion Trk Transporter
trmH b3651 1.8914 0.0192 tRNA (Gm18) 2'-O-methyltransferase
trpE b1264 0.3805 0.0021 anthranilate synthase component I
trxB b0888 2.0565 0.0480 thioredoxin reductase monomer
tsx b0411 0.2461 0.0277 nucleoside channel; receptor of phage T6 and colicin K
ttk b3641 0.6729 0.0216 Ttk transcriptional regulator
tufA b3339 0.7291 0.0156 elongation factor Tu
tyrR b1323 0.7217 0.0246 TyrR-Phenylalanine transcriptional repressor
ubiC b4039 0.2269 0.0075 chorismate pyruvate lyase
udk b2066 1.5831 0.0047 uridine kinase / cytidine kinase
ugpB b3453 1.9109 0.0225 glycerol-3-P ABC transporter / tranport
ulaG b4192 1.5035 0.0480 putative L-ascorbate 6-phosphate lactonase
uppS b0174 0.6969 0.0442 subunit of undecaprenyl diphosphate synthase
uspF b1376 0.5835 0.0176 nucleotide binding protein
uvrB b0779 1.7413 0.0390 DNA repair; excision nuclease subunit B
uvrY b1914 0.5143 0.0135 UvrY- Phosphorylated transcriptional regulator
vsr b1960 0.6583 0.0004
DNA mismatch endonuclease of the very short patch (VSP) mismatch repair
pathway
wbbI b2034 1.8917 0.0454 hypothetical protein; not required for colanic acid biosynthesis
wcaB b2058 3.4010 0.0356 putative transferase
wcaC b2057 3.4672 0.0035 putative glycosyl transferase
wcaE b2055 2.1253 0.0353 putative colanic acid biosynthesis glycosyl transferase
wcaF b2054 2.3400 0.0172 putative transferase
wcaJ b2047 3.5268 0.0124 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase
wcaK b2045 3.6607 0.0020 putative galactokinase (EC 2.7.1.6).
wcaL b2044 3.4923 0.0027 putative colanic biosynthesis glycosyl transferase
wcaM b2043 3.6739 0.0018 hypothetical protein
wzc b2060 2.2224 0.0433 tyrosine kinase involved in colanic acid biosynthesis
wzxC b2046 3.2937 0.0149 WzxC
wzxE b3792 1.7476 0.0290
metabolism; biosynthesis of macromolecules (cellular constituents);
enterobacterial common antigen (surface glycolipid) transport
wzzE b3785 0.5895 0.0452 putative transport protein
xapR b2405 0.3135 0.0382 XapR transcriptional activator
xdhB b2867 1.1750 0.0243 putative xanthine dehydrogenase subunit, FAD-binding domain
xdhD b2881 1.6833 0.0105
putative oxidoreductase; possible component of selenate reductase with possible
role in purine salvage
xerD b2894 0.4958 0.0395 site-specific recombinase
xseB b0422 0.1694 0.0020 exonuclease VII, small subunit
xylA b3565 0.4106 0.0021 xylose isomerase
xylG b3567 0.8076 0.0315 xylose ABC transporter
xylR b3569 0.5108 0.0188 XylR-Xylose transcriptional activator
yabP b0056 0.5438 0.0159 conserved hypothetical protein
yadL b0137 0.6723 0.0395 putative adhesin-like protein
yaeB b0195 1.4683 0.0342 hypothetical protein
yaeF b0193 1.3932 0.0097 putative synthase of the YaeF/YiiX family
yaeH b0163 0.7470 0.0373 putative structural protein
yafK b0224 0.3497 0.0087
conserved protein; in enteroaggregative E. coli, YafK is required for development
of biofilms
yagA b0267 1.6510 0.0239 hypothetical protein
yagK b0277 1.2809 0.0271 hypothetical protein
yagL b0278 2.0628 0.0124 DNA-binding protein
yagN b0280 0.4906 0.0152 hypothetical protein
yagU b0287 0.5401 0.0210 conserved protein
yagZ b0293 1.5683 0.0418 conserved hypothetical protein
yahA b0315 0.3553 0.0092 hypothetical protein
yahG b0321 1.5771 0.0398 conserved protein
yahJ b0324 1.6920 0.0040 putative deaminase
145

APPENDIX I
gene blattner ratio p-value Function
A/B
yaiB b0382 0.2451 0.0009 conserved hypothetical protein
yajR b0427 1.2541 0.0397 YajR MFS transporter
ybaJ b0461 0.2101 0.0016 conserved hypothetical protein
ybaN b0468 0.4651 0.0207 hypothetical protein
ybaP b0482 0.4012 0.0131 putative ligase
ybbK b0489 1.2971 0.0106 putative protease
ybbW b0511 1.7524 0.0306 YbbW NCS1 Transporter
ybcK b0544 2.1084 0.0046 hypothetical protein
ybdM b0601 1.5187 0.0100 conserved protein
ybeD b0631 2.1582 0.0344 conserved hypothetical protein
ybeY b0659 2.4213 0.0071 conserved hypothetical protein
ybeZ b0660 2.9088 0.0292 putative ATP-binding protein
ybfE b0685 1.8437 0.0015 hypothetical protein, transcriptionally regulated by LexA
ybgA b0707 1.5859 0.0393 conserved protein
ybgD b0719 0.5899 0.0284 putative fimbrial-like protein
ybhC b0772 0.4417 0.0083 putative pectinesterase
ybiN b0807 0.6910 0.0207 putative methyltransferase
ybjC b0850 0.5669 0.0359 conserved hypothetical protein; gene is within soxRS regulon
ybjK b0846 1.7319 0.0164 putative DEOR-type transcriptional regulator
ybjP b0865 1.4541 0.0338 putative enzyme
ycaL b0909 0.4083 0.0132 putative heat shock protein
ycbB b0925 0.6763 0.0145 putative amidase
ycdO b1018 1.6105 0.0013 conserved hypothetical protein
yceJ b1057 1.4910 0.0123 putative cytochrome
ycfM b1105 0.5966 0.0118 putative fibronectin-binding protein
ycfQ b1111 2.1759 0.0130 hypothetical protein
ycgE b1162 0.4795 0.0012 putative transcriptional regulator
ycgH_1 b1169 1.8719 0.0154 conserved protein; member of the Autotransporter family
ycgJ b1177 0.7096 0.0429 hypothetical protein
ycgL b1179 0.3597 0.0007 conserved hypothetical protein
ycgN b1181 0.2099 0.0018 conserved hypothetical protein
ychF b1203 1.8344 0.0127 putative GTP-binding protein
ychJ b1233 0.4063 0.0421 conserved hypothetical protein
yciK b1271 0.5205 0.0025 putative oxidoreductase
yciO b1267 1.3356 0.0473 conserved protein
yciS b1279 0.6049 0.0052 conserved hypothetical protein
ycjG b1325 0.4886 0.0004 L-Ala-D/L-Glu epimerase, a muconate lactonizing enzyme
ycjZ b1328 0.3753 0.0083 putative transcriptional regulator LYSR-type
ydaO b1344 0.4843 0.0448 conserved protein
ydaT b1358 1.2401 0.0281 hypothetical protein
ydbK b1378 1.3365 0.0031 putative pyruvate synthase
ydcD b1457 0.4394 0.0073 hypothetical protein
ydcV b1443 1.5826 0.0274 YdcS/YdcT/YdcV/YdcU ABC transporter
ydeH b1535 0.6334 0.0003 hypothetical protein
ydeI b1536 0.7006 0.0434 conserved hypothetical protein
ydeO b1499 1.8404 0.0071 putative ARAC-type regulatory protein
ydeP b1501 1.8515 0.0329 acid resistance protein
ydeQ b1502 1.5966 0.0329 putative adhesin; similar to FimH protein
ydeS b1504 2.0807 0.0078 putative fimbrial-like protein
ydfH b1540 0.6051 0.0014 hypothetical protein
ydfT b1559 1.2620 0.0433 hypothetical protein
YdgE b1599 0.5062 0.0374 YdgE SMR Protein
ydgI b1605 1.2957 0.0413 ArcD APC transporter
ydgT b1625 0.2841 0.0002 conserved hypothetical protein
ydhF b1647 0.5142 0.0040 putative oxidoreductase, NAD(P)-linked
ydhH b1640 0.5712 0.0220 conserved hypothetical protein
146

APPENDIX I
gene blattner ratio p-value Function
A/B
ydhK b1645 0.7743 0.0177 putative membrane protein
ydhR b1667 0.5054 0.0468 conserved hypothetical protein
ydiA b1703 0.3698 0.0021 conserved protein
ydiO b1695 1.7686 0.0429 putative acyl-CoA dehydrogenase
ydjF b1770 0.6322 0.0205 putative DEOR-type transcriptional regulator
ydjG b1771 1.1870 0.0339 putative oxidoreductase
ydjJ b1774 0.7716 0.0258 putative oxidoreductase
ydjO b1730 0.7452 0.0045 putative enzyme
yeaK b1787 0.5384 0.0111 conserved hypothetical protein
yeaL b1789 0.5540 0.0222 hypothetical protein
yeaO b1792 0.7835 0.0264 conserved hypothetical protein
yeaS b1798 1.1343 0.0208 hypothetical protein
yebC b1864 1.9628 0.0112 conserved protein
yebE b1846 1.4183 0.0339 conserved hypothetical protein
yebF b1847 1.6011 0.0157 conserved hypothetical protein
yebG b1848 2.0455 0.0150 hypothetical protein; gene is part of SOS regulon
yebK b1853 0.6198 0.0144 hypothetical protein
yebN b1821 0.1208 0.0031 putative membrane protein, terpenoid synthase-like
yebQ b1828 1.7129 0.0232 YebQ
yebR b1832 0.2946 0.0066 conserved hypothetical protein
yebY b1839 0.3459 0.0078 conserved hypothetical protein
yebZ b1840 0.5397 0.0052 putative resistance protein
yecN b1869 0.4794 0.0004 putative membrane protein
yecO b1870 0.6886 0.0159 putative methyltransferase
yedI b1958 0.7429 0.0417 hypothetical protein
yedL b1932 0.8697 0.0339 putative acyl-CoA N-acyltransferase
yedS_1 b1964 0.5165 0.0447 putative outer membrane protein
yedS_3 b1966 0.5465 0.0327 putative outer membrane protein
yedW b1969 0.2470 0.0035 putative 2-component transcriptional response regulator
yeeN b1983 7.1154 0.0127 conserved protein
yeeT b2003 1.3786 0.0008 hypothetical protein
yeeU b2004 2.0721 0.0304 antitoxin of the YeeV-YeeU toxin-antitoxin pair
yefM b2017 1.3962 0.0282 antitoxin of the YoeB-YefM toxin-antitoxin pair
yegE b2067 1.7115 0.0038 putative sensor-type protein
yegI b2070 0.5358 0.0484 putative chaperonin
yegS b2086 3.9159 0.0491 conserved protein
yehD b2111 2.1221 0.0057 putative fimbrial-like protein
yeiE b2157 0.6563 0.0387 LYSR-type transcriptional regulator
yejE b2179 1.5636 0.0046 YejA/YejB/YejE/YejF ABC transporter
yejG b2181 1.5816 0.0091 conserved hypothetical protein
yfaE b2236 1.4667 0.0481 conserved hypothetical protein, 2Fe-2S ferredoxin-related
yfbE b2253 0.3390 0.0015 UDP-L-Ara4O C-4" transaminase
yfbN b2273 0.6296 0.0373 conserved hypothetical protein
yfcL b2325 1.4297 0.0332 conserved hypothetical protein
yfcR b2335 1.6257 0.0449 putative fimbrial protein
yfdK b2354 0.8266 0.0174 hypothetical protein
yfdO b2358 1.7079 0.0258 hypothetical protein
yfdP b2359 1.3431 0.0013 hypothetical protein
yfgA b2516 0.3616 0.0096 putative membrane protein
yfhG b2555 0.4592 0.0050 conserved protein
yfiB b2605 0.6708 0.0141 putative outer membrane protein
yfiF b2581 0.4349 0.0213 hypothetical protein
yfjD b4461 1.1920 0.0274 putative membrane protein, hemolysin-like
yfjG b2619 1.8537 0.0213 toxin of a putative toxin-antitoxin pair
yfjJ b2626 1.4374 0.0028 hypothetical protein
ygaH b2683 0.3070 0.0005 putative transport protein
147

APPENDIX I
gene blattner ratio p-value Function
A/B
ygaZ b2682 0.2806 0.0339 hypothetical protein
ygcH b2756 1.5103 0.0470 hypothetical protein
ygcK b2759 0.5237 0.0303 hypothetical protein
ygcL b2760 0.4734 0.0068
hypothetical protein with possible relationship to novobiocin and deoxycholate
resistance
ygcT b2773 1.3680 0.0295 hypothetical protein
ygdR b2833 2.0681 0.0458 conserved hypothetical protein
ygeO b2857 1.4246 0.0028 hypothetical protein
ygfB b2909 0.6455 0.0197 conserved hypothetical protein
ygfM b2880 1.8759 0.0385
putative oxidoreductase with a FAD-binding domain; possible component of
selenate reductase
ygfZ b2898 0.6440 0.0118 conserved protein
yggG b2936 1.3788 0.0242 conserved protein
yggH b2960 0.3883 0.0278 tRNA (m7G46) methyltransferase
yggJ b2946 0.4258 0.0253 conserved hypothetical protein
yggL b2959 0.4522 0.0265 conserved hypothetical protein
yggN b2958 0.5163 0.0247 conserved hypothetical protein
yggX b2962 0.3380 0.0026
conserved hypothetical protein with role in oxidation-resistance of iron-sulfur
clusters
yghO b2981 1.4352 0.0178 putative acyltransferase
ygiA b3036 0.6569 0.0453 hypothetical protein
ygiD b3039 1.2199 0.0229 putative enzyme with dioxygenase domain
ygiF b3054 0.4578 0.0171 conserved hypothetical protein
ygiL b3043 0.4481 0.0024 putative fimbrial-like protein
ygiU b3022 0.5823 0.0419 putative cyanide hydratase
ygjD b3064 0.5001 0.0291 putative O-sialoglycoprotein endopeptidase
yhbY b3180 2.4069 0.0493 possible RNA-binding protein
yhcE b3217 1.6908 0.0322 hypothetical protein
yhdA b3252 0.4853 0.0034 conserved protein
yhdN b3293 2.2147 0.0304 conserved hypothetical protein
yheN b3345 0.7236 0.0466 conserved hypothetical protein
yheO b3346 0.6587 0.0186 hypothetical protein
yhfA b3356 0.4740 0.0196 conserved hypothetical protein
yhfG b3362 1.5910 0.0072 conserved hypothetical protein
yhfL b3369 0.7399 0.0465 hypothetical protein
yhfU b3378 1.5087 0.0383 hypothetical protein
yhfX b3381 1.4728 0.0231 conserved protein
yhhH b3483 0.7173 0.0406 hypothetical protein
yhhJ b3485 1.2472 0.0276 YhiH/YhhJ ABC transporter
yhhS b3473 0.5354 0.0441 YhhS MFS transporter
yhhZ b3442 1.5149 0.0020 conserved protein
yhiS b3504 1.7373 0.0348 conserved protein
yhjA b3518 1.6786 0.0050 putative cytochrome C peroxidase (EC 1.11.1)
yhjR b3535 0.3739 0.0105 hypothetical protein
yhjY b3548 1.6225 0.0111 putative lipase
yi5A b3557 0.5204 0.0060 IS5 protein
yiaA b3562 0.3268 0.0239 hypothetical protein
yiaB b3563 0.2619 0.0011 inner membrane protein
yiaN b3578 0.5853 0.0361 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter
yiaW b3587 0.4349 0.0065 hypothetical protein
yibD b3615 2.3369 0.0409 putative glycosyltransferase
yibJ b3595 1.4681 0.0140 hypothetical protein
yicE b3654 0.2155 0.0218 YicE NCS2 tranporter
yicL b3660 0.5423 0.0107 inhibitor of heme biosynthesis
yicN b3663 0.7539 0.0488 conserved hypothetical protein
yidF b3674 1.4127 0.0375 putative transcriptional regulator
yidP b3684 1.4297 0.0316 putative transcriptional regulator
148

APPENDIX I
gene blattner ratio p-value Function
A/B
yieG b3714 0.5508 0.0395 putative membrane / transport protein
yieH b3715 0.4511 0.0214 putative enzyme with a phophatase-like domain
yieN b3746 1.6277 0.0158 putative 2-component regulator
yihF b3861 0.7083 0.0087 conserved protein
yihI b3866 0.6516 0.0111 conserved protein
yihP b3877 1.3286 0.0172 YihP GPH transporter
yihS b3880 1.5315 0.0430 conserved hypothetical protein
yihT b3881 1.5667 0.0274 putative aldolase
yihW b3884 0.5351 0.0149 putative DEOR-type transcriptional regulator
yihX b3885 0.5078 0.0280 putative phosphatase
yiiR b3921 0.7676 0.0009 putative membrane protein
yjbE b4026 2.5798 0.0431 conserved hypothetical protein
yjbQ b4056 0.5074 0.0444 conserved hypothetical protein
yjdA b4109 0.2889 0.0378 hypothetical protein
yjeB b4178 0.3239 0.0058 conserved protein with a Winged helix domain
yjeF b4167 0.6840 0.0052 putative kinase
yjeM b4156 0.5081 0.0299 YjeM APC transporter
yjeQ b4161 0.5621 0.0278 GTPase and putative translation factor / GTPase
yjfI b4181 0.4271 0.0151 conserved hypothetical protein
yjfK b4183 0.6194 0.0161 conserved hypothetical protein
yjgN b4257 0.8020 0.0292 putative membrane protein possible involved in transport
yjgP b4261 0.6738 0.0413 putative transmembrane protein possibly involved in transport
yjhB b4279 1.8533 0.0006 YjhB MFS transporter
yjhH b4298 0.5277 0.0150 putative lyase/synthase
yjiJ b4332 0.6007 0.0492 putative transport protein
yjiP b4338 1.2689 0.0190 hypothetical protein
yjiY b4354 0.7537 0.0416 putative carbon starvation protein
yjjG b4374 1.8650 0.0152 phosphatase
yjjN b4358 1.3488 0.0441 putative oxidoreductase
yjjQ b4365 0.5404 0.0231 putative regulator
yjjV b4378 1.6584 0.0452 putative hydrolase
ykgC b0304 0.4244 0.0245 putative oxidoreductase
ykgE b0306 0.2061 0.0044 putative dehydrogenase subunit
ykgF b0307 0.3156 0.0100 putative dehydrogenase
ylaB b0457 1.6806 0.0383 conserved protein
yliI b0837 2.0458 0.0402 putative dehydrogenase
ymbA b0952 1.2388 0.0174 conserved protein
ymdA b1044 1.4317 0.0156 conserved hypothetical protein
ymfM b1148 1.7959 0.0269 hypothetical protein
ymfO b1151 1.4852 0.0432 hypothetical protein
ymjA b1295 0.4272 0.0063 hypothetical protein
ynaE b1375 0.4467 0.0021 hypothetical protein
ynaK b1365 0.5999 0.0473 hypothetical protein
yncA b1448 0.6404 0.0336 putative N-acetyltransferase
yncI b1458 2.0101 0.0095 conserved protein
yneH b1524 0.6554 0.0043 putative glutaminase
ynfB b1583 0.3413 0.0147 conserved hypothetical protein
ynfG b1589 2.1065 0.0456 oxidoreductase, Fe-S subunit paralog of DmsB
ynfN b1551 0.5507 0.0270 hypothetical protein
yoaH b1811 0.7603 0.0410 conserved hypothetical protein
yobA b1841 0.4646 0.0330 hypothetical protein
yobD b1820 1.1210 0.0371 conserved protein
ypfJ b2475 0.4521 0.0132 conserved protein
yphF b2548 1.2411 0.0065 YphD/YphE/YphF ABC transporter
ypjA b2647 0.5454 0.0295 putative outer membrane protein
ypjC b2650 1.9137 0.0202 hypothetical protein
149

APPENDIX I
gene blattner ratio p-value Function
A/B
ypjF b2646 1.4842 0.0227 member of the YeeV, YkfI, YpjF family of toxin proteins
yqaA b2689 0.3779 0.0112 putative integral membrane protein
yqeF b2844 1.4118 0.0054 putative acyltransferase
yqeI b2847 0.4452 0.0151 putative sensory transducer
yqeJ b2848 0.5502 0.0358 conserved hypothetical protein
yqiA b3031 0.5500 0.0167 putative hydrolase
yqiJ b3050 1.2244 0.0073 putative oxidoreductase
yqjI b3071 1.2930 0.0385 conserved hypothetical protein
yraM b3147 0.6143 0.0013 putative glycosylase
yrbK b3199 0.5981 0.0347 conserved hypothetical protein
yrbL b3207 0.4490 0.0310 conserved hypothetical protein; transcription is regulated by Mg2+
yrdA b3279 1.2726 0.0344 putative transferase
yrdD b3283 0.4972 0.0020 putative DNA topoisomerase
yrfG b3399 1.7111 0.0126 putative hydrolase with a phophatase-like domain
ytfH b4212 1.2193 0.0109 putative transcriptional regulator
ytfM b4220 0.6790 0.0262 hypothetical protein
zapA b2910 0.2597 0.0002 ZapA protein, localizes to the cytokinetic ring
zntR b3292 2.0077 0.0173 ZntR transcriptional regulator
znuA b1857 0.5075 0.0106 ZnuA/ZnuB/ZnuC ABC transporter
znuB b1859 2.2343 0.0178 ZnuA/ZnuB/ZnuC ABC transporter
b0332 1.2327 0.0317
b0395 0.7576 0.0331
Supplementary table – X: LZ41 wild-type (A) Vs LZ41 fis::cm (B)
gene blattner ratio A/B p-value Function
aceB b4014 0.4276 0.0445 malate synthase A
acrE b3265 1.7547 0.0454 transmembrane protein affects septum formation and cell membrane permeability
add b1623 0.8139 0.0457 deoxyadenosine deaminase / adenosine deaminase
adhE b1241 0.5944 0.0064 PFL-deactivase / alcohol dehydrogenase / acetaldehyde dehydrogenase
adiA b4117 0.7038 0.0075 Adi
adk b0474 0.4914 0.0219 adenylate kinase
aer b3072 0.3604 0.0182 aerotaxis sensor receptor, flavoprotein
afuB b0263 0.6224 0.0389 AfuB
agn43 b2000 0.3450 0.0040 outer membrane fluffing protein, sim. to adhesin
ahpC b0605 0.5014 0.0291 AhpC component
ahpF b0606 0.5624 0.0434 AhpF component
aldA b1415 0.7702 0.0392 putative succinate-semialdehyde dehydrogenase / aldehyde dehydrogenase
aldB b3588 0.4765 0.0388 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B
allR b0506 0.3911 0.0082 AllR transcriptional regulator
amn b1982 0.6432 0.0084 AMP nucleosidase
argO b2923 1.8685 0.0322 arginine export protein
aroA b0908 0.6815 0.0220 3-phosphoshikimate-1-carboxyvinyltransferase
aroB b3389 1.7762 0.0173 3-dehydroquinate synthase
aroK b3390 2.0007 0.0057 shikimate kinase I
arpA b4017 0.7171 0.0434 regulator of acetyl CoA synthetase
artI b0863 0.6821 0.0113 arginine ABC transporter
asnS b0930 0.6778 0.0337 asparaginyl-tRNA synthetase
aspC b0928 0.5126 0.0438 aspartate transaminase
aspS b1866 0.5612 0.0181 aspartyl-tRNA synthetase
atpG b3733 1.2411 0.0477 ATP synthase, F1 complex, gamma subunit
b0374 b0374 1.8747 0.0267 putative flagellin structural protein
b1364 b1364 1.9078 0.0056 hypothetical protein
bax b3570 2.7324 0.0137 putative ATP-binding protein
150

