LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

More documents

Recommendations

Info

List of Tables: Page No 1. Table 3.1: List of oligonucleotides used for PCR reactions. 71 2. Table 3.2: List of oligonucleotides used for shRNA cloning. 73 3. Table 3.3: List of oligonucleotides used for cloning shRNAmiR. 74 4. Table 3.4: List of oligonucleotides used for cloning HA tagged 14-3-3 protein. 75 5. Table 3.5: List of oligonucleotides used for cloning shRNA resistant 14-3-3ε and 14-3-3γ. 76 6. Table 3.6: Calcium phosphate transfection mix. 76 7. Table 3.7: List of oligonucleotides used to amplify YFP K18. 79 8. Table 3.8: List of oligonucleotides used for genomic PCR reactions. 80 9. Table 4.2.1: Percentage of EGFP-f positive pups obtained from individual mating with three different pre-founder mice. 108 10. Table 4.2.2: Summary of the integration events observed in the different transgenic animals. 114 11. Table 4.3.1: 14-3-3γ knockdown clones show a defect in cell adhesion. 129 34
List of Figures: Page No 1. Figure 1.1: The cell cycle: 40 2. Figure 1.2: The DNA damage checkpoint pathway. 45 3. Figure 1.3: The G1/S DNA damage checkpoint response. 48 4. Figure 1.4: The incomplete S phase checkpoint response. 50 5. Figure 1.5: The G2/M DNA damage checkpoint response. 52 6. Figure 1.6: Regulation of cdc25C by the checkpoint pathway 55 7. Figure 4.1.1: Generation of lentiviral vectors for the expression of shRNA’s. 97 8. Figure 4.1.2: Generation of pBSK-F2 shuttle vector 98 9. Figure 4.1.3: Generation of lentiviral vectors for the expression of cDNA 99 10. Figure 4.1.4: Generation of bi-cistronic lentiviral vectors for the expression of cDNA 100 11. Figure 4.1.5: Transient and stable transgene expression using bi-cistronic lentiviral vector. 101 12. Figure 4.1.6: Application of bi-cistronic lentiviral vectors in live cell imaging.. 98 13. Figure 4.1.7: Application of bi-cistronic lentiviral vectors in live cell imaging. 103 14. Figure 4.2.1: Infection of morulae in vivo results in the generation of EGFP-f transgenic mice. 106 15. Figure 4.2.2: Generation of transgenic mice. 109 16. Figure 4.2.3: EGFP-f expression in various tissues of founder mice. 111 17. Figure 4.2.4. Analysis of integration events in the EGFP-f transgenic mice. 113 18. Figure 4.3.1: 14-3-3γ or 14-3-3ε does not interact with cdc25C. 116 19. Figure 4.3.2: Testing the 14-3-3γ cDNA and shRNA constructs. 117 20. Figure 4.3.3: Generation of 14-3-3γ knockdown mice 118 21. Figure 4.3.4: Screening for the lentiviral integration in testis 35
Page 1 and 2: Generation of knockdown mice that l
Page 3 and 4: STATEMENT BY AUTHOR This dissertati
Page 5 and 6: CERTIFICATE I certify that the thes
Page 7 and 8: I am thankful to Mr Uday Dandekar f
Page 9 and 10: 3.16 Isolation of Genomic DNA (gDNA
Page 11 and 12: A synopsis of thesis to be submitte
Page 13 and 14: esults in loss of 14-3-3 binding an
Page 15 and 16: and NheI (NEB) to remove tetO-CMV,
Page 17 and 18: Hanging drop and wound healing assa
Page 19 and 20: 360). To generate transgenic animal
Page 21 and 22: asement of the seminiferous tubules
Page 23 and 24: normal female, pups were screened f
Page 25 and 26: 14-3-3ε only in the presence of HP
Page 27 and 28: proteins are expressed in testis (3
Page 29 and 30: 5. Lalit Sehgal, Srikanth B., Khyat
Page 31 and 32: Presented a poster at 33rd All Indi
Page 33: shRNA siRNA TBS-T U.V WT C IF DSG D
Page 37 and 38: 37. Figure 4.3.20: 14-3-3γ interac
Page 39 and 40: CHAPTER 1 INTRODUCTION 39
Page 41 and 42: 1.1.1 Cyclin Cdk complexes Eukaryot
Page 43 and 44: 1.1.1.c Cyclin A cdk complexes The
Page 45 and 46: of which are associated with acquis
Page 47 and 48: 1.2.2 The G1/S DNA Damage checkpoin
Page 49 and 50: complexes. DNA damage induced degra
Page 51 and 52: cytoplasmic accumulation of cdc25 p
Page 53 and 54: 14-3-3 binding site. 14-3-3 binding
Page 55 and 56: G2 arrest and induced premature chr
Page 57 and 58: emoval of S216 phosphorylation as i
Page 59 and 60: embryogenesis, a loss of cdc25A can
Page 61 and 62: dimer was essential for Raf activat
Page 63 and 64: of enhanced apoptosis of peripheral
Page 65 and 66: the generation of transgenic mice a
Page 67 and 68: CHAPTER 2 AIMS AND OBJECTIVES 67
