Phylogeography of a pantropical plant with sea-drifted ... - åèå¤§å¦

( 千葉大学学位申請論文 ) 

Phylogeography of a pantropical plant with 

sea‐drifted seeds; Canavalia rosea (Sw.) DC., 

(Fabaceae) 

汎熱帯海流散布植物ナガミハマナタマメ 

(マメ科 )の系統地理 

2010 年 7 月 

千葉大学大学院理学研究科 

地球生命圏科学専攻生物学コース 

Mohammad Vatanparast

Phylogeography of a pantropical plant with 

sea‐drifted seeds; Canavalia rosea (Sw.) DC., 

(Fabaceae) 

July 2010 

MOHAMMAD VATANPARAST 

Graduate School of Science 

CHIBA UNIVERSITY

TABLE OF CONTENTS PAGES 

ABSTRACT 1 

GENERAL INTRODUCTION 3 

Pantropical plants with sea-drifted seeds species (PPSS) 5 

A project on the phylogeography of the PPSS 6 

A case study of PPSS: Hibiscus tiliaceus L. 7 

Canavalia rosea: a genuine pantropical plant with sea-drifted seeds 8 

Overview of this study 10 

CHAPTER 1 12 

PHYLOGENETIC RELATIONSHIPS AMONG CANAVALIA ROSEA AND ITS 

ALLIED SPECIES 12 

1-1 Introduction 12 

1-2 Materials and Methods 15 

Taxon sampling 15 

DNA extraction, PCR, and sequencing 16 

Phylogenetic analyses based on cpDNA sequence data 18 

Phylogenetic analyses based on ITS sequence data 19 

1-3 Results 21 

Phylogenetic analyses based on cpDNA sequence data 21 

Phylogenetic analyses based on ITS sequence data 22 

1-4 Discussion 24 

Phylogenetic relationships among C. rosea and its related species 24 

The phylogeographic break in the Atlantic Ocean 25 

Origin of the Hawaiian endemic species 26 

Future prospects for the evolutionary studies among C. rosea and its allied 

species 27 

Tables and figures 29 

i

TABLE OF CONTENTS (CONTINUED) PAGES 

CHAPTER 2 40 

GLOBAL GENETIC STRUCTURE OF CANAVALIA ROSEA; EVIDENCE FROM 

CHLOROPLAST DNA SEQUENCES 40 

2-1 Introduction 40 

2-2 Materials and Methods 44 

Sampling 44 

DNA extraction, PCR, and sequencing 44 

Haplotype Composition and Network of C. rosea and its allied species 44 

Population differentiation 45 

Historical migration rates between oceanic regions 46 

Estimates of recent migration rates 48 

2-3 Results 49 

Haplotype Composition and Network of C. rosea and its allied species 49 

Population differentiation 50 

Historical migration rates between oceanic regions 51 

Estimates of recent migration rates 52 

2-4 Discussion 54 

Gene flow in Indo-Pacific Ocean through Long Distance Seed Dispersal 54 

A strong genetic difference between the Indo-Pacific and Atlantic populations 

of C. rosea 56 

2-5 Conclusion 59 

Tables and figures 60 

GENERAL DISCUSSION 74 

REFERENCES 76 

ACKNOWLEDGEMENTS 82 

BIOGRAPHY 83 

ii

ABBREVIATIONS 

AEP 

AMOVA 

bp 

cpDNA 

CTAB 

ESS 

Atlantic East Pacific 

Analysis of molecular variance 

base pair 

chloroplast DNA 

cetyltrimethyl ammonium bromide 

Effective sample size 

F ST 

Fixation index (F-statistices) 

IGS 

ITS 

IWP 

MLE 

nrDNA 

PCR 

PCR-SSCP 

PCR-SSP 

PPSS 

RCA 

SAMOVA 

Intergenic Spacer 

Internal Transcribed Spacers 

Indo West Pacific 

Maximum likelihood estimates 

nuclear ribosomal DNA 

Polymerase Chain Reaction 

PCR amplification with single-strand conformation polymorphism 

PCR amplification with sequence specific primers 

Pantropical Plants with Sea-drifted Seeds 

Rolling Circle Amplification 

Spatial Analysis of Molecular Variance 

iii

ABSTRACT 

This study intends to examine the importance of long distance seed 

dispersal in the recurrent speciation and integration of pantropical plants with 

sea-drifted seeds (PPSS). I focused on one of genuine member of PPSS; 

Canavalia rosea (Sw.) DC. and its allied species. 

Chapter 1 is concerned with the phylogenetic relationships among C. 

rosea and its allied species as well as Hawaiian endemic species using 

chloroplast DNA (cpDNA) and internal transcribed spacers (ITS) of nuclear 

ribosomal DNA (nrDNA) sequences. Phylogenetic analyses using nucleotide 

sequences of 6 cpDNA regions (ca. 6000 bp) as well as nrDNA ITS for C. rosea 

and its related species suggested that rapid speciation might occurred among 

C. rosea and its related species. The phylogenetic results also suggested that 

Hawaiian endemic subgenus Maunaloa, was monophyletic and closely related 

to subgenus Canavalia than to other subgenera (Wenderothia and Catodonia). 

The results suggests that the Hawaiian subgenus originated by single 

colonization to Hawaiian archipelagos by sea-dispersal. 

In chapter 2, spatial genetic structure of cpDNA sequences were studied 

for C. rosea and its related species. In total 515 individuals from 48 populations 

were surveyed based on partial sequences of 6 cpDNA regions (ca. 2000 bp). 

Statistical analyses (F ST -based and coalescent-based methods) did not show 

significant genetic differentiation among the C. rosea populations over whole 

Pacific and Indian Oceanic regions and also within Atlantic region. This 

suggests that significant gene flow by long distance dispersal of sea-drifted 

1

seeds occurs among these oceanic regions. On the other hand, the results of 

phylogenetic and population genetic analyses confirm the genetic 

differentiation of the Atlantic populations. This suggests that African and 

American land masses played roles as geographical barriers to gene flow by 

sea-dispersal. However, partial gene flow was detected between Atlantic and 

Indian oceanic regions which suggest that the unity of the species in global 

scale is kept by long distance seed dispersal over the African continent. 

Directional gene flow within Atlantic region might be corresponded to the 

variation of the strength of tropical Atlantic’s major currents which regarded as 

transatlantic dispersal in Atlantic region. Moreover, highly differentiated 

populations of C. rosea were detected in the southern Brazil. The South 

Equatorial Current bifurcating at the north-eastern horn of Brazil to the 

northward and southward appears to be potential barrier to gene flow and 

may promote the genetic differentiation of the C. rosea populations in 

southern Brazil. 

2

GENERAL INTRODUCTION 

“… mammals have not been able to migrate, whereas some plants, from their 

varied means of dispersal, have migrated across the wide and broken interspaces.” 

(Darwin, 1859) 

The term dispersal has two different but interrelated functions in most 

species. The first one is, range expansion of species, and the second one, gene 

flow within and among populations. Range expansion is necessary for almost 

all species, so they have various strategies to expand their distribution ranges 

(Linhart & Grant, 1996). However, the wider distribution range arisen from 

dispersal causes high genetic heterogeneity among populations because of 

increased levels of selection within local populations and/or because of limited 

levels of genetic exchange among the local populations (Heywood, 1991; 

Hamrick & Nason, 1996; Linhart & Grant, 1996). When genetic heterogeneity 

among populations becomes significantly enough, local populations can evolve 

and eventually form a distinct species (Wright, 1931; Ennos, 1994; Bohonak, 

3

1999). Gene flow is one of the most important processes for species to evolve 

as cohesive units in their distribution range (Mayr, 1963; Levin, 2000; Morjan & 

Rieseberg, 2004). In fact, if levels of gene flow within and among populations 

become high (e.g. greater than four migrants per generation), it homogenize 

the species and prevents genetic divergence of local populations. 

In many plant species, populations are spatially isolated from each other, 

often by hundreds of meters or more and seed dispersal represents the only 

way by which populations can exchange individuals or to expand the 

distribution ranges (Cain et al., 2000). As there are geographical, ecological or 

behavioral barriers to seed dispersal, most plant species are not distributed 

globally (Howe & Smallwood, 1982; Cain et al., 1998; Willson & Traveset, 2000). 

The biggest barrier for land plants will be the ocean, so that most of the 

floristic compositions are generally quite different among continents which are 

divided by oceans. However, there are a few plant species that characterized by 

their extremely wide distribution ranges across littoral areas in tropics and 

subtropics worldwide. They are called “pantropical plants with sea-drifted 

seeds” (Takayama et al., 2006; 2008), referred to as PPSS. A few PPSS are known 

from various families which can roughly divide into 2 categories. One is 

genuine PPSS in which a single species distributes around the globe. 

Canavalia rosea (Sw.) DC. (Fabaceae) and Ipomoea pes-caprae (L.) R. Br. 

(Convolvulaceae) are in this category. The other one is Sub-PPSS, in which 

small numbers of closely related species compose the global distribution in 

total. Hibiscus tiliaceus L., with H. pernambucensis Arruda (Malvaceae), Vigna 

marina (Burm.f.) Merr. with V. luteola (Jacq.) Benth. (Fabaceae), and species of 

Rhizophora L. and Entada Adans. are in this category. 

4

Pantropical plants with sea-drifted seeds species (PPSS) 

The main dispersal mode of PPSS is sea-dispersal. Almost all PPSS have 

seeds or fruits that can float in sea water for long time. The seed coats of these 

species are hard with lightweight cotyledons and there are air spaces between 

the folds of the cotyledons which help the seeds to stay impermeable on sea 

water (Nakanishi, 1988; Loewer, 2005; Thiel & Haye, 2006). Nakanishi (1988) 

investigated germination and buoyancy of seeds and fruits of seventeen 

maritime species (including most of PPSS), after immersion in artificial seawater. 

He revealed that all seeds and fruits tested in the study continued to float in 

sea water for at least three months (Nakanishi, 1988). These characteristics help 

PPSS to distribute in wide areas in equatorial belt around the globe. Their 

distribution ranges are consistent with the areas where the average 

temperature of Ocean water is around 20 ͦC. In the West Atlantic, they are 

distributed from Florida to the Uruguay in Southern West Atlantic. In East 

Atlantic they are distributed from Senegal to the Angola and in the Indian 

Ocean from Northern part of Indian Ocean to the East Cape of South Africa. In 

the West Pacific Ocean their northern limit is Ryukyu Islands in Japan and in the 

south west Pacific is the Brisbane in Australia. In central pacific, their 

distribution ranges are from Hawaii to Polynesia and in the East Pacific from 

Sinaloa in Mexico to the Northern part of Peru in the East Pacific seashores (Fig. 

1-2A). 

The extremely wide distribution range of PPSS has been explained 

mainly by their high ability of seed dispersal (Sauer, 1988; Whistler, 1992). On 

the other hand, high dispersal ability with sea-drifted seeds could raise the 

5

potential of population differentiation and speciation. New species could arise 

independently in remote populations following long-distance seed dispersal 

and/or adaptation to a new habitat. This kind of speciation process is assumed 

to occur in PPSS, as the most of the PPSS have some closely related species 

distributed in limited areas comparing to the mother PPSS (Levin, 2001; 

Takayama et al., 2006). However, until recently there were no empirical data to 

explain how PPSS keep the extremely wide range of distribution. 

A project on the phylogeography of the PPSS 

One of the major difficulties that prevent researchers from performing 

comprehensive study in PPSS was their extremely wide distribution ranges. The 

project of PPSS was started more than 10 years ago with the leading of Dr. 

Tadashi Kajita and with propose of global population sampling as well as 

performing population genetic analyses using various molecular markers. 

Accomplishment of this project was facilitated because of development of 

aviation and transportation systems in recent two decades. Cooperation with 

oversea researchers and institutes are also promoted the project to go ahead. 

Until now more than several thousand samples were collected from 30 

countries and is ongoing project to performing phylogeographic analyses to 

reveal the speciation and population differentiation of PPSS. 

Phylogeography is a relatively new discipline that deals with the spatial 

arrangements of genetic lineages, especially within and among closely related 

species (Avise, 2009). It utilized molecular markers to reveal the evolutionary 

history of the species at the geographical scale. Novel analytical methods with 

high output are also recently developed at the population level (e.g., 

6

application of coalescent-based approaches and tree-based thinking) (Knowles 

& Maddison, 2002; Knowles, 2009). Using these methods will enable us to 

study phylogeographic patterns of PPSS. 

A case study of PPSS: Hibiscus tiliaceus L. 

Recently, one of our colleagues, Koji Takayama studied genetic structure 

of Hibiscus tiliaceus and its allied species using chloroplast DNA (cpDNA) 

polymorphisms and Microsatellite markers (Takayama et al., 2006; 2008). 

Hibiscus tiliaceus is distributed in the East Atlantic and Indo-West Pacific 

regions and its counterpart species, Hibiscus pernambucensis, is distributed in 

the East Pacific-West Atlantic regions. All together distribution range of H. 

tiliaceus and H. pernambucensis covers almost the entire littoral area of the 

tropics worldwide, a situation that could have been established through 

dispersal by sea-drifted seeds. Three morphologically similar species to H. 

tiliaceus are recognized in both the Old World (Hibiscus hamabo Siebold & 

Zucc.) and New World (Hibiscus glaber Matsum. and Hibiscus elatus Sw.). These 

three species have limited distribution ranges, which the two island endemic 

species, H. glaber and H. elatus grow in parallel at inland habitats of islands in 

both the Old and New Worlds respectively, and H. hamabo grows in temperate 

areas of West Pacific area beyond the northern limit of distribution of H. 

tiliaceus (Takayama et al., 2006). The main summary of their finding are as 

follows: 

I. Recurrent speciation from H. tiliaceus has given rise to all of its allied 

species. 

7

II. 

Frequent gene flow by long-distance seed dispersal is responsible for 

species integration of H. tiliaceus in the wide distribution range. 

III. 

American and African continents may be geographical barriers to gene 

flow by sea-drifted seeds among populations of H. pernambucensis and 

H. tiliaceus, respectively. 

IV. 

Introgression between the H. tiliaceus and H. pernambucensis was 

occurred in the Atlantic region. 

All these results are new for a sub-PPSS species and explain their wide 

distribution range; however we still do not know whether these results are 

applicable for other PPSS, especially for a genuine PPSS with global distribution. 

So, to answer this question, I focused on Canavalia rosea (Beach bean), a 

genuine member of PPSS. 

Canavalia rosea: a genuine PPSS 

Canavalia rosea (Beach bean) is mostly prostrate herbaceous vine that 

trails along beach dunes, coastal strand and rocky shores and sometimes 

climbs into low vegetation (Whistler, 1992). The thick and fleshy stem can grow 

to 6 m or more in length and more than 2.5 cm in diameter. The stem is rather 

woody near the base and several branches radiate outward, forming mats of 

light green semi-succulent foliage. Beach bean has compound leaves with 

three thick, more or less rounded, fleshy leaflets, each about 5 -12 cm long. The 

leaflets fold up under the hot sun at midday and are coriaceous, oblong to 

nearly circular in outline, obtuse to emarginate, often minutely apiculate at tip. 