APPENDIX I
gene blattner ratio A/B p-value Function
bcsG b3538 1.3907 0.0114 putative membrane protein
bioA b0774 4.8174 0.0341 adenosylmethionine-8-amino-7-oxononanoate aminotransferase monomer
bioC b0777 2.0996 0.0055 biotin biosynthesis; reaction prior to pimeloyl CoA
bioF b0776 2.1697 0.0187 8-amino-7-oxononanoate synthase
btuE b1710 0.4583 0.0002 vitamin B12 transport system
cdd b2143 0.5184 0.0071 cytidine deaminase
cdsA b0175 1.5062 0.0193 CDP-diglyceride synthetase
cld b2027 1.6377 0.0049 regulator of length of O-antigen component of lipopolysaccharide chains
clpS b0881 0.6844 0.0260 specificity factor for ClpA-ClpP chaperone-protease complex
cobC b0638 1.5268 0.0269 alpha-ribazole-5'-P phosphatase
codA b0337 0.5518 0.0394 cytosine deaminase
crl b0240 0.5173 0.0122 Crl transcriptional regulator
crr b2417 0.7022 0.0165 EIIBCMalX
cspG b0990 1.2495 0.0397 cold shock protein CspG
cybB b1418 0.6780 0.0427 cytochrome b561
cyoB b0431 1.4550 0.0005 cytochrome bo terminal oxidase subunit I
cyoD b0429 1.8390 0.0014 cytochrome bo terminal oxidase subunit IV
cysE b3607 1.3082 0.0119 cysteine synthase
cysZ b2413 0.5453 0.0464 required for sulfate transport
cytR b3934 0.6111 0.0078 CytR-cytidine
dadA b1189 0.9183 0.0319 D-amino acid dehydrogenase, small subunit
dam b3387 1.2185 0.0464 DNA adenine methylase
dapA b2478 0.4234 0.0248 dihydrodipicolinate synthase
dapB b0031 0.7373 0.0483 dihydrodipicolinate reductase
dcp b1538 0.5793 0.0064 dipeptidyl carboxypeptidase II
def b3287 2.0636 0.0181 peptide deformylase
degQ b3234 1.3585 0.0176 serine endoprotease
dgoA b3692 0.2418 0.0237 dgoA 3871635-3871018 : '2-dehydro-3-deoxyphosphogalactonate aldolase / dgoD
3871021-3869873 : galactonate dehydratase
dhaL b1199 2.3586 0.0311 dihydroxyacetone kinase subunit L
dinB b0231 0.3459 0.0147 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis)
dinD b3645 0.3811 0.0274 DNA-damage-inducible protein
dld b2133 0.2646 0.0007 D-lactate:Quinone Oxidoreductase
dnaE b0184 2.0422 0.0092 DNA polymerase III, alpha subunit
dnaG b3066 2.2790 0.0124 DNA biosynthesis; DNA primase
dnaK b0014 0.6706 0.0044 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins
dps b0812 0.6003 0.0129 stationary phase nucleoid protein that sequesters iron and protects DNA from
damage
dsbA b3860 0.4929 0.0066 disulfide oxidoreductase
dusB b3260 3.5507 0.0209 tRNA dihydrouridine synthase
dxr b0173 1.4993 0.0175 DXP reductoisomerase
ecfB b2969 1.8193 0.0019 putative protein exporter (General Secretory Pathway)
ecfG b3055 2.2413 0.0064 protein with possible extracytoplasmic function
ecfM b3096 1.7005 0.0256 conserved hypothetical protein with possible extracytoplasmic function
eco b2209 0.4839 0.0047 ecotin monomer; serine protease inhibitor
eda b1850 0.6319 0.0048 oxaloacetate decarboxylase / 2-keto-3-deoxy-6-phosphogluconate aldolase / 2-keto-
4-hydroxyglutarate aldolase
efp b4147 1.3561 0.0306 elongation factor P (EF-P)
elaA b2267 0.2865 0.0039 hypothetical protein
emrY b2367 2.0045 0.0181 EmrY putative multidrug MFS transporter
eno b2779 0.5823 0.0163 enolase
entA b0596 4.0462 0.0315 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
entB b0595 4.2178 0.0260 apo-EntB
essQ b1556 2.3474 0.0281 hypothetical protein
evgA b2369 2.3983 0.0080 EvgA-Phosphorylated transcriptional regulator
exbB b3006 5.6978 0.0342 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins
exbD b3005 7.3350 0.0026 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins
fabB b2323 1.1422 0.0378 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase
fadJ b2341 0.6377 0.0434 FadJ monomer
fbaB b2097 0.1525 0.0179 fructose bisphosphate aldolase monomer
151

APPENDIX I
gene blattner ratio A/B p-value Function
fdx b2525 1.5992 0.0271 oxidized ferredoxin
fecA b4291 4.3615 0.0002 outer membrane receptor; citrate-dependent iron transport, outer membrane receptor
fecB b4290 11.8210 0.0049 ferric dicitrate uptake system
fecD b4288 13.4703 0.0266 ferric dicitrate uptake system
fecI b4293 2.5694 0.0143 sigma19 factor
fepA b0584 2.2534 0.0377 FepA, outer membrane receptor for ferric enterobactin (enterochelin) and colicins B
and D
fhuF b4367 2.6792 0.0312 acts in reduction of ferrioxamine B iron
fimA b4314 0.0452 0.0017 major type 1 subunit fimbrin (pilin)
fimI b4315 0.2478 0.0086 fimbrial protein
fis b3261 4.8968 0.0026 Fis transcriptional dual regulator
fixC b0043 0.7563 0.0451 flavoprotein (electron transport), possibly involved in anaerobic carnitine
metabolism
fklB b4207 0.4661 0.0011 FKBP-type 22KD peptidyl-prolyl cis-trans isomerase (a rotamase)
flgA b1072 0.6317 0.0353 flagellar biosynthesis; assembly of basal-body periplasmic P ring
flgE b1076 0.5821 0.0222 flagellar hook protein FlgE
flgH b1079 1.4155 0.0024 flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide
layer) ring protein
fliC b1923 0.7914 0.0186 flagellar biosynthesis; flagellin, filament structural protein
fliG b1939 1.5644 0.0322 flagellar motor switch protein FliG; component of motor switching and energizing,
enabling rotation and determining its direction
fliJ b1942 1.5214 0.0394 flagellar biosynthesis protein FliJ
fliL b1944 2.0419 0.0147 flagellar biosynthesis
fliM b1945 2.0037 0.0079 flagellar motor switch protein FliM; component of motor switch and energizing,
enabling rotation and determining its direction
fliN b1946 1.5234 0.0159 flagellar motor switch protein FliN; component of motor switch and energizing,
enabling rotation and determining its direction
fliP b1948 1.8269 0.0083 flagellar biosynthesis protein FliP
fliQ b1949 3.0840 0.0021 flagellar biosynthesis protein FliQ
fliR b1950 7.4349 0.0077 flagellar biosynthesis protein FliR
flxA b1566 0.4049 0.0066 hypothetical protein; gene is regulated by FliA
fmt b3288 3.0666 0.0067 10-formyltetrahydrofolate:L-methionyl-tRNA(fMet) N-formyltransferase
folE b2153 0.4596 0.0053 GTP cyclohydrolase I
folP b3177 0.4636 0.0126 dihydropteroate synthase
frlA b3370 0.7394 0.0427 YhfM methione APC transporter
frr b0172 0.7314 0.0363 ribosome recycling factor
fruL b0079 1.7136 0.0205 fruR leader peptide
fruR b0080 2.1871 0.0153 FruR transcriptional dual regulator
fryB b2387 0.7759 0.0158 putative PTS system enzyme IIB component
ftnA b1905 0.4482 0.0169 cytoplasmic ferritin, an iron storage protein)
ftsI b0084 2.0097 0.0312 essential cell division protein FtsI; penicillin-binding protein 3
ftsK b0890 1.3776 0.0159 essential cell division protein FtsK
ftsL b0083 1.5537 0.0073 essential cell division protein FtsL
ftsQ b0093 1.3855 0.0418 essential cell division protein FtsQ
ftsZ b0095 0.8510 0.0421 essential cell division protein FtsZ
galF b2042 1.2879 0.0298 homolog of Salmonella UTP--glucose-1-P uridyltransferase, probably a UDP-gal
transferase
galM b0756 0.7402 0.0368 aldose-1-epimerase
gatC b2092 0.5085 0.0245 EIIGat
gatY b2096 0.4530 0.0132 tagatose-1,6-bisphosphate aldolase 2
gcvA b2808 2.3893 0.0386 GcvA transcriptional dual regulator
gcvR b2479 0.5830 0.0331 GcvR-gly
ghrA b1033 0.5389 0.0362 glyoxylate reductase
glcB b2976 0.6074 0.0247 malate synthase G
glk b2388 0.6440 0.0382 glucokinase
glmU b3730 1.3338 0.0066 N-acetylglucosamine-1-phosphate uridyltransferase / glucosamine-1-phosphate
acetyltransferase
glnB b2553 0.7567 0.0160 PII-UMP
glnH b0811 1.3681 0.0225 glutamine ABC transporter
glnP b0810 2.0480 0.0032 glutamine ABC transporter
glnQ b0809 1.9701 0.0255 glutamine ABC transporter
152

APPENDIX I
gene blattner ratio A/B p-value Function
gloB b0212 1.6853 0.0005 glyoxalase II
glpD b3426 1.5383 0.0086 glycerol 3-phosphate dehydrogenase, aerobic
glpE b3425 1.5932 0.0002 thiosulfate sulfurtransferase
glpG b3424 2.4244 0.0321 inner membrane-associated protein of glp regulon
glpQ b2239 0.5777 0.0048 glycerophosphoryl diester phosphodiesterase, periplasmic
gltB b3212 0.2558 0.0049 glutamate synthase (NADPH) large chain precursor
gltD b3213 0.2960 0.0005 glutamate synthase (NADPH) small chain
gltF b3214 2.1372 0.0310 regulator of gltBDF operon, induction of Ntr enzymes
gltX b2400 0.6185 0.0045 glutamyl-tRNA synthetase
glyA b2551 0.4249 0.0030 glycine hydroxymethyltransferase
gmd b2053 0.3424 0.0173 GDP-mannose 4,6-dehydratase
gnd b2029 0.7263 0.0098 6-phosphogluconate dehydrogenase (decarboxylating)
gpt b0238 0.3020 0.0046 xanthine phosphoribosyltransferase / guanine phosphoribosyltransferase /
hypoxanthine phosphoribosyltransferase
groE b4142 0.7287 0.0389 GroES, 10 Kd chaperone binds to Hsp60 in pres. Mg-ATP, suppressing its ATPase
activity
grxB b1064 0.5199 0.0055 oxidized glutaredoxin 2
gst b1635 0.2880 0.0003 glutathione transferase
guaB b2508 0.3418 0.0146 IMP dehydrogenase
hchA b1967 0.3576 0.0101 heat shock protein (Hsp) 31
hdeA b3510 0.5429 0.0329 acid-resistance protein, possible chaperone
hdhA b1619 0.7009 0.0222 7-alpha-hydroxysteroid dehydrogenase
hemC b3805 0.6080 0.0324 hydroxymethylbilane synthase
hemG b3850 2.0623 0.0029 protoporphyrinogen oxidase
hemL b0154 0.4775 0.0155 glutamate-1-semialdehyde aminotransferase
hepA b0059 0.5983 0.0278 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor
hflD b1132 0.7830 0.0127 membrane protein in operon with purB
hipA b1507 2.6139 0.0487 HipA transcriptional activator
hisC b2021 0.4902 0.0017 histidine-phosphate aminotransferase
hisD b2020 0.4810 0.0042 histidinal dehydrogenase / histidinol dehydrogenase
hisF b2025 0.8798 0.0136 imidazole glycerol phosphate synthase, HisF subunit
hisH b2023 0.6139 0.0394 imidazole glycerol phosphate synthase, HisH subunit
hisI b2026 0.6499 0.0032 phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphatase
hisJ b2309 0.4481 0.0121 histidine ABC transporter
hofO b3393 1.8479 0.0374 conserved hypothetical protein
hscA b2526 1.6604 0.0128 chaperone, member of Hsp70 protein family
hsdR b4350 2.3402 0.0036 host restriction; endonuclease R
hslO b3401 2.0138 0.0492 molecular chaperone Hsp33
htrA b0161 4.1874 0.0178 DegP
hycI b2717 0.6596 0.0114 hydrogenase 3 maturation protease
ibpA b3687 0.6656 0.0494 small heat shock protein IbpA
ilvY b3773 2.5426 0.0045 IlvY transcriptional dual regulator
infA b0884 1.2615 0.0395 protein chain initiation factor IF-1
infB b3168 0.8553 0.0153 protein chain initiation factor IF-2
iscA b2528 1.2803 0.0391 iron-sulfur cluster assembly protein
iscR b2531 1.7491 0.0017 IscR transcriptional regulator
iscS b2530 1.4813 0.0077 cysteine desulfurase monomer
iscX b2524 1.6876 0.0213 protein with possible role in iron-sulfur cluster biogenesis
ispH b0029 0.5317 0.0441 1-hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase
kbl b3617 0.7553 0.0413 2-amino-3-ketobutyrate CoA ligase
kdgR b1827 0.6868 0.0412 putative ICLR-type transcriptional regulator
kdgT b3909 1.6515 0.0454 KdgT 2-keto-3-deoxygluconate transporter
kduD b2842 0.5804 0.0334 2-deoxy-D-gluconate 3-dehydrogenase
kduI b2843 0.5660 0.0006 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase
lctD b3605 4.5610 0.0020 L-Lactate:Quinone Oxidoreductase
lepB b2568 0.4975 0.0172 leader peptidase (signal peptidase I)
leuA b0074 2.1920 0.0484 2-isopropylmalate synthase
lipB b0630 0.5344 0.0060 lipoyl-protein ligase
lolB b1209 0.7109 0.0354 outer membrane lipoprotein, localization of lipoproteins in the outer membrane
153

APPENDIX I
gene blattner ratio A/B p-value Function
lpxB b0182 2.4803 0.0069 lipid A disaccharide synthase
lpxD b0179 1.9305 0.0077 UDP-3-O-[3-hydroxymyristoyl]glucosamine N-acetyltransferase
lysU b4129 0.3741 0.0006 lysyl-tRNA synthetase (LysRSu), inducible
macB b0879 0.7619 0.0000 MacAB macrolide efflux transporter complex
manY b1818 0.5887 0.0161 EIIMan
map b0168 1.6259 0.0237 methionine aminopeptidase
marA b1531 2.1164 0.0161 MarA transcriptional activator
marR b1530 1.7225 0.0168 MarR-salicylate
mdaB b3028 1.6569 0.0030 NADPH quinone reductase
mdh b3236 0.4517 0.0007 malate dehydrogenase
mdoC b1047 6.6596 0.0265 protein required for succinyl modification of osmoregulated periplasmic glucans
mdoD b1424 0.7811 0.0064 glucan biosynthesis protein D
menG b3929 0.6569 0.0011 inhibitor of ribonuclease E (RNase E) activity
metB b3939 0.5240 0.0189 O-succinylhomoserine lyase / O-succinylhomoserine(thiol)-lyase
metG b2114 1.6218 0.0213 methionyl-tRNA synthetase
metK b2942 1.3643 0.0040 MetK S-adenosylmethionine synthetase monomer
metN b0199 3.0698 0.0232 L- and D-methionine uptake ABC permease
mglB b2150 0.4951 0.0238 galactose ABC transporter
mgsA b0963 0.5158 0.0118 methylglyoxal synthase
miaB b0661 0.5108 0.0076 hypothetical protein
mntR b0817 1.3178 0.0124 putative toxin
moaE b0785 0.5674 0.0315 molybdopterin synthase large subunit
moeB b0826 0.5088 0.0285 molybdopterin biosynthesis
mog b0009 0.6449 0.0095 required for the efficient incorporation of Mo into molybdoproteins
motB b1889 0.7958 0.0468 MotB protein, enables flagellar motor rotation, linking torque machinery to cell wall
mraY b0087 1.6065 0.0384 phospho-N-acetylmuramoyl-pentapeptide transferase
mraZ b0081 2.0473 0.0380 protein encoded by an operon involved in formation of the cell envelope and cell
division
mreB b3251 0.7067 0.0373 rod shape-determining protein
mscL b3291 0.5625 0.0188 MscL (Large Mechanosensitive Channel)
msrB b1778 0.2242 0.0071 methionine sulfoxide reductase B / protein-methionine-S-oxide reductase /
methionine sulfoxide reductase
mug b3068 0.1598 0.0002 stationary phase mismatch/uracil DNA glycosylase
murB b3972 0.6411 0.0055 UDP-N-acetylmuramate dehydrogenase
murG b0090 1.8627 0.0219 N-acetylglucosaminyl transferase
mutM b3635 0.5636 0.0298 formamidopyrimidine DNA glycosylase
nagB b0678 0.6053 0.0321 glucosamine-6-phosphate deaminase
narL b1221 0.3590 0.0003 NarL-Phosphorylated transcriptional dual regulator
narV b1465 2.0037 0.0423 nitrate reductase Z, &gamma; subunit
narX b1222 0.4701 0.0282 NarX-Phis
nfnB b0578 0.6965 0.0277 dihydropteridine reductase
nlpB b2477 0.5501 0.0285 lipoprotein-34
nlpD b2742 0.5577 0.0232 NlpD putative outer membrane lipoprotein
nrdA b2234 2.5576 0.0170 ribonucleoside-diphosphate reductase / CDP reductase / UDP reductase / ADP
reductase / GDP reductase
nrdB b2235 1.5476 0.0143 ribonucleoside-diphosphate reductase / CDP reductase / UDP reductase / ADP
reductase / GDP reductase
nudE b3397 3.6839 0.0376 ADP-ribose diphosphatase
nupC b2393 0.4373 0.0148 NupC nucleoside NUP transporter
nusB b0416 0.6482 0.0130 transcription termination; L factor
ogrK b2082 0.4525 0.0057 OgrK transcriptional regulator
ompA b0957 0.6960 0.0393 outer membrane protein 3a (II*;G;d)
ompR b3405 0.6561 0.0127 OmpR transcriptional dual regulator
oppA b1243 0.5783 0.0065 OppA-oligopeptide ABC transporter substrate-binding
osmC b1482 0.5889 0.0305 osmotically inducible peroxidase OsmC
oxyR b3961 0.5975 0.0148 OxyR transcriptional dual regulator
paaX b1399 0.6230 0.0285 PaaX transcriptional regulator
pal b0741 0.5655 0.0097 Tol-Pal Cell Envelope Complex
panB b0134 0.5737 0.0067 3-methyl-2-oxobutanoate hydroxymethyltransferase monomer
pckA b3403 1.2819 0.0394 phosphoenolpyruvate carboxykinase (ATP)
154

