LIFE01200604005 Shri Somnath Ghosh - Homi Bhabha National ...

RADIATION INDUCED SIGNALING IN MAMMALIAN CELLS
By
SOMNATH GHOSH
Bhabha Atomic Research Centre, Mumbai
A thesis submitted to the Board of Studies in Life Sciences
In partial fulfillment of requirements
For the Degree of
DOCTOR OF PHILOSOPHY
of
HOMI BHABHA NATIONAL INSTITUTE
April, 2012

STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of requirements for an advanced
degree at Homi Bhabha National Institute (HBNI) and is deposited in the Library to be made
available to borrowers under rules of the HBNI.
Brief quotations from this dissertation are allowable without special permission, provided that
accurate acknowledgement of source is made. Requests for permission for extended quotation
from or reproduction of this manuscript in whole or in part may be granted by the Competent
Authority of HBNI when in his or her judgment the proposed use of the material is in the
interests of scholarship. In all other instances, however, permission must be obtained from the
author.
Somnath Ghosh

DECLARATION
I, hereby declare that the investigation presented in the thesis has been carried out by me. The
work is original and has not been submitted earlier as a whole or in part for a degree / diploma at
this or any other Institution / University.
Somnath Ghosh

ACKNOWLEDGEMENTS
I wish to express my heartfelt gratitude to my mentor and guide Dr (Mrs.) Malini Krishna for introducing
me into the wonderful world of signal transduction. From my first steps in the vast maize of pathways to
the more assured strides, she was always there, showing the way with her able guidance, keen
supervision, constant encouragement and support. Her parental affection, infectious optimism, bright
spirits, never say die attitude and belief in me were invaluable at every stumble or wrong turn. She
provided a pleasant and optimum working environment in the lab, where a lack of resources was
something unimaginable due to her managerial skills and foresight. Words can never ever be enough to
thank her and I will remain indebted forever.
I wish to express my deep gratitude to Dr. K.B. Sainis, Director, Biomedical Group, and
Chairman of my doctoral committee for supporting and mentoring me from the day I joined training
school and for always being approachable. I would like to take this opportunity to thank Dr. S.K. Apte,
Associate Director (B), Biomedical Group and member of my doctoral committee for his kind support,
encouragement, critical analysis of the results and valuable suggestion during my presentation. Words of
thanks are due to Dr. M. Seshadri, Head, RB&HSD and member of my doctoral committee for his kind
support, encouragement and for providing the facilities and pleasant working environment in the division.
Many thanks are due to Dr. (Smt.) S. Zingde, Dy. Director, ACTREC, Kharghar and member of my
doctoral committee for her valuable suggestion during my presentation.
I wish to acknowledge all my seniors and colleagues in my division and group for all the help,
support and encouragement that they have provided. I take this opportunity to thank Dr Rakesh Kumar
Singh and Dr. Anirban Kumar Mitra.
Special thanks are due to my lab mates and friends, Dr. (Smt.) Himanshi N Mishra and Fatema
for their cooperation, help and pleasure of their company.
I would like to acknowledge and thank Mr Paresh for his excellent technical assistance and
Manjoor Ali for confocal microscopy. I will be failing in my duty if I do not mention the administrative
staff of this department for their timely help.
On the personal front, words are not enough to thank Baba and Maa for making me what I am.
Special thanks are due to Raju Da, Ravi Da, Botan and Buni for their cooperation
Above all I would reserve my heartiest thanks for my better half ‘Ants’, for being my pillar of
strength through thick and thin and loving me for who I am. I am at a loss of words to thank Siddhant, my
bundle of joy who has brought so much sunshine in our lives. My thesis could never have seen the light of
the day without them.
Somnath Ghosh

CONTENTS
Page No.
SYNOPSIS…………………………………………………………………………. 1-28
LIST OF FIGURES
Fig. 1.1 Pie-chart showing the percentage of radiation exposure…….. 31
Fig. 1.3A Regulation of Cell Cycle by p53 and p21…………………. 50
Fig. 1.3B Pathways of DSB repair……………………………………. 53
Fig. 1.4 Effects of ionizing radiation on cellular response systems….. 62
Fig.1.5. Biological consequences of clustered DNA damage………... 71
Fig. 1.6 Radiation induced bystander effect…………………………. 76
Fig. 3.1.1 Relative radioresistance of three cell line…………………. 96
Fig. 3.1.2 Relative expression of genes in A549 cells……………….. 98
Fig. 3.1.3 Validation of microarray data by RT-PCR………………… 126
Fig.3.1.4 Gene expression of ATM, DNA-PK, Rad52 and MLH1…… 129
Fig. 3.1.5 Repair kinetics as determined by γ-H2AX foci……………… 130
Fig. 3.1.6A Radiation induced foci of DNA damage response proteins... 131
Fig. 3.1.7 Translocation of phospho-p53……………………………….. 133
Fig. 3.1.8 Response of A549 and MCF-7………………………………. 134
Fig.3.1.9 Stabilization of DNA-PK mRNA in A549…………………… 136
Fig.3.1.10 Effect of Rad52 and MLH1…………………………………. 137
Fig.3.2.1 Clonogenic Cell Survival of A549……………………………. 140
Fig.3.2.2 Gene expression of ATM, DNA-PK, ATR, Chk1 and Chk2…. 141
Fig.3.2.3 Immunofluorescence staining and Image analysis…………….. 142
Fig.3.2.4 Gene expression of Bax and Bcl-2…………………………….. 143
Fig.3.3.1.1 Clonogenic Cell Survival of A549 cells……………………... 145
Fig.3.3.1.2 Formation of γ-H2AX foci…………………………………... 147
Fig.3.3.1.3 Phosphorylation of ATM……………………………………. 149
Fig.3.3.1.4 Phosphorylation of ATR…………………………………….. 150
Fig.3.3.1.5 Phosphorylation of BRCA1…………………………………. 151
Fig.3.3.1.6 Phosphorylation of Chk1 and Chk2…………………………. 153
Fig.3.3.1.7a Phosphorylation of ERK…………………………………… 154
Fig.3.3.1.7b Phosphorylation of JNK…………………………………… 155
Fig.3.3.1.8 Apoptosis in carbon irradiated A549 cells…………………... 156
Fig. 3.3.2.1 Clonogenic Cell Survival of A549 cells……………………. 158
Fig. 3.3.2.2 Phosphorylation of H2AX…………………………………. 160
Fig.3.3.2.3 Phosphorylation of ATM…………………………………… 163
Fig.3.3.2.4 Phosphorylation of ATR……………………………………. 164
Fig.3.3.2.5 Phosphorylation of TP53……………………………………. 165
Fig.3.3.2.6 Phosphorylation of Chk2……………………………………. 166
Fig.3.3.2.7 Apoptosis in oxygen irradiated A549 cells………………….. 167
Fig.3.4.1Bystander effect in similar cells (A549 Vs A549)……………... 170
Fig.3.4.2 Bystander effect in dissimilar cells (A549 Vs U937)…………. 171

Fig.3.4.3.1 Gene expression of iNOS, p21, p53 and NF-kB (p65)……… 174
Fig.3.4.3.2 NO production from EL-4 cells……………………………... 175
Fig.3.4.3.3 DNA damage in EL-4 cells………………………………….. 176
Fig. 3.4.3.4a DNA fragmentation assay of EL-4 cells…………………... 177
Fig. 3.4.3.4b Apoptosis assay of EL-4 cells……………………………... 178
Fig.3.4.4a Gene expression of NF-kB (p65) and iNOS gene…………… 180
Fig.3.4.4b DNA damage in EL-4 cells…………………………………... 181
Fig.3.4.5a Gene expression of NF-kB (p65) and iNOS gene…………… 183
Fig.3.4.5b DNA damage in EL-4 cells…………………………………... 184
LIST OF TABLES
Table 2.6 The sequences of gene specific primers………………………. 87
Table 3.1.2A List of Up-regulated Genes: Control Vs 5X2Gy…………. 99
Table 3.1.2B List of Down-regulated Genes: Control Vs 5X2Gy……..... 107
Table 3.1.2C List of Up-regulated genes: 2Gy Vs 5X2Gy……………… 111
Table 3.1.2D List of Down-regulated genes: 2Gy Vs 5X2Gy…………... 116
Table 3.1.2E List of Up-regulated genes: 10Gy Vs 5X2Gy…………….. 117
Table 3.1.2F List of Down-regulated genes of 10Gy Vs 5X2Gy……….. 123
CHAPTER 1- INTRODUCTION
1.1. Ionizing Radiation………………………………………………….. 32
1.2. Radiation Therapy…………………………………………………. 34
1.3. DNA damage signaling following irradiation…………………….. 37
1.3.1 Alarm Sensors…………………………………………… 37
1.3.2 Cell Cycle Regulation…………………………………… 49
1.3.3 DNA Repair……………………………………………… 52
1.4. Overview of Radiation induced cell signaling…………………….. 61
1.5. Charged particle irradiation induced Signaling………………….. 70
1.6. Radiation induced Bystander Signaling…………………………… 75
1.7. Aims and Objectives………………………………………………… 78
CHAPTER 2 - MATERIALS & METHODS
2.1 Chemicals............................................................................................. 80
2.2 Cell Lines…………………………………………………………….. 81
2.3 Irradiation............................................................................................ 81
2.4 Clonogenic Cell Survival Assay……………………………………. 84
2.5 Microarray…………………………………………………………... 84
2.6 Semiquantitative RT-PCR…………………………………………. 86
2.7 Immunofluorescence staining………………………………………. 86
2.8 Image analysis using ImageJ software…………………………….. 88
2.9 Western Blotting…………………………………………………….. 89
2.10 Measurement of DNA damage……………………………………. 90

2.11 Measurement of NO production………………………………….. 91
2.12 Measurement of Apoptosis by DNA fragmentation……………... 91
2.13 Transfection with ShRNA………………………………………… 92
2.14 Statistical Analysis…………………………………………………. 92
CHAPTER 3 - RESULTS
3.1 Fractionated irradiation induced signaling..................................... 94
3.2 Proton beam induced signaling…………………………………….. 138
3.3 High LET irradiation induced signaling…………………………… 144
3.2.1 Carbon beam induced signaling………………………… 144
3.2.2 Oxygen beam induced signaling………………………… 157
3.4 Radiation induced bystander signalling............................................. 168
CHAPTER 4 - DISCUSSION
4.1 Fractionated irradiation induced signaling....................................... 187
4.2 Proton beam induced signaling…………………………………….. 193
4.3 High LET irradiation induced signaling…………………………. 196
4.3.1 Carbon beam induced signaling…………………………. 196
4.3.2 Oxygen beam induced signaling…………………………. 200
4.4 Radiation induced bystander signaling............................................. 203
4.5 Summary and Conclusion.................................................................. 208
CHAPTER 5 – REFERENCES……………………………………………….. 212
Publications and Presentations………………………………………………… 253

SYNOPSIS
SYNOPSIS

PREAMBLE
SYNOPSIS
Ionising radiation leads to a cascade of signaling events which include activation
of alarm signals, cytotoxic and cytoprotective signaling pathways, nitric oxide production
etc. These events culminate in the death or survival of the irradiated cell. The end result
seems to depend upon the pathway predominantly activated. Minute observation of these
complex signaling networks reveals that this is not a random activation of all the
pathways but a very specific, organized and regulated process that is controlled at
multiple steps.
The cellular responses to various forms of radiation are manifested as irreversible
and reversible structural and functional changes in cells and cell organelles. A widely
held view is that the initial reaction of a cell to DNA damage is to repair the damage.
However, with increasing levels of DNA damage the cell switches to cell cycle arrest or
to apoptosis. Cell cycle arrest is sometimes permanent, but ordinarily reversible allowing
time for further DNA repair.
The fact that radiation can lead to cell death has long been exploited effectively in
the therapy of cancer. However, the survival of the radioresistant cell has been the major
drawback of radiotherapy which is delivered in fractionated doses and the cells surviving
the initial dose tend to develop radioresistance making them refractory to subsequent
doses of radiation. Fractionated irradiation induced signaling has not been studied in
detail.
The work embodied in this thesis has been divided into five chapters.
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. References
CHAPTER 1: INTRODUCTION
The first chapter is a general introduction to radiation induced signaling with a historical
perspective on radiation biology. It scans the development of radiation biology and also
reviews the current literature relevant to the work embodied in this thesis. It also lists the
aims and objectives of the present work. A brief overview of the chapter is outlined
below.
Viewed historically, all radiation science is recent, proving that science does
indeed make giant strides in a brief period. Roentgen in the year 1895 initiated the
process by announcing the discovery of a “new kind of penetrating ray” or x-rays [1].
This was followed soon after by Becquerel’s discovery of natural radioactivity in 1896
[2]. Unfortunately the biological effects of ionising radiation and radioactivity lay
unexplored for quite some time after Roentgen’s initial report [3].
When a radiation beam passes through a biological material or other absorbing
media, some energy is imparted to the medium while some of it leaves the volume of
interaction. The absorption of energy from radiation may lead to either excitation or
ionisation. Radiations which lead to the latter effect are called ionising radiation and can
be further classified into electromagnetic and particulate. Ionising radiation can directly
interact with and damage the target molecule. This is known as the direct effect. If it
interacts with the medium to produce secondary particles which, in turn, damages the
target molecule, then it is known as indirect effect.
1

SYNOPSIS
The average energy locally imparted to the medium per unit length of the path
traversed is the Linear Energy Transfer (LET) of the ionising radiation. On this basis
ionising radiation can be classified into high and low LET radiation. High LET radiations
are predominantly causes direct effect whereas low LET radiations are predominantly
causes indirect effect [3, 4]. Direct effects occur when an ionizing particle interacts with a
macromolecule in a cell (DNA, RNA, protein etc.) where as indirect effects involve the
interaction of ionizing radiation with the medium in which the molecules are suspended,
especially water, to produce free radicals and reactive oxygen species (ROS), in presence
of oxygen, that damage critical targets.
Ionising radiation exposure causes a spectrum of lesions within the cell. These
include, at the DNA level, single strand breaks (ssb), double strand breaks (dsb), base
damage, DNA-protein crosslinks etc. Apart from DNA damage, other lesions in cellular
macromolecules (lipids, proteins etc) are also generated. DNA as a target assumes added
importance due to the very limited redundancy of information in the molecule. Any
irreversible damage may lead to loss of genetic information vital for cellular function and
survival. However, the non DNA lesions, probably not as life threatening to the cell, can
stimulate various signaling pathways which determine the final fate of the cell [5].To
complicate matters a number of non-targeted and delayed effects associated with
radiation exposure, referred to as “bystander effect”, may also contribute to mutagenic
events and genome instability in adjacent unexposed cells [6].
The very obvious application of this was the use of ionising radiation as a potent
tool in cancer therapy. This took advantage of inherent radiosensitivity of tumors over
surrounding normal tissue. Moreover, introduction of fractionated radiotherapy by
Coutard was a major step in enhancing the efficacy of radiotherapy [7]. Radiation therapy
has enjoyed tremendous success in the field of cancer, so much so that it is used in the
treatment of two thirds of all cancer patients in India today. However, one of the major
hurdles in the success rate is radioresistance of tumors which may be innate or acquired.
Therefore, study of fractionated irradiation induced signaling in mammalian cells will be
of great importance.
Exposure of cells to ionising radiation leads to the activation of existing cellular
response pathways [8]. These pathways are predominantly either cytoprotective or
cytotoxic. The activation of the former leads to repair, survival and proliferation whereas,
the activation of the latter leads to cell death. Radiation effects are mediated through the
activation of damage sensors which transduce the signal through the signaling cascades.
These in turn direct the response elucidated, depending upon the signaling pathway that is
predominantly activated. Various studies have shown the activation of cytoprotective
factors contribute to radioresistance in the tumors.
Another, albeit less studied, field is high LET radiation induced signal
transduction. This assumes greater importance because of the increased application of
charged particle beam in radiotherapy and the emergence of the phenomenon of radiation
induced bystander effect. The latter is especially relevant in case of low dose exposure to
high LET radiation (e.g. From Radon) where the damage seen in much more than would
be expected by extrapolating from higher doses. It would be of interest to study the effect
of high LET radiation on the signaling pathways since the damage produced by high LET
radiation (clustered damage) is very different from that by low LET (scattered damage)
[9].
2

SYNOPSIS
Aims and Objectives: To Study
1. Fractionated irradiation induced signaling events. The contribution of
these events to the increased cell survival.
2. High LET induced signaling and variance from low LET gamma
radiation.
3. Contribution of radiation induced bystander effect to cell survival and its
mechanism.
CHAPTER 2: MATERIALS AND METHODS
The second chapter lists the reagents and describes in detail the methods
employed in this study. A brief summary of the same is given below.
2.1 Chemicals and Reagents
All fine chemicals used were from Sigma, USA. Primary antibodies were from
Cell Signaling Technology, USA; Calbiochem, USA; Chemicon, USA; Santa Cruz
Biotechnology, USA; Sigma, USA and Transduction Laboratories, USA.
2.2 Cell Lines
All the cell lines used in this study were cultured in 25 cm 2 / 75 cm 2 plastic flasks
in the appropriate medium supplemented with 10% fetal bovine serum (Sigma, USA.).
Cells were kept at 37 0 C in humidified atmosphere with 5% CO 2 .
Following are the list/table of the cell lines used in the experiments
SN Cell line Description p53 status
1 A549 Human Lung Adenocarcinoma Wild type
2 MCF-7 Human breast adenocarcinoma Wild type
3 INT 407 human intestinal epithelial cell line Wild type
4 U937 Human histiocytic lymphoma (Monocyte) Negative
5 EL-4 Mouse lymphoma Wild type
6 RAW 264.7 Mouse macrophages Wild type
3

SYNOPSIS
2.3 Irradiation
2.3.1] Low LET: For gamma irradiation, cells were exposed to required dose of
60 Co γ radiation in in-house facility Gamma Cell 220 at dose rate of 3.5 Gy/min.
Proton beam irradiation was carried out using the Radiation Biology beam line of
in-house 4 MeV Folded Tandem Ion Accelerator (FOTIA) facility.
2.3.2] High LET: Heavy ion irradiation was carried out using the Radiation
Biology beam line of 16 MV 15UD Pelletron at Inter University Accelerator Centre, New
Delhi.
2.4 Clonogenic Cell Survival Assay
After treatment, cells were seeded out in appropriate dilutions (500 cells/60 mm
petriplate) to form colonies in 14 days. Colonies were fixed with glutaraldehyde (6.0%
v/v), stained with crystal violet (0.5% w/v) and counted using a stereomicroscope.
Colonies containing more than 50 cells were scored as survivors.
2.5 Semiquantitative Reverse transcriptional polymerase chain reaction (RT-PCR)
Total RNA from 1 x 10 6 cells was extracted after required time periods of irradiation and
RT-PCR was carried out. Briefly, total RNA from A549 cells was extracted after required
time periods of 1, 2, 3 and 4 hours of irradiation and eluted in 30 µl RNAase free water
using RNA tissue kit (Roche). Equal amount of RNA in each group was reverse
transcribed using cMaster RT kit (Eppendorf). Equal amount (2µl) of cDNA in each
group was used for specific amplification of required genes using gene specific primers.
The PCR condition were 94 o C, 5 min initial denaturation followed by 30 cycles of 94 o C
45 s, 55 – 64 o C 45 s (depending on the annealing temperature of specific primers) 72 o C
45 s and final extension at 72 o C for 10 min. Equal amount of each PCR product (10 µl)
was run on 1.5 % agarose gel containing ethidium bromide in tris borate EDTA buffer at
60 V. The bands in the gel were visualized under UV lamp and relative intensities were
quantified using Gel doc software (Syngene).
4

SYNOPSIS
2.6 Immunofluorescence staining
Cells were grown in cover slips which were kept in 35mm petri dishes and irradiated as
mentioned above. Cell layer were washed 4 h after irradiation in PBS and fixed for 20
min in 4% paraformaldehyde at room temperature. Afterwards, the cells were washed
twice in PBS. For immunofluorescence staining, cells were permeabilized for 3 min in
0.25% Triton X-100 in PBS, washed two times in PBS and blocked for 1 h with 5% BSA
in PBS. Antibodies were diluted (1:200) in 1% BSA in PBS. Cells were incubated with
primary antibodies for 1 h 30 min at room temperature, washed three times in PBS and
incubated with secondary antibodies for 1 h at room temperature. Finally, cells were
rinsed and mounted with ProLong Gold antifede with DAPI mounting media (Molecular
Probe, USA). Images were captured using Carl Zeiss confocal microscope. Acquisition
settings were optimized to obtain maximal signal in immunostained cells with minimal
background.
2.7 Image analysis using ImageJ software
The captured images were analyzed for relative quantification of phosphorylation using
ImageJ software [10]. A 25 x 25 pixel box was positioned over the fluorescent image of
each cell, and the average intensity within the selection (the sum of the intensities of all
the pixels in the selection divided by the number of pixels) was measured. At least 100
cells per experiment were analyzed from three independent experiments.
2.8 Western Blotting
For the samples that had to be probed with specific antibodies, the proteins were
separated by SDS-PAGE (10%) followed by transfer to nitrocellulose membrane
(Hybond ECL, Amersham Pharmacia Biotech), and probed with specific antibodies. The
membranes were then probed with horseradish peroxidase conjugated secondary antibody
against mouse/rabbit (Roche Molecular Biochemicals, Germany) and developed using
BM Chemiluminiscence Western Blotting Kit Mouse/Rabbit (Roche Molecular
Biochemicals, Germany). Densitometry was done using Shimadzu CS 9000 Dual
wavelength flying spot scanner. Statistical analysis was done using ANOVA.
2.9 Measurement of DNA damage
DNA damage in all the groups of EL-4 cells 2 h after exposure to different conditioned
medium, was measured by alkaline single cell gel electrophoresis (comet assay) [11]. In
brief, frosted microscope slides (Gold Coin, Mumbai, India) were covered with 200 µl of
1% normal melting agarose (NMA) in phosphate buffered saline (PBS) at 45 o C, covered
with a cover slip and kept at 4 o C for 10 min. After solidification a second layer of 200 µl
of 0.5% low melting agarose (LMA) containing approximately 105 cells at 37 o C was
layered over it. The cover slips were replaced immediately and the slides were kept at 4
o C. After solidification of the LMA, the cover-slips were removed and slides were placed
in the chilled lysing solution (2.5M NaCl, 100mM Na 2 -EDTA, 10mM Tris–HCl, pH 10,
and 1% DMSO, 1% Triton X100 and 1% sodium sarcosinate) for 1 h at 4 o C. The slides
were removed from the lysing solution and placed on a horizontal electrophoresis tank
filled with freshly prepared alkaline buffer (300mM NaOH, 1mM Na 2 -EDTA and 0.2%
DMSO, pH≥13.0) and were equilibrated in the above buffer for 20 min and
electrophoresis was carried out at 25V for 20 min. After electrophoresis the slides were
washed gently with 0.4M Tris–HCl buffer, pH 7.4, to remove the alkali, stained with 50
µl of propidium iodide (PI, 20 µg/ml) and visualized using a Carl Zeiss Fluorescent
5

SYNOPSIS
microscope (Axioskop). The images (40–50 cells/slide) were captured with highperformance
GANZ (model: ZCY11PH 4) color video camera. The integral frame
grabber used in this system (Cvfbo1p) is a PC based card and it accepts color composite
video output of the camera. The quantification of the DNA strand breaks of the stored
images was done using the CASP software by which %DNA in tail, tail length, tail
moment and Olive tail moment could be obtained directly [12].
2.10 Measurement of NO production in EL-4 cells
Control unirradiated cells, cells exposed to radiation and the cells exposed to different
conditioned media as mentioned above were cultured for 24 h at 37 0 C in 5%CO 2 / 95%
air. The production of NO in the culture supernatants was measured by assaying NO 2
-
using colorimetric Griess reaction [13].
In brief, 100 µl of culture supernatants was incubated with an equal volume of Griess
reagent [1% sulfanilamide and 0.1% N-(1-naphthyl-ethylenediamine) in 2.5% phosphoric
acid; Sigma, USA] at room temperature for 10 min in a 96 well plate. The absorbance at
550 nm was measured using a microplate reader (Fluostar Optima, Biotron Healthcare).
Absorbance measurements were converted to µ moles of NO 2
-
using a standard curve of
NaNO 2.
2.11 Measurement of Apoptosis by DNA fragmentation
Apoptosis in control unirradiated cells, cells exposed to radiation and the cells exposed to
different conditioned media as mentioned above was measured by DNA fragmentation
assay [14]. After transfer of medium from irradiated cells, all the above mentioned
groups of EL-4 cells were cultured for 24 h at 37 0 C in 5%CO 2 , 95% air. The cells were
harvested and lysed in lysis buffer (10 mM EDTA, 50 mM Tris–HCl, pH 8.0, 0.5%
sodium lauryl sarcosine) containing the 100 mg/ml proteinase K at 55 o C for 2 h. The
DNA was extracted with phenol/chloroform and precipitated with ethanol. The RNA was
removed by RNAse A treatment and DNA was electrophorased on agarose gel to
visualize the fragmented DNA.
CHAPTER 3: RESULTS
In this study the relative radioresistance of various cell lines (MCF-7, INT 407
and A 549) was first established. Then the differences in the signaling pattern were
established. The variance in signaling with the change in LET was investigated. Finally,
the contribution of the bystanding cell, which had not been exposed to irradiation, to the
cell survival was also looked at. The results obtained in the study are divided into the
following subsections.
3.1 Fractionated irradiation induced signaling and repair in mammalian cells.
Three human cell lines viz. MCF-7, INT 407 and A 549 were exposed to different
doses of γ irradiation; the first set was irradiated with acute dose of 2 Gy or 10 Gy. The
second set was exposed to 5 fraction of 2 Gy each. Among the three cell line the lung
carcinoma cell line A 549 was found to be relatively more radioresistant if the 10 Gy
dose was delivered as a fractionated regimen. The MCF-7 cell line was found to be
relatively more radiosensitive (Fig. 3.1A). This was further confirmed by analysis of
6

SYNOPSIS
ATM gene expression, which was found to significantly upregulated in A 549 cell line as
compared to the MCF-7 (Fig. 3.1B). DNA-PK gene was also significantly upregulated in
A 549 cell line which had been exposed to 5 fraction of 2 Gy γ-radiation (Fig. 3.1C). As a
consequence of this the Phospho-p53 was found to be translocated to the nucleus of A
549 cell line which had been exposed to fractionated regimen. The expression of
Phospho- p53 was confirmed by western blotting (Fig. 3.1D).
The fractionated dose regimen led to a significant upregulation of ATM and DNA-PK in
A549 cells line. The differences in the two cell lines (A549 and MCF-7) could be
summarized as significant differences in the repair capability of the two. Significant
activation of BRCA1, phospho ATM and Rad52 seems to be causative factors in A549
cells. None of this activation was apparent in MCF-7 (Fig. 3.1E).
The activation of DNA-PK was accompanied by the stabilization of its mRNA and was
regulated by the p38 MAP Kinase pathway but not by ERK or JNK MAP Kinase
pathway (Fig. 3.1F). The ATM and Rad 52 mRNA were not stabilized indicating a
specific and selective stabilization of DNA-PK mRNA. Finally the inhibition of Rad52
with its ShRNA reversed the radioresistance of the A549 cells and made it sensitive to
fractionated irradiation (Fig. 3.1G).
3.2 Proton beam induced signaling in mammalian cells and its comparison with
Gamma irradiation.
Having established that A549 cells are relatively more radioresistant. The
variance in signaling pattern and effectiveness of cell killing with the change in LET was
looked at. A549 Lung Adenocarcinoma cells were irradiated with 2 Gy proton beam or γ-
radiation. Proton beam was found to be more cytotoxic than γ-radiation (Fig. 3.2A).
Proton beam irradiated cells showed phosphorylation of H2AX, ATM, Chk2 and p53
(Fig. 3.2B). The mechanism of excessive cell killing in proton beam irradiated cells was
found to be upregulation of Bax and down-regulation of Bcl-2 (Fig. 3.2C). The
noteworthy finding of this study is the biphasic activation of the sensor proteins, ATM
and DNA-PK and no activation of ATR by proton irradiation (Fig. 3.2D).
3.3 High LET irradiation induced signaling in mammalian cells and its comparison
with Gamma irradiation.
After establishing the signaling differences between proton beam and gamma ray in lung
carcinoma cells. The variance in signaling pattern with higher LET (carbon and oxygen)
was studied.
Lung carcinoma cell line A549 were irradiated with 1 or 2 Gy doses of carbon ions,
oxygen ions or gamma rays and ensuing activation of few important components
involved in DNA repair, cell cycle arrest, apoptosis and survival pathways were
followed.
Expectedly the carbon beam was found to be three times more cytotoxic than γ-radiation
despite the fact that the number of H2AX foci was the same with both the radiations. The
repair, although activated in carbon beam-irradiated cells, was not effective in reviving
the cells. The carbon beam irradiated cells showed increased phosphorylation of primary
regulators of Homologous Recombination Repair (HRR) pathway i.e. H2AX, ATM,
BRCA1 and Chk2 as compared to gamma irradiation (Fig. 3.3). The noteworthy finding
of this study was the biphasic activation of the pH2AX and the unusually large foci of
BRCA1. Apoptosis was found to be p53 independent.
7

SYNOPSIS
Comparison of carbon and oxygen beam irradiation induced signaling
The differences in activation of signaling components with respect to LET and fluence of
radiation can be very helpful in elucidating repair mechanisms in cells. Foci formation of
pH2AX, pATM and pATR was also compared between carbon and oxygen at 1 Gy,
which differ on the basis of LET by a factor of 2. The dose was kept constant since LET
of oxygen is double of carbon, the fluence of oxygen should be half that of carbon ions.
The probability is that with carbon irradiation one cell may be hit by 2.8 carbon ions and
with oxygen irradiation one cell may be hit by 1.3 oxygen ions. Thus the probability that
a cell is not being hit by oxygen increases the bystander responses with oxygen ion
irradiation. pH2AX foci were observed in 60% of the cells at 15 minutes indicating that
only 60% of the cells might have been hit by oxygen (Fig. 3.3I). However, presence of
significant number of pATM foci in 96% of the cells indicates activation of ATM in
bystander cells. pATR foci were also significantly high in oxygen irradiated cells and was
found in 36% of the cells unlike in carbon irradiated cells where only10% cells showed
the foci. This could indicate that complex damage may lead to increased activation of
ATR (Fig. 3.3I).
3.4 Radiation induced bystander signaling in mammalian cells.
To establish the contribution of the bystander effect in the survival of the
neighbouring cells, the lung carcinoma A549 cells were exposed to 2 Gy γ-irradiation.
The medium from irradiated cells was transferred to unirradiated cells. Irradiated A549
cells as well as those cultured in the presence of medium from γ-irradiated A 549 cells
showed decrease in survival, increase in γ-H2AX and pATM foci (Fig. 3.4A). Bystander
signaling was also found to exist between U937 cells (human monocyte) and Lung
carcinoma A549 cells. PMA stimulated and irradiated U937 cells induced bystander
response in unirradiated A549 cells. The latter showed a decrease in survival, increase in
γ-H2AX and pATM foci (Fig. 3.4B). The unstimulated and/or irradiated U937 cells did
not induce bystander effect in unirradiated A549 cells. The mechanism of such a cross
bystander effect was investigated in mouse cell line.
EL-4 and RAW 264.7 cells were exposed to 5 Gy γ-irradiation. The medium from
irradiated cells was transferred to unirradiated cells. Irradiated EL-4 cells as well as those
cultured in the presence of medium from γ-irradiated EL-4 cells showed an upregulation
of NF-κB, iNOS, p53 and p21/waf1 genes (Fig. 3.4C). The directly irradiated and the
bystander EL-4 cells showed an increase in NO production (Fig. 3.4D), DNA damage
(Fig. 3.4E) and apoptosis. Bystander signaling was also found to exist between RAW
264.7 (macrophage) and EL-4 (lymphoma) cells. Unstimulated and/or irradiated RAW
264.7 cells did not induce bystander effect in unirradiated EL-4 cells but LPS stimulated
and irradiated RAW 264.7 cells induced an upregulation of NF-κB and iNOS genes (Fig.
3.4F) and increased the DNA damage in bystander EL-4 cells. Treatment of EL-4 or
RAW 264.7 cells with L-NAME significantly reduced the induction of gene expression
and DNA damage in the bystander EL-4 cells while treatment with cPTIO only partially
reduced the induction of gene expression and DNA damage in the bystander EL-4 cells
(Fig. 3.4G). It was concluded that active iNOS in the irradiated cells was essential for
bystander response.
8

SYNOPSIS
Percentage Survival
100
80
60
40
20
0
MCF7
INT407
A549
0Gy 2Gy 5X2Gy 10Gy
Radiation Dose
Fig. 3.1A. Relative radioresistance of three cell line viz. MCF-7, INT 407 and A 549
Data represents means ± SE of three independent experiments. Lane 1, control
unirradiated A549 cell line. Key; Lane 2, 2 Gy acute dose ( single dose that was
delivered in each fraction ) of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation daily
over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the fraction )
60 Co γ-irradiation.
Ratio of ATM to Actin
5.0
4.5
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
Con 2 Gy 5X2 Gy 10 Gy
Treatment
MCF
INT407
A549
Fig. 3.1B. Gene expression of ATM in MCF-7, INT 407 and A 549 cells. Key;
Lane 1, control unirradiated A549 cell line. Lane 2, 2 Gy acute dose ( single dose that
was delivered in each fraction ) of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation
daily over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the
fraction ) 60 Co γ-irradiation.
9

SYNOPSIS
Ratio of DNA-PK to Actin
2.5
2.0
1.5
1.0
0.5
0.0
1 2 3 4
Lane
Fig. 3.1C. Gene expression of DNA-PK in A 549 cells. Key; Lane 1, control unirradiated
A549 cell line. Lane 2, 2 Gy acute dose ( single dose that was delivered in each fraction )
of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation daily over a period of 5 days,
Lane 4, 10 Gy acute (which is the sum total of all the fraction ) 60 Co γ-irradiation.
Relative phosphorylation of p53
1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
p-TP53
Con 2Gy 5X2Gy 10Gy
Loading
control
(ponceau)
Con 2Gy 5X2Gy 10Gy
Fig. 3.1D Expression of phospho-p53 in A 549 cells. Key; Lane 1, control unirradiated
A549 cell line. Lane 2, 2 Gy acute dose ( single dose that was delivered in each fraction )
of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation daily over a period of 5 days,
Lane 4, 10 Gy acute (which is the sum total of all the fraction ) 60 Co γ-irradiation.
10

SYNOPSIS
Ratio of Rad52 to Actin
Ratio of MLH1 to Actin
140
120
100
80
60
40
20
0
1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
Role of Rad 52 and MLH1 in relative radioresistance
Con 2Gy 5X2Gy 10Gy
Con 2Gy 5X2Gy 10Gy
Rad52
Actin
MLH1
Ratio of Rad52 to Actin
Ratio of MLH1 to Actin
0.6
0.5
0.4
0.3
0.2
0.1
0.0
1.0
0.8
0.6
0.4
0.2
0.0
Con 2Gy 5X2Gy 10Gy
Treatment
Con 2Gy 5X2Gy 10Gy
Treatment
Rad52
MLH1
Rad52
Actin
MLH1
Actin
A549 cells
Actin
MCF-7 cells
Fig. 3.1E. Gene expression of Rad52 and MLH1 in MCF-7 and A 549 cells. Key;
Lane 1, control unirradiated A549 cell line. Lane 2, 2 Gy acute dose ( single dose that
was delivered in each fraction ) of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation
daily over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the
fraction ) 60 Co γ-irradiation.
mRNA stability of DNA-PK
Relative expression of DNA-PK
30000
25000
20000
15000
10000
5000
0
2h+Act 2h+Act+In 4h+Act 4h+Act+In 6h+Act 6h+Act+In 8h+Act 8h+Act+In
Time (h) 2 2 4 4 6 6 8 8
Actinomycin (5mg/ml) + + + + + + + +
p38 MAPK inhibitor (1µM) - + - + - + - +
DNA-PK
Fig. 3.1F Stabilization of DNA-PK mRNA in A549, which had been exposed to 2 Gy of
60 Co γ-irradiation daily over a period of 5 days and its stabilization is control by p38
MAP Kinase.
11

Role of Rad52 and MLH1 In relative radioresistance of A549 cells
SYNOPSIS
Control 5X2Gy 5X2Gy + MLH1 5X2Gy + Rad52
Fig. 3.1G Inhibition of Rad52 with its SiRNA reversed the radioresistance of the A549
cells and made it sensitive to fractionated irradiation. Key; Lane 1, control unirradiated
A549 cell line. Lane 2, 2 Gy of 60 Co γ-irradiation daily over a period of 5 days Lane 3, A
549 cells transfected with MLH1 SiRNA and exposed to 2 Gy of 60 Co γ-irradiation daily
over a period of 5 days, Lane 4, A 549 cells transfected with Rad52 SiRNA and exposed
to 2 Gy of 60 Co γ-irradiation daily over a period of 5 days.
Fig. 3.2A Clonogenic Cell Survival of A 549 cells irradiated with 2Gy Proton Beam or
2Gy γ-radiation. Data shown from representative experiment of three independent
experiments.
12

Relative Phosphorylation
45
40
35
30
25
20
15
10
5
0
Control
Gamma
Proton
y-H2AX p-ATM p-Chk2 p-TP53
Signaling Molecules
SYNOPSIS
Fig.3.2B Immunofluorescence staining and Image analysis of γ-H2AX, phospho-ATM,
phospho-Chk2 and phospho-p53 4h after irradiation in A 549 cells irradiated with 2Gy
Proton Beam or 2Gy γ-radiation. Graph represents relative phosphorylation of H2AX,
ATM, Chk2 and p53 as determined by ImageJ software. At least 100 cells per experiment
were analyzed from three independent experiments. Data represents means ± SE of three
independent experiments; significantly different from unirradiated controls: *P < 0.05,
**P < 0.01.
Fig 3.2C Gene expression of Bax and Bcl-2 12h after irradiation in A 549 cells irradiated
with 2Gy Proton Beam or 2Gy γ-radiation. Con means unirradiated control, H means
proton. Data represents means ± SE of three independent experiments; significantly
different from unirradiated controls: *P < 0.05, **P < 0.01.
13

SYNOPSIS
Fig. 3.2D Gene expression of ATM, DNA-PK, ATR, Chk1 and Chk2 in A 549 cells
irradiated with 2Gy Proton Beam or 2Gy γ-radiation at 2, 3 or 4h after irradiation. Total
RNA from A 549 cells was isolated and reverse transcribed. RT-PCR analysis of ATM,
DNA-PK, ATR, Chk1 and Chk2 genes was carried out as described in materials and
methods. PCR products were resolved on 1.5% agarose gels containing ethidium
bromide. β-Actin gene expression in each group was used as an internal control. Ratio of
intensities of (A & B) ATM, DNA-PK or ATR, (C & D) Chk1 and Chk2 band to that of
respective β-actin band as quantified from gel pictures are shown above each gel picture.
Con means unirradiated control. Data represents means ± SE of three independent
experiments; significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
14

SYNOPSIS
Fig. 3.3A Clonogenic Cell Survival of A 549 cells irradiated with 1, 2 or 3Gy carbon
Beam or γ-radiation. Data represents means ± SD of three independent experiments.
(A)
(B)
Average y-H2AX foci per cell
Relative γ−H2AX intensity
24 Con
22
20
18
15 m
4 hrs
100%
16
100%
14
12
10
8
6
4
57%
2
10%
10%
22%
0
Gamma
Carbon
1 Gy Dose
7
6
5
4
3
2
Con
15m
4h
1
0
Gamma
Carbon
1Gy Dose
Relative Intensity pH2AX
(C)
Lane
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
pH2AX Carbon
pH2AX Gamma
Con 0.2 0.5 1 2 3 4 6
Time (hours)
Gamma
Carbon
C 10 30 1 2 3 4 6
Fig. 3.3B Phosphorylation of H2AX (γ-H2AX) at different time points after exposure to 1
Gy gamma or carbon irradiation in A 549 cells. (A) Graph represents average numbers of
foci per cell, percentage of cells showing the foci is marked above the bars. (B) Graph
represents relative phosphorylation of H2AX as determined by ImageJ software. At least
100 cells per experiment were analyzed from three independent experiments. (C)
Represenative image of immunoblot and histogram showing phosphorylation of H2AX at
various time periods (0.2, 0.5, 1, 2, 3, 4 and 6 hours). Relative pH2Ax band intensity
shown in histogram was divided by ponceau as loading control. Data represents means ±
SD of three independent experiments.
15

SYNOPSIS
(A)
Average pATM foci per cell
35
30
25
20
15
10
5
0
Con
1Gy
52%
88%
25%
22%
Gamma
Carbon
(B)
Relative intensity of phospho ATM
5
4
3
2
1
0
Con
1Gy
Gamma
Carbon
Fig.3.3C Phosphorylation of ATM at 4h after exposure to 1 Gy gamma or carbon
irradiation in A 549 cells. (A) Graph represents average numbers of foci per cell,
percentage of cells showing the foci is marked above the bars. (B) Graph represents
relative phosphorylation of ATM as determined by ImageJ software. At least 100 cells
per experiment were analyzed from three independent experiments. Data represents
means ± SD of three independent experiments.
(A)
Average ATR foci per cell
30
25
20
15
10
5
0
53%
Gamma
Con
1Gy
10%
Carbon
(B)
Relative intensity of pATR
8
7
6
5
4
3
2
1
0
Gamma
Con
1Gy
Carbon
Fig.3.3D Phosphorylation of ATR at 4h after exposure to 1 Gy gamma or carbon
irradiation in A 549 cells. (A) Graph represents average numbers of foci per cell,
percentage of cells showing the foci is marked above the bars. (B) Graph represents
relative phosphorylation of ATR as determined by ImageJ software. At least 100 cells per
experiment were analyzed from three independent experiments. Data represents means ±
SD of three independent experiments.
16

SYNOPSIS
(A)
Av No. of phospho BRCA1 Foci per cell
22
20
18
16
14
12
10
8
6
4
2
0
-2
55%
Gamma
Con
1 Gy
100%
Carbon
(B)
Relative phosphorylation of BRCA
3.0
2.5
2.0
1.5
1.0
0.5
0.0
Gamma
Con
1Gy
Carbon
Fig. 3.3E Phosphorylation of BRCA1 at 4h after exposure to 1 Gy gamma or carbon
irradiation in A 549 cells. (A) Graph represents average numbers of foci per cell,
percentage of cells showing the foci is marked above the bars. (B) Graph represents
relative phosphorylation of BRCA1 as determined by ImageJ software. At least 100 cells
per experiment were analyzed from three independent experiments. Data represents
means ± SD of three independent experiments.
(A)
Relative intensity of pChk1
2.5
2.0
1.5
1.0
0.5
Con
1Gy
(C)
Relative intensity of Chk2
2.5
2.0
1.5
1.0
0.5
Con
1Gy
0.0
Gamma
Carbon
0.0
Gamma
Carbon
Control
1Gy
(B)
p-Chk2 (Gamma) p-Chk2 (Carbon)
Fig.3.3F Phosphorylation of Chk1 and Chk2 at 4h after exposure to 1 Gy gamma or carbon
irradiation in A 549 cells. (A) Graph represents relative phosphorylation of Chk1 as determined
by ImageJ software (B) Representative image showing phosphorylation and foci formation of
Chk2 shown by “arrow” between 1Gy carbon beam and 1Gy γ-radiation. Each phospho-Chk2
antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green). All
images were captured using Carl Zeiss confocal microscope with the same exposure time (C)
Graph represents relative phosphorylation of Chk2 as determined by ImageJ software. At least
100 cells per experiment were analyzed from three independent experiments. Data represents
means ± SD of three independent experiments.
17

SYNOPSIS
Relative phosphorylation
1.5
1.0
0.5
0.0
(A)
pERK(gamma)
pERK(carbon)
Con 0.1 0.5 1 2 3 4 6
Time after irradiation (hrs)
Relative phosphorylation
(B)
1.5
1.0
0.5
0.0
pJNK(gamma)
pJNK(carbon)
Con 0.1 0.5 1 2 3 4 6
Time after irradiation (Hrs)
Carbon
Gamma
Con 10 30 1 2 3 4 6 Lane Con 10 30 1 2 3 4 6
pERK
pJNK
Fig.3.3G Phosphorylation of ERK (pERK) and JNK (pJNK) in A549 cells cells at
different time periods (hours) after exposure to 1 Gy dose of gamma or carbon ion
irradiation. Treated and untreated cells were immunoblotted and detected using antiphospho
ERK (panel A) or anti phospho JNK (panel B). One representative image of
three independent experiments is shown here.
Bar graph represents the relative pERK (panel A) and pJNK (panel B) band intensities
plotted against time. The intensities of pERK/pJNK were obtained after dividing them
with the respective loading control intensities and have been normalized for comparison.
(A)
30
Control 1Gy Gamma 1Gy Carbon
(B)
% Apoptotic Nuclei at 4h
25
20
15
10
5
0
Con
Gamma
Carbon
1 Gy
Con 2h 3h 4h 6h
(C)
Bax
Lane
Fig.3.3H Apoptosis in carbon irradiated A549 cells. Panel A, Apoptotic nuclei of A549 cells were
visualized and quantified by using DAPI staining, 4 hours after carbon or gamma irradiation
(1Gy). Panel B, The percentage of cells with apoptotic nuclei are represented as graph. At least
100 cells per experiment were analyzed from three independent experiments. Panel C,
Representative immunoblot image depicting upregulation of Bax, observed at various time
periods (2, 3, 4 and 6 hours) after carbon irradiation (1 Gy).
18

SYNOPSIS
Percentage Survival
120
100
80
60
40
20
0
(A)
Carbon beam
Oxygen beam
Con 1 Gy 2 Gy
Irradiation Dose
Average H2Ax foci per cell
26
24
22
20
18
16
14
12
10
8
6
4
2
0
(B)
100%
22%
10%
Carbon
Con
1Gy 15m
1Gy 4h
61%
23%
10%
Oxygen
Average pATM foci per cell
30
25
20
15
10
5
0
(C)
22%
Carbon
52%
Con
1Gy
96%
19%
Oxygen
Average ATR foci per cell
40
35
30
25
20
15
10
5
0
(D)
10%
Carbon
Con
1Gy
36%
Oxygen
Fig.3.3I Comparison of carbon and oxygen beam irradiation induced signaling. (A)
Graph represents Clonogenic Cell Survival of A 549 cells irradiated with 1 or 2Gy carbon
or oxygen beam. Data represents means ± SD of three independent experiments. (B-D)
Graphs represent average numbers of foci per cell of γ-H2AX, p-ATM and p-ATR
respectively, percentage of cells showing the foci is marked above the bars. At least 100
cells per experiment were analyzed from three independent experiments. Data represents
means ± SD of three independent experiments.
19

SYNOPSIS
Fig.3.4A. Irradiated A549 cells as well as those cultured in the presence of medium from
γ-irradiated A 549 cells (Bystander) showed decrease in survival, increase in γ-H2AX
and pATM foci
20

SYNOPSIS
Fig.3.4B. Existance of cross bystander effect between Human Lung carcinoma A549
cells and Human Monocyte U937 cells. Key: Lane 1, control unirradiated A549 cells;
Lane 2, unirradiated A549 cells receiving medium from PMA-stimulated (32nM) and γ
irradiated U937 cells; Lane 3, unirradiated A549 cells receiving medium from γ irradiated
U937 cells without PMA-stimulation; Lane 4, unirradiated A549 cells receiving medium
from PMA-stimulated U937 cells; Lane 5, unirradiated A549 cells receiving medium
from unirradiated U937 cells without PMA-stimulation.
21

SYNOPSIS
Fig. 3.4C Gene expression of iNOS, p21, p53 and NF-kB (p65) in EL-4 cells cultured for
2 h in presence of different conditioned media. Key: Lane 1, control unirradiated EL-4
cells; Lane 2, γ irradiated EL-4 cells; Lane 3, unirradiated EL-4 cells receiving medium
from γ irradiated EL-4 cells; Lane 4, unirradiated EL-4 cells receiving medium irradiated
with γ rays in the absence of cells; Lane 5, unirradiated EL-4 cells receiving medium
from unirradiated EL-4 cells. Data represents means ± SE of three independent
experiments; significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
Fig. 3.4D NO production from EL-4 cells cultured for 24 h in the presence of different
conditioned media. The culture supernatant from each group of EL-4 cells was used for
determination of NO 2
-
with Griess reagent. Key: Lane 1, control unirradiated EL-4 cells; Lane 2,
γ irradiated EL-4 cells; Lane 3, unirradiated EL-4 cells receiving medium from γ irradiated EL-4
cells; Lane 4, unirradiated EL-4 cells receiving medium irradiated with γ rays in the absence of
cells; Lane 5, unirradiated EL-4 cells receiving medium from unirradiated EL-4 cells. Data
represents means ± SE of three independent experiments; significantly different from unirradiated
controls: *P < 0.05, **P < 0.01.
22

SYNOPSIS
Fig. 3.4EDNA damage in EL-4 cells cultured for 2 h in presence of different conditioned media
was measured using single cell gel electrophoresis (‘comet assay’), (A) Tail length and (B) %
DNA in tail. Key: Lane 1, control unirradiated EL-4 cells; Lane 2, γ irradiated EL-4 cells; Lane
3, unirradiated EL-4 cells receiving medium from γ irradiated EL-4 cells; Lane 4, unirradiated
EL-4 cells receiving medium irradiated with γ rays in the absence of cells; Lane 5, unirradiated
EL-4 cells receiving medium from unirradiated EL-4 cells. Data represents means ± SE of three
independent experiments; significantly different from unirradiated controls: *P < 0.05, **P <
0.01.
Fig. 3.4F Gene expression of NF-kB (p65) and iNOS gene in EL-4 cells which had received
medium from irradiated RAW 264.7 cells. EL-4 cells cultured for 2 h in presence of different
conditioned media. Key: Lane 1, control EL-4 cells; Lane 2, EL-4 cells receiving medium from
LPS-stimulated (500ng/ml) and γ irradiated RAW 264.7 cells; Lane 3, EL-4 cells receiving
medium from γ irradiated RAW 264.7 cells without LPS-stimulation; Lane 4, EL-4 cells
receiving medium from LPS-stimulated RAW 264.7 cells; Lane 5, EL-4 cells receiving medium
from unirradiated RAW 264.7 cells. Data represents means ± SE of three independent
experiments; significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
23

SYNOPSIS
Fig. 3.4G Gene expression of NF-kB (p65) and iNOS gene in EL-4 cells which had
received medium from irradiated cells. EL-4 cells cultured for 2 h in presence of different
conditioned media. Key: Lane 1, control EL-4 cells; Lane 2, γ irradiated EL-4 cells;
Lane 3, EL-4 cells receiving medium from γ irradiated EL-4 cells; Lane 4, EL-4 cells
receiving medium from L-NAME treated and γ irradiated EL-4 cells; Lane 5, EL-4 cells
receiving medium from cPTIO treated and γ irradiated EL-4 cells; Lane 6, EL-4 cells
receiving medium from LPS-stimulated (500ng/ml), L-NAME treated and γ irradiated
RAW 264.7 cells; Lane 7, EL-4 cells receiving medium from LPS-stimulated
(500ng/ml), cPTIO treated and γ irradiated RAW 264.7 cells. Data represents means ± SE
of three independent experiments; significantly different from unirradiated controls: *P <
0.05, **P < 0.01.
CHAPTER 4: DISCUSSION
The work embodied in this thesis clearly shows that the fractionated doses led to a
signaling response that was different from a single dose of irradiation. The work also
stresses on the signaling differences between Low and High LET radiation and the fine
tuning of bystander signaling. The observed results have been extensively discussed in
this chapter and their significance and impact has been discussed in context with the
current literature. The conclusions drawn from this study has also been included in this
chapter.
4.1 Fractionated irradiation induced signaling and repair in mammalian cells.
In tumor radiotherapy, radiation is given as fractionated doses [4]. This leads to
development of radioresistance in the surviving tumor cells. Chronic exposure of cells to
ionizing radiation induces an adaptive response that results in the increased tolerance to
24

SYNOPSIS
subsequent cytotoxicity caused by the same [15-17]. However the mechanism and the
factors that contribute to radioresistance of an irradiated cell are yet not known. It was of
interest to study the signaling factors that contribute to this phenomenon. A549 cells were
found to be relatively more radioresistant if the 10Gy dose was delivered as a fractionated
regimen. Microarray analysis showed upregulation of DNA repair and cell cycle arrest
genes in fractionated regimen. We have also observed intense activation of DNA repair
pathway (DNA-PK, ATM, Rad52, MLH1 and BRCA1), efficient DNA repair and
phospho-p53 was found to be translocated to the nucleus of A549 cells (5X2 Gy
treatment group). When we silenced the Rad52 gene in A549 cells, the sensitivity of the
cells (5X2 Gy treatment group) increased by more than 50%. The above results indicate
that fractionated dose led to increased radioresistance in A549 cells and Rad52 gene is
one of the factors responsible for increased radioresistance in A549 cells.
4.2 Proton beam induced signaling in mammalian cells and its comparison with
Gamma irradiation.
Exposure of mammalian cells to ionising radiation leads to the activation of several
signaling pathways that result in apoptosis. Although, the end point, apoptosis is
effectively activated by conventional X-ray treatment, the development of radioresistance
following therapy remains a major cause for concern. Clinicians are now favoring proton
beam therapy to avoid the issue [18-23]. However, the mechanism of cell killing by
proton beam is not yet well delineated.
In this study, A549 cells were irradiated with either 2Gy proton beam or 2Gy γ-radiation
and ensuing activation of few important components involved in DNA repair, cell cycle
arrest, and apoptosis pathways were followed to elucidate the mechanisms behind
observed cellular response. Increased phosphorylation of p53, upregulation of Bax and
down-regulation of Bcl-2 in proton beam irradiated A549 cells as compared to γ-
irradiated cells indicate the activation of apoptotic pathways. The noteworthy finding of
this study is the biphasic activation of the sensor proteins, ATM and DNA-PK and no
activation of ATR by proton irradiation and the significant activation of Chk2 even at the
gene level only in the proton beam irradiated cells. Unlike gamma irradiation, the
biphasic induction of ATM and DNA-PK following proton beam irradiation could be
responsible for the activation of apoptotic machinery, however, further studies in this
direction will reveal the importance of such biphasic response.
4.3 High LET irradiation induced signaling in mammalian cells and its comparison
with Gamma irradiation.
Because of the effective cell killing clinicians now favor charged particle beam therapy
over conventional photons for tumors that are radioresistant and when the survival of
nearby cells cannot be compromised [24-26]. Although charged particle beams like
carbon etc are currently being used for the treatment of many cancers [25-27], the
signaling pathways activated and their variance from γ -irradiation is not well understood.
These results suggest that while ATM has been shown to be the critical regulator of low
LET radiation induced responses, BRCA1 seems to dominate the high LET induced
response. The subtle differences leading to different pathways of initiation of downstream
responses with respect to radiation quality seem to lie in pattern of the phosphorylationdephosphorylation
of early response proteins such as H2AX rather than their immediate
phosphorylation per se.
25

SYNOPSIS
4.4 Radiation induced bystander signaling in mammalian cells.
It is now apparent that the target for biological effects of ionizing radiation is not solely
the irradiated cell but also the surrounding cells and tissues. Preliminary evidence
indicates that similar signal transduction pathways are activated in directly irradiated
cells and the bystander cells and contribute to the induction of bystander DNA damage
[28]. Many genes have been shown to be activated in bystander cells [29]but evidence for
genes that are involved in the signaling pathways is lacking.
The present study was carried out to investigate what genes are activated in the
bystanding cell and whether the state of activation of the irradiated cell alters the
bystander response. Bystander signaling was found to exist between U937 cells (human
monocyte) and Lung carcinoma A549 cells. The mechanism of such a cross bystander
signaling was investigated in mouse cell line. Bystander signaling was also found to exist
between RAW 264.7 (macrophage) and EL-4 (lymphoma) cells. Unstimulated and/or
irradiated RAW 264.7 cells did not induce bystander effect in unirradiated EL-4 cells but
LPS stimulated and irradiated RAW 264.7 cells induced an upregulation of NF-κB and
iNOS genes and increased the DNA damage in bystander EL-4 cells. Treatment of EL-4
or RAW 264.7 cells with L-NAME (NOS inhibitor) significantly reduced the induction
of gene expression and DNA damage in the bystander EL-4 cells while treatment with
cPTIO (NO scavenger) only partially reduced the induction of gene expression and DNA
damage in the bystander EL-4 cells. These results showed that active iNOS in the
irradiated cells was essential for bystander response and some long-lived bioactive
factors downstream of NO are most likely involved in this bystander response.
Summary:
The irradiation of cells with fractionated doses led to a signaling response that was
different from a single dose of irradiation. The reasons for the radioresistance of the
A549 cells lay in the repair pathway, the Rad52, the inhibition of which could revert the
cells to radiosensitivity leading to a decrease in survival.
The contribution of the bystander effect to the decrease in survival of A549 cells
cannot be ruled out. There was a significant bystander response by unirradiated A549
cells. The mechanism of which may be via NO generation.
The effectiveness of heavy ions (carbon and oxygen) in decreasing the survival of
A549 cells could be due to the lack of efficient repair despite the activation of the repair
pathways (HRR). The pathway to apoptosis seems to be p53 independent.
Conclusion:
The lung carcinoma cell line A549, a highly radioresistant cell line could be
effectively made radiosensitive by inhibiting Rad52, one of the components of its repair
pathway. The survival of the cells decreased significantly after doing so.
The survival of the A549 cell line could also be significantly decreased by heavy
ion irradiation. The mechanism of which seems to be a lack of repair, despite the
activation of some of the component of the repair pathway.
CHAPTER 5: REFERENCES
[1] Rontgen, W. C. On a New Kind of Rays. Science 3:227-231; 1896.
[2] Becquerel, H. Emission of New Radiations by Metallic Uranium. Compt. Ren.
122:1086-1088; 1896.
[3] Alpen, E. L. Radiation Biophysics. Prentice Hall, New Jersey; 1990.
26

SYNOPSIS
[4] Hall, E. J. Radiobiology for the radiobiologist. J.B. Lippincott Company,
Philadelphia.; 1994.
[5] Criswell, T.; Leskov, K.; Miyamoto, S.; Luo, G.; Boothman, D. A. Transcription
factors activated in mammalian cells after clinically relevant doses of ionizing radiation.
Oncogene 22:5813-5827; 2003.
[6] Morgan, W. F. Non-targeted and delayed effects of exposure to ionizing radiation:
I. Radiation-induced genomic instability and bystander effects in vitro. Radiat Res
159:567-580; 2003.
[7] Coutard, H. The Results and Methods of Treatment of Cancer by Radiation. Ann
Surg 106:584-598; 1937.
[8] Schmidt-Ullrich, R. K.; Dent, P.; Grant, S.; Mikkelsen, R. B.; Valerie, K. Signal
transduction and cellular radiation responses. Radiat Res 153:245-257; 2000.
[9] Prise, K. M.; Ahnstrom, G.; Belli, M.; Carlsson, J.; Frankenberg, D.; Kiefer, J.;
Lobrich, M.; Michael, B. D.; Nygren, J.; Simone, G.; Stenerlow, B. A review of dsb
induction data for varying quality radiations. Int J Radiat Biol 74:173-184; 1998.
[10] Rasband, W. S.; Image, J. U. S. National Institutes of Health, Bethesda, USA.
http://rsb.info.nih.gov/ij/. 1997-2006.
[11] Maurya, D. K.; Salvi, V. P.; Nair, C. K. Radiation protection of DNA by ferulic
acid under in vitro and in vivo conditions. Mol Cell Biochem 280:209-217; 2005.
[12] Konca, K.; Lankoff, A.; Banasik, A.; Lisowska, H.; Kuszewski, T.; Gozdz, S.;
Koza, Z.; Wojcik, A. A cross-platform public domain PC image-analysis program for the
comet assay. Mutat Res 534:15-20; 2003.
[13] Green, L. C.; Wagner, D. A.; Glogowski, J.; Skipper, P. L.; Wishnok, J. S.;
Tannenbaum, S. R. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal
Biochem 126:131-138; 1982.
[14] Jeon, S. H.; Kang, M. G.; Kim, Y. H.; Jin, Y. H.; Lee, C.; Chung, H. Y.; Kwon,
H.; Park, S. D.; Seong, R. H. A new mouse gene, SRG3, related to the SWI3 of
Saccharomyces cerevisiae, is required for apoptosis induced by glucocorticoids in a
thymoma cell line. J Exp Med 185:1827-1836; 1997.
[15] Russell, J.; Wheldon, T. E.; Stanton, P. A radioresistant variant derived from a
human neuroblastoma cell line is less prone to radiation-induced apoptosis. Cancer Res
55:4915-4921; 1995.
[16] Dahlberg, W. K.; Azzam, E. I.; Yu, Y.; Little, J. B. Response of human tumor
cells of varying radiosensitivity and radiocurability to fractionated irradiation. Cancer
Res 59:5365-5369; 1999.
[17] Pearce, A. G.; Segura, T. M.; Rintala, A. C.; Rintala-Maki, N. D.; Lee, H. The
generation and characterization of a radiation-resistant model system to study
radioresistance in human breast cancer cells. Radiat Res 156:739-750; 2001.
[18] Krengli, M.; Hug, E. B.; Adams, J. A.; Smith, A. R.; Tarbell, N. J.; Munzenrider,
J. E. Proton radiation therapy for retinoblastoma: comparison of various intraocular
tumor locations and beam arrangements. Int J Radiat Oncol Biol Phys 61:583-593; 2005.
[19] St Clair, W. H.; Adams, J. A.; Bues, M.; Fullerton, B. C.; La Shell, S.; Kooy, H.
M.; Loeffler, J. S.; Tarbell, N. J. Advantage of protons compared to conventional X-ray
or IMRT in the treatment of a pediatric patient with medulloblastoma. Int J Radiat Oncol
Biol Phys 58:727-734; 2004.
[20] Chang, J. Y.; Zhang, X.; Wang, X.; Kang, Y.; Riley, B.; Bilton, S.; Mohan, R.;
Komaki, R.; Cox, J. D. Significant reduction of normal tissue dose by proton
radiotherapy compared with three-dimensional conformal or intensity-modulated
27

SYNOPSIS
radiation therapy in Stage I or Stage III non-small-cell lung cancer. Int J Radiat Oncol
Biol Phys 65:1087-1096; 2006.
[21] Fukumitsu, N.; Sugahara, S.; Nakayama, H.; Fukuda, K.; Mizumoto, M.; Abei,
M.; Shoda, J.; Thono, E.; Tsuboi, K.; Tokuuye, K. A prospective study of
hypofractionated proton beam therapy for patients with hepatocellular carcinoma. Int J
Radiat Oncol Biol Phys 74:831-836; 2009.
[22] Jones, B.; Dale, R. G.; Carabe-Fernandez, A. Charged particle therapy for cancer:
the inheritance of the Cavendish scientists? Appl Radiat Isot 67:371-377; 2009.
[23] Miralbell, R.; Crowell, C.; Suit, H. D. Potential improvement of three dimension
treatment planning and proton therapy in the outcome of maxillary sinus cancer. Int J
Radiat Oncol Biol Phys 22:305-310; 1992.
[24] Ogata, T.; Teshima, T.; Kagawa, K.; Hishikawa, Y.; Takahashi, Y.; Kawaguchi,
A.; Suzumoto, Y.; Nojima, K.; Furusawa, Y.; Matsuura, N. Particle irradiation suppresses
metastatic potential of cancer cells. Cancer Res 65:113-120; 2005.
[25] Schulz-Ertner, D.; Nikoghosyan, A.; Thilmann, C.; Haberer, T.; Jakel, O.; Karger,
C.; Kraft, G.; Wannenmacher, M.; Debus, J. Results of carbon ion radiotherapy in 152
patients. Int J Radiat Oncol Biol Phys 58:631-640; 2004.
[26] Tsuji, H.; Ishikawa, H.; Yanagi, T.; Hirasawa, N.; Kamada, T.; Mizoe, J. E.;
Kanai, T.; Tsujii, H.; Ohnishi, Y. Carbon-ion radiotherapy for locally advanced or
unfavorably located choroidal melanoma: a Phase I/II dose-escalation study. Int J Radiat
Oncol Biol Phys 67:857-862; 2007.
[27] Miyamoto, T.; Yamamoto, N.; Nishimura, H.; Koto, M.; Tsujii, H.; Mizoe, J. E.;
Kamada, T.; Kato, H.; Yamada, S.; Morita, S.; Yoshikawa, K.; Kandatsu, S.; Fujisawa, T.
Carbon ion radiotherapy for stage I non-small cell lung cancer. Radiother Oncol 66:127-
140; 2003.
[28] Azzam, E. I.; de Toledo, S. M.; Gooding, T.; Little, J. B. Intercellular
communication is involved in the bystander regulation of gene expression in human cells
exposed to very low fluences of alpha particles. Radiat Res 150:497-504; 1998.
[29] Azzam, E. I.; De Toledo, S. M.; Spitz, D. R.; Little, J. B. Oxidative metabolism
modulates signal transduction and micronucleus formation in bystander cells from alphaparticle-irradiated
normal human fibroblast cultures. Cancer Res 62:5436-5442; 2002.
List of Publications:
1. Ghosh, S.; Narang, H.; Sarma, A.; Krishna, M. DNA damage response signaling
in lung adenocarcinoma A549 cells following gamma and carbon beam
irradiation. Mutation Research/Fundamental and Molecular Mechanisms of
Mutagenesis; 2011 (In Press doi:10.1016/j.mrfmmm.2011.07.015).
2. Ghosh, S.; Narang, H.; Sarma, A.; Kaur, H.; Krishna, M. Activation of DNA
damage response signaling in lung adenocarcinoma A549 cells following oxygen
beam irradiation. Mutat Res 723:190-198; 2011.
3. Ghosh, S.; Bhat, N. N.; Santra, S.; Thomas, R. G.; Gupta, S. K.; Choudhury, R.
K.; Krishna, M. Low energy proton beam induces efficient cell killing in A549
lung adenocarcinoma cells. Cancer Invest 28:615-622; 2010.
4. Ghosh, S.; Maurya, D. K.; Krishna, M. Role of iNOS in bystander signaling
between macrophages and lymphoma cells. Int J Radiat Oncol Biol Phys
72:1567-1574; 2008.
28

CHAPTER 1
INTRODUCTION
INTRODUCTION
29

CHAPTER 1
INTRODUCTION
In physics, radiation describes a process in which energetic particles or waves travel
through a medium or space. Radiation can be classified according to the effects it
produces on matter, into ionizing and non-ionizing radiation. Ionizing radiation includes
cosmic rays, X-rays and the radiation from radioactive materials. Non-ionizing radiation
includes ultraviolet light, radiant heat and microwaves. The word radiation is commonly
used in reference to ionizing radiation only (i.e., having sufficient energy to ionize an
atom), but it may also refer to non-ionizing radiation (e.g., radio waves or visible light).
The energy radiates (i.e., travels outward in straight lines in all directions) from its
source. This geometry naturally leads to a system of measurements and physical units
that are equally applicable to all types of radiation. Both ionizing and non-ionizing
radiation can be harmful to organisms and the natural environment. All life on Earth has
evolved in presence of this radiation. Figure 1.1 shows the percentage contribution of
various sources of ionizing radiation to which human beings are exposed. Over 85
percent of total exposure is from natural resources with about half coming from radon
decay products in the home. Medical exposure of patients accounts for 14 percent of the
total, whereas all other artificial sources – fallout, consumer products, occupational
exposure, and discharges from nuclear industries account for less than 1 percent of the
total value. Of all the exposures, medical exposure is of the main interest to scientists all
over the world because of the ability of radiation to treat dreaded disease like cancer, for
which, ironically it is a cause as well.
30

CHAPTER 1
INTRODUCTION
15.8%
9.56%
Natural Radon
Natural Cosmic
Natural External
Natural Internal
Medical
Nuclear
12.9%
19.8%
0.461%
41.5%
Fig.1.1 Pie-chart showing the percentage of radiation exposure from various sources.
[Data taken from UNSCEAR (United Nations Scientific community on the effects of
Atomic Radiation report 2008].
31

CHAPTER 1
INTRODUCTION
This thesis deals with radiation induced signaling in mammalian cells. This introductory
chapter therefore provides an outline of our current knowledge in the same area.
1.1 Ionizing Radiation:
Whenever the energy of a particle or photon exceeds the ionizing potential of a molecule,
a collision with the molecule might lead to its ionization. Therefore, ionizing radiation,
upon interaction with matter, has an ability to remove electrons from atoms resulting in
the formation of ions. The result of this interaction is the production of negatively
charged free electrons and positively charged ions and hence the term “ionizing
radiation”. In other words it can be described as radiation is considered to be ionizing, if
it has a wavelength

CHAPTER 1
INTRODUCTION
far apart and therefore the resulting damage produced are scattered. Contrarily, the
lesions produced by high LET radiations are clustered because the energy transfer events
are very close together. Thus high LET radiation is more damaging because of the very
high density of ionizing events and the subsequent high likelihood that the ionization
event will fall in the volume of an important biomolecule [2].
The ionizing event involves the ejection of an orbital electron from a molecule, producing
a free electron and a positively charged ion. These ions are highly unstable and rapidly
dissipate their energy and undergo chemical change. This results in the production of free
radicals containing unpaired electrons. Free radicals are an extremely reactive species
having a very short half life. They react very rapidly with other surrounding molecules
and may lead to permanent damage of the affected molecule, or the energy may be
transferred to another molecule. Injury due to radiation is caused mainly by ionization
within the tissues of the body. When radiation interacts with a cell, ionizations and
excitations are produced in either biological macromolecules or in the medium, in which
the cellular organelles are suspended (predominantly water). Based on the site of
interaction, the radiation-cellular interactions may be termed as direct or indirect.
Direct effects occur when an ionizing particle interacts with a macromolecule in a cell
(DNA, RNA, protein etc.). The resulting damage to the macromolecules leads to
abnormalities, which initiate the events that lead to biological changes. Direct effects are
predominant with high linear energy transfer (LET) radiations, such as neutrons, protons,
α-particles and heavy nuclei.
Indirect effects involve the interaction of ionizing radiation with the medium in which the
molecules are suspended, especially water, to produce free radicals and reactive oxygen
33

