LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

More documents

Recommendations

Info

d) 3X Laemmli’s buffer Component Final concentration Amount 1M Tris pH 6.8 150mM 15ml Glycerol (SD fine) 30% 30ml SDS (Sigma) 6% 6g Bromophenol blue (Sigma) 0.3% 0.3g Make up the volume to 85ml with distilled water. Before use, to 850l of 1X buffer add 150l of -mercaptoethanol. e) 10X running buffer (10X electrode buffer) Component Final concentration Amount Tris base (Sigma) 250mM 30.0g Glycine (Signa) 2.5M 187.7g SDS (Sigma) 10% 10.0g Dissolve in 750ml of distilled water. Make up the volume to 1000ml with distilled water. f) Transfer buffer Component Amount Tris base 12.1g Glycine 57.6g Methanol 800ml 10% SDS 4ml Make up volume to 4L with distilled water. g) TBS-T (tris buffered saline with Tween-20) Component Final concentration Amount 1M Tris pH8.0 10mM 10.0ml 92
2.5M NaCl 150mM 60ml Tween-20 (Sigma) 0.1% 1.0ml Make up the volume to 1000ml with distilled water. h) NET-N Component Final concentration Amount 1M Tris pH 8.0 20mM 20ml 2.5M NaCl 100mM 40ml 0.5M EDTA pH 8.0 1mM 2ml NP-40 (or Igepal) (Sigma) 0.5% 5ml Make up volume to 1L with distilled water. Store at 4 o C. i) EBC lysis buffer Component Final concentration Amount 1M Tris pH 8.0 50mM 50ml 2.5M NaCl 125mM 50ml NP-40 (or Igepal) (Sigma) 0.5% 5ml Make up volume to 1L with distilled water. Store at 4 o C. Before use add the following protease inhibitors (for 10ml EBC lysis buffer). Inhibitor Final concentration Amount 1mg/ml leupeptin 10g/ml 100l 2mg/ml Aprotinin 20g/ml 100l 500mM PMSF 1mM 20l 1M NaF 50mM 500l 0.2M Na orthovanadate 1mM 50l 93
Page 1 and 2:
Generation of knockdown mice that l
Page 3 and 4:
STATEMENT BY AUTHOR This dissertati
Page 5 and 6:
CERTIFICATE I certify that the thes
Page 7 and 8:
I am thankful to Mr Uday Dandekar f
Page 9 and 10:
3.16 Isolation of Genomic DNA (gDNA
Page 11 and 12:
A synopsis of thesis to be submitte
Page 13 and 14:
esults in loss of 14-3-3 binding an
Page 15 and 16:
and NheI (NEB) to remove tetO-CMV,
Page 17 and 18:
Hanging drop and wound healing assa
Page 19 and 20:
360). To generate transgenic animal
Page 21 and 22:
asement of the seminiferous tubules
Page 23 and 24:
normal female, pups were screened f
Page 25 and 26:
14-3-3ε only in the presence of HP
Page 27 and 28:
proteins are expressed in testis (3
Page 29 and 30:
5. Lalit Sehgal, Srikanth B., Khyat
Page 31 and 32:
Presented a poster at 33rd All Indi
Page 33 and 34:
shRNA siRNA TBS-T U.V WT C IF DSG D
Page 35 and 36:
List of Figures: Page No 1. Figure
Page 37 and 38:
37. Figure 4.3.20: 14-3-3γ interac
Page 39 and 40:
CHAPTER 1 INTRODUCTION 39
Page 41 and 42: 1.1.1 Cyclin Cdk complexes Eukaryot
Page 43 and 44: 1.1.1.c Cyclin A cdk complexes The
Page 45 and 46: of which are associated with acquis
Page 47 and 48: 1.2.2 The G1/S DNA Damage checkpoin
Page 49 and 50: complexes. DNA damage induced degra
Page 51 and 52: cytoplasmic accumulation of cdc25 p
Page 53 and 54: 14-3-3 binding site. 14-3-3 binding
Page 55 and 56: G2 arrest and induced premature chr
Page 57 and 58: emoval of S216 phosphorylation as i
Page 59 and 60: embryogenesis, a loss of cdc25A can
Page 61 and 62: dimer was essential for Raf activat
Page 63 and 64: of enhanced apoptosis of peripheral
Page 65 and 66: the generation of transgenic mice a
Page 67 and 68: CHAPTER 2 AIMS AND OBJECTIVES 67
Page 69 and 70: CHAPTER 3 MATERIALS AND METHODS 69
Page 71 and 72: Name of oligonucleotide EF1α Forwa
Page 73 and 74: cleavage sites GAAGGTATATTGCTGTTGAC
Page 75 and 76: R E1 A GAACGAATAGTGAAGCCACAGATGTA s
Page 77 and 78: 100mm 25ug 225ul 250ul 500 1000ul T
Page 79 and 80: for the transgene were considered a
Page 81 and 82: solution in TBS-T containing 0.02%
