LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

More documents

Recommendations

Info

was observed in the CFP channel upon K18-YFP transduction. Note that cells expressing only one partner of the pair do not show the presence of filaments and show the presence of discrete cytoplasmic aggregates while cells expressing both constructs show the presence of filament network and that the two proteins co-localize as seen in the merged image. (B) HH17 cells were transduced with pLV-CMV- K18-YFP -IRES-Puro (Red pseudo color) and pLV-Ubc-K8-CFP-IRES-Puro (green pseudo color). The transduced cells were visualized using confocal microscopy. (Original magnification 630X with 2X optical zoom). Scale bars are shown in each panel. One of the techniques used to study protein-protein interactions in vivo is Forster resonance energy transfer (FRET) (324). FRET is based upon the transfer of energy from an excited donor fluorophor to a proximate acceptor fluorophor, resulting in enhanced fluorescence emission of the acceptor. This phenomenon only occurs when the distance between donor and acceptor is less than 10 nm and the emission spectra of the donor overlaps with the excitation of the acceptor. As K8 and K18 bind to one another to form keratin filaments (398), the K18-YFP and K8-CFP constructs were used to determine whether these vectors can be used to perform FRET assays. HHL-17 and HEK-293 cells were transduced with both K18-YFP and K8-CFP, and the FRET efficiency between these two proteins was measured in live cells as described in materials and methods. It was observed that K18-YFP and K8-CFP interact with each other with a FRET efficiency of 44.6% in HHL-17 cells (Figures 4.1.7 a, b and c) and 41% in HEK-293 cells (figure 4.1.7 d).The percentage FRET efficiency obtained for K18-YFP and K8-CFP is highly significant (Figure 4.1.7 d) as determined by measuring the FRET efficiency of three different regions for acceptor photobleaching and no bleaching (control) followed by statistical analysis using students t-test. These results suggest that the bi-cistronic lentiviral vector can be effectively used to study protein-protein interactions in live cells using FRET. 104
Figure 4.1.7: Application of bi-cistronic lentiviral vectors in live cell imaging. (A) Acceptor photobleaching FRET was performed in HHL-17 cells co-transduced with both pLV-CMV- K18-YFP -IRES-Puro (Red pseudo color) and pLV-Ubc-K8-CFP-IRES-Puro (green pseudo color). Pre-bleach and post-bleach images were acquired using an LSM510 confocal microscope. The gain in the fluorescence intensity of the donor (K8- CFP) upon acceptor photobleaching is shown in the inset. (B) Graph representing the gain in mean fluorescence intensity upon acceptor photobleaching as a function of time is depicted. The mean fluorescence intensity is on the Y-axis and time in seconds on the X- axis. (C) Graph representing the percentage FRET efficiency for K18-YFP and K8-CFP using acceptor photobleaching in HHL-17 cell. The bars represent the mean and the error bars the standard deviation. The p value was obtained using a student’s t-test. (Original magnification 630X with 2X optical zoom). Scale bars are shown in each panel. 105
Page 1 and 2:
Generation of knockdown mice that l
Page 3 and 4:
STATEMENT BY AUTHOR This dissertati
Page 5 and 6:
CERTIFICATE I certify that the thes
Page 7 and 8:
I am thankful to Mr Uday Dandekar f
Page 9 and 10:
3.16 Isolation of Genomic DNA (gDNA
Page 11 and 12:
A synopsis of thesis to be submitte
Page 13 and 14:
esults in loss of 14-3-3 binding an
Page 15 and 16:
and NheI (NEB) to remove tetO-CMV,
Page 17 and 18:
Hanging drop and wound healing assa
Page 19 and 20:
360). To generate transgenic animal
Page 21 and 22:
asement of the seminiferous tubules
Page 23 and 24:
normal female, pups were screened f
Page 25 and 26:
14-3-3ε only in the presence of HP
Page 27 and 28:
proteins are expressed in testis (3
Page 29 and 30:
5. Lalit Sehgal, Srikanth B., Khyat
Page 31 and 32:
Presented a poster at 33rd All Indi
Page 33 and 34:
shRNA siRNA TBS-T U.V WT C IF DSG D
Page 35 and 36:
List of Figures: Page No 1. Figure
Page 37 and 38:
37. Figure 4.3.20: 14-3-3γ interac
Page 39 and 40:
CHAPTER 1 INTRODUCTION 39
Page 41 and 42:
1.1.1 Cyclin Cdk complexes Eukaryot
Page 43 and 44:
1.1.1.c Cyclin A cdk complexes The
Page 45 and 46:
of which are associated with acquis
Page 47 and 48:
1.2.2 The G1/S DNA Damage checkpoin
Page 49 and 50:
complexes. DNA damage induced degra
Page 51 and 52:
cytoplasmic accumulation of cdc25 p