APPENDIX I
gene blattner ratio A/B p-value Function
pdxA b0052 1.8798 0.0156 PdxA dehydrogenase/decarboxylase
pdxH b1638 0.5634 0.0154 pyridoxine 5'-phosphate oxidase / pyridoxamine 5'-phosphate oxidase
pdxJ b2564 0.5506 0.0132 pyridoxine 5'-phosphate synthase monomer
pdxK b2418 0.7062 0.0312 pyridoxamine kinase / hydroxymethylpyrimidine kinase / pyridoxal kinase
pepB b2523 0.7989 0.0086 aminopeptidase (AP)
pepD b0237 0.6038 0.0133 peptidase D
pepE b4021 0.6872 0.0420 peptidase E, a dipeptidase where amino-terminal residue is aspartate
pepT b1127 0.6315 0.0216 peptidase T
pfkA b3916 0.4420 0.0165 6-phosphofructokinase-1 monomer / putative NAD+ kinase
pfkB b1723 0.5181 0.0126 6-phosphofructokinase-2 monomer
pflA b0902 0.4936 0.0038 pyruvate formate-lyase activating enzyme
pgpA b0418 0.8301 0.0117 phosphatidylglycerophosphatase A
pgpB b1278 0.7228 0.0332 phosphatidylglycerophosphatase B
pheS b1714 1.6482 0.0332 phenylalanyl-tRNA synthetase &alpha;-chain
plsX b1090 2.5029 0.0151 glycerolphosphate auxotrophy in plsB background
potC b1124 0.7615 0.0005 putrescine/spermidine ABC transporter
potD b1123 0.7572 0.0238 putrescine/spermidine ABC transporter
potI b0857 0.7509 0.0248 putrescine ABC transporter
ppsA b1702 0.3641 0.0451 phosphoenolpyruvate synthase
pptA b1461 0.4533 0.0164 probable 4-oxalocrotonate tautomerase (4-OT) monomer
pqiB b0951 0.6225 0.0116 paraquat-inducible protein B
prfA b1211 2.6557 0.0311 peptide chain release factor RF-1
prfC b4375 0.8757 0.0393 peptide chain release factor RF-3
prlC b3498 1.4622 0.0107 oligopeptidase A
prmA b3259 0.6684 0.0246 methylation of 50S ribosomal subunit protein L11
pspE b1308 0.4076 0.0040 thiosulfate sulfurtransferase
pstC b3727 1.5388 0.0331 phosphate ABC transporter
ptrA b2821 0.4205 0.0083 protease III
ptsI b2416 0.5853 0.0249 PTS enzyme I
purB b1131 0.6886 0.0011 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase /
adenylosuccinate lyase
purM b2499 0.5518 0.0249 phosphoribosylformylglycinamide cyclo-ligase
purU b1232 0.6528 0.0200 formyltetrahydrofolate deformylase
putA b1014 0.4763 0.0210 PutA bifunctional enzyme and transcriptional regulator
puuR b1299 2.5246 0.0286 putative oxidoreductase/putative regulator
pykA b1854 0.5364 0.0003 pyruvate kinase II monomer
pyrD b0945 0.6409 0.0178 dihydroorotate oxidase
qseB b3025 1.3558 0.0154 putative 2-component transcriptional regulator
radC b3638 1.5771 0.0440 hypothetical protein
rdoA b3859 0.4925 0.0088 cytoplasmic protein of low abundance
recD b2819 0.4467 0.0117 DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA
endonuclease
recN b2616 2.0533 0.0461 protein used in recombination and DNA repair
recO b2565 0.5768 0.0062 protein interacts with RecR and possibly RecF proteins
recR b0472 0.6890 0.0234 recombination and repair
relB b1564 0.5403 0.0279 antitoxin of the RelE-RelB toxin-antitoxin system and transcriptional repressor of
relBEF
relE b1563 0.4842 0.0123 toxin of the RelE-RelB toxin-antitoxin system; cleaves mRNA in ribosome
rfaH b3842 1.8283 0.0327 RfaH transcriptional regulator
rfaI b3627 0.7426 0.0277 UDP-D-galactose:(glucosyl)lipopolysaccharide-alpha-1,3-D-galactosyltransferase
rfaY b3625 0.6530 0.0111 lipopolysaccharide core biosynthesis
rfaZ b3624 0.6938 0.0035 protein involved in KdoIII attachment during lipopolysaccharide core biosynthesis
rfbB b2041 1.5853 0.0067 RmlB
rhlE b0797 1.1385 0.0098 DEAD-box-containing ATP-dependent RNA helicase family member
rhoL b3782 1.7040 0.0054 rho operon leader peptide
rhsB b3482 0.8055 0.0317 RhsB protein in rhs element
ribA b1277 1.4064 0.0192 GTP cyclohydrolase II
rihA b0651 0.3965 0.0007 ribonucleoside hydrolase 1 (pyrimidine-specific)
rimJ b1066 0.6008 0.0050 acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
155

APPENDIX I
gene blattner ratio A/B p-value Function
rnb b1286 0.5168 0.0188 RNase II, mRNA degradation
rnpA b3704 2.3870 0.0025 RNase P protein component; processes tRNA, 4.5S RNA
rph b3643 0.3966 0.0020 RNase PH monomer
rplC b3320 1.5214 0.0402 50S ribosomal subunit protein L3
rplD b3319 1.4899 0.0297 50S ribosomal subunit protein L4, regulates expression of S10 operon
rplI b4203 1.7848 0.0067 50S ribosomal subunit protein L9
rplK b3983 1.4690 0.0323 50S ribosomal subunit protein L11
rplN b3310 1.8011 0.0070 50S ribosomal subunit protein L14
rplQ b3294 1.5026 0.0193 50S ribosomal subunit protein L17
rplS b2606 1.8032 0.0386 50S ribosomal subunit protein L19
rpmH b3703 2.4577 0.0050 50S ribosomal subunit protein L34
rpmI b1717 1.6463 0.0100 50S ribosomal subunit protein A
rpoS b2741 0.4760 0.0008 sigma38 factor
rpsI b3230 1.5944 0.0225 30S ribosomal subunit protein S9
rpsJ b3321 1.8766 0.0045 30S ribosomal subunit protein S10
rpsM b3298 1.7120 0.0194 30S ribosomal subunit protein S13
rpsN b3307 1.4824 0.0194 30S ribosomal subunit protein S14
rpsP b2609 1.4326 0.0450 30S ribosomal subunit protein S16
rpsR b4202 1.4594 0.0190 30S ribosomal subunit protein S18
rseA b2572 1.2269 0.0063 anti-sigma factor that inhibits sigmaE
rseC b2570 2.1501 0.0204 protein involved in reduction of the SoxR iron-sulfur cluster
rsmB b3289 1.4365 0.0248 16S rRNA m5C967 methyltransferase
rspA b1581 0.2047 0.0078 starvation sensing protein RspA
rsxB b1628 2.6069 0.0042 member of SoxR-reducing complex
rsxC b1629 2.5542 0.0057 member of SoxR-reducing complex
rumA b2785 1.8745 0.0344 23S ribosomal RNA 5-methyluridine methyltransferase
rusA b0550 2.0786 0.0385 endodeoxyribonuclease RUS (Holliday junction resolvase)
ruvA b1861 0.4849 0.0298 branch migration of Holliday structures; repair
sdaB b2797 0.6285 0.0002 L-threonine deaminase II / L-serine deaminase 2
sdaC b2796 0.4271 0.0117 SdaC serine STP transporter
secM b0097 1.3178 0.0023 secretion monitor that regulates SecA translation (General Secretory Pathway)
seqA b0687 2.1946 0.0082 SeqA, negative modulator of initiation of replication
sfcA b1479 0.8152 0.0181 MaeA
sfmF b0534 1.6970 0.0472 putative fimbrial-like protein
sirA b3470 0.6006 0.0488 possible RNA-binding protein required for wild-type FtsZ ring formation on rich
media
slyB b1641 0.4312 0.0113 putative outer membrane protein
slyD b3349 0.6005 0.0258 FKBP-type rotamase, peptidyl prolyl cis-trans isomerase
smg b3284 2.8745 0.0310 hypothetical protein
smpB b2620 0.6515 0.0414 small protein B
sodB b1656 0.5233 0.0110 superoxide dismutase (Fe)
sodC b1646 0.4968 0.0252 superoxide dismutase precursor (Cu-Zn)
speB b2937 0.6792 0.0484 agmatinase
speC b2965 0.3877 0.0088 ornithine decarboxylase, biosynthetic
speD b0120 0.3187 0.0009 adenosylmethionine decarboxylase, proenzyme
speE b0121 0.4811 0.0061 spermidine synthase
spr b2175 1.5236 0.0048 putative lipoprotein
sra b1480 0.3080 0.0010 30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal
component
sscR b2765 1.5203 0.0399 putative 6-pyruvoyl tetrahydrobiopterin synthase
sseA b2521 0.5767 0.0312 3-mercaptopyruvate:cyanide sulfurtransferase
sspA b3229 1.2589 0.0498 regulator of transcription; stringent starvation protein A
sspB b3228 1.8474 0.0062 SspB monomer
sstT b3089 1.4008 0.0348 YgjU DAACS transporter
talA b2464 0.6019 0.0196 transaldolase A
tar b1886 0.6394 0.0421 MCP-II
tauD b0368 1.2571 0.0377 taurine dioxygenase
tdcD b3115 2.0221 0.0493 propionate kinase / acetate kinase C
tdh b3616 0.6205 0.0168 threonine dehydrogenase
156

APPENDIX I
gene blattner ratio A/B p-value Function
tdk b1238 0.7191 0.0164 thymidine kinase / deoxyuridine kinase
tehB b1430 0.6931 0.0312 tellurite resistance
tnaA b3708 0.3883 0.0042 L-cysteine desulfhydrase / tryptophanase
tolA b0739 1.8858 0.0200 Tol-Pal Cell Envelope Complex
tolB b0740 0.6129 0.0276 Tol-Pal Cell Envelope Complex
tolC b3035 1.8109 0.0166 TolC outer membrane channel
topB b1763 1.9680 0.0432 DNA topoisomerase III
torZ b1872 0.6633 0.0251 trimethylamine N-oxide reductase III, TorZ subunit
tpiA b3919 0.5807 0.0093 triose phosphate isomerase monomer
tpx b1324 0.4685 0.0031 thiol peroxidase 2
treB b4240 0.7492 0.0204 EIITre
trg b1421 0.3929 0.0362 MCP-III
trkH b3849 2.8270 0.0037 TrkH potassium ion Trk Transporter
trpA b1260 0.6073 0.0425 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase
trpB b1261 0.6074 0.0328 tryptophan synthase, beta subunit
trpH b1266 0.7233 0.0438 putative enzyme
typA b3871 0.6670 0.0187 protein possibly involved in LPS biosynthesis and host colonization
ubiB b3835 1.7738 0.0367 2-octaprenylphenol hydroxylase
ubiC b4039 0.4470 0.0135 chorismate pyruvate lyase
ubiF b0662 0.4865 0.0324 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinone hydroxylase
ubiG b2232 0.5625 0.0002 3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol
methylase
ucpA b2426 2.1286 0.0385 putative acetoin dehydrogenase
ulaE b4197 0.5257 0.0078 L-xylulose 5-phosphate 3-epimerase
upp b2498 0.5910 0.0244 uracil phosphoribosyltransferase
uvrA b4058 0.5239 0.0019 excision nuclease subunit A
uvrD b3813 0.8144 0.0346 DNA-dependent ATPase I and helicase II
wbbK b2032 0.7715 0.0198 putative transferase
wcaI b2050 0.6835 0.0103 putative colanic biosynthesis glycosyl transferase
wcaM b2043 0.3200 0.0127 hypothetical protein
wzxC b2046 0.7084 0.0032 WzxC
wzyE b3793 1.9754 0.0268 4-&alpha;-fucosyltransferase
xthA b1749 0.6059 0.0079 exonuclease III
xylF b3566 1.8870 0.0111 xylose ABC transporter
xylH b3568 2.3622 0.0026 xylose ABC transporter
yaaW b0011 1.5008 0.0488 HtgA transcriptional regulator
yacH b0117 1.3881 0.0384 putative membrane protein
yadK b0136 1.6125 0.0421 putative adhesin-like protein
yaeB b0195 1.3994 0.0117 hypothetical protein
yafL b0227 1.2458 0.0276 putative lipoprotein
yafO b0233 0.6314 0.0485 conserved protein with a possible role in spontaneous mutagenesis; toxin of a
putative toxin-antitoxin pair
yafY b0251 0.6373 0.0205 inner membrane lipoprotein YafY
yagM b0279 1.3267 0.0037 hypothetical protein
yahO b0329 0.7159 0.0211 conserved hypothetical protein
yaiP b0363 2.5784 0.0399 polysaccharide metabolism
yaiY b0379 1.3880 0.0403 putative membrane protein
yajG b0434 2.1052 0.0002 putative polymerase/proteinase
yajL b0424 0.6797 0.0397 YajL
ybaB b0471 0.7466 0.0289 conserved hypothetical protein; trnascription is rpoE-dependent
ybaD b0413 0.7223 0.0384 conserved protein
ybaK b0481 0.4834 0.0267 conserved hypothetical protein
ybbN b0492 0.4921 0.0481 putative thioredoxin-like protein
ybdB b0597 6.2505 0.0061 conserved hypothetical protein
ybeB b0637 0.7632 0.0489 conserved hypothetical protein
ybeD b0631 0.3535 0.0003 conserved hypothetical protein
ybeL b0643 0.4340 0.0165 conserved hypothetical protein
ybeZ b0660 0.7738 0.0071 putative ATP-binding protein
ybfC b0704 0.2580 0.0019 hypothetical protein
157

APPENDIX I
gene blattner ratio A/B p-value Function
ybfD b0706 0.2417 0.0088 conserved protein
ybfE b0685 3.2986 0.0038 hypothetical protein, transcriptionally regulated by LexA
ybgA b0707 0.5694 0.0092 conserved protein
ybgC b0736 2.2715 0.0226 Tol-Pal Cell Envelope Complex
ybhL b0786 0.4736 0.0364 putative transport protein
ybiB b0800 0.5707 0.0300 putative enzyme
ybiC b0801 0.2496 0.0064 putative dehydrogenase
ybiF b0813 1.6029 0.0489 Threonine and Homoserine Exporter
ybiR b0818 2.1306 0.0273 YbiR
ybjO b0858 2.2594 0.0431 putative membrane protein
ycbL b0927 0.6866 0.0197 putative enzyme
ycbQ b0938 0.6103 0.0474 putative fimbrial-like protein
ycbR b0939 0.6518 0.0108 putative chaperone
ycdN b1016 0.7257 0.0321 hypothetical protein of the OFeT transport family
ycdX b1034 0.6937 0.0343 putative DNA polymerase subunit
ycdY b1035 0.4819 0.0151 putative oxidoreductase component
ycdZ b1036 0.9178 0.0037 putative transport protein
yceK b1050 1.6485 0.0298 hypothetical protein
yceP b1060 1.2575 0.0186 conserved hypothetical protein
ycfF b1103 0.5809 0.0081 hypothetical protein
ycfL b1104 0.6008 0.0188 conserved hypothetical protein
ycfP b1108 0.6776 0.0253 putative hydrolase
ycfQ b1111 0.4481 0.0222 hypothetical protein
ycfX b1119 0.6020 0.0137 putative sugar kinase, ROK family protein
ycgH_1 b1169 2.6426 0.0080 conserved protein; member of the Autotransporter family
ycgM b1180 0.8640 0.0332 putative isomerase
ycgR b1194 0.5120 0.0005 protein involved in flagellar function
ycgZ b1164 0.1971 0.0013 hypothetical protein
yciA b1253 2.3276 0.0365 putative enzyme
yciN b1273 0.5538 0.0078 conserved hypothetical protein
yciS b1279 0.5680 0.0114 conserved hypothetical protein
ycjO b1311 2.7124 0.0316 YcjN/YcjO/YcjP ABC transporter
ycjP b1312 0.7347 0.0241 YcjN/YcjO/YcjP ABC transporter
ycjX b1321 0.6578 0.0175 putative EC 2.1 enzyme
ydcR b1439 2.5283 0.0312 multi modular; putative transcriptional regulator ; also putative ATP-binding
component of a transport system
ydcX b1445 2.1871 0.0183 hypothetical protein
yddH b1462 2.2272 0.0241 putative enzyme
ydeR b1503 2.5428 0.0348 putative fimbrial-like protein
ydeS b1504 0.5808 0.0291 putative fimbrial-like protein
ydfH b1540 0.6839 0.0190 hypothetical protein
ydfJ b1543 2.0107 0.0124 YdfJ
ydgA b1614 0.6747 0.0482 conserved protein
YdgF b1600 2.1962 0.0042 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydgR b1634 1.2643 0.0005 YdgR putative peptide POT Transporter
ydhH b1640 0.4079 0.0176 conserved hypothetical protein
ydhR b1667 0.4304 0.0347 conserved hypothetical protein
ydhT b1669 0.7874 0.0102 conserved protein
ydiA b1703 0.2931 0.0113 conserved protein
ydiY b1722 0.7966 0.0467 conserved hypothetical protein
ydiZ b1724 0.3092 0.0002 conserved hypothetical protein
ydjA b1765 0.6823 0.0153 conserved protein
ydjY b1751 1.2582 0.0333 conserved protein, 4Fe-4S protein
yeaC b1777 0.2726 0.0143 conserved hypothetical protein
yebF b1847 1.2639 0.0016 conserved hypothetical protein
yebR b1832 1.5900 0.0450 conserved hypothetical protein
yebV b1836 0.7303 0.0472 hypothetical protein
yedF b1930 0.5758 0.0367 conserved hypothetical protein; might bind RNA
yedI b1958 0.6020 0.0091 hypothetical protein
158

APPENDIX I
gene blattner ratio A/B p-value Function
yegD b2069 0.1096 0.0022 actin family protein
yegP b2080 0.7106 0.0331 conserved hypothetical protein
yegS b2086 0.6537 0.0417 conserved protein
yegV b2100 0.6305 0.0488 putative kinase
yejK b2186 0.5169 0.0083 nucleoid component
yfaE b2236 1.5204 0.0066 conserved hypothetical protein, 2Fe-2S ferredoxin-related
yfaY b2249 0.6445 0.0134 putative competence-damage protein
yfbB b2263 0.4472 0.0003 putative enzyme
yfcZ b2343 0.5741 0.0249 conserved hypothetical protein
yfdG b2350 2.8866 0.0223 hypothetical protein
yfdH b2351 4.5779 0.0047 putative glycan biosynthesis enzyme
yfdZ b2379 0.4718 0.0255 putative aminotransferase
yfhA b2554 0.6241 0.0138 putative 2-component transcriptional regulator
yfiF b2581 0.3793 0.0154 hypothetical protein
yfiH b2593 2.3518 0.0047 conserved hypothetical protein
yfiQ b2584 0.6139 0.0054 putative NAD(P)-binding and ATP-binding acyl-CoA synthetase
ygaF b2660 0.3095 0.0000 hypothetical protein
ygaZ b2682 2.9721 0.0184 hypothetical protein
ygcL b2760 0.7291 0.0047 hypothetical protein with possible relationship to novobiocin and deoxycholate
resistance
ygeA b2840 0.4954 0.0300 putative resistance protein
ygeO b2857 1.8523 0.0339 hypothetical protein
ygfJ b2877 0.6146 0.0146 conserved protein
ygfS b2886 1.7328 0.0364 putative oxidoreductase, Fe-S subunit
yggJ b2946 1.6239 0.0074 conserved hypothetical protein
yggL b2959 0.6458 0.0023 conserved hypothetical protein
yggW b2955 1.3703 0.0151 putative oxidase
yghB b3009 0.7895 0.0308 putative integral membrane protein
yghU b2989 0.2467 0.0025 glutathione transferase-like protein possibly involved in glutathionylspermidine
metabolism
ygiA b3036 1.6742 0.0177 hypothetical protein
yhaV b3130 0.5692 0.0077 conserved hypothetical protein
yhcA b3215 2.1510 0.0365 putative chaperone
yhdE b3248 0.4955 0.0496 conserved hypothetical protein
yhdH b3253 0.3436 0.0006 putative dehydrogenase
yheL b3343 3.0897 0.0190 conserved hypothetical protein
yheM b3344 4.4555 0.0202 conserved hypothetical protein
yheN b3345 2.6968 0.0330 conserved hypothetical protein
yheO b3346 2.2685 0.0223 hypothetical protein
yhfA b3356 0.5425 0.0352 conserved hypothetical protein
yhhM b3467 0.7356 0.0202 putative receptor
yhhT b3474 1.3859 0.0171 hypothetical protein
yhiQ b3497 1.6969 0.0181 putative methyltransferase
yhjK b3529 1.4678 0.0029 conserved protein
yiaT b3584 0.8971 0.0295 putative outer membrane protein
yibI b3598 1.5584 0.0342 hypothetical protein
yicC b3644 0.6226 0.0107 conserved protein
yifN b3777 0.6923 0.0355 conserved hypothetical protein
yigZ b3848 2.8187 0.0073 putative elongation factor
yiiR b3921 0.6478 0.0117 putative membrane protein
yijP b3955 0.4791 0.0024 hypothetical protein; related to invasion protein of pathogenic E. coli
yjbQ b4056 0.2981 0.0075 conserved hypothetical protein
yjcZ b4110 1.2700 0.0269 hypothetical protein
yjdM b4108 0.3921 0.0080 hypothetical protein
yjgB b4269 0.6383 0.0112 putative oxidoreductase
yjiG b4329 0.6702 0.0021 putative membrane protein
yjjA b4360 0.6315 0.0065 putative glycoprotein/receptor
yjjQ b4365 1.8874 0.0056 putative regulator
ykfG b0247 1.4225 0.0448 putative DNA repair protein
159

APPENDIX I
gene blattner ratio A/B p-value Function
ykgB b0301 0.2697 0.0126 putative membrane protein
ykgI b0303 0.1371 0.0142 hypothetical protein
yliD b0832 0.5942 0.0294 YliA/YliB/YliC/YliD ABC transporter
ymgA b1165 0.1880 0.0008 hypothetical protein
ynaJ b1332 0.6770 0.0219 conserved hypothetical protein
ynfD b1586 0.4744 0.0302 conserved hypothetical protein
ynjH b1760 0.1079 0.0001 conserved hypothetical protein
yoaB b1809 0.4229 0.0064 conserved protein
yoaC b1810 0.4432 0.0033 conserved hypothetical protein
yphC b2545 0.7253 0.0435 predicted oxidoreductase
yqeG b2845 2.3330 0.0145 YqeG STP transporter
yqfB b2900 0.5018 0.0235 conserved hypothetical protein
yqiA b3031 1.8528 0.0482 putative hydrolase
yqiI b3048 1.5915 0.0251 conserved protein
yqjD b3098 0.5135 0.0398 conserved hypothetical protein
yraM b3147 0.6915 0.0206 putative glycosylase
yrbA b3190 1.6358 0.0200 hypothetical protein
yrdC b3282 1.9330 0.0102 RNA-binding protein with unique protein fold
yrdD b3283 3.2410 0.0102 putative DNA topoisomerase
yrfF b3398 3.1897 0.0119 putative dehydrogenase
ytfA b4205 0.6230 0.0360 hypothetical protein
znuA b1857 3.6361 0.0065 ZnuA/ZnuB/ZnuC ABC transporter
znuC b1858 1.3426 0.0008 ZnuA/ZnuB/ZnuC ABC transporter
zraR b4004 2.5337 0.0077 ZraR-Phosphorylated transcriptional activator
Supplementary table – XI: LZ54 wild-type (A) Vs LZ54 fis::cm (B)
gene blattner ratio p-value Function
A/B
aaeX b3242 0.3200 0.0268 hypothetical protein
abgB b1337 0.4513 0.0162 hypothetical protein
aceF b0115 1.4049 0.0029 AceF-lipoate
acs b4069 0.0998 0.0401 putative hydroxycinnamate-CoA ligase / acetyl-CoA synthetase
adk b0474 0.4908 0.0443 adenylate kinase
aegA b2468 0.4339 0.0331 putative oxidoreductase, Fe-S subunit
ahpC b0605 0.4949 0.0199 AhpC component
aldB b3588 0.6066 0.0090 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B
allR b0506 0.3675 0.0004 AllR transcriptional regulator
amyA b1927 1.4397 0.0367 alpha-amylase, cytoplasmic
aniC b4115 0.9075 0.0200 AdiC Arginine:Agmatine Antiporter
argR b3237 0.5889 0.0462 ArgR transcriptional dual regulator
aroA b0908 0.7038 0.0037 3-phosphoshikimate-1-carboxyvinyltransferase
artQ b0862 1.3759 0.0198 arginine ABC transporter
atpG b3733 1.3528 0.0009 ATP synthase, F1 complex, gamma subunit
b0309 b0309 0.3686 0.0298 hypothetical protein
b0373 b0373 0.5710 0.0097 hypothetical protein
b1364 b1364 1.7894 0.0168 hypothetical protein
baeS b2078 0.5383 0.0205 BaeS-Phis
bglG b3723 1.2005 0.0036 BglG monomer
cbl b1987 0.7237 0.0159 Cbl transcriptional activator
chbG b1733 2.1422 0.0047
hypothetical protein, encoded by an operon required for growth on N,N'-
diacetylchitobiose
cheB b1883 2.0876 0.0004 CheB-Pasp / PGluMase / protein-glutamine glutaminase
cheZ b1881 1.3201 0.0444 CheZ
citE b0616 2.1449 0.0394 subunit of citryl-ACP lyase
160