Bracteoles are 1.5 mm long. Pedicel is 3 mm long. Calyx 12 mm long; 

pubescence short, white, sparse to moderately dense; upper lip much shorter 

8

than tube, upper edge constricted behind non-apiculate tip; lowest tooth 2 

mm long, acute, slightly exceeding acute laterals. Standard is 3 cm long. The 

flowers are typical pea flowers, purplish pink, about 5 cm long and borne in 

erect spikes on long stalks. Beach bean blooms most of the summer and 

sporadically the rest of the year. The pods are commonly 10-15 cm long, flat, 

moderately compressed, spirally dehiscent; each valve with sutural ribs and an 

extra rib ca. 3 mm from ventral rib. They are prominently ridged and woody 

when mature. Seeds to 18 X 13 X 10 mm, elliptic, slightly compressed, brown 

with darker marbling, mostly buoyant and indefinitely impermeable to water, at 

least for a year; hilum ca. 7 mm long (Sauer, 1964). Occasionally it is cultivated 

experimentally as a sand binder or cover crop. Flowering time is in all seasons, 

even in the subtropics. The species considered as self-compatible and it can 

also be pollinated by carpenter bee (Xylocopa) species (Arroyo, 1981; Gross, 

1993). 

Canavalia rosea is distributed throughout littoral areas of the tropics and 

subtropics around the world. It is one of the common and most widespread 

tropical seacoast plants, most commonly trailing on beaches at the outer limits 

of land vegetation, where it is usually associated with Ipomoea pes-caprae, 

occasionally climbing on littoral thickets, rarely slightly inland along roadsides 

or coastal plain lake shores. The seeds float because of a lightweight tissue and 

air space (Van Der Pijl, 1969; Loewer, 2005) and remain impermeable in water 

for years while drifting in the sea (Guppy, 1906; Nakanishi, 1988; Thiel & Gutow, 

2004). The extremely wide distribution of C. rosea is considered to be a result 

of long distance seed dispersal by sea-drifted seeds; however, we do not have 

9

any empirical data and don't know whether the gene flow by seed dispersal is 

kept throughout the distribution range over the globe. 

There are three related species to C. rosea; Canavalia cathartica Thouars, 

C. lineata L. and C. sericea A. Gray from the same subgenus Canavalia, which is 

distributed in coastal areas of Indo-Pacific Oceanic regions. Their 

morphological similarity suggests that they might be closely related to each 

other. Given the wide distribution of C. rosea and the limited distribution of the 

other three species, the three species of more limited distribution might have 

diversified from the widely distributed species. Moreover, there are six endemic 

Canavalia species in Hawaiian Islands (subgenus Maunaloa). There is 

hypothesis that these species might originate from species which reach to the 

Hawaiian island by sea drifted seed dispersal (Sauer, 1964). Although the 

presence of several closely related species with limited distribution are likely to 

be explained by recurrent speciation from widely distributed species, as were 

shown in H. tiliaceus; the speciation process among C. rosea and these species 

is still in question. 

The main questions addressed in this thesis are: (1) Have recurrent 

speciation occurred in the distribution range of C. rosea? and (2) Can a single 

species keep gene flow over the extremely wide range of distribution? 

Overview of this study 

In chapter 1, I will study the phylogenetic relationships and evolutionary 

history among C. rosea and its allied species as well as Hawaiian endemic 

species based on cpDNA and internal transcribed spacers (ITS) of nuclear 

ribosomal DNA (nrDNA) sequences, which enable to investigate multiple lines 

10

of evidence. In chapter 2, I will study global phylogeography and genetic 

structure of C. rosea and its allied species based on the cpDNA sequences, 

which provide an ideal marker for studying gene flow through seed dispersal. 

Finally, based on the results obtained in this study, I will discuss importance of 

sea-drifted seed dispersal for the speciation and integration of C. rosea. 

11

CHAPTER 1 

PHYLOGENETIC RELATIONSHIPS AMONG CANAVALIA ROSEA AND 

ITS ALLIED SPECIES 

1-1 Introduction 

The genus Canavalia Adans, 1763, is distributed in tropics and subtropics 

of all over the world (Lackey, 1981; Schrire, 2005). According to the latest 

taxonomic revision, the genus are further divided into four subgenera, namely, 

Catodonia (7 species) and Wenderothia (16 species) mostly distributed in the 

New World, Canavalia (23 species) in both the Old and New World which 

includes some crop species, and Maunaloa (6 species) which is endemic to 

Hawaii Islands (Sauer, 1964). Sauer (1964) studied the morphological 

differences/similarities among species and considered that the most primitive 

subgenus would be Wenderothia, and subgenera Catodonia and Canavalia 

would be originated from it. He also considered that subgenus Maunaloa 

would be originated from subgenus Canavalia because of the presence of a 

pantropical species, Canavalia rosea, in the subgenus. 

12

Canavalia rosea is a typical member of the plant group called 

“Pantropical Plants with Sea-drifted Seeds (Takayama et al. 2006, 2008)"; 

abbreviated as PPSS. These species are distributed in littoral areas of the 

tropics and subtropics all over the world and their main mode of seed dispersal 

is sea-dispersal. In addition, C. rosea has some closely related species from 

subgenus Canavalia which have sea-dispersal, namely, C. cathartica which is 

distributed over Indo-West Pacific regions, C. lineata in South East Asia and C. 

sericea in South West Pacific. These species are distributed within distribution 

range of C. rosea. The other species which is known to have sea-drifted seeds is 

C. bonariensis of subgenus Catodonia. All other species of genus Canavalia do 

not have sea-drifted seeds and their main mode of seed dispersal is 

mechanical (thrown by dehiscent of pods) or gravity dispersal. Although the 

presence of several closely related species with limited distribution are likely to 

be explained by recurrent speciation from widely distributed species, as were 

shown in H. tiliaceus (Takayama et al., 2006); the speciation process among C. 

rosea and its related species from subgenus Canavalia is still in question. 

Moreover, given the distribution ranges of the species and their modes of seed 

dispersal, Sauer (1964) and Carlquist (1966) suggested that the endemic 

species of Hawaii Islands might be originated from the species that reach to 

the Hawaiian Islands by sea-dispersal, and the species would plausibly be the 

pantropical species, Canavalia rosea. However, this hypothesis has never been 

tested using modern molecular phylogenetic methods. 

13

To test the hypothesis about the origin of Hawaiian endemic species of 

Canavalia and speciation process among C. rosea and its related species, we 

employed both nuclear and chloroplast DNA markers. These markers have 

been successfully used to study the origin of Hawaiian endemic species in 

other plant groups (Baldwin & Wagner, 2010). Chloroplast DNA is regarded as 

single locus and maternally inherited through seeds in most angiosperms 

(Mogensen, 1996), and it has been utilized to discover phylogenetic 

relationships in many plant species (Soltis & Soltis, 1998). In addition, nuclear 

DNA markers can also be used in combination with cytoplasmic markers to 

decipher phylogenetic relationships among closely relates species, as using 

multiple lines of molecular markers with highly polymorphic loci could give 

resolved topologies than single locus (Small et al., 1998; Brito & Edwards, 2009; 

Calonje et al., 2009). Although a recent phylogenetic study on tribe Diocleinae 

based on nrDNA ITS sequences (Varela et al., 2004) showed that subgenus 

Canavalia was sister to Catedonia, taxon sampling of the study was not enough 

to reveal phylogenetic relationships of the four subgenera and the origin of 

Hawaiian endemic species. I studied all species of subgenus Maunaloa together 

with other samples of C. rosea and its closely related species, in addition to 

both representative species of subgenera Wenderothia and Catodonia. 

14

1-2 Materials and Methods 

Taxon sampling 

Leaf samples were collected in large-scale, covering almost all 

distribution ranges of the species. For cpDNA phylogenetic analyses, in total, 

62 individuals from Canavalia rosea, 5 individuals from C. cathartica, 4 

individuals from C. lineata, and 3 individuals from C. sericea were included in 

phylogenetic study (Table 1-1). Moreover, an inland species, Canavalia virosa 

(Roxb.) Wight & Arn., two crop species, Canavalia ensiformis (L.) DC. (Common 

Jack bean) and Canavalia gladiata (Jacq.) DC. (Sword bean) from the subgenus 

Canavalia were added in the phylogenetic analyses (Table 1-1). For nrDNA ITS 

phylogenetic analyses selective samples from C. rosea and its related species 

were included (Table 1-2). All Hawaiian endemic species from subgenus 

Maunaloa including Canavalia molokaiensis Degener & al., C. hawaiiensis 

Degener & al., C. napaliensis St. John, C. galeata Gaudich., C. pubescens Hook. 

& Arn., and C. kauaiensis J.D. Sauer (St. John H, 1970; Wagner et al., 1999) were 

also included in either cpDNA and ITS analyses. Canavalia parviflora Benth. was 

added in the phylogenetic analyses as a representative species from subgenus 

Catedonia. Canavalia hirsutissima J.D. Sauer and Canavalia villosa Benth. from 

15

subgenus Wenderothia were chosen as outgroups according to Sauer (1964) 

and Varella (2004). Voucher specimens were deposited in the herbarium of 

University of the Ryukyus (RYU), Jardim Botânico, Rio de Janeiro (RBRJ) and 

Bishop Museum, Honolulu, Hawaii. 

DNA extraction, PCR, and sequencing 

Genomic DNA was extracted from dried leaves using modified CTAB 

(cetyltrimethyl ammonium bromide) method (Doyle & Doyle, 1987) and DNA 

concentration was measured by GeneQuant 100 electrophotometer (GE 

Healthcare, Life Sciences). After an initial screening of 15 cpDNA candidate 

non-coding regions (Shaw et al., 2007), six highly variable regions including 

intergenic spacers (IGS) and introns were chosen for further steps (Table 1-3). 

For nuclear genome, nuclear rDNA ITS was sequenced. Polymerase chain 

reactions (PCR) were performed in 10-25 µL volume reactions containing 1.25 

units ExTaq (TaKaRa), 0.2 mM of dNTPs, 10x PCR buffer contains 1.5 mM MgCl2, 

0.5–1 µM of each primer pairs, and 20 ng genomic DNA. The PCR conditions 

were as follows: 3 min for initial denaturation at 95 °C, followed by 35 

amplification cycles of 1 min denaturation at 95 °C, 1-2 min annealing at 

fragment-specific temperatures (see Table 1-3), 1-2 min extension at 72 °C, and 

a final 10 min extension at 72 °C. The PCR products were visualized by 0.8 % 

agarose gel electrophoresis and purified using either GENECLEAN III kit 

(Qiagen) or ExoSAP-IT (USB Corp., Cleveland, Ohio, USA) following the 

manufacturer's instructions. 

The cycle sequencing reactions were carried out using a BigDye 

Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems) and sequencing 

16

eaction products were purified by ethanol precipitation method. All DNA 

sequences were determined with ABI 377 or ABI 3500 DNA sequencer (Applied 

Biosystems). For ITS sequences which direct sequencing yielded unreadable 

electropherograms, TOPO-TA cloning kit (Invitrogen) was subsequently used 

according to the manufacturer’s instructions. In total for 19 individuals from 14 

species cloning method were used. Twelve colonies from each sample were 

picked up, purified and amplified via TempliPhi DNA Sequencing Template 

Amplification Kits (GE Healthcare). This kit utilize bacteriophage Phi29 DNA 

polymerase and rolling circle amplification (RCA) technology (Polidoros et al., 

2006) for rapid amplification of circular template DNA. The products were then 

sequenced using the ABI Big Dye Terminator v3.1 Cycle Sequencing Ready 

Reaction kit (Applied Biosystems). Both forward and reverse strands were 

assembled manually using the Autoassembler 2.1 (Applied Biosystems) with 

default setting. Sequences manually edited and aligned with Se-Al v2.0a11 

(Rambaut, 2002). Seven Indels and inversions from cpDNA sequence data set 

were coded as separate binary characters according to Kelchner (2000) 

Simmons & Ochoterena (2000) and Ingvarsson (2003). However, length 

variations, all gaps containing homopolymers, AT-rich regions and two 

homoplasious inversions were excluded from all analyses. For the ITS sequence 

data set, cloned products were assembled and singleton mutations were 

excluded by comparing to the corresponding direct ITS sequence data of this 

study. These singletons were presumed as a result of Taq or PCR error in 

cloning method. I chose a threshold that less than two singletons from aligned 

sequence data were removed from the data set. After making final dataset, 

haplotype file in Nexus format was made by the program DNAsp v. 5.10.01 

17

(Librado & Rozas, 2009). Sequences were deposited to the GenBank under the 

accession numbers ### ###. 

Phylogenetic analyses based on cpDNA sequence data 

As the chloroplast genome is inherited as a single unit without 

recombination, combining sequences from multiple cpDNA regions can be 

justified (Soltis & Soltis, 1998). Because all six cpDNA sequenced regions used 

in this study occur in the haploid chloroplast genome and their histories are 

linked, there is no priori reason to infer that their resulting gene trees will differ. 

However, their patterns of evolution might be different (e.g. differences in 

evolutionary rates and/or base compositions), leading to the incongruence 

among datasets (Bull et al., 1993; Wiens, 1998). Keeping these in mind, I 

concatenate all these regions to a single sequence data set. 

Maximum parsimony (MP), maximum likelihood (ML) and Bayesian 

phylogenetic inference were employed for phylogenetic analyses using a 

concatenate data set (Table 1-3). MP analyses were conducted in PAUP* 

v.4.0b10 (Swofford, 2002) using heuristic searches, tree-bisection–reconnection 

(TBR) branch swapping algorithm, and all characters were unweighted and 

unordered. Branch support was evaluated by bootstrapping method of 

Felsenstein (Felsenstein, 1985) based on 1000 replicates. 

ML analysis was employed using the program RAxML (Randomized 

Axelerated Maximum Likelihood) version 7.2.6 which implements a rapid hill 

climbing algorithm (Stamatakis, 2006). The analysis was run with indel and 

inversion characters removed under the GTR+G model of evolution and best- 

18

scoring ML tree inferences. Rapid bootstrap analysis was conducted with 1000 

replications to assess branch support. 

Partitioned Bayesian inference were performed with MrBayes v.3.1.2 

(Ronquist & Huelsenbeck, 2003). The data set was divided into two partitions; 

aligned nucleotides and coded indels and inversions. For nucleotide sequences 

GTR+I model was selected as a best-fit model according to the Akaike 

information criterion (AIC) by MrModel Test v.2 (Nylander, 2004) and binary 

model was employed for coded indels and inversions. Two independent 

Markov Chain Monte Carlo (MCMC) analyses with four simultaneous chains 

and 5,000,000 generations were run. Trees were sampled every 100 

generations and the first 20000 trees were discarded as burn-in. MCMC chains 

convergence was visualized with Tracer v. 1.5 (Rambaut & Drummond, 2009) 

and likelihood scores for sampled trees were inspected. 