CHAPTER 1
INTRODUCTION
species (ROS), in presence of oxygen, that damage critical targets. This is known as
indirect action of radiation. With low LET radiations such as X-rays and γ-rays, most of
the damage induced in the biological systems is indirect and mediated by reactive oxygen
species (ROS) generated by radiolytic products of water. These include oxygen radical
(O •- 2 ), hydrogen radical (H • ), hydroxyl radical (OH • ), hydrogen peroxide (H 2 O 2 ),
aqueous electron (e - aq) etc [3]. These ROS are known to cause damage to important
macromolecules in cellular systems leading to a loss of function.
The very obvious application of this was the use of ionizing radiation as a potent tool in
cancer therapy.
1.2 Radiation Therapy:
Ionizing radiation has been an important part of cancer treatment for almost a century,
being used in external-beam radiotherapy, brachytherapy, and targeted radionuclide
therapy. Radiotherapy is based on the idea that exposure to a sufficient quantity (dose) of
ionizing radiation kills. The goal is to deliver a measured dose of radiation to a defined
volume with minimal damage to surrounding normal tissue, resulting in eradication of the
tumor. The first clinical use of radiation for the treatment of tumors was recorded in
1897, and during the past 50 years radiation biology has led to the development of ideas
that form a mechanistic framework of the predicted pathways between energy deposition
in a tumor cell and probability of cell survival [4]. Ionizing` radiation deposits energy
that injures or destroys cells in the area being treated (the "target tissue") by damaging
their genetic material, making it impossible for these cells to continue to grow. Although
radiation damages both cancer cells and normal cells, proliferating cells are more
radiosensitive and have a greater cell loss/turnover rate. Tumors are rapidly proliferating
34

CHAPTER 1
INTRODUCTION
and are more likely to be irradiated at the radiosensitive phase of the cell cycle. Cells are
most sensitive to ionizing radiation during M (mitosis) and G2 phases of the cell cycle
and most resistant in late S phase (DNA synthesis). Radiotherapy may be used to treat
localized solid tumors, such as cancers of the skin, tongue, larynx, brain, breast, or
uterine cervix [5]. It can also be used to treat leukemia and lymphoma (cancers of the
blood-forming cells and lymphatic system, respectively) [6, 7].
Though use of radiation therapy is one of the major and widely used modality in
treatment of cancer, there are several limiting factors that hamper the success of
radiotherapy. These limiting factors are as follows:
1. Limitation to use high radiation dose to maximize tumor regression.
2. Detrimental effects of radiation doses on the normal tissues/organ falling within
radiation field and surrounding the tumor region.
3. Radioresistance of hypoxic cells in tumor tissues.
4. Radioresistance of cell population in S-phase in tumor tissue
5. Induced radioresistance in the tumor cells.
To overcome some of the above, radiotherapy is given as fractionated doses ranging from
2-4 Gy, per fraction. This is done primarily to enhance tumor cell killing over normal
tissues. This is achieved because of hypoxic cell reoxygenation which renders them
sensitive to radiation. The redistribution or reassortment of cells in the cell cycle is
another reason behind fractionation of the radiotherapy dose. Dividing the radiation dose
into multiple fractions allows cells to reassort to more sensitive phases of the cell cycle
before the next treatment. The total dose and hence the period of treatment may vary
depending on the type of tumor and radiation used [8]. Further in order to optimize the
35

CHAPTER 1
INTRODUCTION
tumor cell killing, clinicians use hyper fractionation and hypofractionation regimens,
depending on the type and radioresistance of the tumors and the nature of the surrounding
normal tissues. However, as a result of the repeated doses of radiation delivered to the
tumor cells, it results in an adaptive response in them, leading to the development of
induced radioresistance, rendering the tumor refractory to subsequent doses of radiation.
Several new approaches to radiation therapy are being evaluated to determine their
effectiveness in treating cancer. One such investigational approach is particle beam
radiation therapy. This type of therapy differs from photon radiotherapy in that it involves
the use of fast-moving charged particles to treat localized cancers. This mode has two
major advantages over conventional radiotherapy. First, because of the high LET, the
damage produced is much more and hence the tumor cell eradication is greatly enhanced.
The second advantage is that the energy deposition by the charged particles is highly
localized in a particular depth in the tissue. This is called the Bragg Peak, which confers
that advantage of selective, localized irradiation of the tumor tissue and the surrounding
normal cells are spared.
Though radiotherapy is a prime modality of cancer treatment, a major obstacle in its
successful execution is the development of radioresistance in tumor cells following
treatment. One of the factors contributing to the development of radioresistance is the
activation of the signaling molecules following irradiation. Modulation of these activated
signaling molecules with a view to overcome radioresistance could perhaps be an
effective approach.
36

CHAPTER 1
INTRODUCTION
1.3 DNA damage signaling following irradiation
The pathways that signal DNA damage can be envisioned as transduction cascades in
which the DNA lesion acts as the signal. Much of our understanding of these pathways is
based on genetic studies of the yeasts Saccharomyces cerevisiae and
Schizosaccharomyces pombe; these studies have identified a series of genes crucial for
signaling. There are mammalian homologues of virtually all of these genes, indicating
that DNA damage signaling is highly conserved.
In all organisms examined, signaling involves proteins of the phosphatidylinositol 3-
kinase-like (PIKK) family — ATR and ATM in humans, Mec1p and Tel1p in S.
cerevisiae, and Rad3 and Tel1 in S. pombe. The prevailing view is that DNA damage
somehow activates these kinases, which then amplify and channel the signal by activating
downstream kinases (hChk1 and hChk2 in humans). These, in turn, phosphorylate target
proteins such as p53, Cdc25A and Cdc25C [9-11] to delay the cell cycle, a process called
the DNA damage checkpoint. In addition to checkpoint control, the downstream kinases
also modulate DNA repair and trigger apoptosis [12, 13].
1.3.1 Alarm Sensors
The first response to radiation induced DNA damage is the activation of the alarm
sensors. As the name indicates, these are proteins which detect the damage and set off the
alarm signals, thereafter, the cell readies itself for subsequent action. Interestingly, it is
the proteins involved in DNA repair, like (DNA-PK, ATR, ATM, BRCA-1, PARP etc.),
which scan the genome, detect the damage and act as alarm sensors.
37

CHAPTER 1
INTRODUCTION
1.3.1.1 DNA-PK: a DNA damage sensor for DNA non-homologous end-joining
DNA-PK is a DSB repair enzyme composed of a catalytic subunit, DNA-PKcs that is
part of the PIKK family [14, 15] and a targeting subunit, the Ku70–Ku80 heterodimer
[16, 17]. DNA-PK was discovered more than a decade ago and has since been studied
extensively at a biochemical level. DNA-PK is characterized by its DNA activated
serine/threonine-directed protein kinase activity and can be considered as a paradigm for
the biochemical functions of PIKK family kinases [15]. DNA-PKcs possesses an
intrinsic, albeit weak, DNA-end binding activity that is greatly stimulated and stabilized
by the Ku70–Ku80 heterodimer [17, 18]. Whether DNA-PK signals DSBs to the
checkpoint machinery [19, 20] remains controversial, but the emerging consensus is that
it does not [21-23]. DNA-PK may, however, be involved in signaling DNA damage to
the apoptosis machinery [24]. Genetically, the main role of DNA-PK seems to be in
promoting the rejoining of DSBs by NHEJ. Thus, cells and animals deficient in DNA-PK
are defective in DSB repair and in V(D)J recombination, a process by which antibody
and T-cell receptor diversity is generated, and are consequently radiosensitive and
immunodeficient [15]. The kinase activity of DNA-PK is required for these processes,
indicating that reversible protein phosphorylation is important and that DNA-PK plays a
catalytic role [25]. However, the proteins that have to be phosphorylated by DNA-PK for
it to exert its effects are unknown.
1.3.1.2 ATR is the main sensor of stalled replication forks
The ATR kinase appears to be the master activator of the replication stress response [26,
27]. ATR is a member of a superfamily of serine-threonine kinases, which include ATM,
DNA-PK, mTOR, TRRAP and SMG-1 [28, 29]. ATR is an essential kinase [30, 31] that
38

CHAPTER 1
INTRODUCTION
associates with chromatin specifically during S-phase and it is thought that it plays a
functional role during normal replication [32, 33]. Transient inhibition of ATR results in
(i) inappropriate firing of replication origins [34]; (ii) fork stalling and (iii) replication
induced chromosome breakage [35, 36]. Recently, some individuals with the Seckel
syndrome were found to have very low levels of ATR kinase in their cells due to a splice
mutation in the ATR gene [37]. These individuals share phenotypes with DNA damage
response syndromes such as the Nijmegen breakage syndrome
Since the intrinsic kinase activity of ATR does not change appreciably following DNA
damage, it is thought that ATR activity is primarily regulated through its cellular
localization. ATR is known to form distinct nuclear foci following blockage of
replication [38] and it has been shown that the single strand-binding protein RPA and the
ATR-interacting protein ATRIP are important for the recruitment of ATR to sites of
blocked replication forks [26, 27]. It is thought that stretches of single-stranded DNA are
formed in and around the stalled replication fork and that these sequences become coated
with RPA proteins. ATR/ATRIP is then recruited to the site of RPA-coated DNA where
ATR phosphorylates its substrates. Some studies have shown that ATR is capable of
phosphorylating its targets even in cells depleted of RPA suggesting that in some
situation RPA may not be required for ATR activity [39, 40].
The Nijmegen breakage syndrome (NBS) has overlapping phenotypes with both ataxia
telangiectasia (AT) and the ATR-Seckel syndrome [37, 41]. Following treatment with the
replication blocking agent hydroxyurea (HU), Chk1 kinase and the tumor suppressor p53
are phosphorylated in an ATR-dependent manner and cells that make it through S-phase
will arrest in the G2 phase of the cell cycle [41]. In NBS1-defective cells, however, the
39

CHAPTER 1
INTRODUCTION
activity of ATR signaling is diminished following replication blockage leading to blunted
phosphorylation of Chk1 and p53 and attenuated cell cycle arrests. Thus, NBS1 may play
some role regulating ATR activity following replication blockage [41]. One potential role
of NBS1 in ATR signaling is to retain the ATR kinase at the sites of replication blockage
as to obtain a stronger induction of phosphorylation of its substrates [41].
The ATR kinase orchestrates DNA repair, apoptosis, S-phase and G2 arrest via the Chk1,
p53 and the Fanconi pathways
The outcomes of the activation of the ATR signaling pathway by replication stress is
many fold . First, ATR induces an intra-S checkpoint via phosphorylation of the Chk1
kinase, which targets the Cdc25A phosphatase for degradation [42, 43]. Loss of Cdc25A
results in the inhibition of replication firing [44, 45]. Furthermore, the FANCD2 protein,
which if defective causes Fanconi anemia (FA), becomes monoubiquitylated following
replication stalling in an ATR-dependent manner by a complex made up by at least six
different FA proteins [46-48]. This monoubuitylation of FANCD2 is critical for its
interaction with the tumor suppressor BRCA1 protein, the relocalization of these proteins
to sites of replication blockage and for the induction of S-phase arrest [46]. Second, the
activation of the Chk1 pathway by ATR following replication stress inhibits cells from
prematurely progressing into mitosis with unreplicated DNA [30, 35]. Third, ATR can
stimulate DNA repair through the activation of the FA pathway [49] by activation of p53
[50-53] or by Chk1-mediated activation of Rad51 [54]. The activation of p53 by ATR is
both direct, by phosphorylation of the ser15 site of p53, and indirect, by an inhibitory
phosphorylation of the MDM2 protein that normally negatively regulates p53 [55].
Fourth, activation of p53 may lead to the induction of apoptosis that eliminates cells that
40

CHAPTER 1
INTRODUCTION
are unable to resolve the blockage of replication. Taken together, the replication
machinery could be considered as an effective scanning apparatus that when blocked by
DNA damage will recruit ATR kinase to sites of RPA-coated single-stranded DNA. This
recruitment will then induce phosphorylation of numerous ATR substrates leading to the
activation of S-phase and G2 cell cycle checkpoints and induction of DNA repair and/or
apoptosis.
1.3.1.3 ATM: a DNA damage sensor for DNA homologous recombination repair and
cell cycle arrest
Ataxia-telangiectasia (A-T) is a rare human disease characterized by cerebellar
degeneration, immune system defects and cancer predisposition [29, 56, 57]. The disease
has been the subject of intense scientific scrutiny, particularly since the identification in
1995 of the gene mutated in A-T, ATM [58, 59]. The ataxia-telangiectasia mutated
protein (ATM) has emerged as a central player in the cellular response to ionizing
radiation (IR), in which it plays a critical role in the activation of cell cycle checkpoints
that lead to DNA damage-induced arrest at G1/S, S, and G2/M. ATM is a member of the
phosphatidylinositol 3-kinaselike family of serine/threonine protein kinases (PIKKs).
Other members of this protein family include ATM- and Rad3-related (ATR), DNAdependent
protein kinase catalytic subunit (DNA-PKcs), mammalian target of rapamycin
(mTOR), and ATX/hSMG-1 [29, 60]. The PIKKs represent a subclass of “atypical”
protein kinases within the overall eukaryotic protein kinase family [61]. ATM, like other
members of this protein kinase family, phosphorylates its substrates on serine or
threonine that is followed by glutamine, i.e. an SQ or TQ motif [62, 63]. ATM shares
several features with other members of the PIKK family, including a FAT domain
41

CHAPTER 1
INTRODUCTION
(named due to amino acid conservation between the PIKK family members FRAP, ATR,
and TRRAP), a phosphoinositide 3,4-kinase (PI3K) domain and a FAT carboxy-terminal
(FAT-C) domain [64]. One function of the FAT domain may be to interact with the
kinase domain to stabilize the carboxy-terminal region of the protein [65]. Bioinformatics
analysis indicates that the amino-terminal portions of ATM, ATR, mTOR and, likely,
DNA-PKcs are composed of multiple huntingtin, elongation factor 3, A subunit of protein
phosphatase 2A and TOR1 (HEAT) repeats [66]. Each HEAT repeat is composed of two
interacting, anti-parallel alpha helices linked by a flexible loop. The amino-terminal
regions of the PIKK proteins, therefore, are predicted to consist of multiple, interacting
HEAT repeats that form a massive, superhelical scaffolding matrix [66]. While the
function of the HEAT repeat domain remains unknown, it is speculated that it could
provide a surface for interactions with other proteins. The first indications of the overall
shape and dimensions of the ATM protein have recently emerged. Single particle electron
microscopic analysis reveals that ATM has a large “head” domain of approximately
115Å by 75–140 Å, as well as a long “arm” structure that protrudes from the head region
[67]. The overall shape of ATM is, thus, similar to that of the related protein, DNA-PKcs,
at similar resolution [68]. Both proteins have the ability to interact with ends of doublestranded
(ds) DNA[69-72], and this interaction may be facilitated by a conformational
change that causes the arm region to wrap around the DNA [67]. From the low-resolution
(30 Å) structure of ATM, it is speculated that the HEAT domain corresponds to the
head structure and the carboxy-terminal kinase domain to the arm. However, elucidation
of the precise molecular architecture of ATM will require a higher resolution structure.
42

CHAPTER 1
INTRODUCTION
Perhaps one of the most important recent developments in the field has been
insight into the mechanism of ATM activation in response to DNA damage. ATM is a
predominantly nuclear protein, the levels of which do not change when cells are exposed
to IR [73-76]. However, the protein kinase activity of ATM, as determined using
immunoprecipitation (IP) kinase assays, increases two- to three-fold following cellular
exposure to IR [75] or the radiomimetic neocarzinostatin (NCS) [73]. IR also induces
increased incorporation of phosphate into ATM [65, 77]. DNA damage-induced
phosphate incorporation was not observed in cells expressing kinase-dead ATM,
suggesting that IR induces autophosphorylation of ATM. Indeed, serine 1981, an SQ site
located in the amino-terminal region of the FAT domain, is rapidly phosphorylated in
cells that have been exposed to even very low doses of IR [65]. ATM containing a serine
to alanine mutation at amino acid 1981 failed to support IR-induced phosphorylation of
p53 or cell cycle arrest, suggesting that serine 1981 phosphorylation is critical for the
function of ATM [65]. trans-Phosphorylation and dissociation of ATM from an inactive
dimeric (or higher order) form to an active monomeric form has, thus, emerged as one of
the earliest events in the activation of ATM [65]. While phosphorylation of serine 1981 is
certainly critical to the activation of ATM, it is also possible that ATM undergoes
autophosphorylation at other sites important for the DNA damage response [77].
Although these elegant experiments place ATM autophosphorylation as an
important upstream event in the activation pathway, they do not address whether ATM is
the primary sensor of DNA damage. If it were a direct sensor of DNA damage, ATM
would be expected to interact directly with the damaged DNA. Addition of dsDNA does
not stimulate ATM protein kinase activity in IP kinase assays [73], although addition of
43

CHAPTER 1
INTRODUCTION
DNA does stimulate the activity of the purified ATM protein under some conditions in
vitro [70, 78]. Purified ATM binds ends of dsDNA in vitro [70], but the affinity of this
interaction is not known. In crude cell extracts, ATM binds preferentially to irradiated
DNA cellulose resin compared to undamaged DNA cellulose suggesting that ATM
interacts with, or is recruited to, damaged DNA [79]. DNA damage also causes a portion
of the total ATM to associate with a chromatin fraction that is resistant to detergent
extraction [80], and serine 1981-phosphorylated ATM localizes to nuclear foci in
response to DNA damage [65]. Together, these studies suggest that ATM may interact
with, or be recruited to, DNA-damaged chromatin. However, these studies, carried out in
intact cells or crude extracts, do not address whether ATM interacts with damaged DNA
directly or indirectly. The MRN complex (composed of Mre11, Rad50, and Nbs1 in
humans, or xrs2 in yeast) fulfills many of the criteria for a DNA damage sensor [81, 82].
Cells that are defective in Mre11 or Nbs1 have many features in common with A-T cells,
including radiosensitivity and cell cycle checkpoint defects. Indeed, mutations in the
human Mre11 gene are responsible for an A-T like disorder (ATLD), which clinically
resembles A-T [83], suggesting that the MRN complex and ATM function in similar
pathways in vivo. Indeed, several recent reports have placed the MRN complex as an
upstream activator of ATM [84, 85]. Autophosphorylation of ATM on serine 1981 is
defective in cells that are compromised for Nbs1 or Mre11 [84, 85], and phosphorylation
of some downstream targets of ATM is partially dependent on a functional MRN
complex [84]. Intriguingly, the nuclease activity of Mre11 is required for activation of
ATM, suggesting that DNA double-strand breaks (DSBs) may require processing prior to
activation of ATM [84]. Also, ATM-mediated phosphorylation of Nbs1 on serine 343
44

CHAPTER 1
INTRODUCTION
occurs at DSBs, suggesting that the proteins co-localize at sites of DNA damage [86].
Together, these studies suggest an attractive model in which (i) the MRN complex binds
directly to damaged DNA, (ii) Mre11 processes the DNA ends, (iii) ATM is recruited and
activated through autophosphorylation and monomerization, and (iv) kinase-active,
monomeric ATM phosphorylates substrates present at, or recruited to, the DSB. Once
activated, ATM may be released from the site of the DSB, enabling phosphorylation of
more distal substrates, such as chromatin-bound histone H2AX. This might account for
the rapid DNA damage-induced phosphorylation of histone H2AX that occurs over
several megabases surrounding the site of a DSB [87]. Indeed, the downstream
checkpoint protein kinase Chk2 is recruited only transiently to sites of DNA damage [86].
It remains to be seen whether this is the only mechanism for activation of ATM by all
DNA-damaging agents, or whether ATM can, under some circumstances, be activated by
direct DNA binding, or by interaction with other DNA-binding partners. A very recent
report suggests that the mediator of DNA damage checkpoint protein, MDC1 (also called
NFBD1), which is known to interact with the MRN complex [88], is required for MRNdependent
activation of ATM at high doses of IR, whereas the p53-binding protein
53BP1 is required for activation of ATM at low doses of IR [89], suggesting that
additional proteins may indeed regulate the activation of ATM. Another fascinating clue
to emerge in recent years is that the BRCA1 protein is required for IR-induced
phosphorylation of some ATM substrates, including p53, c-jun, Nbs1, and Chk2 [90].
BRCA1 is also required for phosphorylation of p53 on serine 15 at later times after DNA
damage in A-T cells, consistent with a requirement of BRCA1 for some ATR-mediated
events [90]. In addition, BRCA1 is required for IR-induced phosphorylation of the
45

CHAPTER 1
INTRODUCTION
structural maintenance of chromosomes protein, SMC1 [91], Chk1 [92], and, is itself a
substrate of ATM[93]. However, BRCA1 is not required for the activation of ATM (as
judged by ATM activity in IP kinase assays) [90]. DNA damage-induced phosphorylation
of histone H2AX and human Rad17 (which recruits the Hus1–Rad1–Rad9 complex) also
do not require the presence of BRCA1 [90]. Together, these studies suggest that BRCA1
acts as a scaffolding protein that makes some, but not all, non-chromatin-associated
substrates accessible to the activated ATM protein [90]. BRCA1 has also been identified
as part of a larger protein complex, BRCA1-associated genome surveillance complex
(BASC), which contains ATM, the mismatch repair proteins MSH2, MSH6, MLH1, the
Bloom syndrome helicase (BLM), the MRN complex, and replication factor C (RFC)
[94], but how BASC functions in the DNA damage response remains to be determined.
BRCA1 contains two carboxy-terminal BRCT repeats, motifs that have been shown
recently to bind phosphoproteins [95-97]. It is, therefore, possible that phosphorylation of
BRCA1 could regulate its association with partner proteins, and thus, further regulate
phosphorylation of BRCA1-associated proteins by ATM. Interestingly, BRCA1 has also
been shown to interact with protein phosphatase 1α [98], providing another possible
mechanism for regulation. Activation of ATM results in the phosphorylation of a plethora
of downstream targets. Some of these proteins are direct substrates of ATM, for example,
ATM likely directly phosphorylates serine 15 of p53 and serine 139 of histone H2AX in
response to DNA damage. Others may be phosphorylated indirectly, through ATMmediated
regulation of other protein kinases, such as Chk1, Chk2 [29, 60], IКB kinase
(IKK) [99], LKB1 [100], c-Abl [101], and the cyclin-dependent protein kinases (cdk1
and cdk2). It was previously thought that ATM signaled directly only to Chk2, while the
46

CHAPTER 1
INTRODUCTION
related protein kinase, ATR, signaled to Chk1. Recent studies, however, have
demonstrated that IR induces ATM-dependent phosphorylation of Chk1 on serine 317
[102] and serine 345 [100], suggesting that ATM and ATR-dependent signaling pathways
could overlap rather than exist in parallel as originally proposed. The most well
characterized cellular response to activation of ATM is activation of G1/S, intra-S, and
G2/M cell cycle checkpoints. However, ATM also plays important roles in other aspects
of the DNA damage response. One of the primary functions of cell cycle arrest may be to
allow the cell more time to repair DNA damage. Thus, activation of ATM-dependent cell
cycle checkpoints would be expected to engage mechanisms for the repair of IR-induced
DNA damage. A very recent study [103], suggests that one way in which this occurs is
via ATM-dependent, Chk2-mediated phosphorylation of BRCA1 on serine 988, and
upregulation of DSB repair via homologous recombination [103, 104]. It is also possible
that ATM-dependent activation of c-Abl [101] and c-Abl-induced phosphorylation of
Rad51 on tyrosine 315 [105], play a role in regulation of DSB repair. c-Abl also
phosphorylates BRCA1 in an ATM-dependent manner [106], while BRCA1 interacts
with BRCA2 which, in turn, interacts with Rad51 [107]. In addition, ATM also
influences DNA damage-induced changes in gene expression through its effects on the
IKK/NF-КB pathway [99] and possibly c-jun [90]. How ATM regulates DNA damageinduced
apoptosis is still uncertain. One possibility is via p53-mediated upregulation of
pro-apoptotic genes, such as Noxa and Puma [108]. Given the importance of ATM in the
cellular response to DSBs, it is perhaps surprising that ATM is not an essential gene in
mammalian cells. This likely reflects the fact that other members of the PIKK family,
such as ATR, DNA-PKcs, or ATX, have similar substrate specificities and may be able to
47

CHAPTER 1
INTRODUCTION
compensate for loss or dysfunction of ATM. However, the inter-relationship between the
various PIKK family members remains to be clarified.
Despite the abundance of physiological substrates of ATM, one of the most
frequently used “read-outs” of ATM activity is the phosphorylation of p53 on serine 15.
IR-induced phosphorylation of p53 is both attenuated and delayed in A-T cells [109].
However, serine 15 phosphorylation of p53 is clearly evident in ATM-deficient cell lines
at later times after exposure to IR, indicating that ATM is required for serine 15
phosphorylation predominantly during the initial phase of the DNA damage response,
and that other serine 15 specific protein kinases, such as ATR, can probably compensate
for the absence of ATM at later times [109]. IR also induces phosphorylation of p53 at
serines 6, 9, 20, 33, 46, 315, and 392, and ATM is required for efficient phosphorylation
on serines 9, 20, and 46, as well as 15 [110]. Indeed, phosphorylation of p53 on serines
20 and 46 is far more dependent on the presence of ATM than is phosphorylation on
serine 15 [110]. Therefore, in studying the requirement for ATM in the cellular response
to a given stressor, the analysis of other ATM-dependent p53 phosphorylation sites, in
particular serines 20 and 46, may be informative. Although p53 is an important target of
ATM, activation of ATM results in the phosphorylation of many other substrates and
regulation of multiple cellular processes. Therefore, analysis of the ATM-dependent
phosphorylation of one substrate cannot provide an accurate picture of the complexity of
a given cellular response. A thorough understanding of the role of ATM will require a
multifactorial approach in which the expression, activity, and phosphorylation of multiple
substrates are analyzed both temporally and spatially. As discussed above, ATM is
predominantly required for the initial response to DNA damage; therefore, time after
48

CHAPTER 1
INTRODUCTION
damage must be an important experimental consideration when examining the potential
role of ATM in a given response. Another important experimental consideration is the
dose of a given DNA-damaging agent used, as alternative or redundant non-ATMdependent
pathways may be engaged at high levels of damage or cellular stress [84, 89].
1.3.2 Cell Cycle Regulation
Once the alarm sensors have set off the alarm, the cell reacts to the damage by
stopping cell cycle progression. This allows the cell to assess the damage and then
accordingly either repair it or undergo apoptosis. The cell cycle is predominantly blocked
at either G 1 -S transition (G 1 -S block) or at the G 2 -M transition (G 2 -M block). Under
normal conditions such transitions are orchestrated by specific cyclins and cyclin
dependent kinases. However, following damage to the DNA, the blocking of the cell
cycle is achieved primarily by p53 and p21 proteins (Fig. 1.3A).
p53
Multicellular organisms elicit a complex response to IR, which is hard to separate from
the fact that they have evolved to have p53 in checkpoint pathways. The checkpoint thus
is not equated with ‘arrest for repair’ that was derived from the extensive studies in yeast.
Instead, an additional cell fate of apoptosis is included in the possible outcomes of cell
fate in higher eukaryotic systems in response to a variety of stress conditions. p53 plays
an important role in the response of IR. It is stabilized in vitro and in vivo after IR. The
level of p53 protein accumulation in response to IR primarily results from the intensity of
DNA damage. Posttranslational modifications of p53 and its interacting proteins
determine its stability and transactivation activity. This stabilization and activation is
important for its roles in inducing growth arrest when reversible, which is coupled with
49

CHAPTER 1
INTRODUCTION
DNA damage repair to protect cells from the IR damage. Apoptosis occurs in response to
a high dose of IR when the damage is irreparable, in order to eliminate the damaged cells.
The mechanism by which p53 mediates cell cycle arrest and apoptosis is largely mediated
through its target genes, although some transcriptional-independent phenomena have
been reported in other systems [111]. The dosage of IR predominantly contributes to the
outcomes of cell fate, either survival or death. The role of p53 in DSB repair may involve
p53 directly. The role(s) of p53 in the S phase arrest/delay are elusive.
Fig. 1.3A: Regulation of Cell Cycle by p53 and p21. Following DNA damage, blocking
of the cell cycle is orchestrated by p53 along with p21.
50

CHAPTER 1
INTRODUCTION
At the present, much insight is being gained regarding the roles of p53 in DSB repair.
Further studies on p53 functioning as the switch from reversible arrest to triggering
apoptosis may offer a greater understanding of radioresistance and radiosensitivity [111].
p21
p21 Waf1/Cip1/Sdi1 is the first identified inhibitor of cyclin/cyclin-dependent kinase (CDK)
complexes, which regulate transitions between different phases of the cell cycle. p21 was
independently isolated as a CDK-binding protein and as a growth-inhibitory gene which
is upregulated by wild-type p53 [112] or overexpressed in senescent fibroblasts [113].
Although many other CDK inhibitors have since been discovered [114], p21 appears to
be the only inhibitor capable of interacting with essentially all of the CDK complexes.
The effects of p21 on CDKs, however, are not limited to simple binding and inhibition.
For example, p21 binding, depending on its stoichiometry, may not only inhibit but also
stimulate CDK4/6 complexes [115]. On the other hand, p21 affinity towards
CDC2/CDK1 (the primary regulator of cellular entry into mitosis) is low, suggesting that
p21 may not bind CDC2 under physiological conditions [116]. Nevertheless, p21
expression efficiently inhibits CDC2 in vivo; this effect appears to be mediated at least in
part through the interference with the activating phosphorylation of CDC2 at Thr 161 [117,
118].
The first transcriptional target of p53 identified was the Cdk inhibitor p21. That p53
transactivation of p21 does not necessarily yield increased p21 protein levels is another
important aspect of the study described by Jascur et al. [119]. DNA damage by ionising
radiation results in stabilization of wild-type p53 and subsequent transcriptional
51

CHAPTER 1
INTRODUCTION
activation of p21. However, p21 protein levels are not increased when WISp39 is
downmodulated with siRNA or Hsp90 is inhibited with the drug geldanamycin following
DNA damage. This exciting observation suggests that p21 levels are increased
transcriptionally by p53 and at the level of protein stability by WISp39 and Hsp90
suggesting that two events are required to stabilize p21. Counterintuitive to the role of
p21 in cell cycle arrest, p21 has also been implicated as a positive regulator of cell
survival. For example, loss of p21 sensitizes cells to undergo uncoordinated DNA
replication and death induced by anticancer drugs [120].
1.3.3 DNA Repair
Following cell cycle arrest and triggering of the alarm sensors, many DNA repair
pathways are activated to repair the damaged DNA. The five major DNA repair pathways
are homologous recombination repair (HRR); non-homologous end joining (NHEJ);
nucleotide excision repair (NER); base excision repair (BER); and mismatch repair
(MMR)[121].
1.3.3.1 DNA double strand break repair
DNA double-strand breaks (DSBs) are a common form of DNA damage and DSB
rejoining is a fundamental mechanism of genome protection. Breaks arise through direct
action of ionizing radiation or some chemicals, and indirectly as a product of blocked
replication forks. The ability to repair DSBs and to ensure that repair is performed with
appropriate fidelity is a fundamental part of genome protection. The three known DSB
repair pathways are outlined in Fig. 1.3B. The pathways are conserved between
Saccharomyces cerevisiae and mammalian cells although the relative importance in each
differs considerably. The prevailing view has been that homologous recombination is the
52

CHAPTER 1
INTRODUCTION
predominant pathway of DSB repair in yeast whereas mammalian cells presented with
similar substrates use non-homologous or illegitimate pathways. This still seems to be the
consensus although there is mounting evidence that DSB repair via homologous
recombination in mammalian cells is more significant than was previously thought [122,
123]. In addition, there are indications that some proteins may participate in more than
one of the three repair pathways.
Fig. 1.3B Pathways of DSB repair. The termini of a DNA DSB introduced by ionising
radiation or other means are bound either by the Ku heterodimer/DNA-PKcs complex or
by hRad52. In the NHEJ rejoining pathway, repair is completed by DNA ligase IV and
XRCC4. DNA strand invasion of the intact sister chromatid, facilitated by hRad51,
initiates repair by homologous recombination. Resection and annealing of short regions
of complementary sequence initiates repair by the SSA pathway in which ligation is
preceded by the trimming of non-complementary single-stranded DNA tails.
53

CHAPTER 1
INTRODUCTION
Non-homologous end rejoining
Non-homologous end rejoining (NHEJ) has been considered the major pathway of DSB
repair in mammalian cells (Fig. 1.3B). Repair is achieved without the need for extensive
homology between the DNA ends to be joined. NHEJ processes the site-specific DSBs
introduced during V(D)J (variable [division] joining) recombination and its importance is
emphasised by the severe combined immune deficiency (SCID) and ionizing radiation
sensitivity of mice with NHEJ defects. NHEJ involves a DNA end-binding heterodimer
of the Ku70 and Ku80 proteins which activates the catalytic subunit (DNA-PKcs) of
DNA-dependent protein kinase (DNA-PK) by stabilizing its interaction with DNA ends.
This facilitates rejoining by a DNA ligase IV/Xrcc4 (X-ray cross-complementing 4)
heterodimer [15]. The presence of constitutively high steady-state levels of DNA-PK is
consistent with a role as a primary DNA damage recognition factor. The family of
kinases to which DNA-PKcs belongs contains the important ATM (ataxia telangiectasia
mutated) and ATR (ataxia telangiectasia Rad3-related) signalling proteins. All three
proteins are serine/ threonine protein kinases which have some sequence similarity to
phosphatidylinositol kinases. DNA-PK can phosphorylate p53 but the p53 response is
apparently intact in DNA-PK-defective mouse cells which express wild-type p53 [124].
These rules out DNA-PK as an essential requirement for activation of the p53 DNA
damage response. Other plausible targets for DNA-PK include the single stranded
binding protein RPA (replication protein A), the DNA ligase IV cofactor Xrcc4, Ku, and
DNA-PKcs itself. It is noteworthy that, although the stimulation of DNA ligase IV
activity by phosphorylated and unphosphorylated forms of Xrcc4 is similar,
phosphorylation of Xrcc4 may prevent its direct association with DNA [125]. This could
54

CHAPTER 1
INTRODUCTION
provide a means to regulate rejoining by modulating the interactions among Xrcc4, DNA
and DNA ligase IV. Both Ku subunits and DNA-PKcs are essential for repair by NHEJ
although defects in DNA-PKcs generally confer a milder phenotype than defects in Ku.
DNA-PK activity is undetectable in Ku-defective cell lines, indicating that DNA binding
by the Ku70:80 heterodimer is essential for its activation. The carboxy-terminal portion
of Ku80 is also important for DNA-PK function and distinct regions are responsible for
Ku70 interaction and DNA-PKcs activation. Deletion of the carboxy-terminal region of
Chinese hamster Ku80 imparts a phenotype similar to DNA-PK deficiency even when
high levels of DNA-PKcs are present[126]. The requirement for this carboxy-terminal
region in kinase activation is consistent with the absence of an analogous Ku80 carboxyterminal
tail in S. cerevisiae which also lack a homologous DNA-PKcs protein. The
molecular architecture of DNA-PKcs suggests a structural role for the protein in the
rejoining process. It has a potential DNA-binding groove and an enclosed cavity with
three apertures through which single-stranded DNA could pass [68]. These findings are
consistent with DNA-PKcs mediating the alignment of short stretches of single stranded
DNA prior to ligation. This would be in addition to any role of DNA-PK in signaling.
Repair by NHEJ is completed by the DNA ligase IV/Xrcc4 complex. Mice with targeted
inactivation of either component exhibit embryonic lethality [127-129]. Consistent with
their joint participation in the NHEJ pathway, the sensitivity of DNA ligase IV or Xrcc4
knockout mouse cells to ionizing radiation, and their defects in V(D)J recombination
mimic those of Ku null mice. As Ku and DNA-PKcs deficient mice are viable, however,
there appears to be an additional requirement for DNA ligase IV and Xrcc4 during
embryonic development. Reduced NHEJ activity may confer radiosensitivity in the
55

CHAPTER 1
INTRODUCTION
absence of overt defects in immune function. Radiation sensitivity and a modest defect in
DSB repair, but no significant impairment in V(D)J recombination, are associated with a
mutated DNA ligase IV in cells from a radiation-sensitive leukaemia patient [130]. The
absence of a detectable effect on V(D)J recombination indicates that an alternative DNArejoining
activity might partially substitute for defective Xrcc4/DNA ligase IV in these
cells. The occurrence of a DNA ligase IV defect in a leukaemia patient suggests that
reduced NHEJ might be a factor in the incidence of this disease.
Homologous recombination
S. cerevisiae has provided a useful model for homology directed recombination (HR)
processes. HR is performed by the RAD52 epistasis group of proteins which includes the
products of RAD50–55, RAD57, and RAD59, MRE11 and XRS2 [131]. Although
mammalian cells are considered to rely less on HR, they do perform mitotic
recombination and preferentially repair DSBs by HR in late S and G2 phases of the cell
cycle when an undamaged sister chromatid is available. Indeed, the DSB repair defect of
murine scid (severe combined immunodeficiency) cells is only apparent in G1/early S
phases [132]. The mammalian Rad51 protein is a homolog of the Escherichia coli RecA
protein and is involved in both meiotic and mitotic recombination. The S. cerevisiae and
human Rad51 proteins catalyse strand exchange in a reaction which is stimulated by
Rad52 and RPA [133, 134]. Human Rad52 has a DNA double-strand end binding activity
like Ku [135] and it probably co-operates with hRad51 in DSB repair but this is unlikely
to be the only important function of Rad51. Targeted inactivation of mRad51 results in
early embryonic lethality [136] whereas Rad52–/– mice are viable and fertile [137].
Rad52–/– murine stem cells, although deficient in recombination, are not detectably
56

CHAPTER 1
INTRODUCTION
hypersensitive to the presence of DSBs. Animals which are null for a third member of the
RAD52 family, mRad54, are also viable and fertile but, in this case, their cells are
hypersensitive to DSB-inducing agents [138]. Unraveling the biochemical functions of
these mammalian RAD52 family members — and defining the essential functions of the
Rad51 and Rad54 proteins — is clearly a high priority. At present, it is clear that they are
not functionally identical to their yeast counterparts. Human Rad51 forms discrete foci in
the nuclei of cells exposed to ionising radiation (but not UV) or chemicals. In rodents,
DNA damage-induced mRad51 focus formation requires mRad54 [139]. As both
mRad51 and mRad54 null cells are sensitive to ionising radiation, the direct participation
of mRad54 and mRad51 in DSB repair is implied. Human cells are known to express two
other Rad51-related proteins — Xrcc2 and Xrcc3 — both of which interact with Rad51
and influence DSB repair by HR [140, 141]. Confusingly, although mRad54-null and
Xrcc3-deficient cells are both sensitive to ionising radiation, only the latter are crosssensitive
to UV light. An important recent development has been the realization that the
products of the human breast cancer susceptibility genes BRCA1 and BRCA2 are involved
in DNA repair. In fact, the carboxy-terminal region (BRCT domain) of these proteins
defines a common motif among DNA-repair proteins [142]. Loss of functional Brca1
results in sensitivity (albeit slight) to radiation and DNA-damaging chemicals [143, 144].
A fraction of hRad51 colocalises with Brca1 and Brca2 in mitotic cells. Following DNA
damage, the three proteins are relocated to structures which also contain PCNA
(proliferating cell nuclear antigen) and may represent sites of active repair [145]. Both
Brca2–/– and Brca1–/– mouse fibroblasts develop spontaneous chromosome aberrations
consistent with the participation of these proteins in the repair of spontaneous DSBs
57

CHAPTER 1
INTRODUCTION
[146]. Brca1 is phosphorylated by the ATM protein [144]. ATM, which is mutated in the
radiationsensitive disorder ataxia-telangiectasia, is a candidate primary sensor of certain
types of DNA damage, particularly DSBs induced by ionizing radiation. Brca1 in
therefore a target for a key protein which signals the response to ionizing radiation.
Brca2–/– cells are also sensitive to DNA-damaging agents, although, curiously, display a
much more pronounced sensitivity to UV than to g-radiation. In addition, the massive
sensitization to mitomycin C which accompanies loss of Xrcc2 or Xrcc3 is not seen in the
Brca2–/– cells [146]. The likely involvement of Brca1 in HR, which is suggested by its
association with mRad51, is supported by the observation that there is relatively more
DSB repair by non-homologous pathways in Brca1–/– cells [123]. This is unlikely to be
the full story, however, because Brca1 also displays a DNA-damage-dependent
association with the hRad50/Mre11/Nbs1 complex [147]. This important tumor
suppressor therefore appears to participate in the two pathways of DSB repair.
Brca1 is also implicated in the removal of oxidized DNA bases from DNA. Damage is
selectively removed from the transcribed DNA strand by a process known as
transcription-coupled repair (TCR). Brca1-null cells are deficient in the TCR of DNA
thymine glycol produced by ionizing radiation or hydrogen peroxide but perform TCR of
UV induced DNA damage normally [143, 148]. It is unclear whether Brca1 participates
directly in TCR or indirectly via a signaling role. The involvement of Brca1 suggests that
the TCR of oxidized bases may represent a form of recombinational repair.
Cellular signaling functions and DSB repair
Many of the participants in DSB repair — including hMRE11, hRad50, DNA-PK, Ku
and Xrcc4 — are phosphoproteins. Brca1 and Brca2 are both phosphorylated in a cell-
58

CHAPTER 1
INTRODUCTION
cycle-specific fashion and the former is a target for the ATM protein kinase [144]. ATM
and the tyrosine kinase c- Abl protein appear to be central to the control of DSB repair.
The c-Abl protein is itself activated by phosphorylation. This appears to be achieved by
its interaction with the ATM protein [149]. Human Rad51 is phosphorylated by c-Abl,
possibly via the formation of a tripartite complex with the ATM protein [105]]. ATM/c-
Abl-dependent phosphorylation promotes the interaction between hRad51 and hRad52,
suggesting that the HR recombination repair pathway is subject, at least in part, to fine
control by these interactions. c-Abl is also implicated in activation of c-Jun aminoterminal
kinase. Significantly, this activation is impaired in Nbs1 (and hMre11) as well as
ATM-defective human cells. The ATM protein is implicated in the p53-related DNA
damage response. p53 plays a crucial role in determining the fate of cells in which DSBs
persist. In particular, the embryonic lethality of both the Rad51 null [136] and Brca1 null
[148] animals is attenuated in a p53–/– background and some double knockout animals
survive to full term. This suggests that the massive failure of cellular proliferation, which
is a feature of Rad51–/– and Brca1–/– embryos, is to some degree a direct consequence
of an active p53. Put another way, cells which fail to repair DSBs by the Rad51- and
Brca1-dependent HR pathways die in a p53-dependent fashion. Promoting the deletion of
cells which might otherwise perform mutation-prone DSB repair may be a facet of p53’s
role as ‘guardian of the genome’.
1.3.3.2Single strand DNA repair
Nucleotide excision repair (NER) repairs DNA with helix-distorting damages, including
the damages of cyclobutane pyrimidine dimers and 6–4 photoproducts produced by UV
light, and adducts produced by the chemotherapeutic agents cisplatin and 4-
59

CHAPTER 1
INTRODUCTION
nitroquinoline oxide [150, 151]. About 30 polypeptides are involved in NER, and the
NER process has been reconstituted with purified components [150].
Key steps of NER include: (i) recognition of a DNA defect; (ii) recruitment of a repair
complex; (iii) preparation of the DNA for repair through action of helicases; (iv) incision
of the damaged strand on each side of the damage, with release of the damage in a singlestrand
fragment about 24–32 nucleotides long; (v) filling in of the gap by repair
synthesis; (vi) ligation to form the final phosphodiester bond [151, 152].
Base excision repair (BER) is a major DNA repair pathway protecting mammalian cells
against single-base DNA damage caused by methylating and oxidizing agents, other
genotoxicants, and a large number (about 10,000 per cell per day) of spontaneous
depurinations [153]. BER is mediated through at least two subpathways, one involving
single nucleotide BER and the other involving longer patch BER of 2–15 nucleotides.
A highly conserved set of MMR proteins in humans is primarily responsible for the postreplication
correction of nucleotide mispairs and extra-helical loops. Mutational defects
in MMR genes in humans give rise to a mutator phenotype, microsatellite instability, and
a predisposition to cancer. Mouse embryonic fibroblast and human epithelial cell lines
lacking the MMR protein, MLH1, are more resistant than wild-type cells to two inducers
of oxidative stress, hydrogen peroxide and tert-butyl hydroperoxide [154]. Analysis of
this resistance indicates that it results from a defect in apoptosis, as the consequence of a
requirement for wild-type MLH1 in the transduction of apoptotic signals by a
mitochondrial pathway, although the details of this pathway are currently unknown.
60

CHAPTER 1
INTRODUCTION
1.4 Overview of Radiation induced cell signaling
Exposure of cells to ionizing radiation results in complex cellular responses resulting in
cell death and altered proliferation states. The underlying cytotoxic, cytoprotective and
cellular stress responses to radiation are mediated by existing signaling pathways,
activation of which may be amplified by intrinsic cellular radical production systems.
These signaling responses include the activation of plasma membrane receptors, the
stimulation of cytoplasmic protein kinases, transcriptional activation, and altered cell
cycle regulation. There is increasing evidence for the functional links between cellular
signal transduction responses and DNA damage recognition and repair, cell survival, or
cell death through apoptosis or reproductive mechanisms.
Recent radiobiological studies have demonstrated that the exposure of
mammalian cells to ionizing radiation over a wide dose range results in activation of
existing cellular response pathways. These pathways, dominantly involving protein
kinases, mediate the cytoprotective and cytotoxic responses of cell survival and cell
death, respectively. Cytoprotective responses involve pathways of the mitogen activated
protein kinase (MAPK) and phosphatidyl inositol- 3-phosphate kinase (PI3 kinase)
cascades which activate the machinery of biosynthesis and may stimulate cell
proliferation if radiation-induced damage is successfully repaired. The most direct
consequence of cytotoxic or stress responses is thought to involve Jun N-terminal kinase
(JNK, now known as MAPK8) and results in apoptosis and/or other forms of cell death.
Although general statements may be premature, current data suggest that cells of the
hematopoietic lineage and fibroblasts or other normal cells are substantially more prone
to undergo radiation-induced apoptosis than many carcinoma cells.
61

CHAPTER 1
INTRODUCTION
The goal of this chapter is to describe the complexity of the responses of cells to
exposure to ionizing radiation. Links between the mechanisms of various sensors of
radiation effects and the activation of major cellular response pathways will be
emphasized where possible (Fig. 1.4). The response networks include cytokines and
plasma membrane receptors, effector protein kinases, and phosphatases in the cytoplasm
or at the interfaces of plasma membrane and nucleus. The extent of radiation-induced
changes in proteins, lipids and nucleic acids, the latter recognized by defined proteins as
DNA damage, is likely to determine the relative balance between plasma membrane
events, mitochondrial reactions, and nuclear responses
EFFECT OF IONIZING RADIATION
ON CELLULAR RESPONSE SYSTEM
RADIATION SENSOR/ROS, RNS AMPLIFIER
SIGNAL TRANSDUCTION
CELL CYCLE
CONTROL
CYTOPROTECTIVE
SURVIVAL
CYTOTOXICITY
DEATH: APOPTOSIS/
REPRODUCTIVE DEATH
FIG. 1.4 Effects of ionizing radiation on cellular response systems. Radiation effects are
mediated through the interaction of radicals and reactive oxygen and nitrogen species
(ROS/RNS), with proteins, lipids and nucleic acids; these radicals may be generated from primary
ionization events or through secondary amplification systems. Biological molecules that are
modified by radicals and generate or transmit intracellular signals are components of existing
cellular signal transduction pathways. Effectors of these systems are linked to cell cycle
regulation and DNA repair, which determine the ultimate fate of cells exposed to radiation.
62

CHAPTER 1
INTRODUCTION
1.4.1 Radiation induced radicals:
In studies of the responses of cells to radiation, it is unclear how a few ionization events,
2000 per gray per cell, can induce the rapid and robust activation of diverse signal
transduction pathways [155]. Recent evidence suggests that cells are endowed with
cytoplasmic amplification mechanisms involving reactive oxygen (ROS) and nitrogen
(RNS) species and that these systems are responsive to relatively low radiation doses.
The primary radical generated as a consequence of initial ionization events is the
. OH, which is short-lived and only diffuses about 4 nm before reacting [156]. Of the
secondary ROS, O - 2 and H 2 O 2 , the latter can react via Fenton chemistry with cellular
metal ions to produce additional . OH. Since the amounts of secondary ROS generated
after irradiation are considerably lower than those produced by normal cell metabolism, it
is unlikely that they contribute significantly to a potential amplification process [155].
Less information is available about RNS that may also be produced after irradiation and
may be a consequence of radiation-induced stimulation of nitric oxide synthase activity in
cells enriched in this enzyme [157]. Reaction of nitric oxide with O 2
-
results in the
formation of peroxynitrite, a membrane-permeant and relatively stable RNS. When
protonated, peroxynitrite isomerizes to trans-peroxynitrous acid, which can cause protein
and DNA damage similar to . OH [158].
Cellular Amplification of Radiation-Induced Generation of ROS/RNS
Indirect evidence for an extranuclear radical amplification mechanism has come from
studies with high-LET particles. For example, bone marrow progenitor cells exposed to
neutrons show both an enhanced ability to oxidize a fluorescent probe for ROS/RNS and
increased 8-hydroxy- 2-deoxyguanosine levels indicative of oxidative DNA base damage
63

CHAPTER 1
INTRODUCTION
[159]. Direct evidence for cytoplasmic ionization events affecting nuclear processes has
come from studies in which individual cells were irradiated with a microbeam of particles
that permitted selective irradiation of the cytoplasm or nucleus. Irradiation of the
cytoplasm was shown to be mutagenic but not cytotoxic [160]. The major class of
mutations was similar to that generated spontaneously and thought to arise from DNA
damage due to endogenous production of ROS/RNS [161] and differed from that induced
after irradiation of the nucleus.
Studies with fluorescent dyes demonstrated generation of ROS/RNS in cells
within 15 min after irradiation with less than one a particle per cell [162]. The
intracellular production of ROS/RNS was 50-fold greater than the extracellular
production. The intracellular source was inhibited by diphenyliodonium, an inhibitor of
flavoproteins, suggesting the involvement of a plasma membrane NADPH oxidase.
However, flavoproteins are also localized to the mitochondria and endoplasmic
reticulum, possible alternative cellular organelles that generate ROS/RNS. Enhanced
cellular production of ROS/RNS has also been observed after exposure to low-LET
radiation [163]. Cobalt- 60 γ-irradiation, at 1–4 Gy, stimulated production of ROS/RNS
in HepG2 cells and depletion of GSH, which radiosensitized cells due to enhanced radical
generation. These studies do not discriminate between possible signal-amplifying
mechanisms or an irreversible mitochondrial permeability transition as a late
consequence of radiation exposure.
Consequences of Radiation-Induced Generation of ROS/RNS
Some ROS/RNS, e.g. H 2 O 2 , nitric oxide and peroxynitrite, are membrane-permeant and
are sufficiently stable to diffuse significant distances within cells, facilitating their
64

CHAPTER 1
INTRODUCTION
interaction with biological molecules, including proteins, lipids and DNA. Of particular
interest for regulation of cytoplasmic signal transduction pathways are proteins SH
residues. The interconversion of oxidized and reduced Cys represents a reversible
controlling element in the regulation of protein functions [164]. For example, H 2 O 2 or
more reactive ROS have been shown to reversibly oxidize a Cys to a cysteine sulfenic
acid in the catalytic site of Tyr phosphatase 1B, resulting in transient inhibition of
phosphatase activity. A possible consequence of this is the enhanced phosphorylation and
activation of target proteins, such as EGFR (also known as ErbB1) [165, 166]. Similarly,
nitric oxide stimulates guanine nucleotide exchange on RAS by S-nitrosylation of a
critical Cys [167].
Irradiation of cells induces lipid peroxidation and changes in membrane structure
in intact cells [168]. How these structural changes modulate membrane function, e.g.
activation of EGFR, and the cellular response to radiation currently are not known.
However, they provide potential mechanisms, through free radical propagation or
changes in membrane fluidity, for the amplification of localized perturbations of the
membrane structure to signals throughout the cell.
1.4.2 Cytokines and Plasma Membrane Receptors
Ionizing radiation activates cytokine receptors, such as EGFR [169] and tumor necrosis
factor receptor (TNFRSF1A, formerly known as TNFR)[170], with consequences
currently indistinguishable from the effects of the physiological cytokine/growth factor
ligands. The downstream effects of receptor activation are the initiation and amplification
of signals along growth and stress pathways, involving MAPK, PI3 kinase and MAPK8,
resulting in modulation of the proliferation and survival states of cells [170, 171].
65

CHAPTER 1
INTRODUCTION
Cytoprotective Response Cascade
The term cytoprotective describes the summation of responses which favor cell survival
and may span from enhanced repair functions to stimulation of proliferation. These
responses may be initiated at the level of the plasma membrane through activation of
ERBB receptor tyrosine kinases and other related molecules [172]. Several lines of
investigation support that the loss of EGFR/ERBB2 function radiosensitizes tumor cells
[172-174].
The radiation-induced activation of EGFR has been linked mechanistically to
enhanced signaling through critical components of the MAPK and MAPK8 pathways
[172, 175]. These links are based on inhibition of the function of EGFR by over
expression of dominant-negative mutants [173, 176] or the use of specific
pharmacological inhibitors, such as the tyrphostin AG1478 [172]. The disruption of
function of ERBB2 may exert similar effects. The radiation-induced activation of EGFR
at doses between 1 and 5 Gy [169] results in the activation of several immediate
downstream effectors. Tyr phosphorylation of EGFR at positions Tyr1068, Tyr1148 and
Tyr1173 (30) permits interaction with adapter proteins GRB2 and SHC, which in turn act
through factors to stimulate GTP for GDP exchange in RAS. Radiation-induced
activation of EGFR also results in the stimulation of PLCγ with production of
diacylglyceride and inositol trisphosphate (IP3)[172, 177]. Diacylglyceride activates
protein kinase C (PRKC) and IP3 induces release of Ca 2+ from intracellular stores [172,
178, 179]. RAS-GTP recruits RAF1 to the plasma membrane; this activation is dependent
on the release of Ca 2+ from intracellular stores [177, 178, 180]. RAF1 primarily signals
along the MAPK cascade involving MAP2K1/2 and p90S6 kinase [180]. MAPK and
66

CHAPTER 1
INTRODUCTION
p90S6 kinase regulate diverse targets in cells including transcription factors [181, 182].
RAF1 has also been shown to phosphorylate the antiapoptosis protein BCL2, a
modification that may counteract the anti-apoptosis function of BCL2 [183]. The
importance of RAS lies in its potential cross-communication into the MAPK8 pathway
[173], and the critical role of MAPK as downstream effector of EGFR is demonstrated by
the finding that inhibition of MAPK by PD98059 [173, 184, 185] disrupts the
cytoprotective response against radiation. Also in line with these conclusions are the
findings that both the inhibition of RAS function through inhibition of prenylation [186]
and the down-regulation of RAF1 with antisense-RAF oligonucleotides [187] result in
radiosensitization of human tumor cells.
Increased signaling through the MAPK pathway is cytoprotective after exposure
to radiation, although the precise mechanism(s) by which this occurs is unclear [172, 175,
184, 185]. There is new evidence that the regulatory functions of MAPK on cell
proliferation compared to differentiation vary with cell type and depend on the magnitude
and duration of MAPK activation [188-191]. A short activation of MAPK correlated with
increased proliferation, potentially through coordinated expression induction of cyclin D1
and the cyclin-dependent kinase (CDK) inhibitor CDKN1A (formerly known as p21)
[188, 190, 191]. In contrast, prolonged stimulation of MAPK activity was linked to
decreased DNA synthesis, potentially through super-induction of CDKN1A [188, 189].
This establishes MAPK as an important target for both radiation- and growth factorinduced
activation of EGFR and transient increases in CDKN1A protein levels [184,
192]. High levels of CDKN1A expression would potentially lead to growth arrest at the
G1/S- and G2/ M-phase boundaries, as has been reported for cells exposed to radiation
67

CHAPTER 1
INTRODUCTION
[193]. Since the activation of EGFR and MAPK occurs in cells expressing wild-type or
mutant TP53 (formerly known as p53), these responses are not necessarily independent
of TP53. Collectively, these studies provide strong evidence that radiation-induced
signaling of MAPK through CDKN1A modulates cell cycle progression and cell
radiosensitivity.
Irradiated cells, in which the activation of MAPK is inhibited, remain arrested in
the G2/M phase of the cell cycle [185]. This arrest is associated with increased Tyr15
phosphorylation of CDK1 and its reduced activity [194, 195]. The prolonged arrest
correlates closely with the previously observed MAPK-dependent enhancement of
radiation-induced apoptosis. Removal of MAP2K1/2 inhibitors or caffeine treatment of
cells 6 h after irradiation abrogates the effects of MAPK inhibition on radiation-induced
G2/Mphase arrest and potentiates apoptosis [185].
Activation of ERBB receptor tyrosine kinases can also enhance PI3 kinase
activity. This kinase plays a critical role in protecting cells from apoptosis during growth
factor deprivation [196], and may fulfill an important cytoprotective function after
irradiation. Downstream of PI3 kinase, an IP3-activated protein kinase termed 3-
phosphoinositide- dependent protein kinase (PDK1/2) has been identified [197]. PDK1/2
phosphorylates and activates the protein kinase AKT. Targets of AKT include glycogen
synthase kinase 3 (GSK3A) and p70S6 kinase [196] regulating transcription factor
function and protein synthesis, respectively.
Cytotoxic Response Pathway
The cytotoxic pathway summarizes responses of cells to a variety of stresses, including
radiation. Two forms of the tumor necrosis factor-a receptor have been characterized as
68

CHAPTER 1
INTRODUCTION
CD4 (formerly known as p55) and TNFRSF1B (formerly known as p75); only CD4
contains a domain which can directly signal the caspase cascade that leads to apoptosis
[198]. Both receptors can activate the lipid-cleaving enzyme acid sphingomyelinase
(ASMase) with the production of ceramide. Ceramide, through the family of GTPbinding
molecules RHO/RAC and RAS, leads to the activation of downstream signaling
molecules MEKK1/2, which are analogous to RAF1 in the MAPK pathway. Active
MEKK1 in turn can phosphorylate and activate MAP2K4/7 and MAP2K3/6. These
molecules share considerable sequence similarity to MAP2K in the MAPK pathway.
MAP2K4/7 [199] signals to MAPK8, which phosphorylates the transcription factor JUN,
and has been shown to facilitate apoptosis in certain cell types. For example, in several
studies using cells of hematopoietic lineage, enhanced MAPK8 signaling has been
closely associated with apoptosis in response to cytotoxic stimuli [200-202]. In other
nonhematopoietic cells, such as carcinoma cells, increased MAPK8 signaling can result
in increased proliferation and protection from radiation and other cytotoxic stresses [203,
204]. Thus the precise role of MAPK8 activation in response to exposure of cells to
radiation may vary substantially with the cell type analyzed. Alternatively, MAP2K3/6
may signal along a rescue pathway involving MAPK1 (formerly known as p38)
reactivating kinase, which facilitates phosphorylation of heat-shock proteins and cell
survival.
Although much research has been done on low LET induced signaling, there have been
few sporadic and diverse studies with high LET radiation.
69

CHAPTER 1
INTRODUCTION
1.5 Charged particle irradiation induced Signaling
Apart from X-rays, biological effects from particulate radiation are of immense interest
due to their use in treatment of certain solid tumors and also due to their abundance in
space. High LET radiations, such as heavy ions or neutrons, have an increased biological
effectiveness compared to X-rays for gene mutation, genomic instability and
carcinogenesis. The amount of induction of DSBs is weakly dependent on LET of the
radiation [205]. However, the degree of lesion complexity increases with increasing LET
[206]. There has been a consensus about the clustering of damage in case of high LET
radiation along individual radiation tracks crossing the DNA
The extensive studies using synthetic clustered DNA lesions have largely contributed to
our understanding of the biological consequences of clustered lesions in cells or tissues.
Clustered damage sites are of large diversity, they are processed differently depending on
the nature of the base modification, the inter lesion spacing, the presence or not of strand
breaks. The expected biological consequences range from point mutations and loss of
genetic material to cellular lethality due to repair impairment and lesion or repairintermediate
persistency (Fig. 1.5) In fact, the deleterious effect of repair intermediates
may be amplified at replication and cause cell killing. Tandem lesions have been isolated
and have been shown to be poorly repaired or by-passed by DNA polymerases, and may
be lethal lesions. Bistranded AP sites are more likely to result in DSBs, the outcome of
which will depend on the presence of damage bases around the DSB, and subsequent
deletions have been observed in human cells. The repair of bistranded oxidized bases is
mostly impaired, causing a point mutation at the unrepaired damaged base. DSBs are
unlikely to be formed by BER at these clusters, but may occur at replication forks if the
70

CHAPTER 1
INTRODUCTION
unrepaired damage is a block to replication as is the case for thymidine glycol or an AP
site. Homologous recombination or single strand annealing will overcome the collapse of
the replication fork and may produce deletions. Importantly, the cell will survive with
mutations or loss of genetic material. The more complex the non-DSB cluster (i.e. several
oxidized base damages or SSB/gap), the more complex the subsequent mutations. The
presence of two or more base substitutions or ±1 insertions/deletions can be considered
the signature of complex non-DSB clusters. The repair of complex DSBs, either formed
by the radiation track or originating from “repair” of non-DSB clusters, is likely
compromised and very slow, potentially forming large deletions. Lethal events may be
expected from such lesions, even though this has not yet been demonstrated.
Fig.1.5. Biological consequences of clustered DNA damage in eukaryotes. Clustered damage in
the form of non-DSB bistranded lesions, tandem lesions or complex DSBs can consist of AP sites
(A), SSBs or base damage (O is 8-oxoG, fU is 5-formyluracil, hU is 5-hydroxyuracil, and FA is
formylamine). Two opposing AP sites can be converted to a DSB and hence complex DSBs can
be formed either directly by the DNA damaging agent or by abortive BER. Complex DSBs can
decrease the efficiency of NHEJ and be inaccurately repaired. Lesions of high complexity can
result in mutagenesis: DSBs are not formed due to inhibition of repair enzymes by near-by
damage. Tandem lesions can block DNA replication, but can also be mutagenic as found for
bistranded lesions consisting of base damage. Partial processing of these latter two types of
lesions could also result in persistent SSBs. Clustered lesions can therefore be mutagenic, result
in DSBs and inaccurate repair, or block replication, and could be cytotoxic to the eukaryote cell.
71

CHAPTER 1
INTRODUCTION
Early observations showed that densely ionizing radiation like high LET radiation was
more cytotoxic than sparsely ionizing radiation and it was anticipated that a greater
proportion of non-repairable strand breaks originating from clustered lesions was
responsible for the increased biological effectiveness of densely ionizing radiation.
Larger proportions of DSBs remain unrejoined after exposure to high LET radiation than
after exposure to sparsely ionizing radiation, and chromosomal damage is more severe
and complex. The frequency of chromosome breaks and of complex rearrangements
increases up to a LET of 100–150 keV/µm and seems to plateau at higher LETs. In most
cellular systems examined but not all, high LET radiation is observed to generate larger
deletions (over Mbp size). A high frequency of complex deletion events and complex
rearrangements at deletion junctions have been observed with high LET radiation and
have not been reported for low LET radiation [207-209]. Notably, an unusually high
proportion of radon-induced mutants exhibited two or more base substitutions and
insertions/deletions within 3–14 bp at the HPRT locus in T lymphocytes and this has
been suggested as a signature of exposure to densely ionizing radiation [210]. The
carcinogenic potential of high LET radiation has also been proven. In addition, exposures
to densely ionizing radiation have been shown to lead to a persistent, transmissible
genomic instability in a variety of biological systems. With regard to DNA repair, it has
recently been shown that DNA-PKcs participates in the repair of some frank DSBs and
some non-DSB clustered damages that are converted into DSB by replication in tumor
cells exposed to high LET radiation [211]. In addition, intact homologous recombination
is also required to ensure DNA repair and cell survival after exposure to high-energy iron
ions [212]. It appears that the biological features specific to high LET radiation do relate
72

CHAPTER 1
INTRODUCTION
well to the known processing of the clustered lesions examined. We still need to
reconstitute the path leading to complex large deletions.
Radiation exposure has been associated with risk of diseases and in particular cancer. On
the other hand, radiotherapy for cancer treatment is used advantageously for about 70%
of cancer patients. The clinical applications of high LET radiation have a long history.
High LET radiotherapy is increasing worldwide, with respect to proton therapy and
hadron therapy, even though a complete understanding of the mechanisms underlying the
biological action has not yet been determined. An important feature of high LET
radiation which can be anticipated from studies on clustered DNA lesions is the increase
of point mutations and clusters of mutations at non-DSB clusters. If a tumor suppressor
gene is thus inactivated in normal tissue located near the irradiated tumor and hit by the
beam, it may be a step towards the development of a secondary, radio-induced cancer.
This situation would particularly apply to proliferating tissues. Even though the energy
deposition of high LET radiation in normal tissue situated near the tumor is not elevated,
the effect is not yet known. In tumor cells, such mutations may contribute to increase
genomic instability and eventually lead to cell death. Low LET radiation also induces
point mutations from dispersed base damages, but the probability of formation and the
complexity of clustered lesions are lower. The frequency of mutation in normal tissue is
expected to be higher than with high LET radiation. Delayed repair of clustered DNA
damage possibly induced by high LET radiation could cause mutations but may also
generate DSBs from stalled replication forks [213], as in rapidly replicating tumor cells.
Such complex DSBs may undergo mutagenic repair via homologous recombination and
may reflect the large (over Mbp) and complex deletions observed in culture cells exposed
73

CHAPTER 1
INTRODUCTION
to high LET radiation. Such genome loss will contribute to genome instability of the
tumor cells, and a probable final outcome is cell death. High LET-induced non-DSB
clusters containing opposing AP sites would be particularly toxic via the formation of
DSBs which will be poorly repaired, or due to the presence of unrepaired AP sites. A
dead cell is a good cell not only for tumor eradication, but also for normal tissue since it
prevents replication of damaged cells with radiation-induced mutations. With respect to
the biological effectiveness of clustered DNA damage, high LET radiotherapy seems to
present a relatively better benefit over risk to the patient than low LET radiotherapy.
Indeed, in combination with a low dose deposited in the entrance channel, fewer as well
as more easily repairable damages are produced in normal tissue, whereas a large dose is
deposited in the tumor, accompanied by complex and poorly repairable lesion production.
In addition, our understanding of repair processes at clustered lesions lets us predict that
inhibiting the late steps of BER should increase toxic DSBs and repair intermediates and
consequently would be beneficial for tumor cell killing and a combination of inhibitors
for the late steps of BER, HR and/or NHEJ would lead to additional cell killing.
Many studies on signaling pathways after low and high LET radiations have found the
activation to be similar except in the intensity [214] but since the end result is different,
there must be a divergence of pathways at some stage.
Since the production of ROS is a major feature of irradiation where some of these could
be permeable, it was of interest to look at the effect of irradiation on cells that had not
exposed to radiation, i.e. the Bystander effect.
74

CHAPTER 1
INTRODUCTION
1.6 Radiation induced Bystander Signaling
The response of a cell or tissue to ionizing radiation has been shown to be mediated by
direct damage to cellular components like DNA, lipids, proteins and small molecules as
well as indirect damage mediated by radiolysis of water ([215]. It is now apparent that the
target for the biological effects of ionizing radiation is not solely the irradiated cells but
also includes the surrounding cells and tissues. Radiation-induced bystander effect is
defined by the observance of biological effects of radiation in cells that were not
themselves in the field of irradiation.
Estimates of the various damage types at sub-cellular, cellular and supra-cellular
level induced by low doses, where no experimental data are available, are generally based
on linear back-extrapolations from data at higher doses. However, a large amount of data
produced during the last decade seem to indicate higher damage yields than expected,
possibly due to the so-called “bystander effect”. One of the most intriguing aspects of
these experiments lies in that bystander damage is observed even at very low doses, down
to the mGy level, and it does not significantly increase with dose. No clear-cut
conclusions can be drawn on the mechanisms underlying bystander effect observations.
Different pathways may be involved, depending on the specific conditions. In any case
the various forms of cellular communication seem to play a key role, since damage in
non-directly hit cells may represent a response to signals coming from cells that were
directly hit by radiation (Fig. 1.6). If these findings are confirmed, radiobiology
experiments may need to be re-interpreted and the models of low-dose radiation action
may need to be revised. Furthermore, a significant role of bystander effects in vivo would
imply the re-evaluation of models of damage at tissue and organ level. A typical example
75

CHAPTER 1
INTRODUCTION
is provided by low-dose cancer risk, which up to now has generally been estimated by
assuming a linear, no-threshold dose-response.
Fig. 1.6: Radiation induced bystander effect. Irradiation of target cells leads to
elicitation of response from unirradiated bystander cells. This takes place through the
transduction of the signal from the irradiated cell to the bystander cell via gap junctions
or through the release of the signaling molecules into the surrounding medium.
A large amount of data on bystander effects has been obtained with the so-called ICM
(Irradiated conditioned medium) treatment [216-219]. This technique consists in
replacing the culture medium of non-irradiated cells with medium taken from cell
cultures previously exposed to radiation. The main finding of these studies, lie in the fact
that such treatment can reduce survival of unexposed cells. This suggests that, as a result
of a radiation insult, certain cell types can release factors in the medium, which therefore
76

CHAPTER 1
INTRODUCTION
becomes potentially cytotoxic. Therefore the onus lies on non gap junction mediated cell
communication.
Evidence for some forms of bystander effect has been suggested also by conventional
irradiation with low doses. One of the first studies in this field has showed a significant,
unexpected increase in the frequency of sister chromatid exchanges (SCEs) after
exposure of Chinese hamster ovary (CHO) cells to very low doses of alpha particles,
from 0.03 to 0.25 cGy [220]. While about 1% or less of the cells were actually traversed
by a particle track, 30–45% of the individual cells showed increased levels of SCE. This
suggests that genetic damage following exposure to very low doses of light ions may
occur also in non directly-irradiated bystander cells.
The studies discussed above strongly suggest a role of extranuclear- and possibly
extracellular-targets in the propagation of certain damage types after irradiation with very
low doses of light ions or treatment with ICM. Experiments allowing the identification of
specific targets for such phenomena can be of great help to better understand the
underlying mechanisms and to quantify the relative contributions of different targets.
This kind of studies is now possible due to the increasing number of microbeam facilities.
Such facilities in which cells are individually irradiated by a predefined exact number of
particles allow the effects of individual particle traversals to be assessed, and these
methods have become a useful tool in the study of bystander responses [221, 222]. Such
studies suggest a major role of cell-to-cell communication via gap-junctions [223].
77

CHAPTER 1
INTRODUCTION
1.7 Aims and Objectives: To Study
1. Fractionated irradiation induced signaling events. The contribution of
these events to the increased cell survival.
2. High LET induced signaling and variance from low LET gamma
radiation.
3. Contribution of radiation induced bystander effect to cell survival and its
mechanism.
78