APPENDIX I
gene blattner ratio p-value Function
A/B
citX b0614 0.4000 0.0370 holo-ACP synthase
clpA b0882 0.7887 0.0340 ATP-binding component of serine protease
cpsB b2049 0.3934 0.0301 mannose-1-phosphate guanylyltransferase-(GDP)
cpxP b3913 2.7585 0.0052
regulator of the Cpx response and possible chaperone involved in resistance to
extracytoplasmic stress
creA b4397 0.6098 0.0489 hypothetical protein
csgA b1042 0.5922 0.0165 curlin, major subunit
cydC b0886 0.5727 0.0423 abc-6-cplx
dcd b2065 0.5033 0.0057 dCTP deaminase
dcp b1538 0.5735 0.0138 dipeptidyl carboxypeptidase II
deoB b4383 2.8180 0.0292 phosphopentomutase
dgoR b4479 0.3103 0.0080 regulator protein for dgo operon
dinB b0231 0.5729 0.0144 DNA polymerase IV (Y-family DNA polymerase; translesion DNA synthesis)
dinD b3645 0.5218 0.0499 DNA-damage-inducible protein
dld b2133 0.3096 0.0065 D-lactate:Quinone Oxidoreductase
dnaG b3066 2.8483 0.0412 DNA biosynthesis; DNA primase
dnaQ b0215 0.4868 0.0086 DNA polymerase III, epsilon subunit
dppB b3543 0.3745 0.0395 dipeptide ABC transporter
elaA b2267 0.3654 0.0026 hypothetical protein
elbB b3209 0.7262 0.0373 sigma cross-reacting protein 27A (SCRP-27A)
emtA b1193 0.5201 0.0102 murein transglycosylase E
entS b0591 5.6019 0.0045 YbdA MFS transporter
erfK b1990 0.4581 0.0299 hypothetical protein with similarity to universal stress protein
exbB b3006 9.4812 0.0258 ExbB protein; uptake of enterochelin; tonB-dependent uptake of B colicins
exbD b3005 4.8930 0.0016 ExbD uptake of enterochelin; tonB-dependent uptake of B colicins
fbaB b2097 0.1818 0.0492 fructose bisphosphate aldolase monomer
fecA b4291 3.3493 0.0110
outer membrane receptor; citrate-dependent iron transport, outer membrane
receptor
fecB b4290 8.7354 0.0011 ferric dicitrate uptake system
feoA b3408 1.5400 0.0067 ferrous iron transport protein A
fepA b0584 3.0382 0.0381
FepA, outer membrane receptor for ferric enterobactin (enterochelin) and colicins
B and D
fhuF b4367 6.4472 0.0140 acts in reduction of ferrioxamine B iron
fimA b4314 0.0474 0.0033 major type 1 subunit fimbrin (pilin)
fimI b4315 0.1958 0.0097 fimbrial protein
fklB b4207 0.6485 0.0088 FKBP-type 22KD peptidyl-prolyl cis-trans isomerase (a rotamase)
fkpA b3347 0.6246 0.0037 peptidyl-prolyl cis-trans isomerase; in protein folding
flgJ b1081 2.4784 0.0147 FlgJ
flgM b1071 1.3378 0.0033 anti-FliA (anti-sigma) factor; also known as RflB protein
flgN b1070 1.6620 0.0138 flagellar biosynthesis protein FlgN
flhB b1880 1.7009 0.0337 flagellar biosynthesis protein FlhB
fliE b1937 1.4750 0.0088 flagellar basal-body protein FliE
fliF b1938 1.6666 0.0306
flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)-
ring and collar protein
fliG b1939 2.1045 0.0069
flagellar motor switch protein FliG; component of motor switching and
energizing, enabling rotation and determining its direction
fliL b1944 2.1945 0.0188 flagellar biosynthesis
fliM b1945 2.0791 0.0003
flagellar motor switch protein FliM; component of motor switch and energizing,
enabling rotation and determining its direction
fliP b1948 1.9491 0.0114 flagellar biosynthesis protein FliP
fliQ b1949 3.0936 0.0072 flagellar biosynthesis protein FliQ
fliZ b1921 1.4597 0.0276 possible cell-density responsive regulator of sigmaF
flxA b1566 1.6260 0.0119 hypothetical protein; gene is regulated by FliA
folE b2153 0.6211 0.0207 GTP cyclohydrolase I
frmA b0356 1.1962 0.0067 formaldehyde dehydrogenase, glutathione-dependent
ftnA b1905 0.4044 0.0002 cytoplasmic ferritin, an iron storage protein)
ftsI b0084 2.4213 0.0314 essential cell division protein FtsI; penicillin-binding protein 3
ftsL b0083 1.7997 0.0053 essential cell division protein FtsL
161

APPENDIX I
gene blattner ratio p-value Function
A/B
galR b2837 2.6916 0.0029 GalR-galactose
galT b0758 0.6631 0.0384
UDP-glucose-hexose-1-phosphate uridylyltransferase / galactose-1-phosphate
uridylyltransferase
galU b1236 1.8258 0.0242 UTP-glucose-1-phosphate uridylyltransferase
garR b3125 0.6022 0.0007 tartronate semialdehyde reductase
gcl b0507 0.3585 0.0257 glyoxylate carboligase
ghrA b1033 0.3564 0.0005 glyoxylate reductase
glmS b3729 1.0956 0.0218 L-glutamine:D-fructose-6-phosphate aminotransferase
gloA b1651 0.8364 0.0384 glyoxalase I
gltB b3212 0.5950 0.0474 glutamate synthase (NADPH) large chain precursor
gltD b3213 0.5153 0.0061 glutamate synthase (NADPH) small chain
glyA b2551 0.5605 0.0266 glycine hydroxymethyltransferase
gmhB b0200 0.6287 0.0027 GmhB
gpp b3779 2.2141 0.0307 guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase
grxB b1064 0.4556 0.0213 oxidized glutaredoxin 2
gst b1635 0.5631 0.0185 glutathione transferase
gutQ b2708 0.7061 0.0173 protein with a sugar isomerase domain
hdeD b3511 1.5185 0.0068 protein involved in acid resistance
hdfR b4480 0.6083 0.0428 transcriptional regulator
hemL b0154 0.6270 0.0356 glutamate-1-semialdehyde aminotransferase
hepA b0059 0.5258 0.0325 RNA Polymerase (RNAP)-binding ATPase and RNAP recycling factor
hflD b1132 0.6486 0.0423 membrane protein in operon with purB
hipA b1507 2.1862 0.0158 HipA transcriptional activator
hisI b2026 0.7672 0.0436 phosphoribosyl-AMP cyclohydrolase / phosphoribosyl-ATP pyrophosphatase
hisJ b2309 0.5028 0.0038 histidine ABC transporter
hscA b2526 1.7721 0.0266 chaperone, member of Hsp70 protein family
hsdM b4349 0.7275 0.0448 host modification; DNA methylase M
hsdS b4348 0.6614 0.0101 specificity determinant for hsdM and hsdR
htrA b0161 2.8995 0.0097 DegP
hybD b2993 0.4468 0.0191 hydrogenase 2 maturation endopeptidase
hydN b2713 1.2745 0.0490 putative electron transport protein HydN
ibpA b3687 2.0616 0.0065 small heat shock protein IbpA
inaA b2237 1.3823 0.0226 pH-inducible protein involved in stress response
infC b1718 1.3280 0.0197 protein chain initiation factor IF-3
iscA b2528 1.4270 0.0242 iron-sulfur cluster assembly protein
iscS b2530 1.4016 0.0167 cysteine desulfurase monomer
iscU b2529 1.3576 0.0171 scaffold protein involved in iron-sulfur cluster assembly
iscX b2524 1.8316 0.0294 protein with possible role in iron-sulfur cluster biogenesis
kdgT b3909 2.3520 0.0274 KdgT 2-keto-3-deoxygluconate transporter
kduD b2842 0.7186 0.0150 2-deoxy-D-gluconate 3-dehydrogenase
kduI b2843 0.7822 0.0384 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase
leuA b0074 2.9952 0.0235 2-isopropylmalate synthase
lplA b4386 0.6314 0.0266 lipoyl-protein ligase A
lysU b4129 0.3830 0.0029 lysyl-tRNA synthetase (LysRSu), inducible
maa b0459 0.6405 0.0004 maltose acetyltransferase
malX b1621 0.5038 0.0496 EIIBCMalX
malY b1622 0.7775 0.0304 bifunctional: repressor of maltose regulon / cystathionine beta-lyase
manA b1613 0.5147 0.0334 mannose-6-phosphate isomerase
map b0168 1.5951 0.0157 methionine aminopeptidase
marA b1531 5.0995 0.0031 MarA transcriptional activator
marR b1530 4.0195 0.0022 MarR-salicylate
mbhA b0230 0.4200 0.0113 putative motility protein
mdaB b3028 1.9345 0.0233 NADPH quinone reductase
mdoD b1424 0.6780 0.0394 glucan biosynthesis protein D
mdtH b1065 0.5184 0.0019 YceL MFS transporter
menG b3929 0.7805 0.0366 inhibitor of ribonuclease E (RNase E) activity
mfd b1114 0.5397 0.0158 transcription-repair coupling factor; mutation frequency decline
162

APPENDIX I
gene blattner ratio p-value Function
A/B
mglC b2148 0.1817 0.0059 galactose ABC transporter
moeB b0826 0.3297 0.0018 molybdopterin biosynthesis
mog b0009 0.6094 0.0062 required for the efficient incorporation of Mo into molybdoproteins
motA b1890 1.4410 0.0182 MotA protein, proton conductor component of motor; no effect on switching
mpaA b1326 0.6680 0.0238 murein peptide amidase A
mraW b0082 1.6512 0.0423 S-adenosyl-dependent methyltransferase
msrA b4219 0.3359 0.0142
methionine sulfoxide reductase A / protein-methionine-S-oxide reductase /
methionine sulfoxide reductase
mug b3068 0.2422 0.0049 stationary phase mismatch/uracil DNA glycosylase
mukE b0923 2.2877 0.0118 protein involved in chromosome partitioning
mukF b0922 2.1539 0.0075 Ca2+-binding protein involved in chromosome partitioning
murC b0091 1.3976 0.0217 UDP-N-acetylmuramate-alanine ligase
murD b0088 1.1421 0.0308 UDP-N-acetylmuramoylalanine-D-glutamate ligase
mutH b2831 0.4240 0.0337 MutHLS complex, methyl-directed mismatch repair
nadR b4390 0.6257 0.0268 NadR transcriptional repressor / NMN adenylyltransferase
nagA b0677 0.5678 0.0282 N-acetylglucosamine-6-phosphate deacetylase
nagB b0678 0.4101 0.0011 glucosamine-6-phosphate deaminase
narL b1221 0.5206 0.0007 NarL-Phosphorylated transcriptional dual regulator
narX b1222 0.4355 0.0202 NarX-Phis
nfi b3998 0.6846 0.0473 endonuclease V (deoxyinosine 3'endoduclease)
nfnB b0578 0.7962 0.0085 dihydropteridine reductase
nfrA b0568 0.3236 0.0069 bacteriophage N4 receptor, outer membrane protein
nfsA b0851 1.5581 0.0063 NADPH nitroreductase
nlpD b2742 0.6439 0.0366 NlpD putative outer membrane lipoprotein
nudH b2830 1.4474 0.0158 putative invasion protein
ompA b0957 0.7281 0.0106 outer membrane protein 3a (II*;G;d)
ompC b2215 2.0986 0.0040 outer membrane porin OmpC
ompX b0814 0.6904 0.0223 outer membrane protein X
oxyR b3961 0.6290 0.0201 OxyR transcriptional dual regulator
paaB b1389 0.0991 0.0404 putative subunit of phenylacetate-CoA oxygenase
paaI b1396 1.8933 0.0289 hypothetical protein with some similarity to thioesterases
pal b0741 0.5468 0.0040 Tol-Pal Cell Envelope Complex
panF b3258 0.7935 0.0164 PanF sodium/pantothenate SSS transporter
pepQ b3847 1.5249 0.0184 proline dipeptidase
pfkA b3916 0.5688 0.0041 6-phosphofructokinase-1 monomer / putative NAD+ kinase
pfkB b1723 0.4510 0.0068 6-phosphofructokinase-2 monomer
pgk b2926 1.3521 0.0229 phosphoglycerate kinase
pheS b1714 1.4275 0.0242 phenylalanyl-tRNA synthetase &alpha;-chain
phnI b4099 2.1789 0.0451 phosphonate metabolism
plsX b1090 2.1023 0.0467 glycerolphosphate auxotrophy in plsB background
pmbA b4235 0.6317 0.0323
protease involved in Microcin B17 maturation and in sensitivity to the DNA
gyrase inhibitor LetD
pnuC b0751 1.2218 0.0260 PnuC NMN transporter
poxA b4155 0.4524 0.0462 putative regulator of pyruvate oxidase
ppiD b0441 0.7431 0.0500 peptidyl-prolyl cis-trans isomerase
prfA b1211 2.0627 0.0070 peptide chain release factor RF-1
prfH b0236 0.3770 0.0439 probable peptide chain release factor
prlC b3498 0.5779 0.0203 oligopeptidase A
prmA b3259 0.6861 0.0196 methylation of 50S ribosomal subunit protein L11
proA b0243 0.8509 0.0152 gamma-glutamyl kinase-GP-reductase multienzyme complex
ptrA b2821 0.2672 0.0247 protease III
purB b1131 0.7424 0.0127
5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole lyase /
adenylosuccinate lyase
purD b4005 0.6497 0.0099 phosphoribosylamine-glycine ligase
purE b0523 0.5049 0.0089 N5-carboxyaminoimidazole ribonucleotide mutase
purR b1658 1.3164 0.0433 PurR transcriptional repressor
purT b1849 0.4486 0.0494 GAR transformylase 2
163

APPENDIX I
gene blattner ratio p-value Function
A/B
puuA b1297 0.4444 0.0002 putative glutamine synthetase (EC 6.3.1.2)
puuR b1299 2.1380 0.0256 putative oxidoreductase/putative regulator
racR b1356 1.7456 0.0218 hypothetical protein
rcsF b0196 0.7467 0.0352 RcsF-P
recB b2820 0.3206 0.0117
RecB; DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit,
ssDNA endonuclease
recC b2822 2.3410 0.0070
DNA helicase, ATP-dependent dsDNA/ssDNA exonuclease V subunit, ssDNA
endonuclease
rep b3778 0.5395 0.0242 rep helicase, a single-stranded DNA dependent ATPase
rffD b3787 1.6810 0.0404 UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase
rffG b3788 1.4341 0.0315 dTDP-glucose 4,6-dehydratase 2
rhsC_1 b0700 0.2172 0.0239 RhsC protein in rhs element, interrupted
rhtB b3824 0.4705 0.0156 RhtB homoserine Rht Transporter
rimJ b1066 0.6184 0.0212
acetylates N-terminal alanine of 30S ribosomal subunit protein S5 / ribosomalprotein-alanine
N-acetyltransferase
rob b4396 0.6252 0.0498 Rob transcriptional activator
rplD b3319 1.8347 0.0070 50S ribosomal subunit protein L4, regulates expression of S10 operon
rplP b3313 1.3529 0.0061 50S ribosomal subunit protein L16
rpmG b3636 1.7607 0.0218 50S ribosomal subunit protein L33
rpsI b3230 2.3038 0.0446 30S ribosomal subunit protein S9
ruvA b1861 0.6819 0.0478 branch migration of Holliday structures; repair
sanA b2144 3.4542 0.0022 vancomycin sensitivity
sapB b1293 1.2822 0.0403 peptide uptake ABC transporter
sbcC b0397 0.5204 0.0154 ATP-dependent dsDNA exonuclease
sbcD b0398 0.5232 0.0154 ATP-dependent dsDNA exonuclease
secG b3175 2.8489 0.0079 Sec Protein Secretion Complex
secY b3300 1.6629 0.0061 Sec Protein Secretion Complex
setB b2170 0.5873 0.0068 YeiO MFS transporter
slt b4392 0.7163 0.0041 soluble lytic murein transglycosylase
smtA b0921 2.2662 0.0008 S-adenosylmethionine-dependent methyltransferase
sodA b3908 1.6251 0.0428 superoxide dismutase (Mn)
sodB b1656 0.6871 0.0357 superoxide dismutase (Fe)
sohA b3129 0.3949 0.0001 putative protease, affects protein secretion
soxS b4062 0.7246 0.0408 SoxS transcriptional activator
speC b2965 0.2278 0.0104 ornithine decarboxylase, biosynthetic
speD b0120 0.4229 0.0032 adenosylmethionine decarboxylase, proenzyme
speE b0121 0.3868 0.0023 spermidine synthase
spoT b3650 2.1390 0.0249 GDP diphosphokinase / guanosine-3',5'-bis(diphosphate) 3'-diphosphatase
sspB b3228 1.6238 0.0353 SspB monomer
stpA b2669 0.6804 0.0362 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing?
talA b2464 0.5618 0.0078 transaldolase A
tauC b0367 1.2163 0.0350 TauA/TauB/TauC ABC transporter
tdcA b3118 0.7075 0.0382 TdcA transcriptional activator
tesB b0452 0.5076 0.0130 thioesterase II
thrA b0002 1.5206 0.0439 aspartate kinase I / homoserine dehydrogenase I
thrS b1719 1.2919 0.0110 threonyl-tRNA synthetase
tnaB b3709 0.3751 0.0371 TnaB tryptophan ArAAP transporter
tolB b0740 0.6004 0.0079 Tol-Pal Cell Envelope Complex
tonB b1252 4.8369 0.0178
TonB protein; energy transducer; uptake of iron, cyanocobalimin; sensitivity to
phages, colicins
topB b1763 2.2188 0.0171 DNA topoisomerase III
tpiA b3919 0.5602 0.0113 triose phosphate isomerase monomer
tpx b1324 0.5721 0.0037 thiol peroxidase 2
trkH b3849 1.6425 0.0408 TrkH potassium ion Trk Transporter
trpA b1260 0.6895 0.0091 tryptophan synthase, alpha subunit / indoleglycerol phosphate aldolase
ubiB b3835 1.8429 0.0208 2-octaprenylphenol hydroxylase
ulaG b4192 0.5353 0.0428 putative L-ascorbate 6-phosphate lactonase
ves b1742 1.6031 0.0028 cold-induced member of the CspA family
164

APPENDIX I
gene blattner ratio p-value Function
A/B
wcaM b2043 0.7903 0.0280 hypothetical protein
xdhD b2881 0.4314 0.0203
putative oxidoreductase; possible component of selenate reductase with possible
role in purine salvage
xseB b0422 0.6395 0.0007 exonuclease VII, small subunit
xylF b3566 0.8595 0.0048 xylose ABC transporter
yaaA b0006 0.6867 0.0434 putative membrane protein
yadI b0129 0.6721 0.0176 EIIAga
yaeR b0187 0.6633 0.0090 putative enzyme
yafK b0224 0.5143 0.0141
conserved protein; in enteroaggregative E. coli, YafK is required for development
of biofilms
yafL b0227 0.6653 0.0187 putative lipoprotein
yagB b0266 0.3543 0.0199 hypothetical protein
yahG b0321 0.4435 0.0499 conserved protein
yajC b0407 0.6234 0.0285 Sec Protein Secretion Complex
yajL b0424 0.5924 0.0146 YajL
yajQ b0426 0.7004 0.0019 nucleotide binding protein
ybbA b0495 0.4961 0.0210 YbbA/YbbP ABC transporter
ybbN b0492 0.5804 0.0095 putative thioredoxin-like protein
ybdB b0597 1.8841 0.0034 conserved hypothetical protein
ybeD b0631 0.5752 0.0204 conserved hypothetical protein
ybeF b0629 0.5481 0.0405 putative transcriptional regulator LYSR-type
ybeL b0643 0.5838 0.0267 conserved hypothetical protein
ybeR b0645 0.6981 0.0297 conserved hypothetical protein
ybfC b0704 0.4592 0.0473 hypothetical protein
ybgA b0707 0.5380 0.0378 conserved protein
ybgF b0742 0.7414 0.0495 Tol-Pal Cell Envelope Complex
ybhA b0766 0.4283 0.0208 putative phosphatase
ybhL b0786 0.4806 0.0166 putative transport protein
ybiC b0801 0.2705 0.0026 putative dehydrogenase
ybjC b0850 2.1246 0.0155 conserved hypothetical protein; gene is within soxRS regulon
ybjT b0869 0.5382 0.0222 putative dTDP-glucose
ycaO b0905 0.5635 0.0133 conserved hypothetical protein
ycaR b0917 0.8119 0.0434 hypothetical protein
ycbK b0926 0.4625 0.0396 conserved hypothetical protein
ycbQ b0938 0.3915 0.0212 putative fimbrial-like protein
ycbW b0946 0.4707 0.0294 conserved hypothetical protein
ycdK b1010 0.6659 0.0336 conserved protein
ycdO b1018 3.1170 0.0011 conserved hypothetical protein
ycdX b1034 0.6258 0.0106 putative DNA polymerase subunit
ycdY b1035 0.5220 0.0048 putative oxidoreductase component
yceP b1060 3.0327 0.0061 conserved hypothetical protein
ycfF b1103 0.7821 0.0425 hypothetical protein
ycfX b1119 0.5588 0.0062 putative sugar kinase, ROK family protein
ycgF b1163 0.4183 0.0033 conserved protein
ycgZ b1164 0.2379 0.0051 hypothetical protein
yciA b1253 2.1238 0.0447 putative enzyme
ycjO b1311 2.0646 0.0042 YcjN/YcjO/YcjP ABC transporter
ycjZ b1328 1.5357 0.0455 putative transcriptional regulator LYSR-type
ydcR b1439 2.1811 0.0125
multi modular; putative transcriptional regulator ; also putative ATP-binding
component of a transport system
ydcX b1445 2.0821 0.0245 hypothetical protein
yddB b1495 1.8931 0.0263 conserved protein
yddE b1464 0.5672 0.0290 conserved protein
yddH b1462 2.1448 0.0097 putative enzyme
ydeK b1510 0.7567 0.0259 YdeK
ydeR b1503 2.0061 0.0065 putative fimbrial-like protein
ydfD b1576 1.1486 0.0464 hypothetical protein
165