Phylogenetic analyses based on ITS sequence data 

For nrDNA ITS sequence data, small number of samples were surveyed 

comparing to the comprehensive cpDNA samples (36 vs. 88). Maximum 

parsimony (MP) and neighbor joining (NJ) analyses were performed with 

PAUP* v.4.0b10 (Swofford, 2002) for nrDNA ITS sequences (Table 1-2). MP 

analyses were conducted using heuristic searches, tree-bisection–reconnection 

(TBR) branch swapping algorithm, and all characters were unweighted and 

unordered. Branch support was evaluated by bootstrapping method of 

Felsenstein (Felsenstein, 1985) based on 1000 replicates. The NJ tree was 

constructed using the distance set to Kimura 2-parameter model (Kimura, 

19

1980) and bootstrap analysis based on 100 replicates. Combine sequence data 

set of cpDNA and nrDNA ITS was performed based on NJ method. In the both 

method Canavalia hirsutissima and Canavalia villosa from subgenus 

Wenderothia are defined as outgroups. 

Network analyses 

20

1-3 Results 

Phylogenetic analyses based on cpDNA sequence data 

The concatenate cpDNA aligned sequence, which consisted of 88 

sequences from 16 species, yielded 27 haplotypes (H1-27) with total length of 

5654 characters after excluding all gaps and ambiguous characters. In total 

seven indels and inversions were coded as binary codes. MP analyses retained 

16112 most parsimonious trees with tree length of 145, consistency index (CI) 

of 0.862, retention index (RI) of 0.807 and rescaled consistency index (RC) of 

0.696 (Fig. 1-3). One hundred twenty-two characters were variable, of which 57 

were parsimony-informative. MP analysis inferred monophyly of all ingroup 

taxa including members of subgenus Canavalia and subgenus Maunaloa all 

together with 100% bootstrap support. Although, C. rosea is not monophyletic 

species, three major clades (I, II and III) were recognized with 93, 88 and 83 

bootstrap support, respectively (Fig. 1-3). Clade I consisted of C. rosea 

haplotypes, H5 from Java in Indian Ocean and H6 from Tanzania in Indian and 

Brazil in Atlantic Ocean. Clade II comprised 3 haplotypes (H16-18) of C. rosea 

which are exclusive to the Atlantic region samples. Haplotypes in this strongly 

supported clade are from both West and East Atlantic Ocean with longer 

21

anch length. Hawaiian endemic species of subgenus Maonalua (clade III) 

make monophyletic group with high bootstrap support (Fig. 1-3). A major 

haplotype (H8) was shared among 5 species (C. rosea, C. lineata, C. cathartica, 

C. gladiata and C. ensiformis) and also shared among 24 samples of C. rosea 

from very wide distribution range in Indian and Pacific Oceans. Haplotype H2 is 

exclusive between C. sericea and C. cathartica from Pacific Ocean and 14 

haplotypes of C. rosea (H1, H3-4, H7, H9-15 and H19-21) which are mainly 

from Atlantic Ocean made polytomies in all phylogenetic analyses. Canavalia 

lineata have only an identical haplotype (H8) with C. rosea, but C. cathartica 

own two haplotypes (H2 and H8) which are shared with C. sericea and C. rosea, 

respectively (Figs 1-3 and 2-1). Maximum likelihood tree (not shown) and 

Bayesian majority role consensus tree (Fig. 1-4) represented an identical 

topology for the main clades which was found in MP analyses. 

Phylogenetic analyses based on ITS sequence data 

Total sequence length of nrDNA ITS was 782 for 36 samples and aligned 

sequence after excluding all gaps and ambiguous characters yielded 674 bp 

(Table 1-2). The analyses inferred monophyly of all ingroup taxa including 

members of subgenus Canavalia and subgenus Maunaloa all together with 

100% bootstrap support same as resultant trees from cpDNA sequences. The 

Hawaiian endemic subgenus Maunaloa was grouped with subgenus Canavalia 

rather than other subgenera (Wenderothia and Catadonia) (Fig. 1-5). MP 

analysis results were revealed that members of subgenus Maunaloa is 

polyphyletic. Although clear phylogenetic relationships among ingroup taxa 

22

were not obtained (polytomy), Hawaiian endemic species and some species 

have multiple copies of ITS sequences. A copy is shared among all species 

including C. rosea and others species (haplotype H1). 

Resultant tree from combined dataset of cpDNA and nrDNA ITS show that 

subgenus Maunaloa is a monophyletic group with high statistical support 

(bootstrap value 88%; Fig. 1-6). Overall, in the nrDNA ITS trees, also same as 

cpDNA trees, clear relationships among C. rosea and its allied species was not 

resolved. 

23

1-4 Discussion 

Phylogenetic relationships among C. rosea and its related species 

Phylogenetic analyses based on ca. 6000 bp cpDNA sequences are revealed a 

monophyletic group including members of subgenus Canavalia and subgenus 

Maunaloa (Fig. 1-3) which is disclosed by morphological (Sauer, 1964) and 

cladistic surveys (De Queiroz et al., 2003). However, our results do not 

segregate clear species relationship among C. rosea and its allied species even 

using high variable cpDNA regions (Fig. 1-3). Therefore understanding 

evolutionary history among these species is rather complicated, and additional 

sequences from nuclear genome and ecological surveys are essential to 

address such issues (Cronn et al., 2002). On the other hand, the genealogy of 

the cpDNA haplotypes appears somewhat “star phylogeny” (Fig. 2-1), with a 

common ancestral-like haplotypes (e.g. H7 and H8) lie at the central position 

and recent derivatives (rare haplotypes) independently connected to it by short 

branches (Avise, 2000). In general, such gene genealogies are interpreted as a 

result of range expansion (Slatkin & Hudson, 1991; Excoffier, 2004). 

Considering phylogenetic trees and haplotype network (Figs 1-3 and 2-1), its 

plausible to suppose that recurrent speciation happened among C. rosea and 

its allies as reported in numerous plant species (Schaal et al., 1998; Kay et al., 

2005; Mort et al., 2007). 

Shared haplotypes of C. cathartica with C. rosea (H8) and C. sericea (H2) 

might be sign of retention of ancestral polymorphisms or traces of recent 

introgression events. Because I used relatively long cpDNA sequences, this 

24

event could not have been caused by lack of information on cpDNA regions. 

Therefore the possibility of introgressive hybridization is more likely, however, 

even extensive organelle sequence data sets may have not sufficient power to 

conclusively resolve between the ancestral retention and contemporary 

introgression (Donnelly et al., 2004). 

Interestingly, two well-known crop species Canavalia ensiformis 

(Common Jack bean) and Canavalia gladiata (Sword bean) have completely 

identical cpDNA sequence haplotype with C. rosea (H8) with using ca. 6000 

highly variable regions. This case shows that cpDNA genome of these crop 

species is same with C. rosea and might suggest that introgression happened 

among these species and/or they might be derived from C. rosea, however 

further study is necessary. 

The phylogeographic break in the Atlantic Ocean 

Usually, when there is a sharp geographic boundary between widely 

distributed clades, researchers assume that such breaks are the result of 

geographic barriers to dispersal, cryptic species boundaries, or recent contacts 

between historically allopatric populations (Irwin & Gibbs, 2002). The 

haplotypes of clade II (H16-18) are specific to Atlantic region with high 

probability support and Long Branch length (Fig. 1-3). Although possibility of 

cryptic species cannot be completely rejected and the populations in the 

African Oceanic regions are not kind of allopatric populations, I considered that 

long-term geographic barrier to dispersal is responsible to such kind of 

phylogeographic break in the Atlantic Ocean (Fig. 2-2). 

25

Origin of the Hawaiian endemic species 

Volcanic oceanic islands such as Hawaii which have never been 

connected to the continents can be colonize by species which have dispersed 

to the islands from elsewhere. These islands which separated by thousands of 

kilometers from a source population are usually colonized by water or animaldispersed 

plant species. According to phylogenetic analyses using nucleotide 

sequences of 6 chloroplast DNA regions (clade III, Fig. 1-3) and combined 

sequence data set of cpDNA and nrDNA ITS (Fig. 1-6), Hawaiian endemic 

subgenus, Maunaloa, was monophyletic with high bootstrap support (84% and 

88%, respectively) and it was closely related to subgenus Canavalia than to 

other subgenera. These results suggest that the Hawaiian subgenus is a result 

of single colonization event to the Hawaiian archipelagos. 

Although ancestral lineage of Hawaiian endemic Canavalia was not 

clearly solved but it is plausible to assume that an ancestral species of Hawaiian 

endemic species, was somewhat similar to C. rosea which has sea-drifted seed 

dispersal ability to reach the Hawaiian Islands. Sauer (1964) and Carlquist 

(1966) reported loss of seed buoyancy for the members of subgenus Maunaloa. 

The loss of seed buoyancy in these species might be due to decreased air 

space in the seeds. In C. rosea, air spaces between the folds of the cotyledons 

help long-term seed buoyancy on sea water (Nakanishi, 1988). Loss of seed 

buoyancy in oceanic island species is a common phenomenon and occurred in 

many species in Hawaiian endemic plants (Carlquist, 1974). Loss of seed 

dispersal ability had occurred in response to the habitat shift toward inlands 

during the speciation process of members of subgenus Maunaloa. 

26

The important attribute of reduced seed dispersibility is expected to 

restrict gene flow among local populations within the Islands, and may lead to 

genetic differentiation among populations. Further studies are required to 

assess gene flow and population genetic structure in inland species. 

Future prospects for the evolutionary studies among C. rosea and its allied 

species 

Although with using more than 6000 bp cpDNA sequences I could get 

overall phylogenetic relationships among C. rosea and its related species, 

however, clear evolutionary history among them is not resolved. This is not the 

only case which single locous is not able to decipher phylogenetic relationships 

among taxa (Cronn et al., 2002). Given the difficulties that closely related taxa 

such as the C. rosea present in terms of phylogenetic resolution, and the low 

sequence divergence found in cpDNA and nrDNA ITS sequences, novel 

approaches are needed to integrate not only a combination of single copy 

genes, but also multiple molecular markers such as Microsatellite or AFLP 

markers (Scherson et al., 2005). The use of multiple and independent nuclear 

loci, promises not only to resolve phylogenetic relationships but also offers a 

means by which speciation events may be solved in PPSS. 

The results of cpDNA phylogeny suggest that recurrent speciation might 

occur among C. rosea and its allied species in oceanic islands. However, 

complete segregation has not been established between these species and 

also some crop species. As theory suggests, long distance dispersal play a role 

for range expansion of species and because of less flow in marginal 

27

populations, speciation might occur. Taking account the limited distribution 

range of allied species of C. rosea and also endemic species of Hawaiian Islands, 

this kind of speciation might occurred among C. rosea and its daughter species 

(C. cathartica, C. lineata and C. sericea) in Indo-West pacific region and also for 

Hawaiian endemic species at oceanic islands which produced an endemic 

subgenus. In terms of speciation, long distance seed dispersal clearly 

contributed in species diversity in oceanic islands. 

28

Subgenus Taxon Oceanic Region Locality N. 

Canavalia C. rosea (Sw.) DC. 

Indian Ocean South Africa Umdloti 2 

Tanzania Dar es salaam 2 

Sri Lanka Wattala, Negambo 2 

Thailand Phuket, Kmala Beach 1 

Indonesia Bali 1 

Java 1 

Sumatra 1 

Australia Darwin 2 

Headland Harbour 1 

West Pacific Thailand Kho Samui 1 

Taiwan Houpihu 1 

Singapore Singapore 1 

Philippine Quezon, Luzon 1 

Australia Queensland 2 

Japan Iriomote 2 

New Caledonia Plage de poe 1 

Fiji Korotogo 1 

Tonga Sopu 1 

Samoa Samoa 1 

Marquises Taipivai, Nuku Hiva 1 

East Pacific Mexico Nayarit 2 

Sinaloa 1 

Oaxaca 1 

Costa Rica Jaco Beach 1 

Panama Veracruz 1 

Ecuador Isla Jambel 1 

West Atlantic Mexico Coatzcoalcos 2 

Costa Rica Puerto Viejo 1 

Panama Pina, Colon 4 

Cuango, Colon 3 

Brazil Para 2 

Gaibu Pernanbuco 1 

Rio De Janeiro, Arraial do Cabo 1 

Rio De Janeiro, Recreio 2 

East Atlantic Senegal Joal-Fadiout 8 

Ghana Busua beach 4 

Angola Musul, Luanda 1 

Subtotal 62 

Table 1‐1. List of Canavalia samples used for cpDNA phylogenetic analyses. N, number 

of individuals in each population. (to be continued) 

29

Subgenus Taxon Oceanic Region Locality N. 