Page 53 and 54: 14-3-3 binding site. 14-3-3 binding
Page 55 and 56: G2 arrest and induced premature chr
Page 57 and 58: emoval of S216 phosphorylation as i
Page 59 and 60: embryogenesis, a loss of cdc25A can
Page 61 and 62: dimer was essential for Raf activat
Page 63 and 64: of enhanced apoptosis of peripheral
Page 65 and 66: the generation of transgenic mice a
Page 67 and 68: CHAPTER 2 AIMS AND OBJECTIVES 67
Page 69 and 70: CHAPTER 3 MATERIALS AND METHODS 69
Page 71 and 72: Name of oligonucleotide EF1α Forwa
Page 73 and 74: cleavage sites GAAGGTATATTGCTGTTGAC
Page 75 and 76: R E1 A GAACGAATAGTGAAGCCACAGATGTA s
Page 77 and 78: 100mm 25ug 225ul 250ul 500 1000ul T
Page 79 and 80: for the transgene were considered a
Page 81 and 82: solution in TBS-T containing 0.02%
Page 83 and 84: mounting agent. Confocal images wer
Page 85 and 86: 3.26 Antibodies used for Western bl
Page 87 and 88: each plate was added cold 500ml of
Page 89 and 90: 3.32 Hanging drop assay to determin
Page 91 and 92: 3.37 Biodistribution of 18 F -FDG u
Page 93 and 94: 2.5M NaCl 150mM 60ml Tween-20 (Sigm
Page 95 and 96: CHAPTER 4 RESULTS 95
Page 97 and 98: Figure 4.1.1 Generation of lentivir
Page 99 and 100: 4.1.2 Generation of lentiviral vect
Page 101 and 102: transduction with the virus. Untran
Page 103: Figure 4.1.6: Application of bi-cis
Page 107 and 108: Figure 4.2.1: Infection of morulae
Page 109 and 110: Figure 4.2.2: Generation of transge
Page 111 and 112: Figure 4.2.3: EGFP-f expression in
Page 113 and 114: sequenced and the distribution amon
Page 115 and 116: 4.3 Generation of 14-3-3γ knockdow
Page 117 and 118: numbering). Alignment was done usin
Page 119 and 120: presence of EGFP-f by performing po
Page 121 and 122: the mouse tested infected with vect
Page 123 and 124: Figure 4.3.7: Staging of 14-3-3γ k
Page 125 and 126: containing spermatozoa is on the Y-
Page 127 and 128: Figure 4.3.9: 14-3-3γ knockdown le
Page 129 and 130: Figure 4.3.11: 14-3-3γ knockdown i
Page 131 and 132: intercellular space (12, 110, 115,
Page 133 and 134: Figure 4.3.13: 14-3-3γ loss leads
Page 135 and 136: Figure 4.3.16: Localization of PKP3
Page 137 and 138: Figure 4.3.18: Reintroduction of sh
Page 139 and 140: A B 139
Page 141 and 142: from our laboratory demonstrated th
Page 143 and 144: Figure 4.3.21: Plakoglobin recruitm
Page 145 and 146: 4.3.23 (A and B)). These proteins g
Page 147 and 148: the desmosomal proteins recruitment
Page 149 and 150: Figure 4.3.25: Generation of stable
Page 151 and 152: KIF5B, however its reduction does n
Page 153 and 154: compared to vector control cells. (
Page 155 and 156:
4.4 Generation of 14-3-3ε knockdow
Page 157 and 158:
into the interstitial spaces of the
Page 159 and 160:
Figure 4.4.3: 14-3-3ε knockdown in
Page 161 and 162:
Figure 4.4.4: Patchy hair loss in 1
Page 163 and 164:
follicle formation marked by black
Page 165 and 166:
Figure 4.4.7: Phenotypes in 14-3-3
Page 167 and 168:
compared to WT lungs (indicated by
Page 169 and 170:
compared to wild type (Figure 4.4.1
Page 171 and 172:
and CD4 positive lyumphocyte number
Page 173 and 174:
Figure 4.4.13: Bone marrow cells fr
Page 175 and 176:
Figure 4.4.15: Generation of stable
Page 177 and 178:
Figure 4.4.16: NIH3T3 cells lacking
Page 179 and 180:
Figure 4.4.18: Generation of induci
Page 181 and 182:
CHAPTER 5 DISCUSSION 181
Page 183 and 184:
to generate transgenic animals expr
Page 185 and 186:
transgenic research and the use of
Page 187 and 188:
(reviewed in (152, 374)). Kinesins
Page 189 and 190:
subtypes known to date. Type IV col
Page 191 and 192:
Figure 5.1 Schematic representation
Page 193 and 194:
loss of 14-3-3ε the T cell activat
Page 195 and 196:
BIBLIOGRAPHY: 1. Abraham, R. T. 200
Page 197 and 198:
29. Blomer, U., L. Naldini, T. Kafr
Page 199 and 200:
58. Cheng, C. Y., and D. D. Mruk. 2
Page 201 and 202:
90. Elia, A. E., P. Rellos, L. F. H
Page 203 and 204:
118. Girard, F., U. Strausfeld, J.
Page 205 and 206:
150. Herrmann, H., M. Haner, M. Bre
Page 207 and 208:
and activation of a cyclin E-cdk2 c
Page 209 and 210:
213. Liu, D., J. Bienkowska, C. Pet
Page 211 and 212:
242. Moll, R., W. W. Franke, D. L.
Page 213 and 214:
274. Pagano, M., R. Pepperkok, F. V
Page 215 and 216:
305. Russell, L. D. 1978. The blood
Page 217 and 218:
inhibitor of metalloproteases-1 in
Page 219 and 220:
364. Tsunekawa, N., M. Matsumoto, S
Page 221 and 222:
397. Yashiro, M., N. Nishioka, and
Page 223:
Research: Biology to Prevention to
show all

LIFE09200604002 Lalit Sehgal - Homi Bhabha National Institute

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?