LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

More documents

Recommendations

Info

cells undergoing premature mitosis show premature chromatin condensation (PCC) (69). The functional ability of the 14-3-3 isoforms to regulate cdc25C function was tested by determining the ability of the 14-3-3 isoforms to inhibit PCC caused by cdc25C overexpression. It was observed that only the two 14-3-3 isoforms that were able to form a complex with cdc25C in vivo, 14-3-3ε and 14-3-3γ could inhibit cdc25C function. 14- 3-3ε and 14-3-3γ however could not inhibit PCC caused by the 14-3-3 non binding cdc25C mutant, S216A indicating that binding of 14-3-3 to cdc25C via the phosphomotif was essential in the regulation of cdc25C function (69, 279). The binding of 14-3-3 proteins to their ligands occurs via two interactions (393). The first is the primary interaction that involves the interaction of the phosphoserine of the ligand with the residues in the phosphopeptide binding groove. After the primary interaction, the 14-3-3 undergoes conformational changes that specify secondary contacts with other domains in the ligand (396). This secondary interaction is known to impart ligand specificity to the 14-3-3 protein. 14-3-3ɛ and 14-3-3γ have the F/V pocket that maybe required for specific complex formation with cdc25C in vivo. 14-3-3 isoforms (β, η, τ, σ and ζ) that do not form a complex with cdc25C do not form this pocket, either because they do not have a Phenylalanine residue at the position corresponding to 135 in 14-3-3ɛ or because they lack the E94-K142 salt bridge present in 14-3-3γ (354). Thus, it seems that the F/V pocket contributes to the specificity of complex formation of 14-3-3ɛ and 14- 3-3γ with cdc25C in vivo (354). Further, mutation of this residue to the corresponding residue present in other 14-3-3 isoforms (F135V) leads to reduced binding to cdc25C and a decrease in the ability to inhibit cdc25C function in vivo. Similarly, F135V failed to rescue the incomplete S phase and the G2 DNA damage checkpoint defects observed in cells lacking 14-3-3ε (354). These results suggest that the specificity of the 14-3-3 ligand interaction may be dependent on structural motifs present in the individual 14-3-3 isoforms (354). Similarly, a decrease in the expression of 14-3-3γ in HCT116 cells resulted in an override of both the incomplete S phase and the G2 DNA damage checkpoint due to failure to inhibit cdc25C function (157). 1.4.3. 14-3-3 knockout mice Several 14-3-3 genes have been knocked out in mice resulting in a variety of phenotypes. E.g. Gene-targeted disruption of 14-3-3σ in mice impairs B-cell homeostasis as a result 62
of enhanced apoptosis of peripheral B cells (347). Loss of 14-3-3σ led to abnormal BCR signaling that damaged the TI immune response, inhibition of early antigenspecific IgM secretion, increased degradation of FOXO1 protein and elevated FOXOs transcriptional activity (347). Thus, 14-3-3σ is essential for B-cell homeostasis because it maintains steady-state FOXO1 protein and modulates FOXO-mediated apoptosis (347). Knockout mice have also been generated for 14-3-3ε and 14-3-3γ. Toyo-oka et al have found that mice with homozygous deletion of 14-3-3 died at birth and the heterozygous mice shows defect in neuronal migration and cortical thining by altering the function of the LIS1 complex (363). Specifically, they found that 14-3-3 interacts with NUDEL, a known binding partner of LIS1 and that the interaction with 14-3-3 protects Cdk5- phosphorylated NUDEL from dephosphorylation. Maintaining the phosphorylation status of NUDEL is crucial for the correct localization and function of the LIS1-NUDEL complex resulting in neuronal migration. 