Page 83 and 84: mounting agent. Confocal images wer
Page 85 and 86: 3.26 Antibodies used for Western bl
Page 87 and 88: each plate was added cold 500ml of
Page 89 and 90: 3.32 Hanging drop assay to determin
Page 91: 3.37 Biodistribution of 18 F -FDG u
Page 95 and 96: CHAPTER 4 RESULTS 95
Page 97 and 98: Figure 4.1.1 Generation of lentivir
Page 99 and 100: 4.1.2 Generation of lentiviral vect
Page 101 and 102: transduction with the virus. Untran
Page 103 and 104: Figure 4.1.6: Application of bi-cis
Page 105 and 106: Figure 4.1.7: Application of bi-cis
Page 107 and 108: Figure 4.2.1: Infection of morulae
Page 109 and 110: Figure 4.2.2: Generation of transge
Page 111 and 112: Figure 4.2.3: EGFP-f expression in
Page 113 and 114: sequenced and the distribution amon
Page 115 and 116: 4.3 Generation of 14-3-3γ knockdow
Page 117 and 118: numbering). Alignment was done usin
Page 119 and 120: presence of EGFP-f by performing po
Page 121 and 122: the mouse tested infected with vect
Page 123 and 124: Figure 4.3.7: Staging of 14-3-3γ k
Page 125 and 126: containing spermatozoa is on the Y-
Page 127 and 128: Figure 4.3.9: 14-3-3γ knockdown le
Page 129 and 130: Figure 4.3.11: 14-3-3γ knockdown i
Page 131 and 132: intercellular space (12, 110, 115,
Page 133 and 134: Figure 4.3.13: 14-3-3γ loss leads
Page 135 and 136: Figure 4.3.16: Localization of PKP3
Page 137 and 138: Figure 4.3.18: Reintroduction of sh
Page 139 and 140: A B 139
Page 141 and 142: from our laboratory demonstrated th
Page 143 and 144:
Figure 4.3.21: Plakoglobin recruitm
Page 145 and 146:
4.3.23 (A and B)). These proteins g
Page 147 and 148:
the desmosomal proteins recruitment
Page 149 and 150:
Figure 4.3.25: Generation of stable
Page 151 and 152:
KIF5B, however its reduction does n
Page 153 and 154:
compared to vector control cells. (
Page 155 and 156:
4.4 Generation of 14-3-3ε knockdow
Page 157 and 158:
into the interstitial spaces of the
Page 159 and 160:
Figure 4.4.3: 14-3-3ε knockdown in
Page 161 and 162:
Figure 4.4.4: Patchy hair loss in 1
Page 163 and 164:
follicle formation marked by black
Page 165 and 166:
Figure 4.4.7: Phenotypes in 14-3-3
Page 167 and 168:
compared to WT lungs (indicated by
Page 169 and 170:
compared to wild type (Figure 4.4.1
Page 171 and 172:
and CD4 positive lyumphocyte number
Page 173 and 174:
Figure 4.4.13: Bone marrow cells fr
Page 175 and 176:
Figure 4.4.15: Generation of stable
Page 177 and 178:
Figure 4.4.16: NIH3T3 cells lacking
Page 179 and 180:
Figure 4.4.18: Generation of induci
Page 181 and 182:
CHAPTER 5 DISCUSSION 181
Page 183 and 184:
to generate transgenic animals expr
Page 185 and 186:
transgenic research and the use of
Page 187 and 188:
(reviewed in (152, 374)). Kinesins
Page 189 and 190:
subtypes known to date. Type IV col
Page 191 and 192:
Figure 5.1 Schematic representation
Page 193 and 194:
loss of 14-3-3ε the T cell activat
Page 195 and 196:
BIBLIOGRAPHY: 1. Abraham, R. T. 200
Page 197 and 198:
29. Blomer, U., L. Naldini, T. Kafr
Page 199 and 200:
58. Cheng, C. Y., and D. D. Mruk. 2
Page 201 and 202:
90. Elia, A. E., P. Rellos, L. F. H
Page 203 and 204:
118. Girard, F., U. Strausfeld, J.
Page 205 and 206:
150. Herrmann, H., M. Haner, M. Bre
Page 207 and 208:
and activation of a cyclin E-cdk2 c
Page 209 and 210:
213. Liu, D., J. Bienkowska, C. Pet
Page 211 and 212:
242. Moll, R., W. W. Franke, D. L.
Page 213 and 214:
274. Pagano, M., R. Pepperkok, F. V
Page 215 and 216:
305. Russell, L. D. 1978. The blood
Page 217 and 218:
inhibitor of metalloproteases-1 in
Page 219 and 220:
364. Tsunekawa, N., M. Matsumoto, S
Page 221 and 222:
397. Yashiro, M., N. Nishioka, and
Page 223:
Research: Biology to Prevention to
show all

LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?