APPENDIX I
gene blattner ratio p-value Function
A/B
ydfG b1539 0.5150 0.0046 3-hydroxy acid dehydrogenase monomer
ydfJ b1543 2.2617 0.0173 YdfJ
ydfR b1555 1.4544 0.0272 hypothetical protein
YdgF b1600 4.2412 0.0211 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydhH b1640 0.4438 0.0035 conserved hypothetical protein
ydhO b1655 1.6025 0.0127 putative lipoprotein
ydhR b1667 2.0667 0.0134 conserved hypothetical protein
ydiA b1703 0.5498 0.0081 conserved protein
ydiJ b1687 0.6760 0.0039 putative oxidase
ydiZ b1724 0.4478 0.0112 conserved hypothetical protein
ydjA b1765 0.7449 0.0457 conserved protein
ydjJ b1774 0.4478 0.0421 putative oxidoreductase
yecM b1875 0.5730 0.0459
conserved hypothetical protein with structural similarity to metal binding
isomerases and oxygenases
yecR b1904 2.2905 0.0227 conserved hypothetical protein
yedA b1959 0.3926 0.0268 putative transmembrane subunit
yedS_2 b1965 1.2318 0.0336 putative outer membrane protein
yedW b1969 1.7473 0.0293 putative 2-component transcriptional response regulator
yeeV b2005 2.3889 0.0447 toxin of the YeeV-YeeU toxin-antitoxin pair
yegD b2069 0.4221 0.0152 actin family protein
yehS b2124 1.5509 0.0010 conserved hypothetical protein
yfaY b2249 0.6432 0.0439 putative competence-damage protein
yfcO b2332 2.0298 0.0093 conserved hypothetical protein
yfdG b2350 1.9660 0.0295 hypothetical protein
yfdH b2351 2.2682 0.0127 putative glycan biosynthesis enzyme
yfdQ b2360 0.7084 0.0485 hypothetical protein
yfdZ b2379 0.4682 0.0142 putative aminotransferase
yfeA b2395 3.1873 0.0153 putative membrane protein
yfgA b2516 1.6228 0.0427 putative membrane protein
yfgG b2504 1.9854 0.0010 hypothetical protein
yfiC b2575 0.6816 0.0353 putative enzyme
ygaF b2660 0.2733 0.0438 hypothetical protein
ygaH b2683 4.1143 0.0001 putative transport protein
ygaZ b2682 3.8502 0.0126 hypothetical protein
ygdR b2833 0.7101 0.0443 conserved hypothetical protein
ygeA b2840 0.7747 0.0342 putative resistance protein
yggG b2936 0.5864 0.0044 conserved protein
yghU b2989 0.2346 0.0021
glutathione transferase-like protein possibly involved in glutathionylspermidine
metabolism
yghX b2999 0.7351 0.0450 putative enzyme
ygiB b3037 0.6675 0.0272 conserved hypothetical protein
ygiC b3038 0.6545 0.0203 putative glutathione-like synthetase
ygjK b3080 0.7192 0.0047 putative isomerase
yhaH b3103 1.7228 0.0160 putative cytochrome
yhaO b3110 0.4765 0.0045 YhaO STP transporter
yhaV b3130 0.4633 0.0039 conserved hypothetical protein
yhdN b3293 0.5429 0.0431 conserved hypothetical protein
yhgA b3411 0.8004 0.0317 hypothetical protein
yhhW b3439 0.5175 0.0175 conserved hypothetical protein
yhhX b3440 0.6329 0.0101 putative galactose 1-dehydrogenase
yicC b3644 0.7406 0.0216 conserved protein
yidS b3690 0.7631 0.0435 putative oxidoreductase with FAD/NAD(P)-binding domain
yidW b3694 0.3773 0.0239
yidZ b3711 0.8211 0.0483 putative transcriptional regulator LysR-type
yifK b3795 3.1137 0.0009 YifK APC transporter
yiiM b3910 0.7020 0.0122 conserved hypothetical protein
yjdI b4126 0.7375 0.0469 conserved hypothetical protein
166

APPENDIX I
gene blattner ratio p-value Function
A/B
yjdL b4130 0.8934 0.0340 YjdL peptide POT transporter
yjeJ b4145 1.3189 0.0227 conserved protein
yjhH b4298 0.5714 0.0293 putative lyase/synthase
yjhQ b4307 0.5879 0.0424 hypothetical protein
yjjQ b4365 0.7703 0.0016 putative regulator
ykgB b0301 0.1144 0.0233 putative membrane protein
ykgI b0303 0.0811 0.0115 hypothetical protein
yliC b0831 0.5742 0.0208 YliA/YliB/YliC/YliD ABC transporter
ymdB b1045 0.4293 0.0044 conserved protein
ymfL b1147 0.6034 0.0298 hypothetical protein
ymgA b1165 0.2057 0.0011 hypothetical protein
ymgB b1166 0.2193 0.0045 hypothetical protein
ynbB b1409 1.8755 0.0346 putative phosphatidate cytidiltransferase
ynbD b1411 2.0382 0.0189 putative enzyme
yncE b1452 1.5010 0.0124 putative receptor
ynfA b1582 0.5690 0.0326 inner membrane protein
ynfF b1588 1.3945 0.0073 oxidoreductase subunit paralog of DmsA
ynfK b1593 1.3710 0.0451 hypothetical protein
yoaB b1809 0.6323 0.0226 conserved protein
yohK b2142 0.6522 0.0298 putative transporter
yojI b2211 4.8991 0.0006 YojI
ypfG b2466 0.5804 0.0215 conserved hypothetical protein
ypjF b2646 0.6684 0.0339 member of the YeeV, YkfI, YpjF family of toxin proteins
yqcD b2794 0.5550 0.0359 conserved hypothetical protein
yqgF b2949 0.5076 0.0306 possible Holliday junction resolvase
yqjE b3099 0.5661 0.0492 conserved protein
yraR b3152 0.6835 0.0499 putative NADH dehydrogenase
yrdA b3279 0.3644 0.0141 putative transferase
yrdD b3283 1.3095 0.0130 putative DNA topoisomerase
ytfN b4221 0.7492 0.0064 conserved protein
zipA b2412 2.6840 0.0155 essential cell division protein ZipA
znuA b1857 2.8611 0.0069 ZnuA/ZnuB/ZnuC ABC transporter
Supplementary table – XII: LZ41 wild-type (A) Vs LZ41 hns-205::Tn10 (B)
gene blattner ratio p-value Function
A/B
aat b0885 0.7595 0.0479 leucyl, phenylalanyl-tRNA-protein transferase
abgR b1339 0.6195 0.0042 putative transcriptional regulator LYSR-type
acrA b0463 4.5010 0.0065 AcrA Membrane Fusion Protein
acrE b3265 0.1208 0.0044 transmembrane protein affects septum formation and cell membrane permeability
acrF b3266 0.6175 0.0474 AcrEF-TolC Drug Efflux Transport System
ade b3665 0.0536 0.0002 cryptic adenine deaminase monomer
agaA b3135 0.5197 0.0250 AgaA
agaC b3139 0.5391 0.0363 EIIAga
aldB b3588 0.6583 0.0359 putative aminobutyraldehyde dehydrogenase / aldehyde dehydrogenase B
allA b0505 0.6574 0.0061 ureidoglycolate hydrolase
allB b0512 0.4423 0.0151 allantoinase
allC b0516 0.4293 0.0117 allantoate amidohydrolase
allD b0517 0.4905 0.0101 ureidoglycolate dehydrogenase
alsB b4088 0.4271 0.0007 YjcX
aniC b4115 0.4105 0.0212 AdiC Arginine:Agmatine Antiporter
araG b1900 0.7483 0.0333 arabinose ABC transporter
167

APPENDIX I
gene blattner ratio p-value Function
A/B
araH b4460 0.4566 0.0067 high-affinity L-arabinose transport protein (ABC superfamily, membrane)
arnT b2257 0.2829 0.0208 4-amino-4-deoxy-L-arabinose (L-Ara4N) transferase
aroD b1693 0.6190 0.0316 3-dehydroquinate dehydratase
aroH b1704 0.5580 0.0038 2-dehydro-3-deoxyphosphoheptonate aldolase
asnS b0930 1.7622 0.0368 asparaginyl-tRNA synthetase
astB b1745 1.3454 0.0327 succinylarginine dihydrolase
atoA b2222 2.3479 0.0324 AtoA / putative acetate CoA-transferase
b0501 b0501 0.1596 0.0008 hypothetical protein
b0816 b0816 0.4687 0.0373 hypothetical protein
b1172 b1172 0.1061 0.0001 conserved hypothetical protein
b1354 b1354 0.5533 0.0243 hypothetical protein
b1364 b1364 10.5092 0.0054 hypothetical protein
b1903 b1903 0.2168 0.0033 hypothetical protein
b2596 b2596 0.5031 0.0010 hypothetical protein
b2680 b2680 0.7122 0.0494 YgaY MFS transporter
b2856 b2856 0.6466 0.0035 hypothetical protein
bcsE b3536 0.5509 0.0240 putative protease
bcsF b3537 0.5029 0.0319 hypothetical protein
bcsZ b3531 0.5272 0.0166 endo-1,4-D-glucanase
bdm b1481 0.4413 0.0416 hypothetical protein
bioB b0775 1.5107 0.0398 biotin synthase monomer
blc b4149 0.6930 0.0385 Blc outer membrane lipoprotein (lipocalin)
bolA b0435 0.5808 0.0485 BolA transcriptional regulator
borD b0557 0.2028 0.0066 bacteriophage lambda Bor protein homolog
btuB b3966 2.0282 0.0268
outer membrane receptor for transport of vitamin B12, E colicins, and
bacteriophage BF23
cadA b4131 0.1817 0.0010 lysine decarboxylase
cadB b4132 0.2314 0.0183 CadB cadaverine/lysine APC exchanger / Transporter
chaA b1216 1.1728 0.0177 ChaA calcium CaCA transporter
chbF b1734 0.4431 0.0084 6-phospho-beta-glucosidase; cryptic
chbG b1733 0.5453 0.0153
hypothetical protein, encoded by an operon required for growth on N,N'-
diacetylchitobiose
chbR b1735 0.2703 0.0116 ChbR transcriptional regulator
cheY b1882 3.2891 0.0487 CheY-Pasp
clpB b2592 0.7053 0.0387 ClpB chaperone
cmr b0842 0.4212 0.0345 MdfA/Cmr MFS multidrug transporter
codA b0337 1.3776 0.0127 cytosine deaminase
cpsB b2049 0.0143 0.0001 mannose-1-phosphate guanylyltransferase-(GDP)
cpsG b2048 0.0793 0.0000 phosphomannomutase
csgA b1042 0.1297 0.0015 curlin, major subunit
csgB b1041 0.2784 0.0091 curlin, minor subunit precursor
csgD b1040 0.2937 0.0139 CsgD transcriptional activator
csgE b1039 0.4605 0.0168 curli production assembly/transport component
csgG b1037 0.3495 0.0413 curli production component
cspA b3556 2.1715 0.0311 cold shock protein CspA
cspB b1557 0.3823 0.0091 cold shock protein CspB
cspC b1823 0.2854 0.0008 cold shock protein CspC
cspG b0990 0.2179 0.0008 cold shock protein CspG
cspI b1552 0.1377 0.0009 cold shock protein CspI
cycA b4208 0.7201 0.0338 CycA serine/alanine/glycine APC transporter
cyoC b0430 0.6460 0.0438 cytochrome bo terminal oxidase subunit III
cysW b2423 0.6811 0.0088 sulfate ABC transporter
dadX b1190 0.5637 0.0240 alanine racemase, major
dctR b3507 0.4508 0.0475 protein involved in metabolism of C4-dicarboxylates
dcuC b0621 0.4523 0.0022 DcuC dicarboxylate transporter
dcyD b1919 1.4064 0.0091 D-cysteine desulfhydrase monomer
degQ b3234 1.3540 0.0123 serine endoprotease
168

APPENDIX I
gene blattner ratio
A/B
p-value
Function
purine nucleoside phosphorylase / guanosine phosphorylase / deoxyguanosine
phosphorylase / inosine phosphorylase / deoxyinosine phosphorylase / adenine
phosphorylase / deoxyadenosine phosphorylase
deoD b4384 1.5417 0.0073
dgt b0160 0.6156 0.0126 deoxyguanosinetriphosphate triphosphohydrolase
dmsC b0896 1.2108 0.0248 dimethyl sulfoxide reductase, chain C
dnaA b3702 1.5798 0.0490 DnaA-ATP transcriptional dual regulator
dnaG b3066 1.3368 0.0473 DNA biosynthesis; DNA primase
dnaK b0014 0.5937 0.0163 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins
dnaN b3701 1.8832 0.0335 DNA polymerase III, beta-subunit
dnaX b0470 1.3300 0.0296 DNA polymerase III, tau and gamma subunits; DNA elongation factor III
dpiB b0619 0.4224 0.0076 DpiB
dppF b3540 1.1825 0.0280 dipeptide ABC transporter
stationary phase nucleoid protein that sequesters iron and protects DNA from
dps b0812 0.5769 0.0236 damage
dsdX b2365 0.3602 0.0190 DsdX Gnt tranporter
dtd b3887 1.2548 0.0380 D-Tyr-tRNATyr deacylase
elaC b2268 0.6406 0.0465 binuclear zinc phosphodiesterase monomer
emrE b0543 0.4603 0.0035 EmrE SMR transporter
emrK b2368 0.5558 0.0366 EmrK putative membrane fusion protein
emrY b2367 0.1336 0.0000 EmrY putative multidrug MFS transporter
envC b3613 1.5602 0.0371 EnvC murein hydrolase
essQ b1556 4.4414 0.0125 hypothetical protein
eutB b2441 0.7106 0.0143 ethanolamine ammonia-lyase, probable regulatory subunit
eutD b2458 0.4881 0.0053 putative phosphate acetyltransferase, ethanolamine utilization
eutN b2456 0.5116 0.0035 putative detox protein, ethanolamine utilization
GDP-4-dehydro-6-deoxy-D-mannose epimerase / GDP-4-dehydro-6-Ldeoxygalactose
fcl b2052 0.0327 0.0006
reductase
outer membrane receptor; citrate-dependent iron transport, outer membrane
fecA b4291 0.6549 0.0354 receptor
fecB b4290 0.6183 0.0038 ferric dicitrate uptake system
fhlA b2731 1.2443 0.0006 FhlA-Formate transcriptional activator
fhuC b0151 2.0062 0.0140 ferrichrome uptake system
stationary-phase protein with possible role in p-aminobenzoate or folate
fic b3361 1.3138 0.0372 biosynthesis
fimA b4314 0.0526 0.0007 major type 1 subunit fimbrin (pilin)
fimB b4312 0.0776 0.0001 regulator for fimA
fimD b4317 0.3019 0.0243 outer membrane protein; export and assembly of type 1 fimbriae, interrupted
fimE b4313 0.0565 0.0001 regulator for fimA
fimG b4319 0.5755 0.0041 fimbrial morphology
fimI b4315 0.0712 0.0005 fimbrial protein
fixB b0042 0.3451 0.0185 probable flavoprotein subunit required for anaerobic carnitine metabolism
flavoprotein (electron transport), possibly involved in anaerobic carnitine
fixC b0043 0.4760 0.0273 metabolism
flgA b1072 27.1534 0.0010 flagellar biosynthesis; assembly of basal-body periplasmic P ring
flgB b1073 24.5528 0.0038 flagellar basal-body rod protein FlgB
flgC b1074 14.9393 0.0009 flagellar basal-body rod protein FlgC
flgD b1075 16.5742 0.0019 flagellar biosynthesis, initiation of hook assembly
flgE b1076 9.2717 0.0007 flagellar hook protein FlgE
flgF b1077 6.1174 0.0007 flagellar basal-body rod protein FlgF
flgG b1078 21.9901 0.0010 flagellar basal-body rod protein FlgG
flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide
flgH b1079 9.7694 0.0040 layer) ring protein
flgI b1080 15.6181 0.0055 flagellar P-ring protein FlgI
flgJ b1081 6.3428 0.0005 FlgJ
flgK b1082 4.5952 0.0289 flagellar biosynthesis, hook-filament junction protein 1
flgM b1071 28.5501 0.0060 anti-FliA (anti-sigma) factor; also known as RflB protein
flgN b1070 7.0812 0.0008 flagellar biosynthesis protein FlgN
flhA b1879 2.5230 0.0463 flagellar biosynthesis protein FlhA
flhB b1880 10.7222 0.0025 flagellar biosynthesis protein FlhB
169

APPENDIX I
gene blattner ratio p-value Function
A/B
flhE b1878 1.3435 0.0065 flagellar protein
fliA b1922 32.8560 0.0014 sigma28 factor
fliC b1923 10.1921 0.0486 flagellar biosynthesis; flagellin, filament structural protein
fliD b1924 12.4018 0.0338 flagellar cap protein FliD; filament capping protein; enables filament assembly
fliE b1937 18.5368 0.0018 flagellar basal-body protein FliE
fliF b1938 23.8464 0.0001
flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)-
ring and collar protein
fliG b1939 17.5399 0.0006
flagellar motor switch protein FliG; component of motor switching and
energizing, enabling rotation and determining its direction
fliH b1940 18.6885 0.0041 flagellar biosynthesis protein FliH
fliJ b1942 14.2153 0.0015 flagellar biosynthesis protein FliJ
fliK b1943 11.4774 0.0028 flagellar hook-length control protein FliK
fliL b1944 21.9931 0.0024 flagellar biosynthesis
fliM b1945 24.5354 0.0007
flagellar motor switch protein FliM; component of motor switch and energizing,
enabling rotation and determining its direction
fliN b1946 20.1390 0.0021
flagellar motor switch protein FliN; component of motor switch and energizing,
enabling rotation and determining its direction
fliO b1947 6.1100 0.0078 flagellar biosynthesis protein FliO
fliQ b1949 16.8460 0.0006 flagellar biosynthesis protein FliQ
fliR b1950 14.0112 0.0024 flagellar biosynthesis protein FliR
fliS b1925 11.4258 0.0360 flagellar biosynthesis protein FliS
fliY b1920 4.6961 0.0053
periplasmic cystine-binding protein; member of extracellular bacterial solutebinding
protein family III
fliZ b1921 11.3145 0.0013 possible cell-density responsive regulator of sigmaF
folX b2303 0.7774 0.0119 dihydroneopterin triphosphate 2'-epimerase
frvR b3897 1.5713 0.0220 FrvR predicted transcriptional regulator
frwC b3949 1.2134 0.0259 EIIBCFrw
ftnA b1905 0.2411 0.0207 cytoplasmic ferritin, an iron storage protein)
ftnB b1902 0.2538 0.0225 hypothetical protein
ftsB b2748 2.1787 0.0303 essential cell division protein FtsB
ftsK b0890 0.8409 0.0222 essential cell division protein FtsK
ftsY b3464 1.1435 0.0290 SRP receptor
fucI b2802 0.7804 0.0498 L-fucose isomerase
fucU b2804 0.5451 0.0123 cytoplasmic L-fucose binding protein
fumC b1611 0.5797 0.0314 fumarase C monomer
fusA b3340 1.6060 0.0216 elongation factor G
fxsA b4140 0.5479 0.0484 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7
gadA b3517 0.0922 0.0055 glutamate decarboxylase A subunit
gadC b1492 0.1563 0.0066 XasA GABA APC transporter
gadE b3512 0.1055 0.0047 GadE transcriptional activator
gadW b3515 0.4779 0.0095 GadWtranscriptional repressor
galP b2943 0.5043 0.0494 GalP - galactose MFS transporter
galS b2151 0.7119 0.0404 GalS-galactose
garL b3126 0.5428 0.0453 alpha-dehydro-beta-deoxy-D-glucarate aldolase
gatA b2094 0.2319 0.0238 EIIGat
gatC b2092 0.3166 0.0061 EIIGat
gatD b2091 0.3602 0.0414 galactitol-1-phosphate dehydrogenase
gatR_1 b2087 0.6518 0.0330
negative DNA-binding transcriptional regulator of galactitol metabolism, subunit
of GatR transcriptional repressor
glf b2036 0.6716 0.0075 UDP-galactopyranose mutase
glgS b3049 0.5189 0.0061 glycogen biosynthesis, rpoS dependent
glpG b3424 1.5025 0.0339 inner membrane-associated protein of glp regulon
gltF b3214 0.2557 0.0049 regulator of gltBDF operon, induction of Ntr enzymes
glxR b0509 0.4957 0.0241 tartronate semialdehyde reductase 2
gmd b2053 0.0770 0.0082 GDP-mannose 4,6-dehydratase
gmk b3648 1.2627 0.0032 deoxyguanylate kinase / guanylate kinase
gmr b1285 0.6330 0.0116 RNase II modulator
gnd b2029 0.5770 0.0017 6-phosphogluconate dehydrogenase (decarboxylating)
170