C. cathartica Thouars Pacific Philippine Atimona 1 

Samoa Samoa 1 

Tonga Tonga 1 

Tahiti Tahiti 1 

Hawaii Kauai 1 

Subtotal 5 

C. lineata (Thunb.) DC. Pacific Taiwan Maopi Tao 1 

Japan Ishigaki 1 

Miyazaki 1 

Ogasawara 1 

Subtotal 4 

C. sericea A. Gray Pacific Tonga Haashini-Lavengatonga 2 

Hawaii Maui, Bishop Museum 1 

Subtotal 3 

C. virosa (Roxb.) Wight & Arn. Atlantic Africa Seed purchased 1 

C. gladiata (Jacq.) DC. Pacific Japan Seed purchased 1 

C. ensiformis (L.) DC. Pacific Japan Seed purchased 1 

Maunaloa C. hawaiiensis Degener & al. Pacific Hawaii Bishop Museum 1 

C. napaliensis St. John Pacific Hawaii Bishop Museum 1 

C. galeata Gaudich. Pacific Hawaii Bishop Museum 1 

C. pubescens Hook. & Arn. Pacific Hawaii Bishop Museum 1 

C. kauaiensis J.D. Sauer Pacific Hawaii Bishop Museum 1 

C. molokaiensis Degener & al. Pacific Hawaii Bishop Museum 1 

C. hawaiiensis Degener & al. Pacific Hawaii Center for Conservation Research and Training (CCRT) 1 

C. galeata Gaudich. Pacific Hawaii Center for Conservation Research and Training (CCRT) 1 

Catodonia Canavalia parviflora Benth. Atlantic Brazil Jardim Botanico (Rio de Janeiro) 1 

Wenderothia Canavalia villosa Benth. Atlantic Mexico MEXU 1 

Canavalia hirsutissima J.D. Sauer Atlantic Mexico MEXU 1 

Total 88 

Table 1‐1. continued 

30

N. Subgenus Taxon Oceanic region Locality DNA voucher Sequence method 

1 Canavalia C. rosea (Sw.) DC. Indian Ocean South Africa Umdloti 98 Cloning 

2 Tanzania Dar es salaam 184 Cloning 

3 Sri Lanka Wattala, Negambo 31 Cloning 

4 Indonesia Sumatra 500 Direct 

5 Australia Headland Harbour 1 Direct 

6 West Pacific Marquises Taipivai, Nuku Hiva 31 Direct 

7 Tonga Sopu 171 Direct 

8 East Pacific Mexico Sinaloa 965 Direct 

9 Panama Veracruz 202 Direct 

10 Ecuador Isla Jambel 1205 Direct 

11 West Atlantic Panama Cuango, Colon 110 Direct 

12 Panama Pina, Colon 24 Cloning 

13 Costa Rica Puerto Viejo 346 Cloning 

14 Mexico Coatzcoalcos 71 Cloning 

15 Brazil Gaibu Pernanbuco 70 Cloning 

16 East Atlantic Senegal Joal-Fadiout 107 & 118 Cloning 

17 Ghana Busua beach 5 Direct 

18 Angola Musul, Luanda 0 Cloning 

Subtotal 19 

19 C. cathartica Thouars Pacific Philippine Atimona CH10 Cloning 

Subtotal 1 

20 C. lineata (Thunb.) DC. Pacific Taiwan Maopi Tao CL1 Direct 

21 Japan Miyazaki 74 Cloning 

Subtotal 2 

22 C. sericea A. Gray Pacific Tonga Haashini-Lavengatonga 42 Direct 

23 Pacific Tonga Haashini-Lavengatonga 138 Cloning 

Subtotal 2 

24 C. virosa (Roxb.) Wight & Arn. Atlantic Africa Seed purchased S3F8 Direct 

25 Maunaloa C. hawaiiensis Degener & al. Pacific Hawaii Bishop Museum 6 Clonig 

26 C. galeata Gaudich. Pacific Hawaii Bishop Museum 7 Clonig 

27 C. kauaiensis J.D. Sauer Pacific Hawaii Bishop Museum 9 Clonig 

28 C. molokaiensis Degener & al. Pacific Hawaii Bishop Museum 4 Clonig 

29 C. napaliensis St. John Pacific Hawaii Bishop Museum 5 Clonig 

30 C. pubescens Hook. & Arn. Pacific Hawaii Bishop Museum 8 Clonig 

31 C. hawaiiensis Degener & al. Pacific Hawaii Center for Conservation Research and Training (CCRT) C6 Direct 

32 C. galeata Gaudich. Pacific Hawaii Center for Conservation Research and Training (CCRT) C7 Direct 

33 Catodonia Canavalia parviflora Benth. Atlantic Brazil Jardim Botanico (Rio de Janeiro) 809 Direct 

34 Wenderothia Canavalia villosa Benth. Atlantic Mexico MEXU 23 Direct 

35 Canavalia hirsutissima J.D. Sauer Atlantic Mexico MEXU 11 Direct 

Total 36 

Table 1‐2 List of Canavalia samples used for nrDNA ITS phylogenetic analyses. 

31

Primer name Length (bp) Primer Pairs Sequence (5'- 3') Annealing Tm. Source 

atpB -rbcL IGS 518-742 atpB GTGGAAACCCCGGGACGAGAAGTAGT 52 °C Hodges and Arnold, 1994 

rbcL ACTTGCTTTAGTTTCTGTTTGTGGTGA Hodges and Arnold, 1994 

ndhD -ndhE 670 ndhD GAAAATTAAGGAACCCGCAA 48 °C Xu et. al 2000 

ndhE TCAACTCGTATCAACCAATC Xu et. al 2000 

psbA -trnH IGS 264-338 psbA CGAAGCTCCATCTACAAATGG 48 °C Hamilton 1998 

trnH ACTGCCTTGATCCACTTGGC Hamilton 1998 

rps16 Intron 781-850 rps16 F GTGGTAGAAAGCAACGTGCGACTT 52 °C Oxelman et al., 1997 

rps16 2R TCGGGATCGAACATCAATTGCAAC Oxelman et al., 1998 

trnD -trnT 1036-1055 trnD ACCAATTGAACTACAATCCC 52 °C Demesure et al. (1995) 

trnT CTACCACTGAGTTAAAAGGG Demesure et al. (1995) 

trnK 2485-2532 trnK 1L CTCAATGGTAGAGTACTCG 52 °C Lavin et al. (2000) 

trnK 685F GTATCGCACTATGTATCATTTGA Wojciechowski et al. (2004) 

matK 789R TAGGAAATCCTGGTGGCGAGATC Hu et al. (2000) 

matK 1777L TTCAGTGGTACGAAGTCAAATG Hu et al. (2000) 

matK 1932R CAGACCGACTTACTAATGGG Hu et al. (2000) 

trnK 2R AACTAGTCGGATGGAGTAG Johnson & Soltis (1994) 

nrDNA ITS 674 ITS5 GGAAGTAAAAGTCGTAACAAGG 54 °C White et al. 1990 

ITS4 TCCTCCGCTTATTGATATGC White et al. 1990 

Table 1‐3 List of primers used for amplifications and sequencing of chloroplast regions. 

PCR amplification primers are shown in bold. 

32

Figure 1‐1. Canavalia rosea and its related species. A: Canavalia rosea, B: C. 

cathartic, C: C. lineata, D: C. sericea, E: C. ensiformis, F: C. gladiata. G: C. 

villosa, H: C. pubescens,I: seed of C. ensiformis (1), C. gladiata (2), C. rosea 

(3), C. lineata (4). 

33

A 

B 

Figure 1‐2. A: Distribution range of PPSS species. B: Distribution range of Canavalia 

rosea and its related species. In each of the encircled areas, C. rosea, C. cathartica, 

C. lineata and C. sericea are distributed in the coastal areas and the members of 

subgenus Maunaloa are distributed in inland areas. 

34

Figure 1‐3. Phylogram of strict consensus tree of 16112 shortest tree based on 

Maximum Parsimony (MP) analysis from 6 cpDNA regions with ca. 6000 bp for 

Canavalia species (Tree length=145, CI= 0.862, RI= 0.807 and RC= 0.696). 

Bootstrap values are shown above branches. Canavalia hirsutissima and 

Canavalia villosa from subgenus Wenderothia and Canavalia parviflora from 

subgenus Catedonia are defined as outgroups. Twenty seven haplotypes (H1‐29) 

were detected for C. rosea and its allied species. Abbreviations in parenthesis are: 

P (Pacific Ocean); A (Atlantic Ocean); I (Indian Ocean); Numbers in the localities 

correspond to the number of sequenced individuals in that locality. 

36

Figure 1‐4. The Bayesian phylogram using 80 samples of Canavalia rosea and other 

species based on concatenate cpDNA data set. Support for nodes is estimated 

from Bayesian posterior probabilities. Support values ≥70% is given. The legends 

are as follows: P (Pacific Ocean); A (Atlantic Ocean); I (Indian Ocean). 

37

Figure 1‐5. Phylogram of strict consensus tree of 28 shortest tree based on Maximum 

Parsimony (MP) analysis from nrDNA ITS for members of subgenus Canavalia and 

Maunaloa (bold) (Tree length=92, CI= 0.9457, RI= 0.9920 and RC= 0.9381). 

Bootstrap values are shown near branches. Canavalia hirsutissima and Canavalia 

villosa from subgenus Wenderothia are defined as outgroups. Abbreviations in 

parenthesis are DNA voucher numbers. Letters A and P correspond to Atlantic 

and Pacific Oceanic regions, respectively. 

38

Figure 1‐6. Strict consensus tree resulting from combined cpDNA and ITS sequence data 

for members of subgenus Canavalia and Maunaloa (bold). Numbers near 

branches indicate bootstrap values. Canavalia hirsutissima and Canavalia villosa 

from subgenus Wenderothia are defined as outgroups. Abbreviations in 

parenthesis are DNA voucher numbers. Letters A and P correspond to Atlantic 

and Pacific Oceanic regions, respectively. 

39

Figure 1‐7. Haplotype network among Canavalia rosea and its related species based on 

statistical parsimony method. Each segment of branch shows the one step 

difference of molecular data. C. rosea has the greatest diversity of haplotypes 

in the Atlantic region than Pacific and Indian Ocean. Hawaiian endemic 

species are more closely related to a haplotype from the Atlantic (Panama‐ 

Angola) which may suggest that these species are diversified from Atlantic before 

closure of Panama Isthmus. 

40

CHAPTER 2 

GLOBAL GENETIC STRUCTURE OF CANAVALIA ROSEA; EVIDENCE 

FROM CHLOROPLAST DNA SEQUENCES 

2-1 Introduction 

Gene flow is considered as a main factor responsible for genetic 

cohesion among populations of a species (Olmstead & Palmer, 1994). In fact, 

when levels of gene flow within and among populations become high (e.g. 

greater than four migrants per generation), it homogenize the species and 

prevents genetic divergence of populations; otherwise local populations can 

evolve and eventually form a distinct species (Wright, 1931; Ennos, 1994; 

Bohonak, 1999). Population differentiation can also results from environmental 

impediments or intrinsic barriers (Avise, 2000). Therefore sufficient amount of 

genetic exchange among populations is expected to hold a species as a 

cohesive unit in spatially continuous populations. 

Populations of many plant species are spatially isolated from each other 

due to presence of physical or ecological barriers such as land masses or water 

barriers (Cain et al., 2000). As a result, the distribution range of many plant 

species are structured to the specific localities like Indo West Pacific (IWP) and 

Atlantic East Pacific (AEP) in some plant species such as mangroves (Duke et al., 

40

2002; Nettel & Dodd, 2007) and PPSS such as Hibiscus tiliaceus (Takayama et al., 

2006). In H. tiliaceus, PCR-SSCP (PCR amplification with single-strand 

conformation polymorphism) and PCR-SSP (PCR amplification with sequence 

specific primers) analyses performed on more than 1100 samples from 65 

populations worldwide to illustrate genetic structure of populations in very 

wide distribution range. The results revealed that gene flow occurred among 

populations of H. tiliaceus in Indo-West Pacific region and also over the African 

continent due to sea-drifted seeds and introgression was happened between H. 

tiliaceus and H. pernambucensis populations in the Atlantic region. On the 

other hand, the American continent was the barrier to gene flow through seadrifted 

seed dispersal among populations of H. pernambucensis (Takayama et 

al., 2006; Takayama et al., 2008). These results suggest the importance of gene 

flow through sea-drifted seeds over the barriers to keep the unity of the 

species and also the role of American continent as a strong barrier to gene 

flow. For globally distributed single PPSS such as C. rosea the existence of these 

barriers seems to be critical to keep gene flow over its distribution range as the 

possibilities of cryptic species would be expected. 

Presence of cryptic species is popular in many plants species where 

morphological diversification might not be happened among lineages. In 

chapter 1, the result of phylogenetic analyses detected some distinct 

haplotypes which were specific to the Atlantic region (clade II, Fig. 1-3). As 

discussed in chapter 1, usually when there is such kind of sharp geographic 

boundary between widely distributed clades, it is assumes that it might be a 

result of geographic barriers to dispersal or possibility of cryptic species 

boundaries (Irwin & Gibbs, 2002). However, gross population data is necessary 

41

to infer the existence of gene flow over African and American continents to 

keep the unity of C. rosea in distant populations. Therefore, the main question 

targeted in this chapter is: How can a single species keep gene flow over the 

extremely wide range of distribution? 

A variety of genetic markers can be used to quantify the gene flow 

through seed dispersal. As discussed by Parker (1998), Ouborg (1999) and 

others, these markers include allozymes, DNA sequences, microsatellites, 

restriction fragment length polymorphisms (RFLPs), and DNA randomly 

amplified from the genome (e.g., RAPDs and AFLPs). Many plants species 

exchange genes among populations by the movement of pollen and seed. 

Only dispersal via seed directly bears on colonization of new populations. 

Movement of both pollen and seed, however, leaves a genetic signature within 

and among populations. Therefore, estimating gene flow among plant 

populations from nuclear DNA, which is transferred via pollen and seed, may 

tend to overestimate seed dispersal (Cain et al., 2000). Because of this effect, 

estimation of the seed dispersal requires appropriate markers inherited only 

through seeds. In most angiosperms, chloroplast DNA (cpDNA) is regarded as 

single locus and maternally inherited through seeds (Corriveau & Coleman, 

1988; Mogensen, 1996). So, it has been utilized to discover phylogenetic and 

phylogeographic patterns in many plant species (Schaal et al., 1998; Petit et al., 

2005; Soltis et al., 2006; Avise, 2009). On the other hand, uniparentally inherited 

markers such as cpDNA may be informative at the interspecific and 

intraspecific level (Wakeley, 2003). 

There are many statistical methods for retrieving information from 

molecular markers to reveal evolutionary relationships among species and 

42

estimating important population parameters (Excoffier & Heckel, 2006). A 

variety of analytical methods exists to estimates gene flow through seed 

dispersal such as F ST -based methods (Wright, 1951), Likelihood-based methods 

(Rannala & Hartigan, 1996) and Coalescent-based methods (Beerli & 

Felsenstein, 1999). Although the latter rely on more realistic parameters than 

the others (Kuhner, 2009). 

For this purpose, I employed molecular markers using short fragments of 

6 cpDNA regions and performing population genetic analysis in global scale. 

Population genetic analyses based on pairwise F ST and coalescent-based 

methods, were conducted for 515 individuals from 48 populations using more 

than 2000 bp nucleotide sequences to elucidate the spatial genetic structure of 

C. rosea populations in its entire distribution range. 

43

2-2 Materials and Methods 

Sampling 

Leaf samples were collected in large-scale, covering almost all 

distribution ranges of the species. In total, 436 individuals (37 populations) 

from Canavalia rosea, 25 individuals (5 populations) from C. cathartica, 42 

individuals (4 populations) from C. lineata, and 12 individuals (2 populations) 

from C. sericea were included in this study (Table 2-1). Voucher specimens 

were deposited in the herbarium of University of the Ryukyus (RYU), Jardim 

Botânico, Rio de Janeiro (RBRJ) and Bishop Museum, Honolulu, Hawaii. 

DNA extraction, PCR, and sequencing 

DNA extraction, PCR and sequencing methods are same as described 

methods in chapter 1. 

Haplotype Composition and Network of C. rosea and its allied species 

In chapter 1, I surveyed more than 6000 bp cpDNA sequences for 

Canavalia samples from wide range of distribution. As sequencing of more 

than 6000 bp of cpDNA genome for all population samples (515 individuals) is 

required extra labor and cost, I targeted partial sequences of 6 cpDNA regions 

(Table 2-2) based on the results of phylogenetic analyses (cf. chapter 1). Several 

new internal primers were designed for these 6 short fragments and in total 

44

2012 base pairs were sequenced for all individuals. Sequences were edited and 

aligned as chapter 1 and haplotype composition of each population was 

recorded. The haplotypes frequency of populations was presented as pie charts 

on the world map. The genealogical relationships of haplotypes were 

constructed with TCS program (Clement et al., 2000) using statistical parsimony 

method with 95% confidence interval (Templeton et al., 1992). For population 

analyses, all populations of C. rosea were divided into five regional groups 

(West-East Atlantic Ocean, Indian Ocean and West-East Pacific Ocean) based 

on geography, phylogenetic results (cf. chapter 1) and observed haplotypes. 

