LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

More documents

Recommendations

Info

conducted using RevertAid First Strand cDNA synthesis Kit (NEB) according to manufacturer’s protocol. Name of oligonucleotide Ptch Forward Ptch Reverse IPCR A IPCR B GAPDH Forward GAPDH Reverse EGFP-f Fwd EGFP-f Rev RFP Fwd RFP Rev Sequence CTGCGGCAAGTTTTTGGTTG AGGGCTTCTCGTTGGCTACAAG CGGCGCGCCCTGCTGAGC GGCCACCGTCGGCGTCTCGCCCG GGCTGCCCAGAACATCAT CGGACACATTGGGGGTAG GAATTCCACCATGGTGAGCAAG GGATCCCCTCAGGAGAGCACACACTT ATGAGCGAGCTGATCAAGG TTATCTGTGCCCCAGTTTGC Table 3.8: List of oligonucleotides used for genomic PCR reactions. 3.18 Antibodies. Tissue culture supernatants of the anti-HA (12CA5), anti-14-3-3γ antibody (CG31) antibodies were used at a dilution of 1:50. The anti-14-3-3 antibody (T-16, Santacruz) and ascitic fluid containing the anti-CDC25C antibody (TC14) were used at a dilution of 1:2000. The anti-GFP antibody (JL-8, Clontech) was used at a dilution of 1:15,000. The primary antibodies for plakophilin3 (clone 23E3-4, Zymed, dilution 1:1000), cytokeratin8 (mouse monoclonal, Sigma, dilution 1:5000), cytokeratin18 (mouse monoclonal, Sigma, dilution 1:50,000), β Actin (mouse monoclonal, Sigma, dilution 1:5000), desmoglein2 (mouse monoclonal, Zymed, dilution 1:500), desmoglein3 (mouse monoclonal, Zymed, dilution 1:500), desmocollin2 & 3 (mouse monoclonal, Zymed, dilution 1:500), desmoplakin I & II (rabbit polyclonal, Santacruz, dilution 1:1000 or Abexome 1:100), plakoglobin (mouse monoclonal, Abcam, dilution 1:500 or abexome 1:100) were used for Western blot analysis. Respective secondary antibodies were used at a dilution of 1:1000 (Invitrogen) or 1:5000 (Pierce). All primary antibody dilutions were made in 1% BSA 80
solution in TBS-T containing 0.02% sodium azide. The antibody dilutions of secondary goat anti-mouse HRP and goat anti-rabbit HRP antibodies were made in 2.5% milk (Carnation) in TBS-T containing 1% goat serum. Dilutions of the secondary anti-goat antibody were made in 2.5% milk (Carnation) in TBS-T without goat serum. 3.19 Histology. For histological analysis of mutlitple tissues were fixed in 10% formaldehyde (SIGMA) overnight and processed for histology. Five micron sections of paraffin embedded tissue were prepared and haematoxylin/eosin staining was performed according to standard methods (197). 3.20 Immunohistochemistry. For immunohistochemical staining of lung, spleen, testis and skin section, the mice were sacrificed and the tissues were fixed in 10% formaldehyde (SIGMA) overnight and processed for histology. 5µm sections of paraffin embedded tissue were prepared and permeabilized for antigen retrieval by microwaving the fixed tissue sections in 10mM Tris buffer (pH 9) with 2mM EDTA and immunohistochemical staining was performed using vectastain ABC kit according to manufacturer’s protocol. 3.21 Immunofluorescence and confocal microscopy. 5 m cryosections of multiple tissues were observed by confocal microscopy to detect the presence of EGFP-f. Confocal images were obtained by using a LSM 510 Meta Carl Zeiss Confocal system with an Argon 488 nm and Helium/Neon 543 nm lasers. All images were obtained using an Axio Observer Z.1 microscope (numerical aperture [NA] 1.4) at a magnification of X 63. 