14-3-3 also binds to NUDEL as demonstrated by yeast two hybrid assay (363), however targeted disruption of 14-3-3 in mice did not show defects in neuronal migration or cortical thinning and moreover the knockout mice were not lethal (342). These results suggest that loss of 14-3-3 genes in the animal may not necessarily reflect what happens in cells in culture. This might be due to compensation by other 14-3-3 isoforms and therefore, studying hypomorphic alleles for the different isoforms might lead to novel insights into their role in growth and development. 1.5 Generation of transgenic mouse models. The first gene transfer into mouse using isolated DNA revealed that the generation of animals stably harboring foreign DNA (121) and having modified phenotypic properties (33, 275) was possible. These experiments also revealed some of the limitations of transgenesis: the generation of transgenic animals by gene microinjection was laborious; the first transgene unexpectedly remained very poorly active or inactive; the growth hormone gene induced an overgrowing of the transgenic mice with numerous physiological side-effects (32). These observations revealed that the reintegration of an isolated gene into the genome of an animal may generate complex and unpredictable biological situations. Direct gene injections were extended to three others mammals (137) 63
Page 1 and 2:
Generation of knockdown mice that l
Page 3 and 4:
STATEMENT BY AUTHOR This dissertati
Page 5 and 6:
CERTIFICATE I certify that the thes
Page 7 and 8:
I am thankful to Mr Uday Dandekar f
Page 9 and 10:
3.16 Isolation of Genomic DNA (gDNA
Page 11 and 12: A synopsis of thesis to be submitte
Page 13 and 14: esults in loss of 14-3-3 binding an
Page 15 and 16: and NheI (NEB) to remove tetO-CMV,
Page 17 and 18: Hanging drop and wound healing assa
Page 19 and 20: 360). To generate transgenic animal
Page 21 and 22: asement of the seminiferous tubules
Page 23 and 24: normal female, pups were screened f
Page 25 and 26: 14-3-3ε only in the presence of HP
Page 27 and 28: proteins are expressed in testis (3
Page 29 and 30: 5. Lalit Sehgal, Srikanth B., Khyat
Page 31 and 32: Presented a poster at 33rd All Indi
Page 33 and 34: shRNA siRNA TBS-T U.V WT C IF DSG D
Page 35 and 36: List of Figures: Page No 1. Figure
Page 37 and 38: 37. Figure 4.3.20: 14-3-3γ interac
Page 39 and 40: CHAPTER 1 INTRODUCTION 39
Page 41 and 42: 1.1.1 Cyclin Cdk complexes Eukaryot
Page 43 and 44: 1.1.1.c Cyclin A cdk complexes The
Page 45 and 46: of which are associated with acquis
Page 47 and 48: 1.2.2 The G1/S DNA Damage checkpoin
Page 49 and 50: complexes. DNA damage induced degra
Page 51 and 52: cytoplasmic accumulation of cdc25 p
Page 53 and 54: 14-3-3 binding site. 14-3-3 binding
Page 55 and 56: G2 arrest and induced premature chr
Page 57 and 58: emoval of S216 phosphorylation as i
Page 59 and 60: embryogenesis, a loss of cdc25A can
Page 61: dimer was essential for Raf activat
Page 65 and 66: the generation of transgenic mice a
Page 67 and 68: CHAPTER 2 AIMS AND OBJECTIVES 67
Page 69 and 70: CHAPTER 3 MATERIALS AND METHODS 69
Page 71 and 72: Name of oligonucleotide EF1α Forwa
Page 73 and 74: cleavage sites GAAGGTATATTGCTGTTGAC
Page 75 and 76: R E1 A GAACGAATAGTGAAGCCACAGATGTA s
Page 77 and 78: 100mm 25ug 225ul 250ul 500 1000ul T
Page 79 and 80: for the transgene were considered a
Page 81 and 82: solution in TBS-T containing 0.02%
Page 83 and 84: mounting agent. Confocal images wer
Page 85 and 86: 3.26 Antibodies used for Western bl
Page 87 and 88: each plate was added cold 500ml of