APPENDIX I
gene blattner ratio p-value Function
A/B
gnsB b1550 0.3110 0.0035 protein that affects unsaturated fatty acid abundance
gspD b3325 0.5089 0.0206 putative protein secretion protein for export
gspE b3326 0.6419 0.0197 putative protein secretion protein for export
gspG b3328 0.6256 0.0416 putative protein secretion protein for export
gspH b3329 0.1773 0.0015 putative protein secretion protein for export
hcaC b2540 1.4004 0.0273 ferredoxin, 3-phenylpropionate dioxygenase system
hchA b1967 0.4961 0.0197 heat shock protein (Hsp) 31
hcr b0872 0.5809 0.0410 NADH oxidoreductase
hdeA b3510 0.0218 0.0006 acid-resistance protein, possible chaperone
hdeB b3509 0.0715 0.0064 10K-L protein, related to acid resistance protein of Shigella flexneri
hdhA b1619 0.3868 0.0075 7-alpha-hydroxysteroid dehydrogenase
hemA b1210 0.1261 0.0284 glutamyl-tRNA reductase
hha b0460 0.3850 0.0259 haemolysin expression modulating protein
hipA b1507 8.3272 0.0254 HipA transcriptional activator
hlyE b1182 0.0720 0.0009 hemolysin E
hns b1237 9.0470 0.0012 H-NS transcriptional dual regulator
holB b1099 3.2529 0.0455 DNA polymerase III, delta prime subunit
hslR b3400 0.8182 0.0329 heat shock protein Hsp15
htrA b0161 0.3019 0.0256 DegP
htrL b3618 0.3142 0.0055 involved in lipopolysaccharide biosynthesis
hybB b2995 0.6320 0.0450 probable cytochrome Ni/Fe component of hydrogenase-2
icdA b1136 0.6386 0.0068 Icd
idnK b4268 0.6017 0.0247 gluconokinase II
idnO b4266 0.5978 0.0248 5-keto-D-gluconate 5-reductase / putative acetoin dehydrogenase
inaA b2237 2.1979 0.0462 pH-inducible protein involved in stress response
intF b0281 1.8823 0.0476 putative phage integrase
intG b1936 0.3321 0.0004 hypothetical protein
intR b1345 0.5389 0.0226 putative transposase
katE b1732 0.5629 0.0051 hydroperoxidase II
kbl b3617 0.5504 0.0248 2-amino-3-ketobutyrate CoA ligase
kduD b2842 1.1891 0.0386 2-deoxy-D-gluconate 3-dehydrogenase
kduI b2843 0.6885 0.0274 homolog of pectin degrading enzyme 5-keto 4-deoxyuronate isomerase
leuO b0076 0.3307 0.0226 LeuO transcriptional activator
lit b1139 0.4834 0.0364 Lit, cell death peptidase; phage exclusion; e14 prophage
lon b0439 0.6940 0.0326 DNA-binding, ATP-dependent protease La
lysS b2890 1.2168 0.0189 lysyl tRNA synthetase (LysRSs), constitutive
maa b0459 0.5169 0.0308 maltose acetyltransferase
malP b3417 2.3538 0.0003 maltodextrin phosphorylase monomer
malZ b0403 0.5110 0.0173 maltodextrin glucosidase
mcrA b1159 0.6575 0.0372 restriction of DNA at 5-methylcytosine residues
mcrB b4346 0.5308 0.0084 MrcB subunit of 5-methylcytosine restriction system
mcrC b4345 0.4781 0.0069 MrcC subunit of 5-methylcytosine restriction system
mdoC b1047 0.5105 0.0193 protein required for succinyl modification of osmoregulated periplasmic glucans
mdoG b1048 0.6617 0.0179 periplasmic glucan (MDO) biosynthesis protein
mdtD b2077 0.2947 0.0001 YegB
mdtM b4337 0.2035 0.0056 YjiO drug MFS transporter
mdtP b4080 0.6347 0.0466 putative enzyme
metE b3829 0.7137 0.0147 Cobalamin-independent homocysteine transmethylase
mhpD b0350 1.7196 0.0017 2-keto-4-pentenoate hydratase
moaE b0785 1.1425 0.0282 molybdopterin synthase large subunit
mokC b0018 0.5463 0.0278 regulatory peptide whose translation enables hokC (gef) expression
motB b1889 31.7966 0.0090
MotB protein, enables flagellar motor rotation, linking torque machinery to cell
wall
mqo b2210 1.3940 0.0142 malate dehydrogenase
msbA b0914 1.4206 0.0411 ATP-binding transport protein; multicopy suppressor of htrB
mtr b3161 0.5406 0.0232 Mtr tryptophan ArAAP transporter
murB b3972 1.3239 0.0246 UDP-N-acetylmuramate dehydrogenase
171

APPENDIX I
gene blattner ratio p-value Function
A/B
mutS b2733 1.7394 0.0434 MutHLS complex, methyl-directed mismatch repair
mviN b1069 6.8399 0.0383 putative virulence factor
nagA b0677 1.4358 0.0326 N-acetylglucosamine-6-phosphate deacetylase
nanA b3225 1.4721 0.0000 N-acetylneuraminate lyase
nanC b4311 0.1875 0.0025 conserved hypothetical protein
narV b1465 10.0792 0.0064 nitrate reductase Z, &gamma; subunit
ndk b2518 0.5474 0.0389
nucleoside diphosphate kinase / UDP kinase / CDP kinase / dUDP kinase / dCDP
kinase / dTDP kinase / dADP kinase / dGDP kinase / GDP kinase
nmpC b0553 0.1597 0.0178 outer membrane porin protein; locus of qsr prophage
nrdH b2673 1.9330 0.0215 glutaredoxin-like protein; hydrogen donor
nrfB b4071 0.7562 0.0150 nitrite reductase complex
nudD b2051 0.0081 0.0000 GDP-mannose mannosyl hydrolase
ompF b0929 4.4090 0.0048 outer membrane porin OmpF
ompL b3875 0.4607 0.0424 OmpL
oppC b1245 0.4030 0.0434 oligopeptide ABC transporter
osmB b1283 0.1157 0.0062 OsmB osmotically inducible lipoprotein
osmC b1482 0.2146 0.0012 osmotically inducible peroxidase OsmC
otsA b1896 0.4210 0.0107 trehalose-6-phosphate synthase
paaB b1389 0.4994 0.0344 putative subunit of phenylacetate-CoA oxygenase
paaI b1396 8.7551 0.0044 hypothetical protein with some similarity to thioesterases
pagP b0622 0.2253 0.0082 PagP monomer
parE b3030 1.4510 0.0027 Topoisomerase IV subunit B
pdxA b0052 0.8447 0.0010 PdxA dehydrogenase/decarboxylase
pflB b0903 0.5179 0.0369 pyruvate formate-lyase (inactive)
pflD b3951 0.7011 0.0477 formate acetyltransferase 2
pgaC b1022 0.4106 0.0015 predicted N-glycosyltransferase
pgaD b1021 0.3002 0.0038 putative inner membrane protein
pheM b1715 0.5171 0.0303 phenylalanyl-tRNA synthetase (pheST) operon leader peptide
pinR b1374 0.1294 0.0012 putative transposon resolvase
pitB b2987 0.4130 0.0274 PitB
plsB b4041 1.4149 0.0072 glycerol-3-phosphate acyltransferase
pmrF b2254 0.1668 0.0000 undecaprenyl phosphate-L-Ara4FN transferase
polB b0060 1.4392 0.0465 DNA polymerase II
potC b1124 0.7024 0.0321 putrescine/spermidine ABC transporter
poxA b4155 0.5601 0.0149 putative regulator of pyruvate oxidase
pphB b2734 0.2574 0.0011
protein phosphatase 2 / protein-tyrosine-phosphatase / phosphoprotein
phosphatase
pptA b1461 0.4035 0.0291 probable 4-oxalocrotonate tautomerase (4-OT) monomer
pqqL b1494 0.3738 0.0359 putative zinc peptidase
prfA b1211 6.2321 0.0253 peptide chain release factor RF-1
prfH b0236 0.4740 0.0086 probable peptide chain release factor
ptrB b1845 0.6002 0.0443 protease II
purC b2476 1.2969 0.0425 phosphoribosylaminoimidazole-succinocarboxamide synthase
puuR b1299 8.2529 0.0016 putative oxidoreductase/putative regulator
pyrE b3642 0.5836 0.0304 orotate phosphoribosyltransferase
rarD b3819 0.3373 0.0007 hypothetical protein
rbfA b3167 1.2320 0.0250 ribosome-binding factor A
rbsD b3748 0.3624 0.0037 D-ribose utilization
rcsA b1951 0.2865 0.0016
positive DNA-binding transcriptional regulator of capsular polysaccharide
synthesis, activates its own expression
recT b1349 0.2404 0.0026 recombinase, DNA renaturation
rfbA b2039 0.6165 0.0268 dTDP-glucose pyrophosphorylase
rfbB b2041 0.5623 0.0045 RmlB
rfbC b2038 0.5770 0.0462 dTDP-4-dehydrorhamnose 3,5-epimerase
rfbX b2037 0.5272 0.0173 RfbX lipopolysaccharide PST transporter
rfc b2035 0.5906 0.0455 O-antigen polymerase
rhsA b3593 0.4056 0.0183 RhsA protein in rhs element
172

APPENDIX I
gene blattner ratio p-value Function
A/B
rhsD b0497 0.1818 0.0162 RhsD protein in rhs element
rihB b2162 0.4616 0.0135 ribonuceloside hydrolase 2 (pyrimidine-specific)
rluC b1086 0.7606 0.0060 23S rRNA pseudouridine synthase
rmuC b3832 1.5317 0.0486 conserved protein
rplM b3231 1.1735 0.0393 50S ribosomal subunit protein L13
rpmG b3636 1.3762 0.0233 50S ribosomal subunit protein L33
rpoA b3295 1.7007 0.0053 RNA polymerase, alpha subunit
rpsO b3165 1.2800 0.0383 30S ribosomal subunit protein S15
rseA b2572 0.6762 0.0264 anti-sigma factor that inhibits sigmaE
rseB b2571 0.5923 0.0358
negative regulator of sigmaE; interacts with RseA and stimulates binding of RseA
to sigmaE
rstA b1608 0.4644 0.0241 RstA- Phosphorylated transcriptional regulator
rsxB b1628 0.8140 0.0337 member of SoxR-reducing complex
rsxD b1630 0.8446 0.0469 integral membrane protein of SoxR-reducing complex
ruvA b1861 0.7247 0.0021 branch migration of Holliday structures; repair
sbmA b0377 1.2804 0.0236 SbmA
sdhA b0723 0.5308 0.0031 succinate dehydrogenase flavoprotein
sdhB b0724 0.6045 0.0340 succinate dehydrogenase iron-sulfur protein
sfmC b0531 0.6341 0.0140 putative chaperone
sfsA b0146 0.7060 0.0346 SfsA
sgbU b3582 0.3459 0.0092 probable 3-hexulose-6-phosphate isomerase
shiA b1981 0.3567 0.0076 ShiA shikimate MFS transporter
skp b0178 1.0703 0.0483 periplasmic chaperone
slp b3506 0.4891 0.0409 outer membrane protein induced after carbon starvation
slyA b1642 0.5661 0.0360 SlyA transcriptional activator
speD b0120 0.6822 0.0032 adenosylmethionine decarboxylase, proenzyme
stpA b2669 0.1356 0.0074 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing?
tatA b3836 1.3939 0.0306 TatA
tatD b4483 1.7888 0.0417 magnesium-dependent DNase
tauA b0365 0.5600 0.0404 TauA/TauB/TauC ABC transporter
tauB b0366 0.6178 0.0194 TauA/TauB/TauC ABC transporter
tdcB b3117 0.2584 0.0065 threonine dehydratase (catabolic)
tdcC b3116 0.2341 0.0055 TdcC threonine STP transporter
tdcD b3115 0.4677 0.0419 propionate kinase / acetate kinase C
tdcF b3113 0.2775 0.0099 hypothetical protein
tdk b1238 0.3639 0.0022 thymidine kinase / deoxyuridine kinase
tnaA b3708 0.1418 0.0152 L-cysteine desulfhydrase / tryptophanase
tolA b0739 0.8478 0.0322 Tol-Pal Cell Envelope Complex
torS b0993 2.0482 0.0380 TorS-Phis850
torY b1873 0.2576 0.0198 trimethylamine N-oxide reductase III, c-type cytochrome subunit
torZ b1872 0.3923 0.0120 trimethylamine N-oxide reductase III, TorZ subunit
treB b4240 25.0943 0.0439 EIITre
treC b4239 7.6034 0.0357 trehalose-6-phosphate hydrolase
trmA b3965 1.5449 0.0177 tRNA (uracil-5-)-methyltransferase
trmH b3651 1.5347 0.0249 tRNA (Gm18) 2'-O-methyltransferase
ubiG b2232 1.1103 0.0475
3-demethylubiquinone 3-methyltransferase / 2-octaprenyl-6-hydroxyphenol
methylase
ugd b2028 0.0650 0.0009 UDP-glucose 6-dehydrogenase
ulaA b4193 1.5705 0.0194 eiisga
ulaR b4191 0.7810 0.0103 putative DeoR-type transcriptional regulator
uppP b3057 0.5663 0.0449 undecaprenyl diphosphatase; bacitracin resistance
uspD b3923 0.4337 0.0346 stress protein involved in resistance to UV irradiation
uvrC b1913 0.4947 0.0149 excinuclease ABC, subunit C; repair of UV damage to DNA
uxaA b3091 0.7147 0.0481 altronate dehydratase
vsr b1960 0.7256 0.0064
DNA mismatch endonuclease of the very short patch (VSP) mismatch repair
pathway
wbbI b2034 0.6317 0.0228 hypothetical protein; not required for colanic acid biosynthesis
173

APPENDIX I
gene blattner ratio p-value Function
A/B
wbbJ b2033 0.6009 0.0130 putative transferase
wcaA b2059 0.1328 0.0082 putative regulator
wcaB b2058 0.0815 0.0015 putative transferase
wcaC b2057 0.1000 0.0029 putative glycosyl transferase
wcaD b2056 0.0149 0.0002 putative colanic acid polymerase
wcaE b2055 0.0409 0.0011 putative colanic acid biosynthesis glycosyl transferase
wcaF b2054 0.0262 0.0002 putative transferase
wcaI b2050 0.3118 0.0133 putative colanic biosynthesis glycosyl transferase
wcaJ b2047 0.1255 0.0000 putative colanic acid biosynthsis UDP-glucose lipid carrier transferase
wcaK b2045 0.1130 0.0074 putative galactokinase (EC 2.7.1.6).
wcaL b2044 0.0764 0.0036 putative colanic biosynthesis glycosyl transferase
wcaM b2043 0.0293 0.0005 hypothetical protein
wza b2062 0.1207 0.0140
Wza Outer Membrane Auxiliary (OMA) Protein, putative polysaccharide export
protein
wzb b2061 0.3249 0.0468 tyrosine phosphatase
wzc b2060 0.1280 0.0091 tyrosine kinase involved in colanic acid biosynthesis
wzxC b2046 0.2888 0.0079 WzxC
wzxE b3792 1.5446 0.0476
metabolism; biosynthesis of macromolecules (cellular constituents);
enterobacterial common antigen (surface glycolipid) transport
xapB b2406 0.4569 0.0141 XapB xanthosine MFS transporter
xapR b2405 0.3765 0.0027 XapR transcriptional activator
yaaW b0011 3.2924 0.0115 HtgA transcriptional regulator
yacH b0117 0.8161 0.0238 putative membrane protein
yadC b0135 0.4099 0.0206 putative fimbrial-like protein
yadL b0137 0.2631 0.0178 putative adhesin-like protein
yadN b0141 0.6154 0.0468 putative fimbrial-like protein
yafT b0217 0.2068 0.0031 putative aminopeptidase
yagL b0278 0.0609 0.0012 DNA-binding protein
yagM b0279 0.3618 0.0281 hypothetical protein
yagU b0287 0.5429 0.0268 conserved protein
yagW b0290 0.1221 0.0006 putative receptor
yagX b0291 0.1265 0.0029 putative enzyme
yagZ b0293 0.0142 0.0005 conserved hypothetical protein
yahA b0315 0.3523 0.0129 hypothetical protein
yahB b0316 0.6555 0.0219 putative transcriptional regulator LYSR-type
yahI b0323 0.5829 0.0393 putative carbamate kinase
yaiB b0382 0.4839 0.0452 conserved hypothetical protein
yaiP b0363 0.2167 0.0005 polysaccharide metabolism
ybaJ b0461 0.2263 0.0008 conserved hypothetical protein
ybaT b0486 1.5467 0.0361 YbaT APC transporter
ybaX b0444 1.3088 0.0297
hypothetical protein with similarity to the ALU1-P aluminum tolerance protein of
Arthrobacter viscosus
ybbD b0500 0.3711 0.0158 conserved hypothetical protein
ybbJ b0488 0.4127 0.0062 conserved protein
ybbW b0511 0.1329 0.0228 YbbW NCS1 Transporter
ybcC b0539 0.6619 0.0153 putative exonuclease (EC 3.1.11.3) of lambda
ybcK b0544 0.2294 0.0058 hypothetical protein
ybcL b0545 0.2269 0.0037 possible kinase regulator
ybcM b0546 0.1406 0.0048 putative ARAC-type regulatory protein
ybcW b0559 0.4816 0.0023 hypothetical protein
ybdG b0577 0.5895 0.0193 putative transport protein
ybdJ b0580 0.5837 0.0492 conserved hypothetical protein
ybdM b0601 0.8195 0.0493 conserved protein
ybdO b0603 0.2801 0.0308 putative transcriptional regulator LYSR-type
ybeZ b0660 0.6636 0.0464 putative ATP-binding protein
ybfD b0706 0.1079 0.0006 conserved protein
ybfG b0690 0.4707 0.0244 conserved hypothetical protein
174

APPENDIX I
gene blattner ratio p-value Function
A/B
ybfH b0691 0.3421 0.0007 conserved hypothetical protein
ybhM b0787 0.3888 0.0098 hypothetical protein
ybjC b0850 0.7170 0.0462 conserved hypothetical protein; gene is within soxRS regulon
ybjG b0841 0.2116 0.0107 putative permease
ybjJ b0845 3.1930 0.0116 putative DEOR-type transcriptional regulator
ybjL b0847 0.3923 0.0043 putative transport protein
ybjN b0853 0.8482 0.0409 putative sensory transduction regulator
ycaN b0900 0.5581 0.0284 putative transcriptional regulator LYSR-type
ycbQ b0938 0.0713 0.0025 putative fimbrial-like protein
ycbR b0939 0.1824 0.0184 putative chaperone
ycbS b0940 0.1652 0.0073 putative outer membrane protein
yccE b1001 0.4529 0.0130 putative hemoglobin-binding protein
yccM b0992 0.6335 0.0164 hypothetical protein
ycdN b1016 1.6654 0.0122 hypothetical protein of the OFeT transport family
ycdU b1029 0.1999 0.0116 putative enzyme
yceI b1056 0.2268 0.0001 periplasmic protein; possibly secreted
yceJ b1057 0.1945 0.0009 putative cytochrome
yceP b1060 0.3901 0.0267 conserved hypothetical protein
ycgH_1 b1169 0.1993 0.0039 conserved protein; member of the Autotransporter family
ycgH_2 b1170 0.4386 0.0046 conserved protein; member of the Autotransporter family
ycgV b1202 0.3109 0.0415 putative adhesion and penetration protein
ycgX b1161 0.7611 0.0359 hypothetical protein
ycgZ b1164 0.5664 0.0112 hypothetical protein
yciA b1253 11.0540 0.0002 putative enzyme
yciE b1257 0.3808 0.0301 conserved protein
yciF b1258 0.1428 0.0003 conserved protein
yciQ b1268 5.5117 0.0014 putative membrane protein
ycjO b1311 8.6194 0.0110 YcjN/YcjO/YcjP ABC transporter
ycjQ b1313 0.2968 0.0286 putative oxidoreductase
ydaL b1340 0.6179 0.0096 hypothetical protein
ydaT b1358 0.7086 0.0152 hypothetical protein
ydaY b1366 0.4876 0.0346 hypothetical protein
ydbA_2 b1405 0.4749 0.0312 hypothetical protein product of fragment 2 of a split CDS
ydcC b1460 0.1497 0.0021 conserved protein, similar to H-repeat associated proteins
ydcD b1457 0.5139 0.0497 hypothetical protein
ydcR b1439 5.6513 0.0349
multi modular; putative transcriptional regulator ; also putative ATP-binding
component of a transport system
ydcX b1445 3.8934 0.0011 hypothetical protein
yddB b1495 7.9254 0.0046 conserved protein
yddH b1462 11.8388 0.0095 putative enzyme
yddJ b1470 1.7194 0.0428 hypothetical protein
yddK b1471 0.7743 0.0210 putative glycoportein
yddV b1490 0.4278 0.0017 conserved protein
ydeH b1535 0.3768 0.0061 hypothetical protein
ydeI b1536 0.0747 0.0002 conserved hypothetical protein
ydeK b1510 0.4789 0.0370 YdeK
ydeO b1499 0.0998 0.0062 putative ARAC-type regulatory protein
ydeP b1501 0.1115 0.0201 acid resistance protein
ydeQ b1502 0.2304 0.0123 putative adhesin; similar to FimH protein
ydeR b1503 7.3709 0.0202 putative fimbrial-like protein
ydeS b1504 0.3919 0.0199 putative fimbrial-like protein
ydfJ b1543 42.4461 0.0301 YdfJ
ydfO b1549 0.5234 0.0174 hypothetical protein
ydfV b1565 0.7286 0.0417 hypothetical protein
YdgE b1599 0.2334 0.0201 YdgE SMR Protein
YdgF b1600 0.0826 0.0007 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydiA b1703 0.2332 0.0171 conserved protein
175