5µm cryosections of the different tissues were deparafinzed and treated with 1% sodium borohydrate at room temperature to reduce auto-fluoresence of tissues. Blocking was performed with 1%BSA and tissues were further immunostained using GFP monoclonal antibody 1:50 (clonetech) overnight to detect the presence of EGFP-f. The next day, the sections were washed and incubated with the secondary antibody (Goat Anti mouse Alexa fluor 568 1:200 Invitrogen). Prpodium iodide was used to stain sperm DNA. Confocal images were obtained as 81
Page 1 and 2:
Generation of knockdown mice that l
Page 3 and 4:
STATEMENT BY AUTHOR This dissertati
Page 5 and 6:
CERTIFICATE I certify that the thes
Page 7 and 8:
I am thankful to Mr Uday Dandekar f
Page 9 and 10:
3.16 Isolation of Genomic DNA (gDNA
Page 11 and 12:
A synopsis of thesis to be submitte
Page 13 and 14:
esults in loss of 14-3-3 binding an
Page 15 and 16:
and NheI (NEB) to remove tetO-CMV,
Page 17 and 18:
Hanging drop and wound healing assa
Page 19 and 20:
360). To generate transgenic animal
Page 21 and 22:
asement of the seminiferous tubules
Page 23 and 24:
normal female, pups were screened f
Page 25 and 26:
14-3-3ε only in the presence of HP
Page 27 and 28:
proteins are expressed in testis (3
Page 29 and 30: 5. Lalit Sehgal, Srikanth B., Khyat
Page 31 and 32: Presented a poster at 33rd All Indi
Page 33 and 34: shRNA siRNA TBS-T U.V WT C IF DSG D
Page 35 and 36: List of Figures: Page No 1. Figure
Page 37 and 38: 37. Figure 4.3.20: 14-3-3γ interac
Page 39 and 40: CHAPTER 1 INTRODUCTION 39
Page 41 and 42: 1.1.1 Cyclin Cdk complexes Eukaryot
Page 43 and 44: 1.1.1.c Cyclin A cdk complexes The
Page 45 and 46: of which are associated with acquis
Page 47 and 48: 1.2.2 The G1/S DNA Damage checkpoin
Page 49 and 50: complexes. DNA damage induced degra
Page 51 and 52: cytoplasmic accumulation of cdc25 p
Page 53 and 54: 14-3-3 binding site. 14-3-3 binding
Page 55 and 56: G2 arrest and induced premature chr
Page 57 and 58: emoval of S216 phosphorylation as i
Page 59 and 60: embryogenesis, a loss of cdc25A can
Page 61 and 62: dimer was essential for Raf activat
Page 63 and 64: of enhanced apoptosis of peripheral
Page 65 and 66: the generation of transgenic mice a
Page 67 and 68: CHAPTER 2 AIMS AND OBJECTIVES 67
Page 69 and 70: CHAPTER 3 MATERIALS AND METHODS 69
Page 71 and 72: Name of oligonucleotide EF1α Forwa
Page 73 and 74: cleavage sites GAAGGTATATTGCTGTTGAC
Page 75 and 76: R E1 A GAACGAATAGTGAAGCCACAGATGTA s
Page 77 and 78: 100mm 25ug 225ul 250ul 500 1000ul T
Page 79: for the transgene were considered a
Page 83 and 84: mounting agent. Confocal images wer
Page 85 and 86: 3.26 Antibodies used for Western bl
Page 87 and 88: each plate was added cold 500ml of
Page 89 and 90: 3.32 Hanging drop assay to determin
Page 91 and 92: 3.37 Biodistribution of 18 F -FDG u
Page 93 and 94: 2.5M NaCl 150mM 60ml Tween-20 (Sigm
Page 95 and 96: CHAPTER 4 RESULTS 95
Page 97 and 98: Figure 4.1.1 Generation of lentivir
Page 99 and 100: 4.1.2 Generation of lentiviral vect
Page 101 and 102: transduction with the virus. Untran
Page 103 and 104: Figure 4.1.6: Application of bi-cis
Page 105 and 106: Figure 4.1.7: Application of bi-cis