CHAPTER 2
MATERIALS AND METHODS
MATERIALS AND METHODS
79

CHAPTER 2
MATERIALS AND METHODS
2.1 Chemicals
Ammonium persulphate (APS), sucrose, 4-(2-hydroxyethyl)-1-
piperazineethanesulfonicacid (HEPES), ethylene (oxyethylenenitrilo) tetraacetic acid (EGTA),
phenylmethylsulphonyl fluoride (PMSF), aprotinin, leupeptin, pepstatin,
ethylenediaminetetraaceticacid (EDTA), β-mercaptoethanol, Triton X-100, dithiothreitol (DTT),
dimethy sulphoxide (DMSO), Acrylamide, N, N’-methylenebisacrylamide, Sodium dodecyl
sulfate (SDS), Trizma base, N, N,N’N’-tetramethylethylenediamine (TEMED), Glycine,
ponceau S and coomassie brilliant blue, bromophenol blue, paraformaldehyde,
Polyoxyethylenesorbitan monolaurate (Tween 20), sulfanilamide, N-(1-naphthylethylenediamine),
phosphoric acid, proteinase K, RPMI 1640 medium, Dulbecco’s Modified
Eagle’s Medium (DMEM), Fetal Bovine Serum (FBS), Streptomycin and Penicillin, Trypan
Blue, Sodium bicarbonate, agarose, bovine serum albumin (BSA), Sarcosyl and ethidium were
procured from Sigma Chemicals (USA). PVDF (poly vinylidene difluoride) membrane and Nitro
cellulose membrane were from Amersham Pharmacia Biotech (U.K). Chemiluminescence
western blotting kits (Mouse/rabbit), RNA tissue kit were obtained from Roche Molecular
Biochemicals (Germany). cMaster RT kit was procured from Eppendorf, Germany. Konica AX
medical X-Ray films and Kodak developer and fixer and other chemicals were procured locally.
The primary antibodies used were mouse anti-pATM (S1981), rabbit anti-γ-H2AX
(S139), rabbit anti-pChk1 (Ser296), rabbit anti-pChk2 (Thr68), rabbit anti-pBRCA1 (Ser1524),
rabbit anti-pATR (Ser428) and mouse anti-phospho-p53 (S15) were procured from Cell
Signaling, USA. Secondary antibodies used were Alexa Fluor 488 goat anti-rabbit IgG and
Alexa Fluor 488 goat anti-mouse IgG were obtained from Invitrogen, Molecular Probe, USA.
80

CHAPTER 2
MATERIALS AND METHODS
2.2 Cell Lines
Human lung adenocarcinoma A549 cells, human breast carcinoma MCF-7 cells, human
monocyte U937 cells and human intestinal cell line INT 407 cells were cultured in 75 cm 2 tissue
culture flasks (Falcon, USA) in in Dulbecco’s modified eagles medium (Sigma) supplemented
with 10% fetal calf serum (Sigma). Mouse lymphoma cell line, EL-4 and mouse macrophage
RAW 264.7 cells were grown in RPMI 1640 (Sigma, USA), supplemented with 10% fetal calf
serum (Sigma). Cells were kept at 37 0 C in humidified atmosphere with 5% CO 2 in Nu-Air water
jacketed CO 2 Incubator (USA).
2.3 Irradiation
2.3.1 Low LET ( 60 Co γ rays): A549, INT 407 and MCF-7 cells were exposed to different doses
of γ irradiation using Gamma Cell 220 irradiator (Atomic Energy of Canada Ltd), at a dose rate
of 3.5 Gy/min; the first set was irradiated with acute dose of 2 Gy or 10 Gy. The second set was
exposed to 5 fraction of 2 Gy each over a period of five days.
A549 cells and PMA stimulated U937 cells were exposed to 2 Gy γ-irradiation. The
medium from irradiated cells was transferred to unirradiated cells. EL-4 and RAW 264.7 cells
were resuspended in RPMI medium at a density of 1x10 6 cells/ml and exposed to 5 Gy γ
irradiation using Gamma Cell 220 irradiator (Atomic Energy of Canada Ltd), at a dose rate of
4.74 Gy/min. Medium from irradiated cells was transferred to unirradiated cells (1 h post
irradiation). Some group of RAW 264.7 cells were stimulated with 500 ng/ml of bacterial
Lipopolysaccharide (LPS, Sigma) for 3 h and then the medium was replaced before irradiation.
2.3.2 Proton beam irradiation: Proton beam irradiation was carried out using the Radiation
Biology beam line of in-house 4 MeV Folded Tandem Ion Accelerator (FOTIA) facility. The
81

CHAPTER 2
MATERIALS AND METHODS
primary proton beam from the FOTIA was collimated using an adjustable slit to reduce the
fluence and then diffused using a gold foil. The diffused beam was channeled to the exit window
made of 20 micrometer titanium foil of 3 cm diameter to get uniformly distributed irradiation
area. The samples were thus irradiated under normal atmospheric pressure at 24 o C. The target to
be irradiated was positioned at a distance of 11 mm from the exit window, that being the closest
possible place to mount the target. Before the irradiation, a silicon surface barrier (SSB) detector
was positioned at the same position where samples were irradiated and the beam energy as well
as the uniformity was measured. Another SSB detector placed inside the scattering chamber at a
forward angle of 40 o to the primary beam, after the gold foil, served as a monitor detector. The
ratio of the monitor detector counts to that of the flux measured using SSB detector at the sample
position was measured by multiple trials and the calibration factor was obtained. Monitor
detector counts and the measured ratio were used for delivering the required fluence to the
samples. Flux was calculated to be 10 8 and the fluence was kept such that each cell is hit by at
least 100 proton particles ensuring that bystander effect is kept to minimum. Fluence was then
used to calculate dose with the help of specific ionization curve constructed for the given energy
distribution and composition of the cellline. The average energy of the proton beam used in this
study was measured to be 3.2 MeV and corresponding estimated LET is 12.5 keV/µm within the
cell layer. Initial portion of Bragg’s curve was used for dose estimation since the cell layer used
for irradiation was in monolayer geometry with thickness less than 10µm, which helped to avoid
steep increase in LET within the sample.
The cells were grown in monolayer geometry on 35mm petri dishes. Media was removed and
petridishes were mounted on the exit window vertically for the irradiation, after which they were
82

CHAPTER 2
MATERIALS AND METHODS
resupplemented with the medium. On an average samples were irradiated for 1 minute to get the
required fluence. The cells were exposed to 2 Gy dose with the help of monitor detector counts.
2.3.3 High LET (heavy ion): For the experiments plateau phase A549 cells were irradiated with
12 C and 16 O ions from 15 UD Pelletron accelerator at the Inter University Accelerator Centre,
New Delhi. During carbon and oxygen irradiation, 35 mm petri plates [NUNC] with cellular
monolayers were kept perpendicular to the particle beam coming out of the exit window. The
petri dishes were kept in the serum free medium in a plexiglass magazine during the irradiation.
The computer controlled irradiation system is such that during the actual irradiation the dish was
removed from medium.
At the cell surface the energy of C ions was 62 MeV (5.16 MeV/u , LET=290 keV/ µm] and the
energy of O ions was 55.8 MeV [LET=614 keV/ µm]. Both the energy and LET were calculated
using the Monte Carlo Code SRIM code [224, 225]. The corresponding fluence for the dose of 1
Gy of carbon was 2.2x10 6 particles cm -2 , thus each cell nuclei can be expected to be physically
traversed at least once by carbon ion. The corresponding fluence for the dose of 1Gy of oxygen
was 1.01x10 6 particles cm -2 , thus each cell nuclei can be expected to be physically traversed at
least once by oxygen ion.
Fluence was calculated using the relation given below [226], approximating the density ρ of
cellular matrix as 1.0:
Dose [Gy] = 1.6 x 10 -9 x LET (keV/ µm) x particle fluence (cm -2 ) x 1/ρ (cm 3 /g)
83

CHAPTER 2
MATERIALS AND METHODS
2.4 Clonogenic Cell Survival Assay
After treatment, cells were seeded out in appropriate dilutions (500 cells/60 mm petriplate, 1000
cells/60 mm petriplate or 2000 cells/60 mm petriplate) to form colonies in 14 days. Colonies
were fixed with glutaraldehyde (6.0% v/v), stained with crystal violet (0.5% w/v) and counted
using a stereomicroscope. Colonies containing more than 50 cells were scored as survivors.
Absolute plating efficiency of A549 cells at 0 Gy (sham irradiated control) was 32.3±2.4 %.
Absolute plating efficiency of MCF-7 cells at 0 Gy (sham irradiated control) was 45.2±2.4 %.
2.5 Microarray
Two independent series of experiments were performed with Human Genome U-133 Plus 2.0
microarrays containing 54675 probe sets (Affymetrix, Santa Clara, CA). Microarray analysis was
carried out at Oscimum Biosolution, Hyderabad on paid basis. Total RNA was isolated from
~3 × 10 6 A549 cells with RNeasy Mini Kits (Qiagen) including digestion with RNase-free
DNase I, and its quantity and integrity were checked spectrophotometrically and by
electrophoresis in 1% agarose gels. Materials and methods for microarrays were from
Affymetrix (Santa Clara); double-stranded cDNA was prepared with the GeneChip Expression
3’-Amplification One-Cycle cDNA Synthesis Kit, cleaned using the Sample Cleanup Module,
and biotinylated cRNA was synthesized with GeneChip Expression 3’-Amplification Reagents
for IVT Labeling, cleaned on RNA Sample Cleanup columns, and fragmented at 94 °C for
35 min in Fragmentation Buffer. The biotinylated cRNA was hybridized first to a control Test3
microarray to evaluate its quality and then to a Human Genome U-133 Plus 2.0 microarrays
containing 54675 probe sets, using GeneChip Expression 3’-Amplification Reagents.
Microarrays were stained with streptavidin–phycoerythrin conjugate and scanned in a Gene
84

CHAPTER 2
MATERIALS AND METHODS
Array G2500A scanner (Agilent) and the expression data on human Affymetrix chip was
generated. Since the numbers of samples in each treatment type were sparse, we used a bivariate
simulation approach to identify differentially expressed (DE) genes for the specified threshold
fold change (FC). The DE candidates across each comparison were further evaluated for their
biological relevance through Gene Ontology and Pathways studies. The statistical analysis was
carried out using R package and the biological analysis was carried out using Genowiz TM
software.
For comparative evaluation, an un-irradiated control cell was used. The expression data on
Affymetrix Human 133AB chip was obtained for each sample. The primary objective of the
study was to obtain differentially expressed (DE) probe sets (genes) across various comparisons.
Also, the interest was to study the clustering of genes and samples and the functional relevance
of the differentially expressed genes.
Upon identifying the DE genes, the next interest was to study the biological relevance of selected
marker genes through GO and Pathway analysis.
The data analysis process involves Robust Multichip Average (RMA) normalization, quality
check analysis, differential expression analysis and the gene enrichment analysis.
The correlation between the expression values for samples was studied through Pearson's
coefficient. A pairwise correlation analysis was performed to generate a correlation matrix
indicating how the samples are related with each other. The coefficient tells about the similarity
of expression trend between the two arrays. A coefficient value close to 1.0 indicates the linear
85

CHAPTER 2
MATERIALS AND METHODS
expression between the arrays. The minimum correlation between the samples was 0.987, which
was above the acceptable criterion of 0.8.
2.6 Semiquantitative Reverse transcriptional polymerase chain reaction (RT-PCR)
Total RNA from all the groups of cells (1 x 10 6 cells) was extracted after required time periods
of irradiation and eluted in 30 µl RNAase free water using RNA tissue kit (Roche). Equal
amount of RNA in each group was reverse transcribed using cMaster RT kit (Eppendorf). Equal
amount (2µl) of cDNA in each group was used for specific amplification of β-actin, NF-κB
(p65), iNOS, p21, p53, ATM, DNA-PK, ATR, MLH1, Rad52, GADD45α, Toll-like receptor 3
(TLR3), Ferredoxin reductase (FDXR), Chk1, Chk2, Bcl-2 or Bax gene using gene specific
primers (Table 2.6). The PCR condition were 94 o C, 5 min initial denaturation followed by 30
cycles of 94 o C 45 s, 55 – 62 o C 45 s (depending on the annealing temperature of specific primers
given in Table 2.6), 72 o C 45 s and final extension at 72 o C for 10 min. Equal amount of each
PCR product (10 µl) was run on 1.5 % agarose gel containing ethidium bromide in tris borate
EDTA buffer at 60 V. The bands in the gel were visualized under UV lamp and relative
intensities were quantified using Gel doc software (Syngene).
2.7 Immunofluorescence staining
Cells were grown in cover slips which were kept in 35mm petri dishes and irradiated as
mentioned above. Cell layer were washed at different time period after irradiation in PBS and
fixed for 20 min in 4% paraformaldehyde at room temperature. Afterwards, the cells were
washed twice in PBS. For immunofluorescence staining, cells were permeabilized for 3 min in
0.25% Triton X-100 in PBS, washed two times in PBS and blocked for 1 h with 5% BSA in
86

CHAPTER 2
MATERIALS AND METHODS
PBS. Antibodies were diluted (1:200) in 1% BSA in PBS. Cells were incubated with primary
antibodies for 1 h 30 min at room temperature, washed three times in PBS and incubated with
secondary antibodies for 1 h at room temperature. Finally, cells were rinsed and mounted with
ProLong Gold antifede with DAPI mounting media (Molecular Probe, USA). Images were
captured using Carl Zeiss confocal microscope. Acquisition settings were optimized to obtain
maximal signal in immunostained cells with minimal background.
Table 2.6: The sequences of gene specific primers and their annealing temperature (Tm) used in
RT-PCR experiments
Gene Primer Sequence Tm ( o C)
β-Actin
F 5’-TGGAATCCTGTGGCATCCATGAAAC-3’
R 5’- TAAAACGCAGCTCAGTAACAGTCCG-3’
55
iNOS F 5’- CTCTGACAGCCCAGAGTTCC - 3’
62
R 5’- AGGCAAAGGAGGAGAAGGAG- 3’
p21 F 5’- GCCTTAGCCCTCACTCTGTG- 3’
58
R 5’-GGTTGGGAGGGGCTTAAATA- 3’
p53 F 5’- CGGGTGGAAGGAAATTTGTA- 3’
58
R 5’- CTTCTGTACGGCGGTCTCTC - 3’
p65 F 5’- ACAACTGAGCCCATGCTGAT- 3’
50
ATM
ATR
R 5’- GAGAGGTCCATGTCCGCAAT- 3’
F 5’-GGACAGTGGAGGCACAAAAT-3’
R 5’-GTGTCGAAGACAGCTGGTGA-3’
F 5’-CTCGCTGAACTGTACGTGGA-3’
R 5’-GCATAGCTCGACCATGGATT-3’
57
57
DNA-PK F 5’-TGCCAATCCAGCAGTCATTA-3’ 64
87

CHAPTER 2
MATERIALS AND METHODS
Chk2
Chk1
Bax
Bcl-2
Rad52
MLH1
CDKN1A
(p21)
GADD45α
TLR3
FDXR
R 5’-GGTCCATCAGGCACTTCACT-3’
F 5’-GGCTTCAGGATGAAGACATGA-3’
R 5’-CACAACACAGCAGCACACAC-3’
F 5’-TGTCAGAGTCTCCCAGTGGA-3’
R 5’-AGGGGCTGGTATCCCATAAG-3’
F 5’-TCCCCCCGAGAGGTCTTT-3’
R 5’-CGGCCCCAGTTGAAGTTG-3’
F 5’-GAGGATTGTGGCCTTCTTTG-3’
R 5’-ACAGTTCCACAAAGGCATCC-3’
F 5’-AGTTTTGGGAATGCACTTGG-3’
R 5’-TCGGCAGCTGTTGTATCTTG-3’
F 5’-GAGGTGAATTGGGACGAAGA-3’
R 5’-TCCAGGAGTTTGGAATGGAG-3’
F 5’-CAGCAGAGGAAGACCATGTG-3’
R 5’-GGCGTTTGGAGTGGTAGAAA-3’
F 5’-TGCGAGAACGACATCAACAT-3’
R 5’-TCCCGGCAAAAACAAATAAG-3’
F 5’-GCCTCTTCGTAACTTGACCA-3’
R 5’-AAGGATGTGGAGGTGAGACA-3’
F 5’-AGAGAACGGACATCACGAAG-3’
R 5’-GTCCTGGAGACCCAAGAAAT-3’
64
59
56
59
50
52
59
58
57
57
F- Forward and R- Reverse
2.8 Image analysis using ImageJ software
The captured images were analyzed for relative quantification of phosphorylation using ImageJ
software [227]. A 25 x 25 pixel box was positioned over the fluorescent image of each cell, and
88

CHAPTER 2
MATERIALS AND METHODS
the average intensity within the selection (the sum of the intensities of all the pixels in the
selection divided by the number of pixels) was measured. All the foci were counted manually; at
least 100 cells per experiment were analyzed from three independent experiments.
2.9 Western Blotting
Proteins were separated by 8 % SDS-PAGE using minigel apparatus (Technosource, India) run
at a constant voltage of 150 volts for 3 hr. The resolved proteins were then transferred to
nitrocellulose membrane using an immunoblot apparatus (Technosource, India) at a constant
voltage of 70 volts for 90 min. Following transfer, membranes were stained using Ponceau S
solution to confirm complete transfer of proteins from the gel. Thereafter, the gel was also
stained with 0.2 % coomassie blue to reconfirm the same. The membranes were blocked
overnight with wash buffer (0.05 M Tris, 0.15 M NaCl and 0.1 % Tween 20 pH8.0) containing 5
% BSA with gentle rocking at 4 0 C. The blocked membranes were probed with specific primary
antibodies (dilutions used are mentioned in the respective figures) followed by washing with
wash buffer four times for 5 min each. Thereafter the membranes were reprobed with horse
radish peroxidase conjugated secondary antibody (Roche Molecular, Biochemicals. Germany) at
a dilution of 1:2000 in wash buffer containing 1 % BSA, washed 4x5 min with wash buffer and
developed with Mouse/Rabbit Western Blotting Kit (Roche Molecular, Biochemicals. Germany).
Chemiluminescence was recorded on Konica AX medical X-Ray films. Images were digitized
using HP Scan Jet ADF Scanner and the figures were assembled using Gelquant Version 2.7
Software.
89

CHAPTER 2
MATERIALS AND METHODS
2.10 Measurement of DNA damage
DNA damage in all the groups of EL-4 cells 2 h after exposure to different conditioned medium,
was measured by alkaline single cell gel electrophoresis (comet assay) [228]. In brief, frosted
microscope slides (Gold Coin, Mumbai, India) were covered with 200 µl of 1% normal melting
agarose (NMA) in phosphate buffered saline (PBS) at 45 o C, covered with a cover slip and kept
at 4 o C for 10 min. After solidification a second layer of 200 µl of 0.5% low melting agarose
(LMA) containing approximately 105 cells at 37 o C was layered over it. The cover slips were
replaced immediately and the slides were kept at 4 o C. After solidification of the LMA, the
cover-slips were removed and slides were placed in the chilled lysing solution (2.5M NaCl,
100mM Na 2 -EDTA, 10mM Tris–HCl, pH 10, and 1% DMSO, 1% Triton X100 and 1% sodium
sarcosinate) for 1 h at 4 o C. The slides were removed from the lysing solution and placed on a
horizontal electrophoresis tank filled with freshly prepared alkaline buffer (300mM NaOH, 1mM
Na 2 -EDTA and 0.2% DMSO, pH≥13.0) and were equilibrated in the above buffer for 20 min and
electrophoresis was carried out at 25V for 20 min. After electrophoresis the slides were washed
gently with 0.4M Tris–HCl buffer, pH 7.4, to remove the alkali, stained with 50 µl of propidium
iodide (PI, 20 µg/ml) and visualized using a Carl Zeiss Fluorescent microscope (Axioskop). The
images (40–50 cells/slide) were captured with high-performance GANZ (model: ZCY11PH 4)
color video camera. The integral frame grabber used in this system (Cvfbo1p) is a PC based card
and it accepts color composite video output of the camera. The quantification of the DNA strand
breaks of the stored images was done using the CASP software by which %DNA in tail, tail
length, tail moment and Olive tail moment could be obtained directly [229].
90

CHAPTER 2
MATERIALS AND METHODS
2.11 Measurement of NO production in EL-4 cells
Control unirradiated cells, cells exposed to radiation and the cells exposed to different
conditioned media as mentioned above were cultured for 24 h at 37 0 C in 5%CO 2 / 95% air. The
production of NO in the culture supernatants was measured by assaying NO - 2 using colorimetric
Griess reaction [230].
In brief, 100 µl of culture supernatants was incubated with an equal volume of Griess reagent
[1% sulfanilamide and 0.1% N-(1-naphthyl-ethylenediamine) in 2.5% phosphoric acid; Sigma,
USA] at room temperature for 10 min in a 96 well plate. The absorbance at 550 nm was
measured using a microplate reader (Fluostar Optima, Biotron Healthcare). Absorbance
measurements were converted to µ moles of NO 2
-
using a standard curve of NaNO 2.
2.12 Measurement of Apoptosis by DNA fragmentation
Apoptosis in control unirradiated cells, cells exposed to radiation and the cells exposed to
different conditioned media as mentioned above was measured by DNA fragmentation assay
[231]. After transfer of medium from irradiated cells, all the above mentioned groups of EL-4
cells were cultured for 24 h at 37 0 C in 5%CO 2 , 95% air. The cells were harvested and lysed in
lysis buffer (10 mM EDTA, 50 mM Tris–HCl, pH 8.0, 0.5% sodium lauryl sarcosine) containing
the 100 mg/ml proteinase K at 55 o C for 2 h. The DNA was extracted with phenol/chloroform and
precipitated with ethanol. The RNA was removed by RNAse A treatment and DNA was
electrophorased on agarose gel to visualize the fragmented DNA.
91

CHAPTER 2
MATERIALS AND METHODS
2.13 Transfection with ShRNA
MLH1, Rad52 and Control shRNA plasmids were procured from Santa cruz biotechnology (Cat
No. sc-35943-SH, sc-37399-SH and sc-108060 respectively). In a six well tissue culture plate,
A549 cells were grown to 50-70% confluency in antibiotic-free normal growth medium
supplemented with FBS and transfection was carried out as per supplier’s instruction. 48 hours
post-transfection, medium was aspirated and replaced with fresh medium containing puromycin
(2µg/ml) for selection of stably transfected cells. Semi-quantitative RT-PCR was performed to
monitor MLH1 and Rad52 gene expression knockdown using gene specific primers (Table 1).
2.14 Statistical Analysis
The data were imported to excel work sheets, and graphs were made using Origin version 5.0.
One-way ANOVA with Tukey–Kramer Multiple Comparisons as post-test for P < 0.05 used to
study the significant level. Data were insignificant at P > 0.05. Each point represented as
mean±S.E. (standard error of the mean).
92

CHAPTER 3
RESULTS
RESULTS
93

CHAPTER 3
RESULTS
Exposure of cells to ionizing radiation leads to a cascade of signaling events in cells. Until
recently, the molecular mechanisms by which cells recognize ionizing radiation damage and
respond to it were unknown, but now they are steadily emerging. Cells use complex protein
signaling systems, which recognize radiation induced oxidative damage to DNA and plasma
membrane lipids, and stimulate intracellular signaling pathways. The balance between various
pathways and the ever-changing cell’s microenvironment together determines the ultimate fate of
the cell which may be death or survival. On surveying the literature on radiation induced signal
transduction, most studies seemed to have been done at doses of choice, very often with
supralethal doses of radiation with the assumption that the same effects can be attributed to lower
or therapeutic doses of radiation. Moreover, the time of observation chosen by the investigators
also varied according to their own past experiences. Most, if not all the studies examined
signaling after a single dose of irradiation. The work embodied in this thesis; therefore, attempts
to bridge these gaps in our understanding of radiation induced signaling.
3.1 Fractionated irradiation induced signaling and repair in mammalian cells.
Radiation therapy is delivered clinically in the form of fractionated doses; therefore the effect of
fractionated doses of γ-irradiation (2Gy per fraction over 5 days), as delivered in cancer
radiotherapy was compared with acute doses of 10 and 2Gy, in three human cell lines viz. MCF-
7, INT 407 and A549. Cell lines were divided into 4 Groups. While a) controls were sham
irradiated, the rest were subjected to b) 2 Gy of 60 Co γ irradiation daily over a period of 5 days c)
10 Gy acute dose (which is the sum total of all the fractions i.e. 2 Gy x 5) or d) 2 Gy acute dose
(single dose that was delivered in each fraction) of 60 Co γ irradiation. The 2 Gy dose was
included to compare the effect of a single fraction that was delivered with the effect of the total
94

CHAPTER 3
RESULTS
fractionated regimen and the 10 Gy acute dose, which is the sum total of all the fractions
delivered. It was of interest to compare both these doses with the fractionated doses.
3.1.1 Clonogenic Cell Survival
To determine the sensitivity of cells to different doses of radiation, their ability to form colonies
after irradiation was observed. There was 52.4±2.5% survival of MCF-7 cells that had been
exposed to 2 Gy acute dose where as there was 25±1.5% of cell survival in those that had been
exposed to 5 fractions of 2 Gy and 0.5±0.05% of cells survived after exposure to 10 Gy acute
dose (Fig.3.1.1).
54±2.1% of INT 407 cells survived after exposure to 2 Gy where as only 30±1.8% survived after
exposure to 5 fractions of 2 Gy and only 1.5±0.08% of cells survived after exposure to 10 Gy
(Fig.3.1.1).
The A549 cells responded differently to radiation. While 60±2.5% of A549 cells survived after
2 Gy. 48±2.8% of cells survived after exposure to 5 fractions of 2 Gy and only 4±0.5% of cells
survived after exposure 10 Gy (Fig.3.1.1).
95

CHAPTER 3
RESULTS
Percentage Survival
100
80
60
40
20
0
MCF7
INT407
A549
0Gy 2Gy 5X2Gy 10Gy
Radiation Dose
Fig. 3.1.1 Relative radioresistance of three cell line viz. MCF-7, INT 407 and A549. Data represents
means ± SE of three independent experiments. Key; Lane 1, control unirradiated cells. Lane 2, 2 Gy
acute dose ( single dose that was delivered in each fraction ) of 60 Co γ-irradiation Lane 3 2 Gy of
60 Co γ-irradiation daily over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the
fraction ) 60 Co γ-irradiation; 2000 cells/60 mm petriplate plated for this treatment group.
3.1.2 Human Genome U-133 Plus 2.0 microarray data analysis.
Having established that A549 was relatively more radioresistant, global expression analysis of
54675 probe set using Human Genome U-133 Plus 2.0 microarray was performed in A549 cells.
For microarray analysis, 4 h after irradiation was selected as the time point to monitor the early
response of cells to irradiation and to identify differentially expressed early genes that mediate
cellular events such as DNA repair and apoptosis.
96

CHAPTER 3
RESULTS
On comparison of control Vs 5X2 Gy (henceforth called fractionated dose), 461 genes were
identified as differentially-expressed; 312 genes up-regulated (defined as a 2.0-fold or greater
increase, Table 3.1.2A) and 149 down-regulated (defined as a 2.0-fold or greater decrease, Table
3.1.2B). Up-regulated genes were associated with p53 signaling pathway, cytokine-cytokine
receptor interaction, hematopoietic cell lineage, Toll-like receptor signaling pathway, Jak-STAT
signaling pathway, MAPK signaling pathway, cell-cycle check point, B cell receptor signaling
pathway. Down-regulated genes were associated with TGF-beta signaling pathway and tyrosine
metabolism.
In the second group (2 Gy Vs 5X2 Gy), 234 genes were identified as differentially-expressed;
172 genes as up-regulated (Table 3.1.2C) and 62 as down-regulated (Table 3.1.2D). Genes
involved in cytokine-cytokine receptor interaction, toll-like receptor signaling pathway,
hematopoietic cell lineage, Jak-STAT signaling pathway, MAPK signaling pathway were upregulated.
Gene involved in folate biosynthesis, glycine, serine and threonine metabolisms were
down-regulated.
In the 10 Gy Vs fractionated group, 289 genes were identified as differentially-expressed; 211
genes as up-regulated (Table 3.1.2E) and 78 as down-regulated (Table 3.1.2F). Genes involved
in cytokine-cytokine receptor interaction, toll-like receptor signaling pathway, cell cycle, DNA
replication, mismatch repair, homologous recombination were up-regulated. Genes involved in
regulation of autophagy, base excision repair, folate biosynthesis were down-regulated.
Cluster analysis of the expression of these genes showed that the fractionated group differed
most in gene expression compared to the other three groups (control, 2Gy or 10Gy) (Fig. 3.1.2
A, B & C).
97

CHAPTER 3
RESULTS
Fig. 3.1.2 Relative expression of genes in A549 cells exposed to 0Gy, 2Gy, 5X2Gy or 10Gy (A-
C) Hierarchical clustering of all experimental groups based on the expression of all genes. (A)
Heatmap showing similarity of genes profile for the comparison Control Vs 5X2Gy. (B)
Heatmap showing similarity of genes profile for the comparison 2Gy Vs 5X2Gy. (C) Heatmap
showing similarity of genes profile for the comparison 10Gy Vs 5X2Gy.
98

CHAPTER 3
RESULTS
Table 3.1.2A List of Up-regulated Genes: Control Vs 5X2Gy
S.No Public ID Gene Symbol Gene Title
1 M21121 CCL5 chemokine (C-C motif) ligand 5
2 NM_153838 GPR115 G protein-coupled receptor 115
3 NM_134268 CYGB cytoglobin
4 NM_005764 PDZK1IP1 PDZK1 interacting protein 1
5 BC021286 C1orf187 chromosome 1 open reading frame 187
6 AF355465 ZMAT3 zinc finger, matrin type 3
7 AB014766 --- ---
8 AF043341 CCL5 chemokine (C-C motif) ligand 5
9 AK094613 RPS24 Ribosomal protein S24
10 AI332397 EIF4A2 eukaryotic translation initiation factor 4A, isoform 2
11 AA580691 RBM25 RNA binding motif protein 25
12 BC039509 LOC643401 hypothetical protein LOC643401
13 BC007947 PHLDB3 pleckstrin homology-like domain, family B, member 3
14 BG389789 --- ---
15
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
BE708432 MALAT1
16 AK090412 LOC375010 hypothetical LOC375010
17 BC040303 LOC727916 hypothetical protein LOC727916
18 BC043411 --- Homo sapiens, clone IMAGE:6155889, mRNA
19 AL832227 BCL8 B-cell CLL/lymphoma 8
20 AL832227 BCL8 B-cell CLL/lymphoma 8
21 AF086134 --- Full length insert cDNA clone ZA88B06
22 AF147425 SF3B14 Splicing factor 3B, 14 kDa subunit
23 AK098337 LOC375010 hypothetical LOC375010
24
serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 1
BC020765 SERPINE1
25 BC017771 CCDC90B coiled-coil domain containing 90B
26 BC018787 MGC59937 Similar to RIKEN cDNA 2310002J15 gene
27 BC023629 PDLIM7 PDZ and LIM domain 7 (enigma)
28 BC023629 PDLIM7 PDZ and LIM domain 7 (enigma)
29 BC041011 EME2 essential meiotic endonuclease 1 homolog 2 (S. pombe)
30 NM_001613 ACTA2 actin, alpha 2, smooth muscle, aorta
31 BG339064 BTG2 BTG family, member 2
32 NM_006763 BTG2 BTG family, member 2
33 BF111821 WSB1 WD repeat and SOCS box-containing 1
34 BG491844 JUN jun oncogene
35 NM_002228 JUN jun oncogene
36 NM_002276 KRT19 keratin 19
37 NM_006762 LAPTM5 lysosomal associated multispanning membrane protein 5
38
NM_002462 MX1
myxovirus (influenza virus) resistance 1, interferoninducible
protein p78 (mouse)
99

CHAPTER 3
RESULTS
39 NM_014734 KIAA0247 KIAA0247
40 NM_005562 LAMC2 laminin, gamma 2
41
NM_002615 SERPINF1
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin,
pigment epithelium derived factor), member 1
42 NM_000389 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1)
43 NM_001710 CFB complement factor B
44 NM_001674 ATF3 activating transcription factor 3
45
angiotensinogen (serpin peptidase inhibitor, clade A,
member 8)
NM_000029 AGT
46 NM_014905 GLS glutaminase
47 NM_005541 INPP5D inositol polyphosphate-5-phosphatase, 145kDa
48 NM_001345 DGKA diacylglycerol kinase, alpha 80kDa
49 NM_005502 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1
50 NM_005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I)
51 NM_001924 GADD45A growth arrest and DNA-damage-inducible, alpha
52
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase
2
NM_004267 CHST2
53 NM_004585 RARRES3 retinoic acid receptor responder (tazarotene induced) 3
54 NM_006851 GLIPR1 GLI pathogenesis-related 1 (glioma)
55 NM_021127 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1
56 NM_000229 LCAT lecithin-cholesterol acyltransferase
57 NM_000698 ALOX5 arachidonate 5-lipoxygenase
58 NM_004961 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon
59 NM_002985 CCL5 chemokine (C-C motif) ligand 5
60 NM_001549 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
61 AA164751 FAS Fas (TNF receptor superfamily, member 6)
62 NM_000043 FAS Fas (TNF receptor superfamily, member 6)
63 NM_004165 RRAD Ras-related associated with diabetes
64 NM_004165 RRAD Ras-related associated with diabetes
65 NM_006307 SRPX sushi-repeat-containing protein, X-linked
66 NM_000203 IDUA iduronidase, alpha-L-
67 NM_000576 IL1B interleukin 1, beta
68 AB046692 AOX1 aldehyde oxidase 1
69 NM_001159 AOX1 aldehyde oxidase 1
70 NM_000600 IL6 interleukin 6 (interferon, beta 2)
71 AF026303 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
72 NM_002392 MDM2 Mdm2 p53 binding protein homolog (mouse)
73 NM_005101 ISG15 ISG15 ubiquitin-like modifier
74 NM_005658 TRAF1 TNF receptor-associated factor 1
75 NM_001785 CDA cytidine deaminase
76 NM_000756 CRH corticotropin releasing hormone
77 NM_003733 OASL 2'-5'-oligoadenylate synthetase-like
78 NM_000777 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
79 NM_001197 BIK BCL2-interacting killer (apoptosis-inducing)
100

CHAPTER 3
RESULTS
80 NM_002185 IL7R interleukin 7 receptor
81 NM_016352 CPA4 carboxypeptidase A4
82 NM_014668 GREB1 GREB1 protein
83
GABBR1 ///
NM_006398 UBD
84 NM_005393 PLXNB3 plexin B3
85 NM_001086 AADAC arylacetamide deacetylase (esterase)
86 NM_001941 DSC3 desmocollin 3
87 NM_003265 TLR3 toll-like receptor 3
88 NM_005531 IFI16 interferon, gamma-inducible protein 16
gamma-aminobutyric acid (GABA) B receptor, 1 ///
ubiquitin D
89
carcinoembryonic antigen-related cell adhesion molecule
NM_001712 CEACAM1 1 (biliary glycoprotein)
90 NM_015364 LY96 lymphocyte antigen 96
91 NM_003811 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9
92
NM_001974 EMR1
egf-like module containing, mucin-like, hormone
receptor-like 1
93 NM_001561 TNFRSF9 tumor necrosis factor receptor superfamily, member 9
94 NM_001531 MR1 major histocompatibility complex, class I-related
95 NM_001531 MR1 major histocompatibility complex, class I-related
96 NM_013314 BLNK B-cell linker
97 NM_004110 FDXR ferredoxin reductase
98
SAA1 ///
NM_030754 SAA2 serum amyloid A1 /// serum amyloid A2
99 AF204231 GOLGA8A golgi autoantigen, golgin subfamily a, 8A
100 AF208043 IFI16 interferon, gamma-inducible protein 16
101 AF247168 C1orf63 chromosome 1 open reading frame 63
102 AF007162 CRYAB crystallin, alpha B
103 BC001743 C7orf44 chromosome 7 open reading frame 44
104 AF237813 ABAT 4-aminobutyrate aminotransferase
105 AF237813 ABAT 4-aminobutyrate aminotransferase
106
X16354 CEACAM1
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
107
DNA segment on chromosome 4 (unique) 234 expressed
NM_014392 D4S234E sequence
108
DNA segment on chromosome 4 (unique) 234 expressed
BC001745 D4S234E sequence
109 BC001422 PGF placental growth factor
110
M87507 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
111 M15329 IL1A interleukin 1, alpha
112 AF010446 MR1 major histocompatibility complex, class I-related
113 AF031469 MR1 major histocompatibility complex, class I-related
114 M11734 CSF2 colony stimulating factor 2 (granulocyte-macrophage)
115 AB007458 TP53AP1 TP53 activated protein 1
101

CHAPTER 3
RESULTS
116 L76224 GRIN2C glutamate receptor, ionotropic, N-methyl D-aspartate 2C
117
AF164622
GOLGA8A
///
GOLGA8B
golgi autoantigen, golgin subfamily a, 8A /// golgi
autoantigen, golgin subfamily a, 8B
118 M13436 INHBA inhibin, beta A
119 AF119863 MEG3 maternally expressed 3
120 AF063612 OASL 2'-5'-oligoadenylate synthetase-like
121 AF064771 DGKA diacylglycerol kinase, alpha 80kDa
122
U13698 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
123
caspase 1, apoptosis-related cysteine peptidase
124
U13699
CASP1
(interleukin 1, beta, convertase)
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
U13700 CASP1
125 AF186255 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
126 U20489 PTPRO protein tyrosine phosphatase, receptor type, O
127 AF201370 MDM2 Mdm2 p53 binding protein homolog (mouse)
128
129
130
M76742
D12502
CEACAM1
CEACAM1
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 2
AL541302 SERPINE2
131 AI762552 HNRPDL Heterogeneous nuclear ribonucleoprotein D-like
132 AI130920 PABPN1 poly(A) binding protein, nuclear 1
133 AW052179 COL4A5 collagen, type IV, alpha 5 (Alport syndrome)
134 AI572079 SNAI2 snail homolog 2 (Drosophila)
135 AA083478 TRIM22 tripartite motif-containing 22
136 AL050154 KIAA1462 KIAA1462
137
Heterogeneous nuclear ribonucleoprotein D (AU-rich
element RNA binding protein 1, 37kDa)
W74620 HNRNPD
138 AU155515 RPL37A ribosomal protein L37a
139 AW103422 PCBP2 poly(rC) binding protein 2
140 AA554945 --- Transcribed locus
141 AL037167 RABL4 RAB, member of RAS oncogene family-like 4
142 AI912583 GLIPR1 GLI pathogenesis-related 1 (glioma)
143
ATP synthase, H+ transporting, mitochondrial F1
BG232034 ATP5C1 complex, gamma polypeptide 1
144 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
145 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
146
AI962377
LOC729222
/// PPFIBP1
PTPRF interacting protein, binding protein 1 (liprin beta
1) /// similar to mKIAA1230 protein
147 NM_006417 IFI44 interferon-induced protein 44
148 M23699 SAA1 /// serum amyloid A1 /// serum amyloid A2
102

CHAPTER 3
RESULTS
SAA2
149 AU134977 TncRNA Trophoblast-derived noncoding RNA
150 AF070569 C17orf91 chromosome 17 open reading frame 91
151 AL080207 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12
152 X83493 FAS Fas (TNF receptor superfamily, member 6)
153 AC004770 FADS3 fatty acid desaturase 3
154 Z70519 FAS Fas (TNF receptor superfamily, member 6)
155 AF107846 GNAS GNAS complex locus
156
collagen, type VII, alpha 1 (epidermolysis bullosa,
dystrophic, dominant and recessive)
L23982 COL7A1
157 AJ276888 MDM2 Mdm2 p53 binding protein homolog (mouse)
158 BE888744 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
159 BE930512 MGC5370 Hypothetical protein MGC5370
160 NM_000064 C3 complement component 3
161 NM_022772 EPS8L2 EPS8-like 2
162 NM_014454 SESN1 sestrin 1
163
THSD1 /// thrombospondin, type I, domain containing 1 ///
NM_018676 THSD1P thrombospondin, type I, domain containing 1 pseudogene
164 NM_004669 CLIC3 chloride intracellular channel 3
165 NM_016321 RHCG Rh family, C glycoprotein
166 NM_015900 PLA1A phospholipase A1 member A
167 NM_022470 ZMAT3 zinc finger, matrin type 3
168 NM_024728 C7orf10 chromosome 7 open reading frame 10
169 NM_017938 FAM70A family with sequence similarity 70, member A
170 NM_017986 GPR172B G protein-coupled receptor 172B
171 AL136861 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2
172 AF133207 HSPB8 heat shock 22kDa protein 8
173 AL537457 NEFL neurofilament, light polypeptide 68kDa
174 BF055311 NEFL neurofilament, light polypeptide 68kDa
175
HNRNPA1
///
LOC728844
heterogeneous nuclear ribonucleoprotein A1 ///
hypothetical LOC728844
AW450929
176 BF131886 SESN2 sestrin 2
177 AB056106 ABI3BP ABI gene family, member 3 (NESH) binding protein
178 AL136680 GBP3 guanylate binding protein 3
179 AL136826 RGMA RGM domain family, member A
180 AF160477 PVRL4 poliovirus receptor-related 4
181
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
AF113016 MALAT1
182 BF062193 CYorf15B chromosome Y open reading frame 15B
183 AF329088 OSAP ovary-specific acidic protein
184 AF229179 TMEM27 transmembrane protein 27
185
AF132202
MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
103

CHAPTER 3
RESULTS
186 BC006355 PLCD4 phospholipase C, delta 4
187
AI446756 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
188
AF001540 MALAT1
metastasis associated lung adenocarcinoma transcript 1
189(non-protein coding)
189 BE675516 TncRNA trophoblast-derived noncoding RNA
190 AI042152 TncRNA trophoblast-derived noncoding RNA
191
BG534952 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
192
AW005982 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
193 AL133001 SULF2 sulfatase 2
194 AI952357 MGC5370 hypothetical protein MGC5370
195 AI355441 --- CDNA FLJ26120 fis, clone SYN00419
196 N21643 --- CDNA FLJ39585 fis, clone SKMUS2006633
197 N21426 SYTL2 synaptotagmin-like 2
198
AI601101
FAM84A ///
LOC653602
family with sequence similarity 84, member A ///
hypothetical LOC653602
199 AW006123 FBXO32 F-box protein 32
200 AL039862 FAM84B family with sequence similarity 84, member B
201 AW341649 TP53INP1 tumor protein p53 inducible nuclear protein 1
202 N21030 NRBP2 nuclear receptor binding protein 2
203 AB033041 VANGL2 vang-like 2 (van gogh, Drosophila)
204 N32834 GLIPR1 GLI pathogenesis-related 1 (glioma)
205 AV682252 GLIPR1 GLI pathogenesis-related 1 (glioma)
206 BE217880 IL7R interleukin 7 receptor
207 BE967311 MCC mutated in colorectal cancers
208 AI565067 KIAA1324 KIAA1324
209 AI188653 MXD1 MAX dimerization protein 1
210
AW117717 AHSA2
AHA1, activator of heat shock 90kDa protein ATPase
homolog 2 (yeast)
211 AI446414 KITLG KIT ligand
212 AL513673 CYGB cytoglobin
213
AI986239 AHSA2
AHA1, activator of heat shock 90kDa protein ATPase
homolog 2 (yeast)
214
W80468 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
215 AA131041 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
216 AI571166 --- CDNA FLJ39306 fis, clone OCBBF2013123
217 AU155361 TncRNA trophoblast-derived noncoding RNA
218
AA524669
LOC1001315
64 hypothetical protein LOC100131564
219 AI343467 --- CDNA FLJ11041 fis, clone PLACE1004405
220 N36085 --- CDNA clone IMAGE:5261213
104

CHAPTER 3
RESULTS
221
LOC643167 RNA binding motif protein 39 /// similar to RNA-binding
BE466173 /// RBM39 region (RNP1, RRM) containing 2
222 BE673226 C15orf52 chromosome 15 open reading frame 52
223 AK024898 --- CDNA: FLJ21245 fis, clone COL01184
224 AI459194 EGR1 Early growth response 1
225 AA632295 STON2 stonin 2
226
AL037917 MALAT1
227 AI817145 PDCD5 Programmed cell death 5
228 BF591483 NTN1 netrin 1
229 AB046848 NOPE neighbor of Punc E11
230
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
Transcribed locus, strongly similar to NP_005768.1 RNA
binding motif protein 6 [Homo sapiens]
AI041522 ---
231 AI953847 RNF144B ring finger 144B
232 BE645119 MGC13057 hypothetical protein MGC13057
233 BE048571 MGC16121 hypothetical protein MGC16121
234 AI927692 --- CDNA FLJ41270 fis, clone BRAMY2036387
235 AA741307 SAMD9 sterile alpha motif domain containing 9
236
Metastasis associated lung adenocarcinoma transcript 1
AI475544 MALAT1 (non-protein coding)
237 AI809749 ORMDL1 ORM1-like 1 (S. cerevisiae)
238 AW071793 MXD1 MAX dimerization protein 1
239
AW007289 ADAMTS7
ADAM metallopeptidase with thrombospondin type 1
motif, 7
240 AI659800 C13orf31 chromosome 13 open reading frame 31
241 AI810764 --- Transcribed locus
242 AA058832 TMEM178 transmembrane protein 178
243 AI559300 SPATA18 spermatogenesis associated 18 homolog (rat)
244 AA741058 ATG16L2 ATG16 autophagy related 16-like 2 (S. cerevisiae)
245 AI075407 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
246 AA760738 --- CDNA FLJ42331 fis, clone TSTOM2000588
247 BG252802 --- Transcribed locus
248 AA902480 MGC5370 hypothetical protein MGC5370
249 AA234096 MGC16121 hypothetical protein MGC16121
250 AI625235 C20orf199 chromosome 20 open reading frame 199
251
Phosphoribosylglycinamide formyltransferase,
phosphoribosylglycinamide synthetase,
phosphoribosylaminoimidazole synthetase
AI207338 GART
252 AI139993 --- Transcribed locus
253
PRP38 pre-mRNA processing factor 38 (yeast) domain
N32872 PRPF38B containing B
254 BE326919 --- Transcribed locus
255 BF510429 CLINT1 clathrin interactor 1
256 AL042483 SPATA18 spermatogenesis associated 18 homolog (rat)
105

CHAPTER 3
RESULTS
257 AI912194 --- Transcribed locus
258
AK024931 GALNT10
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-
acetylgalactosaminyltransferase 10 (GalNAc-T10)
259 AI698574 TTLL6 tubulin tyrosine ligase-like family, member 6
260 AW262311 --- ---
261
metastasis associated lung adenocarcinoma transcript 1
NM_014086 MALAT1 (non-protein coding)
262 N90870 --- CDNA FLJ38472 fis, clone FEBRA2022148
263 AL137763 GRHL3 grainyhead-like 3 (Drosophila)
264 BE927772 SFRS3 Splicing factor, arginine/serine-rich 3
265 AV703311 SCARB1 scavenger receptor class B, member 1
266 AK000106 --- CDNA FLJ20099 fis, clone COL04544
267 AU156721 PAPPA pregnancy-associated plasma protein A, pappalysin 1
268 AB046817 SYTL2 synaptotagmin-like 2
269 AU155094 ANXA1 Annexin A1
270 AK021804 --- CDNA FLJ38472 fis, clone FEBRA2022148
271 AL034418 SULF2 sulfatase 2
272 AV699657 TncRNA trophoblast-derived noncoding RNA
273 AA828371 VPS13C Vacuolar protein sorting 13 homolog C (S. cerevisiae)
274 AW292765 --- CDNA FLJ42786 fis, clone BRAWH3006761
275 AI270356 --- CDNA FLJ31593 fis, clone NT2RI2002481
276 AI040887 ARHGEF7 Rho guanine nucleotide exchange factor (GEF) 7
277 BF689253 SPOCD1 SPOC domain containing 1
278 AA889628 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2)
279 AL036662 --- ---
280 AA703280 --- ---
281 AW591809 --- CDNA FLJ35091 fis, clone PLACE6005786
282 AI693336 FOXA1 Forkhead box A1
283 AI359676 LOC727770 similar to ankyrin repeat domain 20 family, member A1
284 AI479082 FLJ41484 hypothetical LOC650669
285 AV659198 TncRNA trophoblast-derived noncoding RNA
286 AI307802 ANKRD29 ankyrin repeat domain 29
287 AI521618 TPM1 Tropomyosin 1 (alpha)
288 AI422414 --- Transcribed locus
289 AA876179 --- Transcribed locus
290 AI924046 --- Transcribed locus
291 BF512162 C3orf55 chromosome 3 open reading frame 55
292 AI342246 --- Transcribed locus
293 BF970185 --- Transcribed locus
294 AI743261 FAM98A Family with sequence similarity 98, member A
295 AI686890 --- Transcribed locus
296 BE274992 RNF144B ring finger 144B
297 BF061543 --- Transcribed locus
298 AW172407 --- CDNA FLJ37304 fis, clone BRAMY2016070
106

CHAPTER 3
RESULTS
299 BF244402 FBXO32 F-box protein 32
300 AW962458 --- Transcribed locus
301 AA019641 --- Transcribed locus
302 BG260086 XDH xanthine dehydrogenase
303 AW973232 RNF12 Ring finger protein 12
304 AW970888 --- CDNA clone IMAGE:5314281
305 AI078033 --- Transcribed locus
306
Transcribed locus, strongly similar to XP_001160512.1
PREDICTED: hypothetical protein [Pan troglodytes]
AI291804 ---
307 AI458949 IFNGR1 interferon gamma receptor 1
308 W84667 --- ---
309 AI498610 --- ---
310 AA883831 --- Transcribed locus
311 BF224218 --- Transcribed locus
312 M15330 IL1B interleukin 1, beta
Table 3.1.2B List of Down-regulated Genes: Control Vs 5X2 Gy
S.No Public ID Gene Symbol Gene Title
1 NM_020380 CASC5 cancer susceptibility candidate 5
2 NM_144508 CASC5 cancer susceptibility candidate 5
3
TAF5 RNA polymerase II, TATA box binding protein
(TBP)-associated factor, 100kDa
NM_139052 TAF5
4 NM_001453 FOXC1 forkhead box C1
5 BC032247 RBL1 retinoblastoma-like 1 (p107)
6 BC008680 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
7
sterile alpha motif and leucine zipper containing kinase
AZK
AF465843 ZAK
8 BC026969 WDR67 WD repeat domain 67
9 BC043596 FANCB Fanconi anemia, complementation group B
10 AI917078 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
11 BC041481 FLJ35848 hypothetical protein FLJ35848
12 BC040700 --- Homo sapiens, clone IMAGE:5580334, mRNA
13 AK096748 ZNF519 zinc finger protein 519
14 BC033560 --- CDNA clone IMAGE:4824158
15 NM_006623 PHGDH phosphoglycerate dehydrogenase
16 NM_006739 MCM5 minichromosome maintenance complex component 5
17
18
BE550486
SLC2A3
solute carrier family 2 (facilitated glucose transporter),
member 3
solute carrier family 2 (facilitated glucose transporter),
member 3
NM_006931 SLC2A3
19 BC000192 DHFR dihydrofolate reductase
20 NM_015180 SYNE2 spectrin repeat containing, nuclear envelope 2
107

CHAPTER 3
RESULTS
21 NM_001254 CDC6 cell division cycle 6 homolog (S. cerevisiae)
22
NM_001262 CDKN2C
cyclin-dependent kinase inhibitor 2C (p18, inhibits
CDK4)
23 BF305380 GTSE1 G-2 and S-phase expressed 1
24 NM_004523 KIF11 kinesin family member 11
25
ARHGAP11
NM_014783 A
Rho GTPase activating protein 11A
26 NM_003686 EXO1 exonuclease 1
27 NM_004856 KIF23 kinesin family member 23
28 NM_007086 WDHD1 WD repeat and HMG-box DNA binding protein 1
29 U17105 CCNF cyclin F
30 NM_014264 PLK4 polo-like kinase 4 (Drosophila)
31 AF154830 CPS1 carbamoyl-phosphate synthetase 1, mitochondrial
32 NM_002828 PTPN2 protein tyrosine phosphatase, non-receptor type 2
33 NM_001809 CENPA centromere protein A
34 NM_001673 ASNS asparagine synthetase
35 NM_004153 ORC1L origin recognition complex, subunit 1-like (yeast)
36 NM_013296 GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans)
37 AL365505 RBL1 retinoblastoma-like 1 (p107)
38
NM_021992
MGC39900
/// TMSL8 thymosin-like 8 /// thymosin beta15b
39 NM_001274 CHEK1 CHK1 checkpoint homolog (S. pombe)
40 NM_002692 POLE2 polymerase (DNA directed), epsilon 2 (p59 subunit)
41 NM_014645 CEP135 centrosomal protein 135kDa
42 NM_014875 KIF14 kinesin family member 14
43 NM_002530 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
44 NM_015653 RIBC2 RIB43A domain with coiled-coils 2
45 NM_005196 CENPF centromere protein F, 350/400ka (mitosin)
46 U30872 CENPF centromere protein F, 350/400ka (mitosin)
47 AI373676 SMC3 structural maintenance of chromosomes 3
48
AW157094 ID4
inhibitor of DNA binding 4, dominant negative helixloop-helix
protein
49 BG054916 PTCH1 patched homolog 1 (Drosophila)
50
AF225416 SPC25
SPC25, NDC80 kinetochore complex component,
homolog (S. cerevisiae)
51
AF016535 ABCB1
ATP-binding cassette, sub-family B (MDR/TAP), member
1
52
AF016535
ABCB1 ///
ABCB4
ATP-binding cassette, sub-family B (MDR/TAP), member
1 /// ATP-binding cassette, sub-family B (MDR/TAP),
member 4
53 Z25425 NEK2 NIMA (never in mitosis gene a)-related kinase 2
54 BC005832 KIAA0101 KIAA0101
55 BC005995 GINS4 GINS complex subunit 4 (Sld5 homolog)
56 U17074 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits
108

CHAPTER 3
RESULTS
CDK4)
57 AU152107 MKI67 antigen identified by monoclonal antibody Ki-67
58 AU132185 MKI67 antigen identified by monoclonal antibody Ki-67
59 BF001806 MKI67 antigen identified by monoclonal antibody Ki-67
60 AU147044 MKI67 antigen identified by monoclonal antibody Ki-67
61 AI695017 MTUS1 mitochondrial tumor suppressor 1
62 BE552421 MTUS1 mitochondrial tumor suppressor 1
63 AL096842 MTUS1 mitochondrial tumor suppressor 1
64 D38553 NCAPH non-SMC condensin I complex, subunit H
65 BE045993 OIP5 Opa interacting protein 5
66 T87225 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
67 X95152 BRCA2 breast cancer 2, early onset
68 AL109696 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
69 BF973178 GTSE1 G-2 and S-phase expressed 1
70
solute carrier family 2 (facilitated glucose transporter),
member 3 /// solute carrier family 2 (facilitated glucose
transporter), member 14
SLC2A14 ///
AL110298 SLC2A3
71 AA807529 MCM5 minichromosome maintenance complex component 5
72 AJ251844 MYST3 MYST histone acetyltransferase (monocytic leukemia) 3
73 NM_022346 NCAPG non-SMC condensin I complex, subunit G
74 NM_014109 ATAD2 ATPase family, AAA domain containing 2
75 AF118887 VAV3 vav 3 guanine nucleotide exchange factor
76 NM_012177 FBXO5 F-box protein 5
77 NM_020242 KIF15 kinesin family member 15
78
excision repair cross-complementing rodent repair
NM_017669 ERCC6L deficiency, complementation group 6-like
79 NM_018365 MNS1 meiosis-specific nuclear structural 1
80
NM_018123 ASPM
asp (abnormal spindle) homolog, microcephaly associated
(Drosophila)
81 NM_024680 E2F8 E2F transcription factor 8
82 NM_022488 ATG3 ATG3 autophagy related 3 homolog (S. cerevisiae)
83 NM_018518 MCM10 minichromosome maintenance complex component 10
84 BC001651 CDCA8 cell division cycle associated 8
85 BC003186 GINS2 GINS complex subunit 2 (Psf2 homolog)
86 AF360549 BRIP1 BRCA1 interacting protein C-terminal helicase 1
87 AA886335 CALML4 calmodulin-like 4
88 AW195581 GPSM2 G-protein signaling modulator 2 (AGS3-like, C. elegans)
89 AI859865 MCM4 minichromosome maintenance complex component 4
90
solute carrier family 2 (facilitated glucose transporter),
member 3 /// solute carrier family 2 (facilitated glucose
transporter), member 14
SLC2A14 ///
AA778684 SLC2A3
91 BF684446 AXIN2 axin 2 (conductin, axil)
92 AI925583 ATAD2 ATPase family, AAA domain containing 2
93 AB042719 MCM10 minichromosome maintenance complex component 10
109

CHAPTER 3
RESULTS
94 BC002493 TCF19 transcription factor 19 (SC1)
95 AF177340 CLDN2 claudin 2
96 AL136840 MCM10 minichromosome maintenance complex component 10
97 AY028916 MND1 meiotic nuclear divisions 1 homolog (S. cerevisiae)
98 AV686514 EMP2 epithelial membrane protein 2
99 AL512758 CPLX2 complexin 2
100 BE504653 RIF1 RAP1 interacting factor homolog (yeast)
101 AW003459 SLFN11 schlafen family member 11
102
103
AK024288
regulatory factor X, 2 (influences HLA class II
expression)
RFX2
LOC1001281
91 hypothetical protein LOC100128191
H28597
104 BF248364 CASC5 cancer susceptibility candidate 5
105 AW004016 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
106 AI140305 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
107 BF059556 C18orf54 chromosome 18 open reading frame 54
108 N62196 ZNF367 zinc finger protein 367
109 AW572379 --- CDNA clone IMAGE:5263455
110
hCG_203303
9 hypothetical protein BC006136
AA805700
111 AI638593 C15orf42 chromosome 15 open reading frame 42
112 AA041523 C6orf176 chromosome 6 open reading frame 176
113 BE858063 LOC730631 Hypothetical LOC730631
114 AK024292 SGOL1 Shugoshin-like 1 (S. pombe)
115 BE670098 USP37 ubiquitin specific peptidase 37
116
asp (abnormal spindle) homolog, microcephaly associated
(Drosophila)
AK001380 ASPM
117 AI953354 --- CDNA: FLJ20913 fis, clone ADSE00630
118 AK026197 FBXO5 F-box protein 5
119 AL138828 FAM54A family with sequence similarity 54, member A
120 BG170335 ECT2 epithelial cell transforming sequence 2 oncogene
121 AI868315 PHF17 PHD finger protein 17
122 BF974463 CXorf56 chromosome X open reading frame 56
123 AA740849 ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae)
124 AA938184 --- Transcribed locus
125 AW183154 KIF14 kinesin family member 14
126 AW269645 ECT2 Epithelial cell transforming sequence 2 oncogene
127 T90771 SYNC1 Syncoilin, intermediate filament 1
128 BF447038 SP8 Sp8 transcription factor
129 BE218107 EPHA5 EPH receptor A5
130 BE620598 LOC201725 hypothetical protein LOC201725
131 AA224205 CHEK1 CHK1 checkpoint homolog (S. pombe)
132 AA573088 LOC730631 Hypothetical LOC730631
133 AI860012 GAS2L3 Growth arrest-specific 2 like 3
110

CHAPTER 3
RESULTS
134 AL045793 METT10D methyltransferase 10 domain containing
135 R54683 MCM6 minichromosome maintenance complex component 6
136 AI220472 --- Transcribed locus
137 AI928037 RUNDC3B RUN domain containing 3B
138 AA019836 C18orf54 Chromosome 18 open reading frame 54
139 BF666241 RIF1 RAP1 interacting factor homolog (yeast)
140 AI733194 --- Transcribed locus
141 BF516341 --- Transcribed locus
142 AI360832 --- Homo sapiens, clone IMAGE:3660074, mRNA
143 AI684761 SYNE2 spectrin repeat containing, nuclear envelope 2
144 AI924134 --- Transcribed locus
145 AW300380 SYNE1 spectrin repeat containing, nuclear envelope 1
146
sema domain, immunoglobulin domain (Ig), short basic
domain, secreted, (semaphorin) 3A
BF215018 SEMA3A
147 BG283921 C18orf54 chromosome 18 open reading frame 54
148 AI144299 DHFR dihydrofolate reductase
149 AW025529 CALML4 calmodulin-like 4
Table 3.1.2C List of Up-regulated genes: 2Gy Vs 5X2Gy
S.No Public ID Gene Symbol Gene Title
1 M21121 CCL5 chemokine (C-C motif) ligand 5
2 NM_005764 PDZK1IP1 PDZK1 interacting protein 1
3 AF043341 CCL5 chemokine (C-C motif) ligand 5
4 BC039509 LOC643401 hypothetical protein LOC643401
5
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
BE708432 MALAT1
6 BC043411 --- Homo sapiens, clone IMAGE:6155889, mRNA
7 AL832227 BCL8 B-cell CLL/lymphoma 8
8 AL832227 BCL8 B-cell CLL/lymphoma 8
9 AF086134 --- Full length insert cDNA clone ZA88B06
10
serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 1
BC020765 SERPINE1
11 BC023629 PDLIM7 PDZ and LIM domain 7 (enigma)
12 NM_001613 ACTA2 actin, alpha 2, smooth muscle, aorta
13 AF010314 ENC1 ectodermal-neural cortex (with BTB-like domain)
14 BG491844 JUN jun oncogene
15 NM_002228 JUN jun oncogene
16 NM_002276 KRT19 keratin 19
17
myxovirus (influenza virus) resistance 1, interferoninducible
protein p78 (mouse)
NM_002462 MX1
18 NM_005562 LAMC2 laminin, gamma 2
19 BC002666 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa
111

CHAPTER 3
RESULTS
20 NM_001710 CFB complement factor B
21 AW117498 FOXO1 forkhead box O1
22 NM_004120 GBP2 guanylate binding protein 2, interferon-inducible
23
angiotensinogen (serpin peptidase inhibitor, clade A,
member 8)
NM_000029 AGT
24 NM_001548 IFIT1 interferon-induced protein with tetratricopeptide repeats 1
25 NM_001345 DGKA diacylglycerol kinase, alpha 80kDa
26 NM_005103 FEZ1 fasciculation and elongation protein zeta 1 (zygin I)
27
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase
2
NM_004267 CHST2
28 NM_004585 RARRES3 retinoic acid receptor responder (tazarotene induced) 3
29 NM_006851 GLIPR1 GLI pathogenesis-related 1 (glioma)
30 NM_000698 ALOX5 arachidonate 5-lipoxygenase
31
chemokine (C-X-C motif) ligand 1 (melanoma growth
stimulating activity, alpha)
NM_001511 CXCL1
32 NM_004961 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon
33 NM_002985 CCL5 chemokine (C-C motif) ligand 5
34 NM_001549 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
35 NM_000203 IDUA iduronidase, alpha-L-
36 NM_000576 IL1B interleukin 1, beta
37 AB046692 AOX1 aldehyde oxidase 1
38 NM_001159 AOX1 aldehyde oxidase 1
39 NM_000600 IL6 interleukin 6 (interferon, beta 2)
40 AF026303 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
41 NM_005101 ISG15 ISG15 ubiquitin-like modifier
42 NM_005658 TRAF1 TNF receptor-associated factor 1
43 NM_001785 CDA cytidine deaminase
44 NM_003733 OASL 2'-5'-oligoadenylate synthetase-like
45 NM_000777 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
46 NM_002185 IL7R interleukin 7 receptor
47 NM_016352 CPA4 carboxypeptidase A4
48
GABBR1 ///
NM_006398 UBD
49 NM_001086 AADAC arylacetamide deacetylase (esterase)
50 NM_002652 PIP prolactin-induced protein
51 NM_015364 LY96 lymphocyte antigen 96
gamma-aminobutyric acid (GABA) B receptor, 1 ///
ubiquitin D
52
egf-like module containing, mucin-like, hormone
NM_001974 EMR1 receptor-like 1
53 NM_001531 MR1 major histocompatibility complex, class I-related
54 NM_013314 BLNK B-cell linker
55
SAA1 ///
NM_030754 SAA2 serum amyloid A1 /// serum amyloid A2
56 AF204231 GOLGA8A golgi autoantigen, golgin subfamily a, 8A
57 BC001743 C7orf44 chromosome 7 open reading frame 44
112

CHAPTER 3
RESULTS
58 AF237813 ABAT 4-aminobutyrate aminotransferase
59 AF237813 ABAT 4-aminobutyrate aminotransferase
60
X16354 CEACAM1
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
61
M87507 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
62 M15329 IL1A interleukin 1, alpha
63 AF010446 MR1 major histocompatibility complex, class I-related
64 M11734 CSF2 colony stimulating factor 2 (granulocyte-macrophage)
65 M13436 INHBA inhibin, beta A
66 AF063612 OASL 2'-5'-oligoadenylate synthetase-like
67 AF064771 DGKA diacylglycerol kinase, alpha 80kDa
68
U13699 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
69
U13700 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
70
AF119873 SERPINA1
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase,
antitrypsin), member 1
71 AF186255 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
72 AF043337 IL8 interleukin 8
73
M76742 CEACAM1
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
74 D86983 PXDN peroxidasin homolog (Drosophila)
75
AL541302 SERPINE2
serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 2
76 AW052179 COL4A5 collagen, type IV, alpha 5 (Alport syndrome)
77 AA083478 TRIM22 tripartite motif-containing 22
78 AA554945 --- Transcribed locus
79 AI337069 RSAD2 radical S-adenosyl methionine domain containing 2
80 AI912583 GLIPR1 GLI pathogenesis-related 1 (glioma)
81 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
82 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
83 NM_006417 IFI44 interferon-induced protein 44
84
SAA1 ///
M23699 SAA2 serum amyloid A1 /// serum amyloid A2
85 AK000923 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3
86 W46388 SOD2 superoxide dismutase 2, mitochondrial
87 AL080207 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12
88 BE888744 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
89 NM_000064 C3 complement component 3
90 NM_004669 CLIC3 chloride intracellular channel 3
91 NM_015900 PLA1A phospholipase A1 member A
92 AL136861 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2
93 AF133207 HSPB8 heat shock 22kDa protein 8
113

CHAPTER 3
RESULTS
94
oligonucleotide/oligosaccharide-binding fold containing
AU157541 OBFC2A 2A
95 AK024680 --- CDNA: FLJ21027 fis, clone CAE07110
96 AB056106 ABI3BP ABI gene family, member 3 (NESH) binding protein
97 AL136680 GBP3 guanylate binding protein 3
98 AF228422 C15orf48 chromosome 15 open reading frame 48
99
AA827878 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
100
AF113016 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
101 AF229179 TMEM27 transmembrane protein 27
102
AF132202 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
103
AI446756 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
104
AF001540 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
105
BG534952 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
106
AW005982 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
107 AI355441 --- CDNA FLJ26120 fis, clone SYN00419
108 N21643 --- CDNA FLJ39585 fis, clone SKMUS2006633
109 N21426 SYTL2 synaptotagmin-like 2
110 AW006123 FBXO32 F-box protein 32
111 N32834 GLIPR1 GLI pathogenesis-related 1 (glioma)
112 AV682252 GLIPR1 GLI pathogenesis-related 1 (glioma)
113 BE967311 MCC mutated in colorectal cancers
114 AL513673 CYGB cytoglobin
115
W80468 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
116 AA131041 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
117 AU155361 TncRNA trophoblast-derived noncoding RNA
118
AA524669
LOC1001315
64 hypothetical protein LOC100131564
119 AI343467 --- CDNA FLJ11041 fis, clone PLACE1004405
120 BE673226 C15orf52 chromosome 15 open reading frame 52
121 AI459194 EGR1 Early growth response 1
122
AL037917 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
123 BF591483 NTN1 netrin 1
124 AI953847 RNF144B ring finger 144B
125 BE048571 MGC16121 hypothetical protein MGC16121
126 AA741307 SAMD9 sterile alpha motif domain containing 9
114

CHAPTER 3
RESULTS
127 AI809749 ORMDL1 ORM1-like 1 (S. cerevisiae)
128 AI810764 --- Transcribed locus
129 AA058832 TMEM178 transmembrane protein 178
130 AI559300 SPATA18 spermatogenesis associated 18 homolog (rat)
131 AI075407 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
132 AA760738 --- CDNA FLJ42331 fis, clone TSTOM2000588
133 BG252802 --- Transcribed locus
134 AA234096 MGC16121 hypothetical protein MGC16121
135 AI625235 C20orf199 chromosome 20 open reading frame 199
136 BE669858 SAMD9L sterile alpha motif domain containing 9-like
137
Phosphoribosylglycinamide formyltransferase,
phosphoribosylglycinamide synthetase,
phosphoribosylaminoimidazole synthetase
AI207338 GART
138 BF510429 CLINT1 clathrin interactor 1
139 AL042483 SPATA18 spermatogenesis associated 18 homolog (rat)
140 AW003173 STC1 Stanniocalcin 1
141 AW014593 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa
142 AW262311 --- ---
143
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
NM_014086 MALAT1
144 AK000106 --- CDNA FLJ20099 fis, clone COL04544
145 AU144005 --- CDNA FLJ11397 fis, clone HEMBA1000622
146 AB046817 SYTL2 synaptotagmin-like 2
147 AU155094 ANXA1 Annexin A1
148
oligonucleotide/oligosaccharide-binding fold containing
2A
AV734843 OBFC2A
149 AK021804 --- CDNA FLJ38472 fis, clone FEBRA2022148
150 AV699657 TncRNA trophoblast-derived noncoding RNA
151 AW292765 --- CDNA FLJ42786 fis, clone BRAWH3006761
152 BF689253 SPOCD1 SPOC domain containing 1
153 AL036662 --- ---
154 H09245 WWC1 WW and C2 domain containing 1
155 AV659198 TncRNA trophoblast-derived noncoding RNA
156 AI521618 TPM1 Tropomyosin 1 (alpha)
157 AI342246 --- Transcribed locus
158 AW954199 --- Transcribed locus
159 BF061543 --- Transcribed locus
160 AW172407 --- CDNA FLJ37304 fis, clone BRAMY2016070
161 BF244402 FBXO32 F-box protein 32
162 AW962458 --- Transcribed locus
163 AA019641 --- Transcribed locus
164 BG260086 XDH xanthine dehydrogenase
165 BE877420 --- Transcribed locus
166 AI078033 --- Transcribed locus
115