Populations of C. cathartica, C. lineata and C. sericea were excluded from all 

population analyses. 

Population differentiation 

To compare chloroplast genetic diversity among population of five oceanic 

regional groups, I calculated numbers of haplotypes (H), polymorphis site (S), 

Haplotype diversity (Hd) and nucleotide diversity (π) using the program DnaSP 

version 5.10 (Librado & Rozas, 2009). To determine the amount of genetic 

differentiation among populations of C. rosea, F-statistics (F ST ) analysis (Wright, 

1951) performed by the program AREQUIN v. 3.11 (Excoffier et al., 2005). 

Pairwise F ST was calculated following the method of Weir & Cockerham (1984) 

and statistical significance was assessed using 1000 permutations. An exact test 

of population differentiation was performed to examine the null hypothesis of 

the random distribution of haplotypes across populations (Raymond & Rousset, 

1995). 

To clarify groups of C. rosea populations which are geographically 

homogeneous and maximally differentiated from each other, spatial analysis of 

45

molecular variance (SAMOVA; Dupanloup et al. 2002) was conducted. To 

ensure that the conformation of the groups (K) is not affected by the given 

initial conditions, the simulated annealing procedure is repeated 100 times 

(Dupanloup et al., 2002). The analyses were repeated for user-defined groups 

(K) from 2 to 12, and the highest FCT values was maintained as the best 

grouping of populations in case there are not included single population 

(Heuertz et al., 2004). Because SAMOVA analysis uses locality coordination and 

sampling scale in this study cover the whole equatorial belt, arbitrary 

coordinates were tried to avoid miscalculation of analyses. 

Historical migration rates between oceanic regions 

To assess migration rates, direction of gene flow and genetic diversity among 

populations of C. rosea, I applied coalescent approach (Kingman, 1982a, b) 

using the Maximum likelihood and Bayesian inference methods implemented 

in MIGRATE-N version 3.1.3 (Beerli & Felsenstein, 1999; 2001; Beerli, 2008). 

Coalescent based genealogies provide more realistic estimates of population 

parameters than other summary statistics methods (Kuhner, 2009). I was 

specifically interested in contrasting the migration rate and direction of gene 

flow between geographic regions rather than between sampled populations. 

Hence, all populations were pooled into five regional groups (West-East 

Atlantic Ocean, Indian Ocean and West-East Pacific Ocean). Given the linear 

distribution of C. rosea at coastal lines, the stepping stone migration model 

with asymmetric rates was employed (Kimura & Weiss, 1964). 

For each of the five regional groups, the genetic diversity (θ=Neμ, where 

Ne is the effective population size and µ is the mutation rate per site per 

generation), pairwise migration rate (M=m/μ, where m is the rate of migration 

46

for each locus) and number of migrants per generation (Nm=Mθ) were 

estimated. Starting parameters for migrant values and θ were generated from 

F ST calculation. For Maximum likelihood analysis, 20 short chains (length 5.0 x 

10 4 ) followed by 5 long chains (length 5.0 x 10 5 ) with sample increment of 100 

and for both run were conducted and the first 15000 generations were 

discarded as burn-in at the beginning of each chain. An adaptive heating 

scheme with 4 chains and a swapping interval of 1 was applied. Maximum 

likelihood estimates (MLE) were verified with three replicate Markov Chain 

Monte Carlo (MCMC) simulation runs to ensure convergence of similar values 

for θ. 

Bayesian MCMC coalescent modeling were also used which is provide 

parameter estimates based on full likelihood estimation and decreased 

computation time of approximation comparing to Maximum likelihood 

estimates. Bayesian parameters included an update frequency of 0.5, a 

Metropolis-Hastings sampling algorithm for both θ and M; uniform priors were 

placed on θ from 0 to 0.001 and M from 0 to 50000. Starting parameters for 

migrant values and θ were generated from F ST calculation. An adaptive heating 

scheme with 4 chains and a swapping interval of 1 was applied. I used the 

Felsenstein 84 model of evolution, and set the transition to transversion ratio 

to 2 as a default values in the program. Six independent MCMC runs of varying 

length and burn-in were conducted which produced similar results. Hence, I 

present results from the longest run which consisted a long chain of 50 million 

steps with sample increment of 100 and the first 5 million steps were discarded 

as burn-in. Using tracer v1.5 (Rambaut & Drummond, 2009) convergence of 

the likelihood in MCMC chains and effective sample size (ESS) observed 

47

following the burn-in. The analyses were considered as converged upon a 

stationary distribution, if the different runs generated similar posterior density 

distributions with a minimum ESS of 100 (Hey, 2005; Kuhner & Smith, 2007). 

Estimates of recent migration rates 

Although estimating of gene flow and migration rates using MIGRATE-N based 

on coalescent methods have many advantages comparing to the other 

conventional methods, it also has drawback in separation of recurrent gene 

flow from ancestral polymorphism (Carbone et al., 2004; Brito, 2005; Bowie et 

al., 2006; Kane et al., 2009). To distinguish whether the estimated migration 

rates from MIGRATE-N are the result of the retention of ancestral 

polymorphism or recent gene flow, additional coalescent based analyses were 

conducted using the program MDIV which is implements both likelihood and 

Bayesian methods using MCMC coalescent simulations for jointly estimating of 

the θ and M (Nielsen & Wakeley, 2001). 

Theta and M for pairwise comparisons of each of the five oceanic 

regional groups were estimated. Uniform prior Values for Mmax (maximum 

value for the scaled migration rate) and θ was set to the 10 and zero, 

respectively. The program ran under the default finite sites mutation model of 

HKY (Hasegawa et al., 1985); with Markov chain simulation for 5000000 steps, 

where the first 500000 were discarded as burn-in. Multiple runs with different 

random seeds and prior distributions were conducted to determine if the 

analyses were reached to the convergence in the mode of the posterior 

distribution (Nielsen & Wakeley, 2001). 

48

2-3 Results 

Haplotype Composition and Network of C. rosea and its allied species 

For population analyses 2012 bp aligned sequences were attained using partial 

sequence of 6 cpDNA regions which is including 12 substitutions, 2 indels and 

one inversion (Table 2-3). Through 21 haplotypes (H1-21) which were detected 

in chapter 1 by full sequence of 6 cpDNA regions among samples of four 

species (C. rosea, C. lineata, C. cathartica and C. sericea), I detected 17 

haplotypes (H1-17) by partial sequences at population level (Fig. 2-1; Table 2- 

1). Four haplotypes, H18 and H19-21 of phylogenetic analyses (chapter 1) 

could not be detected by partial sequences and therefore they are identical to 

haplotypes H16 and H7 in population analyses (this chapter), respectively. 

Haplotype network based on full sequence length were shown in figure 2-1. 

Colors in the network correspond to the haplotypes which could detect by 

partial sequence of 6 short fragments (H1-17). All haplotypes were shared 

among C. rosea populations except haplotype H2 which is exclusive to C. 

cathartica and C. sericea populations from Pacific Ocean (n= 18; Fig. 2-2; Table 

2-1). A major haplotype (H8) was shared among C. rosea, C. lineata and C. 

cathartica populations from Indian and Pacific Oceanic regions (n=293), (Fig. 2- 

2). Notably, all samples of C. lineata (n=42) have an identical haplotype with C. 

rosea haplotype (H8), however, C. cathartica shares haplotypes with C. rosea 

(H8, n=19) and with C. sericea (H2, n=6). Another major haplotypes of C. rosea 

were found in Atlantic and Indian Oceanic region including H7 (n=45), H6 

(n=32), H17 (n=29) and H16 (n=25), respectively (Table 2-1). Haplotype H1 

(n=7) shared between a population from southern Brazil (n=1) and Panama 

(n=6) in Atlantic Ocean. Haplotype H3 shared between a population from 

49

Mexico (n=2) and Senegal (n=7) in Atlantic Ocean; haplotype H4 shared 

between 2 populations from Mexico (Nayarit and Sinaloa, n=9) in Pacific Ocean 

and haplotypes H5, H9-15 are private haplotypes (haplotypes which is found 

only in one population) in oceanic regions (Fig. 2-2; Table 2-1). 

Population differentiation 

Total haplotype diversity (Hd) and nucleotide diversity (π) within C. rosea 

populations were estimated to be 0.69124 and 0.00086, respectively (Table 2-4). 

The populations at West Atlantic and East Atlantic had the highest haplotype 

diversity (0.7809 and 0.74.34, Table 2-4) and populations of the West Pacific 

Ocean share a lowest haplotype diversity and nucleotide diversity (0.03418 and 

0.00002, respectively). Pairwise F ST analysis detected genetic differentiation in 6 

out of 10 pairs of C. rosea populations (5 regional groups) from different 

oceanic regions (Table 2-5). The F ST values between the West and East Atlantic, 

Indian and West Pacific and between West and East pacific populations were 

0.13, 0.19 and 0.16 respectively. The F ST value between the Indian Ocean and 

East pacific was 0.08. On the other hand the F ST values between the East 

Atlantic and Indian and between East Pacific and West Atlantic and between 

and East pacific populations were 0.36 and 0.45 respectively. All differentiations 

were significant using an exact test (P < 0.05; Table 2-5). 

The results of SAMOVA are shown in figure 2-3 and Table 2-6. The 

SAMOVA method did not allow to unambiguously identifying the groups of 

populations (K) displaying the highest differentiation among groups, F CT . This 

was because F CT values increased progressively as K was increased, reaching a 

plateau at K = 8 (Fig. 2-3). The number of K which has highest F CT without 

single population was K=3 which is divide all populations to three groups 

50

(Table 2-6). First group comprise populations from Ghana, Mexico (A), Panama 

(colon2), Para and Senegal. Second group includes populations from 

Pernambuco, Rio De Janeiro (1 and 2) and Java and the last groups 

corresponds to the rests of populations (Table 2-6). The composition of these 

three groups is partially corresponding to the geographical distribution of 

haplotypes visually identified on the haplotype frequency map (Fig. 2-2). From 

K=4 to K=10 all groups includes at least single population (populations which 

have private haplotypes) which is not appropriate to the analysis (Heuertz et al., 

2004). 

Historical migration rates between oceanic regions 

Coalescent-based maximum likelihood estimates (MLE) from MIGRATE-N 

indicate asymmetric gene flow along the distribution range of the C. rosea 

populations (Table 2-7). The MLE showed that genetic diversity was highest in 

the West Atlantic region (θ = 0.0163), and lowest in the West Pacific region (θ 

= 0.0069). The most probable estimates of migration rates (M) ranged from 0 

to 395.7, with the highest migration observed out of the East Atlantic into the 

West Atlantic. In contrast, estimates of migration in the both side of Panama 

Isthmus as well as into the Indian Ocean from the East Atlantic were zero (Table 

2-7). Comparing with high migration rates between West-East Atlantic region 

and between Indian-West Pacific region, migration between the West and East 

Pacific was low but significantly greater than zero. The direction of migration 

was asymmetrical, with the West Atlantic region experiencing a greater input of 

polymorphism due to migration (M EA to WA = 395.7) than the East Atlantic (M WA 

to EA = 166.4). Based on values of M and θ, I calculated a mean probability of 

number of migrants per generation (Nm) among 5 regional groups (Table 2-7) 

51

which the highest was greater than 8 migrant per generation within East-West 

Atlantic region and the lowest was zero between Western and eastern side of 

American continent and Indian region to the Atlantic region. The estimated 

number of migrants between Indian-West Pacific pairs and between West-East 

Pacific pairs were 5.5 and near 1, respectively. 

Results of pairwise F ST and MIGRATE-N among Indian and West Pacific 

Oceanic regions show relatively low genetic differentiation (F ST = 0.19, Table 2- 

5) and high number of migrants (Nm >5 per generation), respectively (Table 2- 

7). Rates of gene flow between West and East Pacific regions (F ST = 0.16; Nm ≅ 

1) were lower than that of between Indian and West Pacific which may 

consequence of very long distance between population in pacific Oceans. 

Bayesian inference of theta and Migration rates among five groups are 

plotted on figures 2-4 and 2-5 respectively. Although Bayesian estimation of 

migration rates looks much bigger than Maximum likelihood estimation but in 

total estimates of number of migrants (Nm) are almost equal in ML and 

Bayesian estimation (see fig. 2-6 and Table 2-7). Highest number of migrants 

was from West Pacific to the Indian Ocean (Nm=10.98; fig. 2-6) and East 

Atlantic to West Atlantic region (Nm=9.01). 

Estimates of recent migration rates 

Figure 2-7 shows the posterior distributions for migration rates (M) and 

mutation rates (θ) obtained from MDIV program among population of C. rosea 

at different regional groups. Results are interestingly comparable with the 

results of MIGRATE-N (Figs. 2-4, 2-5 and Table 2-7). For example, migration 

rates between East Atlantic and Indian Oceanic region and also between East 

52

Pacific and West Atlantic region was definitely low among populations 

comparing to the populations at three other regional groups (Fig. 2-7). These 

results are concordant with MIGRATE-N results and reveal that observed gene 

flow within East and West Atlantic, Indo-West Pacific and also between West 

and East Pacific is likely result of recent gene flow than retention of ancestral 

polymorphism. 

53

2-4 Discussion 

Gene flow in Indo-Pacific Ocean through Long Distance Seed Dispersal 

Geographical variation of cpDNA haplotypes is expected to indicate gene flow 

through seed dispersal as chloroplast genome is maternally inherited 

(Mogensen, 1996). When seed-mediated gene flow frequently occurs among 

populations, distribution of cpDNA haplotypes will be homogeneous in spatial 

scale. Population genetic analyses (Fig. 2-2, Tables 2-4 and 2-5) show high 

levels of gene flow and low levels of population structure both within and 

between populations of C. rosea across Pacific and Indian Oceanic regions. The 

major haplotype of C. rosea (H8) has an extremely wide distribution range from 

South Africa in the West Indian Ocean to Panama in the East Pacific Ocean (Fig. 

2-2). Results of Fst, MIGRATE-N and MDIV also show low genetic 

differentiation among Indian and West Pacific Oceanic regions (F ST = 0.19) and 

high number of migrants (Nm > 5 per generation, Table 2-7), respectively. 

Rates of gene flow between West and East Pacific regions (F ST = 0.16; Nm ≅ 1) 

were lower than that of between Indian and West Pacific which may due to 

very long distance between populations in the Pacific Ocean. According to the 

theoretical thoughts such amount of migrants is enough to keep the unity of 

species in such long distances (>25000 kilometers). 