Page 89 and 90: 3.32 Hanging drop assay to determin
Page 91 and 92: 3.37 Biodistribution of 18 F -FDG u
Page 93 and 94: 2.5M NaCl 150mM 60ml Tween-20 (Sigm
Page 95 and 96: CHAPTER 4 RESULTS 95
Page 97 and 98: Figure 4.1.1 Generation of lentivir
Page 99 and 100: 4.1.2 Generation of lentiviral vect
Page 101 and 102: transduction with the virus. Untran
Page 103 and 104: Figure 4.1.6: Application of bi-cis
Page 105 and 106: Figure 4.1.7: Application of bi-cis
Page 107 and 108: Figure 4.2.1: Infection of morulae
Page 109 and 110: Figure 4.2.2: Generation of transge
Page 111 and 112: Figure 4.2.3: EGFP-f expression in
Page 113 and 114:
sequenced and the distribution amon
Page 115 and 116:
4.3 Generation of 14-3-3γ knockdow
Page 117 and 118:
numbering). Alignment was done usin
Page 119 and 120:
presence of EGFP-f by performing po
Page 121 and 122:
the mouse tested infected with vect
Page 123 and 124:
Figure 4.3.7: Staging of 14-3-3γ k
Page 125 and 126:
containing spermatozoa is on the Y-
Page 127 and 128:
Figure 4.3.9: 14-3-3γ knockdown le
Page 129 and 130:
Figure 4.3.11: 14-3-3γ knockdown i
Page 131 and 132:
intercellular space (12, 110, 115,
Page 133 and 134:
Figure 4.3.13: 14-3-3γ loss leads
Page 135 and 136:
Figure 4.3.16: Localization of PKP3
Page 137 and 138:
Figure 4.3.18: Reintroduction of sh
Page 139 and 140:
A B 139
Page 141 and 142:
from our laboratory demonstrated th
Page 143 and 144:
Figure 4.3.21: Plakoglobin recruitm
Page 145 and 146:
4.3.23 (A and B)). These proteins g
Page 147 and 148:
the desmosomal proteins recruitment
Page 149 and 150:
Figure 4.3.25: Generation of stable
Page 151 and 152:
KIF5B, however its reduction does n
Page 153 and 154:
compared to vector control cells. (
Page 155 and 156:
4.4 Generation of 14-3-3ε knockdow
Page 157 and 158:
into the interstitial spaces of the
Page 159 and 160:
Figure 4.4.3: 14-3-3ε knockdown in
Page 161 and 162:
Figure 4.4.4: Patchy hair loss in 1
Page 163 and 164:
follicle formation marked by black
Page 165 and 166:
Figure 4.4.7: Phenotypes in 14-3-3
Page 167 and 168:
compared to WT lungs (indicated by
Page 169 and 170:
compared to wild type (Figure 4.4.1
Page 171 and 172:
and CD4 positive lyumphocyte number
Page 173 and 174:
Figure 4.4.13: Bone marrow cells fr
Page 175 and 176:
Figure 4.4.15: Generation of stable
Page 177 and 178:
Figure 4.4.16: NIH3T3 cells lacking
Page 179 and 180:
Figure 4.4.18: Generation of induci
Page 181 and 182:
CHAPTER 5 DISCUSSION 181
Page 183 and 184:
to generate transgenic animals expr
Page 185 and 186:
transgenic research and the use of
Page 187 and 188:
(reviewed in (152, 374)). Kinesins
Page 189 and 190:
subtypes known to date. Type IV col
Page 191 and 192:
Figure 5.1 Schematic representation
Page 193 and 194:
loss of 14-3-3ε the T cell activat
Page 195 and 196:
BIBLIOGRAPHY: 1. Abraham, R. T. 200
Page 197 and 198:
29. Blomer, U., L. Naldini, T. Kafr
Page 199 and 200:
58. Cheng, C. Y., and D. D. Mruk. 2
Page 201 and 202:
90. Elia, A. E., P. Rellos, L. F. H
Page 203 and 204:
118. Girard, F., U. Strausfeld, J.
Page 205 and 206:
150. Herrmann, H., M. Haner, M. Bre
Page 207 and 208:
and activation of a cyclin E-cdk2 c
Page 209 and 210:
213. Liu, D., J. Bienkowska, C. Pet
Page 211 and 212:
242. Moll, R., W. W. Franke, D. L.
Page 213 and 214:
274. Pagano, M., R. Pepperkok, F. V
Page 215 and 216:
305. Russell, L. D. 1978. The blood
Page 217 and 218:
inhibitor of metalloproteases-1 in
Page 219 and 220:
364. Tsunekawa, N., M. Matsumoto, S
Page 221 and 222:
397. Yashiro, M., N. Nishioka, and
Page 223:
Research: Biology to Prevention to
show all

LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?