CHAPTER 3
RESULTS
167 BG026159 --- CDNA FLJ42225 fis, clone THYMU2040427
168 AI986192 SERPINB9 serpin peptidase inhibitor, clade B (ovalbumin), member 9
169 AI458949 IFNGR1 interferon gamma receptor 1
170 AI498610 --- ---
171 BF224218 --- Transcribed locus
172 M15330 IL1B interleukin 1, beta
Table 3.1.2D List of Down-regulated genes: 2Gy Vs 5X2Gy
S.No Public ID Gene Symbol Gene Title
1 BC032247 RBL1 retinoblastoma-like 1 (p107)
2 BC008680 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
3 BC026969 WDR67 WD repeat domain 67
4 BC043596 FANCB Fanconi anemia, complementation group B
5 AI917078 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
6 BG387892 RBL1 retinoblastoma-like 1 (p107)
7 AK021715 --- CDNA FLJ11653 fis, clone HEMBA1004538
8 BC040700 --- Homo sapiens, clone IMAGE:5580334, mRNA
9 AK096748 ZNF519 zinc finger protein 519
10 NM_006623 PHGDH phosphoglycerate dehydrogenase
11 NM_006739 MCM5 minichromosome maintenance complex component 5
12 NM_015180 SYNE2 spectrin repeat containing, nuclear envelope 2
13
cyclin-dependent kinase inhibitor 2C (p18, inhibits
CDK4)
NM_001262 CDKN2C
14 BE535746 REEP1 receptor accessory protein 1
15 NM_003609 HIRIP3 HIRA interacting protein 3
16 NM_003686 EXO1 exonuclease 1
17 NM_007086 WDHD1 WD repeat and HMG-box DNA binding protein 1
18 NM_001673 ASNS asparagine synthetase
19
MGC39900
NM_021992 /// TMSL8 thymosin-like 8 /// thymosin beta15b
20 NM_002692 POLE2 polymerase (DNA directed), epsilon 2 (p59 subunit)
21 NM_015653 RIBC2 RIB43A domain with coiled-coils 2
22
SPC25, NDC80 kinetochore complex component,
AF225416 SPC25 homolog (S. cerevisiae)
23 Z25425 NEK2 NIMA (never in mitosis gene a)-related kinase 2
24 BC005995 GINS4 GINS complex subunit 4 (Sld5 homolog)
25 AU152107 MKI67 antigen identified by monoclonal antibody Ki-67
26 AU132185 MKI67 antigen identified by monoclonal antibody Ki-67
27 BF001806 MKI67 antigen identified by monoclonal antibody Ki-67
28 AI695017 MTUS1 mitochondrial tumor suppressor 1
29 AL096842 MTUS1 mitochondrial tumor suppressor 1
30 T87225 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
116

CHAPTER 3
RESULTS
31 BE615699 UNC84A unc-84 homolog A (C. elegans)
32 S76476 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
33 AL109696 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
34
defective in sister chromatid cohesion 1 homolog (S.
cerevisiae)
NM_024094 DSCC1
35 NM_018365 MNS1 meiosis-specific nuclear structural 1
36 NM_024749 VASH2 vasohibin 2
37 NM_024680 E2F8 E2F transcription factor 8
38 BC003186 GINS2 GINS complex subunit 2 (Psf2 homolog)
39 AA886335 CALML4 calmodulin-like 4
40 BF684446 AXIN2 axin 2 (conductin, axil)
41 AB042719 MCM10 minichromosome maintenance complex component 10
42 BC002493 TCF19 transcription factor 19 (SC1)
43 AF177340 CLDN2 claudin 2
44 AY028916 MND1 meiotic nuclear divisions 1 homolog (S. cerevisiae)
45 AV686514 EMP2 epithelial membrane protein 2
46 AL512758 CPLX2 complexin 2
47 AI092930 WDR20 WD repeat domain 20
48 AW004016 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
49 AA406603 CLCC1 Chloride channel CLIC-like 1
50 AI823645 PRIMA1 proline rich membrane anchor 1
51 AK024292 SGOL1 Shugoshin-like 1 (S. pombe)
52 BE670098 USP37 ubiquitin specific peptidase 37
53 AI953354 --- CDNA: FLJ20913 fis, clone ADSE00630
54 AA938184 --- Transcribed locus
55 AW269645 ECT2 Epithelial cell transforming sequence 2 oncogene
56 AL045793 METT10D methyltransferase 10 domain containing
57 R54683 MCM6 minichromosome maintenance complex component 6
58 AA019836 C18orf54 Chromosome 18 open reading frame 54
59 AI924134 --- Transcribed locus
60 BG283921 C18orf54 chromosome 18 open reading frame 54
61 AI144299 DHFR dihydrofolate reductase
62 AW025529 CALML4 calmodulin-like 4
Table 3.1.2E List of Up-regulated genes: 10Gy Vs 5X2Gy
S.No Public ID Gene Symbol Gene Title
1 M21121 CCL5 chemokine (C-C motif) ligand 5
2 NM_153838 GPR115 G protein-coupled receptor 115
3 NM_005764 PDZK1IP1 PDZK1 interacting protein 1
4 AF043341 CCL5 chemokine (C-C motif) ligand 5
5 CA428769 RTN4 reticulon 4
6 AW079553 --- CDNA FLJ41020 fis, clone UTERU2019163
117

CHAPTER 3
RESULTS
7 AA580691 RBM25 RNA binding motif protein 25
8 AK055254 --- CDNA FLJ30692 fis, clone FCBBF2000677
9 BQ944989 STRAP Serine/threonine kinase receptor associated protein
10
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
BE708432 MALAT1
11 AL832227 BCL8 B-cell CLL/lymphoma 8
12 AL832227 BCL8 B-cell CLL/lymphoma 8
13 AF086134 --- Full length insert cDNA clone ZA88B06
14 BI868311 ARF1 ADP-ribosylation factor 1
15 AL832409 TGIF1 TGFB-induced factor homeobox 1
16
serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 1
BC020765 SERPINE1
17 BC023629 PDLIM7 PDZ and LIM domain 7 (enigma)
18 BF111821 WSB1 WD repeat and SOCS box-containing 1
19 AF010314 ENC1 ectodermal-neural cortex (with BTB-like domain)
20 NM_003633 ENC1 ectodermal-neural cortex (with BTB-like domain)
21 BG491844 JUN jun oncogene
22 NM_002228 JUN jun oncogene
23 NM_002276 KRT19 keratin 19
24 NM_005562 LAMC2 laminin, gamma 2
25 BC002666 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa
26 NM_001710 CFB complement factor B
27 NM_006290 TNFAIP3 tumor necrosis factor, alpha-induced protein 3
28 NM_001548 IFIT1 interferon-induced protein with tetratricopeptide repeats 1
29 AF097493 GLS glutaminase
30 NM_014905 GLS glutaminase
31 NM_001345 DGKA diacylglycerol kinase, alpha 80kDa
32
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase
NM_004267 CHST2 2
33 NM_004585 RARRES3 retinoic acid receptor responder (tazarotene induced) 3
34 NM_006851 GLIPR1 GLI pathogenesis-related 1 (glioma)
35
NM_001511 CXCL1
chemokine (C-X-C motif) ligand 1 (melanoma growth
stimulating activity, alpha)
36 NM_004961 GABRE gamma-aminobutyric acid (GABA) A receptor, epsilon
37 NM_003155 STC1 stanniocalcin 1
38 NM_002985 CCL5 chemokine (C-C motif) ligand 5
39 NM_001549 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
40 NM_006994 BTN3A3 butyrophilin, subfamily 3, member A3
41 NM_006307 SRPX sushi-repeat-containing protein, X-linked
42 NM_000203 IDUA iduronidase, alpha-L-
43 NM_000576 IL1B interleukin 1, beta
44 AB046692 AOX1 aldehyde oxidase 1
45 NM_001159 AOX1 aldehyde oxidase 1
46 NM_000600 IL6 interleukin 6 (interferon, beta 2)
118

CHAPTER 3
RESULTS
47 AF026303 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
48 NM_005101 ISG15 ISG15 ubiquitin-like modifier
49 NM_005658 TRAF1 TNF receptor-associated factor 1
50 NM_001785 CDA cytidine deaminase
51 NM_000756 CRH corticotropin releasing hormone
52 NM_003733 OASL 2'-5'-oligoadenylate synthetase-like
53 NM_000777 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
54 NM_002185 IL7R interleukin 7 receptor
55 NM_016352 CPA4 carboxypeptidase A4
56 NM_005393 PLXNB3 plexin B3
57 NM_001086 AADAC arylacetamide deacetylase (esterase)
58 NM_002852 PTX3 pentraxin-related gene, rapidly induced by IL-1 beta
59 NM_002652 PIP prolactin-induced protein
60 NM_015364 LY96 lymphocyte antigen 96
61
FAM36A /// homeobox A7 /// family with sequence similarity 36,
NM_006896 HOXA7 member A
62
egf-like module containing, mucin-like, hormone
NM_001974 EMR1 receptor-like 1
63 NM_013314 BLNK B-cell linker
64 NM_002090 CXCL3 chemokine (C-X-C motif) ligand 3
65
SAA1 ///
NM_030754 SAA2 serum amyloid A1 /// serum amyloid A2
66 AF204231 GOLGA8A golgi autoantigen, golgin subfamily a, 8A
67 BC001743 C7orf44 chromosome 7 open reading frame 44
68 AF237813 ABAT 4-aminobutyrate aminotransferase
69 AF237813 ABAT 4-aminobutyrate aminotransferase
70
X16354 CEACAM1
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
71 M57731 CXCL2 chemokine (C-X-C motif) ligand 2
72
M87507 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
73 D26121 SF1 splicing factor 1
74 M11734 CSF2 colony stimulating factor 2 (granulocyte-macrophage)
75
AF164622
GOLGA8A
///
GOLGA8B
golgi autoantigen, golgin subfamily a, 8A /// golgi
autoantigen, golgin subfamily a, 8B
76 M13436 INHBA inhibin, beta A
77 AF119863 MEG3 maternally expressed 3
78 AF063612 OASL 2'-5'-oligoadenylate synthetase-like
79 AF064771 DGKA diacylglycerol kinase, alpha 80kDa
80
U13699 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
81
U13700 CASP1
caspase 1, apoptosis-related cysteine peptidase
(interleukin 1, beta, convertase)
119

CHAPTER 3
RESULTS
82 AF186255 SULT1C2 sulfotransferase family, cytosolic, 1C, member 2
83 AF043337 IL8 interleukin 8
84 U20489 PTPRO protein tyrosine phosphatase, receptor type, O
85
carcinoembryonic antigen-related cell adhesion molecule
1 (biliary glycoprotein)
M76742 CEACAM1
86 D86983 PXDN peroxidasin homolog (Drosophila)
87 AW052179 COL4A5 collagen, type IV, alpha 5 (Alport syndrome)
88 BE327172 JUN Jun oncogene
89 AA083478 TRIM22 tripartite motif-containing 22
90 AW103422 PCBP2 poly(rC) binding protein 2
91 AA554945 --- Transcribed locus
92 AI912583 GLIPR1 GLI pathogenesis-related 1 (glioma)
93 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
94 X90579 CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5
95
LOC729222 PTPRF interacting protein, binding protein 1 (liprin beta
AI962377 /// PPFIBP1 1) /// similar to mKIAA1230 protein
96 NM_006417 IFI44 interferon-induced protein 44
97
SAA1 ///
M23699 SAA2 serum amyloid A1 /// serum amyloid A2
98 U79273 EIF4A1 Eukaryotic translation initiation factor 4A, isoform 1
99 AL080207 ABCA12 ATP-binding cassette, sub-family A (ABC1), member 12
100 BE888744 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
101
aldo-keto reductase family 1, member C1 (dihydrodiol
dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid
dehydrogenase)
BF508244 AKR1C1
102 NM_000064 C3 complement component 3
103 NM_021730 NLRP1 NLR family, pyrin domain containing 1
104 NM_017734 PALMD palmdelphin
105 NM_004669 CLIC3 chloride intracellular channel 3
106 NM_016321 RHCG Rh family, C glycoprotein
107 NM_015900 PLA1A phospholipase A1 member A
108 NM_018194 HHAT hedgehog acyltransferase
109 AL136861 CRISPLD2 cysteine-rich secretory protein LCCL domain containing 2
110
oligonucleotide/oligosaccharide-binding fold containing
AU157541 OBFC2A 2A
111 AK024680 --- CDNA: FLJ21027 fis, clone CAE07110
112
BE646573 NFKBIZ
nuclear factor of kappa light polypeptide gene enhancer in
B-cells inhibitor, zeta
113
AB037925 NFKBIZ
nuclear factor of kappa light polypeptide gene enhancer in
B-cells inhibitor, zeta
114 AB056106 ABI3BP ABI gene family, member 3 (NESH) binding protein
115 AL136680 GBP3 guanylate binding protein 3
116
AF113016 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
120

CHAPTER 3
RESULTS
117 BF062193 CYorf15B chromosome Y open reading frame 15B
118 AF229179 TMEM27 transmembrane protein 27
119 AF317392 BCOR BCL6 co-repressor
120
AF132202 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
121 BC006355 PLCD4 phospholipase C, delta 4
122
AI446756 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
123
AF001540 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
124 AI042152 TncRNA trophoblast-derived noncoding RNA
125
BG534952 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
126
AW005982 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
127 AI355441 --- CDNA FLJ26120 fis, clone SYN00419
128 N21643 --- CDNA FLJ39585 fis, clone SKMUS2006633
129 N21426 SYTL2 synaptotagmin-like 2
130 AW006123 FBXO32 F-box protein 32
131 N21030 NRBP2 nuclear receptor binding protein 2
132 N32834 GLIPR1 GLI pathogenesis-related 1 (glioma)
133 AV682252 GLIPR1 GLI pathogenesis-related 1 (glioma)
134 BE217880 IL7R interleukin 7 receptor
135 BE967311 MCC mutated in colorectal cancers
136 BE966604 SAMD9L sterile alpha motif domain containing 9-like
137 AL513673 CYGB cytoglobin
138
AI986239 AHSA2
AHA1, activator of heat shock 90kDa protein ATPase
homolog 2 (yeast)
139
W80468 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
140 AA131041 IFIT2 interferon-induced protein with tetratricopeptide repeats 2
141 AU155361 TncRNA trophoblast-derived noncoding RNA
142
AA524669
LOC1001315
64 hypothetical protein LOC100131564
143 AI343467 --- CDNA FLJ11041 fis, clone PLACE1004405
144 BE673226 C15orf52 chromosome 15 open reading frame 52
145 AI459194 EGR1 Early growth response 1
146 AV728999 MGC16121 hypothetical protein MGC16121
147
AL037917 MALAT1
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
148 BF591483 NTN1 netrin 1
149
AI041522 ---
Transcribed locus, strongly similar to NP_005768.1 RNA
binding motif protein 6 [Homo sapiens]
150 BE048571 MGC16121 hypothetical protein MGC16121
121

CHAPTER 3
RESULTS
151 AA741307 SAMD9 sterile alpha motif domain containing 9
152
AI475544 MALAT1
Metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
153 AI809749 ORMDL1 ORM1-like 1 (S. cerevisiae)
154 AI810764 --- Transcribed locus
155 AA058832 TMEM178 transmembrane protein 178
156 AI075407 IFIT3 interferon-induced protein with tetratricopeptide repeats 3
157 BG252802 --- Transcribed locus
158 AA234096 MGC16121 hypothetical protein MGC16121
159 AI129626 DCLK1 Doublecortin-like kinase 1
160 AI625235 C20orf199 chromosome 20 open reading frame 199
161
Phosphoribosylglycinamide formyltransferase,
phosphoribosylglycinamide synthetase,
phosphoribosylaminoimidazole synthetase
AI207338 GART
162 BF510429 CLINT1 clathrin interactor 1
163 AL042483 SPATA18 spermatogenesis associated 18 homolog (rat)
164 AW003173 STC1 Stanniocalcin 1
165
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-
acetylgalactosaminyltransferase 10 (GalNAc-T10)
AK024931 GALNT10
166 AI698574 TTLL6 tubulin tyrosine ligase-like family, member 6
167 AI038059 DIO2 deiodinase, iodothyronine, type II
168 AW014593 GBP1 guanylate binding protein 1, interferon-inducible, 67kDa
169 AW262311 --- ---
170
metastasis associated lung adenocarcinoma transcript 1
(non-protein coding)
NM_014086 MALAT1
171 N90870 --- CDNA FLJ38472 fis, clone FEBRA2022148
172 AV703311 SCARB1 scavenger receptor class B, member 1
173 AK000106 --- CDNA FLJ20099 fis, clone COL04544
174 AU156721 PAPPA pregnancy-associated plasma protein A, pappalysin 1
175 AB046817 SYTL2 synaptotagmin-like 2
176 AU155094 ANXA1 Annexin A1
177
oligonucleotide/oligosaccharide-binding fold containing
AV734843 OBFC2A 2A
178 AK021804 --- CDNA FLJ38472 fis, clone FEBRA2022148
179 AK026869 TMEM43 Transmembrane protein 43
180
AK025151
hCG_200366
3 hCG2003663
181 AV699657 TncRNA trophoblast-derived noncoding RNA
182 AI972661 --- CDNA FLJ39413 fis, clone PLACE6015729
183 BF591288 --- Transcribed locus
184 AW292765 --- CDNA FLJ42786 fis, clone BRAWH3006761
185 BF689253 SPOCD1 SPOC domain containing 1
186
AV713062
MAP3K8
Mitogen-activated protein kinase kinase kinase 8 ///
CDNA clone IMAGE:4689481
122

CHAPTER 3
RESULTS
187 AL036662 --- ---
188 AW591809 --- CDNA FLJ35091 fis, clone PLACE6005786
189 BE222109 --- Transcribed locus
190 AI693336 FOXA1 Forkhead box A1
191 AV659198 TncRNA trophoblast-derived noncoding RNA
192 AW015521 CAT Catalase
193 AI521618 TPM1 Tropomyosin 1 (alpha)
194 AA644178 IRS1 Insulin receptor substrate 1
195 AI342246 --- Transcribed locus
196 AW963634 --- Transcribed locus
197 AW954199 --- Transcribed locus
198 BF061543 --- Transcribed locus
199 AW962458 --- Transcribed locus
200 AA019641 --- Transcribed locus
201 BG260086 XDH xanthine dehydrogenase
202 BE877420 --- Transcribed locus
203 AW973232 RNF12 Ring finger protein 12
204 AI078033 --- Transcribed locus
205 AI791820 --- Transcribed locus
206
Transcribed locus, strongly similar to XP_001160512.1
PREDICTED: hypothetical protein [Pan troglodytes]
AI291804 ---
207 AI458949 IFNGR1 interferon gamma receptor 1
208 AI498610 --- ---
209 AA167167 --- ---
210 AW292830 --- Transcribed locus
211 M15330 IL1B interleukin 1, beta
Table 3.1.2F List of Down-regulated genes of 10Gy Vs 5X2Gy
S.No Public ID Gene Symbol Gene Title
1 BC032247 RBL1 retinoblastoma-like 1 (p107)
2 BC008680 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
3 BC026969 WDR67 WD repeat domain 67
4 BC040700 --- Homo sapiens, clone IMAGE:5580334, mRNA
5 AK096748 ZNF519 zinc finger protein 519
6 NM_006623 PHGDH phosphoglycerate dehydrogenase
7 BC000192 DHFR dihydrofolate reductase
8 NM_000791 DHFR dihydrofolate reductase
9 NM_015180 SYNE2 spectrin repeat containing, nuclear envelope 2
10 NM_002358 MAD2L1 MAD2 mitotic arrest deficient-like 1 (yeast)
11 U77949 CDC6 cell division cycle 6 homolog (S. cerevisiae)
12 NM_001254 CDC6 cell division cycle 6 homolog (S. cerevisiae)
13 NM_001262 CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits
123

CHAPTER 3
RESULTS
CDK4)
14 NM_003686 EXO1 exonuclease 1
15 AW772140 WDHD1 WD repeat and HMG-box DNA binding protein 1
16 NM_007086 WDHD1 WD repeat and HMG-box DNA binding protein 1
17 NM_002828 PTPN2 protein tyrosine phosphatase, non-receptor type 2
18 NM_001673 ASNS asparagine synthetase
19 AL365505 RBL1 retinoblastoma-like 1 (p107)
20
MGC39900
/// TMSL8 thymosin-like 8 /// thymosin beta15b
NM_021992
21 NM_024908 WDR76 WD repeat domain 76
22 NM_002692 POLE2 polymerase (DNA directed), epsilon 2 (p59 subunit)
23 NM_015653 RIBC2 RIB43A domain with coiled-coils 2
24
acidic (leucine-rich) nuclear phosphoprotein 32 family,
member E
NM_030920 ANP32E
25 BC005832 KIAA0101 KIAA0101
26 BC005995 GINS4 GINS complex subunit 4 (Sld5 homolog)
27 AU132185 MKI67 antigen identified by monoclonal antibody Ki-67
28 BF001806 MKI67 antigen identified by monoclonal antibody Ki-67
29 AI695017 MTUS1 mitochondrial tumor suppressor 1
30 AL096842 MTUS1 mitochondrial tumor suppressor 1
31 T87225 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
32
PDS5, regulator of cohesion maintenance, homolog A (S.
cerevisiae)
AW991219 PDS5A
33 BE615699 UNC84A unc-84 homolog A (C. elegans)
34 X95152 BRCA2 breast cancer 2, early onset
35 AL109696 NTRK3 neurotrophic tyrosine kinase, receptor, type 3
36
37
AA905286
DLEU2 ///
DLEU2L
deleted in lymphocytic leukemia, 2 /// deleted in
lymphocytic leukemia 2-like
defective in sister chromatid cohesion 1 homolog (S.
cerevisiae)
NM_024094 DSCC1
38 NM_018365 MNS1 meiosis-specific nuclear structural 1
39 NM_024680 E2F8 E2F transcription factor 8
40 NM_022488 ATG3 ATG3 autophagy related 3 homolog (S. cerevisiae)
41 NM_018518 MCM10 minichromosome maintenance complex component 10
42 AF360549 BRIP1 BRCA1 interacting protein C-terminal helicase 1
43 AA886335 CALML4 calmodulin-like 4
44 AI859865 MCM4 minichromosome maintenance complex component 4
45 AI859865 MCM4 minichromosome maintenance complex component 4
46 AI925583 ATAD2 ATPase family, AAA domain containing 2
47 BC005400 CENPK centromere protein K
48 AB042719 MCM10 minichromosome maintenance complex component 10
49 BC002493 TCF19 transcription factor 19 (SC1)
50 AY028916 MND1 meiotic nuclear divisions 1 homolog (S. cerevisiae)
51 BC001104 NUPL1 nucleoporin like 1
124

CHAPTER 3
RESULTS
52 AV686514 EMP2 epithelial membrane protein 2
53 AL512758 CPLX2 complexin 2
54 AI889959 HELLS helicase, lymphoid-specific
55 AI341146 E2F7 E2F transcription factor 7
56 AW004016 ST6GAL2 ST6 beta-galactosamide alpha-2,6-sialyltranferase 2
57 AI754871 SPATA5 spermatogenesis associated 5
58 BF059556 C18orf54 chromosome 18 open reading frame 54
59 AI823645 PRIMA1 proline rich membrane anchor 1
60 AW014743 --- Transcribed locus
61 AI654224 ALDH1L2 Aldehyde dehydrogenase 1 family, member L2
62 BE670098 USP37 ubiquitin specific peptidase 37
63 AL117589 KIF26A kinesin family member 26A
64 AI961235 VASH2 vasohibin 2
65 BF974463 CXorf56 chromosome X open reading frame 56
66 AA938184 --- Transcribed locus
67 AA224205 CHEK1 CHK1 checkpoint homolog (S. pombe)
68 AL045793 METT10D methyltransferase 10 domain containing
69 R54683 MCM6 minichromosome maintenance complex component 6
70 AI220472 --- Transcribed locus
71 AA019836 C18orf54 Chromosome 18 open reading frame 54
72 BF516341 --- Transcribed locus
73 AW340004 NARG2 NMDA receptor regulated 2
74 AI360832 --- Homo sapiens, clone IMAGE:3660074, mRNA
75 AI024029 ZNF789 Zinc finger protein 789
76 BG283921 C18orf54 chromosome 18 open reading frame 54
77 AI144299 DHFR dihydrofolate reductase
78 AW025529 CALML4 calmodulin-like 4
3.1.3 Validation of Microarray data.
In order to verify the microarray data, semi-quantitative RT-PCR was performed for four genes
from control and fractionated group of A549 cells. Four genes were CDKN1A (p21),
GADD45α, Toll-like receptor 3 (TLR3) and Ferredoxin reductase (FDXR). These results
corresponded very well with those for the microarray data for all four genes, strongly supporting
the reliability and rationale of the strategy (Fig. 3.1.3A & B).
125

CHAPTER 3
RESULTS
Fig. 3.1.3 Validation of microarray data by semi-quantitative RT-PCR. (A) Fold changes of
genes as determined by microarray analysis. (B) Fold changes of genes as determined by RT-
PCR.
3.1.4 Activation of repair related genes
Microarray data had shown that DNA repair pathways were up-regulated in A549 cells that had
been exposed to fractionated irradiation; it was of interest to look at the activation of genes
involved in DNA repair pathways. When compared to the controls there was a significant upregulation
of ATM, DNA-PK, Rad52 and MLH1 genes in A549 cells that had been exposed to
fractionated irradiation (Fig.3.1.4, A, B, C and D, Lane3). However, in A549 cells that had been
126

CHAPTER 3
RESULTS
exposed to 10 Gy acute dose there was marginal up-regulation of ATM, DNA-PK and Rad52
genes although it was significantly lower than the fractionated group (Fig.3.1.4, A, B, C and D,
Lane4). In A549 cells that had been exposed to 2 Gy acute dose there was marginal upregulation
of Rad52 and MLH1 genes but these were also significantly lower than the
fractionated group(Fig.3.1.4, A, B, C and D, Lane2).
3.1.5 Efficient Repair of DNA
It has been established recently that H2AX at the DNA double strand break (DSB) sites are
immediately phosphorylated upon irradiation, and the phosphorylated H2AX (γ-H2AX) can be
visualized in situ by immunostaining with a γ-H2AX specific antibody [232, 233]. γ-H2AX
induction can be measured quantitatively at physiological doses, and the numbers of residual γ-
H2AX foci can be used to estimate the kinetics of DSB rejoining. This has become the gold
standard for the detection of DSB [233, 234].
Repair kinetics was determined by counting the γ-H2AX foci at 15 min and 4h after irradiation.
As expected maximum numbers of foci were seen at 15 min in A549 cells exposed to 10 Gy
followed by cells exposed to fractionated irradiation and very few foci were seen in cells
exposed to 2 Gy acute dose. By 4h the number of foci in cells exposed to fractionated irradiation
had been reduced to almost control but in the cells exposed to 10 Gy the number of foci was still
very high, indicating that there was efficient repair of DNA in A549 cells that had been exposed
to fractionated irradiation (Fig. 3.1.5).
127

CHAPTER 3
RESULTS
3.1.6 Radiation induced foci of DNA damage response proteins ATM and BRCA1
ATM, an important DNA damage response protein to ionizing radiation and a part of irradiation
induced foci (IRIF), is mainly involved in cell cycle arrest and repair. It gets activated after DNA
double strand break by phosphorylation at ser 1981 and activates many key cellular proteins that
include H2AX, BRCA1, Chk1/2 and p53. Phospho ATM foci and intensity were looked at 4
hours after irradiation. All the cells either exposed to 10 Gy (23±3 foci per cell) or fractionated
irradiation (25±2.8 foci per cell) showed ATM foci but only 10% of cells exposed to 2 Gy
showed ATM foci and the number of foci per cell was 2±0.08 (Fig. 3.1.6A). The intensity of
phosphorylation of ATM was quantified by ImageJ software, was significantly higher in the
fractionated group as compared to any of the treatment groups (control, 2Gy or 10Gy )
BRCA1, which is phosphorylated by ATM, is a part of IRIF and shares many downstream
substrates of ATM. 4 hours after irradiation, A549 cells that had been exposed to 2 Gy acute
dose did not show any BRCA1 foci where as 55 % of cells that had been exposed to fractionated
irradiation showed BRCA1 foci and the number of foci per cells was 24±4. 22% of cells that had
been exposed to 10 Gy acute showed BRCA1 foci and the number of foci per cell was 15±2.1
(Fig. 3.1.6B). The intensity of phosphorylation of BRCA1 as determined by ImageJ software
was significantly higher in the fractionated group as compared to any of the treatment groups
(control, 2Gy or 10Gy).
128

CHAPTER 3
RESULTS
Fig.3.1.4 Gene expression of ATM, DNA-PK, Rad52 and MLH1 in A549 cells irradiated with
different doses of γ-radiation. Total RNA from A549 cells was isolated and reverse transcribed
4h after irradiation. RT-PCR analysis of ATM, DNA-PK, Rad52 and MLH1 genes was carried
out as described in materials and methods. β-Actin gene expression in each group was used as an
internal control. Ratio of intensities of (A) ATM, (B) DNA-PK, (C) Rad52 and (D) MLH1 band
to that of respective β-actin band as quantified from gel pictures are shown above each gel
picture. Key;Lane 1, control unirradiated A549 cell line. Lane 2, 2 Gy acute dose (single dose
that was delivered in each fraction) of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation daily
over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the fraction) 60 Co γ-
irradiation. Data represents means ± SE of three independent experiments; significantly different
from unirradiated controls: *P < 0.05, **P < 0.01.
129

CHAPTER 3
RESULTS
Fig. 3.1.5 Repair kinetics as determined by γ-H2AX foci in different treatment group of A549
cells at 15 min and 4h after irradiation. Cells were fixed 15 minutes and 4 hours after irradiation
in 4% paraformaldehyde, permeabilized in 0.25% Triton X-100 and labeled with specific
antibodies as described in “Materials and Methods”. Each phospho-site antibody was indirectly
labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with
ProLong Gold antifede with DAPI (blue). The encircled area roughly represents cell nuclei as
seen by DAPI staining. All images were captured using Carl Zeiss confocal microscope with the
same exposure time. Representative image of three independent experiments is shown here; at
least 100 cells per experiment were analyzed from three independent experiments.
130

CHAPTER 3
RESULTS
Fig. 3.1.6 Radiation induced foci of DNA damage response proteins (A) ATM and (B) BRCA1
in different treatment group of A549 cells 4h after irradiation. Cells were fixed in 4%
paraformaldehyde 4h after irradiation, permeabilized in 0.25% Triton X-100 and labeled with
specific antibodies as described in “Materials and Methods”. Each phospho-site antibody was
indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted
with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss
confocal microscope with the same exposure time. Representative images of three independent
experiments are shown here; at least 100 cells per experiment were analyzed from three
independent experiments.
131

CHAPTER 3
RESULTS
3.1.7 Translocation of phospho-p53
Microarray data had shown that p53 signaling pathway was up-regualted in A549 cells that had
been exposed to fractionated irradiation; it was of interest to look at the phosphorylation of p53
and its translocation to the nucleus of A549 cells. 18 hours after irradiation, phospho-p53 was
found to be translocated into the nucleus of A549 cells exposed to fractionated irradiation (Fig.
3.1.7A). Phospho-p53 was not found to be translocated into the nucleus of A549 cells that had
been exposed to 2Gy acute dose. However, in A549 cells that had been exposed to 10 Gy acute
dose, there was marginally higher phosphorylation of p53 although it was significantly lower
than the fractionated group (Fig. 3.1.7A). The intensity of phosphorylation was significantly
higher in the cells exposed to fractionated irradiation. Phosphorylation of p53 was further
confirmed by western blot. (Fig. 3.1.7B, Lane3).
3.1.8 Response of A549 and MCF-7 cells exposed to fractionated irradiation.
Having established that among the three cell lines the lung carcinoma cell line A549 was found
to be relatively more radioresistant if the 10 Gy dose was delivered as a fractionated regimen and
MCF-7 cell line more radiosensitive. It was of interest to look at mechanism of such response. 4
h after irradiation, there was a significant up-regulation of ATM, DNA-PK, Rad52 and MLH1
genes in A549 cells but not in MCF-7 cells (Fig. 3.1.8B, Lane3). ATM and BRCA1
phosphorylation was found to be significantly higher 4 h after irradiation in A549 cells but not in
MCF-7 cells (Fig. 3.1.8C). 18 h after irradiation, phospho-p53 was found to be translocated into
the nucleus of A549 cells but not in MCF-7 cells (Fig. 3.1.8C).There was efficient repair of DNA
by 4h in A549 cells as determined by counting γ-H2AX but not in MCF-7 cells (Fig. 3.1.8D).
132

CHAPTER 3
RESULTS
Fig. 3.1.7 Translocation of phospho-p53 into the nucleus of A549 cells 18h after irradiation. (A)
Representative image of three independent experiments showing phosphorylation and
translocation of p53 into nucleus of A549 cells. Each phospho-site antibody was indirectly
labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with
ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss confocal
microscope with the same exposure time. At least 100 cells per experiment were analyzed from
three independent experiments. (B) Representative immunoblot image of three independent
experiments depicting phosphorylation of p53 in different treatment group. Graph represents
phospho-p53 band intensities (divided with the respective loading control intensities and
normalized). Key Lane 1, control unirradiated A549 cell line. Lane 2, 2 Gy acute dose (single
dose that was delivered in each fraction) of 60 Co γ-irradiation Lane 3 2 Gy of 60 Co γ-irradiation
daily over a period of 5 days, Lane 4, 10 Gy acute (which is the sum total of all the fraction)
60 Co γ-irradiation.
133

CHAPTER 3
RESULTS
Fig. 3.1.8 Response of A549 and MCF-7 cells exposed to fractionated irradiation. (A)
Clonogenic Cell Survival of A549 and MCF-7 cells exposed to fractionated irradiation. Data
represents means ± SE of three independent experiments; **P < 0.01 compared with MCF-7 (B)
Representative image of three independent experiments showing gene expression of ATM,
DNA-PK, Rad52 and MLH1 in A549 and MCF-7 cells exposed to fractionated irradiation. β-
Actin gene expression in each group was used as an internal control. (C) Phosphorylation of
ATM, BRCA1 and p53 in A549 and MCF-7 cells exposed to fractionated irradiation. (D) Repair
kinetics as determined by γ-H2AX foci in A549 and MCF-7 cells exposed to fractionated
irradiation at 15 min and 4h after irradiation. Each phospho-site antibody was indirectly labeled
with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong
Gold antifede with DAPI (blue). The encircled area roughly represents cell nuclei as seen by
DAPI staining. All images were captured using Carl Zeiss confocal microscope with the same
exposure time. Representative images of three independent experiments are shown here; at least
100 cells per experiment were analyzed from three independent experiments.
134

CHAPTER 3
RESULTS
3.1.9 Stabilization of DNA-PK mRNA
mRNA stability plays a major role in gene expression in mammalian cells, affecting the rates at
which mRNAs disappear following transcriptional repression and accumulate following
transcriptional induction. An array of exogenous factors, from hormones to viruses to radiation,
influence mRNA halflives in ways that are incompletely understood. It was of interest to look for
the stabilization of different mRNA in A549 cells exposed to fractionated irradiation.
The activation of DNA-PK was accompanied by the stabilization of its mRNA in A549 cells that
had been exposed to fractionated irradiation (Fig. 3.1.9). The ATM and Rad 52 mRNA were not
stabilized indicating a specific and selective stabilization of DNA-PK mRNA. Very little is
known about the signaling pathways regulating mRNA turnover in contrast to current
understanding of how signaling pathways regulate transcription. Recently, however, several
studies have provided increasing support for the notion that mRNA stability is regulated through
signal transduction pathways involving phosphorylation events. It was of interest to look for the
role of signal transduction pathway in the regulation of mRNA stabilization of DNA-PK. DNA-
PK mRNA stabilization was found to be regulated by the p38 MAP Kinase pathway but not by
ERK or JNK MAP Kinase pathway (Fig. 3.1.9).
135

CHAPTER 3
RESULTS
y
Relative expression of DNA-PK
30000
25000
20000
15000
10000
5000
0
2h+Act 2h+Act+In 4h+Act 4h+Act+In 6h+Act 6h+Act+In 8h+Act 8h+Act+In
Time (h) 2 2 4 4 6 6 8 8
Actinomycin (5mg/ml) + + + + + + + +
p38 MAPK inhibitor (1µM) - + - + - + - +
DNA-PK
Fig.3.1.9 Stabilization of DNA-PK mRNA in A549, that had been exposed to 2 Gy of 60 Co γ-
irradiation daily over a period of 5 days and its stabilization is control by p38 MAP Kinase.
3.1.10 Role of Rad52 and MLH1
Since there was an intense activation of Rad52 and MLH1 in A549 cells exposed to fractionated
irradiation, it was of interest to look for their role in survival of A549 cells. MLH1 and Rad52
gene expression knockdown was carried out in A549 cells using MLH1 and Rad52 shRNA
plasmids. Stably transfected cells were selected and the transfection efficiency was found to be
85% for MLH1 gene and 80% for Rad52 gene.
There was 48±2.8% survival of A549 cells exposed to fractionated irradiation. The survival of
A549 cells that had been transfected with MLH1 shRNA plasmid and exposed to fractionated
irradiation was found to be 40±1.8% where as the survival of A549 cells that had been
transfected with Rad52 shRNA plasmid and exposed to fractionated irradiation was found to be
136

CHAPTER 3
RESULTS
23±1.5% (Fig. 3.1.10, A and B). The survival of cells transfected with control shRNA plasmid
was the same as unirradiated control cells.
Fig.3.1.10 Effect of Rad52 and MLH1 on the growth and radioresistance of A549 cells which
had been exposed to 5 fractions of 2Gy radiation. A549 cells were transfected with either MLH1
or Rad52 ShRNA as described in “Materials and Methods”. (A) Clonogenic survival assay of
A549 cells. Key; control, control unirradiated A549 cells. 5X2Gy, A549 cells exposed to 2 Gy
of 60Co γ-irradiation daily over a period of 5 days. 5X2Gy + M, A549 cells transfected with
MLH1 ShRNA and exposed to 2 Gy of 60 Co γ-irradiation daily over a period of 5 days. 5X2Gy +
R, A549 cells transfected with Rad52 ShRNA and exposed to 2 Gy of 60 Co γ-irradiation daily
over a period of 5 days. (B) Representative image of three independent experiments. Data
represents means ± SE of three independent experiments; *P < 0.05, **P < 0.01 compared with
5X2Gy treatment group.
137

CHAPTER 3
RESULTS
3.2 Proton beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
Having established that among the three cell lines, A549 was the most radioresistant, the
variance in signaling pattern and effectiveness of cell killing with the change in LET was looked
at. In this study, A549 cells were irradiated with either 2Gy proton beam or 2Gy γ-radiation and
ensuing activation of few important components involved in DNA repair, cell cycle arrest, and
apoptosis pathways were followed to elucidate the mechanisms behind observed cellular
response. Despite the variability in effectiveness of these two radiations, equal doses of each
were chosen to ensure that each cell is hit by proton beam and no bystander effects are
manifested. Essentially all biological differences between proton and gamma radiations arise
from differences in their ionization tracks. Equitoxic doses were not preferred because the
probability of unhit cells would increase. How this qualitative difference of radiation is translated
into activation of crucial intracellular pathways was the focus of the study.
3.2.1 Cell Survival Assay
There was only 23±2 % of A549 cells were survived that had been exposed to 2Gy of proton
beam where as 56±2.2 % cells were survived that had been exposed to 2Gy of γ-radiation as
observed with clonogenic assay (Fig.3.2.1). This result clearly showed that proton beam is more
cytotoxic than gamma radiation.
3.2.2 Differential modulation of Gene expression following proton beam and gamma irradiation
Expression of ATM, DNA-PK and Chk2 genes were significantly upregulated after 4h of
irradiation only in A549 cells that had been exposed to proton beam (2Gy) (Fig.3.2.2 A, C),
138

CHAPTER 3
RESULTS
whereas only the ATR gene was significantly upregulated after 4h of irradiation in A549 cells
that had been exposed to γ-radiation (2Gy) (Fig.3.2.2 B). There was no change in the gene
expression of Chk1 in A549 cells that had been exposed to either γ-radiation or proton beam
(2Gy) (Fig.3.2.2 C, D). Independent experiments were carried out for gamma and proton beam
irradiated cells, so the control group of gamma and proton irradiated cells may have different
transcript level. However, the data were normalized for the respective controls.
3.2.3 Activation of signaling components involved in DNA damage sensing and repair following
proton beam irradiation.
Since ataxia telangiectasia mutated (ATM) protein plays a central role in DNA-double strand
break (DSBs) sensing and repair and determines the cellular response in eukaryotes. It was of
interest to look for its phosphorylation and its substrates at 4 hours after irradiation. There was
significantly higher phosphorylation of ATM at serine 1981, H2AX at γ-position, Chk2 at
threonine 68 and p53 at serine 15 in A549 cells that had been exposed to 2Gy of proton beam,
but their phosphorylation was not found to be increased 4 hours after 2Gy of γ-radiation as
compared to the control (Fig.3.2.3).
3.2.4 Expression of Apoptosis related genes
Since there was significantly higher phosphorylation of p53 in A549 cells that had been exposed
to 2Gy proton beam (Fig.3.2.3), it was our interest to look for the expression of apoptosis related
gene like Bax and Bcl-2.
139

CHAPTER 3
RESULTS
There was significant upregulation of pro-apoptotic gene, Bax, 12 h after irradiation in A549
cells that had been exposed to 2Gy proton beam as compared to the unirradiated control. In γ-
irradiated (2Gy) cells there was no significant upregulation of the Bax gene (p

CHAPTER 3
RESULTS
Fig.3.2.2 Gene expression of ATM, DNA-PK, ATR, Chk1 and Chk2 in A 549 cells irradiated
with 2Gy Proton Beam or 2Gy γ-radiation at 2, 3 or 4h after irradiation. Total RNA from A 549
cells was isolated and reverse transcribed. RT-PCR analysis of ATM, DNA-PK, ATR, Chk1 and
Chk2 genes was carried out as described in materials and methods. PCR products were resolved
on 1.5% agarose gels containing ethidium bromide. β-Actin gene expression in each group was
used as an internal control. Ratio of intensities of (A & B) ATM, DNA-PK or ATR, (C & D)
Chk1 and Chk2 band to that of respective β-actin band as quantified from gel pictures are shown
above each gel picture. Con means unirradiated control. Data represents means ± SE of three
independent experiments; significantly different from unirradiated controls: *P < 0.05, **P <
0.01.
141

CHAPTER 3
RESULTS
Fig.3.2.3 Immunofluorescence staining and Image analysis of γ-H2AX, phospho-ATM, phospho-Chk2
and phospho-p53 4h after irradiation in A 549 cells irradiated with 2Gy Proton Beam or 2Gy γ-radiation.
Cells were fixed in 4% paraformaldehyde, permeabilized in 0.25% Triton X-100 and labeled with specific
antibodies as described in “Materials and Methods”. Each phospho-site antibody was indirectly labeled
with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold
antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same
exposure time. Comparison of phosphorylation between 2Gy Proton beam and 2Gy γ-radiation of (A)
H2AX, (B) ATM, (C) Chk2, (D) p53. (E) Graph represents relative phosphorylation of H2AX, ATM,
Chk2 and p53 as determined by ImageJ software. At least 100 cells per experiment were analyzed from
three independent experiments. Data represents means ± SE of three independent experiments;
significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
142

CHAPTER 3
RESULTS
Fig.3.2.4 Gene expression of Bax and Bcl-2 12h after irradiation in A 549 cells irradiated with
2Gy Proton Beam or 2Gy γ-radiation. Total RNA from A 549 cells was isolated and reverse
transcribed. RT-PCR analysis of Bax and Bcl-2 genes was carried out as described in materials
and methods. PCR products were resolved on 1.5% agarose gels containing ethidium bromide. β-
Actin gene expression in each group was used as an internal control. Ratio of intensities of Bax
and Bcl-2 band to that of respective β-actin band as quantified from gel pictures are shown above
each gel picture. Con means unirradiated control, H means proton. Data represents means ± SE
of three independent experiments; significantly different from unirradiated controls: *P < 0.05,
**P < 0.01.
143

CHAPTER 3
RESULTS
3.3 High LET irradiation induced signaling in mammalian cells and its comparison with
Gamma irradiation.
Having established the signaling differences between proton beam and gamma ray in lung
carcinoma A549 cells, the variance in signaling pattern with higher LET (Carbon and Oxygen)
was studied. Although enough gross evidence exists of the activation of signaling pathways after
irradiation, the differences between gamma and High LET have not been studied in detail. The
two seem to activate the same pathways but must diverge at some point so that the end point can
be different. Many studies on signaling pathways after low and high LET radiations have found
the activation to be similar except in the intensity [214] but since the end result is different, there
must be a divergence of pathways at some stage. It is this stage of signaling, that is different, that
will be crucial to designing therapies that target specific molecules or pathways. The aim of the
present study was to look for these subtle differences that are of immense consequences.
3.3.1 Carbon beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
Carbon beams are high linear energy transfer (LET) radiation characterized by higher relative
biological effectiveness than low LET radiation. The aim of the current study was to determine
the signaling differences between γ and carbon ion-irradiation. A549 cells were irradiated with
1Gy carbon or γ-radiation and the activation of DNA damage response signaling was studied.
3.3.1.1 Carbon ions were three times more cytotoxic than gamma
To determine the sensitivity of cells to similar dose of high and low LET radiation, their ability
to form colonies after irradiation was observed. Irradiation of exponentially growing A549 cells
144

CHAPTER 3
RESULTS
with equal doses of gamma and carbon (290Mev/micron) revealed that at same dose carbon ions
were much more cytotoxic than gamma rays. At 1Gy, the percentage survival for gamma and
carbon was 92.3±6.8% and 24.5±1.22% respectively. As against 1Gy of carbon ions, 20% cell
survival was obtained at 3Gy of gamma. Thus, carbon ions were found to be three times more
toxic than gamma rays. At 2Gy percentage survivals were 60.6±4% and 4.8±0.24 % for gamma
and carbon respectively (Fig.1).
Fig.3.3.1.1 Clonogenic Cell Survival of A549 cells irradiated with 1 and 2Gy Carbon Beam or γ-
radiation. Data represents means ± SD of three independent experiments.
145

CHAPTER 3
RESULTS
3.3.1.2 Number of initial γ-H2AX foci formed for both radiation types of radiation.
Since DNA double strand breaks are the primary toxic lesions induced by radiation, the number
of double strand breaks were scored by examining the foci of phosphorylated H2AX in irradiated
cells. After 15 minutes of either radiation, γ-H2AX foci, visualized as bright spots, were present
in all the cells. The average numbers of foci after 15min of 1Gy gamma irradiation were
15.8±4.8, while after 1Gy carbon irradiation the foci were 19±4.7 (Fig.3.3.1.2). Thus unlike the
cell survival, not much difference was observed in number of γ-H2AX foci after irradiation with
equal doses of carbon and gamma. The foci were also counted 4 hours after irradiation. 57% of
gamma irradiated cells still showed γ-H2AX foci and the average foci per cell had reduced to
only 2.9±2.28. Carbon ion irradiated cells also showed a significant reduction in the number of γ-
H2Ax foci (2±2) per cell that were visible in only 22% of cells (Fig. Fig.3.3.1.2A, B). When total
intensity of γ-H2AX rather than the foci was estimated by ImageJ software in the same images, it
corroborated well with the number of γ-H2AX foci in gamma irradiated cells at 15min and 4hr
after irradiation (Fig. Fig.3.3.1.2C). However, in case of carbon irradiation, the total intensity of
γ-H2AX at 4 hours was yet high (Fig.3.3.1.2C).
Since initial response as observed from γ-H2AX foci at 15 minutes was similar with both type of
radiation, irradiation induced foci of downstream signaling components was followed at 4 hours
to highlight the signaling differences at that time period.
146

CHAPTER 3
RESULTS
Fig.3.3.1.2 Formation of γ-H2AX foci after exposure to 1Gy gamma or carbon irradiation in
A549 cells.(A) Representative image showing γ-H2AX foci (green) in cells fixed 15 minutes and
4 hours after irradiation. The encircled area roughly represents cell nuclei as seen by DAPI
staining. All images were captured using Carl Zeiss confocal microscope with the same exposure
time (B) Graph represents average foci per cell, percentage of cells showing the foci is marked
above the bars. (C) Graph represents relative intensity of γ-H2AX as determined by ImageJ
software. At least 100 cells per experiment were analyzed from three independent experiments.
147

CHAPTER 3
RESULTS
3.3.1.3 ATM foci in gamma and carbon irradiated cells
ATM, an important DNA damage response protein to ionizing radiation and a part of irradiation
induced foci (IRIF), is mainly involved in cell cycle arrest and repair. It gets activated after DNA
dsb by phosphorylation at ser 1981 and activates many key cellular proteins that include H2AX,
BRCA1, Chk1/2 and p53. Phospho ATM foci and intensity were scored at 4 hours after gamma
or carbon irradiation. At 4 hours after gamma irradiation, 88% cells showed pATM foci with the
average foci per cell was 6.5±4.4, as against 25% control cells (3.4±1.67) (Fig.3.3.1.3A, B).
Like γ-H2AX foci, small number of ATM foci 4 hours after gamma irradiation indicates that by
4 hours most of the repair have taken place. However, at 4 hours after carbon ion irradiation only
52 % of the cells showed the foci but the average pATM foci per cell (21±10) was much higher
as compared to 4 hours after gamma (Fig.3.3.1.3A, B). Total intensity levels of phospho ATM
matched with the number of foci observed (Fig.3.3.1.3C).
3.3.1.4 ATR foci in gamma and carbon irradiated cells
ATR, another important DNA damage sensor, which is known to respond late to the IR induced
damage, was also looked for its activation at 4 hours. After gamma irradiation, 53% of the cells
showed ATR foci (2.8±1.64), as against no foci in any of the control-unirradiated cells. On the
other hand, 4 hours after carbon ion irradiation although only 10% of cells showed the foci, the
average foci per cell (7±4.5) were thrice that of gamma irradiated cells (Fig.3.3.1.4A, B). Total
intensity levels of phospho ATR matched with the number of foci observed (Fig.3.3.1.4C).
148

CHAPTER 3
RESULTS
Fig.3.3.1.3 Phosphorylation of ATM at 4h after exposure to 1Gy gamma or carbon irradiation in
A549 cells. (A) Representative image showing p-ATM foci 4 hours after irradiation. Each
phospho-ATM antibody was indirectly labeled with Molecular Probe 488 secondary antibody
(green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All images were
captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph
represents average numbers of foci per cell, percentage of cells showing the foci is marked above
the bars. (C) Graph represents relative intensity of p-ATM as determined by ImageJ software. At
least 100 cells per experiment were analyzed from three independent experiments. Data
represents means ± SD of three independent experiments.
149

CHAPTER 3
RESULTS
Fig.3.3.1.4 Phosphorylation of ATR at 4h after exposure to 1Gy gamma or carbon irradiation in
A549 cells. (A) Representative image showing p-ATR foci 4 hours after irradiation. Each
phospho-ATR antibody was indirectly labeled with Molecular Probe 488 secondary antibody
(green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All images were
captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph
represents average numbers of foci per cell, percentage of cells showing the foci is marked above
the bars. (C) Graph represents relative intensity of p-ATR as determined by ImageJ software. At
least 100 cells per experiment were analyzed from three independent experiments. Data
represents means ± SD of three independent experiments.
3.3.1.5 BRCA1 foci
Another important protein involved in DSB repair is the tumor suppressor protein BRCA1 which
is phosphorylated by ATM and is also a part of IRIF. 4 hours after gamma irradiation, 55% cells
displayed BRCA1 foci (13±8) while 100% of carbon irradiated cells displayed BRCA1 foci
150

CHAPTER 3
RESULTS
(7.5±0.64) (Fig. 3.3.1.5) and the foci, although less in number were larger in size than gamma
induced foci. Presence of BRCA1 foci in all cells irradiated after carbon irradiation indicates that
BRCA1 might be the important player in response to complex DNA damage induced by high
LET radiation.
Fig.3.3.1.5 Phosphorylation of BRCA1 at 4h after exposure to 1Gy gamma or carbon irradiation in A549
cells. (A) Representative image showing p-BRCA1 foci 4 hours after irradiation. Each phospho-BRCA1
antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were
mounted with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss
confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per cell,
percentage of cells showing the foci is marked above the bars. (C) Graph represents relative intensity of
p-BRCA1 as determined by ImageJ software. At least 100 cells per experiment were analyzed from three
independent experiments. Data represents means ± SD of three independent experiments.
151

CHAPTER 3
RESULTS
3.3.1.6 Activation of downstream effectors; Chk1 and Chk2
Activation of ATM, ATR and BRCA1 after DNA damage leads to the activation of further
downstream components including Chk1 and Chk2. After activation in the nuclei, Chk1 and
Chk2 move to cytoplasm. Phospho Chk1, the major target of ATR, was found to increase in
nuclei of carbon-irradiated cells but not in gamma (Fig.6 A). Marginal activation of Chk2, the
preferred substrate of ATM, was observed in the nucleus in all the cells irrespective of radiation
quality (Fig.6 B). Many pChk2 foci were observed outside the nuclei of carbon irradiated cells
unlike gamma-irradiated cells (Fig.6 C).
3.3.1.7 Activation of intracellular MAPKs, ERK and JNK
ERK1/2 showed significant activation 1 hour after gamma irradiation and thereafter the increase
was persistent till 4 hours (Fig.3.3.1.7a), while JNK did not show any activation after gamma
irradiation (Fig.3.3.1.7b). Interestingly, after carbon irradiation the activation pattern of these
kinases was exact opposite. ERK was not activated at all after carbon irradiation (Fig.3.3.1.7a)
while JNK showed marginal activation at 15 minutes that remained so till 1 hour (Fig.3.3.1.7b).
3.3.1.8 Apoptosis
At 4 hours after irradiation, morphological features of DAPI stained apoptotic nuclei were scored
and many apoptotic nuclei were observed in cells irradiated with carbon ion but not in gamma
irradiated cells (Fig. 3.3.1.8 A, B).
Upregulation of Bax expression was also observed as early as 2 hours after carbon ion irradiation
indicating apoptotic tendency of the cells (Fig. 3.3.1.8C). Gamma irradiated cells did not show
any upregulation of Bax.
152

CHAPTER 3
RESULTS
Fig.3.3.1.6 Phosphorylation of Chk1 and Chk2 at 4h after exposure to 1Gy gamma or carbon
irradiation in A549 cells. (A) Graph represents relative phosphorylation of Chk1 as determined
by ImageJ software (B) Representative image showing phosphorylation and Chk2 foci (marked
by “arrow”). The encircled area roughly represents cell nuclei as seen by DAPI staining. All
images were captured using Carl Zeiss confocal microscope with the same exposure time (C)
Graph represents relative phosphorylation of Chk2 as determined by ImageJ software. At least
100 cells per experiment were analyzed from three independent experiments. Data represents
means ± SD of three independent experiments.
153

CHAPTER 3
RESULTS
Fig.3.3.1.7a Phosphorylation of ERK (pERK) in A549 cells. Cells were lysed at different time
periods (hours) after exposure to 1Gy dose of gamma or carbon ion irradiation, immunoblotted
and detected using anti- phospho ERK. One representative image of three independent
experiments is shown here (A). Graph represents pERK band intensities (divided with the
respective loading control intensities and normalized) plotted against time (B).
154

CHAPTER 3
RESULTS
Fig.3.3.1.7b Phosphorylation of JNK (pJNK) in A549 cells. Cells were lysed at different time
periods (hours) after exposure to 1Gy dose of gamma or carbon ion irradiation, immunoblotted
and detected using anti- phospho JNK. One representative image of three independent
experiments is shown here (A). Graph represents band intensities of pJNK (divided with the
respective loading control intensities and normalized) plotted against time (B).
155

CHAPTER 3
RESULTS
Fig.3.3.1.8 Apoptosis in carbon irradiated A549 cells. (A), Apoptotic nuclei of A549 cells were
visualized and quantified by using DAPI staining, 4 hours after carbon or gamma irradiation
(1Gy). (B), Graph showing the percentage of cells with apoptotic nuclei. At least 100 cells per
experiment were analyzed from three independent experiments. (C), Representative immunoblot
image depicting upregulation of Bax, observed at various time periods (2, 3, 4 and 6 hours) after
carbon irradiation (1Gy).
156

CHAPTER 3
RESULTS
3.3.2 Oxygen beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
Having established the signaling differences between carbon beam and gamma irradiation in
A549 cells, the variance in signaling pattern with oxygen beam was studied. Oxygen beams are
high linear energy transfer (LET) radiation characterized by higher relative biological
effectiveness than low LET radiation. The aim of the current study was to determine the
signaling differences between γ- and oxygen ion-irradiation. Activation of various signaling
molecules was looked in A549 lung adenocarcinoma cells irradiated with 2Gy oxygen, 2Gy or
6Gy γ-radiation.
3.3.2.1. Cytotoxicity of oxygen ions Vs gamma
To determine the sensitivity of cells to similar dose of high and low LET radiation, their ability
to form colonies after irradiation was observed. Irradiation of exponentially growing A549 cells
with equal doses of gamma and oxygen beam (614 keV/ µm) revealed that at same dose oxygen
ions were much more cytotoxic than gamma rays as assessed by the clonogenic cell survival
assay. The calculated RBE (relative biological effectiveness) for A549 cells irradiated with 1Gy
oxygen ions particles relative to γ rays was found to be nearly 3 at 20% survival (Fig. 3.3.2.1).
The calculated D 0 value from the plot curve for A549 cells was found to be 0.6Gy for oxygen
ions and 2.5Gy for γ rays.
157

CHAPTER 3
RESULTS
Fig. 3.3.2.1 Clonogenic Cell Survival of A549 cells irradiated with 1, 2 or 3Gy Oxygen beam or
γ-radiation. Data represents means ± SD of three independent experiments.
3.3.2.2. Numbers of initial γ-H2AX foci formed for both types of radiation
Since DNA double strand breaks are the primary toxic lesions induced by radiation, the number
of double strand breaks were scored by examining the foci of phosphorylated H2AX in irradiated
cells. After 15 minutes of either radiation, γ-H2AX foci, visualized as bright spots, were present
158

CHAPTER 3
RESULTS
in all the cells. The average numbers of foci after 15min of 2Gy gamma irradiation were 24±5,
while after 2Gy oxygen irradiation; the foci were 28±4.7 (Fig. 3.3.2.2 A & C). Thus unlike the
cell survival, the difference in induction of γ-H2AX foci 15 min after 2Gy of either radiation was
not as profound. Activation of signaling molecules at dose of 2Gy of gamma radiation was
studied because the initial response manifested as double strand breaks, as indicated by γ-H2AX
foci, was found to be almost the same at 2Gy of either radiation. Since the RBE of oxygen ions
was nearly 3, it would be more logical to compare 2Gy of oxygen ion with 6Gy of gamma ray.
The average numbers of foci after 15min of 6Gy gamma irradiation were 35±3.5 (Fig. 3.3.2.2 A
& C). Thus, 6Gy gamma ray induced 1.25 times more foci than 2Gy oxygen ions.
The γ-H2AX foci were also counted 4 hours after irradiation to compare the repair status at that
time. 53% of 2Gy gamma irradiated cells still showed γ-H2AX foci but the average foci per cell
had reduced to only 4.3±2.2, where as 100% of 6Gy gamma irradiated cells showed γ-H2AX
foci and the average foci per cell had reduced to only 8±2.5. In oxygen ion irradiated cells,
although bright green γ-H2AX intensity was observed till 4 hours in 60% of cells, there was a
significant reduction in appearance of distinct foci like structures (10±2) (Fig. 3.3.2.2 B & C).
Disappearance of γ-H2AX foci indicates DNA repair/rejoining. However, from the survival data
of A549 cells it was clear that in oxygen irradiated cells the repair of DNA had not taken place.
The result was so intriguing that it was essential to measure the total intensity of γ-H2AX in
irradiated cells. Instead of counting number of foci, the intensity of γ-H2AX in cells showing the
foci was estimated by ImageJ software in the same images. In case of 2Gy or 6Gy gamma
irradiation, both γ-H2AX foci and its total intensity levels had reduced at 4 hours (Fig. 3.3.2.2
D). However, in case of oxygen irradiation, the total intensity of γ-H2AX at 4 hours was yet very
high (Fig. 3.3.2.2D) although foci were not properly visible. This could indicate diffusion of γ-
159

CHAPTER 3
RESULTS
H2AX foci rather than its disappearance due to actual dephosphorylation of γ-H2AX. Presence
of γ-H2AX even 4 hours after oxygen ion irradiation suggests that DNA had not been repaired.
Fig. 3.3.2.2 Phosphorylation of H2AX (γ-H2AX) at different time points after exposure to 2Gy
and 6Gy gamma or 2Gy oxygen irradiation in A549 cells. Representative image showing γ-
H2AX foci (A) 15 minutes and (B) 4 hours after irradiation. Each phospho-H2AX antibody was
indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted
with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss
confocal microscope with the same exposure time. (C) Graph represents average numbers of foci
per cell, percentage of cells showing the foci is marked above the bars. (D) Graph represents
relative intensity of γ-H2AX as determined by ImageJ software. At least 100 cells per
experiment were analyzed from three independent experiments. Data represents means ± SD of
three independent experiments; significantly different from unirradiated controls: *P < 0.05, **P
< 0.01.
160

CHAPTER 3
RESULTS
3.3.2.3 Radiation induced foci of DNA damage response proteins ATM
ATM is an important DNA damage response protein to ionizing radiation and a part of
irradiation induced foci (IRIF). It gets activated after DNA dsb by phosphorylation at ser 1981
and activates many key cellular proteins that include H2AX, BRCA1, Chk1/2 and p53 [235,
236]. Phospho ATM foci and intensity were looked at 4 hours after gamma or oxygen
irradiation. At 4 hours after 2Gy gamma irradiation, most of the cells (93%) showed ATM foci
(5.9±3.7) as against 25% unirradiated cells (3.4±1.6) (Fig.3.3.2.3). Like γ-H2AX foci, lesser
number of ATM foci 4 hours after 2Gy gamma irradiation indicates that by 4 hours most of the
repair due to damage by low LET irradiation would have taken place. 4 hours after 6Gy gamma
irradiation, 100% of the cells showed the foci and average ATM foci per cell were 14.5±6.05.
However, at 4 hours after oxygen ion irradiation, 100% of the cells still showed the foci and
average ATM foci per cell (18.6±8.7) were higher than gamma irradiation. Total intensity levels
of phospho ATM matched with the number of foci observed (Fig.3.3.2.3).
3.3.2.4 Radiation induced foci of DNA damage response proteins ATR
ATR, another PI3 kinase family member, which is known to respond late to the IR induced
damage, was also looked for its activation at 4 hours. After gamma irradiation, average foci per
cell were very less (2.7±0.95 for 2Gy and 4±1 for 6Gy) and that too were visible in only half of
the irradiated cells. (Fig.3.3.2.4). On the other hand, although only 36% of oxygen ion irradiated
cells showed ATR foci, the average foci per cell were (24±14) at least six times more than that of
gamma irradiated cells. Total intensity levels of phospho ATR matched with the number of foci
observed (Fig.3.3.2.4).
161

CHAPTER 3
RESULTS
3.3.2.5. Activation of downstream substrates of ATR and ATM: Chk1, Chk2 and p53
There was significantly higher phosphorylation of p53 at serine 15 in A549 cells that had been
exposed to 2Gy of oxygen beam, but not after 2Gy γ-radiation (Fig.3.3.2.5). Cells exposed to
6Gy γ-radiation showed marginally higher phosphorylation of p53, but it was significantly lower
than 2Gy oxygen irradiated cells (Fig.3.3.2.5).
Chk2, which is activated by ATM and shares its substrates including p53, was found to be
significantly activated in oxygen irradiated cells. Activation of Chk2 is critical in regulating cell
cycle arrest and DSB repair. Presence of pChk2 foci in nuclei of oxygen irradiated cells but not
gamma indicates Chk2 as an active player in high LET radiation induced responses
(Fig.3.3.2.6A, B). Immunofluorescence of phospho Chk1, which is a major target of ATR, was
also found to increase in nuclei of oxygen-irradiated cells but not after 2Gy γ-radiation
(Fig.3.3.2.6C). Cells exposed to 6Gy γ-radiation showed marginally higher phosphorylation of
Chk1, but it was significantly lower than 2Gy oxygen irradiated cells (Fig.3.3.2.6C).
3.3.2.6 Apoptosis
At 18 hours after irradiation, morphological features of DAPI stained apoptotic nuclei were
scored and many apoptotic nuclei were observed in cells irradiated with 2Gy oxygen ion and
6Gy gamma but not in 2Gy gamma irradiated cells (Fig.3.3.2.7). Cells exposed to 2Gy oxygen
ion showed significantly higher apoptotic nuclei than 6Gy gamma (Fig.3.3.2.7).
162

CHAPTER 3
RESULTS
Fig.3.3.2.3 Phosphorylation of ATM at 4h after exposure to 2Gy and 6Gy gamma or 2Gy
oxygen irradiation in A549 cells. (A) Representative image showing p-ATM foci 4 hours after
irradiation. Each phospho-ATM antibody was indirectly labeled with Molecular Probe 488
secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI
(blue). All images were captured using Carl Zeiss confocal microscope with the same exposure
time. (B) Graph represents average numbers of foci per cell, percentage of cells showing the foci
is marked above the bars. (C) Graph represents relative intensity of p-ATM as determined by
ImageJ software. At least 100 cells per experiment were analyzed from three independent
experiments. Data represents means ± SD of three independent experiments; significantly
different from unirradiated controls: *P < 0.05, **P < 0.01.
163

CHAPTER 3
RESULTS
Fig.3.3.2.4 Phosphorylation of ATR at 4h after exposure to 2Gy and 6Gy gamma or 2Gy oxygen
irradiation in A549 cells. (A) Representative image showing p-ATR foci 4 hours after
irradiation. Each phospho-ATR antibody was indirectly labeled with Molecular Probe 488
secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI
(blue). All images were captured using Carl Zeiss confocal microscope with the same exposure
time. (B) Graph represents average numbers of foci per cell, percentage of cells showing the foci
is marked above the bars. (C) Graph represents relative intensity of p-ATR as determined by
ImageJ software. At least 100 cells per experiment were analyzed from three independent
experiments. Data represents means ± SD of three independent experiments; significantly
different from unirradiated controls: *P < 0.05, **P < 0.01. Significantly different from 6Gy
gamma: ## P < 0.01.
164

CHAPTER 3
RESULTS
Fig.3.3.2.5 Phosphorylation of TP53 at 4h after exposure to 2Gy and 6Gy gamma or 2Gy oxygen
irradiation in A549 cells. (A) Representative image showing p-TP53 4 hours after irradiation.
Each phospho-TP53 antibody was indirectly labeled with Molecular Probe 488 secondary
antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All
images were captured using Carl Zeiss confocal microscope with the same exposure time. (B)
Graph represents relative intensity of p-TP53 as determined by ImageJ software. At least 100
cells per experiment were analyzed from three independent experiments. Data represents means
± SD of three independent experiments; significantly different from unirradiated controls: *P <
0.05, **P < 0.01. Significantly different from 6Gy gamma: # P < 0.05.
165

CHAPTER 3
RESULTS
Fig.3.3.2.6 Phosphorylation of Chk2 at 4h after exposure to 2Gy and 6Gy gamma or 2Gy oxygen
irradiation in A549 cells. (A) Representative image showing p-Chk2 4 hours after irradiation.
Each phospho-Chk2 antibody was indirectly labeled with Molecular Probe 488 secondary
antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All
images were captured using Carl Zeiss confocal microscope with the same exposure time. (B)
Graph represents relative intensity of p-Chk2 as determined by ImageJ software. (C) Graph
represents relative intensity of p-Chk1 as determined by ImageJ software At least 100 cells per
experiment were analyzed from three independent experiments. Data represents means ± SD of
three independent experiments; significantly different from unirradiated controls: *P < 0.05, **P
< 0.01. Significantly different from 6Gy gamma: # P < 0.05.
166

CHAPTER 3
RESULTS
Fig.3.3.2.7 Apoptosis in oxygen irradiated A549 cells. Apoptotic nuclei of A549 cells were
visualized and quantified by using DAPI staining, 18 hours after 2Gy and 6Gy gamma or 2Gy
oxygen irradiation. The percentage of cells with apoptotic nuclei are represented as graph. At
least 100 cells per experiment were analyzed from three independent experiments. Data
represents means ± SD of three independent experiments; significantly different from
unirradiated controls: *P < 0.05, **P < 0.01. Significantly different from 6Gy gamma: # P < 0.05.
167

CHAPTER 3
RESULTS
3.4 Radiation induced bystander signaling in mammalian cells.
Radiation induced bystander effect has generated a lot of interest in recent times wherein the
effect of irradiating the target cell on the surrounding unirradiated bystander cells have been
studied. Having established that the response of the signaling factors varied with dose, dose
fractionation, time, microenvironment and radiation quality (LET), it was of interest to
investigate this emerging phenomenon. An attempt has been made to investigate the underlying
mechanism involved and also to determine what component of the signaling system could be
altered by bystander effect and contribution of the bystander effect in the survival of the
neighbouring cells. To understand bystander signaling a number of studies have been made
between the same cell lines. However, not much is known whether bystander effect is extendable
to dissimilar cells, particularly those cells that communicate with each other under physiological
situations. The present study describes the bystander effects of radiation between similar cells
and dissimilar cells in vitro. Gap junction independent signaling mechanism was looked into
using human A549 cells where they were exposed to 2Gy of 60 Co γ irradiation, the medium
isolated and added to fresh cells. Bystander signaling was also studied between U937 cells
(human monocyte) and Lung carcinoma A549 cells. Before designing the experiment there were
two aspects that had to be taken care of, one was the likelihood that the replacement of the
medium itself caused transient expression of certain signaling factors and second that the
components of the medium, which include proteins like growth factors, etc. which are
unavoidably exposed to radiation, contribute to the changes in the bystander cell. The
experimental design, therefore, consisted of the following sets: (a) control unirradiated cells, (b)
γ irradiated cells, (c) A549 cells receiving medium from unirradiated A549 cells or U937 cells or
168

CHAPTER 3
RESULTS
PMA stimulated U937 cells (d) A549 cells receiving medium from γ irradiated A549 cells or
irradiated U937 cells or PMA stimulated and irradiated U937 cells and (e) A549 cells receiving γ
irradiated medium.
3.4.1 Bystander effect in similar cells (A549 Vs A549)
Irradiated A549 cells as well as those cultured in the presence of medium from γ-irradiated A
549 cells showed decrease in survival, increase in γ-H2AX and pATM foci (Fig.3.4.1). However,
the cells which had received only irradiated medium or medium from unirradiated control cells
did not show decrease in survival or increase in γ-H2AX and pATM foci as compared to that in
unirradiated control.
3.4.2 Bystander effect in dissimilar cells (A549 Vs U937)
Having confirmed the existence of bystander signaling between similar cells (A549 Vs A549),
the work was extended to determine if bystander effects can be demonstrated between different
cell types (A549 Vs U937). Bystander signaling was also found to exist between U937 cells
(human monocyte) and Lung carcinoma A549 cells. PMA stimulated and irradiated U937 cells
induced bystander response in unirradiated A549 cells. The latter showed a decrease in survival,
increase in γ-H2AX and pATM foci (Fig.3.4.2). The unstimulated and/or irradiated U937 cells
did not induce bystander effect in unirradiated A549 cells.
169

CHAPTER 3
RESULTS
Fig.3.4.1. Irradiated A549 cells as well as those cultured in the presence of medium from γ-
irradiated A 549 cells (Bystander) showed decrease in survival, increase in γ-H2AX and pATM
foci
170

CHAPTER 3
RESULTS
Fig.3.4.2. Existance of cross bystander effect between Human Lung carcinoma A549 cells and
Human Monocyte U937 cells. Key: Lane 1, control unirradiated A549 cells; Lane 2, unirradiated
A549 cells receiving medium from PMA-stimulated (32nM) and γ irradiated U937 cells; Lane 3,
unirradiated A549 cells receiving medium from γ irradiated U937 cells without PMAstimulation;
Lane 4, unirradiated A549 cells receiving medium from PMA-stimulated U937
cells; Lane 5, unirradiated A549 cells receiving medium from unirradiated U937 cells without
PMA-stimulation.
171