Page 107 and 108: Figure 4.2.1: Infection of morulae
Page 109 and 110: Figure 4.2.2: Generation of transge
Page 111 and 112: Figure 4.2.3: EGFP-f expression in
Page 113 and 114: sequenced and the distribution amon
Page 115 and 116: 4.3 Generation of 14-3-3γ knockdow
Page 117 and 118: numbering). Alignment was done usin
Page 119 and 120: presence of EGFP-f by performing po
Page 121 and 122: the mouse tested infected with vect
Page 123 and 124: Figure 4.3.7: Staging of 14-3-3γ k
Page 125 and 126: containing spermatozoa is on the Y-
Page 127 and 128: Figure 4.3.9: 14-3-3γ knockdown le
Page 129 and 130: Figure 4.3.11: 14-3-3γ knockdown i
Page 131 and 132:
intercellular space (12, 110, 115,
Page 133 and 134:
Figure 4.3.13: 14-3-3γ loss leads
Page 135 and 136:
Figure 4.3.16: Localization of PKP3
Page 137 and 138:
Figure 4.3.18: Reintroduction of sh
Page 139 and 140:
A B 139
Page 141 and 142:
from our laboratory demonstrated th
Page 143 and 144:
Figure 4.3.21: Plakoglobin recruitm
Page 145 and 146:
4.3.23 (A and B)). These proteins g
Page 147 and 148:
the desmosomal proteins recruitment
Page 149 and 150:
Figure 4.3.25: Generation of stable
Page 151 and 152:
KIF5B, however its reduction does n
Page 153 and 154:
compared to vector control cells. (
Page 155 and 156:
4.4 Generation of 14-3-3ε knockdow
Page 157 and 158:
into the interstitial spaces of the
Page 159 and 160:
Figure 4.4.3: 14-3-3ε knockdown in
Page 161 and 162:
Figure 4.4.4: Patchy hair loss in 1
Page 163 and 164:
follicle formation marked by black
Page 165 and 166:
Figure 4.4.7: Phenotypes in 14-3-3
Page 167 and 168:
compared to WT lungs (indicated by
Page 169 and 170:
compared to wild type (Figure 4.4.1
Page 171 and 172:
and CD4 positive lyumphocyte number
Page 173 and 174:
Figure 4.4.13: Bone marrow cells fr
Page 175 and 176:
Figure 4.4.15: Generation of stable
Page 177 and 178:
Figure 4.4.16: NIH3T3 cells lacking
Page 179 and 180:
Figure 4.4.18: Generation of induci
Page 181 and 182:
CHAPTER 5 DISCUSSION 181
Page 183 and 184:
to generate transgenic animals expr
Page 185 and 186:
transgenic research and the use of
Page 187 and 188:
(reviewed in (152, 374)). Kinesins
Page 189 and 190:
subtypes known to date. Type IV col
Page 191 and 192:
Figure 5.1 Schematic representation
Page 193 and 194:
loss of 14-3-3ε the T cell activat
Page 195 and 196:
BIBLIOGRAPHY: 1. Abraham, R. T. 200
Page 197 and 198:
29. Blomer, U., L. Naldini, T. Kafr
Page 199 and 200:
58. Cheng, C. Y., and D. D. Mruk. 2
Page 201 and 202:
90. Elia, A. E., P. Rellos, L. F. H
Page 203 and 204:
118. Girard, F., U. Strausfeld, J.
Page 205 and 206:
150. Herrmann, H., M. Haner, M. Bre
Page 207 and 208:
and activation of a cyclin E-cdk2 c
Page 209 and 210:
213. Liu, D., J. Bienkowska, C. Pet
Page 211 and 212:
242. Moll, R., W. W. Franke, D. L.
Page 213 and 214:
274. Pagano, M., R. Pepperkok, F. V
Page 215 and 216:
305. Russell, L. D. 1978. The blood
Page 217 and 218:
inhibitor of metalloproteases-1 in
Page 219 and 220:
364. Tsunekawa, N., M. Matsumoto, S
Page 221 and 222:
397. Yashiro, M., N. Nishioka, and
Page 223:
Research: Biology to Prevention to
show all

LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

Create successful ePaper yourself

Delete template?

Save as template?