APPENDIX I
gene blattner ratio p-value Function
A/B
ydiB b1692 0.4286 0.0109 shikimate dehydrogenase
ydiF b1694 0.3148 0.0286 putative enzyme / putative acetate CoA-transferase
ydiO b1695 0.4529 0.0403 putative acyl-CoA dehydrogenase
ydiR b1698 1.8775 0.0115 putative subunit of YdiQ-YdiR flavoprotein
ydjH b1772 0.4958 0.0014 putative kinase
ydjI b1773 0.2754 0.0004 putative aldolase
ydjJ b1774 0.1765 0.0009 putative oxidoreductase
yeaE b1781 0.4708 0.0318 putative oxidoreductase, NAD(P)-linked
yeaJ b1786 0.4275 0.0188 putative membrane protein
yebN b1821 0.3622 0.0207 putative membrane protein, terpenoid synthase-like
yebQ b1828 3.1669 0.0052 YebQ
yecD b1867 0.4967 0.0298 putative enzyme
yecR b1904 18.6699 0.0070 conserved hypothetical protein
yecT b1877 0.3511 0.0159 hypothetical protein
yedK b1931 1.3670 0.0277 conserved hypothetical protein
yedM b1935 2.1595 0.0289 hypothetical protein
yedN_2 b1933 0.5833 0.0372 hypothetical protein
yedS_1 b1964 0.4832 0.0090 putative outer membrane protein
yedS_2 b1965 0.1868 0.0002 putative outer membrane protein
yedS_3 b1966 0.0869 0.0022 putative outer membrane protein
yedV b1968 0.3589 0.0025 putative 2-component sensor protein
yedW b1969 0.3706 0.0275 putative 2-component transcriptional response regulator
yeeE b2013 0.7926 0.0476 putative transport system permease protein
yeeN b1983 0.5430 0.0021 conserved protein
yeeW b2006 0.7709 0.0145 hypothetical protein
yegI b2070 0.3095 0.0072 putative chaperonin
yegJ b2071 0.2268 0.0018 hypothetical protein
yegR b2085 0.1713 0.0037 hypothetical protein
yegS b2086 0.2875 0.0021 conserved protein
yegW b2101 0.7504 0.0332 putative transcriptional regulator
yegZ b2083 0.2051 0.0136 hypothetical protein
yehL b2119 0.1192 0.0005 putative transport protein (ABC superfamily, atp_bind)
yehM b2120 0.2962 0.0436 conserved hypothetical protein
yehX b2129 1.5433 0.0241 YehW/YehX/YehY/YehZ ABC transporter
yeiG b2154 0.6806 0.0088 putative esterase (EC 3.1.1.-).
yeiH b2158 0.6070 0.0478 putative membrane protein
yeiT b2146 0.5692 0.0283 putative dihydrothymine dehydrogenase
yfaO b2251 0.3555 0.0129 putative enzyme (Nudix hydrolase)
yfaQ b2226 0.6289 0.0473 conserved protein
yfaS_1 b2228 0.4905 0.0091 putative membrane protein
yfaU b2245 0.3551 0.0071 protein with similarity to HHED aldolases
yfbB b2263 1.5292 0.0311 putative enzyme
yfbE b2253 0.4484 0.0060 UDP-L-Ara4O C-4" transaminase
yfbP b2275 0.5151 0.0301 hypothetical protein
yfdP b2359 0.5750 0.0474 hypothetical protein
yfdU b2373 0.4607 0.0057 putative enzyme
yffB b2471 0.3324 0.0071 conserved thioredoxin-like protein
yfgH b2505 0.4115 0.0103 putative outer membrane lipoprotein
yfhK b2556 1.8314 0.0452 putative 2-component sensor protein
yfiB b2605 0.6217 0.0406 putative outer membrane protein
yfiC b2575 0.7187 0.0190 putative enzyme
yfiP b2583 1.3837 0.0071 conserved hypothetical protein
yfiR b2603 0.3222 0.0010 conserved protein
yfjK b2627 0.3419 0.0029 hypothetical protein
yfjL b2628 0.3105 0.0061 hypothetical protein
yfjO b2631 0.3841 0.0077 hypothetical protein
176

APPENDIX I
gene blattner ratio p-value Function
A/B
ygbT b2755 0.1586 0.0012 conserved hypothetical protein
ygcG b2778 0.4150 0.0418 putative membrane protein
ygcI b2757 0.0266 0.0000 hypothetical protein
ygcJ b2758 0.4687 0.0197 conserved hypothetical protein
ygcK b2759 0.0180 0.0001 hypothetical protein
ygcL b2760 0.1023 0.0021
hypothetical protein with possible relationship to novobiocin and deoxycholate
resistance
ygdR b2833 0.4092 0.0084 conserved hypothetical protein
ygeQ b2863 0.6468 0.0449 hypothetical protein
ygeW b2870 0.5789 0.0021 putative carbamoyl transferase
yghJ b2973 0.4626 0.0310 predicted inner membrane lipoprotein
yghR b2984 1.2529 0.0320 conserved protein
ygiL b3043 0.0354 0.0001 putative fimbrial-like protein
ygjD b3064 1.4330 0.0151 putative O-sialoglycoprotein endopeptidase
yhaB b3120 0.6588 0.0079 conserved protein
yhcH b3221 1.4678 0.0226 conserved hypothetical protein; gene is in sialic acid catabolic operon
yhdH b3253 1.5233 0.0446 putative dehydrogenase
yhfK b3358 0.7711 0.0070 hypothetical protein
yhfL b3369 0.1799 0.0003 hypothetical protein
yhhI b3484 0.1140 0.0042 conserved protein similar to H-repeat-associated proteins
yhiK b3489 0.5909 0.0164 hypothetical protein
yhjB b3520 0.6632 0.0240 putative regulator
yhjH b3525 15.5314 0.0446 protein involved in flagellar function
yhjR b3535 0.3106 0.0149 hypothetical protein
yiaA b3562 0.3589 0.0101 hypothetical protein
yiaJ b3574 1.4560 0.0188 YiaJ transcriptional repressor
yiaN b3578 0.5883 0.0029 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter
yiaT b3584 0.3441 0.0061 putative outer membrane protein
yiaU b3585 0.3785 0.0049 putative transcriptional regulator LYSR-type
yiaV b3586 0.5890 0.0043 putative membrane protein
yiaW b3587 0.2799 0.0038 hypothetical protein
yibA b3594 0.1903 0.0047 putative lyase
yibJ b3595 0.2186 0.0238 hypothetical protein
yieL b3719 0.5420 0.0231 putative xylanase
yigF b3817 0.2284 0.0094 conserved hypothetical protein
yigZ b3848 1.3342 0.0497 putative elongation factor
yihN b3874 0.4333 0.0156 YihN MFS transporter
yihO b3876 0.6279 0.0411 YihO GPH transporter
yihQ b3878 0.6251 0.0380 putative glycosidase
yiiG b3896 0.2402 0.0073 conserved protein
yiiS b3922 0.2364 0.0157 conserved hypothetical protein
yiiU b3928 1.3852 0.0299 conserved hypothetical protein
yjbE b4026 0.0840 0.0029 conserved hypothetical protein
yjbM b4048 0.4310 0.0137 conserved hypothetical protein
yjeB b4178 1.6962 0.0415 conserved protein with a Winged helix domain
yjeJ b4145 0.3840 0.0307 conserved protein
yjeM b4156 0.2229 0.0057 YjeM APC transporter
yjeN b4157 0.3408 0.0038 conserved hypothetical protein
yjfJ b4182 0.6175 0.0334 conserved protein
yjfK b4183 0.4529 0.0043 conserved hypothetical protein
yjfL b4184 0.5766 0.0073 hypothetical protein
yjfN b4188 1.3712 0.0202 conserved hypothetical protein
yjfZ b4204 0.3394 0.0322 hypothetical protein
yjgM b4256 0.4628 0.0240 putative acyltransferase
yjgN b4257 0.5071 0.0145 putative membrane protein possible involved in transport
yjhB b4279 0.3122 0.0246 YjhB MFS transporter
yjhC b4280 0.3612 0.0064 KpLE2 phage-like element; putative NAD(P)-binding dehydrogenase
177

APPENDIX I
gene blattner ratio p-value Function
A/B
yjhF b4296 0.1057 0.0123 YjhF Gnt tranporter
yjhG b4297 0.3226 0.0116 putative dehydratase
yjhH b4298 0.0468 0.0002 putative lyase/synthase
yjhI b4299 0.1141 0.0053 putative regulator
yjhP b4306 0.5874 0.0178 putative methyltransferase
yjiW b4347 0.2530 0.0215 hypothetical protein
ykgA b0300 0.5109 0.0205 putative ARAC-type regulatory protein
ykgB b0301 0.2477 0.0014 putative membrane protein
ykgF b0307 0.2214 0.0430 putative dehydrogenase
ykgH b0310 0.3306 0.0076 conserved protein
ykgI b0303 0.0848 0.0003 hypothetical protein
ykiA b0392 0.3451 0.0025 hypothetical protein
ylbA b0515 0.4807 0.0467 conserved hypothetical protein
yliF b0834 0.7291 0.0466 conserved protein
ymcC b0986 0.5145 0.0239 putative synthetase, lipoprotein, and/or outer membrane porin
ymfE b1138 0.1606 0.0015 hypothetical protein
ymfK b1145 1.3071 0.0271 putative phage repressor
ymgA b1165 0.3510 0.0002 hypothetical protein
ymgB b1166 0.2729 0.0002 hypothetical protein
ymgD b1171 0.1185 0.0000 hypothetical protein
ynaE b1375 0.1056 0.0000 hypothetical protein
ynaI b1330 0.5331 0.0212 YnaI
ynaK b1365 0.2104 0.0022 hypothetical protein
ynbB b1409 9.4657 0.0003 putative phosphatidate cytidiltransferase
ynbD b1411 8.0957 0.0101 putative enzyme
yncD b1451 7.7140 0.0189 Probable TonB-dependent receptor
yncH b1455 0.6158 0.0168 hypothetical protein
yncI b1458 0.0504 0.0048 conserved protein
yneG b1523 1.4493 0.0097 conserved hypothetical protein
yneK b1527 0.7595 0.0440 conserved protein
ynfC b1585 0.6339 0.0385 YnfC lipoprotein
ynfN b1551 0.1481 0.0169 hypothetical protein
ynjI b1762 0.5647 0.0434 conserved protein
yoaC b1810 0.5527 0.0163 conserved hypothetical protein
yobF b1824 0.2638 0.0011 hypothetical protein
yodA b1973 0.4038 0.0074 cadmium-induced metal binding protein
yodB b1974 0.6011 0.0076 putative cytochrome
ypdE b2384 0.1729 0.0092 putative endoglucanase
yphE b2547 0.7172 0.0119 YphD/YphE/YphF ABC transporter
yqeA b2874 0.7065 0.0379 putative carbamate kinase
yqeI b2847 0.5345 0.0347 putative sensory transducer
yqeJ b2848 0.5636 0.0205 conserved hypothetical protein
yqgF b2949 2.0009 0.0211 possible Holliday junction resolvase
yqiH b3047 0.4868 0.0245 putative membrane protein
yqiJ b3050 0.3830 0.0118 putative oxidoreductase
yqjK b3100 0.7262 0.0339 conserved hypothetical protein
yraH b3142 0.2087 0.0035 putative fimbrial-like protein
yraI b3143 0.2992 0.0267 putative chaperone
ytfT b4230 1.3375 0.0312 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter
znuB b1859 0.7309 0.0475 ZnuA/ZnuB/ZnuC ABC transporter
b0322 0.7535 0.0039
178

APPENDIX I
Supplementary table – XIII: LZ54 wild-type (A) Vs LZ54 hns-205::Tn10 (B)
gene blattner ratio p-value Function
A/B
acrA b0463 8.3277 0.0131 AcrA Membrane Fusion Protein
acrE b3265 0.1011 0.0148 transmembrane protein affects septum formation and cell membrane permeability
acrF b3266 0.2552 0.0263 AcrEF-TolC Drug Efflux Transport System
add b1623 1.4042 0.0098 deoxyadenosine deaminase / adenosine deaminase
ade b3665 0.0660 0.0072 cryptic adenine deaminase monomer
adiY b4116 0.0713 0.0172 AdiY transcriptional activator
ais b2252 0.1177 0.0011 protein induced by aluminum
allC b0516 0.3939 0.0128 allantoate amidohydrolase
alsI b4090 0.7750 0.0194 allose-6-phosphate isomerase / ribose-5-phosphate isomerase B
alsK b4084 2.5002 0.0286 putative D-allose kinase
amiC b2817 1.7337 0.0146 N-acetylmuramyl-L-alanine amidase
arsR b3501 1.4310 0.0291 ArsR transcriptional regulator
atoS b2219 0.6377 0.0248 AtoS-Phis
b0309 b0309 0.4289 0.0345 hypothetical protein
b0501 b0501 0.2721 0.0205 hypothetical protein
b1172 b1172 0.1161 0.0024 conserved hypothetical protein
b1354 b1354 0.2405 0.0296 hypothetical protein
b1578 b1578 0.6068 0.0497 hypothetical protein
b1903 b1903 0.3571 0.0463 hypothetical protein
b2084 b2084 0.2100 0.0429 hypothetical protein
b2680 b2680 1.5403 0.0320 YgaY MFS transporter
b3044 b3044 0.5660 0.0243 IS21 protein
basS b4112 0.6845 0.0066 BasS-Phis
bcsF b3537 0.4067 0.0472 hypothetical protein
bdm b1481 0.1582 0.0096 hypothetical protein
betA b0311 2.0313 0.0247 choline dehydrogenase
betB b0312 2.1260 0.0391 betaine aldehyde dehydrogenase
betI b0313 3.1436 0.0193 BetI-choline
bglJ b4366 0.3117 0.0457 BglJ transcriptional regulator
borD b0557 0.2556 0.0172 bacteriophage lambda Bor protein homolog
cadA b4131 0.4549 0.0121 lysine decarboxylase
caiA b0039 1.3966 0.0108 crotonobetaine reductase
cdd b2143 0.6686 0.0274 cytidine deaminase
chbB b1738 1.5210 0.0330 EIIChb
chbR b1735 0.3341 0.0058 ChbR transcriptional regulator
chpB b4225 0.7179 0.0459 ChpB transcriptional regulator
citE b0616 1.9938 0.0234 subunit of citryl-ACP lyase
cmtA b2933 0.4295 0.0164 EIIABCmt
cpsB b2049 0.2756 0.0341 mannose-1-phosphate guanylyltransferase-(GDP)
creC b4399 0.7339 0.0442 CreC-Phis
creD b4400 0.6783 0.0283 tolerance to colicin E2
csgD b1040 0.1783 0.0088 CsgD transcriptional activator
csgE b1039 0.2969 0.0355 curli production assembly/transport component
cspA b3556 1.4925 0.0396 cold shock protein CspA
cspC b1823 0.3803 0.0208 cold shock protein CspC
cspI b1552 0.1418 0.0099 cold shock protein CspI
cstA b0598 1.7226 0.0068 peptide transporter induced by carbon starvation
cynT b0339 1.4406 0.0420 carbonate dehydratase monomer
cytR b3934 0.4811 0.0258 CytR-cytidine
dacA b0632 1.4499 0.0371 D-alanyl-D-alanine carboxypeptidase, fraction A; penicillin-binding protein 5
damX b3388 1.5321 0.0329 putative membrane protein
dapE b2472 0.5982 0.0184 N-succinyl-L-diaminopimelate desuccinylase subunit
dcm b1961 1.6163 0.0045 DNA cytosine methylase
dcuR b4124 0.5341 0.0130 DcuR-Pasp56
179

APPENDIX I
gene blattner ratio p-value Function
A/B
dcuS b4125 0.5773 0.0341 DcuS-Phis349
djlB b0646 1.2276 0.0139 putative chaperone
dnaE b0184 1.5214 0.0034 DNA polymerase III, alpha subunit
dnaK b0014 0.4911 0.0367 chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins
dpiB b0619 0.4548 0.0076 DpiB
emrE b0543 0.6713 0.0308 EmrE SMR transporter
emrY b2367 0.2312 0.0466 EmrY putative multidrug MFS transporter
entA b0596 2.3095 0.0058 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase
envR b3264 0.5029 0.0145 EnvR transcriptional regulator
essQ b1556 4.5609 0.0352 hypothetical protein
eutN b2456 0.6705 0.0289 putative detox protein, ethanolamine utilization
evgA b2369 0.2767 0.0265 EvgA-Phosphorylated transcriptional regulator
evgS b2370 0.4198 0.0441 EvgS-Phis
fabB b2323 0.8572 0.0316 beta-ketoacyl-ACP synthase I / malonyl-ACP decarboxylase
fabR b3963 1.6568 0.0385 FabR transcriptional repressor
fbp b4232 0.7673 0.0093 fructose 1,6 bisphosphatase monomer
fecR b4292 4.8729 0.0414 regulator for fec operon, periplasmic
fepE b0587 0.2112 0.0281 ferric enterobactin (enterochelin) transport
fhuA b0150 2.6610 0.0397
FhuA outer membrane protein receptor for ferrichrome, colicin M, and phages T1,
T5, and phi80
fhuC b0151 2.1677 0.0270 ferrichrome uptake system
fimA b4314 0.1075 0.0169 major type 1 subunit fimbrin (pilin)
fimB b4312 0.0623 0.0004 regulator for fimA
fimD b4317 0.6323 0.0042 outer membrane protein; export and assembly of type 1 fimbriae, interrupted
fimE b4313 0.0983 0.0165 regulator for fimA
fimI b4315 0.1498 0.0170 fimbrial protein
flgA b1072 5.9250 0.0103 flagellar biosynthesis; assembly of basal-body periplasmic P ring
flgB b1073 2.4622 0.0099 flagellar basal-body rod protein FlgB
flgC b1074 5.0956 0.0165 flagellar basal-body rod protein FlgC
flgD b1075 4.9964 0.0107 flagellar biosynthesis, initiation of hook assembly
flgE b1076 5.2448 0.0144 flagellar hook protein FlgE
flgF b1077 3.8916 0.0140 flagellar basal-body rod protein FlgF
flgG b1078 6.8388 0.0172 flagellar basal-body rod protein FlgG
flgH b1079 2.7794 0.0275
flagellar L-ring protein FlgH; basal-body outer-membrane L (lipopolysaccharide
layer) ring protein
flgI b1080 4.9957 0.0130 flagellar P-ring protein FlgI
flgJ b1081 4.6874 0.0136 FlgJ
flgM b1071 4.1452 0.0056 anti-FliA (anti-sigma) factor; also known as RflB protein
flgN b1070 2.3884 0.0246 flagellar biosynthesis protein FlgN
flhB b1880 3.0669 0.0156 flagellar biosynthesis protein FlhB
fliA b1922 9.7781 0.0072 sigma28 factor
fliC b1923 2.9614 0.0275 flagellar biosynthesis; flagellin, filament structural protein
fliD b1924 3.9935 0.0464 flagellar cap protein FliD; filament capping protein; enables filament assembly
fliE b1937 4.0249 0.0012 flagellar basal-body protein FliE
fliF b1938 7.3494 0.0024
flagellar M-ring protein FliF; basal-body MS(membrane and supramembrane)-
ring and collar protein
fliG b1939 6.5031 0.0323
flagellar motor switch protein FliG; component of motor switching and
energizing, enabling rotation and determining its direction
fliH b1940 3.0144 0.0294 flagellar biosynthesis protein FliH
fliJ b1942 4.6660 0.0065 flagellar biosynthesis protein FliJ
fliK b1943 3.4194 0.0186 flagellar hook-length control protein FliK
fliL b1944 7.1439 0.0097 flagellar biosynthesis
fliM b1945 7.9995 0.0100
flagellar motor switch protein FliM; component of motor switch and energizing,
enabling rotation and determining its direction
fliN b1946 7.8012 0.0123
flagellar motor switch protein FliN; component of motor switch and energizing,
enabling rotation and determining its direction
fliQ b1949 3.9371 0.0296 flagellar biosynthesis protein FliQ
fliS b1925 4.0888 0.0000 flagellar biosynthesis protein FliS
180

APPENDIX I
gene blattner ratio p-value Function
A/B
fliZ b1921 4.4203 0.0056 possible cell-density responsive regulator of sigmaF
focA b0904 0.3591 0.0199 FocA formate FNT transporter
frlA b3370 0.6250 0.0009 YhfM methione APC transporter
frmB b0355 1.4987 0.0417 putative S-formylglutathione hydrolase
fsaB b3946 1.6046 0.0285 fructose 6-phosphate aldolase 2
fxsA b4140 0.5805 0.0376 inner membrane protein; overproduction inhibits F exclusion of bacteriophage T7
gadA b3517 0.1582 0.0235 glutamate decarboxylase A subunit
gadC b1492 0.2334 0.0316 XasA GABA APC transporter
gadE b3512 0.1309 0.0490 GadE transcriptional activator
galE b0759 1.2371 0.0142 UDP-glucose 4-epimerase monomer
gatD b2091 0.2599 0.0438 galactitol-1-phosphate dehydrogenase
gatY b2096 0.2067 0.0396 tagatose-1,6-bisphosphate aldolase 2
gatZ b2095 0.1364 0.0278 tagatose-1,6-bisphosphate aldolase 2
ghrA b1033 1.3218 0.0231 glyoxylate reductase
glf b2036 0.7362 0.0107 UDP-galactopyranose mutase
glpF b3927 0.6041 0.0017 GlpF - glycerol MIP channel
glpG b3424 1.3109 0.0131 inner membrane-associated protein of glp regulon
gltD b3213 1.3195 0.0434 glutamate synthase (NADPH) small chain
gltF b3214 0.1336 0.0102 regulator of gltBDF operon, induction of Ntr enzymes
gltK b0653 1.4577 0.0267 glutamate ABC transporter
gmd b2053 0.3426 0.0190 GDP-mannose 4,6-dehydratase
gntX b3413 1.8845 0.0301 gluconate periplasmic binding protein
gshA b2688 1.5587 0.0456 glutamate-cysteine ligase
gspD b3325 0.5645 0.0087 putative protein secretion protein for export
gspE b3326 0.6429 0.0423 putative protein secretion protein for export
hdeA b3510 0.0429 0.0068 acid-resistance protein, possible chaperone
hdeB b3509 0.0449 0.0041 10K-L protein, related to acid resistance protein of Shigella flexneri
hdeD b3511 0.3744 0.0297 protein involved in acid resistance
hdhA b1619 0.3986 0.0141 7-alpha-hydroxysteroid dehydrogenase
hipA b1507 4.0652 0.0109 HipA transcriptional activator
hisH b2023 1.7301 0.0302 imidazole glycerol phosphate synthase, HisH subunit
hlyE b1182 0.1729 0.0157 hemolysin E
hns b1237 6.1952 0.0176 H-NS transcriptional dual regulator
hofM b3395 1.4093 0.0034 conserved hypothetical protein
hscA b2526 2.5483 0.0441 chaperone, member of Hsp70 protein family
hycI b2717 1.2466 0.0014 hydrogenase 3 maturation protease
hypC b2728 1.6554 0.0250 pleiotrophic effects on 3 hydrogenase isozymes
ibpA b3687 0.6923 0.0383 small heat shock protein IbpA
idnK b4268 0.4140 0.0285 gluconokinase II
ilvN b3670 1.7883 0.0127 acetohydroxybutanoate synthase I / acetolactate synthase I
intZ b2442 1.7292 0.0221 putative prophage integrase
ispB b3187 1.2318 0.0439 octaprenyl diphosphate synthase
kbl b3617 0.5690 0.0286 2-amino-3-ketobutyrate CoA ligase
kdpB b0697 1.6697 0.0185 potassium ion P-type ATPase transporter
kdsB b0918 1.7064 0.0110 3-deoxy-D-manno-octulosonate-cytidylyltransferase
kefB b3350 1.5528 0.0397 KefB potassium CPA2 transporter
lepA b2569 1.9688 0.0349 GTP-binding elongation factor, may be inner membrane protein
lolD b1117 1.2471 0.0101 LolCDE ABC lipoprotein transporter
lysP b2156 2.0194 0.0452 LysP lysine APC transporter
maa b0459 0.4245 0.0030 maltose acetyltransferase
mdtG b1053 1.2882 0.0249 YceE drug MFS transporter
mdtL b3710 0.7142 0.0215 YidY drug MFS transporter
metH b4019 0.7227 0.0004 Cobalamin-dependent homocysteine transmethylase
metI b0198 1.4979 0.0420 L- and D-methionine uptake ABC permease
metR b3828 1.6070 0.0336 MetR-Homocysteine transcriptional activator
miaB b0661 1.4769 0.0167 hypothetical protein
181