CHAPTER 3
RESULTS
Having established the bystander effect in human cell lines, the mechanism of such a bystander
effect was investigated in mouse cell line.
The experimental design, consisted of the following sets: (a) control unirradiated cells, (b) γ
irradiated cells, (c) EL-4 cells receiving medium from unirradiated EL-4 cells or RAW 264.7
cells or LPS stimulated RAW 264.7 cells (d) EL-4 cells receiving medium from γ irradiated EL-
4 cells or irradiated RAW 264.7 cells or LPS stimulated and irradiated RAW 264.7 cells and (e)
EL-4 cells receiving γ irradiated medium. The cells (EL-4 and RAW 264.7) were also divided
into two groups; one was treated with 20 µM cPTIO (NO scavenger) and the other with 1 mmol
L-NAME (NOS inhibitor). L-NAME was washed off after 30 min so that it is not present in the
bystander cells during incubation.
3.4.3 Bystander effect in similar cells (EL-4 Vs EL-4)
3.4.3.1 Gene expression of NF-κB (p65), iNOS, p53 and p21 in irradiated and bystander cells
The relative gene expression in EL-4 cells cultured for 2 h in presence of different conditioned
media was studied. Actin-β gene expression in each group was used as internal control.
Expression of NF-κB (p65) and iNOS genes were significantly upregulated in irradiated as well
as in bystander cells as compared to the unirradiated control (Fig.3.4.3.1 A and B, Lane, 2 and
3), but their expression was not altered in the cells that had received only irradiated medium or
medium from unirradiated control cells (Fig.3.4.3.1A and B, Lane, 4 and 5). Similarly, the
expression of p53 and p21 genes were found to be significantly upregulated in irradiated and
bystander cells as compared to the control (Fig.3.4.3.1 C and D, Lane, 2 and 3). However, in the
cells cultured in presence of irradiated medium there was a marginal up-regulation of p53 and no
172

CHAPTER 3
RESULTS
up-regulation of p21 (Fig.3.4.3.1 C and D, Lane, 4). The expression of p53 gene in these cells
was significantly lower than irradiated cells as well as bystander cells. The cells cultured in the
presence of medium derived from unirradiated cells did not show up-regulation either p53 or p21
gene expression (Fig.3.4.3.1 C and D, Lane 5).
3.4.3.2 NO production in irradiated and bystander cells
Since the expressions of iNOS gene was significantly upregulated in irradiated and bystander
cells (Fig.3.4.3.1B, Lane 2 and 3), it was of interest to look for NO production in these cells. NO
production was found to be significantly enhanced in irradiated cells and bystander cells as
compared to that in unirradiated control cells (Fig. 3, Lane 2 and 3). The NO production in the
cells cultured in presence of only irradiated medium or medium derived from unirradiated cells
was found to be similar to that in unirradiated cells (Fig.3.4.3.2, Lane 4 and 5).
3.4.3.3 DNA damage in irradiated and bystander cells
Damage to cellular DNA was expressed as tail length (Fig.3.4.3.3 A), per cent DNA in tail
(Fig.3.4.3.3 B), Olive tail moment (Fig.3.4.3.3 C) and Tail moment (Fig.3.4.3.3 D). The DNA
damage was significantly higher in irradiated EL-4 cells as compared to that in unirradiated cells
(Fig.3.4.3.3, A, B, C, D, Lane 2). The cells cultured in the presence of medium derived from
irradiated cells also showed a significantly higher DNA damage as compared to the unirradiated
control cells (Fig.3.4.3.3, A, B, C, D, Lane 3). However, the cells that had received only
irradiated medium or medium from unirradiated control cells did not show any increase in DNA
damage as compared to that in unirradiated control (Fig.3.4.3.3, A, B, C, D, Lane 4 and 5).
173

CHAPTER 3
RESULTS
Fig.3.4.3.1 Gene expression of iNOS, p21, p53 and NF-kB (p65) in EL-4 cells cultured for 2 h in
presence of different conditioned media. Total RNA from EL-4 cells was isolated and reverse
transcribed. RT-PCR analysis of iNOS, p21, p53 and NF-kB (p65) genes was carried out as
described in materials and methods. PCR products were resolved on 1.5% agarose gels
containing ethidium bromide. Actin-β gene expression in each group was used as an internal
control. Ratio of intensities of (A) NF-kB (p65), (B) iNOS, (C) p53 and (D) p21band to that of
respective actin- β band as quantified from gel pictures are shown above each gel picture. Key:
Lane 1, control unirradiated EL-4 cells; Lane 2, γ irradiated EL-4 cells; Lane 3, unirradiated
EL-4 cells receiving medium from γ irradiated EL-4 cells; Lane 4, unirradiated EL-4 cells
receiving medium irradiated with γ rays in the absence of cells; Lane 5, unirradiated EL-4 cells
receiving medium from unirradiated EL-4 cells. Data represents means ± SE of three
independent experiments; significantly different from unirradiated controls: *P < 0.05, **P <
0.01.
174

CHAPTER 3
RESULTS
Fig.3.4.3.2 NO production from EL-4 cells cultured for 24 h in the presence of different
conditioned media. The culture supernatant from each group of EL-4 cells was used for
-
determination of NO 2 with Griess reagent. Key: Lane 1, control unirradiated EL-4 cells; Lane 2,
γ irradiated EL-4 cells; Lane 3, unirradiated EL-4 cells receiving medium from γ irradiated EL-4
cells; Lane 4, unirradiated EL-4 cells receiving medium irradiated with γ rays in the absence of
cells; Lane 5, unirradiated EL-4 cells receiving medium from unirradiated EL-4 cells. Data
represents means ± SE of three independent experiments; significantly different from
unirradiated controls: *P < 0.05, **P < 0.01.
175

CHAPTER 3
RESULTS
Fig.3.4.3.3 DNA damage in EL-4 cells cultured for 2 h in presence of different conditioned
media was measured using single cell gel electrophoresis (‘comet assay’), (A) Tail length, (B) %
DNA in tail, (C) Olive tail moment, and (D) Tail moment. Key: Lane 1, control unirradiated EL-
4 cells; Lane 2, γ irradiated EL-4 cells; Lane 3, unirradiated EL-4 cells receiving medium from γ
irradiated EL-4 cells; Lane 4, unirradiated EL-4 cells receiving medium irradiated with γ rays in
the absence of cells; Lane 5, unirradiated EL-4 cells receiving medium from unirradiated EL-4
cells; Lane 6, unirradiated EL-4 cells receiving fresh medium. Data represents means ± SE of
three independent experiments; significantly different from unirradiated controls: *P < 0.05, **P
< 0.01.
176

CHAPTER 3
RESULTS
3.4.3.4 Apoptotic DNA fragmentation in irradiated and bystander cells (EL-4 Vs EL-4)
There is a clear DNA ladder formation (a hallmark of apoptosis) in irradiated and bystander EL-
4 cells. But the extent of apoptosis was found to be more in irradiated cells as compared to that in
bystander cells (Fig. 4, Lane 2 and 3). There was no increase in apoptosis in the cells that had
received only irradiated medium (Fig. 3.4.3.4a, Lane 4) or medium from unirradiated control
cells (Fig. 3.4.3.4a, Lane 5) as compared to that in unirradiated cells (Fig. 3.4.3.4a, Lane 1).
Apoptosis in irradiated and bystander EL-4 cells was further confirmed by annexin V/PI assay
(Fig. 3.4.3.4b).
Fig. 3.4.3.4a DNA fragmentation assay of EL-4 cells. EL-4 cells cultured for 24 h in the
presence of different conditioned media. DNAs of each group of cells were isolated as described
in materials and methods section and electrophoresed on 1.8% Agarose gel containing ethidium
bromide. Key: Lane M, DNA molecular weight marker; Lane 1, control unirradiated EL-4 cells;
Lane 2, γ irradiated EL-4 cells (5Gy); Lane 3, unirradiated EL-4 cells receiving medium from γ
irradiated EL-4 cells; Lane 4, unirradiated EL-4 cells receiving medium irradiated with γ rays in
the absence of cells; Lane 5, unirradiated EL-4 cells receiving medium from unirradiated EL-4
cells. Data shown from representative experiment of three independent experiments.
177

CHAPTER 3
RESULTS
Fig. 3.4.3.4b Apoptosis assay of Control, Irradiated and Bystander EL-4 cells by Annexin-PI
staining. EL-4 cells cultured for 18 h in the presence of different conditioned media. The EL-4
cells were stained using an annexin V/PI-staining kit. Characterization and quantification of
apoptosis was done by confocal microscopy. Key: A, Annexin-V; B, PI; C, DAPI; D, Merge
image of annexin-v, PI and DAPI. Data represents means ± SE of three independent
experiments; significantly different from unirradiated controls: **P < 0.01.
178

CHAPTER 3
RESULTS
3.4.4 Bystander effect in dissimilar cells (EL-4 Vs RAW 264.7)
Having confirmed the existence of bystander signaling between similar cells (EL-4 Vs EL-4), the
work was extended to determine if bystander effects can be demonstrated between different cell
type (RAW 264.7 and EL-4) and whether the state of stimulation of macrophages (RAW 264.7)
affects bystander response. The expression of NF-κB as well as iNOS genes were significantly
upregulated in unirradiated EL-4 cells that had received medium from LPS stimulated and
irradiated RAW 264.7 cells (Fig. 3.4.4a, Compare Lane, 2 and Lane 1); but the expression of
NF-κB was not altered in the cells that had received medium from either irradiated RAW 264.7
cells or unstimulated RAW 264.7 cells (Fig.3.4.4a, Compare Lane, 3 and 5 Vs Lane 1), however,
the expression of iNOS was down regulated in the above groups. The EL-4 cells cultured in the
presence of medium derived from LPS stimulated RAW 264.7 cells showed only marginal
upregulation of iNOS gene but not NF-κB gene (3.4.4a, Compare Lane 4 and Lane 1).
DNA damage in the above groups of EL-4 cells cultured 2 h after exposure to different
conditioned media was significantly higher in unirradiated EL-4 cells that had received medium
from LPS stimulated and irradiated RAW 264.7 cells (Fig.3.4.4b, Compare Lane, 2 and Lane 1).
However, the cells that had received medium from irradiated RAW 264.7 cells, LPS stimulated
RAW 264.7 cells or unstimulated RAW 264.7 cells did not show any increase in DNA damage
(Fig.3.4.4b, Lane, 3, 4 and 5).
179

CHAPTER 3
RESULTS
Fig.3.4.4a Gene expression of NF-kB (p65) and iNOS gene in EL-4 cells which had received
medium from irradiated RAW 264.7 cells. EL-4 cells cultured for 2 h in presence of different
conditioned media. β-Actin gene expression in each group was used as an internal control. Ratio
of intensities of NF-kB (p65) and iNOS band to that of respective β-actin band as quantified
from gel pictures are shown above each gel picture. Key: Lane 1, control EL-4 cells; Lane 2,
EL-4 cells receiving medium from LPS-stimulated (500ng/ml) and γ irradiated RAW 264.7 cells;
Lane 3, EL-4 cells receiving medium from γ irradiated RAW 264.7 cells without LPSstimulation;
Lane 4, EL-4 cells receiving medium from LPS-stimulated RAW 264.7 cells; Lane
5, EL-4 cells receiving medium from unirradiated RAW 264.7 cells. Data represents means ± SE
of three independent experiments; significantly different from unirradiated controls: *P < 0.05,
**P < 0.01.
180

CHAPTER 3
RESULTS
Fig.3.4.4b DNA damage in EL-4 cells cultured for 2 h in presence of different conditioned
media was measured using single cell gel electrophoresis (‘comet assay’) and expressed as tail
length. Key: Lane 1, control EL-4 cells; Lane 2, EL-4 cells receiving medium from LPSstimulated
(500ng/ml) and γ irradiated RAW 264.7 cells; Lane 3, EL-4 cells receiving medium
from γ irradiated RAW 264.7 cells without LPS-stimulation; Lane 4, EL-4 cells receiving
medium from LPS-stimulated RAW 264.7 cells; Lane 5, EL-4 cells receiving medium from
unirradiated RAW 264.7 cells. Data represents means ± SE of three independent
3.4.5 Effect of L-NAME and cPTIO on Bystander response.
Since the expressions of NF-κB and iNOS gene were significantly upregulated in irradiated as
well as in bystander cells (Fig.3.4.5a, Lane 2 and 3), it was of interest to determine which
181

CHAPTER 3
RESULTS
signaling factors were involved in bystander response. The response was looked at in the
presence of cPTIO or L-NAME. L-NAME was washed out before irradiation so that the
bystander cells are not exposed to L-NAME and iNOS is inhibited only in the irradiated cells.
The addition of cPTIO, which scavenges the NO released in the medium, did not affect the
expression of iNOS gene if the bystanding cell was of same origin, although NF-κB was
somewhat inhibited (Fig.3.4.5a, Compare Lane 5 and Lane 3). The addition of L-NAME, which
inhibits the iNOS in the irradiated cells, completely inhibited the bystander response in the EL-4
cells (Fig.3.4.5a, Compare Lane 4 and Lane 3). However both L-NAME and cPTIO inhibited
the expression of NF-κB and iNOS in the bystander EL-4 cells if the medium was from LPS
stimulated and irradiated RAW 264.7 cells (Fig.3.4.5a, Lane 6 and 7) i.e. the cell type was
different, indicating that the bystander response was dependent on the cells type and the state of
stimulation of the irradiated cells.
The DNA damage was significantly higher in irradiated as well as in bystander cells (Fig.3.4.5b,
Lane 2 and 3) as compared to the unirradiated control. However, the unirradiated EL-4 cells that
had received medium either from L-NAME treated and irradiated EL-4 cells or from LPS
stimulated, L-NAME treated and irradiated RAW 264.7 cells did not show any increase in DNA
damage as compared to that in unirradiated control (Fig.3.4.5b, Lane 4 and 6). Similarly the
unirradiated EL-4 cells that had received medium either from cPTIO treated and irradiated EL-4
cells or from LPS stimulated, cPTIO treated and irradiated RAW 264.7 cells did not show any
increase in DNA damage as compared to that in unirradiated control (Fig.3.4.5b, Lane 5 and 7).
Neither L-NAME nor cPTIO itself had any effect on DNA damage in EL-4 cells (Fig.3.4.5b,
Lane 8 and 9).
182

CHAPTER 3
RESULTS
Fig.3.4.5a Gene expression of NF-kB (p65) and iNOS gene in EL-4 cells which had received
medium from irradiated cells. EL-4 cells cultured for 2 h in presence of different conditioned
media. β-Actin gene expression in each group was used as an internal control. Ratio of intensities
of NF-kB (p65) and iNOS band to that of respective β-actin band as quantified from gel pictures
are shown above each gel picture. Key: Lane 1, control EL-4 cells; Lane 2, γ irradiated EL-4
cells; Lane 3, EL-4 cells receiving medium from γ irradiated EL-4 cells; Lane 4, EL-4 cells
receiving medium from L-NAME treated and γ irradiated EL-4 cells; Lane 5, EL-4 cells
receiving medium from cPTIO treated and γ irradiated EL-4 cells; Lane 6, EL-4 cells receiving
medium from LPS-stimulated (500ng/ml), L-NAME treated and γ irradiated RAW 264.7 cells;
Lane 7, EL-4 cells receiving medium from LPS-stimulated (500ng/ml), cPTIO treated and γ
irradiated RAW 264.7 cells. Data represents means ± SE of three independent experiments;
significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
183

CHAPTER 3
RESULTS
Fig.3.4.5b DNA damage in EL-4 cells cultured for 2 h in presence of different conditioned
media was measured using single cell gel electrophoresis (‘comet assay’) and expressed as tail
length. Key: Lane 1, control EL-4 cells; Lane 2, γ irradiated EL-4 cells; Lane 3, EL-4 cells
receiving medium from γ irradiated EL-4 cells; Lane 4, EL-4 cells receiving medium from L-
NAME treated and γ irradiated EL-4 cells; Lane 5, EL-4 cells receiving medium from cPTIO
treated and γ irradiated EL-4 cells; Lane 6, EL-4 cells receiving medium from LPS-stimulated
(500ng/ml), L-NAME treated and γ irradiated RAW 264.7 cells; Lane 7, EL-4 cells receiving
medium from LPS-stimulated (500ng/ml), cPTIO treated and γ irradiated RAW 264.7 cells;
Lane 8, EL-4 cells treated with L-NAME; Lane 9, EL-4 cells treated with cPTIO. Data
represents means ± SE of three independent experiments; significantly different from
unirradiated controls: *P < 0.05, **P < 0.01.
184

CHAPTER 4
DISCUSSION
DISCUSSION
185

CHAPTER 4
DISCUSSION
Ionising radiation (IR) has been used for nearly a century to treat human cancers. The objective
of radiotherapy is to deliver a lethal dose to cancer cells but attenuate the toxic effects of IR on
adjacent normal tissue. In order to achieve this, radiotherapy is given as fractionated dose
ranging from 2-4 Gy per fraction. Therefore, the manner in which cell senses and respond to
radiation damage is critical for the outcome of radiotherapy. The molecular pathways that are
triggered by acute dose of irradiation will be different from fractionated dose of irradiation. This
will ultimately determine the multiple possible responses, whether they be DNA repair, cell
cycle arrest, cell death or cell adaptive response. Moreover, these pathways provide molecular
explanation of why different cell types differ in their response to radiation. Some cell types are
relatively more radioresistant than others. The reason for the radioresistance could, therefore be
efficient DNA repair, but cannot be the sole reason for it. The contribution of signaling to these
phenomena could be enormous. Radioresistant cells and cells that become radioresistant after
radiation treatment need newer modalities of irradiation like heavy ions because the relative
biological effectiveness (RBE) increases with an increase in the LET of the incident radiation.
The effectiveness of Ionising radiation is because it induces DNA damage, which generates a
complex cascade of events leading to cell cycle arrest, transcriptional and post-transcriptional
activation of a subset of genes including those associated with DNA repair and triggering
apoptosis. Probably the most dangerous of all the types of DNA damage are double strand breaks
(DSBs) and their repair is complex. Moreover, the degree of lesion complexity increases with
increasing LET. The cellular genotoxic response depends on the type of DNA damage which in
turn can evoke unique cellular response.
The signaling events seen in totality may also have contribution from the surrounding
microenvironment that is of necessity exposed to radiation. The cells nearby which are not
186

CHAPTER 4
DISCUSSION
directly exposed to the radiation but are juxtaposed to the irradiated cells are also affected
because of signals transduced from the ‘hit’ cell. The classical paradigm of radiation biology
asserts that all radiation effects on cells, tissues and organisms are due to the direct action of
radiation. However, there has been a recent growth of interest in the indirect actions of radiation
including the radiation-induced adaptive response, the bystander effect, low-dose
hypersensitivity, and genomic instability, which are specific modes of stress exhibited in
response to low-dose/low-dose rate radiation.
4.1 Fractionated irradiation induced signaling and repair in mammalian cells.
It is known that cellular response to ionising radiation is a complex phenomenon where the dose,
dose rate and its fractionation play an equally important role in deciding the fate of the cell.
Extensive work has been done and published on the response of the cell to single doses of
radiation which are reflected as lesions in the DNA and non DNA targets. Among the latter are
the signaling proteins that act to signal that the DNA is damaged as well as to regulate processes
such as cell cycle progression and DNA repair. These pathways are also intricately linked with
the intrinsic radioresistance of the cell [237, 238]. In recent years these signaling proteins are
being exploited as targets to enhance tumor radiosensitivity [238-240]. The targets have been
chosen based on their activation following a single dose of radiation. Since signaling, as it is now
known, is not a linear activation of a pathway but a complex network where both positive and
negative signals are activated simultaneously following exposure to stress , it is quite likely that
the signaling factors that are being targeted may not be activated in a cancer cell that has
undergone radiotherapy. The study of the ultimate radioresistant phenotype is undoubtedly a
very important aspect but the immediate response of the signaling factors to repeated doses of
187

CHAPTER 4
DISCUSSION
radiation are yet unknown. More information about the response of these signaling factors at
clinically relevant doses during and after a fractionated regimen is needed to understand their
role.
In the present study human lung adenocarcinoma A549 cells were found to be more
radioresistant if 10 Gy dose was delivered as fractionated dose (Fig.3.1.1). Although
fractionation is supposed to play an important role in inducing an adaptive response and deciding
the fate of cells, the mechanism by which it does so can be many and innumerable factors could
be responsible. In microarray analysis, most of the pathways which were up-regulated in A549
cells exposed to fractionated irradiation in all comparisons were associated with the survival or
repair of the A549 cells. This indicated that fractionated irradiation could induce up-regulation of
survival/repair related pathways in cancer cells.
Previous reports concerning radioresistant non–small-cell lung cancer and HeLa cells
indicated that cell cycle signaling pathways, mismatch repair, homologous recombination were
up-regulated [241, 242]. In this study, some of these genes were previously known to be
associated with responsiveness to radiation, such as p21 and GADD45α, but others were novel.
These novel genes can be expected to be involved in radioresistance, but the precise function of
each gene remains unclear; so further study was necessary to clarify the nature of associations.
Microarray data had shown that p53 signaling pathway was up-regualted in A549 cells
that had been exposed to fractionated irradiation; it was of interest to look at the phosphorylation
of p53 and its translocation to the nucleus of A549 cells. Lung adenocarcinoma A549 cells
typically express wild-type p53 protein [243] and would be expected to be sensitive to the DNAdamaging
agents used for cancer therapy; however, these cells are radioresistant if the radiation
188

CHAPTER 4
DISCUSSION
dose is delivered as fractionated irradiation. p53 classically considered to be a tumor suppressor
protein, but in this study the results are contradictory. The fact that A549 cells express wild-type
p53 protein, it was unable to suppress the proliferation of A549 cells that had been exposed to
fractionated irradiation.
Wild-type p53 function involves two steps. First, upstream signaling pathways stabilize and
activate the p53 protein in response to DNA damage or other forms of cellular stress. In the
second step, activated p53 binds to regulatory sequences of its target genes and activates their
expression [244]. Either step may be defective in lung adenocarcinoma A549 cells. Defective
activation of wild-type p53 after DNA damage could be the mechanism for suppression of p53
function in A549 cells. The response of p53 to DNA damage involves an increase in p53 protein
levels due to stabilization of the protein and an increase in p53 functional activity [245, 246]. It is
quite likely that there is no defect in regulation of p53 stabilization in response to DNA damage
because p53 was stabilized in response to fractionated irradiation in A549 cell line examined, and
the steady-state levels of p53 were very high (Fig. 3.1.7A, B & C). The regulation of the
functional activity of p53 seems to be defective. These findings are consistent with previous
reports showing the function of wild-type p53 protein is apparently compromised in many cancer
cells [247, 248]. Moreover, translocation of phospho-p53 into the nucleus could lead to cell cycle
arrest, which will allow the cells to repair the DNA damage.
Since DNA repair pathways were up-regulated in A549 cells that had been exposed to
fractionated irradiation, it was of interest to look at the activation of genes and proteins involved
in DNA repair pathways. Results of this study indicated that there is intense activation of repair
genes and protein in A549 cells exposed to fractionated irradiation (Fig.3.1.4 and Fig.3.1.6).
189

CHAPTER 4
DISCUSSION
These results on DNA-PK are consistent with earlier works where authors have also shown the
role of DNA-PK in the radioresistance of lung carcinoma cells [249, 250]. However, these
authors have looked at the response only after single dose of irradiation and it is logical to expect
these pathways to get activated. In this study it was shown that DNA-PK is also involved in
radioresistance if the cells are subjected to fractionated irradiation but the reason for the
development of radioresistance still remains an enigma.
ATM and BRCA1 have been regarded as primary regulators of homologous
recombination repair (HRR) [251]. In this study an intense activation of ATM gene and ATM
foci were seen in all the cells exposed to fractionated irradiation and most of the cells showed
BRCA1 foci (Fig.3.1.4 and Fig.3.1.6) indicating the fact that HRR pathway was activated in
A549 cells and therefore, these proteins could be involved in HRR which can take advantage of
the other strand that may be intact. ATM and BRCA1 reside in macromolecular complex and
form foci after irradiation. These results are in agreement with earlier works where authors have
also shown the role ATM in radioresistance of cancer cells [252, 253]. However, these authors
have studied using single dose of irradiation.
The repair of DNA at 4h in A549 cells exposed to fractionated irradiation but not in cells
that had been exposed to 10 Gy acute dose, indicating the fact that fractionated irradiation
induced better repair capability of the cells. Moreover, the DNA repair pathways were activated
in A549 cells exposed to fractionated irradiation allow these cells to repair its damage DNA
faster than 10 Gy acute dose.
190

CHAPTER 4
DISCUSSION
A clear cause and effect relationship was established between DNA damage signaling,
gene expression and efficient DNA repair and was evident in the form of cell survival in A549
cells that had been exposed to fractionated irradiation.
It has been reported that A549 cells are relatively more radioresistant than MCF-7 cells if
radiation dose was delivered as fractionated regimen [254]. But the mechanism of such response
has not been studied. To best of my knowledge this is the first study explaining the mechanism
of such response as activation of repair pathway, efficient DNA repair and translocation of
phospho-p53 into the nucleus of A549 cells exposed to fractionated irradiation and not in MCF-7
cells exposed to fractionated irradiation (Fig. 3.1.8).
The level of mRNA expression is known to be modulated through transcriptional and
posttranscriptional control mechanisms. An important posttranscriptional control is exerted on
mRNA stability, which varies considerably from one mRNA species to another and can be
modulated by various stimuli such as radiation [255-257].How these stimuli influence mRNA
halflives in ways that are incompletely understood. Although much has been researched about
radioresistance and DNA damage, surprisingly there are absolutely no reports on the stabilization
of mRNA of crucial DNA damage and maintenance of proteins. It is quite likely that mRNA
stabilization could contribute to the development of radio resistance. The expression of DNA-PK
was partly due to up-regulation of DNA-PK transcriptional activity to some degree, DNA-PK
mRNA stabilization played important roles in maintaining high DNA-PK expression level in this
study (Fig. 3.1.9). The ATM and Rad52 mRNA were not stabilized indicating a specific and
selective stabilization of DNA-PK mRNA. The DNA-PK mRNA stabilization was mediated by
p38 MAP kinase signaling pathways but not by ERK or JNK MAP Kinase pathway (Fig. 3.1.9).
191

CHAPTER 4
DISCUSSION
This result indicates that there is existence of cross talk between DNA repair pathway and p38
MAP Kinase pathway. The p38 MAP kinase pathway plays an important role in the posttranscriptional
regulation of many genes. p38 has been found to regulate both the translation and
the stability of inflammatory mRNAs. The mRNAs regulated by p38 share common AU-rich
elements (ARE) present in their 3’-untranslated regions. AREs act as mRNA instability
determinants but also confer stabilization of the mRNA by the p38 pathway. In recent years,
AREs have shown to be binding sites for numerous proteins [258]. How p38 MAP Kinase
pathway regulates DNA-PK mRNA stability remains to be investigated.
Numerous reports have implicated DNA repair genes as being mainly responsible for the
development of radioresistance due to fractionated irradiation [249, 250, 252, 253]. Processing of
DNA double strand breaks (DSB) in eukaryotes is most likely achieved by multiple pathways
including homologous recombination. Although Rad52 has been shown to be important in DSB
repair in yeast, its role in mammalian cells has not been demonstrated. In this study, silencing of
Rad52 gene in A549 cells by transfection followed by exposure to fractionated irradiation
showed increased sensitivity of these cells to fractionated irradiation. This observation suggests
that homologous recombination repair mediated by Rad52 is involved in double strand break
repair in A549 cells.
In summary, these results indicated that A549 cells were relatively more radioresistant if
these cells were exposed to fractionated irradiation. The reason for radioresistance could be the
activation of DNA repair pathways and Rad52 gene is an important factor modulating
radioresistance in A549 cells.
192

CHAPTER 4
DISCUSSION
4.2 Proton beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
After establishing that A549 cells were relatively more radioresistant if these cells were exposed
to fractionated irradiation, the variance in signaling pattern and effectiveness of cell killing with
the change in LET was studies in A549 cells.
More than 2 fold decrease in survival of the A549 cells as assessed by the clonogenic cell
survival assay was indicative of the fact that the proton beam is more efficient in killing the
tumor cells and may be a more preferred mode of treatment (Fig.3.2.1). The mechanisms of cell
death caused by proton treatment and the signaling pathways that ensue have not yet been
investigated in detail although proton beam therapy is in use for many cancers [259-264].
The massive activation of DNA-PK and ATM after proton irradiation when compared
with gamma (Fig.3.2.2 A &B) was more or less expected and may be due to the fact that DNA
damage activates Phosphatidylinositol 3-kinase-like kinases (DNA-PK, ATM), which then
amplify and channel the signal by activating downstream kinases (Chk1 and Chk2). These, in
turn, phosphorylate target proteins such as p53, Cdc25A and Cdc25C [11] to delay the cell cycle,
a process called the DNA damage checkpoint. In addition to checkpoint control, the downstream
kinases also modulate DNA repair and trigger apoptosis [13]. The lack of activation of ATR after
proton irradiation was however intriguing and was found to be reflected no activation of Chk1
(Fig.3.2.2).
Phosphorylation of H2AX even at 4 hours in A549 cells that had been exposed to proton
beam indicates the presence of large number of double strand breaks at that time indicating very
193

CHAPTER 4
DISCUSSION
slow repair. DNA repair pathways activated by charged particle radiation might be different from
those studied after gamma irradiation.
Likewise, there was significantly higher phosphorylation of ATM at serine 1981 in A549 cells
that had been exposed to proton beam (Fig.3.2.3), indicating the fact that despite significant
activation of ATM (4 hours) much of the damage still persisted. The activated/phosphorylated
ATM would further phosphorylate various downstream target proteins such as H2AX, Chk2, p53
etc. leading to opening of the chromatin and recruitment of other proteins involved in DNA
repair or cell cycle arrest.
Phosphorylation of Chk2 indicated that small component of ATM activation is also diverted to
cell cycle arrest pathways such as Chk2, CDC25 phosphatase and CDKs. These could also be
involved in activation of other proteins such as BRCA1 and p53. Phosphorylation of p53 at
serine 15 was then observed in unirradiated and irradiated A549 cells at 2Gy of proton beam
(Fig.3.2.3). These results indicated cell cycle arrest in A549 cells exposed proton beam.
Whether DNA-PK signals DSBs to the checkpoint machinery remains controversial, but the
emerging consensus is that it does not [22]. DNA-PK may, however, be involved in signaling
DNA damage to the apoptosis machinery [24].
The degree of radiation-induced apoptosis has been shown to correlate with the p53 wild-type
status [265]. In addition, apoptosis is induced when wild-type p53 is transfected into certain cell
lines lacking p53 [266]. This indicates that p53 not only plays a role in regulating the progression
through the cell cycle, it can also induce apoptosis in cells. p53 is not an essential component of
the machinery that carries out apoptosis; however, it appears to be an activator of apoptosis.
194

CHAPTER 4
DISCUSSION
Although the exact means by which p53 activates apoptosis is unclear, evidence has shown that
p53 mediates apoptosis by way of transcription-independent and transcription-dependent
mechanisms [267, 268]. p53 is known to regulate the expression of several proteins involved in
the apoptotic pathway and also interacts with BAX, BCL-XL, and BCL-2 to exert a direct
apoptotic effect at the level of the mitochondria [111, 269, 270].
Increased phosphorylation of p53, upregulation of Bax and down-regulation of Bcl-2 in proton
beam irradiated A549 cells as compared to γ-irradiated cells (Fig.3.2.3 and Fig.3.2.4) indicate the
activation of apoptotic pathways.
The noteworthy finding of this study is the biphasic activation of the sensor proteins, ATM and
DNA-PK and no activation of ATR by proton irradiation and the significant activation of Chk2
even at the gene level only in the proton beam irradiated cells (Fig.3.2.2). Such biphasic response
after irradiation with proton or other heavy ions have been observed and may be characteristics
of particle irradiation [271]. Unlike gamma irradiation, the biphasic induction of ATM and
DNA-PK following proton beam irradiation could be responsible for the activation of apoptotic
machinery, however, further studies in this direction will reveal the importance of such biphasic
response.
The use of proton beam therapy has definite advantage over gamma therapy. The mechanism of
apoptosis will give the clinician a handle to manipulate therapy for enhanced cell killing.
195

CHAPTER 4
DISCUSSION
4.3 High LET irradiation induced signaling in mammalian cells and its comparison with
Gamma irradiation.
Although many studies on signaling pathways after low and high LET radiations have found the
activation to be similar except in the intensity [214] but since the end result of the two
irradiations is different, there must be a divergence of pathways at some stage. It is this stage of
signaling, that is different, that will be crucial to designing therapies that target specific
molecules or pathways
4.3.1 Carbon beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
Although 1Gy dose of carbon ions was three times more toxic to the cells than gamma
rays, both produced same number of γ-H2AX foci, indicators of DNA double strand breaks, the
primary lesions induced by radiation (Fig.3.3.1.1 and Fig.3.3.1.2). This discrepancy between
observed cytotoxicity and estimated γ-H2AX foci after high LET radiation has also been
reported previously [272]. The observed decrease in number of γ-H2AX foci 4 hours after
gamma irradiation indicated that DNA damage induced by low LET was repaired faster than
high LET radiation and is supported by nearly 100% survival. However, the decrease in γ-H2AX
foci after Carbon ion irradiation was definitely not indicative of repair because the cell survival
data contradicts the fact (Fig.3.3.1.2). Since total intensity of γ-H2AX was yet high at 4 hours in
carbon irradiated cells, it indicated diffused staining of γ-H2AX rather than dephosphorylation. It
may represent sites of increased DNA damage arising from misrepair or incomplete repair [273,
274].
196

CHAPTER 4
DISCUSSION
Similar number of γ-H2AX foci at 15 minutes after irradiation irrespective of the radiation
quality indicated that initial events might not differ much with the radiation quality. Activation
of other molecules including ATM, ATR, BRCA1, Chk1, Chk2 and Bax was therefore followed
only at later time point of 4 hours. Moreover, since by this time most of the damage would be
repaired, comparing the activation of these molecules at this time could highlight signaling
differences with respect to clustered damage.
ATM and ATR, the initial DNA damage sensors, are critical regulators of cell cycle checkpoints
and repair. ATM has particularly been shown to respond to IR induced damage. Presence of few
ATM foci in ~90% of the gamma irradiated cells 4 hours after irradiation indicates the repair of
the damage in most cells. However, in carbon-irradiated cells, although the percentage of cells
showing the pATM foci (55%) was less, the average number of foci/cell was more (Fig.3.3.1.3).
Similar trend was also observed with ATR foci with respect to radiation quality (Fig.3.3.1.4).
Higher percentage of gamma irradiated cells showing the ATM/ATR foci 4 hours after
irradiation as compared to carbon irradiated cells indicates more homogenous nature of gamma
radiation induced responses while presence of lesser average ATM/ATR foci per gamma
irradiated cell as against carbon irradiation indicates efficient repair after gamma. This
observation is in agreement with the previous studies where higher activation of repair molecules
had been observed few hours after heavy ion irradiation as compared to low LET irradiation
[214, 275] and has been attributed to unrepaired DNA that keeps the damage sensors in activated
state.
The formation of BRCA1 foci was unlike ATM/ATR and very interesting. BRCA1 exists in a
complex containing ATM and other DSB repair proteins and both ATM and BRCA1 have been
197

CHAPTER 4
DISCUSSION
regarded as primary regulators of HRR [251]. Presence of BRCA1 foci in ~55% (Fig.3.3.1.5) of
the gamma irradiated cells is in agreement with the previous studies where BRCA1 foci have
been found to be activated only in cells in S, G2/M phases of the cycle [275] and therefore is
thought to play a role in HRR which can take the advantage of the other strand that may be
intact. Unlike after gamma irradiation, presence of BRCA1 foci in all of the carbon irradiated
cells was quite intriguing. Moreover, the downstream substrates, Chk1 (Fig.3.3.1.6A) and Chk2
(Fig.3.3.1.6C) also showed relatively higher activation in carbon irradiated cells as compared to
gamma. Activation of all these repair components with high LET radiation at first indicates
persistent and even more intense activation of repair pathways. However, presence of ATM foci
in only half of carbon irradiated cells while BRCA1 foci in all cells suggest that BRCA1 is
associated with different proteins and may not require activated ATM. The larger size of BRCA1
foci after Carbon irradiation also indicated that macromolecular complexes containing BRCA1
might be different after two types of radiation treatments. Number of Chk2 foci, another
important regulator of HRR, also did not seem to parallel ATM foci. This, along with the fact
that the survival of the cells is only 20% (Fig.3.3.1.1) and many apoptotic nuclei are present at 4
hours (Fig.3.3.1.8) indicates that these macromolecular complexes containing BRCA1 may be
majorly involved in apoptotic responses after a complex damage to the DNA. Recent studies
suggest multifunctional nature of BRCA1 in maintaining genome integrity. It has been shown to
play an important role in apoptosis and cell cycle control and does so by associating in distinct
protein complexes [276].
The cytoplasmic MAPK pathways, ERK and JNK, that feed into and are fed upon by DNA
damage repair signaling also play an equally important role in deciding the fate of the irradiated
cell. Reactive oxygen species generated after gamma irradiation have been thought to be one of
198

CHAPTER 4
DISCUSSION
the mechanism for early activation of these kinases [277]. ATM has been shown to enhance
repair via activation of ERK pathway [251] and inhibition of JNK [278]. Observed activation of
ERK (Fig.3.3.1.7a) but not JNK (Fig.3.3.1.7b) in gamma irradiated cells indicated the dominance
of pro-survival pathways.
Since, with high LET radiation yield of ROS is very low because of the radical-radical
recombination, the early activation of ERK was not expected. However, complete absence of
ERK activation even hours after high LET radiation suggests that repair pathways are neither
feeding into nor being fed upon by intracellular cytoprotective signaling. However, the proapoptotic
JNK pathway was found to be activated after high LET radiation. BRCA1 induced
apoptotic responses have also been shown to be via activation of JNK [279]. Thus, after carbon
irradiation, DNA damage induced activation of repair components are being fed into by
cytotoxic signaling rather than cytoprotective responses and was evident in the form of early
induction of apoptosis (Fig.3.3.1.8). Since, cellular decisions are summation of all the activated
pathways, the final response after high LET radiation tips towards death.
In summary, these results suggest that the subtle differences leading to different outcomes due to
radiation quality seem to lie in different macromolecular complexes of crucial DNA damage
response proteins and activation of other intracellular pathways. Analysis of functionality of
these macromolecular complexes as a whole rather than individual proteins and holistic study
involving intracellular survival pathways could help in revealing the mechanistic details of
complex DNA damage responses.
199

CHAPTER 4
DISCUSSION
4.3.2 Oxygen beam induced signaling in mammalian cells and its comparison with Gamma
irradiation.
The calculated RBE (relative biological effectiveness) for A549 cells irradiated with 1Gy oxygen
ions particles relative to γ rays was found to be nearly 3 at 20% survival. Thus, oxygen ions
were found to be three times more toxic than gamma rays (Fig. 3.3.2.1). These results therefore
further support previous studies where high LET oxygen beam have been found to be much more
efficient in killing the tumor cells and hence may be a preferred mode of treatment for
radioresistant tumors. However, mechanisms of cell death caused by oxygen treatment and the
signaling pathways that ensue have not yet been investigated in detail although heavy ion beam
therapy is in use for many cancers [280-283]. Since DNA double strand breaks are the primary
toxic lesions induced by radiation, the number of dsbs were scored by examining the foci of
phosphorylated H2AX in irradiated cells. γ-H2AX foci detected in cells irradiated with 2Gy
oxygen ion is contradictory to the fact that number of ion that hits on nucleus and number of γ-
H2AX foci formed agrees well in heavy-ion irradiated cells, because heavy-ion densely deposits
energy along their trajectories. Calculating from LET of oxygen ion, it is estimated that the
number of ion hit on each cell nucleus by irradiation of 2Gy oxygen ions was approximately 3
particles. However, nearly 10 times of foci were detected in the cells irradiated with 2Gy of
oxygen ions. This discrepancy between observed γ-H2AX foci and estimated γ-H2AX foci after
high LET radiation has also been reported previously [214]. Moreover, 3 particles of oxygen
may induce more than 3 double strand break in the DNA which will ultimately decide the
number of γ-H2AX foci.
200

CHAPTER 4
DISCUSSION
Thus unlike the cell survival, the difference in induction of γ-H2AX foci 15 min after 2Gy of
either radiation was not as profound (Fig. 3.3.2.2). Similar number of γ-H2AX at 15 minutes
after irradiation irrespective of the radiation quality indicated that initial events might not differ
much with the radiation quality. Activation of other molecules involved in DNA damage
response were therefore followed only at later time point of 4 hours. Moreover, by this time low
LET induced damage is mostly repaired and the activation of these factors is reduced to control
levels [284] thereby sealing the fate of the cell. Comparing the activation of these molecules at
this time could therefore give important insight into differences in damage response signaling
with respect to radiation quality. Phosphorylation of H2AX even at 4 hours (Fig.3.3.2.2B & D)
indicates the presence of large number of double strand breaks at that time indicating very slow
repair in A549 cells exposed to oxygen beam.
Persistence of significant pATM foci till 4 hours after oxygen ion irradiation (Fig.3.3.2.3)
indicates the presence of unrepaired DNA, which is still keeping the damage sensor protein
ATM in activated form. The slower disappearance of pATM foci from cells, unlike the γ-H2AX
foci (that was seen in 60% of oxygen irradiated cells at 4 hours), could reflect their different
roles in the repair process with γ-H2AX foci playing a primary role in activating downstream
pathways and initiating DNA repair while ATM foci remaining till broken DNA ends are
present. Since the cell survival after 2Gy oxygen irradiation was only 11%, ATM might be
activating downstream apoptotic responses.
The massive activation of ATR after oxygen irradiation when compared with gamma
(Fig.3.3.2.4) in 36% of the cells indicated its specific role in high LET induced complex damage.
The downstream component Chk2, which is activated by ATM and shares its substrates like p53,
201

CHAPTER 4
DISCUSSION
was found to be significantly activated in oxygen irradiated cells. Activation of Chk2 is critical
in regulating cell cycle arrest and DSB repair. Presence of pChk2 foci in nuclei of oxygen
irradiated cells but not gamma indicated Chk2 was an active player in high LET radiation
induced responses (Fig.3.3.2.6A, B). Both ATM and Chk2 have been regarded as primary
regulators of homologous recombination repair (HRR) [103, 251]. Activation of these kinases
after oxygen irradiation indicated involvement of HRR pathway for repairing complex damage
caused by high LET. It is also reasonable to suppose that cells would prefer to repair a complex
damage by activating the machinery of HRR, which can take the advantage of the other strand
that may be intact. Contribution of HRR after high LET radiation had also been shown by
previous studies [212]. Immunofluorescence of phospho Chk1, which is a major target of ATR,
was also found to increase in nuclei of oxygen-irradiated cells (Fig.3.3.2.6C). Activation of Chk2
and Chk1 after oxygen irradiation also indicates cell cycle arrest.
Activation of p53 in oxygen irradiated cells (Fig.3.3.2.5) along with observance of apoptotic
cells (Fig.3.3.2.7) indicated p53 dependent apoptosis in these cells. Despite significant activation
of ATM, ATR, Chk1 and Chk2 in A549 cells exposed to 2Gy oxygen beam, DNA was not
repaired as indicated by the survival data. This further point to the involvement of these kinases
in activation of apoptotic machinery after high LET irradiation.
From a critical analysis of all the results of the present study, it was evident that in
general, high LET radiations cause more severe genomic damage as compared to low LET
radiations. The noteworthy finding of this study is the activation of the sensor proteins, ATM and
ATR by oxygen irradiation and the significant activation of Chk1, Chk2 and p53 only in the
oxygen beam irradiated cells. Since the signaling pathways activated by oxygen beam are
202

CHAPTER 4
DISCUSSION
different from gamma irradiation, signaling component and intensity of activation will be
different by both types of irradiation. These kinases play an important role in repair, cell cycle
arrest and apoptosis. However, only 11% survival after high LET radiation suggests that most of
the damage could not be repaired and that the persistent activation of these kinases may be a
signature for activation of apoptotic responses. Further studies in this direction will reveal the
importance of such response.
4.4 Radiation induced bystander signaling in mammalian cells.
The signaling events seen in totality in the foregoing work may have contribution from the
surrounding microenvironment that is of necessity exposed to radiation. The cells nearby which
are not directly exposed to the radiation but are juxtaposed to the irradiated cells are also affected
because of signals transduced from the ‘hit’ cell. The classical paradigm of radiation biology
asserts that all radiation effects on cells, tissues and organisms are due to the direct action of
radiation. However, there has been a recent growth of interest in the indirect actions of radiation
including the radiation-induced adaptive response, the bystander effect, low-dose
hypersensitivity, and genomic instability, which are specific modes of stress exhibited in
response to low-dose/low-dose rate radiation.
Radiation-induced bystander signals (whether observed through use of medium harvested from
irradiated cells, or through observation of non-hit cells in contact with irradiated cells), appear to
coordinate tissue or population responses so that cells not directly exposed or traversed by
radiation show responses, which may be part of higher order homeostatic control. Bystander
effects appear to be the result of a generalized stress response in tissues or cells. The signals may
be produced by all exposed cells but the response may require a quorum in order to be expressed.
203

CHAPTER 4
DISCUSSION
The major response involving low LET radiation exposure discussed in the existing literature is a
death response, which has many characteristics of apoptosis but may be detected in cell lines
without p53 expression [285].
Two main models have emerged concerning the mechanisms of bystander mediated responses,
mainly based on the way the experiments were performed and the cell type selected for
investigation. They are communication via gap junction intercellular communication (GJIC) and
communication via media-borne or transmissible factors [286-289] (Fig. 1.6).
The present study was carried out to investigate what genes and proteins are activated in the
bystanding cell and whether the state of activation of the irradiated cell alters the bystander
response. The results revealed that there was significant decrease in the survival of bystander
A549 cells and significant increase in γ-H2AX and pATM foci but only in those cells that had
received medium from irradiated cells (Fig.3.4.1). Since the cells treated only with irradiated
medium did not show any change in survival or γ-H2AX and pATM foci the signals which
caused the damage in the bystander cells must be coming from the irradiated cells themselves.
Having confirmed the existence of bystander effect between similar cells (A549 Vs
A549), the work was extended to look for the existence of cross bystander effect between A549
and U937 cells i.e. lung carcinoma and monocytes. There was a significant decrease in the
survival of A549 cells that had received medium from PMA stimulated and irradiated U937 cells
(Fig.3.4.2) and expectedly the γ-H2AX and pATM foci were also significantly higher in these
cells (Fig.3.4.2). A549 cells that had received medium from either irradiated or PMA stimulated
U937 cells did not show bystander response, indicating the fact that activation of U937 was prerequisite
for the induction of cross bystander response. The PMA treatment of monocytes
204

CHAPTER 4
DISCUSSION
upregulates many genes in the monocyte hence their response to irradiation will be different
from unstimulated monocyte.
Having confirmed that bystander effect contributed the survival of the neighbouring cells, the
lung carcinoma A549 cells, the mechanism of bystander effect and the factor involved in the
bystander effect was studied in mouse cell line.
The present results revealed a significant increase in DNA damage in the bystander cells but only
in those cells that had received medium from irradiated cells (Fig.3.4.3.3). Since the cells treated
only with irradiated medium did not show any DNA damage or NO production, the signals
which caused the damage in the bystander cells must be coming from the irradiated cells
themselves. The expression of cell cycle related genes (p53 and p21) was significantly
upregulated in bystander similar cells (Fig.3.4.3.1C and D, Lane 3). These results are in
agreement with the work on bystander signaling [290, 291]. The first report describing the
induction of sister chromatid exchanges (SCE) was examined in Chinese hamster ovary (CHO)
cells. Since CHO cells contain mutant p53, therefore, p53 could not be involved in the bystander
induction of SCE [220]. If the p53 of the bystander cell is mutated there should be less DNA
repair and in fact more bystander effect can be seen when assessed in terms of DNA damage.
A clear cause and effect relationship was established between DNA damage, gene expression
and cell survival and was evident in the form of increase apoptosis in bystander cells (Fig.
3.4.3.4a, Lane 3 and Fig. 3.4.3.4b).
An increased expression of NF-κB gene (p65) could lead to the activation of iNOS gene since
the promoter of the iNOS gene contains binding sites for NF-κB. NF-κB is known to be
205

CHAPTER 4
DISCUSSION
activated by several oxidative stresses including ionization radiation [292-297]. As a
consequence of iNOS gene upregulation and increased production of NO, many forms of
reactive nitrogen species (RNS) would be formed leading to covalent modification of proteins
and the expression of various other genes [298].
Having confirmed the existence of bystander effect between similar cells (EL-4 Vs EL-4), the
work was extended to look for the existence of cross bystander effect between EL-4 and RAW
264.7 cells i.e. lymphocytes and macrophages. There was a significant upregulation of NF-κB
and iNOS genes in EL-4 cells that had received medium from LPS stimulated and irradiated
RAW 264.7 cells (Fig. 3.4.4a, Lane, 2) and expectedly the DNA damage was also significantly
higher in these cells (Fig. 3.4.4b, Lane, 2). A noteworthy finding of this study is the fact that the
unirradiated EL-4 cells that had received medium from LPS stimulated RAW 264.7 cells also
showed upregulation of iNOS gene but not NF-κB gene (Fig. 3.4.4a, Lane, 4). The LPS
treatment of macrophage upregulates many genes in the macrophage hence their response to
irradiation will be different from unstimulated macrophage. Another noteworthy finding of this
study is the fact that the addition of medium from non-irradiated RAW 264.7 cells resulted in
significantly decrease in iNOS gene expression in EL-4 cells relative to the control (Fig. 3.4.4a,
Lane, 5). Non-irradiated macrophages may release some factor which is responsible for down
regulation of iNOS in EL-4 cells. Further studies in this direction will reveal the nature of the
factor. It is clear from the above results that effective cross bystander effects exists between these
two cell lines only when the RAW 264.7 cells are both stimulated and irradiated. Other studies
have looked at only the clonogenic survival of dissimilar bystander cells [216].
206

CHAPTER 4
DISCUSSION
Numerous studies have implicated extracellular secreted signaling proteins in mediating the
bystander effect [289], but the strongest contenders have been reactive oxygen and nitrogen
species [299]. To investigate what factors are involved in radiation induced bystander effect, the
cells were treated with either L-NAME (NOS inhibitor) or cPTIO (NO scavenger). The effect of
cPTIO and L-NAME in bystander response between similar cell (EL-4 Vs EL-4) was different in
the fact that treatment with L-NAME reduces the bystander induction of NF-κB as well as iNOS
gene expression in EL-4 cells receiving medium from irradiated EL-4 cells (Fig. 3.4.5a, Lane 4)
but the treatment with cPTIO reduces the bystander induction of only NF-κB gene expression
and not iNOS gene expression (Fig. 3.4.5a, Lane 5). The above results demonstrate that the
activated NOS in the irradiated cell is essential for gene expression in the bystanding cell.
The addition of either L-NAME or cPTIO reduces the bystander induction of NF-κB as well as
iNOS gene expression in EL-4 cells receiving medium from LPS stimulated and irradiated RAW
264.7 cells (Fig. 3.4.5a, Lane 6 and 7), indicating that both activation of iNOS in the irradiated
cell and NO production play a role in cross bystander effect.
The treatment with L-NAME or cPTIO also reduces the bystander induction of DNA damage in
EL-4 cells receiving medium from irradiated EL-4 cells or LPS stimulated and irradiated RAW
264.7 cells (Fig. 3.4.5b, Lane 4, 5, 6 and 7), demonstrating that NO contributes to the DNA
damage in bystander EL-4 cells. NO is generated endogeneously from L-arginine by inducible
NO synthases [300, 301] that can be stimulated by radiation in mammalian cells [302]. It is
believed that NO itself does not induce DNA strand breaks, although one of its oxidation
product, peroxynitrite is toxic and can cause DNA damage by both attacking deoxyribose and
direct oxidation of purine and pyrimidine [303]. Radiation induced NO has the possibility of
207

CHAPTER 4
DISCUSSION
attacking nearby cells within their diffusion distance of less than 0.5mm [304, 305]. However,
because of their having very short half-lives, they may not be direct contributors to the cellular
damage in the bystander population. This is confirmed by the fact that inclusion of cPTIO in the
medium only marginally inhibits the bystander response in similar cells (Fig. 3.4.5a, Lane 5).
Contrarily, it has also been reported that NO is involved in the bystander responses caused by the
conditioned medium harvested from irradiated cells [306]. Therefore, some long-lived bioactive
factors downstream of NO are most likely involved in this bystander response.
4.5 Summary and Conclusion
Summary:
The irradiation of cells with fractionated doses led to a signaling response that was
different from a single dose of irradiation. A549 cells were found to be relatively more
radioresistant if the 10Gy dose was delivered as a fractionated regimen. Microarray
analysis showed upregulation of DNA repair and cell cycle arrest genes in the cells
exposed to fractionated irradiation. There was intense activation of DNA repair pathway
(DNA-PK, ATM, Rad52, MLH1 and BRCA1), efficient DNA repair and phospho-p53
was found to be translocated to the nucleus of A549 cells exposed to fractionated
irradiation. MCF-7 cells responded differently in fractionated regimen. Silencing of the
Rad52 gene in fractionated group of A549 cells made the cells radiosensitive. The
reasons for the radioresistance of the A549 cells lay in the repair pathway, the Rad52, the
208

CHAPTER 4
DISCUSSION
inhibition of which could revert the cells to radiosensitivity leading to a decrease in
survival.
Proton beam was found to be more cytotoxic than γ-radiation. Proton beam irradiated
cells showed phosphorylation of H2AX, ATM, Chk2 and p53. The mechanism of
excessive cell killing in proton beam irradiated cells was found to be upregulation of Bax
and down-regulation of Bcl-2. The noteworthy finding of this study is the biphasic
activation of the sensor proteins, ATM and DNA-PK and no activation of ATR by proton
irradiation.
Carbon beam was found to be three times more cytotoxic than γ-radiation despite the fact
that the numbers of γ-H2AX foci were same. Percentage of cells showing ATM/ATR foci
were more with gamma however number of foci per cell were more in case of carbon
irradiation. Large BRCA1 foci were found in all carbon irradiated cells unlike gamma
irradiated cells and prosurvival ERK pathway was activated after gamma irradiation but
not carbon. The noteworthy finding of this study is the early phase apoptosis induction by
carbon ions. Despite activation of same repair molecules, differences in low and high
LET damage responses are due to distinct macromolecular complexes of repair proteins
such as ATM, BRCA1 etc rather than their individual activation and the activation of
cytoplasmic pathways such as ERK.
Oxygen beam was found to be three times more cytotoxic than γ-radiation. By 4h there
was efficient repair of DNA in A549 cells exposed to 2Gy or 6Gy gamma radiation but
not in cells exposed to 2Gy oxygen beam as determined by γ-H2AX counting. Number of
ATM foci was found to be significantly higher in cells exposed to 2Gy oxygen beam.
209

CHAPTER 4
DISCUSSION
Percentage of cells showing ATR foci were more with gamma however number of foci
per cell were more in case of oxygen beam. Oxygen beam irradiated cells showed
phosphorylation of Chk1, Chk2 and p53. Many apoptotic nuclei were seen by DAPI
staining in cells exposed to oxygen beam. The noteworthy finding of this study is the
activation of the sensor proteins, ATM and ATR by oxygen irradiation and the significant
activation of Chk1, Chk2 and p53 only in the oxygen beam irradiated cells.
The current study is a clear evidence of radiation induced bystander effect being involved
in adaptive responses in the bystander cells. Moreover, it also points towards the potential
involvement of signaling molecules released into the medium by the irradiated cells
which elicit a response in the bystander cells. Also there may be potential involvement of
stable free radicals that are produced in the medium as a result of irradiation, in eliciting a
response from the bystander cells. The mechanism of which may be via NO generation.
Conclusion:
Radiation induced signal transduction, as understood presently, is an activation of the
existing network, where both positive and negative signals converge and these are interpreted as
cell survival and cell death. In spite of the fact that mere phosphorylation by kinases seem to be
the basic theme, it is crucial as based on this life or death decisions are taken. Hence enormous
cross checking of the ultimate signal must exist. The lung carcinoma cell line A549, a highly
radioresistant cell line could be effectively made radiosensitive by inhibiting Rad52, one of the
components of its repair pathway. The survival of the cells decreased significantly after doing so.
210

CHAPTER 4
DISCUSSION
The survival of the A549 cell line could also be significantly decreased by heavy ion
irradiation. The mechanism of which seems to be a lack of repair, despite the activation of some
of the component of the repair pathway. Besides the microenvironment of the cells and the LET
of the radiation, even transfer of medium from irradiated cells to non-irradiated cells can alter the
pattern of signaling in a cell.
211

CHAPTER 5
REFERENCES
REFERENCES
212

CHAPTER 5
REFERENCES
[1] Khan, F. The physics of radiation therapy. Baltimore, MD: Williams and Wilkins;
1994.
[2] Alpen, E. L. Radiation Biophysics. Prentice Hall, New Jersey; 1990.
[3] Little, J. B. Cellular effects of ionizing radiation. N Engl J Med 278:369-376
concl; 1968.
[4] Prise, K. M.; Schettino, G.; Folkard, M.; Held, K. D. New insights on cell death
from radiation exposure. Lancet Oncol 6:520-528; 2005.
[5] Szostak, M. J.; Kyprianou, N. Radiation-induced apoptosis: predictive and
therapeutic significance in radiotherapy of prostate cancer (review). Oncol Rep 7:699-
706; 2000.
[6] Aviles, A.; Fernandez, R.; Calva, A.; Neri, N.; Huerta-Guzman, J.; Nambo, M. J.
Radiotherapy versus combined therapy in early stages with bulky disease aggressive
malignant lymphoma. Hematology 8:7-10; 2003.
[7] Zhang, M.; Zhang, Z.; Garmestani, K.; Schultz, J.; Axworthy, D. B.; Goldman, C.
K.; Brechbiel, M. W.; Carrasquillo, J. A.; Waldmann, T. A. Pretarget radiotherapy with
an anti-CD25 antibody-streptavidin fusion protein was effective in therapy of
leukemia/lymphoma xenografts. Proc Natl Acad Sci U S A 100:1891-1895; 2003.
[8] Thames, H. D.; Bentzen, S. M.; Turesson, I.; Overgaard, M.; Van den Bogaert,
W. Time-dose factors in radiotherapy: a review of the human data. Radiother Oncol
19:219-235; 1990.
[9] Caspari, T. How to activate p53. Curr Biol 10:R315-317; 2000.
213

CHAPTER 5
REFERENCES
[10] Mailand, N.; Falck, J.; Lukas, C.; Syljuasen, R. G.; Welcker, M.; Bartek, J.;
Lukas, J. Rapid destruction of human Cdc25A in response to DNA damage. Science
288:1425-1429; 2000.
[11] Lakin, N. D.; Jackson, S. P. Regulation of p53 in response to DNA damage.
Oncogene 18:7644-7655; 1999.
[12] Lowndes, N. F.; Murguia, J. R. Sensing and responding to DNA damage. Curr
Opin Genet Dev 10:17-25; 2000.
[13] Rich, T.; Allen, R. L.; Wyllie, A. H. Defying death after DNA damage. Nature
407:777-783; 2000.
[14] Hartley, K. O.; Gell, D.; Smith, G. C.; Zhang, H.; Divecha, N.; Connelly, M. A.;
Admon, A.; Lees-Miller, S. P.; Anderson, C. W.; Jackson, S. P. DNA-dependent protein
kinase catalytic subunit: a relative of phosphatidylinositol 3-kinase and the ataxia
telangiectasia gene product. Cell 82:849-856; 1995.
[15] Smith, G. C.; Jackson, S. P. The DNA-dependent protein kinase. Genes Dev
13:916-934; 1999.
[16] Dvir, A.; Stein, L. Y.; Calore, B. L.; Dynan, W. S. Purification and
characterization of a template-associated protein kinase that phosphorylates RNA
polymerase II. J Biol Chem 268:10440-10447; 1993.
[17] Gottlieb, T. M.; Jackson, S. P. The DNA-dependent protein kinase: requirement
for DNA ends and association with Ku antigen. Cell 72:131-142; 1993.
[18] Hammarsten, O.; Chu, G. DNA-dependent protein kinase: DNA binding and
activation in the absence of Ku. Proc Natl Acad Sci U S A 95:525-530; 1998.
214

CHAPTER 5
REFERENCES
[19] Woo, R. A.; McLure, K. G.; Lees-Miller, S. P.; Rancourt, D. E.; Lee, P. W. DNAdependent
protein kinase acts upstream of p53 in response to DNA damage. Nature
394:700-704; 1998.
[20] Shieh, S. Y.; Ikeda, M.; Taya, Y.; Prives, C. DNA damage-induced
phosphorylation of p53 alleviates inhibition by MDM2. Cell 91:325-334; 1997.
[21] Rathmell, W. K.; Kaufmann, W. K.; Hurt, J. C.; Byrd, L. L.; Chu, G. DNAdependent
protein kinase is not required for accumulation of p53 or cell cycle arrest after
DNA damage. Cancer Res 57:68-74; 1997.
[22] Burma, S.; Kurimasa, A.; Xie, G.; Taya, Y.; Araki, R.; Abe, M.; Crissman, H. A.;
Ouyang, H.; Li, G. C.; Chen, D. J. DNA-dependent protein kinase-independent activation
of p53 in response to DNA damage. J Biol Chem 274:17139-17143; 1999.
[23] Jhappan, C.; Yusufzai, T. M.; Anderson, S.; Anver, M. R.; Merlino, G. The p53
response to DNA damage in vivo is independent of DNA-dependent protein kinase. Mol
Cell Biol 20:4075-4083; 2000.
[24] Wang, S.; Guo, M.; Ouyang, H.; Li, X.; Cordon-Cardo, C.; Kurimasa, A.; Chen,
D. J.; Fuks, Z.; Ling, C. C.; Li, G. C. The catalytic subunit of DNA-dependent protein
kinase selectively regulates p53-dependent apoptosis but not cell-cycle arrest. Proc Natl
Acad Sci U S A 97:1584-1588; 2000.
[25] Kurimasa, A.; Kumano, S.; Boubnov, N. V.; Story, M. D.; Tung, C. S.; Peterson,
S. R.; Chen, D. J. Requirement for the kinase activity of human DNA-dependent protein
kinase catalytic subunit in DNA strand break rejoining. Mol Cell Biol 19:3877-3884;
1999.
215

CHAPTER 5
REFERENCES
[26] Zou, L.; Elledge, S. J. Sensing DNA damage through ATRIP recognition of RPAssDNA
complexes. Science 300:1542-1548; 2003.
[27] You, Z.; Kong, L.; Newport, J. The role of single-stranded DNA and polymerase
alpha in establishing the ATR, Hus1 DNA replication checkpoint. J Biol Chem
277:27088-27093; 2002.
[28] Abraham, R. T. Cell cycle checkpoint signaling through the ATM and ATR
kinases. Genes Dev 15:2177-2196; 2001.
[29] Shiloh, Y. ATM and related protein kinases: safeguarding genome integrity. Nat
Rev Cancer 3:155-168; 2003.
[30] Brown, E. J.; Baltimore, D. Essential and dispensable roles of ATR in cell cycle
arrest and genome maintenance. Genes Dev 17:615-628; 2003.
[31] Brown, E. J.; Baltimore, D. ATR disruption leads to chromosomal fragmentation
and early embryonic lethality. Genes Dev 14:397-402; 2000.
[32] Hekmat-Nejad, M.; You, Z.; Yee, M. C.; Newport, J. W.; Cimprich, K. A.
Xenopus ATR is a replication-dependent chromatin-binding protein required for the
DNA replication checkpoint. Curr Biol 10:1565-1573; 2000.
[33] Dart, D. A.; Adams, K. E.; Akerman, I.; Lakin, N. D. Recruitment of the cell
cycle checkpoint kinase ATR to chromatin during S-phase. J Biol Chem 279:16433-
16440; 2004.
[34] Shechter, D.; Costanzo, V.; Gautier, J. ATR and ATM regulate the timing of
DNA replication origin firing. Nat Cell Biol 6:648-655; 2004.
216

CHAPTER 5
REFERENCES
[35] Nghiem, P.; Park, P. K.; Kim, Y.; Vaziri, C.; Schreiber, S. L. ATR inhibition
selectively sensitizes G1 checkpoint-deficient cells to lethal premature chromatin
condensation. Proc Natl Acad Sci U S A 98:9092-9097; 2001.
[36] Cha, R. S.; Kleckner, N. ATR homolog Mec1 promotes fork progression, thus
averting breaks in replication slow zones. Science 297:602-606; 2002.
[37] O'Driscoll, M.; Ruiz-Perez, V. L.; Woods, C. G.; Jeggo, P. A.; Goodship, J. A. A
splicing mutation affecting expression of ataxia-telangiectasia and Rad3-related protein
(ATR) results in Seckel syndrome. Nat Genet 33:497-501; 2003.
[38] Tibbetts, R. S.; Cortez, D.; Brumbaugh, K. M.; Scully, R.; Livingston, D.;
Elledge, S. J.; Abraham, R. T. Functional interactions between BRCA1 and the
checkpoint kinase ATR during genotoxic stress. Genes Dev 14:2989-3002; 2000.
[39] Dodson, G. E.; Shi, Y.; Tibbetts, R. S. DNA replication defects, spontaneous
DNA damage, and ATM-dependent checkpoint activation in replication protein A-
deficient cells. J Biol Chem 279:34010-34014; 2004.
[40] Bomgarden, R. D.; Yean, D.; Yee, M. C.; Cimprich, K. A. A novel protein
activity mediates DNA binding of an ATR-ATRIP complex. J Biol Chem 279:13346-
13353; 2004.
[41] Stiff, T.; Reis, C.; Alderton, G. K.; Woodbine, L.; O'Driscoll, M.; Jeggo, P. A.
Nbs1 is required for ATR-dependent phosphorylation events. Embo J 24:199-208; 2005.
[42] Busino, L.; Donzelli, M.; Chiesa, M.; Guardavaccaro, D.; Ganoth, D.; Dorrello,
N. V.; Hershko, A.; Pagano, M.; Draetta, G. F. Degradation of Cdc25A by beta-TrCP
during S phase and in response to DNA damage. Nature 426:87-91; 2003.
217

CHAPTER 5
REFERENCES
[43] Jin, J.; Shirogane, T.; Xu, L.; Nalepa, G.; Qin, J.; Elledge, S. J.; Harper, J. W.
SCFbeta-TRCP links Chk1 signaling to degradation of the Cdc25A protein phosphatase.
Genes Dev 17:3062-3074; 2003.
[44] Heffernan, T. P.; Simpson, D. A.; Frank, A. R.; Heinloth, A. N.; Paules, R. S.;
Cordeiro-Stone, M.; Kaufmann, W. K. An ATR- and Chk1-dependent S checkpoint
inhibits replicon initiation following UVC-induced DNA damage. Mol Cell Biol
22:8552-8561; 2002.
[45] Bartek, J.; Lukas, C.; Lukas, J. Checking on DNA damage in S phase. Nat Rev
Mol Cell Biol 5:792-804; 2004.
[46] Andreassen, P. R.; D'Andrea, A. D.; Taniguchi, T. ATR couples FANCD2
monoubiquitination to the DNA-damage response. Genes Dev 18:1958-1963; 2004.
[47] Wang, X.; D'Andrea, A. D. The interplay of Fanconi anemia proteins in the DNA
damage response. DNA Repair (Amst) 3:1063-1069; 2004.
[48] Venkitaraman, A. R. Tracing the network connecting BRCA and Fanconi
anaemia proteins. Nat Rev Cancer 4:266-276; 2004.
[49] Pichierri, P.; Rosselli, F. The DNA crosslink-induced S-phase checkpoint depends
on ATR-CHK1 and ATR-NBS1-FANCD2 pathways. Embo J 23:1178-1187; 2004.
[50] Tibbetts, R. S.; Brumbaugh, K. M.; Williams, J. M.; Sarkaria, J. N.; Cliby, W. A.;
Shieh, S. Y.; Taya, Y.; Prives, C.; Abraham, R. T. A role for ATR in the DNA damageinduced
phosphorylation of p53. Genes Dev 13:152-157; 1999.
[51] Lakin, N. D.; Hann, B. C.; Jackson, S. P. The ataxia-telangiectasia related protein
ATR mediates DNA-dependent phosphorylation of p53. Oncogene 18:3989-3995; 1999.
218

CHAPTER 5
REFERENCES
[52] McKay, B. C.; Ljungman, M.; Rainbow, A. J. Potential roles for p53 in nucleotide
excision repair. Carcinogenesis 20:1389-1396; 1999.
[53] Sengupta, S.; Harris, C. C. p53: traffic cop at the crossroads of DNA repair and
recombination. Nat Rev Mol Cell Biol 6:44-55; 2005.
[54] Sorensen, C. S.; Hansen, L. T.; Dziegielewski, J.; Syljuasen, R. G.; Lundin, C.;
Bartek, J.; Helleday, T. The cell-cycle checkpoint kinase Chk1 is required for mammalian
homologous recombination repair. Nat Cell Biol 7:195-201; 2005.
[55] Shinozaki, T.; Nota, A.; Taya, Y.; Okamoto, K. Functional role of Mdm2
phosphorylation by ATR in attenuation of p53 nuclear export. Oncogene 22:8870-8880;
2003.
[56] Shiloh, Y. ATM: ready, set, go. Cell Cycle 2:116-117; 2003.
[57] Lavin, M. F.; Shiloh, Y. The genetic defect in ataxia-telangiectasia. Annu Rev
Immunol 15:177-202; 1997.
[58] Savitsky, K.; Sfez, S.; Tagle, D. A.; Ziv, Y.; Sartiel, A.; Collins, F. S.; Shiloh, Y.;
Rotman, G. The complete sequence of the coding region of the ATM gene reveals
similarity to cell cycle regulators in different species. Hum Mol Genet 4:2025-2032;
1995.
[59] Savitsky, K.; Bar-Shira, A.; Gilad, S.; Rotman, G.; Ziv, Y.; Vanagaite, L.; Tagle,
D. A.; Smith, S.; Uziel, T.; Sfez, S.; Ashkenazi, M.; Pecker, I.; Frydman, M.; Harnik, R.;
Patanjali, S. R.; Simmons, A.; Clines, G. A.; Sartiel, A.; Gatti, R. A.; Chessa, L.; Sanal,
O.; Lavin, M. F.; Jaspers, N. G.; Taylor, A. M.; Arlett, C. F.; Miki, T.; Weissman, S. M.;
Lovett, M.; Collins, F. S.; Shiloh, Y. A single ataxia telangiectasia gene with a product
similar to PI-3 kinase. Science 268:1749-1753; 1995.
219