If we consider the results of SAMOVA, the populations in the Atlantic 

region are differentiated from Indo-Pacific regions (table 2-6). In the number of 

K=3 (Table 2-6), populations of most of Atlantic and one population from 

Indian Ocean (Java) is grouped in two groups and rest of populations from 

Indo-Pacific regions are making an integrate group. The result of coalescent 

methods from MIGRATE-N and MDIV programs are also coherent with 

54

SAMOVA results, as significant differentiation between Indo-Pacific oceanic 

regions was not detected. Hence, long distance dispersal of drifted seeds by 

oceanic currents appears to be the most probable explanation for the present 

distribution patterns of C. rosea haplotypes within Indo-Pacific oceanic. Overall, 

these results suggest that substantial gene flow occurs among populations of 

Indo-Pacific oceanic regions by sea-drifted seeds which are impermeable in 

water for years (Guppy, 1906; Thiel & Gutow, 2005). 

Although overall haplotype diversity and population differentiation is 

very low between the West and East Pacific Oceanic region, however migration 

rates between these oceanic regions is low comparing to the other regions like 

between Indian and West Pacific region (Fig. 2-6, Table 2-7). A possible 

explanation to this outcome can be presence of very long distance between 

West and East Pacific populations which makes difficult dispersal of seeds by 

oceanic currents (Figs., 2-2, 2-6 and Table 2-7). Another interpretation can be 

the role of the East Pacific barrier in this region as similar results have seen in 

another PPSS, Ipomea pes-caprae (Wakita, unpublished) and Hibiscus tiliaceus 

(Takayama et al., 2006). Thus, land masses such as African and American 

continents not only could be barriers to the seed dispersal for C. rosea and also 

other PPSS but also Ocean currents itself are as intrinsic barriers to seed 

dispersal which naturally are main barrier to the terrestrial plants (Murray, 1986; 

Sauer, 1988; Cox & Moore, 2005; Thiel & Haye, 2006). 

55

A strong genetic difference between the Indo-Pacific and Atlantic populations of 

C. rosea 

The results of phylogenetic (chapter 1) and population genetic analyses 

clearly exhibit genetic structure in the populations of Atlantic region even very 

limited gene flow have occurred between the Atlantic and Indian Oceanic 

region (H6 shared between Brazil and Tanzania populations, Figs. 2-1 and 2-2). 

Pairwise F ST analysis revealed presence of genetic differentiation between the 

West Atlantic and East Pacific region (F ST = 0.45) and between the East Atlantic 

and Indian Oceanic region (F ST = 0.36). Results of migration analyses also unveil 

that migration to the in and out of Atlantic region is restricted except some 

migrants from East Atlantic to the Indian Ocean (Nm=1.6; see Table 2-7). These 

results confirm that African and American land masses are geographical 

barriers to gene flow through seed dispersal by oceanic currents among C. 

rosea populations, as observed in another PPSS Hibiscus tiliaceus (Takayama et 

al., 2006) and Ipomea pes-caprae (N. Wakita, unpublished) and also in 

mangrove species (Dodd et al., 2002; Duke et al., 2002; Nettel & Dodd, 2007). 

Inference of patterns of current or historical gene flow from gene 

genealogies seems straightforward when there is a sharp geographic boundary 

between two widely distributed clades (Irwin & Gibbs, 2002). Usually, 

researchers assume that such boundary is the result of geographic barriers to 

dispersal or cryptic species boundaries. The haplotypes H16-18 are specific to 

Atlantic region with high probability support and Long Branch length (Fig. 2-1). 

Although possibility of cryptic species cannot be completely rejected and the 

populations in the African Oceanic regions are not kind of allopatric 

populations, I considered that long-term geographic barrier to dispersal is 

56

esponsible to such kind of phylogeographic break in the Atlantic Ocean (Fig. 

2-2). 

Directional gene flow within Atlantic region was suggested by MIGRATE- 

N; as migration rates from the East to the West Atlantic were two times larger 

than vice versa (M EA to WA = 395.65; M WA to EA = 166.42). These results might 

correspond to the variation of the strength of tropical Atlantic’s major currents 

which regarded as transatlantic dispersal in Atlantic region (Renner, 2004). 

Chloroplast DNA sequences detected highly differentiated populations of C. 

rosea in southern Brazil (H6, Fig. 2-2). Although there are no known barriers, 

the bifurcating status of the South Equatorial Current at the north-eastern horn 

of Brazil to the northward and southward (Fratantoni et al., 2000; Renner, 2004), 

appears to be potential barrier to gene flow. These opposite ocean current 

directions may promote the genetic differentiation of the C. rosea populations 

in southern Brazil which is also the case in H. pernambucensis populations 

(Takayama et al., 2008). 

Overall, same haplotypes are distributed in the all range of Indo-Pacific 

regions and also over Africa (Fig. 2-2). Similar results also were found in other 

PPSS such as Hibiscus tiliaceus and H. pernambucensis (Takayama et al., 2006; 

Takayama et al., 2008) and Ipomea pes-caprae (N. Wakita, unpublished). The 

results suggested that this kind of haplotype distribution patterns was occurred 

due to long distance dispersal of sea-drifted seeds which keep the unity of 

these species over such a long distances. However, additional data using 

molecular markers is necessary to assess the possibility of cryptic species in the 

Atlantic region for C. rosea populations and also verify presence of the gene 

57

flow over Isthmus of Panama which was restricted by sea-drifted seed dispersal 

according to the cpDNA sequence results. 

58

2-5 Conclusion 

Chloroplast DNA sequence revealed that frequent gene flow through longdistance 

seed dispersal occurs over the Pacific and Indian Oceanic regions and 

also within Atlantic region. Chloroplast DNA sequence also revealed partial 

gene flow has detected between Atlantic and Indian oceanic regions which 

suggest that the unity of the species in global scale is kept by long distance 

seed dispersal by ocean currents. The results detected highly differentiated 

populations of C. rosea overall Atlantic region. This suggests that African and 

American land masses played as geographical barriers to gene flow by seadispersal. 

Gene flow across the extremely wide distribution range of C. rosea was 

kept by long distance seed dispersal through oceanic currents. In terms of long 

distance dispersal, this scale of gene flow from such widely distributed range of 

plant species is a new and unique case. And it shows the significance of long 

distance seed dispersal to keep species integration in worldwide distributed 

populations. 

Although sea currents enable gene flow over the global distribution 

range of plants with sea-drifted seeds, our study detected highly differentiated 

populations in southern Brazil which might be the result of bidirectional 

current of South Equatorial Current. Finally, the results provide good evidence 

for transatlantic long-distance seed dispersal by sea currents in Atlantic region. 

Seed dispersal prevented in the Isthmus of Panama and caused a distinct 

genetic difference in the cpDNA haplotype distribution between the Pacific and 

Atlantic populations of C. rosea. 

59

Taxon Oceanic Region Locality N. 

C. rosea (Sw.) DC. H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14 H15 H16 H17 

Indian Ocean South Africa Umdloti ‐29.67 31.12 22 8 14 

Tanzania Dar es salaam ‐6.82 39.32 25 4 21 

Sri Lanka Wattala, Negambo 6.97 79.89 11 10 1 

Thailand Phuket, Kmala Beach 7.99 98.29 10 10 

Indonesia Bali ‐1.08 100.42 3 3 

Java ‐8.73 115.17 10 10 

Sumatra ‐2.91 104.71 10 10 

Australia Darwin ‐12.44 130.83 10 10 

Headland Harbour ‐20.31 118.58 10 10 

West Pacific Thailand Kho Samui 9.51 100.06 9 9 

Taiwan Houpihu 38.99 117.56 15 15 

Singapore Singapore 1.35 103.99 9 9 

Philippine Quezon, Luzon 16.44 120.33 10 10 

Australia Queensland ‐16.73 145.66 10 8 2 

Japan Iriomote 24.40 123.76 15 15 

New Caledonia Plage de poe ‐21.61 165.39 10 10 

Fiji Korotogo ‐18.17 177.54 8 8 

Tonga Sopu ‐21.13 ‐175.21 10 10 

Samoa Samoa ‐13.86 ‐171.71 10 10 

Marquises Taipivai, Nuku Hiva ‐8.93 ‐140.09 10 10 

East Pacific Mexico Nayarit 21.58 ‐105.28 10 5 5 

Sinaloa 25.44 ‐108.73 4 4 

Oaxaca 15.94 ‐97.42 10 10 

Costa Rica Jaco Beach 9.61 ‐84.63 11 11 

Panama Veracruz 8.89 ‐79.62 10 10 

Ecuador Isla Jambel 0.74 ‐79.20 10 10 

West Atlantic Mexico Coatzcoalcos 18.14 ‐94.41 10 2 8 

Costa Rica Puerto Viejo 10.75 ‐83.56 5 5 

Panama Pina, Colon 1 9.28 ‐80.05 10 7 2 1 

Cuango, Colon 2 9.55 -79.31 10 6 4 

Brazil Para ‐1.32 ‐46.40 11 7 4 

Pernanbuco ‐8.34 ‐34.95 10 10 

Rio De Janeiro 1, Arraial do Cabo ‐22.97 ‐42.03 10 10 

Rio De Janeiro 2, Recreio ‐23.02 ‐43.44 9 1 8 

East Atlantic Senegal Joal-Fadiout 14.17 ‐16.85 31 7 3 4 17 

Ghana Busua beach 4.96 ‐1.73 18 5 10 3 

Angola Musul, Luanda ‐8.95 13.06 30 30 

Subtotal 436 7 0 9 9 10 32 45 232 5 10 14 1 2 4 2 25 29 

C. cathartica Thouars Pacific Philippine Atimona 10 10 

Samoa Samoa 2 2 

Tonga Tonga 5 5 

Tahiti Tahiti 1 1 

Hawaii Kauai 7 7 

Subtotal 25 6 19 

C. lineata (Thunb.) DC. Pacific Taiwan Maopi Tao 11 11 

Japan Ishigaki 11 11 

Miyazaki 10 10 

Ogasawara 10 10 

Subtotal 42 42 

C. sericea A. Gray Pacific Tonga Haashini-Lavengatonga 10 10 

Hawaii Maui, Bishop Museum 2 2 

Subtotal 12 12 

Table 2‐1. Chloroplast DNA haplotype composition and coordinates of populations for 

our study group. Haplotypes ranged from H1 to H17 and N, number of samples 

in each population. 

60

Primer name Length (bp) Primer Pairs Sequence (5'- 3') Source 

atpB partial 590 atpB-146 TTGGTACCATCCAACCAATTC This study 

ndhD partial 396 ndhD ACATCCGTCCCAAGGTATCA This study 

ndhE CAACTCGTATCAACCAATCGAA This study 

psbA 250 psbA CGAAGCTCCATCTACAAATGG Hamilton 1998 

rps16 partial 186 rps16-610 CCTTTGAGTTATCGGGTTGC This study 

trnK 5' flanking 250 trnK5' F GAATGGAAAAAGTAGCATGTCG This study 

trnK5' R TGCGATACGATCAAAACAGG This study 

trnK 3' flanking 340 trnK3' F AAAGGTCGGATTTGGTATTTAGA This study 

trnK3' R TCCTGAATCCCAACTCTTATTACAT This study 

Table 2‐2. List of primers used for sequencing of chloroplast regions in population 

samples. PCR amplification primers are shown in table 1‐2. 

61

Taxon 

Population's 

haplotypes Haplotype frequency atp B‐rbc L ndh D‐ndh E psb A‐trn H rps 16 trn K 5' trnK 3' 

256 510 267 644 23 155 183 308 682 733 748 155 156 2211 2290 

C. rosea C1 7 C G G C 0 A T 2= 0 T T T C G A 

C. catharca, C. sericea C2 18 T . . . . . . 2= 0 C . . . T . 

C. rosea C3 9 T . . . . . . 2= 0 . C . . . . 

C. rosea C4 9 T . A . . . . 2= 0 . . . A . . 

C. rosea C5 10 T . . . . . . 2= 0 . . G A T T 

C. rosea C6 32 T . . . . . . 2= 0 . . . A T T 

C. rosea C7 45 T . . . . . . 2= 0 . . . . . . 

C. rosea, C. lineata, C. catharca C8 293 T . . . . . . 2= 0 . . . . T . 

C. rosea C9 5 T . . T . . . 2= 0 . . . . . . 

C. rosea C10 10 T . . . . T . 2= 0 . . . . T . 

C. rosea C11 14 T . . . 1$ . . 2= 0 . . . . T . 

C. rosea C12 1 T . . . . . . 2+ 0 . C . . . . 

C. rosea C13 2 T . . . . . . 2+ 0 . . . . T . 

C. rosea C14 4 T . . . . . G 2+ 0 . . . . . . 

C. rosea C15 2 T . . . . . G 2= 0 . C . . . . 

C. rosea C16 25 T T . . . . G 2= 0 . . . . . . 

C. rosea C17 29 T T . . . . G 2= 1# . . . . . . 

$ AAAAT; = AGA; + TCT; # TTATT 

Table 2‐3. Variable sites of short fragments of 6 cpDNA regions used to determine 

haplotypes in Canavalia rosea and its related species populations. Dots (•) 

indicate that character states are same as for C. rosea haplotype C1. Numbers 

(0, 1 and 2) in sequences indicate indels, with ‘0’ indicating absence, ‘1’ 

presence and ‘2’ inversion. 

62

Regions N (h) (S) (Hd) (π) 

West Atlantic 75 7 8 0.7809 0.0014 

East Atlantic 79 6 6 0.74034 0.00087 

Indian Ocean 111 6 8 0.5507 0.00053 

West Pacific 116 2 1 0.03418 0.00002 

East Pacific 55 2 3 0.27879 0.00042 

Total 436 16* 14 0.69124 0.00086 

*, number of haplotypes shared between C. rosea populations 

Table 2‐4. Number of haplotypes (h), Polymorphic sites (S), Haplotype diversity (Hd), 

Nucleotide diversity (π). 

63

IN WP EP WA EA 

IN 0 0.1967 0.0826 0.3331 0.3605 

WP 0.1967 0 0.1684 0.6454 0.6577 

EP 0.0826 0.1684 0 0.4518 0.47 

WA 0.3331 0.6454 0.4518 0 0.1309 

EA 0.3605 0.6577 0.47 0.1309 0 

Table 2‐5. Pairwise FST comparison between 5 geographic regions. All differentiations 

are significant using an exact test (P < 0.05). (WA: West Atlantic, EA: East 

Atlantic, In: Indian Ocean, WP: West Pacific, EP: East Pacific). 