Page 69 and 70: CHAPTER 3 MATERIALS AND METHODS 69
Page 71 and 72: Name of oligonucleotide EF1α Forwa
Page 73 and 74: cleavage sites GAAGGTATATTGCTGTTGAC
Page 75 and 76: R E1 A GAACGAATAGTGAAGCCACAGATGTA s
Page 77 and 78: 100mm 25ug 225ul 250ul 500 1000ul T
Page 79 and 80: for the transgene were considered a
Page 81 and 82: solution in TBS-T containing 0.02%
Page 83 and 84: mounting agent. Confocal images wer
Page 85 and 86:
3.26 Antibodies used for Western bl
Page 87 and 88:
each plate was added cold 500ml of
Page 89 and 90:
3.32 Hanging drop assay to determin
Page 91 and 92:
3.37 Biodistribution of 18 F -FDG u
Page 93 and 94:
2.5M NaCl 150mM 60ml Tween-20 (Sigm
Page 95 and 96:
CHAPTER 4 RESULTS 95
Page 97 and 98:
Figure 4.1.1 Generation of lentivir
Page 99 and 100:
4.1.2 Generation of lentiviral vect
Page 101 and 102:
transduction with the virus. Untran
Page 103 and 104:
Figure 4.1.6: Application of bi-cis
Page 105 and 106:
Figure 4.1.7: Application of bi-cis
Page 107 and 108:
Figure 4.2.1: Infection of morulae
Page 109 and 110:
Figure 4.2.2: Generation of transge
Page 111 and 112:
Figure 4.2.3: EGFP-f expression in
Page 113 and 114:
sequenced and the distribution amon
Page 115 and 116:
4.3 Generation of 14-3-3γ knockdow
Page 117 and 118:
numbering). Alignment was done usin
Page 119 and 120:
presence of EGFP-f by performing po
Page 121 and 122:
the mouse tested infected with vect
Page 123 and 124:
Figure 4.3.7: Staging of 14-3-3γ k
Page 125 and 126:
containing spermatozoa is on the Y-
Page 127 and 128:
Figure 4.3.9: 14-3-3γ knockdown le
Page 129 and 130:
Figure 4.3.11: 14-3-3γ knockdown i
Page 131 and 132:
intercellular space (12, 110, 115,
Page 133 and 134:
Figure 4.3.13: 14-3-3γ loss leads
Page 135 and 136:
Figure 4.3.16: Localization of PKP3
Page 137 and 138:
Figure 4.3.18: Reintroduction of sh
Page 139 and 140:
A B 139
Page 141 and 142:
from our laboratory demonstrated th
Page 143 and 144:
Figure 4.3.21: Plakoglobin recruitm
Page 145 and 146:
4.3.23 (A and B)). These proteins g
Page 147 and 148:
the desmosomal proteins recruitment
Page 149 and 150:
Figure 4.3.25: Generation of stable
Page 151 and 152:
KIF5B, however its reduction does n
Page 153 and 154:
compared to vector control cells. (
Page 155 and 156:
4.4 Generation of 14-3-3ε knockdow
Page 157 and 158:
into the interstitial spaces of the
Page 159 and 160:
Figure 4.4.3: 14-3-3ε knockdown in
Page 161 and 162:
Figure 4.4.4: Patchy hair loss in 1
Page 163 and 164:
follicle formation marked by black
Page 165 and 166:
Figure 4.4.7: Phenotypes in 14-3-3
Page 167 and 168:
compared to WT lungs (indicated by
Page 169 and 170:
compared to wild type (Figure 4.4.1
Page 171 and 172:
and CD4 positive lyumphocyte number
Page 173 and 174:
Figure 4.4.13: Bone marrow cells fr
Page 175 and 176:
Figure 4.4.15: Generation of stable
Page 177 and 178:
Figure 4.4.16: NIH3T3 cells lacking
Page 179 and 180:
Figure 4.4.18: Generation of induci
Page 181 and 182:
CHAPTER 5 DISCUSSION 181
Page 183 and 184:
to generate transgenic animals expr
Page 185 and 186:
transgenic research and the use of
Page 187 and 188:
(reviewed in (152, 374)). Kinesins
Page 189 and 190:
subtypes known to date. Type IV col
Page 191 and 192:
Figure 5.1 Schematic representation
Page 193 and 194:
loss of 14-3-3ε the T cell activat
Page 195 and 196:
BIBLIOGRAPHY: 1. Abraham, R. T. 200
Page 197 and 198:
29. Blomer, U., L. Naldini, T. Kafr
Page 199 and 200:
58. Cheng, C. Y., and D. D. Mruk. 2
Page 201 and 202:
90. Elia, A. E., P. Rellos, L. F. H
Page 203 and 204:
118. Girard, F., U. Strausfeld, J.
Page 205 and 206:
150. Herrmann, H., M. Haner, M. Bre
Page 207 and 208:
and activation of a cyclin E-cdk2 c
Page 209 and 210:
213. Liu, D., J. Bienkowska, C. Pet
Page 211 and 212:
242. Moll, R., W. W. Franke, D. L.
Page 213 and 214:
274. Pagano, M., R. Pepperkok, F. V
Page 215 and 216:
305. Russell, L. D. 1978. The blood
Page 217 and 218:
inhibitor of metalloproteases-1 in
Page 219 and 220:
364. Tsunekawa, N., M. Matsumoto, S
Page 221 and 222:
397. Yashiro, M., N. Nishioka, and
Page 223:
Research: Biology to Prevention to
show all

LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

Create successful ePaper yourself

Delete template?

Save as template?