CHAPTER 5
REFERENCES
[60] Goodarzi, A. A.; Block, W. D.; Lees-Miller, S. P. The role of ATM and ATR in
DNA damage-induced cell cycle control. Prog Cell Cycle Res 5:393-411; 2003.
[61] Manning, G.; Whyte, D. B.; Martinez, R.; Hunter, T.; Sudarsanam, S. The protein
kinase complement of the human genome. Science 298:1912-1934; 2002.
[62] Kim, S. T.; Lim, D. S.; Canman, C. E.; Kastan, M. B. Substrate specificities and
identification of putative substrates of ATM kinase family members. J Biol Chem
274:37538-37543; 1999.
[63] O'Neill, T.; Dwyer, A. J.; Ziv, Y.; Chan, D. W.; Lees-Miller, S. P.; Abraham, R.
H.; Lai, J. H.; Hill, D.; Shiloh, Y.; Cantley, L. C.; Rathbun, G. A. Utilization of oriented
peptide libraries to identify substrate motifs selected by ATM. J Biol Chem 275:22719-
22727; 2000.
[64] Bosotti, R.; Isacchi, A.; Sonnhammer, E. L. FAT: a novel domain in PIK-related
kinases. Trends Biochem Sci 25:225-227; 2000.
[65] Bakkenist, C. J.; Kastan, M. B. DNA damage activates ATM through
intermolecular autophosphorylation and dimer dissociation. Nature 421:499-506; 2003.
[66] Perry, J.; Kleckner, N. The ATRs, ATMs, and TORs are giant HEAT repeat
proteins. Cell 112:151-155; 2003.
[67] Llorca, O.; Rivera-Calzada, A.; Grantham, J.; Willison, K. R. Electron
microscopy and 3D reconstructions reveal that human ATM kinase uses an arm-like
domain to clamp around double-stranded DNA. Oncogene 22:3867-3874; 2003.
[68] Leuther, K. K.; Hammarsten, O.; Kornberg, R. D.; Chu, G. Structure of DNAdependent
protein kinase: implications for its regulation by DNA. Embo J 18:1114-1123;
1999.
220

CHAPTER 5
REFERENCES
[69] Cary, R. B.; Peterson, S. R.; Wang, J.; Bear, D. G.; Bradbury, E. M.; Chen, D. J.
DNA looping by Ku and the DNA-dependent protein kinase. Proc Natl Acad Sci U S A
94:4267-4272; 1997.
[70] Smith, G. C.; Cary, R. B.; Lakin, N. D.; Hann, B. C.; Teo, S. H.; Chen, D. J.;
Jackson, S. P. Purification and DNA binding properties of the ataxia-telangiectasia gene
product ATM. Proc Natl Acad Sci U S A 96:11134-11139; 1999.
[71] Merkle, D.; Douglas, P.; Moorhead, G. B.; Leonenko, Z.; Yu, Y.; Cramb, D.;
Bazett-Jones, D. P.; Lees-Miller, S. P. The DNA-dependent protein kinase interacts with
DNA to form a protein-DNA complex that is disrupted by phosphorylation. Biochemistry
41:12706-12714; 2002.
[72] Yaneva, M.; Kowalewski, T.; Lieber, M. R. Interaction of DNA-dependent
protein kinase with DNA and with Ku: biochemical and atomic-force microscopy studies.
Embo J 16:5098-5112; 1997.
[73] Banin, S.; Moyal, L.; Shieh, S.; Taya, Y.; Anderson, C. W.; Chessa, L.;
Smorodinsky, N. I.; Prives, C.; Reiss, Y.; Shiloh, Y.; Ziv, Y. Enhanced phosphorylation
of p53 by ATM in response to DNA damage. Science 281:1674-1677; 1998.
[74] Lakin, N. D.; Weber, P.; Stankovic, T.; Rottinghaus, S. T.; Taylor, A. M.;
Jackson, S. P. Analysis of the ATM protein in wild-type and ataxia telangiectasia cells.
Oncogene 13:2707-2716; 1996.
[75] Canman, C. E.; Lim, D. S.; Cimprich, K. A.; Taya, Y.; Tamai, K.; Sakaguchi, K.;
Appella, E.; Kastan, M. B.; Siliciano, J. D. Activation of the ATM kinase by ionizing
radiation and phosphorylation of p53. Science 281:1677-1679; 1998.
221

CHAPTER 5
REFERENCES
[76] Chan, D. W.; Gately, D. P.; Urban, S.; Galloway, A. M.; Lees-Miller, S. P.; Yen,
T.; Allalunis-Turner, J. Lack of correlation between ATM protein expression and tumour
cell radiosensitivity. Int J Radiat Biol 74:217-224; 1998.
[77] Kozlov, S.; Gueven, N.; Keating, K.; Ramsay, J.; Lavin, M. F. ATP activates
ataxia-telangiectasia mutated (ATM) in vitro. Importance of autophosphorylation. J Biol
Chem 278:9309-9317; 2003.
[78] Chan, D. W.; Son, S. C.; Block, W.; Ye, R.; Khanna, K. K.; Wold, M. S.;
Douglas, P.; Goodarzi, A. A.; Pelley, J.; Taya, Y.; Lavin, M. F.; Lees-Miller, S. P.
Purification and characterization of ATM from human placenta. A manganese-dependent,
wortmannin-sensitive serine/threonine protein kinase. J Biol Chem 275:7803-7810; 2000.
[79] Suzuki, K.; Kodama, S.; Watanabe, M. Recruitment of ATM protein to double
strand DNA irradiated with ionizing radiation. J Biol Chem 274:25571-25575; 1999.
[80] Andegeko, Y.; Moyal, L.; Mittelman, L.; Tsarfaty, I.; Shiloh, Y.; Rotman, G.
Nuclear retention of ATM at sites of DNA double strand breaks. J Biol Chem 276:38224-
38230; 2001.
[81] Petrini, J. H.; Stracker, T. H. The cellular response to DNA double-strand breaks:
defining the sensors and mediators. Trends Cell Biol 13:458-462; 2003.
[82] van den Bosch, M.; Bree, R. T.; Lowndes, N. F. The MRN complex: coordinating
and mediating the response to broken chromosomes. EMBO Rep 4:844-849; 2003.
[83] Stewart, G. S.; Maser, R. S.; Stankovic, T.; Bressan, D. A.; Kaplan, M. I.; Jaspers,
N. G.; Raams, A.; Byrd, P. J.; Petrini, J. H.; Taylor, A. M. The DNA double-strand break
repair gene hMRE11 is mutated in individuals with an ataxia-telangiectasia-like disorder.
Cell 99:577-587; 1999.
222

CHAPTER 5
REFERENCES
[84] Uziel, T.; Lerenthal, Y.; Moyal, L.; Andegeko, Y.; Mittelman, L.; Shiloh, Y.
Requirement of the MRN complex for ATM activation by DNA damage. Embo J
22:5612-5621; 2003.
[85] Carson, C. T.; Schwartz, R. A.; Stracker, T. H.; Lilley, C. E.; Lee, D. V.;
Weitzman, M. D. The Mre11 complex is required for ATM activation and the G2/M
checkpoint. Embo J 22:6610-6620; 2003.
[86] Lukas, C.; Falck, J.; Bartkova, J.; Bartek, J.; Lukas, J. Distinct spatiotemporal
dynamics of mammalian checkpoint regulators induced by DNA damage. Nat Cell Biol
5:255-260; 2003.
[87] Rogakou, E. P.; Boon, C.; Redon, C.; Bonner, W. M. Megabase chromatin
domains involved in DNA double-strand breaks in vivo. J Cell Biol 146:905-916; 1999.
[88] Goldberg, M.; Stucki, M.; Falck, J.; D'Amours, D.; Rahman, D.; Pappin, D.;
Bartek, J.; Jackson, S. P. MDC1 is required for the intra-S-phase DNA damage
checkpoint. Nature 421:952-956; 2003.
[89] Mochan, T. A.; Venere, M.; DiTullio, R. A., Jr.; Halazonetis, T. D. 53BP1 and
NFBD1/MDC1-Nbs1 function in parallel interacting pathways activating ataxiatelangiectasia
mutated (ATM) in response to DNA damage. Cancer Res 63:8586-8591;
2003.
[90] Foray, N.; Marot, D.; Gabriel, A.; Randrianarison, V.; Carr, A. M.; Perricaudet,
M.; Ashworth, A.; Jeggo, P. A subset of ATM- and ATR-dependent phosphorylation
events requires the BRCA1 protein. Embo J 22:2860-2871; 2003.
223

CHAPTER 5
REFERENCES
[91] Kim, S. T.; Xu, B.; Kastan, M. B. Involvement of the cohesin protein, Smc1, in
Atm-dependent and independent responses to DNA damage. Genes Dev 16:560-570;
2002.
[92] Yarden, R. I.; Pardo-Reoyo, S.; Sgagias, M.; Cowan, K. H.; Brody, L. C. BRCA1
regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat Genet
30:285-289; 2002.
[93] Gatei, M.; Zhou, B. B.; Hobson, K.; Scott, S.; Young, D.; Khanna, K. K. Ataxia
telangiectasia mutated (ATM) kinase and ATM and Rad3 related kinase mediate
phosphorylation of Brca1 at distinct and overlapping sites. In vivo assessment using
phospho-specific antibodies. J Biol Chem 276:17276-17280; 2001.
[94] Wang, Y.; Cortez, D.; Yazdi, P.; Neff, N.; Elledge, S. J.; Qin, J. BASC, a super
complex of BRCA1-associated proteins involved in the recognition and repair of aberrant
DNA structures. Genes Dev 14:927-939; 2000.
[95] Yu, X.; Chini, C. C.; He, M.; Mer, G.; Chen, J. The BRCT domain is a phosphoprotein
binding domain. Science 302:639-642; 2003.
[96] Manke, I. A.; Lowery, D. M.; Nguyen, A.; Yaffe, M. B. BRCT repeats as
phosphopeptide-binding modules involved in protein targeting. Science 302:636-639;
2003.
[97] Rodriguez, M.; Yu, X.; Chen, J.; Songyang, Z. Phosphopeptide binding
specificities of BRCA1 COOH-terminal (BRCT) domains. J Biol Chem 278:52914-
52918; 2003.
224

CHAPTER 5
REFERENCES
[98] Liu, Y.; Virshup, D. M.; White, R. L.; Hsu, L. C. Regulation of BRCA1
phosphorylation by interaction with protein phosphatase 1alpha. Cancer Res 62:6357-
6361; 2002.
[99] Li, N.; Banin, S.; Ouyang, H.; Li, G. C.; Courtois, G.; Shiloh, Y.; Karin, M.;
Rotman, G. ATM is required for IkappaB kinase (IKKk) activation in response to DNA
double strand breaks. J Biol Chem 276:8898-8903; 2001.
[100] Sapkota, G. P.; Deak, M.; Kieloch, A.; Morrice, N.; Goodarzi, A. A.; Smythe, C.;
Shiloh, Y.; Lees-Miller, S. P.; Alessi, D. R. Ionizing radiation induces ataxia
telangiectasia mutated kinase (ATM)-mediated phosphorylation of LKB1/STK11 at Thr-
366. Biochem J 368:507-516; 2002.
[101] Baskaran, R.; Wood, L. D.; Whitaker, L. L.; Canman, C. E.; Morgan, S. E.; Xu,
Y.; Barlow, C.; Baltimore, D.; Wynshaw-Boris, A.; Kastan, M. B.; Wang, J. Y. Ataxia
telangiectasia mutant protein activates c-Abl tyrosine kinase in response to ionizing
radiation. Nature 387:516-519; 1997.
[102] Gatei, M.; Sloper, K.; Sorensen, C.; Syljuasen, R.; Falck, J.; Hobson, K.; Savage,
K.; Lukas, J.; Zhou, B. B.; Bartek, J.; Khanna, K. K. Ataxia-telangiectasia-mutated
(ATM) and NBS1-dependent phosphorylation of Chk1 on Ser-317 in response to ionizing
radiation. J Biol Chem 278:14806-14811; 2003.
[103] Zhang, J.; Willers, H.; Feng, Z.; Ghosh, J. C.; Kim, S.; Weaver, D. T.; Chung, J.
H.; Powell, S. N.; Xia, F. Chk2 phosphorylation of BRCA1 regulates DNA double-strand
break repair. Mol Cell Biol 24:708-718; 2004.
225

CHAPTER 5
REFERENCES
[104] Lee, J. S.; Collins, K. M.; Brown, A. L.; Lee, C. H.; Chung, J. H. hCds1-mediated
phosphorylation of BRCA1 regulates the DNA damage response. Nature 404:201-204;
2000.
[105] Chen, G.; Yuan, S. S.; Liu, W.; Xu, Y.; Trujillo, K.; Song, B.; Cong, F.; Goff, S.
P.; Wu, Y.; Arlinghaus, R.; Baltimore, D.; Gasser, P. J.; Park, M. S.; Sung, P.; Lee, E. Y.
Radiation-induced assembly of Rad51 and Rad52 recombination complex requires ATM
and c-Abl. J Biol Chem 274:12748-12752; 1999.
[106] Foray, N.; Marot, D.; Randrianarison, V.; Venezia, N. D.; Picard, D.; Perricaudet,
M.; Favaudon, V.; Jeggo, P. Constitutive association of BRCA1 and c-Abl and its ATMdependent
disruption after irradiation. Mol Cell Biol 22:4020-4032; 2002.
[107] Powell, S. N.; Kachnic, L. A. Roles of BRCA1 and BRCA2 in homologous
recombination, DNA replication fidelity and the cellular response to ionizing radiation.
Oncogene 22:5784-5791; 2003.
[108] Villunger, A.; Michalak, E. M.; Coultas, L.; Mullauer, F.; Bock, G.;
Ausserlechner, M. J.; Adams, J. M.; Strasser, A. p53- and drug-induced apoptotic
responses mediated by BH3-only proteins puma and noxa. Science 302:1036-1038; 2003.
[109] Siliciano, J. D.; Canman, C. E.; Taya, Y.; Sakaguchi, K.; Appella, E.; Kastan, M.
B. DNA damage induces phosphorylation of the amino terminus of p53. Genes Dev
11:3471-3481; 1997.
[110] Saito, S.; Goodarzi, A. A.; Higashimoto, Y.; Noda, Y.; Lees-Miller, S. P.;
Appella, E.; Anderson, C. W. ATM mediates phosphorylation at multiple p53 sites,
including Ser(46), in response to ionizing radiation. J Biol Chem 277:12491-12494;
2002.
226

CHAPTER 5
REFERENCES
[111] Fei, P.; El-Deiry, W. S. P53 and radiation responses. Oncogene 22:5774-5783;
2003.
[112] el-Deiry, W. S.; Tokino, T.; Velculescu, V. E.; Levy, D. B.; Parsons, R.; Trent, J.
M.; Lin, D.; Mercer, W. E.; Kinzler, K. W.; Vogelstein, B. WAF1, a potential mediator
of p53 tumor suppression. Cell 75:817-825; 1993.
[113] Noda, A.; Ning, Y.; Venable, S. F.; Pereira-Smith, O. M.; Smith, J. R. Cloning of
senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp Cell
Res 211:90-98; 1994.
[114] Sherr, C. J.; Roberts, J. M. CDK inhibitors: positive and negative regulators of
G1-phase progression. Genes Dev 13:1501-1512; 1999.
[115] LaBaer, J.; Garrett, M. D.; Stevenson, L. F.; Slingerland, J. M.; Sandhu, C.; Chou,
H. S.; Fattaey, A.; Harlow, E. New functional activities for the p21 family of CDK
inhibitors. Genes Dev 11:847-862; 1997.
[116] Harper, J. W.; Elledge, S. J.; Keyomarsi, K.; Dynlacht, B.; Tsai, L. H.; Zhang, P.;
Dobrowolski, S.; Bai, C.; Connell-Crowley, L.; Swindell, E.; et al. Inhibition of cyclindependent
kinases by p21. Mol Biol Cell 6:387-400; 1995.
[117] Smits, V. A.; Klompmaker, R.; Vallenius, T.; Rijksen, G.; Makela, T. P.;
Medema, R. H. p21 inhibits Thr161 phosphorylation of Cdc2 to enforce the G2 DNA
damage checkpoint. J Biol Chem 275:30638-30643; 2000.
[118] Roninson, I. B. Oncogenic functions of tumour suppressor p21(Waf1/Cip1/Sdi1):
association with cell senescence and tumour-promoting activities of stromal fibroblasts.
Cancer Lett 179:1-14; 2002.
227

CHAPTER 5
REFERENCES
[119] Jascur, T.; Brickner, H.; Salles-Passador, I.; Barbier, V.; El Khissiin, A.; Smith,
B.; Fotedar, R.; Fotedar, A. Regulation of p21(WAF1/CIP1) stability by WISp39, a
Hsp90 binding TPR protein. Mol Cell 17:237-249; 2005.
[120] Waldman, T.; Lengauer, C.; Kinzler, K. W.; Vogelstein, B. Uncoupling of S
phase and mitosis induced by anticancer agents in cells lacking p21. Nature 381:713-716;
1996.
[121] Wood, R. D.; Mitchell, M.; Sgouros, J.; Lindahl, T. Human DNA repair genes.
Science 291:1284-1289; 2001.
[122] Sonoda, E.; Sasaki, M. S.; Morrison, C.; Yamaguchi-Iwai, Y.; Takata, M.;
Takeda, S. Sister chromatid exchanges are mediated by homologous recombination in
vertebrate cells. Mol Cell Biol 19:5166-5169; 1999.
[123] Moynahan, M. E.; Chiu, J. W.; Koller, B. H.; Jasin, M. Brca1 controls homologydirected
DNA repair. Mol Cell 4:511-518; 1999.
[124] Jimenez, G. S.; Bryntesson, F.; Torres-Arzayus, M. I.; Priestley, A.; Beeche, M.;
Saito, S.; Sakaguchi, K.; Appella, E.; Jeggo, P. A.; Taccioli, G. E.; Wahl, G. M.; Hubank,
M. DNA-dependent protein kinase is not required for the p53-dependent response to
DNA damage. Nature 400:81-83; 1999.
[125] Modesti, M.; Hesse, J. E.; Gellert, M. DNA binding of Xrcc4 protein is associated
with V(D)J recombination but not with stimulation of DNA ligase IV activity. Embo J
18:2008-2018; 1999.
[126] Singleton, B. K.; Torres-Arzayus, M. I.; Rottinghaus, S. T.; Taccioli, G. E.;
Jeggo, P. A. The C terminus of Ku80 activates the DNA-dependent protein kinase
catalytic subunit. Mol Cell Biol 19:3267-3277; 1999.
228

CHAPTER 5
REFERENCES
[127] Frank, K. M.; Sekiguchi, J. M.; Seidl, K. J.; Swat, W.; Rathbun, G. A.; Cheng, H.
L.; Davidson, L.; Kangaloo, L.; Alt, F. W. Late embryonic lethality and impaired V(D)J
recombination in mice lacking DNA ligase IV. Nature 396:173-177; 1998.
[128] Barnes, D. E.; Stamp, G.; Rosewell, I.; Denzel, A.; Lindahl, T. Targeted
disruption of the gene encoding DNA ligase IV leads to lethality in embryonic mice.
Curr Biol 8:1395-1398; 1998.
[129] Gao, Y.; Sun, Y.; Frank, K. M.; Dikkes, P.; Fujiwara, Y.; Seidl, K. J.; Sekiguchi,
J. M.; Rathbun, G. A.; Swat, W.; Wang, J.; Bronson, R. T.; Malynn, B. A.; Bryans, M.;
Zhu, C.; Chaudhuri, J.; Davidson, L.; Ferrini, R.; Stamato, T.; Orkin, S. H.; Greenberg,
M. E.; Alt, F. W. A critical role for DNA end-joining proteins in both lymphogenesis and
neurogenesis. Cell 95:891-902; 1998.
[130] Riballo, E.; Critchlow, S. E.; Teo, S. H.; Doherty, A. J.; Priestley, A.; Broughton,
B.; Kysela, B.; Beamish, H.; Plowman, N.; Arlett, C. F.; Lehmann, A. R.; Jackson, S. P.;
Jeggo, P. A. Identification of a defect in DNA ligase IV in a radiosensitive leukaemia
patient. Curr Biol 9:699-702; 1999.
[131] Baumann, P.; West, S. C. Role of the human RAD51 protein in homologous
recombination and double-stranded-break repair. Trends Biochem Sci 23:247-251; 1998.
[132] Lee, S. E.; Mitchell, R. A.; Cheng, A.; Hendrickson, E. A. Evidence for DNA-
PK-dependent and -independent DNA double-strand break repair pathways in
mammalian cells as a function of the cell cycle. Mol Cell Biol 17:1425-1433; 1997.
[133] New, J. H.; Sugiyama, T.; Zaitseva, E.; Kowalczykowski, S. C. Rad52 protein
stimulates DNA strand exchange by Rad51 and replication protein A. Nature 391:407-
410; 1998.
229

CHAPTER 5
REFERENCES
[134] Benson, F. E.; Baumann, P.; West, S. C. Synergistic actions of Rad51 and Rad52
in recombination and DNA repair. Nature 391:401-404; 1998.
[135] Van Dyck, E.; Stasiak, A. Z.; Stasiak, A.; West, S. C. Binding of double-strand
breaks in DNA by human Rad52 protein. Nature 398:728-731; 1999.
[136] Lim, D. S.; Hasty, P. A mutation in mouse rad51 results in an early embryonic
lethal that is suppressed by a mutation in p53. Mol Cell Biol 16:7133-7143; 1996.
[137] Rijkers, T.; Van Den Ouweland, J.; Morolli, B.; Rolink, A. G.; Baarends, W. M.;
Van Sloun, P. P.; Lohman, P. H.; Pastink, A. Targeted inactivation of mouse RAD52
reduces homologous recombination but not resistance to ionizing radiation. Mol Cell Biol
18:6423-6429; 1998.
[138] Essers, J.; Hendriks, R. W.; Swagemakers, S. M.; Troelstra, C.; de Wit, J.;
Bootsma, D.; Hoeijmakers, J. H.; Kanaar, R. Disruption of mouse RAD54 reduces
ionizing radiation resistance and homologous recombination. Cell 89:195-204; 1997.
[139] Tan, T. L.; Essers, J.; Citterio, E.; Swagemakers, S. M.; de Wit, J.; Benson, F. E.;
Hoeijmakers, J. H.; Kanaar, R. Mouse Rad54 affects DNA conformation and DNAdamage-induced
Rad51 foci formation. Curr Biol 9:325-328; 1999.
[140] Liu, N.; Lamerdin, J. E.; Tebbs, R. S.; Schild, D.; Tucker, J. D.; Shen, M. R.;
Brookman, K. W.; Siciliano, M. J.; Walter, C. A.; Fan, W.; Narayana, L. S.; Zhou, Z. Q.;
Adamson, A. W.; Sorensen, K. J.; Chen, D. J.; Jones, N. J.; Thompson, L. H. XRCC2 and
XRCC3, new human Rad51-family members, promote chromosome stability and protect
against DNA cross-links and other damages. Mol Cell 1:783-793; 1998.
230

CHAPTER 5
REFERENCES
[141] Pierce, A. J.; Johnson, R. D.; Thompson, L. H.; Jasin, M. XRCC3 promotes
homology-directed repair of DNA damage in mammalian cells. Genes Dev 13:2633-
2638; 1999.
[142] Callebaut, I.; Mornon, J. P. From BRCA1 to RAP1: a widespread BRCT module
closely associated with DNA repair. FEBS Lett 400:25-30; 1997.
[143] Gowen, L. C.; Avrutskaya, A. V.; Latour, A. M.; Koller, B. H.; Leadon, S. A.
BRCA1 required for transcription-coupled repair of oxidative DNA damage (Retracted
article. See vol 300, pg 1657, June 13 2003). Science 281:1009-1012; 1998.
[144] Cortez, D.; Wang, Y.; Qin, J.; Elledge, S. J. Requirement of ATM-dependent
phosphorylation of brca1 in the DNA damage response to double-strand breaks. Science
286:1162-1166; 1999.
[145] Chen, J. J.; Silver, D. P.; Walpita, D.; Cantor, S. B.; Gazdar, A. F.; Tomlinson,
G.; Couch, F. J.; Weber, B. L.; Ashley, T.; Livingston, D. M.; Scully, R. Stable
interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in
mitotic and meiotic cells. Molecular Cell 2:317-328; 1998.
[146] Patel, K. J.; Yu, V. P. C. C.; Lee, H. S.; Corcoran, A.; Thistlethwaite, F. C.;
Evans, M. J.; Colledge, W. H.; Friedman, L. S.; Ponder, B. A. J.; Venkitaraman, A. R.
Involvement of Brca2 in DNA repair. Molecular Cell 1:347-357; 1998.
[147] Zhong, Q.; Chen, C. F.; Li, S.; Chen, Y. M.; Wang, C. C.; Xiao, J.; Chen, P. L.;
Sharp, Z. D.; Lee, W. H. Association of BRCA1 with the hRad50-hMre11-p95 complex
and the DNA damage response. Science 285:747-750; 1999.
231

CHAPTER 5
REFERENCES
[148] Cressman, V. L.; Backlund, D. C.; Avrutskaya, A. V.; Leadon, S. A.; Godfrey,
V.; Koller, B. H. Growth retardation, DNA repair defects, and lack of spermatogenesis in
BRCA1-deficient mice. Mol Cell Biol 19:7061-7075; 1999.
[149] Shafman, T.; Khanna, K. K.; Kedar, P.; Spring, K.; Kozlov, S.; Yen, T.; Hobson,
K.; Gatei, M.; Zhang, N.; Watters, D.; Egerton, M.; Shiloh, Y.; Kharbanda, S.; Kufe, D.;
Lavin, M. F. Interaction between ATM protein and c-Abl in response to DNA damage.
Nature 387:520-523; 1997.
[150] Winkler, G. S.; Vermeulen, W.; Coin, F.; Egly, J. M.; Hoeijmakers, J. H.; Weeda,
G. Affinity purification of human DNA repair/transcription factor TFIIH using epitopetagged
xeroderma pigmentosum B protein. J Biol Chem 273:1092-1098; 1998.
[151] Balajee, A. S.; Bohr, V. A. Genomic heterogeneity of nucleotide excision repair.
Gene 250:15-30; 2000.
[152] Wood, R. D. Nucleotide excision repair in mammalian cells. J Biol Chem
272:23465-23468; 1997.
[153] Evans, A. R.; Limp-Foster, M.; Kelley, M. R. Going APE over ref-1. Mutat Res-
DNA Repair 461:83-108; 2000.
[154] Hardman, R. A.; Afshari, C. A.; Barrett, J. C. Involvement of mammalian MLH1
in the apoptotic response to peroxide-induced oxidative stress. Cancer Res 61:1392-
1397; 2001.
[155] Ward, J. F. DNA damage as the cause of ionizing radiation-induced gene
activation. Radiat Res 138:S85-88; 1994.
232

CHAPTER 5
REFERENCES
[156] Roots, R.; Okada, S. Protection of DNA molecules of cultured mammalian cells
from radiation-induced single-strand scissions by various alcohols and SH compounds.
Int J Radiat Biol Relat Stud Phys Chem Med 21:329-342; 1972.
[157] Ibuki, Y.; Goto, R. Enhancement of NO production from resident peritoneal
macrophages by in vitro gamma-irradiation and its relationship to reactive oxygen
intermediates. Free Radic Biol Med 22:1029-1035; 1997.
[158] Beckman, J. S.; Koppenol, W. H. Nitric oxide, superoxide, and peroxynitrite: the
good, the bad, and ugly. Am J Physiol 271:C1424-1437; 1996.
[159] Clutton, S. M.; Townsend, K. M.; Walker, C.; Ansell, J. D.; Wright, E. G.
Radiation-induced genomic instability and persisting oxidative stress in primary bone
marrow cultures. Carcinogenesis 17:1633-1639; 1996.
[160] Wu, L. J.; Randers-Pehrson, G.; Xu, A.; Waldren, C. A.; Geard, C. R.; Yu, Z.;
Hei, T. K. Targeted cytoplasmic irradiation with alpha particles induces mutations in
mammalian cells. Proc Natl Acad Sci U S A 96:4959-4964; 1999.
[161] Rossman, T. G.; Goncharova, E. I. Spontaneous mutagenesis in mammalian cells
is caused mainly by oxidative events and can be blocked by antioxidants and
metallothionein. Mutat Res 402:103-110; 1998.
[162] Narayanan, P. K.; Goodwin, E. H.; Lehnert, B. E. Alpha particles initiate
biological production of superoxide anions and hydrogen peroxide in human cells.
Cancer Res 57:3963-3971; 1997.
[163] Morales, A.; Miranda, M.; Sanchez-Reyes, A.; Biete, A.; Fernandez-Checa, J. C.
Oxidative damage of mitochondrial and nuclear DNA induced by ionizing radiation in
human hepatoblastoma cells. Int J Radiat Oncol Biol Phys 42:191-203; 1998.
233

CHAPTER 5
REFERENCES
[164] Lander, H. M.; Ogiste, J. S.; Teng, K. K.; Novogrodsky, A. p21ras as a common
signaling target of reactive free radicals and cellular redox stress. J Biol Chem
270:21195-21198; 1995.
[165] Bae, Y. S.; Kang, S. W.; Seo, M. S.; Baines, I. C.; Tekle, E.; Chock, P. B.; Rhee,
S. G. Epidermal growth factor (EGF)-induced generation of hydrogen peroxide. Role in
EGF receptor-mediated tyrosine phosphorylation. J Biol Chem 272:217-221; 1997.
[166] Lee, S. R.; Kwon, K. S.; Kim, S. R.; Rhee, S. G. Reversible inactivation of
protein-tyrosine phosphatase 1B in A431 cells stimulated with epidermal growth factor. J
Biol Chem 273:15366-15372; 1998.
[167] Lander, H. M.; Ogiste, J. S.; Pearce, S. F.; Levi, R.; Novogrodsky, A. Nitric
oxide-stimulated guanine nucleotide exchange on p21ras. J Biol Chem 270:7017-7020;
1995.
[168] Ritov, V. B.; Banni, S.; Yalowich, J. C.; Day, B. W.; Claycamp, H. G.; Corongiu,
F. P.; Kagan, V. E. Non-random peroxidation of different classes of membrane
phospholipids in live cells detected by metabolically integrated cis-parinaric acid.
Biochim Biophys Acta 1283:127-140; 1996.
[169] Schmidt-Ullrich, R. K.; Valerie, K.; Fogleman, P. B.; Walters, J. Radiationinduced
autophosphorylation of epidermal growth factor receptor in human malignant
mammary and squamous epithelial cells. Radiat Res 145:81-85; 1996.
[170] Rosette, C.; Karin, M. Ultraviolet light and osmotic stress: activation of the JNK
cascade through multiple growth factor and cytokine receptors. Science 274:1194-1197;
1996.
234

CHAPTER 5
REFERENCES
[171] Xia, Z.; Dickens, M.; Raingeaud, J.; Davis, R. J.; Greenberg, M. E. Opposing
effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270:1326-1331; 1995.
[172] Schmidt-Ullrich, R. K.; Mikkelsen, R. B.; Dent, P.; Todd, D. G.; Valerie, K.;
Kavanagh, B. D.; Contessa, J. N.; Rorrer, W. K.; Chen, P. B. Radiation-induced
proliferation of the human A431 squamous carcinoma cells is dependent on EGFR
tyrosine phosphorylation. Oncogene 15:1191-1197; 1997.
[173] Contessa, J. N.; Reardon, D. B.; Todd, D.; Dent, P.; Mikkelsen, R. B.; Valerie, K.;
Bowers, G. D.; Schmidt-Ullrich, R. K. The inducible expression of dominant-negative
epidermal growth factor receptor-CD533 results in radiosensitization of human mammary
carcinoma cells. Clin Cancer Res 5:405-411; 1999.
[174] Baselga, J.; Norton, L.; Albanell, J.; Kim, Y. M.; Mendelsohn, J. Recombinant
humanized anti-HER2 antibody (Herceptin) enhances the antitumor activity of paclitaxel
and doxorubicin against HER2/neu overexpressing human breast cancer xenografts.
Cancer Res 58:2825-2831; 1998.
[175] Reardon, D. B.; Contessa, J. N.; Mikkelsen, R. B.; Valerie, K.; Amir, C.; Dent, P.;
Schmidt-Ullrich, R. K. Dominant negative EGFR-CD533 and inhibition of MAPK
modify JNK1 activation and enhance radiation toxicity of human mammary carcinoma
cells. Oncogene 18:4756-4766; 1999.
[176] Kashles, O.; Yarden, Y.; Fischer, R.; Ullrich, A.; Schlessinger, J. A dominant
negative mutation suppresses the function of normal epidermal growth factor receptors
by heterodimerization. Mol Cell Biol 11:1454-1463; 1991.
[177] Todd, D. G.; Mikkelsen, R. B.; Rorrer, W. K.; Valerie, K.; Schmidt-Ullrich, R. K.
Ionizing radiation stimulates existing signal transduction pathways involving the
235

CHAPTER 5
REFERENCES
activation of epidermal growth factor receptor and ERBB-3, and changes of intracellular
calcium in A431 human squamous carcinoma cells. J Recept Signal Transduct Res
19:885-908; 1999.
[178] Mason, C. S.; Springer, C. J.; Cooper, R. G.; Superti-Furga, G.; Marshall, C. J.;
Marais, R. Serine and tyrosine phosphorylations cooperate in Raf-1, but not B-Raf
activation. Embo J 18:2137-2148; 1999.
[179] Todd, D. G.; Mikkelsen, R. B. Ionizing radiation induces a transient increase in
cytosolic free [Ca2+] in human epithelial tumor cells. Cancer Res 54:5224-5230; 1994.
[180] Dent, P.; Reardon, D. B.; Morrison, D. K.; Sturgill, T. W. Regulation of Raf-1
and Raf-1 mutants by Ras-dependent and Ras-independent mechanisms in vitro. Mol Cell
Biol 15:4125-4135; 1995.
[181] Le Gallic, L.; Sgouras, D.; Beal, G., Jr.; Mavrothalassitis, G. Transcriptional
repressor ERF is a Ras/mitogen-activated protein kinase target that regulates cellular
proliferation. Mol Cell Biol 19:4121-4133; 1999.
[182] Kuroki, M.; O'Flaherty, J. T. Extracellular signal-regulated protein kinase (ERK)-
dependent and ERK-independent pathways target STAT3 on serine-727 in human
neutrophils stimulated by chemotactic factors and cytokines. Biochem J 341 ( Pt 3):691-
696; 1999.
[183] Navarro, P.; Valverde, A. M.; Benito, M.; Lorenzo, M. Activated Ha-ras induces
apoptosis by association with phosphorylated Bcl-2 in a mitogen-activated protein
kinase-independent manner. J Biol Chem 274:18857-18863; 1999.
[184] Carter, S.; Auer, K. L.; Reardon, D. B.; Birrer, M.; Fisher, P. B.; Valerie, K.;
Schmidt-Ullrich, R.; Mikkelsen, R.; Dent, P. Inhibition of the mitogen activated protein
236

CHAPTER 5
REFERENCES
(MAP) kinase cascade potentiates cell killing by low dose ionizing radiation in A431
human squamous carcinoma cells. Oncogene 16:2787-2796; 1998.
[185] Abbott, D. W.; Holt, J. T. Mitogen-activated protein kinase kinase 2 activation is
essential for progression through the G2/M checkpoint arrest in cells exposed to ionizing
radiation. J Biol Chem 274:2732-2742; 1999.
[186] Bernhard, E. J.; McKenna, W. G.; Hamilton, A. D.; Sebti, S. M.; Qian, Y.; Wu, J.
M.; Muschel, R. J. Inhibiting Ras prenylation increases the radiosensitivity of human
tumor cell lines with activating mutations of ras oncogenes. Cancer Res 58:1754-1761;
1998.
[187] Gokhale, P. C.; McRae, D.; Monia, B. P.; Bagg, A.; Rahman, A.; Dritschilo, A.;
Kasid, U. Antisense raf oligodeoxyribonucleotide is a radiosensitizer in vivo. Antisense
Nucleic Acid Drug Dev 9:191-201; 1999.
[188] Tombes, R. M.; Auer, K. L.; Mikkelsen, R.; Valerie, K.; Wymann, M. P.;
Marshall, C. J.; McMahon, M.; Dent, P. The mitogen-activated protein (MAP) kinase
cascade can either stimulate or inhibit DNA synthesis in primary cultures of rat
hepatocytes depending upon whether its activation is acute/phasic or chronic. Biochem J
330 ( Pt 3):1451-1460; 1998.
[189] Auer, K. L.; Park, J. S.; Seth, P.; Coffey, R. J.; Darlington, G.; Abo, A.;
McMahon, M.; Depinho, R. A.; Fisher, P. B.; Dent, P. Prolonged activation of the
mitogen-activated protein kinase pathway promotes DNA synthesis in primary
hepatocytes from p21Cip-1/WAF1-null mice, but not in hepatocytes from p16INK4a-null
mice. Biochem J 336 ( Pt 3):551-560; 1998.
237

CHAPTER 5
REFERENCES
[190] Sewing, A.; Wiseman, B.; Lloyd, A. C.; Land, H. High-intensity Raf signal
causes cell cycle arrest mediated by p21Cip1. Mol Cell Biol 17:5588-5597; 1997.
[191] Woods, D.; Parry, D.; Cherwinski, H.; Bosch, E.; Lees, E.; McMahon, M. Rafinduced
proliferation or cell cycle arrest is determined by the level of Raf activity with
arrest mediated by p21Cip1. Mol Cell Biol 17:5598-5611; 1997.
[192] Fiddes, R. J.; Janes, P. W.; Sivertsen, S. P.; Sutherland, R. L.; Musgrove, E. A.;
Daly, R. J. Inhibition of the MAP kinase cascade blocks heregulin-induced cell cycle
progression in T-47D human breast cancer cells. Oncogene 16:2803-2813; 1998.
[193] Macleod, K. F.; Sherry, N.; Hannon, G.; Beach, D.; Tokino, T.; Kinzler, K.;
Vogelstein, B.; Jacks, T. p53-dependent and independent expression of p21 during cell
growth, differentiation, and DNA damage. Genes Dev 9:935-944; 1995.
[194] Poon, R. Y.; Chau, M. S.; Yamashita, K.; Hunter, T. The role of Cdc2 feedback
loop control in the DNA damage checkpoint in mammalian cells. Cancer Res 57:5168-
5178; 1997.
[195] Leach, S. D.; Scatena, C. D.; Keefer, C. J.; Goodman, H. A.; Song, S. Y.; Yang,
L.; Pietenpol, J. A. Negative regulation of Wee1 expression and Cdc2 phosphorylation
during p53-mediated growth arrest and apoptosis. Cancer Res 58:3231-3236; 1998.
[196] Pap, M.; Cooper, G. M. Role of glycogen synthase kinase-3 in the
phosphatidylinositol 3-Kinase/Akt cell survival pathway. J Biol Chem 273:19929-19932;
1998.
[197] Shaw, M.; Cohen, P.; Alessi, D. R. Further evidence that the inhibition of
glycogen synthase kinase-3beta by IGF-1 is mediated by PDK1/PKB-induced
238

CHAPTER 5
REFERENCES
phosphorylation of Ser-9 and not by dephosphorylation of Tyr-216. FEBS Lett 416:307-
311; 1997.
[198] Magnusson, C.; Vaux, D. L. Signalling by CD95 and TNF receptors: not only life
and death. Immunol Cell Biol 77:41-46; 1999.
[199] Davis, R. J. Signal transduction by the c-Jun N-terminal kinase. Biochem Soc
Symp 64:1-12; 1999.
[200] Verheij, M.; Bose, R.; Lin, X. H.; Yao, B.; Jarvis, W. D.; Grant, S.; Birrer, M. J.;
Szabo, E.; Zon, L. I.; Kyriakis, J. M.; Haimovitz-Friedman, A.; Fuks, Z.; Kolesnick, R.
N. Requirement for ceramide-initiated SAPK/JNK signalling in stress-induced apoptosis.
Nature 380:75-79; 1996.
[201] Chmura, S. J.; Mauceri, H. J.; Advani, S.; Heimann, R.; Beckett, M. A.;
Nodzenski, E.; Quintans, J.; Kufe, D. W.; Weichselbaum, R. R. Decreasing the apoptotic
threshold of tumor cells through protein kinase C inhibition and sphingomyelinase
activation increases tumor killing by ionizing radiation. Cancer Res 57:4340-4347; 1997.
[202] Haimovitz-Friedman, A. Radiation-induced signal transduction and stress
response. Radiat Res 150:S102-108; 1998.
[203] Auer, K. L.; Contessa, J.; Brenz-Verca, S.; Pirola, L.; Rusconi, S.; Cooper, G.;
Abo, A.; Wymann, M. P.; Davis, R. J.; Birrer, M.; Dent, P. The
Ras/Rac1/Cdc42/SEK/JNK/c-Jun cascade is a key pathway by which agonists stimulate
DNA synthesis in primary cultures of rat hepatocytes. Mol Biol Cell 9:561-573; 1998.
[204] Potapova, O.; Haghighi, A.; Bost, F.; Liu, C.; Birrer, M. J.; Gjerset, R.; Mercola,
D. The Jun kinase/stress-activated protein kinase pathway functions to regulate DNA
239

CHAPTER 5
REFERENCES
repair and inhibition of the pathway sensitizes tumor cells to cisplatin. J Biol Chem
272:14041-14044; 1997.
[205] Prise, K. M.; Ahnstrom, G.; Belli, M.; Carlsson, J.; Frankenberg, D.; Kiefer, J.;
Lobrich, M.; Michael, B. D.; Nygren, J.; Simone, G.; Stenerlow, B. A review of dsb
induction data for varying quality radiations. Int J Radiat Biol 74:173-184; 1998.
[206] Tilly, N.; Fernandez-Varea, J. M.; Grusell, E.; Brahme, A. Comparison of Monte
Carlo calculated electron slowing-down spectra generated by 60Co gamma-rays,
electrons, protons and light ions. Phys Med Biol 47:1303-1319; 2002.
[207] Kagawa, Y.; Shimazu, T.; Gordon, A. J.; Fukunishi, N.; Inabe, N.; Suzuki, M.;
Hirano, M.; Kato, T.; Watanabe, M.; Hanaoka, F.; Yatagai, F. Complex hprt deletion
events are recovered after exposure of human lymphoblastoid cells to high-LET carbon
and neon ion beams. Mutagenesis 14:199-205; 1999.
[208] Masumura, K.; Kuniya, K.; Kurobe, T.; Fukuoka, M.; Yatagai, F.; Nohmi, T.
Heavy-ion-induced mutations in the gpt delta transgenic mouse: comparison of mutation
spectra induced by heavy-ion, X-ray, and gamma-ray radiation. Environ Mol Mutagen
40:207-215; 2002.
[209] Singleton, B. K.; Griffin, C. S.; Thacker, J. Clustered DNA damage leads to
complex genetic changes in irradiated human cells. Cancer Res 62:6263-6269; 2002.
[210] Albertini, R. J.; Clark, L. S.; Nicklas, J. A.; O'Neill, J. P.; Hui, T. E.; Jostes, R.
Radiation quality affects the efficiency of induction and the molecular spectrum of HPRT
mutations in human T cells. Radiat Res 148:S76-86; 1997.
240

CHAPTER 5
REFERENCES
[211] Anderson, J. A.; Harper, J. V.; Cucinotta, F. A.; O'Neill, P. Participation of DNA-
PKcs in DSB repair after exposure to high- and low-LET radiation. Radiat Res 174:195-
205; 2010.
[212] Zafar, F.; Seidler, S. B.; Kronenberg, A.; Schild, D.; Wiese, C. Homologous
recombination contributes to the repair of DNA double-strand breaks induced by highenergy
iron ions. Radiat Res 173:27-39; 2010.
[213] Harper, J. V.; Anderson, J. A.; O'Neill, P. Radiation induced DNA DSBs:
Contribution from stalled replication forks? DNA Repair (Amst) 9:907-913; 2010.
[214] Asaithamby, A.; Uematsu, N.; Chatterjee, A.; Story, M. D.; Burma, S.; Chen, D.
J. Repair of HZE-particle-induced DNA double-strand breaks in normal human
fibroblasts. Radiat Res 169:437-446; 2008.
[215] Hall, E. J. Radiobiology for the radiobiologist. J.B. Lippincott Company,
Philadelphia.; 1994.
[216] Mothersill, C.; Seymour, C. Medium from irradiated human epithelial cells but
not human fibroblasts reduces the clonogenic survival of unirradiated cells. International
Journal of Radiation Biology 71:421-427; 1997.
[217] Mothersill, C.; Seymour, C. B. Cell-cell contact during gamma irradiation is not
required to induce a bystander effect in normal human keratinocytes: evidence for release
during irradiation of a signal controlling survival into the medium. Radiat Res 149:256-
262; 1998.
[218] Seymour, C.; Mothersill, C. Cell communication and the "bystander effect".
Radiat Res 151:505-506; 1999.
241

CHAPTER 5
REFERENCES
[219] Seymour, C. B.; Mothersill, C. Relative contribution of bystander and targeted
cell killing to the low-dose region of the radiation dose-response curve. Radiat Res
153:508-511; 2000.
[220] Nagasawa, H.; Little, J. B. Induction of sister chromatid exchanges by extremely
low doses of alpha-particles. Cancer Res 52:6394-6396; 1992.
[221] Folkard, M.; Schettino, G.; Vojnovic, B.; Gilchrist, S.; Michette, A. G.;
Pfauntsch, S. J.; Prise, K. M.; Michael, B. D. A focused ultrasoft x-ray microbeam for
targeting cells individually with submicrometer accuracy. Radiat Res 156:796-804; 2001.
[222] Randers-Pehrson, G.; Geard, C. R.; Johnson, G.; Elliston, C. D.; Brenner, D. J.
The Columbia University single-ion microbeam. Radiat Res 156:210-214; 2001.
[223] Ballarini, F.; Biaggi, M.; Ottolenghi, A.; Sapora, O. Cellular communication and
bystander effects: a critical review for modelling low-dose radiation action. Mutat Res
501:1-12; 2002.
[224] Ziegler, J. F. The Stopping and Range of Ions in Matter, http://www.srim.org/.
[225] Ziegler, J. F.; Bierserk, J. P.; Littmark, U. Stopping and ranges of ions in matter.
Pergamon Press, New York; 1985.
[226] Kraft, G. Tumor therapy with heavy charged particles. Prog Part Nucl Phys
45:S473-S544; 2000.
[227] Rasband, W. S.; Image, J. U. S. National Institutes of Health, Bethesda, USA.
http://rsb.info.nih.gov/ij/. 1997-2006.
[228] Maurya, D. K.; Salvi, V. P.; Nair, C. K. Radiation protection of DNA by ferulic
acid under in vitro and in vivo conditions. Mol Cell Biochem 280:209-217; 2005.
242

CHAPTER 5
REFERENCES
[229] Konca, K.; Lankoff, A.; Banasik, A.; Lisowska, H.; Kuszewski, T.; Gozdz, S.;
Koza, Z.; Wojcik, A. A cross-platform public domain PC image-analysis program for the
comet assay. Mutat Res 534:15-20; 2003.
[230] Green, L. C.; Wagner, D. A.; Glogowski, J.; Skipper, P. L.; Wishnok, J. S.;
Tannenbaum, S. R. Analysis of nitrate, nitrite, and [15N]nitrate in biological fluids. Anal
Biochem 126:131-138; 1982.
[231] Jeon, S. H.; Kang, M. G.; Kim, Y. H.; Jin, Y. H.; Lee, C.; Chung, H. Y.; Kwon,
H.; Park, S. D.; Seong, R. H. A new mouse gene, SRG3, related to the SWI3 of
Saccharomyces cerevisiae, is required for apoptosis induced by glucocorticoids in a
thymoma cell line. J Exp Med 185:1827-1836; 1997.
[232] Rogakou, E. P.; Pilch, D. R.; Orr, A. H.; Ivanova, V. S.; Bonner, W. M. DNA
double-stranded breaks induce histone H2AX phosphorylation on serine 139. J Biol
Chem 273:5858-5868; 1998.
[233] Olive, P. L.; Banath, J. P. Phosphorylation of histone H2AX as a measure of
radiosensitivity. Int J Radiat Oncol Biol Phys 58:331-335; 2004.
[234] Fernandez-Capetillo, O.; Lee, A.; Nussenzweig, M.; Nussenzweig, A. H2AX: the
histone guardian of the genome. DNA Repair (Amst) 3:959-967; 2004.
[235] Kastan, M. B.; Lim, D. S. The many substrates and functions of ATM. Nat Rev
Mol Cell Biol 1:179-186; 2000.
[236] Kurz, E. U.; Lees-Miller, S. P. DNA damage-induced activation of ATM and
ATM-dependent signaling pathways. DNA Repair (Amst) 3:889-900; 2004.
[237] Jameel, J. K.; Rao, V. S.; Cawkwell, L.; Drew, P. J. Radioresistance in carcinoma
of the breast. Breast 13:452-460; 2004.
243

CHAPTER 5
REFERENCES
[238] Belka, C.; Jendrossek, V.; Pruschy, M.; Vink, S.; Verheij, M.; Budach, W.
Apoptosis-modulating agents in combination with radiotherapy-current status and
outlook. Int J Radiat Oncol Biol Phys 58:542-554; 2004.
[239] Mackay, H. J.; Twelves, C. J. Protein kinase C: a target for anticancer drugs?
Endocr Relat Cancer 10:389-396; 2003.
[240] Osaki, M.; Oshimura, M.; Ito, H. PI3K-Akt pathway: its functions and alterations
in human cancer. Apoptosis 9:667-676; 2004.
[241] Lee, Y. S.; Oh, J. H.; Yoon, S.; Kwon, M. S.; Song, C. W.; Kim, K. H.; Cho, M.
J.; Mollah, M. L.; Je, Y. J.; Kim, Y. D.; Kim, C. D.; Lee, J. H. Differential gene
expression profiles of radioresistant non-small-cell lung cancer cell lines established by
fractionated irradiation: tumor protein p53-inducible protein 3 confers sensitivity to
ionizing radiation. Int J Radiat Oncol Biol Phys 77:858-866; 2010.
[242] Qing, Y.; Yang, X. Q.; Zhong, Z. Y.; Lei, X.; Xie, J. Y.; Li, M. X.; Xiang, D. B.;
Li, Z. P.; Yang, Z. Z.; Wang, G.; Wang, D. Microarray analysis of DNA damage repair
gene expression profiles in cervical cancer cells radioresistant to 252Cf neutron and X-
rays. BMC Cancer 10:71; 2010.
[243] Lehman, T. A.; Bennett, W. P.; Metcalf, R. A.; Welsh, J. A.; Ecker, J.; Modali, R.
V.; Ullrich, S.; Romano, J. W.; Appella, E.; Testa, J. R.; et al. p53 mutations, ras
mutations, and p53-heat shock 70 protein complexes in human lung carcinoma cell lines.
Cancer Res 51:4090-4096; 1991.
[244] Levine, A. J. p53, the cellular gatekeeper for growth and division. Cell 88:323-
331; 1997.
244

CHAPTER 5
REFERENCES
[245] Kastan, M. B.; Onyekwere, O.; Sidransky, D.; Vogelstein, B.; Craig, R. W.
Participation of p53 protein in the cellular response to DNA damage. Cancer Res
51:6304-6311; 1991.
[246] Chernov, M. V.; Stark, G. R. The p53 activation and apoptosis induced by DNA
damage are reversibly inhibited by salicylate. Oncogene 14:2503-2510; 1997.
[247] Shu, H. K.; Kim, M. M.; Chen, P.; Furman, F.; Julin, C. M.; Israel, M. A. The
intrinsic radioresistance of glioblastoma-derived cell lines is associated with a failure of
p53 to induce p21(BAX) expression. Proc Natl Acad Sci U S A 95:14453-14458; 1998.
[248] Satyamoorthy, K.; Chehab, N. H.; Waterman, M. J.; Lien, M. C.; El-Deiry, W. S.;
Herlyn, M.; Halazonetis, T. D. Aberrant regulation and function of wild-type p53 in
radioresistant melanoma cells. Cell Growth Differ 11:467-474; 2000.
[249] Lees-Miller, S. P.; Godbout, R.; Chan, D. W.; Weinfeld, M.; Day, R. S., 3rd;
Barron, G. M.; Allalunis-Turner, J. Absence of p350 subunit of DNA-activated protein
kinase from a radiosensitive human cell line. Science 267:1183-1185; 1995.
[250] Sirzen, F.; Nilsson, A.; Zhivotovsky, B.; Lewensohn, R. DNA-dependent protein
kinase content and activity in lung carcinoma cell lines: correlation with intrinsic
radiosensitivity. Eur J Cancer 35:111-116; 1999.
[251] Golding, S. E.; Rosenberg, E.; Khalil, A.; McEwen, A.; Holmes, M.; Neill, S.;
Povirk, L. F.; Valerie, K. Double strand break repair by homologous recombination is
regulated by cell cycle-independent signaling via ATM in human glioma cells. J Biol
Chem 279:15402-15410; 2004.
245

CHAPTER 5
REFERENCES
[252] Tribius, S.; Pidel, A.; Casper, D. ATM protein expression correlates with
radioresistance in primary glioblastoma cells in culture. Int J Radiat Oncol Biol Phys
50:511-523; 2001.
[253] Collis, S. J.; Swartz, M. J.; Nelson, W. G.; DeWeese, T. L. Enhanced radiation
and chemotherapy-mediated cell killing of human cancer cells by small inhibitory RNA
silencing of DNA repair factors. Cancer Res 63:1550-1554; 2003.
[254] Matthews, J. H.; Meeker, B. E.; Chapman, J. D. Response of human tumor cell
lines in vitro to fractionated irradiation. Int J Radiat Oncol Biol Phys 16:133-138; 1989.
[255] Mitchell, P.; Tollervey, D. mRNA stability in eukaryotes. Curr Opin Genet Dev
10:193-198; 2000.
[256] Ross, J. mRNA stability in mammalian cells. Microbiol Rev 59:423-450; 1995.
[257] Wilusz, C. J.; Wormington, M.; Peltz, S. W. The cap-to-tail guide to mRNA
turnover. Nat Rev Mol Cell Biol 2:237-246; 2001.
[258] Dean, J. L.; Sully, G.; Clark, A. R.; Saklatvala, J. The involvement of AU-rich
element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated
mRNA stabilisation. Cell Signal 16:1113-1121; 2004.
[259] Krengli, M.; Hug, E. B.; Adams, J. A.; Smith, A. R.; Tarbell, N. J.; Munzenrider,
J. E. Proton radiation therapy for retinoblastoma: comparison of various intraocular
tumor locations and beam arrangements. Int J Radiat Oncol Biol Phys 61:583-593; 2005.
[260] St Clair, W. H.; Adams, J. A.; Bues, M.; Fullerton, B. C.; La Shell, S.; Kooy, H.
M.; Loeffler, J. S.; Tarbell, N. J. Advantage of protons compared to conventional X-ray
or IMRT in the treatment of a pediatric patient with medulloblastoma. Int J Radiat Oncol
Biol Phys 58:727-734; 2004.
246

CHAPTER 5
REFERENCES
[261] Miralbell, R.; Crowell, C.; Suit, H. D. Potential improvement of three dimension
treatment planning and proton therapy in the outcome of maxillary sinus cancer. Int J
Radiat Oncol Biol Phys 22:305-310; 1992.
[262] Jones, B.; Dale, R. G.; Carabe-Fernandez, A. Charged particle therapy for cancer:
the inheritance of the Cavendish scientists? Appl Radiat Isot 67:371-377; 2009.
[263] Chang, J. Y.; Zhang, X.; Wang, X.; Kang, Y.; Riley, B.; Bilton, S.; Mohan, R.;
Komaki, R.; Cox, J. D. Significant reduction of normal tissue dose by proton
radiotherapy compared with three-dimensional conformal or intensity-modulated
radiation therapy in Stage I or Stage III non-small-cell lung cancer. Int J Radiat Oncol
Biol Phys 65:1087-1096; 2006.
[264] Fukumitsu, N.; Sugahara, S.; Nakayama, H.; Fukuda, K.; Mizumoto, M.; Abei,
M.; Shoda, J.; Thono, E.; Tsuboi, K.; Tokuuye, K. A prospective study of
hypofractionated proton beam therapy for patients with hepatocellular carcinoma. Int J
Radiat Oncol Biol Phys 74:831-836; 2009.
[265] Fei, P.; Bernhard, E. J.; El-Deiry, W. S. Tissue-specific induction of p53 targets in
vivo. Cancer Res 62:7316-7327; 2002.
[266] Yonish-Rouach, E.; Resnitzky, D.; Lotem, J.; Sachs, L.; Kimchi, A.; Oren, M.
Wild-type p53 induces apoptosis of myeloid leukaemic cells that is inhibited by
interleukin-6. Nature 352:345-347; 1991.
[267] Sabbatini, P.; Lin, J.; Levine, A. J.; White, E. Essential role for p53-mediated
transcription in E1A-induced apoptosis. Genes Dev 9:2184-2192; 1995.
[268] Caelles, C.; Helmberg, A.; Karin, M. p53-dependent apoptosis in the absence of
transcriptional activation of p53-target genes. Nature 370:220-223; 1994.
247

CHAPTER 5
REFERENCES
[269] Polyak, K.; Xia, Y.; Zweier, J. L.; Kinzler, K. W.; Vogelstein, B. A model for
p53-induced apoptosis. Nature 389:300-305; 1997.
[270] Mihara, M.; Erster, S.; Zaika, A.; Petrenko, O.; Chittenden, T.; Pancoska, P.;
Moll, U. M. p53 has a direct apoptogenic role at the mitochondria. Molecular Cell
11:577-590; 2003.
[271] Mitra, A. K.; Bhat, N.; Sarma, A.; Krishna, M. Alteration in the expression of
signaling parameters following carbon ion irradiation. Mol Cell Biochem 276:169-173;
2005.
[272] Prise, K. M.; Pinto, M.; Newman, H. C.; Michael, B. D. A review of studies of
ionizing radiation-induced double-strand break clustering. Radiat Res 156:572-576;
2001.
[273] Foster, E. R.; Downs, J. A. Histone H2A phosphorylation in DNA double-strand
break repair. Febs J 272:3231-3240; 2005.
[274] Lowndes, N. F.; Toh, G. W. DNA repair: the importance of phosphorylating
histone H2AX. Curr Biol 15:R99-R102; 2005.
[275] Karlsson, K. H.; Stenerlow, B. Focus formation of DNA repair proteins in normal
and repair-deficient cells irradiated with high-LET ions. Radiat Res 161:517-527; 2004.
[276] Deng, C. X. BRCA1: cell cycle checkpoint, genetic instability, DNA damage
response and cancer evolution. Nucleic Acids Res 34:1416-1426; 2006.
[277] Valerie, K.; Yacoub, A.; Hagan, M. P.; Curiel, D. T.; Fisher, P. B.; Grant, S.;
Dent, P. Radiation-induced cell signaling: inside-out and outside-in. Mol Cancer Ther
6:789-801; 2007.
248

CHAPTER 5
REFERENCES
[278] Weizman, N.; Shiloh, Y.; Barzilai, A. Contribution of the Atm protein to
maintaining cellular homeostasis evidenced by continuous activation of the AP-1
pathway in Atm-deficient brains. J Biol Chem 278:6741-6747; 2003.
[279] Lafarge, S.; Sylvain, V.; Ferrara, M.; Bignon, Y. J. Inhibition of BRCA1 leads to
increased chemoresistance to microtubule-interfering agents, an effect that involves the
JNK pathway. Oncogene 20:6597-6606; 2001.
[280] Miyamoto, T.; Yamamoto, N.; Nishimura, H.; Koto, M.; Tsujii, H.; Mizoe, J. E.;
Kamada, T.; Kato, H.; Yamada, S.; Morita, S.; Yoshikawa, K.; Kandatsu, S.; Fujisawa, T.
Carbon ion radiotherapy for stage I non-small cell lung cancer. Radiother Oncol 66:127-
140; 2003.
[281] Ogata, T.; Teshima, T.; Kagawa, K.; Hishikawa, Y.; Takahashi, Y.; Kawaguchi,
A.; Suzumoto, Y.; Nojima, K.; Furusawa, Y.; Matsuura, N. Particle irradiation suppresses
metastatic potential of cancer cells. Cancer Res 65:113-120; 2005.
[282] Schulz-Ertner, D.; Nikoghosyan, A.; Thilmann, C.; Haberer, T.; Jakel, O.; Karger,
C.; Kraft, G.; Wannenmacher, M.; Debus, J. Results of carbon ion radiotherapy in 152
patients. Int J Radiat Oncol Biol Phys 58:631-640; 2004.
[283] Tsuji, H.; Ishikawa, H.; Yanagi, T.; Hirasawa, N.; Kamada, T.; Mizoe, J. E.;
Kanai, T.; Tsujii, H.; Ohnishi, Y. Carbon-ion radiotherapy for locally advanced or
unfavorably located choroidal melanoma: a Phase I/II dose-escalation study. Int J Radiat
Oncol Biol Phys 67:857-862; 2007.
[284] Wang, H.; Zeng, Z. C.; Bui, T. A.; DiBiase, S. J.; Qin, W.; Xia, F.; Powell, S. N.;
Iliakis, G. Nonhomologous end-joining of ionizing radiation-induced DNA double-
249

CHAPTER 5
REFERENCES
stranded breaks in human tumor cells deficient in BRCA1 or BRCA2. Cancer Res
61:270-277; 2001.
[285] Mothersill, C.; Seymour, C. Radiation-induced bystander effects: are they good,
bad or both? Med Confl Surviv 21:101-110; 2005.
[286] Mothersill, C.; Seymour, C. Radiation-induced bystander effects, carcinogenesis
and models. Oncogene 22:7028-7033; 2003.
[287] Hall, E. J.; Hei, T. K. Genomic instability and bystander effects induced by high-
LET radiation. Oncogene 22:7034-7042; 2003.
[288] Prise, K. M.; Folkard, M.; Michael, B. D. Bystander responses induced by low
LET radiation. Oncogene 22:7043-7049; 2003.
[289] Azzam, E. I.; de Toledo, S. M.; Little, J. B. Oxidative metabolism, gap junctions
and the ionizing radiation-induced bystander effect. Oncogene 22:7050-7057; 2003.
[290] Azzam, E. I.; De Toledo, S. M.; Spitz, D. R.; Little, J. B. Oxidative metabolism
modulates signal transduction and micronucleus formation in bystander cells from alphaparticle-irradiated
normal human fibroblast cultures. Cancer Res 62:5436-5442; 2002.
[291] Azzam, E. I.; de Toledo, S. M.; Gooding, T.; Little, J. B. Intercellular
communication is involved in the bystander regulation of gene expression in human cells
exposed to very low fluences of alpha particles. Radiat Res 150:497-504; 1998.
[292] Brach, M. A.; Hass, R.; Sherman, M. L.; Gunji, H.; Weichselbaum, R.; Kufe, D.
Ionizing radiation induces expression and binding activity of the nuclear factor kappa B.
J Clin Invest 88:691-695; 1991.
[293] Ginn-Pease, M. E.; Whisler, R. L. Redox signals and NF-kappaB activation in T
cells. Free Radic Biol Med 25:346-361; 1998.
250

CHAPTER 5
REFERENCES
[294] Zhou, H.; Ivanov, V. N.; Lien, Y. C.; Davidson, M.; Hei, T. K. Mitochondrial
function and nuclear factor-kappaB-mediated signaling in radiation-induced bystander
effects. Cancer Res 68:2233-2240; 2008.
[295] Li, N.; Karin, M. Ionizing radiation and short wavelength UV activate NF-kappaB
through two distinct mechanisms. Proc Natl Acad Sci U S A 95:13012-13017; 1998.
[296] Lowenstein, C. J.; Alley, E. W.; Raval, P.; Snowman, A. M.; Snyder, S. H.;
Russell, S. W.; Murphy, W. J. Macrophage nitric oxide synthase gene: two upstream
regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl Acad
Sci U S A 90:9730-9734; 1993.
[297] Xie, Q. W.; Whisnant, R.; Nathan, C. Promoter of the mouse gene encoding
calcium-independent nitric oxide synthase confers inducibility by interferon gamma and
bacterial lipopolysaccharide. J Exp Med 177:1779-1784; 1993.
[298] Martinez-Ruiz, A.; Lamas, S. Signalling by NO-induced protein S-nitrosylation
and S-glutathionylation: Convergences and divergences. Cardiovasc Res 75:220-228;
2007.
[299] Kadhim, M. A.; Moore, S. R.; Goodwin, E. H. Interrelationships amongst
radiation-induced genomic instability, bystander effects, and the adaptive response. Mutat
Res 568:21-32; 2004.
[300] Maragos, C. M.; Morley, D.; Wink, D. A.; Dunams, T. M.; Saavedra, J. E.;
Hoffman, A.; Bove, A. A.; Isaac, L.; Hrabie, J. A.; Keefer, L. K. Complexes of No with
Nucleophiles as Agents for the Controlled Biological Release of Nitric-Oxide -
Vasorelaxant Effects. J Med Chem 34:3242-3247; 1991.
251

CHAPTER 5
REFERENCES
[301] Nathan, C. Nitric-Oxide as a Secretory Product of Mammalian-Cells. Faseb J
6:3051-3064; 1992.
[302] Matsumoto, H.; Hayashi, S.; Hatashita, M.; Shioura, H.; Ohtsubo, T.; Kitai, R.;
Ohnishi, T.; Yukawa, O.; Furusawa, Y.; Kano, E. Induction of radioresistance to
accelerated carbon-ion beams in recipient cells by nitric oxide excreted from irradiated
donor cells of human glioblastoma. Int J Radiat Biol 76:1649-1657; 2000.
[303] Tamir, S.; Tannenbaum, S. R. The role of nitric oxide (NO center dot) in the
carcinogenic process. Bba-Rev Cancer 1288:F31-F36; 1996.
[304] Lancaster, J. R. Diffusion of free nitric oxide. Method Enzymol 268:31-50; 1996.
[305] Saran, M.; Bors, W. Signaling by O-2(-Center-Dot) and No-Center-Dot - How
Far Can Either Radical, or Any Specific Reaction-Product, Transmit a Message under in-
Vivo Conditions. Chem-Biol Interact 90:35-45; 1994.
[306] Shao, C.; Stewart, V.; Folkard, M.; Michael, B. A.; Prise, K. M. Nitric oxidemediated
signaling in the bystander response of individually targeted glioma cells.
Cancer Research 63:8437-8442; 2003.
252

PUBLICATIONS AND PRESENTATIONS
Publications
1. Ghosh, S.; Krishna, M. Role of Rad52 in fractionated irradiation induced signaling in
A549 lung adenocarcinoma cells. Mutation Research/Fundamental and Molecular
Mechanisms of Mutagenesis; 2012 Jan 3;729(1-2):61-72.
2. Ghosh, S.; Narang, H.; Sarma, A.; Krishna, M. DNA damage response signaling in lung
adenocarcinoma A549 cells following gamma and carbon beam irradiation. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis; 2011 Nov 1;716(1-
2):10-9.
3. Ghosh, S.; Narang, H.; Sarma, A.; Kaur, H.; Krishna, M. Activation of DNA damage
response signaling in lung adenocarcinoma A549 cells following oxygen beam
irradiation. Mutat Res 723:190-198; 2011.
4. Ghosh, S.; Bhat, N. N.; Santra, S.; Thomas, R. G.; Gupta, S. K.; Choudhury, R. K.;
Krishna, M. Low energy proton beam induces efficient cell killing in A549 lung
adenocarcinoma cells. Cancer Invest 28:615-622; 2010.
5. Ghosh, S.; Maurya, D. K.; Krishna, M. Role of iNOS in bystander signaling between
macrophages and lymphoma cells. Int J Radiat Oncol Biol Phys 72:1567-1574; 2008.
253

Symposia
1. Ghosh S and Krishna M. Role of Nitric Oxide in Radiation induced Bystander Signaling.
Presented at International Conference on Advances in Free Radical Research: Natural
products, antioxidant and radioprotector, CSM Medical University, Lucknow. March 19-
21, 2009
2. Ghosh S and Krishna M. Mechanism of relative radioresistance of different cell lines.
Presented at DAE-BRNS 4 th
Life Science Symposium on Recent Advances in
Immunomodulation in Stress and Cancer, BARC, Mumbai. December 22-24, 2008
3. Ghosh S and Krishna M. Radiation Induced Bystander Effect: Similar and dissimilar
cells. Presented at International Conference on Free Radical & Natural Products in
Health, University of Rajasthan, Jaipur, 14-16 th February, 2008.
4. Ghosh S, Maurya DK and Krishna M. Molecular Mechanism of Bystander effect in
similar cells: Lack of Bystander effect in dissimilar cells. Presented at DAE-BRNS
Symposium 2007 on DNA damage, Repair and their Implications, BARC, Mumbai, 5-7,
December, 2007.
254

Mutation Research 729 (2012) 61–72
Contents lists available at SciVerse ScienceDirect
Mutation Research/Fundamental and Molecular
Mechanisms of Mutagenesis
jo ur n al hom ep a ge: www.elsevier.com/locate/molmut
C om mun i ty a ddress: www.elsevier.com/locate/mutres
Role of Rad52 in fractionated irradiation induced signaling in A549 lung
adenocarcinoma cells
Somnath Ghosh, Malini Krishna ∗
Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085, India
a r t i c l e i n f o
Article history:
Received 16 June 2011
Received in revised form
22 September 2011
Accepted 27 September 2011
Available online 4 October 2011
Keywords:
Fractionated irradiation
ATM
BRCA1
DNA repair
Rad52
a b s t r a c t
The effect of fractionated doses of -irradiation (2 Gy per fraction over 5 days), as delivered in cancer
radiotherapy, was compared with acute doses of 10 and 2 Gy, in A549 cells. A549 cells were found to
be relatively more radioresistant if the 10 Gy dose was delivered as a fractionated regimen. Microarray
analysis showed upregulation of DNA repair and cell cycle arrest genes in the cells exposed to fractionated
irradiation. There was intense activation of DNA repair pathway-associated genes (DNA-PK, ATM, Rad52,
MLH1 and BRCA1), efficient DNA repair and phospho-p53 was found to be translocated to the nucleus of
A549 cells exposed to fractionated irradiation. MCF-7 cells responded differently in fractionated regimen.
Silencing of the Rad52 gene in fractionated group of A549 cells made the cells radiosensitive. The above
result indicated increased radioresistance in A549 cells due to the activation of Rad52 gene.
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
Cellular response to ionizing radiation is a complex phenomenon
where the dose, dose rate and fractionation play an
equally important role in deciding the fate of the cell. Chronic exposure
of cells to ionizing radiation induces an adaptive response
that results in the increased tolerance to subsequent cytotoxicity
caused by the same [1–4]. Evidence from a number of studies has
indicated that a potential cause of radiation treatment failure may
be that multifraction irradiation selects a population of radiation
resistant cells from which regrowth of tumor progresses [5–7]. A
better understanding of how resistance is promoted at the molecular
level can form the basis for novel treatment strategies in the
future. The targets have been chosen based on their activation following
a single dose of radiation. However, more information about
the response of these signaling factors at clinically relevant doses
following a fractionated regimen is needed to understand their role,
if any, in the development of a radioresistant phenotype.
Mammalian cells have evolved a number of repair systems to
deal with the DNA double-strand breaks (DSBs) induced by exposure
to ionizing radiation [8]. The two major types of double-strand
break repair are homologous recombination and nonhomologous
∗ Corresponding author. Tel.: +91 22 2559 0416; fax: +91 22 2550 5151.
E-mail addresses: ghosh.barc@gmail.com (S. Ghosh), malinik00@gmail.com
(M. Krishna).
end-joining. The relative contribution of each of these types of
repair is controversial [9–11].
The phosphatidyl-inositol kinase-related protein ATM is the
most proximal signal transducer initiating cell cycle changes after
the DNA damage induced by ionizing radiation [12]. Likewise,
the rapid induction of ATM serine/threonine protein kinase activity
after ionizing radiation has also suggested that ATM acts at
an early stage of signal transduction in mammalian cells [13,14].
Mammalian ATM is a member of a family of protein kinases that
include ATM-Rad3-related (ATR), DNA-dependent protein kinase,
and FRAP, which are related because they have a similar carboxyterminal
kinase domain [15,16]. Recently, Bakkenist and Kastan
[17] showed that, ATM activation may result from changes in the
structure of chromatin brought about by intermolecular autophosphorylation
and ATM dimer dissociation. Once dissociated, ATM
can then potentially phosphorylate numerous downstream targets,
including p53, MDM2, CHK2, NBS1, RAD9, and BRCA1. ATM acts
specifically in the cellular responses to ionizing radiation and DNA
DSBs, rather than having a more general function in DNA repair.
It resides in a complex with BRCA1 and phosphorylates BRCA1
in a region that contains clusters of serine-glutamine residues
[18]. Phosphorylation of this domain appears to be functionally
important because a mutated BRCA1 protein that lacks these key
phosphorylation sites is unable to rescue the radiation hypersensitivity
of BRCA1-deficient cell lines [18]. Cells deficient in BRCA1
show genetic instability, defective G2/M checkpoint control, and
reduced homologous recombination [19,20]
0027-5107/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.mrfmmm.2011.09.007

62 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
Repair of DNA damage is critical for the maintenance of genome
integrity and cell survival. Living organisms have developed different
pathways of DNA repair to deal with various types of
DNA damage. In Saccharomyces cerevisiae, three epistasis groups
of DNA-damage-repair genes have been identified [21,22]. The
Rad52 epistasis group, which is mainly responsible for doublestrand
break (DSB) repair contains several genes: Rad50–Rad57,
MRE11, and XRS2. Among these genes, mutations in Rad51, Rad52,
and Rad54 cause the most severe and pleiotropic defects [23–25].
Yeast strains lacking a functional Rad52 gene are extremely X-
ray sensitive and deficient in mitotic and meiotic recombination
[26]. Mutations in different regions of Rad52 often result in different
phenotypes [27]. Shinohara et al. proposed that the product of
the Rad52 gene is not required for the initiation of recombination,
but is essential for an intermediate stage following the formation
of DSBs but before the appearance of stable recombinants
[28]. Recently, homologs of the Rad52 gene were found in several
eukaryotic organisms. Sequence analysis has revealed that the N-
terminal amino acid sequence of Rad52 protein is highly conserved
while the C-terminal region is less conserved [29–32]. Rad52 protein
interacts through its C-terminal domain with the N-terminal
domain of Rad51 protein in a species specific manner [33–35]. It
was reported that the over expression of human Rad52 HsRad52
conferred enhanced resistance to -rays and induced homologous
intrachromosomal recombination in cultured monkey cells [36]
MLH1, another protein involved in Mismatch repair (MMR), has
also been suggested to be involved in the DSB repair pathway [37].
MLH1 modulates error prone NHEJ by inhibiting the annealing of
DNA ends containing noncomplementary base pairs [38]. Furthermore,
the influence of MLH1 on IR-induced autosomal mutations
has been studied in a mouse Mlh1−/− kidney cell line. A high frequency
of IR induced mutations was found in Mlh1−/− cells due
to increased crossover events of mitotic recombination, suggesting
that MLH1, or MMR may serve as a modulator in mitotic HR
repair [39]. Previous study showed that the expression of MLH1 was
induced by IR, and the loss of MLH1 expression not only elevated
cell cycle progression but also increased the yield of IR-induced
chromosomal translocations, suggesting that this gene, involved
mostly in MMR, may play a role in DSB repair and cell cycle regulation
[40]
The present study was conducted to look at how repair pathways
respond to different irradiation regimens with aim to identify
markers of radioresistance which may serve as future targets for
modulation to enhance the efficacy of radiotherapy.
2. Materials and methods
2.1. Cell culture
Human Lung Adenocarcinoma A549 cells and human breast carcinoma MCF-7
cells were grown in DMEM (Sigma, USA), supplemented with 10% fetal calf serum
(Sigma). Cells were maintained at 37 ◦ C in humidified atmosphere with 5% CO 2.
2.2. Irradiation of cells
Before designing the experiment, there were two aspects that had to be taken
care of. One the stochastic effects of radiation and second the deterministic effects of
radiation. Radiation dose as well as confluency of cells could influence the stochastic
or deterministic effects of radiation. Exposure of cells (≥2 Gy) with confluency more
than 80%, deterministic effects will be more and stochastic effects will be minimal.
At this confluency of cells and radiation dose, it is expected that all the cells will
get threshold number of hits. Deterministic rather than stochastic factors explain
most of the variation in radio-responsiveness following fractionated irradiation of
2 Gy per fraction [41]. A549 and MCF-7 cells with 80% confluency were exposed to
different doses of irradiation using Gamma Cell 220 irradiator (Atomic Energy of
Canada Ltd.), at a dose rate of 3.5 Gy/min; the first set was irradiated with acute
dose of 2 Gy or 10 Gy. The second set was exposed to 5 fraction of 2 Gy each over a
period of five days, after irradiation cells were trypsinized and seeded, so that cells
will reach 80% confluency by next day.
2.3. Clonogenic cell survival assay
After irradiation, clonogenic assay was done as described earlier [42]. Absolute
plating efficiency of A549 cells at 0 Gy (sham irradiated control) was 32.3 ± 2.4%.
Absolute plating efficiency of MCF-7 cells at 0 Gy (sham irradiated control) was
45.2 ± 2.4%.
2.4. Immunofluorescence staining
Immunofluorescence staining was done as described earlier [42]. The primary
antibodies used were mouse anti-pATM (S1981), rabbit anti--H2AX (S139), rabbit
anti-pBRCA1 (Ser1524) and mouse anti-phospho-p53 (S15) (Cell Signaling). Secondary
antibodies used were Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor
488 goat anti-mouse IgG (Molecular Probe, USA).
2.5. Image analysis using ImageJ software
The captured images were analyzed for relative quantification of phosphorylation
using ImageJ software [43]. DAPI stained nucleus of each cell was selected and
the same frame was used for relative quantification of phosphorylation using ImageJ
software as described earlier [42]. All the foci were counted manually; at least 100
cells per experiment were analyzed from three independent experiments.
2.6. Western Blotting
Immunoblotting was done as described previously [4]. Primary antibody used
was mouse anti-phospho-p53 (S15) (Cell Signaling). The bound HRP labeled secondary
antibody was then detected using BM Chemiluminiscence Western Blotting
Kit (Roche Molecular Bio chemicals, Germany). The band intensity was quantified by
Image J software. The total intensity of bands obtained in ponceau staining was used
as a protein loading and transfer control. All other band intensities were divided by
the intensity of their respective ponceau blot.
2.7. Microarray
For microarray analysis, 4 h after irradiation was selected as the time point
to monitor the early response of cells to irradiation and to identify differentially
expressed early genes that mediate cellular events such as DNA repair and apoptosis.
Two independent series of experiments were performed with Human Genome
U-133 Plus 2.0 microarrays containing 54,675 probe sets (Affymetrix, Santa Clara,
CA). Microarray analysis was carried out at Oscimum Biosolution, Hyderabad on paid
basis. Total RNA was isolated from ∼3 × 10 6 A549 cells with RNeasy Mini Kits (Qiagen)
including digestion with RNase-free DNase I, and its quantity and integrity were
checked spectrophotometrically and by electrophoresis in 1% agarose gels. Materials
and methods for microarrays were from Affymetrix (Santa Clara); double-stranded
cDNA was prepared with the GeneChip Expression 3 ′ -Amplification One-Cycle cDNA
Synthesis Kit, cleaned using the Sample Cleanup Module, and biotinylated cRNA
was synthesized with GeneChip Expression 3 ′ -Amplification Reagents for IVT Labeling,
cleaned on RNA Sample Cleanup columns, and fragmented at 94 ◦ C for 35 min
in Fragmentation Buffer. The biotinylated cRNA was hybridized first to a control
Test3 microarray to evaluate its quality and then to a Human Genome U-133
Plus 2.0 microarrays containing 54,675 probe sets, using GeneChip Expression 3 ′ -
Amplification Reagents. Microarrays were stained with streptavidin–phycoerythrin
conjugate and scanned in a Gene Array G2500A scanner (Agilent) and the expression
data on human Affymetrix chip was generated. Since the numbers of samples
in each treatment type were sparse, we used a bivariate simulation approach to
identify differentially expressed (DE) genes for the specified threshold fold change
(FC). The DE candidates across each comparison were further evaluated for their
biological relevance through Gene Ontology and Pathways studies. The statistical
analysis was carried out using R package and the biological analysis was carried out
using Genowiz TM software.
For comparative evaluation, an un-irradiated control cell was used. The expression
data on Affymetrix Human 133AB chip was obtained for each sample. The
primary objective of the study was to obtain differentially expressed (DE) probe
sets (genes) across various comparisons. Also, the interest was to study the clustering
of genes and samples and the functional relevance of the differentially expressed
genes.
Upon identifying the DE genes, the next interest was to study the biological
relevance of selected marker genes through GO and Pathway analysis.
The data analysis process involves Robust Multichip Average (RMA) normalization,
quality check analysis, differential expression analysis and the gene enrichment
analysis.
The correlation between the expression values for samples was studied through
Pearson’s coefficient. A pairwise correlation analysis was performed to generate
a correlation matrix indicating how the samples are related with each other. The
coefficient tells about the similarity of expression trend between the two arrays.
A coefficient value close to 1.0 indicates the linear expression between the arrays.
The minimum correlation between the samples was 0.987, which was above the
acceptable criterion of 0.8.