APPENDIX I
gene blattner ratio
A/B
p-value
Function
cell division inhibitor of the MinC-MinD-MinE and DicB-MinC systems that
regulate septum placement
minC b1176 0.5656 0.0077
mltB b2701 1.6697 0.0259 membrane-bound lytic murein transglycosylase B
moaB b0782 1.8201 0.0406 MoaB subunit
MotB protein, enables flagellar motor rotation, linking torque machinery to cell
wall
motB b1889 8.5864 0.0015
msbA b0914 2.4362 0.0074 ATP-binding transport protein; multicopy suppressor of htrB
murP b2429 0.3070 0.0310 MurP
nadC b0109 1.2142 0.0267 quinolinate phosphoribosyltransferase (decarboxylating) monomer
nagA b0677 1.3065 0.0297 N-acetylglucosamine-6-phosphate deacetylase
nanC b4311 0.1870 0.0154 conserved hypothetical protein
nfnB b0578 0.5525 0.0086 dihydropteridine reductase
nikC b3478 1.8058 0.0147 nickel ABC transporter
nmpC b0553 0.0693 0.0038 outer membrane porin protein; locus of qsr prophage
nrfD b4073 0.4712 0.0109 nitrite reductase complex
nudD b2051 0.0587 0.0129 GDP-mannose mannosyl hydrolase
nudE b3397 1.8481 0.0487 ADP-ribose diphosphatase
ogrK b2082 0.4983 0.0113 OgrK transcriptional regulator
ompC b2215 0.6383 0.0480 outer membrane porin OmpC
ompF b0929 2.5595 0.0108 outer membrane porin OmpF
osmB b1283 0.2432 0.0020 OsmB osmotically inducible lipoprotein
osmC b1482 0.4503 0.0263 osmotically inducible peroxidase OsmC
pagP b0622 0.2419 0.0392 PagP monomer
parE b3030 1.4390 0.0125 Topoisomerase IV subunit B
pflB b0903 0.5987 0.0440 pyruvate formate-lyase (inactive)
pgaD b1021 0.2752 0.0393 putative inner membrane protein
phoR b0400 1.8038 0.0289 PhoR-Phis
pinR b1374 0.1363 0.0086 putative transposon resolvase
pioO b3322 0.5656 0.0226 calcium-binding protein required for initiation of chromosome replication
pitB b2987 0.3142 0.0356 PitB
proB b0242 0.5567 0.0474 gamma-glutamyl kinase-GP-reductase multienzyme complex
prpD b0334 1.8705 0.0377 2-methylcitrate dehydratase
purL b2557 1.1685 0.0423 phosphoribosylformylglycinamide synthase
puuP b1296 1.5737 0.0077 YcjJ APC transporter
puuR b1299 3.1778 0.0435 putative oxidoreductase/putative regulator
rbsC b3750 0.3361 0.0271 ribose ABC transporter
rbsD b3748 0.2044 0.0179 D-ribose utilization
rbsK b3752 0.6382 0.0278 ribokinase
positive DNA-binding transcriptional regulator of capsular polysaccharide
rcsA b1951 0.0925 0.0303 synthesis, activates its own expression
rcsD b2216 0.7698 0.0039 putative 2-component sensor protein
relA b2784 1.3700 0.0315 GDP pyrophosphokinase / GTP pyrophosphokinase
rffD b3787 2.2065 0.0462 UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase
rho b3783 2.2388 0.0451 transcription termination factor Rho monomer; polarity suppressor
rhsA b3593 0.4975 0.0344 RhsA protein in rhs element
rhsD b0497 0.1777 0.0029 RhsD protein in rhs element
ribD b0414 1.2103 0.0239 pyrimidine reductase / pyrimidine deaminase
rihC b0030 2.3026 0.0130 ribonucleoside hydrolase 3
rng b3247 1.6144 0.0451 ribonuclease G (RNAse G) monomer
rplK b3983 1.5386 0.0382 50S ribosomal subunit protein L11
rplL b3986 1.6665 0.0070 50S ribosomal subunit protein L7/L12
rplU b3186 1.8052 0.0302 50S ribosomal subunit protein L21
rpsC b3314 1.5181 0.0057 30S ribosomal subunit protein S3
rpsJ b3321 1.3506 0.0099 30S ribosomal subunit protein S10
rpsR b4202 1.5535 0.0028 30S ribosomal subunit protein S18
rpsS b3316 1.5309 0.0152 30S ribosomal subunit protein S19
rspB b1580 0.2910 0.0312 putative dehydrogenase RspB
182

APPENDIX I
gene blattner ratio p-value Function
A/B
rumB b0859 2.8430 0.0229 23S ribosomal RNA 5-methyluridine methyltransferase
rzpR b1362 0.3718 0.0295 putative prophage lambda endopeptidase
serC b0907 0.8655 0.0233 phosphohydroxythreonine transaminase / phosphoserine transaminase
sfmF b0534 1.5761 0.0050 putative fimbrial-like protein
sfsB b3188 0.6211 0.0341 Nlp transcriptional regulator
sgbU b3582 0.4728 0.0465 probable 3-hexulose-6-phosphate isomerase
sgcR b4300 0.7052 0.0469 SgcR transcriptional regulator
sieB b1353 0.6826 0.0164 phage superinfection exclusion protein
slp b3506 0.2794 0.0041 outer membrane protein induced after carbon starvation
sra b1480 0.3405 0.0369
30S ribosomal subunit protein S22; sub-stoichiometric stationary phase ribosomal
component
ssuC b0934 1.3094 0.0450 YcbE/YcbM ABC transporter
stpA b2669 0.2394 0.0352 DNA-binding protein; H-NS-like protein; chaperone activity; RNA splicing?
sufA b1684 2.2615 0.0121 scaffold protein for iron-sulfur cluster assembly
sufC b1682 2.6029 0.0111
ATPase component of SufB-SufC-SufD cysteine desulfurase (SufS) activator
complex
tar b1886 5.6716 0.0475 MCP-II
tatD b4483 1.8518 0.0203 magnesium-dependent DNase
tauA b0365 0.3175 0.0372 TauA/TauB/TauC ABC transporter
tdcC b3116 0.1433 0.0075 TdcC threonine STP transporter
tdcD b3115 0.4925 0.0458 propionate kinase / acetate kinase C
tgt b0406 0.7951 0.0462 tRNA-guanine transglycosylase monomer
thiD b2103 0.7993 0.0109 hydroxymethylpyrimidine kinase 2 / HMP-P kinase
tnaA b3708 0.0673 0.0163 L-cysteine desulfhydrase / tryptophanase
tolB b0740 1.3875 0.0321 Tol-Pal Cell Envelope Complex
trpD b1263 1.2758 0.0363 anthranilate synthase component II
tsr b4355 2.6861 0.0245 MCP-I
ttdB b3062 0.7602 0.0085 L-tartrate dehydratase, beta subunit
ubiC b4039 1.5219 0.0401 chorismate pyruvate lyase
ugd b2028 0.1087 0.0032 UDP-glucose 6-dehydrogenase
ung b2580 1.1711 0.0157 uracil-DNA-glycosylase
uvrB b0779 1.5839 0.0266 DNA repair; excision nuclease subunit B
uvrC b1913 0.6579 0.0189 excinuclease ABC, subunit C; repair of UV damage to DNA
uvrY b1914 0.5041 0.0474 UvrY- Phosphorylated transcriptional regulator
wcaA b2059 0.5870 0.0415 putative regulator
wcaC b2057 0.5717 0.0358 putative glycosyl transferase
wcaD b2056 0.0530 0.0169 putative colanic acid polymerase
wcaE b2055 0.1901 0.0098 putative colanic acid biosynthesis glycosyl transferase
wcaF b2054 0.1153 0.0195 putative transferase
wcaM b2043 0.3407 0.0472 hypothetical protein
wzc b2060 0.3446 0.0355 tyrosine kinase involved in colanic acid biosynthesis
wzxE b3792 1.8477 0.0010
metabolism; biosynthesis of macromolecules (cellular constituents);
enterobacterial common antigen (surface glycolipid) transport
wzyE b3793 1.4866 0.0048 4-&alpha;-fucosyltransferase
xapR b2405 0.1931 0.0064 XapR transcriptional activator
xerC b3811 1.4882 0.0457
site-specific recombinase, acts on cer sequence of ColE1, effects chromosome
segregation at cell division
xseA b2509 1.6165 0.0433 exonuclease VII, large subunit
xylB b3564 0.4772 0.0249 xylulokinase
xylF b3566 0.5971 0.0345 xylose ABC transporter
yaaY b0024 2.2168 0.0034 hypothetical protein
yabP b0056 0.6871 0.0260 conserved hypothetical protein
yadD b0132 1.2444 0.0248 hypothetical protein
yadL b0137 0.2804 0.0369 putative adhesin-like protein
yafD b0209 1.4135 0.0200 conserved hypothetical protein
yafJ b0223 0.6082 0.0284 putative amidotransferase
yafS b0213 1.4431 0.0410 putative methyltransferase
yagG b0270 0.5001 0.0099 YagG GPH Transporter
183

APPENDIX I
gene blattner ratio p-value Function
A/B
yagT b0286 0.6949 0.0498 putative oxidoreductase, Fe-S subunit
yagX b0291 0.3706 0.0491 putative enzyme
yagZ b0293 0.0536 0.0008 conserved hypothetical protein
yahA b0315 0.3956 0.0385 hypothetical protein
ybaJ b0461 0.2760 0.0119 conserved hypothetical protein
ybbD b0500 0.3847 0.0090 conserved hypothetical protein
ybbL b0490 0.7678 0.0092 YbbL
ybcJ b0528 1.3234 0.0305 putative RNA-binding protein
ybcW b0559 0.4321 0.0311 hypothetical protein
ybdB b0597 1.9962 0.0233 conserved hypothetical protein
ybfD b0706 0.2376 0.0116 conserved protein
ybfF b0686 1.5949 0.0464 putative enzyme
ybgD b0719 0.5377 0.0327 putative fimbrial-like protein
ybgS b0753 1.8287 0.0028 putative homeobox protein
ybhM b0787 0.4738 0.0397 hypothetical protein
ybiB b0800 1.3766 0.0189 putative enzyme
ybiU b0821 0.8261 0.0211 conserved hypothetical protein
ybjD b0876 0.5663 0.0278 conserved protein with a nucleotide triphosphate hydrolase domain
ybjL b0847 0.5150 0.0010 putative transport protein
ycbQ b0938 0.1147 0.0155 putative fimbrial-like protein
ycdJ b1009 1.6640 0.0210 putative acetyltransferase
ycdL b1011 2.0719 0.0001 putative synthetase
yceG b1097 2.3657 0.0237 putative thymidylate kinase (EC 2.7.4.9)
yceI b1056 0.3488 0.0018 periplasmic protein; possibly secreted
yceJ b1057 0.3421 0.0458 putative cytochrome
ycfH b1100 2.0979 0.0027 putative hydrolase
ycfR b1112 5.2716 0.0014 conserved hypothetical protein
ycgE b1162 0.6911 0.0063 putative transcriptional regulator
ycgV b1202 0.2423 0.0354 putative adhesion and penetration protein
ycgX b1161 0.4727 0.0469 hypothetical protein
ychJ b1233 1.3522 0.0498 conserved hypothetical protein
ychQ b1213 1.7261 0.0345 hypothetical protein
yciA b1253 2.8879 0.0202 putative enzyme
yciF b1258 0.3526 0.0266 conserved protein
ycjN b1310 0.3041 0.0419 YcjN/YcjO/YcjP ABC transporter
ycjO b1311 2.4268 0.0369 YcjN/YcjO/YcjP ABC transporter
ycjT b1316 0.7525 0.0127 putative enzyme
ydbA_1 b1401 0.7593 0.0356 hypothetical protein product of fragment 1 of a split CDS
ydcC b1460 0.2272 0.0112 conserved protein, similar to H-repeat associated proteins
ydcL b1431 0.6791 0.0441 conserved hypothetical protein
ydcR b1439 4.0253 0.0261
multi modular; putative transcriptional regulator ; also putative ATP-binding
component of a transport system
ydeA b1528 2.7790 0.0432 YdeA MFS transporter
ydeI b1536 0.1821 0.0253 conserved hypothetical protein
ydeK b1510 0.6187 0.0071 YdeK
ydeP b1501 0.1915 0.0184 acid resistance protein
ydeS b1504 0.4539 0.0400 putative fimbrial-like protein
ydfB b1572 1.6584 0.0428 hypothetical protein
ydfE b1577 0.6538 0.0130 hypothetical protein
ydfJ b1543 3.1165 0.0181 YdfJ
YdgE b1599 0.2358 0.0111 YdgE SMR Protein
YdgF b1600 0.1460 0.0053 YdgF SMR protein; toxin of a putative toxin-antitoxin pair
ydgR b1634 2.3865 0.0058 YdgR putative peptide POT Transporter
ydiA b1703 0.3853 0.0309 conserved protein
ydjG b1771 0.6625 0.0268 putative oxidoreductase
ydjI b1773 0.3205 0.0299 putative aldolase
ydjJ b1774 0.3084 0.0391 putative oxidoreductase
184

APPENDIX I
gene blattner ratio p-value Function
A/B
ydjL b1776 0.6122 0.0341 putative oxidoreductase
yeaG b1783 0.4721 0.0039 conserved protein
yeaJ b1786 0.4354 0.0260 putative membrane protein
yebN b1821 0.2184 0.0221 putative membrane protein, terpenoid synthase-like
yebW b1837 1.6464 0.0240 hypothetical protein
yecR b1904 3.4357 0.0288 conserved hypothetical protein
yedS_2 b1965 0.2584 0.0387 putative outer membrane protein
yedS_3 b1966 0.2391 0.0482 putative outer membrane protein
yedV b1968 0.1575 0.0161 putative 2-component sensor protein
yeeE b2013 1.3107 0.0382 putative transport system permease protein
yeeN b1983 0.3367 0.0153 conserved protein
yegJ b2071 0.2035 0.0169 hypothetical protein
yehT b2125 0.5225 0.0364 two-component response regulator
yeiS b2145 0.4474 0.0138 hypothetical protein
yfaL b2233 1.3955 0.0170 potential adhesin
yfaO b2251 0.4117 0.0366 putative enzyme (Nudix hydrolase)
yfbE b2253 0.2945 0.0149 UDP-L-Ara4O C-4" transaminase
yfbN b2273 0.1982 0.0195 conserved hypothetical protein
yfcI b2305 0.5760 0.0448 hypothetical protein
yfcV b2339 0.1962 0.0324 putative fimbrial-like protein
yfdP b2359 0.7302 0.0446 hypothetical protein
yfdZ b2379 1.3458 0.0451 putative aminotransferase
yfeD b2399 0.6741 0.0159 hypothetical protein
yfeX b2431 1.2507 0.0360 conserved protein
yffB b2471 0.3893 0.0112 conserved thioredoxin-like protein
yfgH b2505 0.1761 0.0294 putative outer membrane lipoprotein
yfiR b2603 0.5716 0.0344 conserved protein
yfjH b2623 0.5403 0.0467 putative histone
yfjK b2627 0.5869 0.0193 hypothetical protein
ygbE b2749 2.2898 0.0383 putative cytochrome oxidase subunit
ygbT b2755 0.3143 0.0043 conserved hypothetical protein
ygcF b2777 0.4973 0.0417 hypothetical protein
ygcI b2757 0.0520 0.0045 hypothetical protein
ygcJ b2758 0.4560 0.0338 conserved hypothetical protein
ygcK b2759 0.0541 0.0086 hypothetical protein
ygcL b2760 0.0966 0.0050
hypothetical protein with possible relationship to novobiocin and deoxycholate
resistance
ygdI b2809 1.7669 0.0042 hypothetical protein
ygdL b2812 1.7338 0.0474 putative enzyme
ygeO b2859 0.7191 0.0320 conserved protein
yggP b2931 0.4937 0.0082 putative NAD(P)-binding dehydrogenase (B2931)
yghQ b2983 1.6030 0.0092 putative serine protease
yghS b2985 0.3944 0.0088 conserved protein
ygiL b3043 0.0454 0.0037 putative fimbrial-like protein
ygiR b3015 2.2378 0.0114
ygiU b3022 1.4623 0.0263 putative cyanide hydratase
yhbW b3160 1.3420 0.0364 putative enzyme
yhcA b3215 0.4083 0.0170 putative chaperone
yhdX b3269 0.4868 0.0189 YhdW/YhdX/YhdY/YhdZ ABC transporter
yhfL b3369 0.2237 0.0277 hypothetical protein
yhhH b3483 0.5665 0.0435 hypothetical protein
yhhI b3484 0.2639 0.0294 conserved protein similar to H-repeat-associated proteins
yhiP b3496 1.4822 0.0076 YhiP peptide POT transporter
yhjB b3520 0.5360 0.0254 putative regulator
yhjR b3535 0.3791 0.0427 hypothetical protein
yhjX b3547 0.4577 0.0155 YhjX MFS transporter
yiaA b3562 0.2225 0.0295 hypothetical protein
185

APPENDIX I
gene blattner ratio p-value Function
A/B
yiaN b3578 0.3218 0.0405 YiaMNO Binding Protein-dependent Secondary (TRAP) Transporter
yiaT b3584 0.3228 0.0018 putative outer membrane protein
yiaU b3585 0.2708 0.0129 putative transcriptional regulator LYSR-type
yiaV b3586 0.6530 0.0169 putative membrane protein
yiaW b3587 0.1805 0.0226 hypothetical protein
yibA b3594 0.2554 0.0369 putative lyase
yibI b3598 1.5678 0.0042 hypothetical protein
yibJ b3595 0.4409 0.0364 hypothetical protein
yifK b3795 1.6627 0.0041 YifK APC transporter
yiiS b3922 0.2877 0.0426 conserved hypothetical protein
yjbE b4026 0.2320 0.0056 conserved hypothetical protein
yjdI b4126 0.3844 0.0223 conserved hypothetical protein
yjeJ b4145 0.1947 0.0001 conserved protein
yjfJ b4182 0.4165 0.0368 conserved protein
yjfO b4189 0.6287 0.0167 conserved protein
yjgA b4234 1.4336 0.0306 putative transport protein (ABC superfamily, atp_bind)
yjgM b4256 0.3526 0.0092 putative acyltransferase
yjhF b4296 0.3026 0.0290 YjhF Gnt tranporter
yjhG b4297 0.3862 0.0320 putative dehydratase
yjhH b4298 0.1447 0.0289 putative lyase/synthase
yjhI b4299 0.1010 0.0196 putative regulator
yjiW b4347 0.3016 0.0341 hypothetical protein
yjjQ b4365 0.5375 0.0405 putative regulator
yjjY b4402 1.8482 0.0252 hypothetical protein
ykfF b0249 1.4653 0.0173 hypothetical protein
ykgA b0300 0.3332 0.0455 putative ARAC-type regulatory protein
ykgB b0301 0.4130 0.0197 putative membrane protein
ykgF b0307 0.0923 0.0096 putative dehydrogenase
ykgI b0303 0.1914 0.0271 hypothetical protein
ykgK b0294 0.3670 0.0464 putative regulator
ykiA b0392 0.4606 0.0100 hypothetical protein
yliF b0834 0.5389 0.0387 conserved protein
ymgD b1171 0.2996 0.0307 hypothetical protein
ynaE b1375 0.1454 0.0051 hypothetical protein
ynaI b1330 0.4059 0.0015 YnaI
ynaK b1365 0.2128 0.0235 hypothetical protein
yncC b1450 0.7923 0.0469 hypothetical protein
yncD b1451 4.6042 0.0276 Probable TonB-dependent receptor
yncI b1458 0.2616 0.0295 conserved protein
ynfN b1551 0.1250 0.0013 hypothetical protein
ynjF b1758 1.9527 0.0260 putative cytochrome oxidase
ynjI b1762 0.6095 0.0436 conserved protein
yoaC b1810 0.5329 0.0343 conserved hypothetical protein
yobF b1824 0.2197 0.0180 hypothetical protein
yodA b1973 0.3883 0.0353 cadmium-induced metal binding protein
yohL b2105 0.8820 0.0341 conserved hypothetical protein
yojI b2211 2.6739 0.0227 YojI
ypfJ b2475 1.7103 0.0293 conserved protein
ypjF b2646 1.7408 0.0282 member of the YeeV, YkfI, YpjF family of toxin proteins
yqcC b2792 1.1876 0.0346 conserved hypothetical protein
yqeI b2847 0.3092 0.0385 putative sensory transducer
yqhC b3010 1.5425 0.0156 putative ARAC-type regulatory protein
yqjF b3101 1.9399 0.0112 putative membrane protein
yraH b3142 0.4222 0.0010 putative fimbrial-like protein
yraQ b3151 1.7555 0.0334 putative membrane protein
yrdD b3283 0.8037 0.0413 putative DNA topoisomerase
186

APPENDIX I
gene blattner ratio p-value Function
A/B
yrfF b3398 1.2449 0.0097 putative dehydrogenase
ysgA b3830 1.9227 0.0146 putative enzyme
ytfA b4205 0.5673 0.0178 hypothetical protein
ytfT b4230 1.5645 0.0022 YtfQ/YtfR/YtfS/YtfT/YjfF ABC transporter
ytjB b4387 1.3640 0.0001 membrane protein
187

Statement of sources
Declaration
I declare that this thesis is my own work and has not been submitted in
any form for another degree or diploma at any university or other
institution of tertiary education. Information derived from published
scientific work has been cited in the text and listed in the references.
Signature
Date
188

189

190