64

Grouping 

K FCT (P < 0.05) 

1 2 3 4 5 6 7 8 9 10 

Ghana (A) 

Mexico (A) 

2 0.57801 Panama-A2(A) Rests 

Para (A) 

Senegal (A) 

3 0.67019 

Ghana (A) 

Mexico (A) 

Panama-A2 

Para 

Senegal (A) 

4 0.68682 Mexico-Sin (P) 

5 0.71847 Java (I) 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Java (I) 

6 0.73819 Mexico-Nay Mexico-Sin Java (I) 

Ghana (A) 

Mexico (A) 

Panama-A1 

Panama-A2 

Para Senegal (A) 

Ghana (A) 

Mexico(A) 


Panama-A2 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Java (I) 

Angola (A) 

Costa-A 

Panama-A1 

7 0.75362 Darwin (I) Mexico-Nay Mexico-Sin Java (I) 

Mexico-Sin 

Ghana (A) Mexico(A) 


Panama-A2 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Angola (A) 

Costa-A 

Panama-A1 

8 0.76387 Panama-A2 Darwin (I) Mexico-Nay Mexico-Sin Java (I) 



Panama-A2 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Angola (A) Costa-A 

Panama-A1 



Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro3 

Angola (A) Costa-A 

Panama-A1 

9 0.76322 Angola (A) Panama-A2 Darwin (I) Mexico-Nay Mexico-Sin Java (I) Costa-A Panama-A1 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro3 


Para 

Senegal (A) 

10 0.77158 South Africa (A) Angola (A) Senegal (A) Panama-A2 Darwin (I) Mexico-Nay Mexico-Sin Java (I) Costa-A Panama-A1 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Ghana (A) 

Mexico(A) 

Para 

Rests 

Pernanbuco 

RDJaneiro1 

RDJaneiro2 

Rests 

Table 2‐6. Fixation indices (FCT) of C. rosea population groupings obtained from SAMOVA (Dupanloup et 

al., 2002) as a function of the user‐defined number K of groups of populations. Bold populations in 

the grouping indicate the newly separated populations at a given level of K. 

65

0.05 MLE 0.95 Nm 

θWA 0.0133 0.0163 0.0202 

θEA 0.0122 0.0144 0.0171 

θIn 0.0131 0.0154 0.0184 

θWP 0.006 0.0069 0.0081 

θEP 0.0071 0.009 0.0119 

MEA to WA 302.43 395.65 506.36 6.4491 

MEP to WA 1.11E‐07 1.27E‐07 13.0875 0 

MWA to EA 119.79 166.42 223.96 2.3964 

M In to EA 1.75E‐08 1.99E‐08 8.0529 0 

MEA to In 52.7402 105.53 185.43 1.6252 

MWP to In 195.14 296.22 422.56 4.5618 

MIn to WP 82.1782 146.84 238.55 1.0132 

MEP to WP 14.2155 16.2463 58.7398 0.1121 

MWP to EP 41.8149 96.8064 186.78 0.8713 

MWA to EP 8.31E‐14 9.36E‐14 26.2257 0 

Table 2‐7. Maximum likelihood estimates (MLE) and 95% confidence interval of θ and 

migration rates (M) and number of migrants (Nm) obtained from MIGRATE‐N 

for 5 regional groups (WA: West Atlantic, EA: East Atlantic, In: Indian Ocean, 

WP: West Pacific, EP: East Pacific). 

66

Figure 2‐1. Statistical parsimony networks of 21 haplotypes (H1‐21) based on full 

length cpDNA sequences among C. rosea and its allied species. Symbols, colors 

and size of each haplotype correspond to species, haplotypes could detect by 

partial sequence of 6 short fragments and frequencies of the corresponding 

haplotypes, respectively. The small white circles indicate the undetected 

intermediate haplotypes. 

67

Figure 2‐2. Distribution map of the cpDNA haplotypes identified by partial sequence 

(2012 bp) for 48 populations from five oceanic regional groups of C. rosea. Pie 

charts represent the proportion of haplotypes in each locality and the size of 

pie charts is proportional to sample size. Haplotypes H1‐21 corresponds to the 

figure 2‐1. 

68

1 

0.9 

0.8 

0.7 

0.6 

0.5 

0.4 

0.3 

0.2 

0.1 

0 

FST 

F 

FSC 

0 2 4 6 8 10 12 

Figure 2‐3. Fixation indices F obtained with the SAMOVA program (Dupanloup et al. 

2002) as a function of the user‐defined number K of groups of populations. F ST , 

differentiation among populations; F CT , differentiation among groups of 

populations; F SC , differentiation among populations within groups. . All 

differentiations were significant (P < 0.01). 

69

Figure 2‐4. Posterior density distribution of Bayesian analysis from MIGRATE‐N for 

mutation rates (θ). Number 1‐5 corresponds to West Atlantic, East Atlantic, 

Indian Ocean, West Pacific and East Pacific regions. 

70

Figure 2‐5. Posterior density distribution of Bayesian analysis obtained from 

MIGRATE‐N for migration rates (M) within C. rosea populations. 

71

12 

Number of Migrants (Nm) 

10 

8 

6 

4 

2 

0 

Figure 2‐6. Estimated number of migrants (Nm) within different Oceanic regions 

obtained from Bayesian method implemented in MIGRATE‐N program. 

Calculation was based on 95% credible interval of θ and M values. 

72

Figure 2‐7. The theta and migration rates (M) posterior probability 

distributions between five oceanic groups of C. rosea populations using MDIV 

program (Nielsen & Wakeley, 2001). Legends are as follows: WA=West Atlantic, 

EA=East Atlantic, IN=Indian Ocean, WP= West Pacific and EP= East Pacific. 

73

GENERAL DISCUSSION 

In this study, I reported the results of phylogenetic analyses among Canavalia 

rosea, a genuine member PPSS and its related species based on cpDNA and 

nrDNA ITS sequences and also the result of phylogeographic analyses from a 

large survey of cpDNA variations among populations of C. rosea. 

This phylogeographic study of a genuine PPSS, suggested several 

interesting findings on a single species that keeps its distribution range by long 

distance seed dispersal by sea-drifted seeds. Comparing my results with the 

studies of sub PPSS, H. tiliaceus and its allies, will give us a comprehensive idea 

about the evolutionary history of PPSS. 

I. Closely related species are speciated in the wide distribution range 

of PPSS. Although we did not have strong evidence of speciation 

in Canavalia rosea, the widest range of distribution and high 

haplotype diversity of this species may suggest that some species 

were speciated from C. rosea as mother species. In the case of H. 

tiliaceus recurrent speciation from H. tiliaceus has given rise to all 

of its allied species. 

II. 

Substantial gene flow over wide range of distribution is common 

in both H. tiliaceus and C. rosea, especially over Indo-Pacific region. 

III. 

In H. tiliaceus and H. pernambucensis, two species boundary are 

present: one is the East Pacific and the other is the Atlantic Ocean. 

It is interesting that both of them are oceanic barriers. In H. 

pernambucensis in addition, American continents are clear barrier 

74

to shape a clear geographic structure between Pacific and Atlantic 

regions. In C. rosea, gene flow over East Pacific and Atlantic are 

observed. These would be caused by the difference of seed 

dispersibility between the two species group, which suggest that 

seed dispersibility is the key factor to be a genuine PPSS. 

IV. 

The land barriers of Africa and American Continents are common 

for the both PPSS species which support that sea-drifted seed 

dispersal is limited by land masses. 

V. The quite different point between the two studies was the genetic 

diversity among populations in Pacific and Atlantic regions. 

Haplotype diversity in the Pacific region for the H. tiliaceus was 

much higher than that for C. rosea. On the other hand, in the 

Atlantic region haplotype diversity in C. rosea populations was 

significantly higher than H. tiliaceus populations. Such interesting 

results show different evolutionary history of these species and 

require additional studies to clear up such fascinating patterns. 

75

REFERENCES 

Arroyo, M.T.K. (1981) Breeding systems and pollination biology in leguminosae. Advances in legume 

systematics (ed. by R.M.P.a.P.H. Raven), pp. 723–770. Royal Botanic Gardens, Kew, UK. 

Avise, J. (2000) Phylogeography: The history and formation of species. Harvard University Press. 

Avise, J. (2009) Phylogeography: Retrospect and prospect. Journal of Biogeography, 36, 3‐15 

Baldwin, B.G. & Wagner, W.L. (2010) Hawaiian angiosperm radiations of north american origin. 

Annals of Botany, 105, 849‐879 

Beerli, P. (2008) Migrate version 3.0: A maximum likelihood and bayesian estimator of gene flow 

using the coalescent. In: Distributed over the Internet at http://popgen.scs.edu/migrate.html 

Beerli, P. & Felsenstein, J. (1999) Maximum‐likelihood estimation of migration rates and effective 

population numbers in two populations using a coalescent approach. Genetics, 152, 763‐773 

Beerli, P. & Felsenstein, J. (2001) Maximum likelihood estimation of a migration matrix and effective 

population sizes in n subpopulations by using a coalescent approach. Proceedings of the 

National Academy of Sciences of the United States of America, 98, 4563‐4568 

Bohonak, A.J. (1999) Dispersal, gene flow, and population structure. The Quarterly Review of Biology, 

74, 21 

Bowie, R., Fjeldså, J., Hackett, S., Bates, J. & Crowe, T. (2006) Coalescent models reveal the relative 

roles of ancestral polymorphism, vicariance, and dispersal in shaping phylogeographical 

structure of an african montane forest robin. Molecular Phylogenetics and Evolution, 38, 171‐ 

188 

Brito, P. & Edwards, S. (2009) Multilocus phylogeography and phylogenetics using sequence‐based 

markers. Genetica, 135, 439‐455 

Brito, P.H. (2005) The influence of pleistocene glacial refugia on tawny owl genetic diversity and 

phylogeography in western europe. Molecular Ecology, 14, 3077‐3094 

Bull, J.J., Huelsenbeck, J.P., Cunningham, C.W., Swofford, D.L. & Waddell, P.J. (1993) Partitioning and 

combining data in phylogenetic analysis. Systematic Biology, 42, 384‐397 

Cain, M., Damman, H. & Muir, A. (1998) Seed dispersal and the holocene migration of woodland 

herbs. Ecological Monographs, 68, 325‐347 

Cain, M.L., Milligan, B.G. & Strand, A.E. (2000) Long‐distance seed dispersal in plant populations. 

American Journal of Botany 87, 1217‐1227 

Calonje, M., Martín‐Bravo, S., Dobeš, C., Gong, W., Jordon‐Thaden, I., Kiefer, C., Kiefer, M., Paule, J., 

Schmickl, R. & Koch, M. (2009) Non‐coding nuclear DNA markers in phylogenetic 

reconstruction. Plant Systematics and Evolution, 282, 257‐280 

Carbone, I., Liu, Y.‐C., Hillman, B.I. & Milgroom, M.G. (2004) Recombination and migration of 

cryphonectria hypovirus 1 as inferred from gene genealogies and the coalescent. Genetics, 

166, 1611‐1629 

Carlquist, S. (1966) The biota of long‐distance dispersal. Iii. Loss of dispersibility in the hawaiian flora. 

Brittonia, 18, 310‐335 

Carlquist, S. (1974) Loss of dispersibility in island plants. Island biology, pp. 429‐486. Columbia 

University Press, New York. 

Clement, M., Posada, D. & Crandall, K. (2000) Tcs: A computer program to estimate gene genealogies. 

Molecular Ecology, 9, 1657‐1659 

Corriveau, J.L. & Coleman, A.W. (1988) Rapid screening method to detect potential biparental 

inheritance of plastid DNA and results for over 200 angiosperm species. American Journal of 

Botany, 75, 1443‐1458 

76

Cox, C. & Moore, P. (2005) Biogeography: An ecological and evolutionary approach (2005), Seventh 

edn. Blackwell Publishing Limited. 

Cronn, R.C., Small, R.L., Haselkorn, T. & Wendel, J.F. (2002) Rapid diversification of the cotton genus 

(gossypium: Malvaceae) revealed by analysis of sixteen nuclear and chloroplast genes. 

American Journal of Botany, 89, 707‐725 

Darwin, C. (1859) On the origin of species by means of natural selection, or the preservation of 

favoured races in the struggle for life. 

De Queiroz, L., Fortunato, R. & Giulietti, A. (2003) Phylogeny of the diocleinae (papilionoideae: 

Phaseoleae) based on morphological characters. Advances in legume systematics, 10, 303– 

324 

Dodd, R.S., Afzal‐Rafii, Z., Kashani, N. & Budrick, J. (2002) Land barriers and open oceans: Effects on 

gene diversity and population structure in avicennia germinans l. (avicenniaceae). Molecular 

Ecology, 11, 1327‐1338 

Donnelly, M.J., Pinto, J., Girod, R., Besansky, N.J. & Lehmann, T. (2004) Revisiting the role of 

introgression vs shared ancestral polymorphisms as key processes shaping genetic diversity in 

the recently separated sibling species of the anopheles gambiae complex. Heredity, 92, 61‐68 

Doyle, J. & Doyle, J. (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. 

Phytochemistry, 19, 11‐15 

Duke, N., Lo, E. & Sun, M. (2002) Global distribution and genetic discontinuities of mangrovesemerging 

patterns in the evolution of rhizophora. Trees‐Structure and Function, 16, 65‐79 

Dupanloup, I., Schneider, S. & Excoffier, L. (2002) A simulated annealing approach to define the 

genetic structure of populations. Molecular Ecology, 11, 2571‐2581 

Ennos, R.A. (1994) Estimating the relative rates of pollen and seed migration among plant 

populations. Heredity, 72, 250‐259 

Excoffier, L. (2004) Patterns of DNA sequence diversity and genetic structure after a range expansion: 

Lessons from the infinite‐island model. Molecular Ecology, 13, 853‐864 

Excoffier, L. & Heckel, G. (2006) Computer programs for population genetics data analysis: A survival 

guide. Nature Reviews Genetics, 7, 745‐758 

Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin (version 3.0): An integrated software package 

for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50 

Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the bootstrap. Evolution, 

39, 783‐791 

Fratantoni, D.M., Johns, W.E., Townsend, T.L. & Hurlburt, H.E. (2000) Low‐latitude circulation and 

mass transport pathways in a model of the tropical atlantic ocean. Journal of Physical 

Oceanography, 30, 1944‐1966 

Gross, C. (1993) The reproductive ecology of canavalia rosea (fabaceae) on anak krakatau, indonesia. 

Australian Journal of Botany, 41, 591‐599 

Guppy, H.B. (1906) Observations of a naturalist in the pacific between 1896 and 1899 , vol. 2. Plant 

dispersal. MacMillan, London. 

Hamrick, J. & Nason, J. (1996) Consequences of dispersal in plants. Population dynamics in ecological 

space and time, pp. 203–236. University of Chicago Press. 

Hasegawa, M., Kishino, H. & Yano, T. (1985) Dating of the human‐ape splitting by a molecular clock of 

mitochondrial DNA. Journal of molecular evolution, 22, 160‐174 

Heuertz, M., Hausman, J., Hardy, O., Vendramin, G., Frascaria‐Lacoste, N. & Vekemans, X. (2004) 

Nuclear microsatellites reveal contrasting patterns of genetic structure between western and 

southeastern european populations of the common ash (fraxinus excelsior l.). Evolution, 58, 

976‐988 

77

Hey, J. (2005) On the number of new world founders: A population genetic portrait of the peopling of 

the americas. PLoS Biology, 3, e193 

Heywood, J.S. (1991) Spatial analysis of genetic variation in plant populations. Annual Review of 

Ecology and Systematics, 22, 335‐355 

Howe, H.F. & Smallwood, J. (1982) Ecology of seed dispersal. Annual Review of Ecology and 

Systematics, 13, 201‐228 

Ingvarsson, P.K., Ribstein, S. & Taylor, D.R. (2003) Molecular evolution of insertions and deletion in 

the chloroplast genome of silene. Molecular Biology and Evolution, 20, 1737‐1740 

Irwin, D.E. & Gibbs, H.L. (2002) Phylogeographic breaks without geographic barriers to gene flow. 