S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72 63
Table 1
The sequences of gene specific primers and their annealing temperature (T m) used
in RT-PCR experiments.
Gene Primer sequence T m ( ◦ C)
-Actin F 5 ′ -TGGAATCCTGTGGCATCCATGAAA-3 ′ 55
R 5 ′ -TAAAACGCAGCTCAGTAACAGTCCG-3 ′
ATM F 5 ′ -GGACAGTGGAGGCACAAAAT-3 ′ 57
R 5 ′ -GTGTCGAAGACAGCTGGTGA-3 ′
DNA-PK F 5 ′ -TGCCAATCCAGCAGTCATTA-3 ′ 64
R 5 ′ -GGTCCATCAGGCACTTCACT-3 ′
Rad52 F 5 ′ -AGTTTTGGGAATGCACTTGG-3 ′ 50
R 5 ′ -TCGGCAGCTGTTGTATCTTG-3 ′
MLH1 F 5 ′ -GAGGTGAATTGGGACGAAGA-3 ′ 52
R 5 ′ -TCCAGGAGTTTGGAATGGAG-3 ′
CDKN1A (p21) F 5 ′ -CAGCAGAGGAAGACCATGTG-3 ′ 59
R 5 ′ -GGCGTTTGGAGTGGTAGAAA-3 ′
GADD45 F 5 ′ -TGCGAGAACGACATCAACAT-3 ′ 58
R 5 ′ -TCCCGGCAAAAACAAATAAG-3 ′
TLR3 F 5 ′ -GCCTCTTCGTAACTTGACCA-3 ′ 57
R 5 ′ -AAGGATGTGGAGGTGAGACA-3 ′
FDXR F 5 ′ -AGAGAACGGACATCACGAAG-3 ′ 57
R 5 ′ -GTCCTGGAGACCCAAGAAAT-3 ′
F, forward and R, reverse.
Percentage Survival
100
80
60
40
20
0
0Gy 2Gy 5X2Gy 10Gy
Radiation Dose
Fig. 1. Clonogenic cell survival of A549 cells irradiated with 2 Gy, 5 fractions of 2 Gy
or 10 Gy -radiation. Data represent means ± SE of three independent experiments;
*P < 0.05, **P < 0.01 compared with 10 Gy acute dose.
**
2.8. Semiquantitative reverse transcriptional polymerase chain reaction (RT-PCR)
Total RNA from 1 × 10 6 cells was extracted 4 h after irradiation and RT-PCR was
carried out as described earlier [44]. Primer sequence and annealing temperature of
specific primers are given in Table 1.
2.9. Transfection with ShRNA
MLH1, Rad52 and Control shRNA plasmids were procured from Santa cruz
biotechnology (Cat No. sc-35943-SH, sc-37399-SH and sc-108060 respectively). In
a six well tissue culture plate, A549 cells were grown to 50–70% confluency in
antibiotic-free normal growth medium supplemented with FBS and transfection
was carried out as per supplier’s instruction. 48 h post-transfection, medium was
aspirated and replaced with fresh medium containing puromycin (2 g/ml) for
selection of stably transfected cells. Semi-quantitative RT-PCR was performed to
monitor MLH1 and Rad52 gene expression knockdown using gene specific primers
(Table 1).
2.10. Statistical analysis
The data were imported to excel work sheets, and graphs were made using
Origin version 5.0. One-way ANOVA with Tukey–Kramer Multiple Comparisons as
post-test for P < 0.05 used to study the significant level. Data were insignificant at
P > 0.05. Each point represented as mean ± SE (standard error of the mean).
3. Results
3.1. Clonogenic cell survival
To determine the sensitivity of cells to different doses of radiation,
their ability to form colonies after irradiation was observed.
There was 60 ± 2.5% survival of A549 cells that had been exposed
to 2 Gy acute dose where as there was 48 ± 2.8% of cells survived
that had been exposed to 5 fractions of 2 Gy radiations and 4 ± 0.5%
of cells survived that had been exposed to 10 Gy acute dose (Fig. 1).
3.2. Human genome U-133 Plus 2.0 microarray data analysis
Global expression analysis of 54,675 probe set using Human
Genome U-133 Plus 2.0 microarray was performed in A549 cells.
On comparison of control vs 5X2 Gy (henceforth called fractionated
dose), 461 genes were identified as differentially expressed;
312 genes up-regulated (defined as a 2.0-fold or greater increase,
Supplementary data) and 149 down-regulated (defined as a 2.0-
fold or greater decrease, Supplementary data). Up-regulated genes
were associated with p53 signaling pathway, cytokine–cytokine
receptor interaction, hematopoietic cell lineage, Toll-like receptor
signaling pathway, Jak-STAT signaling pathway, MAPK signaling
pathway, cell-cycle check point, B cell receptor signaling pathway.
Down-regulated genes were associated with TGF-beta signaling
pathway and tyrosine metabolism.
In the second group (2 Gy vs 5X2 Gy), 234 genes were identified
as differentially expressed; 172 genes as up-regulated
(Supplementary data) and 62 as down-regulated (Supplementary
data). Genes involved in cytokine–cytokine receptor interaction,
toll-like receptor signaling pathway, hematopoietic cell lineage,
Jak-STAT signaling pathway, MAPK signaling pathway were upregulated.
Gene involved in folate biosynthesis, glycine, serine and
threonine metabolisms were down-regulated.
In the 10 Gy vs fractionated group, 289 genes were identified
as differentially expressed; 211 genes as up-regulated
(Supplementary data) and 78 as down-regulated (Supplementary
data). Genes involved in cytokine–cytokine receptor interaction,
toll-like receptor signaling pathway, cell cycle, DNA replication,
mismatch repair, homologous recombination were up-regulated.
Genes involved in regulation of autophagy, base excision repair,
folate biosynthesis were down-regulated.
Cluster analysis of the expression of these genes showed that
the fractionated group differed most in gene expression compared
to the other three groups (control, 2 Gy or 10 Gy) (Supplementary
data, TCS2 means 2 Gy treatment group, TCS3 means fractionated
group, TCS4 means 10 Gy treatment group).
3.3. Validation of microarray data
In order to verify the microarray data, semi-quantitative RT-PCR
was performed for four genes from control and fractionated group
of A549 cells. These results corresponded very well with those for
the microarray data for all four genes, strongly supporting the reliability
and rationale of our strategy (Fig. 2A and B).
3.4. Activation of repair related genes
When compared to the controls there was a significant upregulation
of ATM, DNA-PK, Rad52 and MLH1 genes in A549 cells
that had been exposed to fractionated irradiation (Fig. 3A–D, Lane
3). However, in A549 cells that had been exposed to 10 Gy acute
dose there was marginal up-regulation of ATM, DNA-PK and Rad52
genes although it was significantly lower than the fractionated
group (Fig. 3A–D, Lane 4). In A549 cells which had been exposed
to 2 Gy acute dose there was marginal up-regulation of Rad52 and

64 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
(A)
rray)
Fold Change (Microar
(B)
Fold Change (RT-PC CR)
3.6
3.4
Control
3.2
5X2Gy
3.0
2.8
2.6
2.4
2.2
2.0
1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
CDK1A(p21) GADD45A TLR3 FDXR
Genes
3.6
3.4
3.2
Control
3.0
5X2Gy
2.8
2.6
2.4
2.2
2.0
1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0
CDK1A(p21) GADD45A TLR3 FDXR
Genes
Fig. 2. Validation of microarray data by semi-quantitative RT-PCR. (A) Fold changes
of genes as determined by microarray analysis. (B) Fold changes of genes as determined
by RT-PCR. Four genes from control and 5X2 Gy treatment group of A549 cells
were selected and performed three sets of semi-quantitative RT-PCR as described
in Section 2. Four genes were CDKN1A (p21), GADD45, Toll-like receptor 3 (TLR3)
and Ferredoxin reductase (FDXR).
MLH1 genes but these were also significantly lower than the fractionated
group (Fig. 3A–D, Lane 2).
3.5. Efficient repair of DNA
Repair kinetics was determined by counting the -H2AX foci
at 15 min and 4 h after irradiation. As expected maximum numbers
of foci were seen at 15 min in A549 cells exposed to 10 Gy
followed by cells exposed to fractionated irradiation and very few
foci were seen in cells exposed to 2 Gy acute dose. By 4 h the number
of foci in cells exposed to fractionated irradiation had been reduced
to almost control but in the cells exposed to 10 Gy the number of
foci was still very high, indicating that there was efficient repair of
DNA in A549 cells that had been exposed to fractionated irradiation
(Fig. 4).
3.6. Radiation induced foci of DNA damage response proteins
ATM and BRCA1
ATM, an important DNA damage response protein to ionizing
radiation and a part of irradiation induced foci (IRIF), is mainly
involved in cell cycle arrest and repair. It gets activated after DNA
DSB by phosphorylation at ser 1981 and activates many key cellular
proteins that include H2AX, BRCA1, Chk1/2 and p53. Phospho
ATM foci and intensity were looked at 4 h after irradiation. All the
cells either exposed to 10 Gy (23 ± 3 foci per cell) or fractionated
irradiation (25 ± 2.8 foci per cell) showed ATM foci but only 10%
of cells exposed to 2 Gy showed ATM foci and the number of foci
per cell was 2 ± 0.08 (Fig. 5A). The intensity of phosphorylation of
ATM was quantified by ImageJ software, was significantly higher in
the fractionated group as compared to any of the treatment groups
(control, 2 Gy or 10 Gy) (Supplementary data, Fig. 5C).
BRCA1, which is phosphorylated by ATM, is a part of IRIF and
shares many downstream substrates of ATM. 4 h after irradiation,
A549 cells that had been exposed to 2 Gy acute dose did not show
any BRCA1 foci where as 55% of cells that had been exposed to fractionated
irradiation showed BRCA1 foci and the number of foci per
cell was 24 ± 4. 22% of cells that had been exposed to 10 Gy acute
showed BRCA1 foci and the number of foci per cell was 15 ± 2.1
(Fig. 5B). The intensity of phosphorylation of BRCA1 as determined
by ImageJ software was significantly higher in the fractionated
group as compared to any of the treatment groups (control, 2 Gy
or 10 Gy) (Supplementary data, Fig. 5D).
3.7. Translocation of phospho-p53
18 h after irradiation, phospho-p53 was found to be translocated
into the nucleus of A549 cells exposed to fractionated irradiation
(Fig. 6A). The intensity of phosphorylation was significantly higher
in the cells exposed to fractionated irradiation (Supplementary
data, Fig. 6C). Phosphorylation of p53 was further confirmed by
Western Blot (Fig. 6B, Lane 3).
3.8. Response of A549 and MCF-7 cells exposed to fractionated
irradiation
There was 48 ± 2.8% survival of A549 cells exposed to fractionated
irradiation where as only 10 ± 1.2% of MCF-7 cells survived
exposed to fractionated irradiation (Fig. 7A). 4 h after irradiation,
there was a significant up-regulation of ATM, DNA-PK, Rad52 and
MLH1 genes in A549 cells but not in MCF-7 cells (Fig. 7B, Lane
3). ATM and BRCA1 phosphorylation was found to be significantly
higher 4 h after irradiation in A549 cells but not in MCF-7 cells
(Fig. 7C). 18 h after irradiation, phospho-p53 was found to be
translocated into the nucleus of A549 cells but not in MCF-7 cells
(Fig. 7C). There was efficient repair of DNA by 4 h in A549 cells as
determined by counting -H2AX but not in MCF-7 cells (Fig. 7D).
3.9. Role of Rad52 and MLH1
Since there was an intense activation of Rad52 and MLH1 in
A549 cells exposed to fractionated irradiation, it was of interest to
look for their role in survival of A549 cells. MLH1 and Rad52 gene
expression knockdown was carried out in A549 cells using MLH1
and Rad52 shRNA plasmids. Stably transfected cells were selected
and the transfection efficiency was found to be 85% for MLH1 gene
and 80% for Rad52 gene (Fig. 8A).
There was 48 ± 2.8% survival of A549 cells exposed to fractionated
irradiation. The survival of A549 cells that had been transfected
with MLH1 shRNA plasmid and exposed to fractionated irradiation
was found to be 40 ± 1.8% where as the survival of A549 cells that
had been transfected with Rad52 shRNA plasmid and exposed to
fractionated irradiation was found to be 23 ± 1.5% (Fig. 8B and C).
The survival of cells transfected with control shRNA plasmid was
the same as unirradiated control cells (data not shown).
4. Discussion
Chronic exposure of cells to IR has been reported to induce
an adaptive response that results in an enhanced tolerance to the
cytotoxicity of subsequent doses of IR [1–4]. There could be many
possible mechanisms for the induction of the adaptive response
which would eventually determine the cell fate. In the present

S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72 65
Fig. 3. Gene expression of ATM, DNA-PK, Rad52 and MLH1 in A549 cells irradiated with different doses of -radiation. Total RNA from A549 cells was isolated and reverse
transcribed 4 h after irradiation. RT-PCR analysis of ATM, DNA-PK, Rad52 and MLH1 genes was carried out as described in Section 2. PCR products were resolved on 1.5%
agarose gels containing ethidium bromide. -Actin gene expression in each group was used as an internal control. Ratio of intensities of (A) ATM, (B) DNA-PK, (C) Rad52 and
(D) MLH1 band to that of respective -actin band as quantified from gel pictures are shown above each gel picture. Key: Lane 1, control unirradiated A549 cell line; Lane 2,
2 Gy acute dose (single dose that was delivered in each fraction) of 60 Co -irradiation; Lane 3, 2 Gy of 60 Co -irradiation daily over a period of 5 days; Lane 4, 10 Gy acute
(which is the sum total of all the fraction) 60 Co -irradiation. Data represent means ± SE of three independent experiments; significantly different from unirradiated controls:
*P < 0.05, **P < 0.01.
study human lung adenocarcinoma A549 cells were found to be
more radioresistant if 10 Gy dose was delivered as 5 fractions of
2 Gy dose. Although fractionation is supposed to play an important
role in inducing an adaptive response and deciding the fate of cells,
the mechanism by which it does so can be many and innumerable
factors could be responsible. DNA microarray analysis is a powerful
tool for obtaining comprehensive information concerning expression
of thousands of genes in cancer cells [45] DNA microarray
analysis revealed variable expression of many genes. Up-regulated
genes in A549 cells exposed to fractionated irradiation were associated
with p53 signaling pathway, cytokine-cytokine receptor
interaction, hematopoietic cell lineage, toll-like receptor signaling
pathway, Jak-STAT signaling pathway, MAPK signaling pathway,
cell-cycle check point, B cell receptor signaling pathway, DNA
replication, mismatch repair, homologous recombination. Toll-like
receptor signaling pathway is responsible for survival and proliferation
of the cells [46]. The Janus kinase-signal transducer and
activator of transcription (JAK-STAT) pathway mediate signaling
by cytokines, which control survival, proliferation and differentiation
of several cell types [47]. MAPK signaling pathways are
known to be involved in various processes of growth, differentiation
and cell death [48]. Most of the pathways which were
up-regulated in A549 cells exposed to fractionated irradiation in
all comparisons were associated with the survival or repair of
the A549 cells. This indicates that fractionated irradiation could
induce up-regulation of survival/repair related pathways in cancer
cells.
To the authors’ knowledge, this is the first report indicating
the differential gene expression profiles of A549 cells
exposed to fractionated irradiation. Previous reports concerning

66 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
Fig. 4. Repair kinetics as determined by -H2AX foci in different treatment group of A549 cells at 15 min and 4 h after irradiation. Cells were fixed 15 min and 4 h after
irradiation in 4% paraformaldehyde, permeabilized in 0.25% Triton X-100 and labeled with specific antibodies as described in Section 2. Each phospho-site antibody was
indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). The encircled area roughly
represents cell nuclei as seen by DAPI staining. All images were captured using Carl Zeiss confocal microscope with the same exposure time. Representative image of three
independent experiments is shown here; at least 100 cells per experiment were analyzed from three independent experiments. (For interpretation of the references to color
in this figure legend, the reader is referred to the web version of the article.)
radioresistant non-small-cell lung cancer and HeLa cells
also indicated that cell cycle signaling pathways, mismatch
repair, homologous recombination were up-regulated
[49,50]. In the current study, some of these genes were
previously known to be associated with responsiveness
to radiation, such as p21 and GADD45˛, but others were
novel. These novel genes can be expected to be involved in
radioresistance, but the precise function of each gene remains
unclear; so further study is necessary to clarify the nature of
associations.
Microarray data had shown that p53 signaling pathway was
up-regulated in A549 cells that had been exposed to fractionated

S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72 67
Fig. 5. Radiation induced foci of DNA damage response proteins. (A) ATM and (B) BRCA1 in different treatment groups of A549 cells 4 h after irradiation. Cells were fixed in 4%
paraformaldehyde 4 h after irradiation, permeabilized in 0.25% Triton X-100 and labeled with specific antibodies as described in Section 2. Each phospho-site antibody was
indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All images were captured using
Carl Zeiss confocal microscope with the same exposure time. Representative images of three independent experiments are shown here; at least 100 cells per experiment
were analyzed from three independent experiments. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)

68 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
Fig. 6. Translocation of phospho-p53 into the nucleus of A549 cells 18 h after irradiation. (A) Representative image of three independent experiments showing phosphorylation
and translocation of p53 into nucleus of A549 cells. Each phospho-site antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were
mounted with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. At least 100 cells per
experiment were analyzed from three independent experiments. (B) Representative immunoblot image of three independent experiments depicting phosphorylation of p53
in different treatment group. Graph represents phospho-p53 band intensities (divided with the respective loading control intensities and normalized). Key: Lane 1, control
unirradiated A549 cell line; Lane 2, 2 Gy acute dose (single dose that was delivered in each fraction) of 60 Co -irradiation; Lane 3, 2 Gy of 60 Co -irradiation daily over a period
of 5 days; Lane 4, 10 Gy acute (which is the sum total of all the fraction) 60 Co -irradiation. Data represent means ± SE of three independent experiments. (For interpretation
of the references to color in this figure legend, the reader is referred to the web version of the article.)

S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72 69
Fig. 7. Response of A549 and MCF-7 cells exposed to fractionated irradiation. (A) Clonogenic cell survival of A549 and MCF-7 cells exposed to fractionated irradiation.
Data represent means ± SE of three independent experiments; **P < 0.01 compared with MCF-7. (B) Representative image of three independent experiments showing gene
expression of ATM, DNA-PK, Rad52 and MLH1 in A549 and MCF-7 cells exposed to fractionated irradiation. -Actin gene expression in each group was used as an internal
control. (C) Phosphorylation of ATM, BRCA1 and p53 in A549 and MCF-7 cells exposed to fractionated irradiation. (D) Repair kinetics as determined by -H2AX foci in A549
and MCF-7 cells exposed to fractionated irradiation at 15 min and 4 h after irradiation. Each phospho-site antibody was indirectly labeled with Molecular Probe 488 secondary
antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). The encircled area roughly represents cell nuclei as seen by DAPI staining. All the
images were taken using a 100× objective lens except the images of p53 phosphorylation. The images of p53 phosphorylation were taken using 40× objective lens for A549
cells and MCF-7 cells. All images were captured using Carl Zeiss confocal microscope with the same exposure time. Representative images of three independent experiments
are shown here; at least 100 cells per experiment were analyzed from three independent experiments. (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of the article.)

70 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
Fig. 8. Effect of inhibition of Rad52 and MLH1 on the growth and radioresistance of
A549 cells which had been exposed to 5 fractions of 2 Gy radiation. A549 cells were
transfected with either MLH1 or Rad52 ShRNA as described in Section 2. (A) Transfection
efficiency as determined by semi-quantitative RT-PCR. Gene expression of
Rad52 and MLH1 in A549 cells transfected with Control ShRNA, Rad52 ShRNA or
MLH1 ShRNA. Total RNA from A549 cells was isolated and reverse transcribed 7
days after transfection. RT-PCR analysis of Rad52 and MLH1 genes were carried out
as described in Section 2. PCR products were resolved on 1.5% agarose gels containing
ethidium bromide. -Actin gene expression in each group was used as an internal
control. Ratio of intensities of Rad52 or MLH1 band to that of respective -actin band
as quantified from gel pictures are shown above each gel picture. Key: Rad52, Gene
expression of Rad52 to that of -actin in A549 cells transfected with control ShRNA;
−ve Rad52, gene expression of Rad52 to that of -actin in A549 cells transfected
with Rad52 ShRNA; MLH1, gene expression of MHL1 to that of -actin in A549 cells
transfected with control ShRNA; −ve MLH1, gene expression of MLH1 to that of -
actin in A549 cells transfected with MLH1 ShRNA. (B) Clonogenic survival assay of
A549 cells. Key: control, control unirradiated A549 cells; 5X2 Gy, A549 cells exposed
to 2 Gy of 60Co -irradiation daily over a period of 5 days; 5X2 Gy + M, A549 cells
transfected with MLH1 ShRNA and exposed to 2 Gy of 60 Co -irradiation daily over a
period of 5 days; 5X2 Gy + R, A549 cells transfected with Rad52 ShRNA and exposed
to 2 Gy of 60 Co -irradiation daily over a period of 5 days. (C) Representative image
of three independent experiments. Data represent means ± SE of three independent
experiments; *P < 0.05, **P < 0.01 compared with 5X2 Gy treatment group.
irradiation; it was our interest to look at the phosphorylation of
p53 and its translocation to the nucleus of A549 cells. Lung adenocarcinoma
A549 cells typically express wild-type p53 protein
[51] and would be expected to be sensitive to the DNA-damaging
agents used for cancer therapy; however, these cells are radioresistant
if the radiation dose is delivered as fractionated irradiation.
p53 classically considered to be a tumor suppressor protein, but in
this study the results are contradictory. Even though the p53 levels
are up-regulated following fractionated doses (Fig. 6A and B), the
apoptotic function of the p53 appears to be compromised. p53 is
considered to be a classic “gatekeeper” of cellular fate [52,53]. p53
is activated in response to genotoxic stress such as radiation. And
once activated, it initiates cell cycle arrest, senescence or apoptosis
via pathways involving the transactivation of p53 target genes
[52,53]. There was no change in the expression of pro apoptotic
targets of p53 such as Bax, Perp, Puma and Noxa in the cells that
had been exposed to fractionated irradiation as compared to control
cells (Microarray data in Supplementary Files). However, there
was higher expression of cell cycle target genes of p53 such as p21
and GADD45 in the cells that had been exposed to fractionated
irradiation as compared to control cells (Fig. 2).
Since DNA repair pathways were up-regulated in A549 cells that
had been exposed to fractionated irradiation, it was of interest to
look at the activation of genes and proteins involved in DNA repair
pathways. Our results indicate that there was intense activation of
repair genes and protein in A549 cells exposed to fractionated irradiation
(Figs. 3 and 5). Our results on DNA-PK are consistent with
earlier works where authors have also shown the role of DNA-PK in
the radioresistance of lung carcinoma cells [54,55]. However, these
authors have looked at the response only after single dose of irradiation
and it is logical to expect these pathways to get activated.
In this study we reiterate the fact that DNA-PK is also involved in
radioresistance if the cells are subjected to fractionated irradiation
but the reason for the development of radioresistance still remains
an enigma.
ATM and BRCA1 have been regarded as primary regulators of
homologous recombination repair (HRR) [56]. In this study there
was intense activation of ATM gene and ATM foci were seen in all
the cells exposed to fractionated irradiation and most of the cells
showed BRCA1 foci (Figs. 3 and 5) indicating the fact that HRR pathway
was activated in A549 cells and therefore, these proteins could
be involved in HRR which can take advantage of the other strand
that may be intact. ATM and BRCA1 reside in macromolecular complex
and form foci after irradiation. Our results are in agreement
with earlier works where authors have also shown the role ATM
in radioresistance of cancer cells [57,58]. However, these authors
have studied using single dose of irradiation.
By 4 h there was an efficient repair of DNA in A549 cells exposed
to fractionated irradiation but not in cells that had been exposed to
10 Gy acute dose as determined by the disappearance of -H2AX
foci (Fig. 4). It has been established recently that H2AX at the DNA
DSB sites are immediately phosphorylated upon irradiation, and
the phosphorylated H2AX (-H2AX) can be visualized in situ by
immunostaining with a -H2AX specific antibody [59,60]. -H2AX
induction can be measured quantitatively at physiological doses,
and the numbers of residual -H2AX foci can be used to estimate
the kinetics of DSB rejoining. This has become the gold standard for
the detection of DSB [60,61].
A clear cause and effect relationship was established between
DNA damage signaling, gene expression and efficient DNA repair
and was evident in the form of cell survival in A549 cells that had
been exposed to fractionated irradiation.
It has been reported that A549 cells are relatively more
radioresistant than MCF-7 cells if radiation dose was delivered as
fractionated regimen [62]. But the mechanism of such response has
not been studied. To the authors’ knowledge this is the first report

S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72 71
explaining the mechanism of such response as activation of repair
pathway, efficient DNA repair and translocation of phospho-p53
into the nucleus of A549 cells exposed to fractionated irradiation
and not in MCF-7 cells exposed to fractionated irradiation (Fig. 7).
Numerous reports have implicated DNA repair genes as being
mainly responsible for the development of radioresistance due to
fractionated irradiation [54,55,57,58]. To investigate what factors
are involved in fractionated irradiation induced radioresistance in
A549 cells, the cells were transfected with either Rad52 or MLH1
shRNA plasmid and exposed to 5 fractions of 2 Gy. The survival of
A549 cells that had been transfected with MLH1 shRNA plasmid
and exposed to fractionated irradiation was found to be 40 ± 1.8%
where as the survival of A549 cells which had been transfected with
Rad52 shRNA plasmid and exposed to fractionated irradiation was
23 ± 1.5% (Fig. 8). The above results demonstrate that the Rad52
gene is one of the factors responsible for the increased radioresistance
in A549 cells if 10 Gy dose was delivered as fractionated
irradiation. These observations strongly argue for the functional
importance of Rad52 in DSB repair in lung adenocarcinoma A549
cells.
5. Conclusions
In summary, our results indicated that A549 cells were relatively
more radioresistant if these cells were exposed to fractionated irradiation.
The reason for radioresistance could be the activation of
DNA repair pathways and Rad52 gene is an important factor modulating
radioresistance in A549 cells. This study contributes basic
information about some of the genes involved in radioresistance
and may eventually contribute to clinical investigations of prediction
markers and prognostic factors, as well as the development of
radiosensitive molecules for therapeutic use.
Conflict of interest statement
The authors declare that there are no conflicts of interest.
Acknowledgments
Authors would like to thank Mr. Manjoor Ali and Mr. Paresh
Khadilkar, RB&HSD, BARC for their help in Confocal Microscopy and
Lab work respectively.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.mrfmmm.2011.09.007.
References
[1] J. Russell, T.E. Wheldon, P. Stanton, A radioresistant variant derived from a
human neuroblastoma cell line is less prone to radiation-induced apoptosis,
Cancer Res. 55 (1995) 4915–4921.
[2] W.K. Dahlberg, E.I. Azzam, Y. Yu, J.B. Little, Response of human tumor cells of
varying radiosensitivity and radiocurability to fractionated irradiation, Cancer
Res. 59 (1999) 5365–5369.
[3] A.G. Pearce, T.M. Segura, A.C. Rintala, N.D. Rintala-Maki, H. Lee, The generation
and characterization of a radiation-resistant model system to study radioresistance
in human breast cancer cells, Radiat. Res. 156 (2001) 739–750.
[4] A.K. Mitra, M. Krishna, Fractionated and acute irradiation induced signaling in
a murine tumor, J. Cell. Biochem. 101 (2007) 745–752.
[5] R.R. Weichselbaum, M.A. Beckett, W. Dahlberg, A. Dritschilo, Heterogeneity of
radiation response of a parent human epidermoid carcinoma cell line and four
clones, Int. J. Radiat. Oncol. Biol. Phys. 14 (1988) 907–912.
[6] M.C. Joiner, Evidence for induced radioresistance from survival and other end
points: an introduction, Radiat. Res. 138 (1994) S5–S8.
[7] S. Henness, M.W. Davey, R.M. Harvie, R.A. Davey, Fractionated irradiation of H69
small-cell lung cancer cells causes stable radiation and drug resistance with
increased MRP1, MRP2, and topoisomerase IIalpha expression, Int. J. Radiat.
Oncol. Biol. Phys. 54 (2002) 895–902.
[8] K. Valerie, L.F. Povirk, Regulation and mechanisms of mammalian doublestrand
break repair, Oncogene 22 (2003) 5792–5812.
[9] R. Kanaar, J.H. Hoeijmakers, D.C. van Gent, Molecular mechanisms of DNA double
strand break repair, Trends Cell Biol. 8 (1998) 483–489.
[10] J.E. Haber, Partners and pathwaysrepairing a double-strand break, Trends
Genet. 16 (2000) 259–264.
[11] R.D. Johnson, M. Jasin, Double-strand-break-induced homologous recombination
in mammalian cells, Biochem. Soc. Trans. 29 (2001) 196–201.
[12] T. Samuel, H.O. Weber, J.O. Funk, Linking DNA damage to cell cycle checkpoints,
Cell Cycle 1 (2002) 162–168.
[13] S. Banin, L. Moyal, S. Shieh, Y. Taya, C.W. Anderson, L. Chessa, N.I. Smorodinsky,
C. Prives, Y. Reiss, Y. Shiloh, Y. Ziv, Enhanced phosphorylation of p53 by ATM
in response to DNA damage, Science 281 (1998) 1674–1677.
[14] C.E. Canman, D.S. Lim, K.A. Cimprich, Y. Taya, K. Tamai, K. Sakaguchi, E. Appella,
M.B. Kastan, J.D. Siliciano, Activation of the ATM kinase by ionizing radiation
and phosphorylation of p53, Science 281 (1998) 1677–1679.
[15] C.H. Westphal, Cell-cycle signaling: Atm displays its many talents, Curr. Biol. 7
(1997) R789–R792.
[16] M.F. Hoekstra, Responses to DNA damage and regulation of cell cycle checkpoints
by the ATM protein kinase family, Curr. Opin. Genet. Dev. 7 (1997)
170–175.
[17] C.J. Bakkenist, M.B. Kastan, DNA damage activates ATM through intermolecular
autophosphorylation and dimer dissociation, Nature 421 (2003) 499–506.
[18] D. Cortez, Y. Wang, J. Qin, S.J. Elledge, Requirement of ATM-dependent phosphorylation
of brca1 in the DNA damage response to double-strand breaks,
Science 286 (1999) 1162–1166.
[19] X. Xu, Z. Weaver, S.P. Linke, C. Li, J. Gotay, X.W. Wang, C.C. Harris, T. Ried, C.X.
Deng, Centrosome amplification and a defective G2-M cell cycle checkpoint
induce genetic instability in BRCA1 exon 11 isoform-deficient cells, Mol. Cell 3
(1999) 389–395.
[20] M.E. Moynahan, J.W. Chiu, B.H. Koller, M. Jasin, Brca1 controls homologydirected
DNA repair, Mol. Cell 4 (1999) 511–518.
[21] E. Friedberg, W. Siede, A.J. Cooper, The Molecular and Cellular Biology of the
Yeast Saccharomyces, Cold Spring Harbor Laboratory Press, Plainview, NY,
1991.
[22] J. Game, Radiation-sensitive Mutants and Repair in Yeast, Springer-Verlag, New
York, 1983.
[23] M. Ajimura, S.H. Leem, H. Ogawa, Identification of new genes required
for meiotic recombination in Saccharomyces cerevisiae, Genetics 133 (1993)
51–66.
[24] E.L. Ivanov, V.G. Korolev, F. Fabre, XRS2, a DNA repair gene of Saccharomyces
cerevisiae, is needed for meiotic recombination, Genetics 132 (1992) 651–664.
[25] T. Petes, R.E. Malone, I.S. Symington, Recombination in Yeast, Cold Spring Harbor
Laboratory Press, New York, 1991.
[26] M.A. Resnick, Genetic control of radiation sensitivity in Saccharomyces cerevisiae,
Genetics 62 (1969) 519–531.
[27] K.L. Boundy-Mills, D.M. Livingston, A Saccharomyces cerevisiae RAD52 allele
expressing a C-terminal truncation protein: activities and intragenic complementation
of missense mutations, Genetics 133 (1993) 39–49.
[28] A. Shinohara, H. Ogawa, T. Ogawa, Rad51 protein involved in repair and recombination
in S. cerevisiae is a RecA-like protein, Cell 69 (1992) 457–470.
[29] O.Y. Bezzubova, H. Schmidt, K. Ostermann, W.D. Heyer, J.M. Buerstedde,
Identification of a chicken RAD52 homologue suggests conservation of the
RAD52 recombination pathway throughout the evolution of higher eukaryotes,
Nucleic Acids Res. 21 (1993) 5945–5949.
[30] D.F. Muris, K. Vreeken, A.M. Carr, B.C. Broughton, A.R. Lehmann, P.H. Lohman, A.
Pastink, Cloning the RAD51 homologue of Schizosaccharomyces pombe, Nucleic
Acids Res. 21 (1993) 4586–4591.
[31] C. Bendixen, I. Sunjevaric, R. Bauchwitz, R. Rothstein, Identification of a mouse
homologue of the Saccharomyces cerevisiae recombination and repair gene,
RAD52, Genomics 23 (1994) 300–303.
[32] Z. Shen, K. Denison, R. Lobb, J.M. Gatewood, D.J. Chen, The human and mouse
homologs of the yeast RAD52 gene: cDNA cloning, sequence analysis, assignment
to human chromosome 12p12.2-p13, and mRNA expression in mouse
tissues, Genomics 25 (1995) 199–206.
[33] G.T Milne, D.T. Weaver, Dominant negative alleles of RAD52 reveal a DNA
repair/recombination complex including Rad51 and Rad52, Genes Dev. 7 (1993)
1755–1765.
[34] J.W. Donovan, G.T. Milne, D.T. Weaver, Homotypic and heterotypic protein
associations control Rad51 function in double-strand break repair, Genes Dev.
8 (1994) 2552–2562.
[35] Z. Shen, K.G. Cloud, D.J. Chen, M.S. Park, Specific interactions between the
human RAD51 and RAD52 proteins, J. Biol. Chem. 271 (1996) 148–152.
[36] M.S. Park, Expression of human RAD52 confers resistance to ionizing radiation
in mammalian cells, J. Biol. Chem. 270 (1995) 15467–15470.
[37] Y. Habraken, O. Jolois, J. Piette, Differential involvement of the
hMRE11/hRAD50/NBS1 complex, BRCA1 and MLH1 in NF-kappaB activation
by camptothecin and X-ray, Oncogene 22 (2003) 6090–6099.
[38] L.A. Bannister, B.C. Waldman, A.S. Waldman, Modulation of error-prone doublestrand
break repair in mammalian chromosomes by DNA mismatch repair
protein Mlh1, DNA Repair (Amst) 3 (2004) 465–474.
[39] Q. Wang, O.N. Ponomareva, M. Lasarev, M.S. Turker, High frequency induction
of mitotic recombination by ionizing radiation in Mlh1 null mouse cells, Mutat.
Res. 594 (2006) 189–198.
[40] Y. Zhang, L.H. Rohde, K. Emami, D. Hammond, R. Casey, S.K. Mehta, A.S. Jeevarajan,
D.L. Pierson, H. Wu, Suppressed expression of non-DSB repair genes inhibits

72 S. Ghosh, M. Krishna / Mutation Research 729 (2012) 61–72
gamma-radiation-induced cytogenetic repair and cell cycle arrest, DNA Repair
(Amst) 7 (2008) 1835–1845.
[41] A. Safwat, S.M. Bentzen, I. Turesson, J.H. Hendry, Deterministic rather than
stochastic factors explain most of the variation in the expression of skin telangiectasia
after radiotherapy, Int. J. Radiat. Oncol. Biol. Phys. 52 (2002) 198–204.
[42] S. Ghosh, N.N. Bhat, S. Santra, R.G. Thomas, S.K. Gupta, R.K. Choudhury, M.
Krishna, Low energy proton beam induces efficient cell killing in A549 lung
adenocarcinoma cells, Cancer Invest. 28 (2010) 615–622.
[43] W.S. Rasband, J.U.S. Image, National Institutes of Health, Bethesda, USA.
http://rsb.info.nih.gov/ij/, 1997–2006.
[44] S. Ghosh, D.K. Maurya, M. Krishna, Role of iNOS in bystander signaling between
macrophages and lymphoma cells, Int. J. Radiat. Oncol. Biol. Phys. 72 (2008)
1567–1574.
[45] S.M. Bentzen, Preventing or reducing late side effects of radiation therapy:
radiobiology meets molecular pathology, Nat. Rev. Cancer 6 (2006) 702–713.
[46] F.J. Barrat, R.L. Coffman, Development of TLR inhibitors for the treatment of
autoimmune diseases, Immunol. Rev. 223 (2008) 271–283.
[47] S.N. Constantinescu, M. Girardot, C. Pecquet, Mining for JAK-STAT mutations in
cancer, Trends Biochem. Sci. 33 (2008) 122–131.
[48] M. Krishna, H. Narang, The complexity of mitogen-activated protein kinases
(MAPKs) made simple, Cell. Mol. Life Sci. 65 (2008) 3525–3544.
[49] Y.S. Lee, J.H. Oh, S. Yoon, M.S. Kwon, C.W. Song, K.H. Kim, M.J. Cho, M.L. Mollah,
Y.J. Je, Y.D. Kim, C.D. Kim, J.H. Lee, Differential gene expression profiles
of radioresistant non-small-cell lung cancer cell lines established by fractionated
irradiation: tumor protein p53-inducible protein 3 confers sensitivity to
ionizing radiation, Int. J. Radiat. Oncol. Biol. Phys. 77 (2010) 858–866.
[50] Y. Qing, X.Q. Yang, Z.Y. Zhong, X. Lei, J.Y. Xie, M.X. Li, D.B. Xiang, Z.P. Li, Z.Z. Yang,
G. Wang, D. Wang, Microarray analysis of DNA damage repair gene expression
profiles in cervical cancer cells radioresistant to 252Cf neutron and X-rays, BMC
Cancer 10 (2010) 71.
[51] T.A. Lehman, W.P. Bennett, R.A. Metcalf, J.A. Welsh, J. Ecker, R.V. Modali, S.
Ullrich, J.W. Romano, E. Appella, J.R. Testa, et al., p53 mutations, ras mutations,
and p53-heat shock 70 protein complexes in human lung carcinoma cell lines,
Cancer Res. 51 (1991) 4090–4096.
[52] P. May, E. May, Twenty years of p53 research: structural and functional aspects
of the p53 protein, Oncogene 18 (1999) 7621–7636.
[53] B. Vogelstein, D. Lane, A.J. Levine, Surfing the p53 network, Nature 408 (2000)
307–310.
[54] S.P. Lees-Miller, R. Godbout, D.W. Chan, M. Weinfeld, R.S. Day, G.M. 3rd,
J. Barron, Allalunis-Turner, Absence of p350 subunit of DNA-activated protein
kinase from a radiosensitive human cell line, Science 267 (1995)
1183–1185.
[55] F. Sirzen, A. Nilsson, B. Zhivotovsky, R. Lewensohn, DNA-dependent protein
kinase content and activity in lung carcinoma cell lines: correlation with intrinsic
radiosensitivity, Eur. J. Cancer 35 (1999) 111–116.
[56] S.E. Golding, E. Rosenberg, A. Khalil, A. McEwen, M. Holmes, S. Neill, L.F. Povirk,
K. Valerie, Double strand break repair by homologous recombination is regulated
by cell cycle-independent signaling via ATM in human glioma cells, J. Biol.
Chem. 279 (2004) 15402–15410.
[57] S. Tribius, A. Pidel, D. Casper, ATM protein expression correlates with radioresistance
in primary glioblastoma cells in culture, Int. J. Radiat. Oncol. Biol. Phys.
50 (2001) 511–523.
[58] S.J. Collis, M.J. Swartz, W.G. Nelson, T.L. DeWeese, Enhanced radiation and
chemotherapy-mediated cell killing of human cancer cells by small inhibitory
RNA silencing of DNA repair factors, Cancer Res. 63 (2003) 1550–1554.
[59] E.P. Rogakou, D.R. Pilch, A.H. Orr, V.S. Ivanova, W.M. Bonner, DNA doublestranded
breaks induce histone H2AX phosphorylation on serine 139, J. Biol.
Chem. 273 (1998) 5858–5868.
[60] P.L. Olive, J.P. Banath, Phosphorylation of histone H2AX as a measure of
radiosensitivity, Int. J. Radiat. Oncol. Biol. Phys. 58 (2004) 331–335.
[61] O. Fernandez-Capetillo, A. Lee, M. Nussenzweig, A. Nussenzweig, H2AX: the
histone guardian of the genome, DNA Repair (Amst) 3 (2004) 959–967.
[62] J.H. Matthews, B.E. Meeker, J.D. Chapman, Response of human tumor cell lines
in vitro to fractionated irradiation, Int. J. Radiat. Oncol. Biol. Phys. 16 (1989)
133–138.

Mutation Research 716 (2011) 10–19
Contents lists available at ScienceDirect
Mutation Research/Fundamental and Molecular
Mechanisms of Mutagenesis
jou rnal h omepa g e: www.elsevier.com/locate/molmut
Co mm unit y ad d ress: www.elsevier.com/locate/mutres
DNA damage response signaling in lung adenocarcinoma A549 cells following
gamma and carbon beam irradiation
Somnath Ghosh a , Himanshi Narang a,∗ , Asitikantha Sarma b , Malini Krishna a
a Radiation Biology and Health Sciences Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085, India
b Radiation Biology Laboratory, Inter University Accelerator Centre, Aruna Asaf Ali Marg, New Delhi 110 067, India
a r t i c l e i n f o
Article history:
Received 24 March 2011
Received in revised form 22 July 2011
Accepted 26 July 2011
Available online 3 August 2011
Key words:
Carbon
-Rays
-H2AX
ATM
BRCA1
a b s t r a c t
Carbon beams (5.16 MeV/u, LET = 290 keV/m) are high linear energy transfer (LET) radiation characterized
by higher relative biological effectiveness than low LET radiation. The aim of the current study was
to determine the signaling differences between -rays and carbon ion-irradiation. A549 cells were irradiated
with 1 Gy carbon or -rays. Carbon beam was found to be three times more cytotoxic than -rays
despite the fact that the numbers of -H2AX foci were same. Percentage of cells showing ATM/ATR foci
were more with -rays however number of foci per cell were more in case of carbon irradiation. Large
BRCA1 foci were found in all carbon irradiated cells unlike -rays irradiated cells and prosurvival ERK
pathway was activated after -rays irradiation but not carbon. The noteworthy finding of this study is
the early phase apoptosis induction by carbon ions. In the present study in A549 lung adenocarcinoma,
authors conclude that despite activation of same repair molecules such as ATM and BRCA1, differences in
low and high LET damage responses might be due to their distinct macromolecular complexes rather than
their individual activation and the activation of cytoplasmic pathways such as ERK, whether it applies to
all the cell lines need to be further explored.
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
Biological consequences of high-energy charged particle exposure
are of crucial importance in the clinic, space exploration and
risk assessments [1]. Track structure of charged-particle radiation
is known to be a critical determinant of its biological effectiveness
[2–4]. Energy deposition by HZE ions is highly heterogeneous,
with a localized contribution along the trajectory of every particle
and lateral diffusion of energetic electrons (i.e., -rays, the target
atom electrons ionized by the incident HZE ion and emitted at high
energy) many microns from the path of the ions. These particles
are therefore densely ionizing (high-LET) along the primary track
(e.g., the track followed by the incident heavy ion); and also they
have a low-LET component because of the high-energy electrons
ejected by ions as they traverse tissue. Biophysical models have
shown that energy-deposition events by high-LET radiation produce
different DNA lesions, including complex DNA breaks, and
that qualitative difference between high-LET radiation and low-
LET radiation affects both the induction and repair of DNA damage
[4–8]. Because of the effective cell killing many clinicians now
favor charged particle beam therapy over conventional photons
for tumors that are radio resistant and when the survival of nearby
∗ Corresponding author. Tel.: +91 22 2559 5310; fax: +91 22 2550 5151.
E-mail address: himinarang@gmail.com (H. Narang).
cells cannot be compromised e.g. in treatment of lung cancer [9,10].
Although charged particle beams like carbon etc. are currently
being used for the treatment, the signaling pathways activated and
their variance from -rays irradiation is not well understood.
DNA, the main target for radiation induced cell killing, upon
damage, triggers a signaling network that senses different types
of damage and coordinates responses which include activation of
transcription, cell cycle control, apoptosis, senescence, and DNA
repair processes [11]. Hundreds of proteins are recruited in time
dependent manner in the vicinity of a DSB leading to formation
of a signaling-repair complex which can be visualized as foci and
are therefore termed as radiation induced foci (RIF). One of the
components of RIF is -H2AX that is immediately phosphorylated
upon irradiation, can be visualized in situ by immunostaining with
a -H2AX specific antibody and measured quantitatively [12–14].
Mathematical methods has been developed to analyze flow cytometry
data to describe the kinetics of DNA damage response protein
activation after exposure to X-rays and high energy Iron nuclei [15].
Other proteins like ATM (ataxia telangiectasia mutated), ATR (ATM
and Rad3-related) and BRCA1, also function in complexes that can
be seen as foci. There are reports that ATM responds differently
to DSBs induced by high-LET and low-LET radiations [16,17]. The
signal is transduced downstream by proteins such as Chk1/Chk2
and p53 that trigger off DNA repair, cycle arrest or apoptosis. The
cytoplasmic MAPK pathways, namely ERK and JNK, have also been
linked to the DNA damage response and ATM-mediated signaling
0027-5107/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.mrfmmm.2011.07.015

S. Ghosh et al. / Mutation Research 716 (2011) 10–19 11
events [18]. ERK1/2 signaling has been shown to be a positive regulator
of homologous recombination repair (HRR) [19] and has also
been shown to be activated by ATM [20]. JNK on the other hand has
been shown to be inhibited by ATM [21] and plays a role in radiation
induced apoptosis. These cytoplasmic signaling pathways coordinate
with DNA damage activated pathways and summation of all
the pathways decides the ultimate fate of the cell [18].
Many studies on signaling pathways after low and high LET radiations
have found the activation to be similar except in the intensity
[22] but since the end result is different, there must be a divergence
of pathways at some stage. It is this stage of signaling, that is different,
that will be crucial to designing therapies that target specific
molecules or pathways. The aim of the present study was to look for
these subtle differences that are of important consequences. A549,
a lung carcinoma cell line was chosen as lung cancer is one of the
most commonly diagnosed types of cancer with the highest death
rates [23] and high LET ions pose a therapeutic advantage over
conventional photons for treatment of non-small-cell lung cancer
(NSCLC) [10].
2. Methods
2.1. Cell culture
Human Lung Adenocarcinoma, A549 cells were cultured and seeded as described
earlier [24].
2.2. Irradiation of cells
For the experiments plateau phase A549 cells were irradiated with 60 Co -rays
and 12 C ions from 15 UD Pelletron accelerator at the Inter University Accelerator
Centre, New Delhi. During carbon irradiation, 35 mm petri plates [NUNC] with cellular
monolayers were kept perpendicular to the particle beam coming out of the
exit window. The petri dishes were kept in the serum free medium in a plexiglass
magazine during the irradiation. The computer controlled irradiation system is such
that during the actual irradiation the dish was removed from medium. Control cells
were sham irradiated in similar way.
At the cell surface the energy of C ions was 62 MeV [5.16 MeV/u, LET = 290 keV/
m]. Both the energy and LET were calculated using the Monte Carlo Code SRIM
code [25]. The corresponding fluence for the dose of 1 Gy was 2.2 × 10 6 particles
cm −2 , thus each cell nuclei can be expected to be physically traversed at least once
by carbon ion.
Fluence was calculated using the relation given below, approximating the density
of cellular matrix as 1.0:
Dose [Gy]=1.6 × 10 −9 ×LET (keV/m) ×particle fluence (cm −2 ) × 1 (cm3 /g)
For gamma irradiation, cells were exposed to 1, 2 and 3 Gy of 60 Co -rays in
in-house facility Gamma Cell 220 [AECL, Canada] at dose rate of 3 Gy/min and same
experimental conditions were kept as far as possible. In all experiments, controls
were sham irradiated.
2.3. Clonogenic cell survival assay
2.6. Image analysis using ImageJ software
The captured images were analyzed for relative quantification of phosphorylation
using ImageJ software [27]. DAPI stained nucleus of each cell was selected and
the same frame was used for relative quantification of phosphorylation using ImageJ
software as described earlier [24]. All the foci were counted manually; at least 100
cells per experiment were analyzed from three independent experiments.
3. Results
3.1. Carbon ions were three times more cytotoxic than gamma
To determine the sensitivity of cells to similar dose of high and
low LET radiations, their ability to form colonies after irradiation
was observed. Irradiation of plateau phase A549 cells with equal
doses of -rays and carbon (290 keV/m) revealed that at same
dose carbon ions were much more cytotoxic than -rays. The calculated
RBE (relative biological effectiveness) of carbon ions relative
to rays for 20% survival of A549 cells was found to be nearly 3.
Thus, carbon ions were found to be three times more toxic than -
rays. At 2 Gy percentage survivals were 60.6 ± 4% and 4.8 ± 0.24%
for -rays and carbon respectively (Fig. 1).
3.2. Number of initial -H2AX foci formed was almost same for
both radiation type
Since DNA double strand breaks are the primary toxic lesions
induced by radiation, the number of DSBs was scored by examining
the foci of phosphorylated H2AX in irradiated cells. After 15 min
of either radiation, -H2AX foci, visualized as bright spots, were
present in all the cells. The average numbers of foci after 15 min
of 1 Gy -rays irradiation were 15.8 ± 4.8, while after 1 Gy carbon
irradiation the foci were 19 ± 4.7 (Fig. 2). Thus unlike the cell survival,
not much difference was observed in number of -H2AX foci
after irradiation with equal doses of carbon and -rays. However,
the size of -H2AX foci in carbon irradiated samples was larger than
-rays irradiated samples. The foci were also counted 4 h after irradiation.
57% of -rays irradiated cells still showed -H2AX foci and
the average foci per cell had reduced to only 2.9 ± 2.28. Carbon ion
irradiated cells also showed a significant reduction in the number
of -H2Ax foci (2 ± 2) per cell that were visible in only 22% of cells
(Fig. 2B and C). When total intensity of -H2AX rather than the foci
was estimated by ImageJ software in the same images, it corroborated
well with the number of -H2AX foci in -ray irradiated cells
at 15 min and 4 h after irradiation (Fig. 2D). However, in case of car-
1
After irradiation, clonogenic assay was done as described earlier [24]. Absolute
plating efficiency at 0 Gy was 32.3 ± 2.4%.
2.4. Western blotting
Unirradiated and irradiated cells were lysed at different time periods and
immunoblotted, as described previously [26]. Blots were probed with anti-Bax, antiphospho
ERK (Thr/Tyr) and anti-phospho JNK (Thr/Tyr). The bound HRP labeled
secondary antibody was detected by Chemiluminiscence (Roche Molecular Biochemicals,
Germany). The total intensity of bands obtained in ponceau staining was
used as a protein loading and transfer control. All band intensities were divided by
the intensity of their respective ponceau blot.
Surviving Fraction
0.1
0.01
γ ray
Carbon beam
2.5. Immunofluorescence staining
Unirradiated and irradiated cells were fixed at different time periods and
immunofluorescence staining was done as described earlier [24]. The primary antibodies
used were mouse anti-pATM (S1981), rabbit anti--H2AX (S139), rabbit
anti-pChk1 (Ser296), rabbit anti-pChk2 (Thr68), rabbit anti-pBRCA1 (Ser1524) and
rabbit anti-pATR (Ser428) (Cell Signaling). Secondary antibodies used were Alexa
Fluor 488 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG (Molecular
Probe, USA).
1E-3
0
1
Dose (Gy)
Fig. 1. Clonogenic cell survival of A549 cells irradiated with 1 and 2 Gy carbon beam
or -rays. Data represents means ± SD of three independent experiments.
2
3

12 S. Ghosh et al. / Mutation Research 716 (2011) 10–19
Fig. 2. Phosphorylation of H2AX (-H2AX) at different time points after exposure to 1 Gy -rays or carbon irradiation in A549 cells. Representative images showing -H2AX
foci (A) 15 min and (B) 4 h after irradiation. Each phospho-H2AX antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted
with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (C) Graph represents average
numbers of foci per cell, percentage of cells showing the foci is marked above the bars. (D) Graph represents relative intensity of -H2AX as determined by ImageJ software.
At least 100 cells per experiment were analyzed from three independent experiments. Data represents means ± SD of three independent experiments. (For interpretation of
the references to color in this figure legend, the reader is referred to the web version of the article.)
bon irradiation, the total intensity of -H2AX at 4 h was yet high
(Fig. 2D).
Since initial response as observed from -H2AX foci at 15 min
was similar with both types of radiation, irradiation induced foci of
downstream signaling components was followed at 4 h to highlight
the signaling differences at that time period.
3.3. ATM/ATR foci in gamma and carbon irradiated cells
ATM, an important DNA damage response protein to ionizing
radiation and a part of radiation induced foci (RIF), is mainly
involved in cell cycle arrest and repair. In response to DSBs, ATM is
activated and phosphorylates key players in various branches of the

S. Ghosh et al. / Mutation Research 716 (2011) 10–19 13
Fig. 3. Phosphorylation of ATM at 4 h after exposure to 1 Gy -rays or carbon irradiation in A549 cells. (A) Representative image showing p-ATM foci 4 h after irradiation.
Each phospho-ATM antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI
(blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per cell, percentage of
cells showing the foci is marked above the bars. (C) Graph represents relative intensity of p-ATM as determined by ImageJ software. At least 100 cells per experiment were
analyzed from three independent experiments. Data represents means ± SD of three independent experiments. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of the article.)
DNA damage response network that include H2AX, BRCA1, Chk1/2
and p53. Phospho ATM foci and intensity were scored at 4 h after -
rays or carbon irradiation. At 4 h after gamma irradiation, 88% cells
showed that pATM foci with the average foci per cell was 6.5 ± 4.4,
as against 25% control cells (3.4 ± 1.67) (Fig. 3). Like -H2AX foci,
small number of ATM foci 4 h after -rays irradiation indicates that
by 4 h most of the repair has taken place. However, at 4 h after carbon
ion irradiation only 52% of the cells showed the foci but the
average pATM foci per cell (21 ± 10) was much higher as compared
to 4 h after -rays (Fig. 3). Total intensity levels of phospho ATM
matched with the number of foci observed (Fig. 3C).
ATR, another important DNA damage sensor, which is known to
respond late to the IR induced damage, was also looked for its activation
at 4 h. After -rays irradiation, 53% of the cells showed ATR
foci (2.8 ± 1.64), as against no foci in any of the control-unirradiated
cells. On the other hand, 4 h after carbon ion irradiation although
only 10% of cells showed the foci, the average foci per cell (7 ± 4.5)
were thrice that of -rays irradiated cells (Fig. 4). Total intensity
levels of phospho ATR matched with the number of foci observed
(Fig. 4C).
3.4. BRCA1 foci
Another important protein involved in DSB repair is the tumor
suppressor protein BRCA1 which is phosphorylated by ATM and is
also a part of RIF. 4 h after -rays irradiation, 55% cells displayed
BRCA1 foci (13 ± 8) while 100% of carbon irradiated cells displayed
BRCA1 foci (7.5 ± 0.64) (Fig. 5) and the foci, although less in number
were larger in size than -ray induced foci. The intensity of
phosphorylation of BRCA1 as determined by ImageJ software was
higher in carbon irradiated cells (Fig. 5C). Presence of BRCA1 foci
in all cells irradiated after carbon irradiation indicates that BRCA1
might be the important player in response to complex DNA damage
induced by high LET radiation.
3.5. Activation of downstream effectors, Chk1 and Chk2
Activation of ATM, ATR and BRCA1 after DNA damage leads to
the activation of further downstream components including Chk1
and Chk2. After activation in the nuclei, Chk1 and Chk2 move to
cytoplasm. Phospho Chk1, the major target of ATR, was found to
increase in nuclei of carbon-irradiated cells but not in -rays irradiated
cells (Fig. 6A). Marginal activation of Chk2, the preferred
substrate of ATM, was observed in the nucleus in all the cells irrespective
of radiation quality (Fig. 6B).
3.6. Activation of intracellular MAPKs, ERK and JNK
ERK1/2 showed significant activation 1 h after -rays irradiation
and thereafter the increase was persistent till 4 h (Fig. 7A), while

14 S. Ghosh et al. / Mutation Research 716 (2011) 10–19
Fig. 4. Phosphorylation of ATR at 4 h after exposure to 1 Gy -rays or carbon irradiation in A549 cells. (A) Representative image showing p-ATR foci 4 h after irradiation. Each
phospho-ATR antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All
images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per cell, percentage of cells showing
the foci is marked above the bars. (C) Graph represents relative intensity of p-ATR as determined by ImageJ software. At least 100 cells per experiment were analyzed from
three independent experiments. Data represents means ± SD of three independent experiments. (For interpretation of the references to color in this figure legend, the reader
is referred to the web version of the article.)
JNK did not show any activation after -rays irradiation (Fig. 7B).
Interestingly, after carbon irradiation the activation pattern of these
kinases was exact opposite. ERK was not activated at all after carbon
irradiation (Fig. 7A) while JNK showed marginal activation at
15 min that remained so till 1 h (Fig. 7B). The expression of total
ERK did not change during the same period in the cells that had
been exposed to either -rays or carbon beam.
3.7. Apoptosis
At 4 h after irradiation, morphological features of DAPI stained
apoptotic nuclei were scored and many apoptotic nuclei were
observed in cells irradiated with carbon ion but not in -rays irradiated
cells (Fig. 8A and B).
Upregulation of Bax expression was also observed as early as
2 h after carbon ion irradiation indicating apoptotic tendency of the
cells (Fig. 8C). -Rays irradiated cells did not show any upregulation
of Bax (data not shown).
4. Discussion
Although 1 Gy dose of carbon ions was three times more toxic to
the cells than -rays, both produced same number of -H2AX foci,
indicators of DNA double strand breaks. This discrepancy between
observed cytotoxicity and estimated -H2AX foci after high LET
radiation has also been reported previously [28]. Since our aim
was to find out signaling differences arising from DNA damaged
by either of the radiations, we chose 1 Gy of both radiations rather
than their equitoxic doses. The observed decrease in number of -
H2AX foci 4 h after -rays irradiation indicates repair of damage
and is supported by nearly 100% survival. However, the decrease in
-H2AX foci after carbon ion irradiation was definitely not indicative
of repair because the cell survival data contradicts the fact
(Fig. 2). Foci formation is a biochemical kinetic process involving
both formation and loss of foci [29], there is never an exact one-toone
correspondence between the number of DSB and foci [30]. In
addition, multiple DSB may be visible as a single focus due to DNA
supercoiling [31]. For heavy ions, clustering of damage including
DSB along the trajectory of the ion leads to further complexities
in relating foci counts to damage numbers [14]. However, since
total intensity of -H2AX was yet high at 4 h in carbon irradiated
cells, indicating its phosphorylated state, it may represent sites of
increased DNA damage after carbon irradiation, arising from misrepair
or incomplete repair [32,33].
Similar number of -H2AX foci at 15 min after both high and low
LET radiations indicated that initial events might not differ much
with the radiation quality. Activation of other molecules including
ATM, ATR, BRCA1, Chk1, Chk2 and Bax was therefore followed

S. Ghosh et al. / Mutation Research 716 (2011) 10–19 15
Fig. 5. Phosphorylation of BRCA1 at 4 h after exposure to 1 Gy -rays or carbon irradiation in A549 cells. (A) Representative image showing p-BRCA1 foci 4 h after irradiation.
Each phospho-BRCA1 antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI
(blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per cell, percentage of
cells showing the foci is marked above the bars. (C) Graph represents relative intensity of p-BRCA1 as determined by ImageJ software. At least 100 cells per experiment were
analyzed from three independent experiments. Data represents means ± SD of three independent experiments. (For interpretation of the references to color in this figure
legend, the reader is referred to the web version of the article.)
only at later time point of 4 h as comparing the activation of these
molecules at this time could highlight signaling differences with
respect to clustered damage.
ATM and ATR, the initial DNA damage sensors, are critical regulators
of cell cycle checkpoints and repair. ATM has particularly
been shown to respond to IR induced damage. Presence of few
ATM foci in -rays irradiated cells 4 h after irradiation indicates the
repair of the damage in most cells. However, in carbon irradiated
cells, although the percentage of cells showing the pATM foci (55%)
was less, the average number of foci/cell was more than -rays irradiated
cells (Fig. 3). Similar trend was also observed with ATR foci
with respect to radiation quality (Fig. 4). Higher percentage of -
rays irradiated cells showing the ATM/ATR foci 4 h after irradiation
as compared to carbon irradiated cells indicates more homogenous
nature of -rays induced responses while presence of lesser average
ATM/ATR foci per -rays irradiated cell as against carbon irradiation
indicates efficient repair after -rays irradiation. This observation
is in agreement with the previous studies where higher activation
of repair molecules had been observed few hours after heavy ion
irradiation as compared to low LET irradiation [22,34] and has been
attributed to unrepaired DNA that keeps the damage sensors in activated
state. However, these studies have shown that size of the foci
and the number of foci at 24 h is different between high and low
LET radiations.
The formation of BRCA1 foci was unlike ATM/ATR and very interesting.
BRCA1 exists in a complex containing ATM and other DSB
repair proteins and both ATM and BRCA1 have been regarded as primary
regulators of HRR [35]. Presence of BRCA1 foci in ∼55% (Fig. 5)
of the -rays irradiated cells is in agreement with the previous studies
where BRCA1 foci have been found to be activated only in cells
in S, G2/M phases of the cycle [34] and therefore is thought to play
a role in HRR which can take the advantage of the other strand that
may be intact. Unlike after -rays irradiation, presence of BRCA1
foci in all of the carbon irradiated cells was quite intriguing. Moreover,
the downstream substrates, Chk1 (Fig. 6A) and Chk2 (Fig. 6B)
also showed relatively higher activation in carbon irradiated cells.
Despite higher activation of all these repair components in carbon
irradiated cells, their DNA was still unrepaired as indicated by -
H2AX staining and survival data. The authors therefore, believe that
activated repair components might have different functionalities
after low and high LET radiations and that this functionality might
be imparted through association of proteins in different macromolecular
complexes. This was supported by larger size of -H2AX
and BRCA1 foci observed after carbon irradiation. This result is
in accordance with previous studies where authors had observed
larger foci of DNA damage response proteins in the cells that had
been exposed to high LET radiation [14,36]. This means that foci
from -rays in essentially have a distinct meaning from those from

16 S. Ghosh et al. / Mutation Research 716 (2011) 10–19
Fig. 6. Phosphorylation of Chk1 and Chk2 at 4 h after exposure to 1 Gy -rays or carbon irradiation in A549 cells. (A) Representative image showing p-Chk1 4 h after
irradiation. Graph represents relative phosphorylation of Chk1 as determined by ImageJ software. (B) Representative image showing p-Chk2 4 h after irradiation. Graph
represents relative phosphorylation of Chk2 as determined by ImageJ software. Each phospho-Chk1 or phospho-Chk2 antibody was indirectly labeled with Molecular Probe
488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the
same exposure time. At least 100 cells per experiment were analyzed from three independent experiments. Data represents means ± SD of three independent experiments.
(For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
high LET ions. Presence of ATM foci in only half of carbon irradiated
cells while BRCA1 foci in all the cells also suggest that BRCA1
is associated with different proteins and may not require activated
ATM. Further study on co-localization experiment for BRCA1 with
ATM by immunofluorescence would provide better understanding
of repair responses elicited by low and high LET radiations. Number
of Chk2 foci, another important regulator of HRR, also did not
seem to parallel ATM foci. This, along with the fact that the survival
of the cells is only 20% (Fig. 1) and many apoptotic nuclei are
present at 4 h (Fig. 8) indicates that these macromolecular complexes
containing BRCA1 may be involved in apoptotic responses
after a complex damage to the DNA. Recent studies suggest multifunctional
nature of BRCA1 in maintaining genome integrity. It has
been shown to play an important role in apoptosis and cell cycle
control and does so by associating in distinct protein complexes
[37]. However, further studies on BRCA1 and apoptosis again need
to be experimentally addressed.
The cytoplasmic MAPK pathways, ERK and JNK, that feed into
and are fed upon by DNA damage repair signaling also play an
equally important role in deciding the fate of the irradiated cell.
Reactive oxygen species generated after -rays irradiation has been
thought to be one of the mechanisms for early activation of these
kinases [18]. ATM has been shown to enhance repair via activation
of ERK pathway [35] and inhibition of JNK [21]. Observed activation
of ERK (Fig. 7A) but not JNK (Fig. 7B) in -rays irradiated cells
indicated the dominance of pro-survival pathways.

