LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute
LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute
LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
conducted using RevertAid First Strand cDNA synthesis Kit (NEB) according to<br />
manufacturer’s protocol.<br />
Name of oligonucleotide<br />
Ptch Forward<br />
Ptch Reverse<br />
IPCR A<br />
IPCR B<br />
GAPDH Forward<br />
GAPDH Reverse<br />
EGFP-f Fwd<br />
EGFP-f Rev<br />
RFP Fwd<br />
RFP Rev<br />
Sequence<br />
CTGCGGCAAGTTTTTGGTTG<br />
AGGGCTTCTCGTTGGCTACAAG<br />
CGGCGCGCCCTGCTGAGC<br />
GGCCACCGTCGGCGTCTCGCCCG<br />
GGCTGCCCAGAACATCAT<br />
CGGACACATTGGGGGTAG<br />
GAATTCCACCATGGTGAGCAAG<br />
GGATCCCCTCAGGAGAGCACACACTT<br />
ATGAGCGAGCTGATCAAGG<br />
TTATCTGTGCCCCAGTTTGC<br />
Table 3.8: List of oligonucleotides used for genomic PCR reactions.<br />
3.18 Antibodies.<br />
Tissue culture supernatants of the anti-HA (12CA5), anti-14-3-3γ antibody (CG31)<br />
antibodies were used at a dilution of 1:50. The anti-14-3-3 antibody (T-16, Santacruz)<br />
and ascitic fluid containing the anti-CDC25C antibody (TC14) were used at a dilution of<br />
1:2000. The anti-GFP antibody (JL-8, Clontech) was used at a dilution of 1:15,000. The<br />
primary antibodies for plakophilin3 (clone 23E3-4, Zymed, dilution 1:1000), cytokeratin8<br />
(mouse monoclonal, Sigma, dilution 1:5000), cytokeratin18 (mouse monoclonal, Sigma,<br />
dilution 1:50,000), β Actin (mouse monoclonal, Sigma, dilution 1:5000), desmoglein2<br />
(mouse monoclonal, Zymed, dilution 1:500), desmoglein3 (mouse monoclonal, Zymed,<br />
dilution 1:500), desmocollin2 & 3 (mouse monoclonal, Zymed, dilution 1:500),<br />
desmoplakin I & II (rabbit polyclonal, Santacruz, dilution 1:1000 or Abexome 1:100),<br />
plakoglobin (mouse monoclonal, Abcam, dilution 1:500 or abexome 1:100) were used for<br />
Western blot analysis. Respective secondary antibodies were used at a dilution of 1:1000<br />
(Invitrogen) or 1:5000 (Pierce). All primary antibody dilutions were made in 1% BSA<br />
80