Evolution, 56, 2383‐2394 

Kane, N., King, M., Barker, M., Raduski, A., Karrenberg, S., Yatabe, Y., Knapp, S. & Rieseberg, L. (2009) 

Comparative genomic and population genetic analyses indicate highly porous genomes and 

high levels of gene flow between divergent helianthus species. Evolution, 63, 2061‐2075 

Kay, K.M., Reeves, P.A., Olmstead, R.G. & Schemske, D.W. (2005) Rapid speciation and the evolution 

of hummingbird pollination in neotropical costus subgenus costus (costaceae): Evidence from 

nrdna its and ets sequences. American Journal of Botany, 92, 1899‐1910 

Kelchner, S.A. (2000) The evolution of non‐coding chloroplast DNA and its application in plant 

systematics. Annals of the Missouri Botanical Garden, 87, 482‐498 

Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through 

comparative studies of nucleotide sequences. Journal of molecular evolution, 16, 111‐120 

Kimura, M. & Weiss, G. (1964) The stepping stone model of population structure and the decrease of 

genetic correlation with distance. Genetics, 49, 561‐576 

Kingman, J. (1982a) The coalescent. Stochastic processes and their applications, 13, 235‐248 

Kingman, J. (1982b) On the genealogy of large populations. Journal of Applied Probability, 19, 27‐43 

Knowles, L.L. (2009) Statistical phylogeography. Annual Review of Ecology, Evolution, and Systematics, 

40, 593‐612 

Knowles, L.L. & Maddison, W.P. (2002) Statistical phylogeography. Molecular Ecology, 11, 2623‐2635 

Kuhner, M.K. (2009) Coalescent genealogy samplers: Windows into population history. Trends in 

Ecology & Evolution, 24, 86‐93 

Kuhner, M.K. & Smith, L.P. (2007) Comparing likelihood and bayesian coalescent estimation of 

population parameters. Genetics, 175, 155‐165 

Lackey, J. (1981) Phaseoleae. Advances in legume systematics (ed. by R.P.a.P. Raven), pp. 301‐327. 

Royal Botanic Gardens, Kew, London. 

Levin, D.A. (2000) The origin, expansion and demise of plant species. Oxford University Press. 

Levin, D.A. (2001) The recurrent origin of plant races and species. Systematic Botany, 26, 197‐204 

Librado, P. & Rozas, J. (2009) Dnasp v5: A software for comprehensive analysis of DNA polymorphism 

data. In: Bioinformatics, pp. 1451‐1452 

Linhart, Y.B. & Grant, M.C. (1996) Evolutionary significance of local genetic differentiation in plants. 

Annual Review of Ecology and Systematics, 27, 237‐277 

Loewer, P. (2005) Seed dispersal. In: Seeds: The definitive guide to growing, history, and lore. Pp. 61‐ 

74. Timber Press. 

Mayr, E. (1963) Animal species and evolution. Belknap Press. 

Mogensen, H.L. (1996) The hows and whys of cytoplasmic inheritance in seed plants. American 

Journal of Botany, 83, 383‐404 

Morjan, C.L. & Rieseberg, L.H. (2004) How species evolve collectively: Implications of gene flow and 

selection for the spread of advantageous alleles. Molecular Ecology, 13, 1341‐1356 

78

Mort, M.E., Archibald, J.K., Randle, C.P., Levsen, N.D., O'leary, T.R., Topalov, K., Wiegand, C.M. & 

Crawford, D.J. (2007) Inferring phylogeny at low taxonomic levels: Utility of rapidly evolving 

cpdna and nuclear its loci. American Journal of Botany, 94, 173‐183 

Murray, D.R. (1986) Seed dispersal by water. Seed dispersal, pp. 49‐85. Academic Press, Sydney. 

Nakanishi, H. (1988) Dispersal ecology of the maritime plants in the ryukyu islands, japan. Ecological 

Research, 3, 163‐173 

Nettel, A. & Dodd, R.S. (2007) Drifting propagules and receding swamps: Genetic footprints of 

mangrove recolonization and dispersal along tropical coasts. Evolution, 61, 958‐971 

Nielsen, R. & Wakeley, J. (2001) Distinguishing migration from isolation: A markov chain monte carlo 

approach. Genetics, 158, 885‐896 

Nylander, J. (2004) Mrmodeltest v2. Program distributed by the author. In: Evolutionary Biology 

Centre, Uppsala University 

Olmstead, R. & Palmer, J. (1994) Chloroplast DNA systematics: A review of methods and data analysis. 

American Journal of Botany, 81, 1205‐1224 

Ouborg, N.J., Piquot Y. & Van Groenendael J. M. (1999) Population genetics, molecular markers and 

the study of dispersal in plants. Journal of Ecology, 87, 551‐568 

Parker, P.G., Allison, A.S., Schug, M.D., Booton, G.C. & Fuerst, P.A. (1998) What molecules can tell us 

about populations: Choosing and using a molecular marker. Ecology, 79, 361‐382 

Petit, R., Duminil, J., Fineschi, S., Hampe, A., Salvini, D. & Vendramin, G. (2005) Comparative 

organization of chloroplast, mitochondrial and nuclear diversity in plant populations. 

Molecular Ecology, 14, 689‐701 

Polidoros, A., Pasentsis, K. & Tsaftaris, A. (2006) Rolling circle amplification‐race: A method for 

simultaneous isolation of 5'and 3'cdna ends from amplified cdna templates. BioTechniques, 

41, 35 

Rambaut, A. (2002) Se‐al: A manual sequence alignment editor v2.0a11. 

Rambaut, A. & Drummond, A. (2009) Tracer v1.5. Available 

from:. In: 

Rannala, B. & Hartigan, J.A. (1996) Estimating gene flow in island populations. Genetics Research, 67, 

147‐158 

Raymond, M. & Rousset, F. (1995) An exact test for population differentiation. Evolution, 49, 1280‐ 

1283 

Renner, S. (2004) Plant dispersal across the tropical atlantic by wind and sea currents. International 

Journal of Plant Sciences, 165, S23‐S33 

Ronquist, F. & Huelsenbeck, J.P. (2003) Mrbayes 3: Bayesian phylogenetic inference under mixed 

models. Bioinformatics, 19, 1572‐1574 

Sauer, J. (1964) Revision of canavalia. Brittonia, 16, 106‐181 

Sauer, J. (1988) Plant migration: The dynamics of geographic patterning in seed plant species. 

University of California Press, Berkeley, California, USA. 

Schaal, B.A., Hayworth, D.A., Olsen, K.M., Rauscher, J.T. & Smith, W.A. (1998) Phylogeographic 

studies in plants: Problems and prospects. Molecular Ecology, 7, 465‐474 

Scherson, R., Choi, H., Cook, D. & Sanderson, M. (2005) Phylogenetics of new world astragalus: 

Screening of novel nuclear loci for the reconstruction of phylogenies at low taxonomic levels. 

Brittonia, 57, 354‐366 

Schrire, B.D. (2005) Phaseoleae. Legumes of the world (ed. by B.S. Gwilym Lewis, Barbara Mackinder, 

and Mike Lock), pp. 393‐431. Kew Publishing. 

Shaw, J., Lickey, E.B., Schilling, E.E. & Small, R.L. (2007) Comparison of whole chloroplast genome 

sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise 

and the hare iii. American Journal of Botany, 94, 275‐288 

79

Simmons, M. & Ochoterena, H. (2000) Gaps as characters in sequence‐based phylogenetic analyses. 

Systematic Biology, 49, 369 

Slatkin, M. & Hudson, R. (1991) Pairwise comparisons of mitochondrial DNA sequences in stable and 

exponentially growing populations. Genetics, 129, 555 

Small, R.L., Ryburn, J.A., Cronn, R.C., Seelanan, T. & Wendel, J.F. (1998) The tortoise and the hare: 

Choosing between noncoding plastome and nuclear adh sequences for phylogeny 

reconstruction in a recently diverged plant group. American Journal of Botany, 85, 1301‐1315 

Soltis, D.E., Morris, A.B., Mclachlan, J.S., Manos, P.S. & Soltis, P.S. (2006) Comparative 

phylogeography of unglaciated eastern north america. Molecular Ecology, 15, 4261‐4293 

Soltis, D.E. & Soltis, P.S. (1998) Choosing an approach and appropriate gene for phylogenetic analysis. 

Molecular systematics of plants ii. DNA sequencing (ed. by D.E. Soltis, P.S. Soltis and J.J. 

Doyle), pp. 1‐42. Kluwer Academic Publishers. 

St. John H (1970) Revision of the hawaiian species of canavalia (leguminosae). Hawaiian plant studies. 

Israel Journal of Botany, 19, 161‐219 

Stamatakis, A. (2006) Raxml‐vi‐hpc: Maximum likelihood‐based phylogenetic analyses with thousands 

of taxa and mixed models. Bioinformatics, 22, 2688‐2690 

Swofford, D. (2002) Paup* 4.0 beta 10: Phylogenetic analysis using parsimony (*and other methods). 

In. Sinauer Associates Sunderland, MA 

Takayama, K., Kajita, T., Murata, J. & Tateishi, Y. (2006) Phylogeography and genetic structure of 

hibiscus tiliaceus‐ speciation of a pantropical plant with sea‐drifted seeds. Molecular Ecology, 

15, 2871‐2881 

Takayama, K., Tateishi, Y., Murata, J. & Kajita, T. (2008) Gene flow and population subdivision in a 

pantropical plant with sea‐drifted seeds hibiscus tiliaceus and its allied species: Evidence from 

microsatellite analyses. Molecular Ecology, 17, 2730‐2742 

Templeton, A., Crandall, K. & Sing, C. (1992) A cladistic analysis of phenotypic associations with 

haplotypes inferred from restriction endonuclease mapping and DNA sequence data. Iii. 

Cladogram estimation. Genetics, 132, 619 

Thiel, M. & Gutow, L. (2005) The ecology of rafting in the marine environment: I. The floating 

substrata. Oceanography and Marine Biology: An Annual Review Volume 42, 42, 181‐264 

Thiel, M. & Haye, P.A. (2006) The ecology of rafting in the marine environment. Iii. Biogeographical 

and evolutionary consequences. Oceanography and marine biology: An annual review (ed. by 

R. Gibson, R. Atkinson and J. Gordon), pp. 323‐429. CRC Press. 

Varela, E.S., Lima, J.P.M.S., Galdino, A.S., Pinto, L.D.S., Bezerra, W.M., Nunes, E.P., Alves, M.a.O. & 

Grangeiro, T.B. (2004) Relationships in subtribe diocleinae (leguminosae; papilionoideae) 

inferred from internal transcribed spacer sequences from nuclear ribosomal DNA. 

Phytochemistry, 65, 59‐69 

Wagner, W., Herbst, D. & Sohmer, S. (1999) Manual of the flowering plants of hawaii, revised edition. 

University of Hawaii Press. 

Wakeley, J. (2003) Inferences about the structure and history of populations: Coalescents and 

intraspecific phylogeography. The evolution of population biology (ed. by R. Singh and M. 

Uyenoyama), pp. 193–215. Cambridge University Press, Cambridge. 

Weir, B. & Cockerham, C. (1984) Estimating f‐statistics for the analysis of population structure. 

Evolution, 38, 1358‐1370 

Whistler, W. (1992) Flowers of the pacific island seashore. Univ. of Hawaii Press. 

Wiens, J.J. (1998) Combining data sets with different phylogenetic histories. Systematic Biology, 47, 

568‐581 

Willson, M. & Traveset, A. (2000) The ecology of seed dispersal. Seeds the ecology of regeneration in 

plant communities 2nd edition (ed. by M. Fenner), pp. 85‐110. CAB International. 

80

Wright, S. (1931) Evolution in mendelian populations. Genetics, 16, 97‐159 

Wright, S. (1951) The genetical structure of populations. Annals of Eugenics, 15, 323‐354 

81

ACKNOWLEDGEMENTS 

I am deeply grateful to my supervisor, Prof. Dr. Tadashi Kajita who 

encouraging me to do a good research, and challenge me to logical thinking. 

His efforts, support, and patience in accepting me as a PhD student, will never 

forget as my dream (study abroad) came true. I am also grateful to my cosupervisor, 

Prof. Dr. Yasuyuki Watano who always remind me how to learn and 

Dr. Takeshi Asakawa for his valuable suggestions. I specially thank Prof. Dr. 

Takayoshi Tsuchiya and Prof. Dr. Sumiko Kimura for their suggestions and 

comments as referees. I also owe a great debt to Dr. Koji Takayama, who 

taught me molecular methods and for his valuable comments. I would like to 

thank Mr. Alvin Y. Yoshinaga from Center for Conservation Research and 

Training, Hawaii for sending materials. I would like to thank Prof. Dr. Yoichi 

Tateishi for his helpful comments and allowing me to visit the herbarium of 

University of the Ryukyus. I am also grateful to Prof. Dr. Masaki Miya for 

valuable classes in phylogenetic analysis. 

I specially thank Dr. Akihisa Shirai, Dr. Norihisa Wakita, Dr. Bayu Adjie, for 

their help and suggestions. I would also like to thank to all students of Watano 

and Kajita laboratory for any helps during my researches. 

And finally, thanks to my family and all friends for their love, support, 

and encouragement throughout the years. 

My study fully supported by Monbukagakusho (MEXT: Ministry of 

Education, Culture, Sports, Science and Technology) scholarship. 

82

BIOGRAPHY 

Mohammad Vatanparast was born in Urmia, central city of West Azerbaijan 

province in the North West of Iran in 20 February 1976. He finished his 

undergraduate level in plant biology from Urmia University in 1999. In 2000 he 

enter master course in the plant systematic field at Tarbiat Modarres University 

in Tehran and graduate in 2003. His master thesis was on biosystematics of the 

genus Trifolium a part of national project about Flora of Iran in Persian 

language. As his dreams and interest was study abroad to learn novel practical 

and analytical methods in the plant systematic and evolution, with efforts of 

Prof. Dr. Tadashi Kajita, he could enter to the PhD course in his laboratory in 

Chiba University, Japan. In October 2006 he entered Japan and after taking 6 

month research student course in April 2007 he started his PhD project 

focusing on “Phylogeography of a pantropical plants with sea-drifted seeds, 

Canavalia rosea” by applying large population sampling using molecular 

methods such as chloroplast DNA sequences and population genetic analyses. 

83

Phylogeography of a pantropical plant with sea-drifted ... - åèå¤§å­¦

Create successful ePaper yourself

Delete template?

Save as template?

Phylogeography of a pantropical plant with sea-drifted ... - åèå¤§å¦