S. Ghosh et al. / Mutation Research 716 (2011) 10–19 17
Fig. 7. Phosphorylation of ERK (pERK) and JNK (pJNK) in A549 cells at different time periods (h) after exposure to 1 Gy dose of -rays or carbon ion irradiation. Treated and
untreated cells were immunoblotted and detected using anti-phospho ERK (panel A) or anti phospho JNK (panel B). One representative image of three independent experiments
is shown here. Bar graph represents the relative pERK (panel A) and pJNK (panel B) band intensities plotted against time. The intensities of pERK/pJNK were obtained after
dividing them with the respective loading control intensities and have been normalized for comparison. Data represents means ± SEM of three independent experiments.
Fig. 8. Apoptosis in carbon irradiated A549 cells. (A) Apoptotic nuclei of A549 cells were visualized and quantified by using DAPI staining, 4 h after carbon or -rays
irradiation (1 Gy). (B) Graph showing the percentage of cells with apoptotic nuclei. At least 100 cells per experiment were analyzed from three independent experiments. (C)
Representative immunoblot image depicting upregulation of Bax, observed at various time periods (2, 3, 4 and 6 h) after carbon irradiation (1 Gy).

18 S. Ghosh et al. / Mutation Research 716 (2011) 10–19
Since, with high LET radiation yield of ROS is very low as compared
to low LET radiation [38–40], the early activation of ERK was
not expected with high LET radiation. However, complete absence
of ERK activation even hours after high LET radiation suggests that
repair pathways are neither feeding into nor being fed upon by
intracellular cytoprotective signaling. However, the pro-apoptotic
JNK pathway was found to be activated after high LET radiation.
BRCA1 induced apoptotic responses have also been shown to be
via activation of JNK [41]. Thus, after carbon irradiation, DNA damage
induced activation of repair components are being fed into
by cytotoxic signaling rather than cytoprotective responses and
was evident in the form of early induction of apoptosis (Fig. 8).
Since, cellular decisions are summation of all the activated pathways,
the final response after high LET radiation tips towards
death.
5. Conclusions
In summary, our results suggest that the subtle differences
leading to different outcomes due to radiation quality seem to
lie in different macromolecular complexes of crucial DNA damage
response proteins and activation of other intracellular pathways
in A549 lung adenocarcinoma cell line. Analysis of functionality of
these macromolecular complexes as a whole rather than individual
proteins and holistic study involving intracellular survival pathways
could help in revealing the mechanistic details of complex
DNA damage responses.
Conflict of interest
The authors declare that there are no conflicts of interest.
Acknowledgments
This work was funded by Board of Research in Nuclear Sciences,
Department of Atomic Energy [DAE], Government of India, through
a project sanctioned to one of the authors, A. Sarma, bearing sanction
number 2007/37/37/BRNS. All the authors are thankful to the
Director, IUAC, New Delhi for providing radiation facility for the
work. We would also like to extend our thanks to all the members
of Pelletron group of IUAC and Harminder Kaur, Radiation Biology
Laboratory, IUAC for their sincere help during irradiation. Authors
would like to thank Mr. Manjoor Ali and Mr. Paresh Khadilkar,
RB&HSD, BARC for their help in Confocal Microscopy and Lab work
respectively.
References
[1] F.A. Cucinotta, M. Durante, Cancer risk from exposure to galactic cosmic rays:
implications for space exploration by human beings, Lancet Oncol. 7 (2006)
431–435.
[2] F.A. Cucinotta, H. Wu, M.R. Shavers, K. George, Radiation dosimetry and biophysical
models of space radiation effects, Gravit. Space Biol. Bull. 16 (2003)
11–18.
[3] D.T. Goodhead, The initial physical damage produced by ionizing radiations,
Int. J. Radiat. Biol. 56 (1989) 623–634.
[4] F.A. Cucinotta, H. Nikjoo, D.T. Goodhead, Model for radial dependence of frequency
distributions for energy imparted in nanometer volumes from HZE
particles, Radiat. Res. 153 (2000) 459–468.
[5] E.A. Blakely, A. Kronenberg, Heavy-ion radiobiology: new approaches to delineate
mechanisms underlying enhanced biological effectiveness, Radiat. Res.
150 (1998) S126–S145.
[6] F.A. Cucinotta, R. Katz, J.W. Wilson, Radial distribution of electron spectra from
high-energy ions, Radiat. Environ. Biophys. 37 (1998) 259–265.
[7] B.M. Sutherland, P.V. Bennett, O. Sidorkina, J. Laval, Clustered DNA damages
induced in isolated DNA and in human cells by low doses of ionizing radiation,
Proc. Natl. Acad. Sci. U.S.A. 97 (2000) 103–108.
[8] B. Rydberg, B. Cooper, P.K. Cooper, W.R. Holley, A. Chatterjee, Dose-dependent
misrejoining of radiation-induced DNA double-strand breaks in human fibroblasts:
experimental and theoretical study for high- and low-LET radiation,
Radiat. Res. 163 (2005) 526–534.
[9] D. Schulz-Ertner, A. Nikoghosyan, C. Thilmann, T. Haberer, O. Jakel, C. Karger, G.
Kraft, M. Wannenmacher, J. Debus, Results of carbon ion radiotherapy in 152
patients, Int. J. Radiat. Oncol. Biol. Phys. 58 (2004) 631–640.
[10] T. Miyamoto, N. Yamamoto, H. Nishimura, M. Koto, H. Tsujii, J.E. Mizoe, T.
Kamada, H. Kato, S. Yamada, S. Morita, K. Yoshikawa, S. Kandatsu, T. Fujisawa,
Carbon ion radiotherapy for stage I non-small cell lung cancer, Radiother. Oncol.
66 (2003) 127–140.
[11] S.P. Jackson, Sensing and repairing DNA double-strand breaks, Carcinogenesis
23 (2002) 687–696.
[12] E.P. Rogakou, D.R. Pilch, A.H. Orr, V.S. Ivanova, W.M. Bonner, DNA doublestranded
breaks induce histone H2AX phosphorylation on serine 139, J. Biol.
Chem. 273 (1998) 5858–5868.
[13] O. Fernandez-Capetillo, A. Lee, M. Nussenzweig, A. Nussenzweig, H2AX: the
histone guardian of the genome, DNA Repair (Amst.) 3 (2004) 959–967.
[14] N. Desai, E. Davis, P. O’Neill, M. Durante, F.A. Cucinotta, H. Wu, Immunofluorescence
detection of clustered gamma-H2AX foci induced by HZE-particle
radiation, Radiat. Res. 164 (2005) 518–522.
[15] L.J. Chappell, M.K. Whalen, S. Gurai, A. Ponomarev, F.A. Cucinotta, J.M. Pluth,
Analysis of flow cytometry DNA damage response protein activation kinetics
after exposure to X rays and high-energy iron nuclei, Radiat. Res. 174 (2010)
691–702.
[16] M.K. Whalen, S.K. Gurai, H. Zahed-Kargaran, J.M. Pluth, Specific ATM-mediated
phosphorylation dependent on radiation quality, Radiat. Res. 170 (2008)
353–364.
[17] R. Ugenskiene, K. Prise, M. Folkard, J. Lekki, Z. Stachura, M. Zazula, J. Stachura,
Dose response and kinetics of foci disappearance following exposure to highand
low-LET ionizing radiation, Int. J. Radiat. Biol. 85 (2009) 872–882.
[18] K. Valerie, A. Yacoub, M.P. Hagan, D.T. Curiel, P.B. Fisher, S. Grant, P. Dent,
Radiation-induced cell signaling: inside-out and outside-in, Mol. Cancer Ther.
6 (2007) 789–801.
[19] S.E. Golding, E. Rosenberg, S. Neill, P. Dent, L.F. Povirk, K. Valerie, Extracellular
signal-related kinase positively regulates ataxia telangiectasia mutated,
homologous recombination repair, and the DNA damage response, Cancer Res.
67 (2007) 1046–1053.
[20] K.E. Keating, N. Gueven, D. Watters, H.P. Rodemann, M.F. Lavin, Transcriptional
downregulation of ATM by EGF is defective in ataxia-telangiectasia cells
expressing mutant protein, Oncogene 20 (2001) 4281–4290.
[21] N. Weizman, Y. Shiloh, A. Barzilai, Contribution of the ATM protein to
maintaining cellular homeostasis evidenced by continuous activation of
the AP-1 pathway in ATM-deficient brains, J. Biol. Chem. 278 (2003)
6741–6747.
[22] A. Asaithamby, N. Uematsu, A. Chatterjee, M.D. Story, S. Burma, D.J. Chen, Repair
of HZE-particle-induced DNA double-strand breaks in normal human fibroblasts,
Radiat. Res. 169 (2008) 437–446.
[23] A. Jemal, R. Siegel, E. Ward, Y. Hao, J. Xu, T. Murray, M.J. Thun, Cancer statistics,
CA Cancer J. Clin. 58 (2008) 71–96.
[24] S. Ghosh, N.N. Bhat, S. Santra, R.G. Thomas, S.K. Gupta, R.K. Choudhury, M.
Krishna, Low energy proton beam induces efficient cell killing in A549 lung
adenocarcinoma cells, Cancer Invest. 28 (2010) 615–622.
[25] J.F. Ziegler, M.D. Ziegler, J.P. Biersack, SRIM – The stopping and range of ions in
matter, Nucl. Instrum. Meth. B 268 (2010) 1818–1823.
[26] H. Narang, M. Krishna, Effect of nitric oxide donor and gamma irradiation on
MAPK signaling in murine peritoneal macrophages, J. Cell. Biochem. 103 (2008)
576–587.
[27] W.S. Rasband, ImageJ, U.S. National Institutes of Health, Bethesda, USA,
1997–2006, http://rsb.info.nih.gov/ij/.
[28] K.M. Prise, M. Pinto, H.C. Newman, B.D. Michael, A review of studies of ionizing
radiation-induced double-strand break clustering, Radiat. Res. 156 (2001)
572–576.
[29] F.A. Cucinotta, J.M. Pluth, J.A. Anderson, J.V. Harper, P. O’Neill, Biochemical
kinetics model of DSB repair and induction of gamma-H2AX foci by nonhomologous
end joining, Radiat. Res. 169 (2008) 214–222.
[30] S. Ghosh, H. Narang, A. Sarma, H. Kaur, M. Krishna, Activation of DNA damage
response signaling in lung adenocarcinoma A549 cells following oxygen beam
irradiation, Mutat. Res. 723 (2011) 190–198.
[31] A.L. Ponomarev, S.V. Costes, F.A. Cucinotta, Stochastic properties of radiationinduced
DSB: DSB distributions in large scale chromatin loops the HPRT gene
and within the visible volumes of DNA repair foci, Int. J. Radiat. Biol. 84 (2008)
916–929.
[32] E.R. Foster, J.A. Downs, Histone H2A phosphorylation in DNA double-strand
break repair, FEBS J. 272 (2005) 3231–3240.
[33] N.F. Lowndes, G.W. Toh, DNA repair: the importance of phosphorylating histone
H2AX, Curr. Biol. 15 (2005) R99–R102.
[34] K.H. Karlsson, B. Stenerlow, Focus formation of DNA repair proteins in normal
and repair-deficient cells irradiated with high-LET ions, Radiat. Res. 161 (2004)
517–527.
[35] S.E. Golding, E. Rosenberg, A. Khalil, A. McEwen, M. Holmes, S. Neill, L.F. Povirk,
K. Valerie, Double strand break repair by homologous recombination is regulated
by cell cycle-independent signaling via ATM in human glioma cells, J. Biol.
Chem. 279 (2004) 15402–15410.
[36] A.L. Ponomarev, J. Huff, F.A. Cucinotta, The analysis of the densely populated
patterns of radiation-induced foci by a stochastic, Monte Carlo model of DNA
double-strand breaks induction by heavy ions, Int. J. Radiat. Biol. 86 (2010)
507–515.
[37] C.X. Deng, BRCA1: cell cycle checkpoint genetic instability, DNA damage
response and cancer evolution, Nucleic Acids Res. 34 (2006) 1416–1426.

S. Ghosh et al. / Mutation Research 716 (2011) 10–19 19
[38] A. Kuppermann, Diffusion kinetics in radiation chemistry: an assessment, in:
R.D. Cooper, R.W. Wood (Eds.), Physical Mechanisms in Radiation Biology,
Springfield, Virginia, 1974, pp. 155–183.
[39] D.E. Watt, Absolute biological effectiveness of neutrons and photons, Radiat.
Prot. Dosim. 23 (1988) 63–67.
[40] M. Spotheim-Maurizot, M. Charlier, R. Sabattier, DNA radiolysis by fast neutrons,
Int. J. Radiat. Biol. 57 (1990) 301–313.
[41] S. Lafarge, V. Sylvain, M. Ferrara, Y.J. Bignon, Inhibition of BRCA1 leads to
increased chemoresistance to microtubule-interfering agents, an effect that
involves the JNK pathway, Oncogene 20 (2001) 6597–6606.

Mutation Research 723 (2011) 190–198
Contents lists available at ScienceDirect
Mutation Research/Genetic Toxicology and
Environmental Mutagenesis
j o ur nal homep ag e: www.elsevier.com/locate/gentox
Co mm unit y add re ss: www.elsevier.com/locate/mutres
Activation of DNA damage response signaling in lung adenocarcinoma A549 cells
following oxygen beam irradiation
Somnath Ghosh a,∗ , Himanshi Narang a , Asiti Sarma b , Harminder Kaur b , Malini Krishna a
a Radiation Biology and Health Science Division, Bhabha Atomic Research Centre, Trombay, Mumbai 400085, India
b Radiation Biology Laboratory, Inter University Accelerator Centre, Aruna Asaf Ali Marg, New Delhi 110 067, India
a r t i c l e i n f o
Article history:
Received 1 December 2010
Received in revised form 5 April 2011
Accepted 9 May 2011
Available online 14 May 2011
Keywords:
Oxygen
Gamma
-H2AX
ATM
ATR
a b s t r a c t
Oxygen beams are high linear energy transfer (LET) radiation characterized by higher relative biological
effectiveness than low LET radiation. The aim of the current study was to determine the signaling differences
between - and oxygen ion-irradiation. Activation of various signaling molecules was looked in
A549 lung adenocarcinoma cells irradiated with 2 Gy oxygen, 2 Gy or 6 Gy -radiation. Oxygen beam was
found to be three times more cytotoxic than -radiation. By 4 h there was efficient repair of DNA in A549
cells exposed to 2 Gy or 6 Gy gamma radiation but not in cells exposed to 2 Gy oxygen beam as determined
by -H2AX counting. Number of ATM foci was found to be significantly higher in cells exposed
to 2 Gy oxygen beam. Percentage of cells showing ATR foci were more with gamma however number of
foci per cell were more in case of oxygen beam. Oxygen beam irradiated cells showed phosphorylation of
Chk1, Chk2 and p53. Many apoptotic nuclei were seen by DAPI staining in cells exposed to oxygen beam.
The noteworthy finding of this study is the activation of the sensor proteins, ATM and ATR by oxygen
irradiation and the significant activation of Chk1, Chk2 and p53 only in the oxygen beam irradiated cells.
© 2011 Elsevier B.V. All rights reserved.
1. Introduction
Exposure of mammalian cells to ionizing radiation leads to the
activation of several signaling pathways that result in apoptosis.
Although, the end point, apoptosis is effectively activated by conventional
X-ray treatment, the development of radio resistance
following therapy remains a major cause for concern. Clinicians
are now favoring charged particle therapy to avoid the issue [1–4].
However, the mechanism of cell killing by oxygen beam is not yet
well delineated.
High LET radiations like oxygen have an increased biological
effectiveness compared to X-rays for gene mutation, genomic instability,
and carcinogenesis [5]. This is because charged particle tracks
show a high density of ionizing events along the center of particle
path, resulting in spatially localized energy deposition within
the cellular target. This high relative biological effectiveness has
been imparted to difficult to repair clustered DNA damage that is
generated in cells after high LET irradiation.
Lung cancer is a frequently occurring, mostly lethal disease in
all countries world wide [6]. It is one of the most commonly diagnosed
types of cancer and has the highest death rates [7,8]. Overall,
fewer than 10% of people with primary lung cancer are alive 5
∗ Corresponding author. Tel.: +91 22 2559 0415; fax: +91 22 2550 5151.
E-mail addresses: somnath@barc.gov.in, ghosh.barc@gmail.com (S. Ghosh).
years after diagnosis. Depending on tumor size, location and histology,
several treatment options are available, including surgery and
radiotherapy (RT), both often combined with chemotherapy [9]. A
major problem remains local tumor control [10,11]. Therefore, new
ways to deliver radiotherapy beyond photons have been sought
for, including oxygen and carbon ions [12]. Furthermore, treatment
with charged particle radiation has several potential advantages
over treatment with gamma or X-ray radiation such as the Bragg
peak enables precise localization of the radiation dose, an inverted
depth-dose distribution, a higher relative biological effectiveness
(RBE), and a lower cellular capability for repair of radiation injury.
Because of their superior dose-distribution, a therapeutic gain can
be expected with charged particles [1–4]. Although charged particle
therapies are currently being used for the treatment of many
cancers, the mechanism of cell killing and its variance from gamma
irradiation is not well understood. Understanding the specific biological
effects of charged particle radiation on cancer cells could also
provide valuable insights for the design of novel therapeutic applications
for the treatment of cancers which are resistant to many
types of therapies. Moreover, therapies can be designed only if the
signaling pathway is understood.
ATM (ataxia telangiectasia mutated), a protein kinase, is the
major mediator of DSB responses. The kinase is activated by
autophosphorylation when DSBs are formed and it phosphorylates
a number of proteins involved in the repair and damage signaling
pathways after exposure to ionizing radiation [13,14]. Many
1383-5718/$ – see front matter © 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.mrgentox.2011.05.002

S. Ghosh et al. / Mutation Research 723 (2011) 190–198 191
proteins such as ATM, ATR (ATM and Rad3-related) and H2AX
are part of irradiation-induced foci (IRIF), which are at the core of
DNA damage signaling apparatus [15–17]. These foci contain hundreds
to thousands of proteins and are believed to represent sites
with ongoing repair or to be an indication of a checkpoint mechanism.
All these proteins form foci at different time points after
irradiation. In this study we have looked at the foci at 4 h after irradiation.
This time point was chosen since by this time most of the
repairable damage is repaired and hence the foci formation is no
longer observed if DNA repair has been completed.
In this study, A549 cells were irradiated with either 2 Gy oxygen
beam or 2 Gy and 6 Gy -radiation and ensuing activation of few
important components involved in DNA repair, cell cycle arrest, and
apoptosis pathways were followed to elucidate the mechanisms
behind observed cellular response.
n
Fractio
viving F
Surv
1
0.1
0.01
γ ray
Oxygen
2. Materials and methods
2.1. Cell culture
Human A549 cells were cultured in Dulbecco’s modified eagles medium (Sigma)
supplemented with 10% fetal calf serum (Sigma). Cells were maintained at 37 ◦ C in
humidified atmosphere with 5% CO 2. Cells were seeded at density of 5 × 10 5 cells in
small 35 mm petri plates [NUNC] 24 h before the irradiation.
1E-3
0
1
2
Dose (Gy)
3
2.2. Irradiation of cells
For the experiments, exponentially growing A549 cells were irradiated with
60 Co gamma rays and 16 O ions from 15 UD Pelletron accelerator at the Inter University
Accelerator Centre, New Delhi. During oxygen irradiation, 35 mm petri plates
[NUNC] with cellular monolayers were kept perpendicular to the particle beam coming
out of the exit window. The petri dishes were kept in the serum free medium
in a plexiglass magazine during the irradiation. The computer controlled irradiation
system is such that during the actual irradiation the dish was removed from
medium.
At the cell surface the energy of O ions was 55.8 MeV [LET = 614 keV/m]. Both
the energy and LET were calculated using the Monte Carlo Code SRIM code [18,19].
The corresponding fluence for the dose of 2 Gy was 2.02 × 10 6 particles cm −2 , thus
each cell nuclei can be expected to be physically traversed at least once by oxygen
ion.
Fluence was calculated using the relation given below [20], approximating the
density of cellular matrix as 1.0:
Dose [Gy] = 1.6 × 10 −9 × LET (keV/m) × particle fluence (cm −2 ) × 1 (cm3 /g)
For gamma irradiation, cells were exposed to 1–3 and 6 Gy of 60 Co radiation in
in-house facility Gamma Cell 220 [AECL, Canada] at dose rate of 3 Gy/min and same
experimental conditions were kept as far as possible. In all experiments, controls
were sham irradiated.
Fig. 1. Clonogenic cell survival of A549 cells irradiated with 1, 2 or 3 Gy Oxygen beam
or -radiation. Data represents means ± SD of three independent experiments.
rabbit anti-pChk1 (Ser296), rabbit anti-pChk2 (Thr68) and mouse anti-phosphop53
(S15) (all primary antibodies were from Cell Signaling). Secondary antibodies
used were Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse
IgG (Molecular Probe, USA).
2.5. Image analysis using ImageJ software
The captured images were analyzed for relative quantification of phosphorylation
using ImageJ software [22]. DAPI stained nucleus of each cell was selected and
the same frame was used for relative quantification of phosphorylation using ImageJ
software as described earlier [21]. All the foci were counted manually; at least 100
cells per experiment were analyzed from three independent experiments.
2.6. Statistical analysis
The data were imported to excel work sheets, and graphs were made using
Origin version 5.0. One-way ANOVA with Tukey–Kramer multiple comparisons as
post-test for P < 0.05 used to study the significance level. Data were insignificant at
P > 0.05. Each point represented as mean ± S.D. (standard deviation).
2.3. Clonogenic cell survival assay
After irradiation, clonogenic assay was done as described earlier [21]. Briefly,
after treatment, cells were seeded out in appropriate dilutions (500 cells/60 mm
petriplate) to form colonies in 14 days. Colonies were fixed with glutaraldehyde
(6.0%, v/v), stained with crystal violet (0.5%, w/v) and counted using a stereomicroscope.
Colonies containing more than 50 cells were scored as survivors. Absolute
plating efficiency at 0 Gy (sham irradiated control) was 32.3 ± 2.4%.
2.4. Immunofluorescence staining
Unirradiated and irradiated cells were fixed at different time periods and
immunofluorescence staining was done as described earlier [21]. Briefly, cells were
grown in cover slips which were kept in 35 mm petri plates and irradiated as mentioned
above. Cell layer were washed at different time period after irradiation in PBS
and fixed for 20 min in 4% paraformaldehyde at room temperature. Afterwards, the
cells were washed twice in PBS. For immunofluorescence staining, cells were permeabilized
for 3 min in 0.25% Triton X-100 in PBS, washed two times in PBS and blocked
for 1 h with 5% BSA in PBS. Antibodies were diluted (1:200) in 1% BSA in PBS. Cells
were incubated with primary antibodies for 1 h 30 min at room temperature, washed
three times in PBS and incubated with secondary antibodies for 1 h at room temperature.
Finally, cells were rinsed and mounted with ProLong Gold antifede with DAPI
mounting media (Molecular Probe, USA). Images were captured using Carl Zeiss confocal
microscope. Acquisition settings were optimized to obtain maximal signal in
immunostained cells with minimal background. The primary antibodies used were
mouse anti-pATM (S1981), rabbit anti-pATR (Ser428), rabbit anti--H2AX (S139),
3. Results and discussion
3.1. Oxygen ions were three times more cytotoxic than gamma
To determine the sensitivity of cells to similar dose of high and
low LET radiation, their ability to form colonies after irradiation
was observed. Irradiation of exponentially growing A549 cells with
equal doses of gamma and oxygen beam (614 keV/m) revealed
that at same dose oxygen ions were much more cytotoxic than
gamma rays as assessed by the clonogenic cell survival assay. The
calculated RBE (relative biological effectiveness) for A549 cells irradiated
with 1 Gy oxygen ions particles relative to rays was found
to be nearly 3 at 20% survival. Thus, oxygen ions were found to be
three times more toxic than gamma rays (Fig. 1). The calculated
D 0 value from the plot curve for A549 cells was found to be 0.6 Gy
for oxygen ions and 2.5 Gy for rays. Our results therefore further
support previous studies where high LET oxygen beam have been
found to be much more efficient in killing the tumor cells and hence
may be a preferred mode of treatment for radio resistant tumors.
However, mechanisms of cell death caused by oxygen treatment
and the signaling pathways that ensue have not yet been investi-

192 S. Ghosh et al. / Mutation Research 723 (2011) 190–198
Fig. 2. Phosphorylation of H2AX (-H2AX) at different time points after exposure to 2 Gy and 6 Gy gamma or 2 Gy oxygen irradiation in A549 cells. Representative image
showing -H2AX foci (A) 15 min and (B) 4 h after irradiation. Each phospho-H2AX antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and
cells were mounted with ProLong Gold antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (C) Graph
represents average numbers of foci per cell, percentage of cells showing the foci is marked above the bars. (D) Graph represents relative intensity of -H2AX as determined
by ImageJ software. At least 100 cells per experiment were analyzed from three independent experiments. Data represents means ± SD of three independent experiments;
significantly different from unirradiated controls: *P < 0.05, **P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the web
version of this article.)
gated in detail although heavy ion beam therapy is in use for many
cancers [1–4].
3.2. Numbers of initial -H2AX foci formed were almost same for
both types of radiation
Since DNA double strand breaks are the primary toxic lesions
induced by radiation, the number of DSBs were scored by examining
the foci of phosphorylated H2AX in irradiated cells. It has been
established recently that H2AX at the DNA DSB sites is immediately
phosphorylated upon irradiation, and the phosphorylated H2AX
(-H2AX) can be visualized in situ by immunostaining with a -
H2AX specific antibody [23,24]. -H2AX induction can be measured
quantitatively at physiological doses, and the numbers of residual
-H2AX foci can be used to estimate the kinetics of DSB rejoining.
This has become the gold standard for the detection of DSB [16,23].
After 15 min of either radiation, -H2AX foci, visualized as bright
spots, were present in all the cells. The average numbers of foci after
15 min of 2 Gy gamma irradiation were 24 ± 5, while after 2 Gy oxygen
irradiation; the foci were 28 ± 4.7 (Fig. 2(A and C)). Our result
on -H2AX foci detected in cells irradiated with 2 Gy oxygen ion is
contradictory to the fact that number of ion that hits on nucleus and
number of -H2AX foci formed agrees well in heavy-ion irradiated
cells, because heavy-ion densely deposits energy along their trajectories.
Calculating from LET of oxygen ion, it is estimated that the
number of ion hit on each cell nucleus by irradiation of 2 Gy oxygen
ions was approximately 3 particles. However, nearly 10 times of foci
were detected in the cells irradiated with 2 Gy of oxygen ions. This
discrepancy between observed -H2AX foci and estimated -H2AX
foci after high LET radiation has also been reported previously [25].
Thus unlike the cell survival, the difference in induction of -H2AX
foci 15 min after 2 Gy of either radiation was not as profound. We
looked at activation of signaling molecules at dose of 2 Gy of gamma
radiation because the initial response manifested as double strand
breaks, as indicated by -H2AX foci was found to be almost same
at 2 Gy of either radiation. Since the RBE of oxygen ions was nearly
3, it would be more logical to compare 2 Gy of oxygen ion with 6 Gy
of gamma ray. The average numbers of foci after 15 min of 6 Gy
gamma irradiation were 35 ± 3.5. Thus, 6 Gy gamma ray induced
1.25 times more foci than 2 Gy oxygen ions. The cell irradiated with

S. Ghosh et al. / Mutation Research 723 (2011) 190–198 193
Fig. 3. Phosphorylation of ATM at 4 h after exposure to 2 Gy and 6 Gy gamma or 2 Gy oxygen irradiation in A549 cells. (A) Representative image showing p-ATM foci 4 h
after irradiation. Each phospho-ATM antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold
antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per
cell, percentage of cells showing the foci is marked above the bars. (C) Graph represents relative intensity of p-ATM as determined by ImageJ software. At least 100 cells per
experiment were analyzed from three independent experiments. Data represents means ± SD of three independent experiments; significantly different from unirradiated
controls: *P < 0.05, **P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
6 Gy of gamma-ray exhibited more -H2AX foci than 2 Gy gammaray
sample. However the increased ratio is only 1.45, and far from
3. This result is contradictory to the fact that induction of DNA double
strand break is physical process, not biological process. Thus
it is expected to increase in proportion with irradiated physical
dose if the source of radiation is same. We have used immunofluorescent
staining assay for -H2AX, one of the limitation of this
assay is the exposures of cells higher than 4 Gy result in foci saturation,
reducing the useful range of the assay to doses less than 4 Gy.
However, major advantage of this assay, it is more sensitive than
other methods for detecting -H2AX [26]. Many downstream signaling
molecules are known to get activated from these irradiation
induced -H2AX foci [27].
The -H2AX foci were also counted 4 h after irradiation to compare
the repair status at that time with respect to radiation quality.
53% of 2 Gy gamma irradiated cells still showed -H2AX foci but the
average foci per cell had reduced to only 4.3 ± 2.2, where as 100% of
6 Gy gamma irradiated cells showed -H2AX foci and the average
foci per cell had reduced to only 8 ± 2.5. In oxygen ion irradiated
cells, although bright green -H2AX intensity was observed till 4 h
in 60% of cells, there was a significant reduction in appearance of
distinct foci like structures (10 ± 2) (Fig. 2(B and C)). Disappearance
of -H2AX foci indicates DNA repair/rejoining. Instead of counting
number of foci, the intensity of -H2AX in cells showing the foci was
estimated by ImageJ software in the same images. In case of 2 Gy
or 6 Gy gamma irradiation, both -H2AX foci and its total intensity
levels had reduced at 4 h (Fig. 2(D)). However, in case of oxygen
irradiation, the total intensity of -H2AX at 4 h was yet very high
(Fig. 2(D)) though foci were not properly visible. This could indicate
diffusion of -H2AX foci rather than its disappearance due to actual
dephosphorylation of -H2AX. Presence of -H2AX even 4 h after
oxygen ion irradiation suggests that DNA had not been repaired.
Similar number of -H2AX at 15 min after irradiation irrespective
of the radiation quality indicated that initial events might
not differ much with the radiation quality. Activation of other
molecules involved in DNA damage response was therefore fol-

194 S. Ghosh et al. / Mutation Research 723 (2011) 190–198
Fig. 4. Phosphorylation of ATR at 4 h after exposure to 2 Gy and 6 Gy gamma or 2 Gy oxygen irradiation in A549 cells. (A) Representative image showing p-ATR foci 4 h after
irradiation. Each phospho-ATR antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with
DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents average numbers of foci per cell, percentage
of cells showing the foci is marked above the bars. (C) Graph represents relative intensity of p-ATR as determined by ImageJ software. At least 100 cells per experiment were
analyzed from three independent experiments. Data represents means ± SD of three independent experiments; significantly different from unirradiated controls: *P < 0.05,
**P < 0.01. Significantly different from 6 Gy gamma: ## P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)
lowed only at later time point of 4 h. Moreover, by this time low
LET induced damage is mostly repaired and the activation of these
factors is reduced to control levels [28] thereby sealing the fate of
the cell. Comparing the activation of these molecules at this time
could therefore give important insight into differences in damage
response signaling with respect to radiation quality. Phosphorylation
of H2AX even at 4 h indicates the presence of large number
of double strand breaks at that time indicating very slow repair in
A549 cells exposed to oxygen beam.
3.3. Radiation induced foci of DNA damage response proteins
ATM and ATR
ATM is an important DNA damage response protein to ionizing
radiation and a part of irradiation induced foci (IRIF). It gets activated
after DNA DSB by phosphorylation at ser 1981 and activates
many key cellular proteins that include H2AX, BRCA1, Chk1/2 and
p53 [14,29]. Phospho ATM foci and intensity were looked at 4 h
after gamma or oxygen irradiation. At 4 h after 2 Gy gamma irradiation,
most of the cells (93%) cells showed ATM foci (5.9 ± 3.7)
as against 25% unirradiated cells (3.4 ± 1.6) (Fig. 3). Like -H2AX
foci, lesser number of ATM foci 4 h after 2 Gy gamma irradiation
indicates that by 4 h most of the repair due to damage by low LET
irradiation would have taken place. 4 h after 6 Gy gamma irradiation,
100% of the cells showed the foci and average ATM foci per
cell were 14.5 ± 6.05. However, at 4 h after oxygen ion irradiation,
100% of the cells still showed the foci and average ATM foci per cell
(18.6 ± 8.7) were higher than gamma irradiation. Total intensity
levels of phospho ATM matched with the number of foci observed
(Fig. 3). ATM is major mediator of DSB response and is involved
in cell cycle arrest, repair and apoptosis. Persistence of significant
pATM foci till 4 h after oxygen ion irradiation indicates the presence
of unrepaired DNA, which is still keeping the damage sensor
protein ATM in activated form. The slower disappearance of pATM

S. Ghosh et al. / Mutation Research 723 (2011) 190–198 195
Fig. 5. Phosphorylation of TP53 at 4 h after exposure to 2 Gy and 6 Gy gamma or 2 Gy oxygen irradiation in A549 cells. (A) Representative image showing p-TP53 4 h after
irradiation. Each phospho-TP53 antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede
with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents relative intensity of p-TP53 as determined
by ImageJ software. At least 100 cells per experiment were analyzed from three independent experiments. Data represents means ± SD of three independent experiments;
significantly different from unirradiated controls: *P < 0.05, **P < 0.01. Significantly different from 6 Gy gamma: # P < 0.05. (For interpretation of the references to colour in this
figure legend, the reader is referred to the web version of this article.)
foci from cells, unlike the -H2AX foci (that was seen in 60% of
oxygen irradiated cells at 4 h), could reflect their different roles in
the repair process with -H2AX foci playing a primary role in activating
downstream pathways and initiating DNA repair while ATM
foci remaining till broken DNA ends are present. Since the cell survival
after 2 Gy oxygen irradiation was only 11%, ATM might be
activating downstream apoptotic responses.
ATR, another PI3 kinase family member, which is known to
respond late to the IR induced damage, was also looked for its
activation at 4 h. After gamma irradiation, average foci per cell
were very less (2.7 ± 0.95 for 2 Gy and 4 ± 1 for 6 Gy) and that
too were visible in only half of the irradiated cells (Fig. 4). On
the other hand, although only 36% of oxygen ion irradiated cells
showed ATR foci, the average foci per cell were (24 ± 14) at least
six times more than that of gamma irradiated cells. Total intensity
levels of phospho ATR matched with the number of foci
observed (Fig. 4). The massive activation of ATR after oxygen
irradiation when compared with gamma (Fig. 4) in 36% of the

196 S. Ghosh et al. / Mutation Research 723 (2011) 190–198
Fig. 6. Phosphorylation of Chk2 at 4 h after exposure to 2 Gy and 6 Gy gamma or 2 Gy oxygen irradiation in A549 cells. (A) Representative image showing p-Chk2 4 h
after irradiation. Each phospho-Chk2 antibody was indirectly labeled with Molecular Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold
antifede with DAPI (blue). All images were captured using Carl Zeiss confocal microscope with the same exposure time. (B) Graph represents relative intensity of p-Chk2
as determined by ImageJ software. (C) Graph represents relative intensity of p-Chk1 as determined by ImageJ software At least 100 cells per experiment were analyzed
from three independent experiments. Data represents means ± SD of three independent experiments; significantly different from unirradiated controls: *P < 0.05, **P < 0.01.
Significantly different from 6 Gy gamma: # P < 0.05. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
cells indicates its specific role in high LET induced complex damage.
3.4. Activation of downstream substrates of ATR and ATM: Chk1,
Chk2 and p53
Increased activation of ATM and ATR in irradiated cells led
us to investigate the activation of further downstream components
including p53, Chk1 and Chk2 which are actual effectors
of the cell cycle arrest or apoptosis [30,31]. There was significantly
higher phosphorylation of p53 at serine 15 in A549
cells that had been exposed to 2 Gy of oxygen beam, but
not after 2 Gy -radiation (Fig. 5). Cells exposed to 6 Gy -
radiation showed marginally higher phosphorylation of p53,
but it was significantly lower than 2 Gy oxygen irradiated
cells (Fig. 5). This along with survival data supports the activation
of p53 dependent apoptotic responses after high LET
radiation.

S. Ghosh et al. / Mutation Research 723 (2011) 190–198 197
Fig. 7. Apoptosis in oxygen irradiated A549 cells. Apoptotic nuclei of A549 cells were visualized and quantified by using DAPI staining, 18 h after 2 Gy and 6 Gy gamma or
2 Gy oxygen irradiation. The percentage of cells with apoptotic nuclei are represented as graph. At least 100 cells per experiment were analyzed from three independent
experiments. Data represents means ± SD of three independent experiments; significantly different from unirradiated controls: *P < 0.05, **P < 0.01. Significantly different
from 6 Gy gamma: # P < 0.05.
Chk2, which is activated by ATM and shares its substrates
including p53, was found to be significantly activated in oxygen
irradiated cells. Activation of Chk2 is critical in regulating cell cycle
arrest and DSB repair. Presence of pChk2 foci in nuclei of oxygen
irradiated cells but not gamma indicates Chk2 as an active player
in high LET radiation induced responses (Fig. 6(A and B)). Both ATM
and Chk2 have been regarded as primary regulators of homologous
recombination repair (HRR) [32,33]. Activation of these kinases
after oxygen irradiation indicates involvement of HRR pathway for
repairing complex damage caused by high LET. It is also reasonable
to suppose that cells would prefer to repair a complex damage
by activating the machinery of HRR, which can take the advantage
of the other strand that may be intact. Contribution of HRR after
high LET radiation had also been shown by previous studies [34].
Immunofluorescence of phospho Chk1, which is a major target of
ATR, was also found to increase in nuclei of oxygen-irradiated cells
but not after 2 Gy -radiation (Fig. 6(C)). Cells exposed to 6 Gy -
radiation showed marginally higher phosphorylation of Chk1, but it
was significantly lower than 2 Gy oxygen irradiated cells (Fig. 6(C)).
Activation of Chk2 and Chk1 after oxygen irradiation also indicates
cell cycle arrest.
3.5. Apoptosis
At 18 h after irradiation, morphological features of DAPI stained
apoptotic nuclei were scored and many apoptotic nuclei were
observed in cells irradiated with 2 Gy oxygen ion and 6 Gy gamma
but not in 2 Gy gamma irradiated cells (Fig. 7). Cells exposed to
2 Gy oxygen ion showed significantly higher apoptotic nuclei than
6 Gy gamma (Fig. 7). The degree of radiation-induced apoptosis has
been shown to correlate with the p53 wild-type status [35]. In addition,
apoptosis is induced when wild-type p53 is transfected into
certain cell lines lacking p53 [36]. Activation of p53 in oxygen irradiated
cells along with observance of apoptotic cells indicates p53
dependent apoptosis in these cells. Despite significant activation
of ATM, ATR, Chk1 and Chk2 in A549 cells exposed to 2 Gy oxygen
beam, DNA was not repaired. This further point to the involvement
of these kinases in activation of apoptotic machinery after high LET
irradiation.
4. Conclusion
From a critical analysis of all the results of the present study,
it will be evident that in general, high LET radiations cause more
severe genomic damage as compared to low LET radiations. The
noteworthy finding of this study is the activation of the sensor
proteins, ATM and ATR by oxygen irradiation and the significant
activation of Chk1, Chk2 and p53 only in the oxygen beam irradiated
cells. These kinases play an important role in repair, cell cycle
arrest and apoptosis. However, only 11% survival after high LET
radiation suggests that most of the damage could not be repaired
and that the persistent activation of these kinases may be a signa-

198 S. Ghosh et al. / Mutation Research 723 (2011) 190–198
ture for activation of apoptotic responses. Further studies in this
direction will reveal the importance of such response.
The use of oxygen beam therapy has definite advantage over
gamma therapy and the understanding of the mechanism of apoptosis
will give the clinician a handle to manipulate therapy for
enhanced cell killing.
Conflict of interest
The authors declare that there are no conflicts of interest.
Acknowledgements
This work was funded by Board of Research in Nuclear Sciences,
Department of Atomic Energy [DAE], Government of India,
through a project sanctioned to one of the authors, AS, bearing sanction
number 2007/37/37/BRNS. All the authors are thankful to the
Director, IUAC, New Delhi for providing radiation facility for the
work. We would also like to extend our thanks to all the members
of Pelletron group of IUAC for their sincere help during irradiation.
Authors would like to thank Mr. Manjoor Ali and Mr. Paresh
Khadilkar, RB&HSD, BARC for their help in Confocal Microscopy and
Lab work, respectively.
References
[1] T. Miyamoto, N. Yamamoto, H. Nishimura, M. Koto, H. Tsujii, J.E. Mizoe, T.
Kamada, H. Kato, S. Yamada, S. Morita, K. Yoshikawa, S. Kandatsu, T. Fujisawa,
Carbon ion radiotherapy for stage I non-small cell lung cancer, Radiother. Oncol.
66 (2003) 127–140.
[2] T. Ogata, T. Teshima, K. Kagawa, Y. Hishikawa, Y. Takahashi, A. Kawaguchi,
Y. Suzumoto, K. Nojima, Y. Furusawa, N. Matsuura, Particle irradiation
suppresses metastatic potential of cancer cells, Cancer Res. 65 (2005)
113–120.
[3] D. Schulz-Ertner, A. Nikoghosyan, C. Thilmann, T. Haberer, O. Jakel, C. Karger, G.
Kraft, M. Wannenmacher, J. Debus, Results of carbon ion radiotherapy in 152
patients, Int. J. Radiat. Oncol. Biol. Phys. 58 (2004) 631–640.
[4] H. Tsuji, H. Ishikawa, T. Yanagi, N. Hirasawa, T. Kamada, J.E. Mizoe, T. Kanai, H.
Tsujii, Y. Ohnishi, Carbon-ion radiotherapy for locally advanced or unfavorably
located choroidal melanoma: a phase I/II dose-escalation study, Int. J. Radiat.
Oncol. Biol. Phys. 67 (2007) 857–862.
[5] M. Durante, F.A. Cucinotta, Heavy ion carcinogenesis and human space exploration,
Nat. Rev. Cancer 8 (2008) 465–472.
[6] K. Shibuya, C.D. Mathers, C. Boschi-Pinto, A.D. Lopez, C.J. Murray, Global and
regional estimates of cancer mortality and incidence by site. II. Results for the
global burden of disease 2000, BMC Cancer 2 (2002) 37.
[7] A. Jemal, R. Siegel, E. Ward, Y. Hao, J. Xu, T. Murray, M.J. Thun, Cancer statistics2008,
CA Cancer J. Clin. 58 (2008) 71–96.
[8] J. Ferlay, P. Autier, M. Boniol, M. Heanue, M. Colombet, P. Boyle, Estimates of
the cancer incidence and mortality in Europe in 2006, Ann. Oncol. 18 (2007)
581–592.
[9] J. Jassem, The role of radiotherapy in lung cancer: where is the evidence?
Radiother. Oncol. 83 (2007) 203–213.
[10] Y.S. Kim, S.M. Yoon, E.K. Choi, B.Y. Yi, J.H. Kim, S.D. Ahn, S.W. Lee, S.S. Shin, J.S.
Lee, C. Suh, S.W. Kim, D.S. Kim, W.S. Kim, H.J. Park, C.I. Park, Phase II study of
radiotherapy with three-dimensional conformal boost concurrent with paclitaxel
and cisplatin for Stage IIIB non-small-cell lung cancer, Int. J. Radiat. Oncol.
Biol. Phys. 62 (2005) 76–81.
[11] D. Farray, N. Mirkovic, K.S. Albain, Multimodality therapy for stage III nonsmall-cell
lung cancer, J. Clin. Oncol. 23 (2005) 3257–3269.
[12] M. Koto, T. Miyamoto, N. Yamamoto, H. Nishimura, S. Yamada, H. Tsujii, Local
control and recurrence of stage I non-small cell lung cancer after carbon ion
radiotherapy, Radiother. Oncol. 71 (2004) 147–156.
[13] T.K. Pandita, H.B. Lieberman, D.S. Lim, S. Dhar, W. Zheng, Y. Taya, M.B. Kastan,
Ionizing radiation activates the ATM kinase throughout the cell cycle, Oncogene
19 (2000) 1386–1391.
[14] M.B. Kastan, D.S. Lim, The many substrates and functions of ATM, Nat. Rev. Mol.
Cell. Biol. 1 (2000) 179–186.
[15] R.S. Maser, K.J. Monsen, B.E. Nelms, J.H. Petrini, hMre11 and hRad50 nuclear foci
are induced during the normal cellular response to DNA double-strand breaks,
Mol. Cell. Biol. 17 (1997) 6087–6096.
[16] O. Fernandez-Capetillo, A. Lee, M. Nussenzweig, A. Nussenzweig, H2AX: the
histone guardian of the genome, DNA Repair (Amst.) 3 (2004) 959–967.
[17] S. Bekker-Jensen, C. Lukas, R. Kitagawa, F. Melander, M.B. Kastan, J. Bartek, J.
Lukas, Spatial organization of the mammalian genome surveillance machinery
in response to DNA strand breaks, J. Cell. Biol. 173 (2006) 195–206.
[18] J.F. Ziegler, The Stopping and Range of Ions in Matter, http://www.srim.org/.
[19] J.F. Ziegler, J.P. Bierserk, U. Littmark, Stopping and Ranges of Ions in Matter,
Pergamon Press, New York, 1985.
[20] G. Kraft, Tumor therapy with heavy charged particles, Prog. Part. Nucl. Phys. 45
(2000) S473–S544.
[21] S. Ghosh, N.N. Bhat, S. Santra, R.G. Thomas, S.K. Gupta, R.K. Choudhury, M.
Krishna, Low energy proton beam induces efficient cell killing in A549 lung
adenocarcinoma cells, Cancer Invest. 28 (2010) 615–622.
[22] W.S. Rasband, J.U.S. Image, National Institutes of Health, Bethesda, USA,
1997–2006, http://rsb.info.nih.gov/ij/.
[23] E.P. Rogakou, D.R. Pilch, A.H. Orr, V.S. Ivanova, W.M. Bonner, DNA doublestranded
breaks induce histone H2AX phosphorylation on serine 139, J. Biol.
Chem. 273 (1998) 5858–5868.
[24] P.L. Olive, J.P. Banath, Phosphorylation of histone H2AX as a measure of
radiosensitivity, Int. J. Radiat. Oncol. Biol. Phys. 58 (2004) 331–335.
[25] A. Asaithamby, N. Uematsu, A. Chatterjee, M.D. Story, S. Burma, D.J. Chen, Repair
of HZE-particle-induced DNA double-strand breaks in normal human fibroblasts,
Radiat. Res. 169 (2008) 437–446.
[26] D. Avondoglio, T. Scott, W.J. Kil, M. Sproull, P.J. Tofilon, K. Camphausen, High
throughput evaluation of gamma-H2AX, Radiat. Oncol. 4 (2009) 31.
[27] T.T. Paull, E.P. Rogakou, V. Yamazaki, C.U. Kirchgessner, M. Gellert, W.M. Bonner,
A critical role for histone H2AX in recruitment of repair factors to nuclear foci
after DNA damage, Curr. Biol. 10 (2000) 886–895.
[28] H. Wang, Z.C. Zeng, T.A. Bui, S.J. DiBiase, W. Qin, F. Xia, S.N. Powell, G. Iliakis, Nonhomologous
end-joining of ionizing radiation-induced DNA double-stranded
breaks in human tumor cells deficient in BRCA1 or BRCA2, Cancer Res. 61 (2001)
270–277.
[29] E.U. Kurz, S.P. Lees-Miller, DNA damage-induced activation of ATM and ATMdependent
signaling pathways, DNA Repair (Amst.) 3 (2004) 889–900.
[30] N.D. Lakin, S.P. Jackson, Regulation of p53 in response to DNA damage, Oncogene
18 (1999) 7644–7655.
[31] T. Rich, R.L. Allen, A.H. Wyllie, Defying death after DNA damage, Nature 407
(2000) 777–783.
[32] J. Zhang, H. Willers, Z. Feng, J.C. Ghosh, S. Kim, D.T. Weaver, J.H. Chung, S.N.
Powell, F. Xia, Chk2 phosphorylation of BRCA1 regulates DNA double-strand
break repair, Mol. Cell. Biol. 24 (2004) 708–718.
[33] S.E. Golding, E. Rosenberg, A. Khalil, A. McEwen, M. Holmes, S. Neill, L.F. Povirk,
K. Valerie, Double strand break repair by homologous recombination is regulated
by cell cycle-independent signaling via ATM in human glioma cells, J. Biol.
Chem. 279 (2004) 15402–15410.
[34] F. Zafar, S.B. Seidler, A. Kronenberg, D. Schild, C. Wiese, Homologous recombination
contributes to the repair of DNA double-strand breaks induced by
high-energy iron ions, Radiat. Res. 173 (2010) 27–39.
[35] P. Fei, E.J. Bernhard, W.S. El-Deiry, Tissue-specific induction of p53 targets in
vivo, Cancer Res. 62 (2002) 7316–7327.
[36] E. Yonish-Rouach, D. Resnitzky, J. Lotem, L. Sachs, A. Kimchi, M. Oren, Wildtype
p53 induces apoptosis of myeloid leukaemic cells that is inhibited by
interleukin-6, Nature 352 (1991) 345–347.

Cancer Investigation, 28:615–622, 2010
ISSN: 0735-7907 print / 1532-4192 online
Copyright c○ Informa Healthcare USA, Inc.
DOI: 10.3109/07357901003630991
ORIGINAL ARTICLE
Cellular and Molecular Biology
Low Energy Proton Beam Induces Efficient Cell
Killing in A549 Lung Adenocarcinoma Cells
Somnath Ghosh, 1 Nagesh N. Bhat, 2 S. Santra, 3 R. G. Thomas, 3 S.K. Gupta, 3 R.K. Choudhury, 3 and Malini Krishna 1
Radiation Biology and Health Sciences Division, 1 Radiological Physics and Advisory Division, 2 Nuclear Physics Division, Bhabha Atomic
Research Centre, Trombay, Mumbai, India 3
Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
ABSTRACT
The aim of the current study was to determine the signaling differences between γ- and
proton beam-irradiations. A549 lung adenocarcinoma cells were irradiated with 2 Gy proton
beam or γ-radiation. Proton beam was found to be more cytotoxic than γ-radiation. Proton
beam-irradiated cells showed phosphorylation of H2AX, ATM, Chk2, and p53. The mechanism
of excessive cell killing in proton beam-irradiated cells was found to be upregulation of Bax
and downregulation of Bcl-2. The noteworthy finding of this study is the biphasic activation of
the sensor proteins, ATM, and DNA-PK and no activation of ATR by proton irradiation.
INTRODUCTION
Exposureof mammalian cells to ionizing radiation leads to
the activation of several signaling pathways that result in apoptosis.
Although, the end point, apoptosis is effectively activated
by conventional X-ray treatment, the development of radioresistance
following therapy remains a major cause for concern.
Clinicians are now favoring proton beam therapy to avoid the
issue (1–6). However, the mechanism of cell killing by proton
beam is not yet well delineated.
Lung cancer is a frequently occurring, mostly lethal disease
in all countries worldwide (7). It is one of the most commonly
diagnosed types of cancer and has the highest death rate (8, 9).
Overall, fewer than 10% of people with primary lung cancer
are alive 5 years after diagnosis. Depending on tumor size, location,
and histology, several treatment options are available,
including surgery and radiotherapy (RT), both often combined
with chemotherapy (10). A major problem remains local tumor
control (11, 12). Therefore, new ways to deliver radiotherapy
beyond photons have been sought for, including protons (13, 14)
Keywords Proton beam, ATM, p53, Bax, Bcl-2
Correspondence to:
Malini Krishna
Radiation Biology and Health Sciences Division
Bhabha Atomic Research Centre
Trombay, Mumbai
India, 400085
email: malini@barc.gov.in; malinik00@gmail.com
and carbon ions (15). Furthermore, treatment with charged particle
radiation has several potential advantages over treatment
with γ or X-ray radiation such as the Bragg peak enables precise
localization of the radiation dose, an inverted depth-dose
distribution, a higher relative biological effectiveness (RBE),
and a lower cellular capability for repair of radiation injury.
Because of their superior dose distribution, a therapeutic gain
can be expected with charged particles (1–4). Although proton
beams are currently being used for the treatment of many cancers
(1–6), the mechanism of cell killing and its variance from
γ -irradiation is not well understood. Understanding the specific
biological effects of charged particle radiation on cancer cells
could also provide valuable insights for the design of novel
therapeutic applications for the treatment of cancers, which are
resistant to many types of therapies. Moreover, therapies can be
designed only if the signaling pathway is understood.
A cytological manifestation of nuclear activity in response
to ionizing radiation (IR) is the formation of the socalled
IR-induced foci (IRIF) (16). IRIFs are dynamic, microscopically
discernible structures containing thousands of
copies of proteins, including γ H2AX, ataxia telangiectasia
mutated (ATM), BRCA1, 53BP1, MDC1, RAD51, and the
MRE11/RAD50/NBS1 (MRN) complex, which accumulate in
the vicinity of a DNA double-strand breaks (DSB) (17, 18). It is
being appreciated lately that DNA repair pathways activated by
charged particle radiation might be different from those studied
after γ -irradiation.
When exposed to ionizing radiation, eukaryotic cells also
activate checkpoint pathways to delay the progression of the
615

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
cell cycle. In case of charged particle irradiation a prolonged to the primary beam, after the gold foil, served as a monitor
cell cycle arrest (19) and a slower rejoining of DSB have been detector. The ratio of the monitor detector counts to that of the
reported to occur (20).
flux measured using SSB detector at the sample position was
Apart from DNA repair pathways, ionizing radiation leads to measured by multiple trials and the calibration factor was obtained.
Monitor detector counts and the measured ratio were
activation of intracellular signaling pathways that play an important
role in cellular decisions of death or survival. Although used for delivering the required fluence to the samples. Flux
a fair amount of literature exists for the activation of signaling was calculated to be 10 8 and the fluence was kept such that each
pathway after charged particle irradiation, there has been no cell is hit by at least 100 proton particles ensuring that bystander
systematic comparison of photon and proton beam irradiation. effect is kept to minimum. Fluence was then used to calculate
In this study, A549 cells were irradiated with either 2 Gy dose with the help of specific ionization curve constructed for
proton beam- or 2 Gy γ -radiation and ensuing activation of few the given energy distribution and composition of the cell line.
important components involved in DNA repair, cell cycle arrest, The average energy of the proton beam used in this study was
and apoptosis pathways were followed to elucidate the mechanisms
behind observed cellular response. Despite the variability 12.5 keV/µm within the cell layer. Initial portion of Bragg’s
measured to be 3.2 MeV and corresponding estimated LET is
in effectiveness of these two radiations, equal doses of each were curve was used for dose estimation since the cell layer used for
chosen to ensure that each cell is hit by proton beam and no bystander
effects are manifested. Essentially all biological differ-
10 µm, which helped to avoid steep increase in LET within the
irradiation was in monolayer geometry with thickness less than
ences between proton and γ -radiations arise from differences sample.
in their ionization tracks. Equitoxic doses were not preferred The cells were grown in monolayer geometry on 35 mm
because the probability of unhit cells would increase. How this petri dishes. Media was removed and petri dishes were mounted
qualitative difference of radiation is translated into activation of on the exit window vertically for the irradiation, after which
crucial intracellular pathways was the focus of the study. Only they were resupplemented with the medium. On an average
one cell line was chosen in this study because the response of samples were irradiated for 1 min to get the required fluence. The
different cell lines is different to proton irradiation (21). cells were exposed to 2 Gy dose with the help of monitor detector
counts.
MATERIALS AND METHODS
Cell culture
Clonogenic cell survival assay
After treatment, cells were seeded out in appropriate dilutions
(500 cells/60 mm petriplate) to form colonies in 14 days.
Human A549 cells were cultured in Dulbecco’s modified eagles
medium (Sigma) supplemented with 10% fetal calf serum
(Sigma). Cells were maintained at 37 ◦ Colonies were fixed with glutaraldehyde (6.0% v/v), stained
C in humidified atmosphere
with 5% CO 2 . Cells were seeded at density of 5 × 10 5 with crystal violet (0.5% w/v) and counted using a stereomicroscope.
Colonies containing more than 50 cells were scored as
cells in small 35 mm petri dishes 24 hr before the irradiation.
survivors. Absolute plating efficiency at 0 Gy (sham irradiated
control) was 32.3 ± 2.4%
Treatment of cells
Irradiation
Semiquantitative reverse transcriptional
For γ -irradiation, cells were exposed to 2 Gy of 60 Co γ -
polymerase chain reaction (RT-PCR)
radiation in in-house facility Gamma Cell 220 at dose rate of
3 Gy/min.
Total RNA from A549 cells (1 × 10 6 cells) was extracted after
Proton beam irradiation was carried out using the Radiation required time periods of irradiation and RT-PCR was carried out
Biology beam line of in-house 4 MeV Folded Tandem Ion Accelerator
(FOTIA) facility. The primary proton beam from the was extracted after required time periods of 1, 2, 3, and 4 hr of
as described earlier (22). Breifly, total RNA from A549 cells
FOTIA was collimated using an adjustable slit to reduce the irradiation and eluted in 30 µL RNAase free water using RNA
fluence and then diffused using a gold foil. The diffused beam tissue kit (Roche). Equal amount of RNA in each group was
was channeled to the exit window made of 20 µm titanium foil reverse transcribed using cMaster RT kit (Eppendorf). Equal
of 3-cm diameter to get uniformly distributed irradiation area. amount (2 µL) of cDNA in each group was used for specific
The samples were thus irradiated under normal atmospheric amplification of β-actin, ATM, DNA-PK, ATR, Chk1, Chk2,
pressure at 24 ◦ C. The target to be irradiated was positioned at a Bcl-2, or Bax gene using gene specific primers (Table 1). The
distance of 11 mm from the exit window, that being the closest PCR condition were 94 ◦ C, 5 min initial denaturation followed
possible place to mount the target. Before the irradiation, a silicon
surface barrier (SSB) detector was positioned at the same annealing temperature of specific primers given in Table 1),
by 30 cycles of 94 ◦ C 45 s, 55–64 ◦ C 45 s (depending on the
position where samples were irradiated and the beam energy 72 ◦ C 45 s and final extension at 72 ◦ C for 10 min. Equal amount
as well as the uniformity was measured. Another SSB detector of each PCR product (10 µL) was run on 1.5% agarose gel
placed inside the scattering chamber at a forward angle of 40 ◦ containing ethidium bromide in tris borate EDTA buffer at 60 V.
616 S. Ghosh et al.

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
Table 1. The Sequences of Gene Specific Primers and Their
Annealing Temperature (Tm) Used in RT-PCR Experiments
Gene Primer Sequence Tm ( ◦ C)
β-actin F 5 ′ -TGGAATCCTGTGGCATCCATGAAA-3 ′ 55
R5 ′ -TAAAACGCAGCTCAGTAACAGTCCG-3 ′
ATM F 5 ′ -GGACAGTGGAGGCACAAAAT-3 ′ 57
R5 ′ -GTGTCGAAGACAGCTGGTGA-3 ′
ATR F 5 ′ -CTCGCTGAACTGTACGTGGA-3 ′ 57
R5 ′ -GCATAGCTCGACCATGGATT-3 ′
DNA-PK F 5 ′ -TGCCAATCCAGCAGTCATTA-3 ′ 64
R5 ′ -GGTCCATCAGGCACTTCACT-3 ′
Chk2 F 5 ′ -GGCTTCAGGATGAAGACATGA-3 ′ 64
R5 ′ -CACAACACAGCAGCACACAC-3 ′
Chk1 F 5 ′ -TGTCAGAGTCTCCCAGTGGA-3 ′ 59
R5 ′ -AGGGGCTGGTATCCCATAAG-3 ′
Bax F 5 ′ -TCCCCCCGAGAGGTCTTT-3 ′ 56
R5 ′ -CGGCCCCAGTTGAAGTTG-3 ′
Bcl-2 F 5 ′ -GAGGATTGTGGCCTTCTTTG-3 ′ 59
R5 ′ -ACAGTTCCACAAAGGCATCC-3 ′
F indicates forward and R indicates reverse.
The bands in the gel were visualized under UV lamp and relative
intensities were quantified using Gel doc software (Syngene).
Immunofluorescence staining
Cells were grown in cover slips that were kept in 35 mm
petri dishes and irradiated as mentioned above. Cell layers were
washed 4 h after irradiation in PBS and fixed for 20 min in 4%
paraformaldehyde at room temperature. Afterward, the cells
were washed twice in PBS. For immunofluorescence staining,
cells were permeabilized for 3 min in 0.25% Triton X-100 in
PBS, washed two times in PBS, and blocked for 1 hr with 5%
BSA in PBS. Antibodies were diluted (1:200) in 1% BSA in
PBS. Cells were incubated with primary antibodies for 1 hr
30 min at room temperature, washed three times in PBS, and
incubated with secondary antibodies for 1 hr at room temperature.
Finally, cells were rinsed and mounted with ProLong
Gold antifede with DAPI mounting media (Molecular Probe,
USA). Images were captured using Carl Zeiss confocal microscope.
Acquisition settings were optimized to obtain maximal
signal in immunostained cells with minimal background. The
primary antibodies used were mouse anti-pATM (S1981), rabbit
anti-γ -H2AX (S139), rabbit anti-pChk2 (Thr68), and mouse
anti-phospho-p53 (S15) (Cell Signaling). Secondary antibodies
used were Alexa Fluor 488 goat antirabbit IgG and Alexa Fluor
488 goat antimouse IgG (Molecular Probe, USA).
Image analysis using ImageJ software
The captured images were analyzed for relative quantification
of phosphorylation using ImageJ software (23). A 25 × 25
pixel box was positioned over the fluorescent image of each cell,
and the average intensity within the selection (the sum of the
intensities of all the pixels in the selection divided by the number
of pixels) was measured. At least 100 cells per experiment
were analyzed from three independent experiments.
Statistical analysis
The data were imported to excel worksheets, and graphs
were made using Origin version 5.0. One-way ANOVA with
Tukey–Kramer Multiple Comparisons as post-test for p < .05
used to study the significant level. Data were insignificant at
p > .05. Each point represented as mean ± S.E. (standard error
of the mean).
RESULTS
Cell survival assay
There were only 23 ± 2% of A549 cells that survived which
had been exposed to 2 Gy of proton beam where as 56 ± 2.2%
cells were survived which had been exposed to 2 Gy of γ -
radiation as observed with clonogenic assay(Figure 1). This
result clearly showed that proton beam is more cytotoxic than
γ -radiation.
Differential modulation of gene expression
following proton beam and γ-irradiation
Expression of ATM, DNA-PK, and Chk2 genes were significantly
upregulated after 4 hr of irradiation only in A549
cells which had been exposed to proton beam (2 Gy) [Figures
2(A) and (C)], whereas only the ATR gene was significantly
upregulated after 4 hr of irradiation in A549 cells which had
been exposed to γ -radiation (2 Gy) [Figure 2(B)]. There was
no change in the gene expression of Chk1 in A549 cells which
had been exposed to either γ -radiation or proton beam (2 Gy)
[Figures 2(C), and (D)]. Independent experiments were carried
out for γ - and proton beam-irradiated cells, so the control group
of γ - and proton-irradiated cells may have different transcript
level. However, the data were normalized for the respective controls.
Activation of signaling components involved in
DNA damage sensing and repair following
proton beam irradiation
SinceATM protein plays a central role in DNA double-strand
breaks (DSBs) sensing and repair and determines the cellular
Figure 1. Clonogenic Cell Survival of A549 cells irradiated with 2
Gy proton beam or 2 Gy γ-radiation. Data shown from representative
experiment of three independent experiments.
Efficient Cell killing by Proton Beam 617

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
Figure 2. Gene expression of ATM, DNA-PK, ATR, Chk1, and Chk2 in A549 cells irradiated with 2 Gy proton beam or 2 Gy γ-radiation at 2, 3,
or 4 hr after irradiation. Total RNA from A549 cells was isolated and reverse transcribed. RT-PCR analysis of ATM, DNA-PK, ATR, Chk1, and
Chk2 genes was carried out as described in materials and methods. PCR products were resolved on 1.5% agarose gels containing ethidium
bromide. β-actin gene expression in each group was used as an internal control. Ratio of intensities of (A and B) ATM, DNA-PK, or ATR and (C
and D) Chk1 and Chk2 band to that of respective β-actin band as quantified from gel pictures are shown above each gel picture. Con means
unirradiated control. Data represents means ± SE of three independent experiments, significantly different from unirradiated controls. ∗ p < .05,
∗∗ p < .01.
response in eukaryotes (24). It was of interest to look for its
phosphorylation and its substrates at 4 hr after irradiation. There
was significantly higher phosphorylation of ATM at serine 1981,
H2AX at γ -position, Chk2 at threonine 68, and p53 at serine 15
in A549 cells which had been exposed to 2 Gy of proton beam,
but their phosphorylation was not found to be increased 4 hr
after 2 Gy of γ -radiation as compared to the control (Figure 3).
Expression of apoptosis-related genes
Since there was significantly higher phosphorylation of p53
in A549 cells which had been exposed to 2 Gy proton beam
(Figure 3), it was our interest to look for the expression of
apoptosis-related gene like Bax and Bcl-2.
In our study, there was significant upregulation of proapoptotic
gene, Bax, 12 hr after irradiation in A549 cells, which had
been exposed to 2 Gy proton beam as compared to the unirradiated
control. In γ -irradiated (2 Gy) cells there was no significant
upregulation of the Bax gene (p < .05) (Figure 4).
On the other hand there was significant downregulation of
antiapoptotic gene, Bcl-2, 12 hr after irradiation in A549 cells,
which had been exposed to 2 Gy proton beam. However, following
γ -irradiation there was no significant downregulation of
Bcl-2 gene. (p < .05) (Figure 4).
618 S. Ghosh et al.

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
Figure 3. Immunofluorescence staining and Image analysis of γ-H2AX, phospho-ATM, phospho-Chk2, and phospho-p53 4 hr after irradiation in
A549 cells irradiated with 2 Gy proton beam or 2 Gy γ-radiation. Cells were fixed in 4% paraformaldehyde, permeabilized in 0.25% Triton X-100,
and labeled with specific antibodies as described in “Materials and Methods.” Each phospho-site antibody was indirectly labeled with Molecular
Probe 488 secondary antibody (green) and cells were mounted with ProLong Gold antifede with DAPI (blue). All images were captured using
Carl Zeiss confocal microscope with the same exposure time. (A)–(D) shows the comparison of phosphorylation between 2 Gy proton beam
and 2 Gy γ-radiation of [(A) H2AX, (B) ATM, (C) Chk2, (D) p53]. (E) Graph represents relative phosphorylation of H2AX, ATM, Chk2, and p53 as
determined by ImageJ software. At least 100 cells per experiment were analyzed from three independent experiments. Data represents means
± SE of three independent experiments, significantly different from unirradiated controls. ∗ p < .05, ∗∗ p < .01.
Efficient Cell killing by Proton Beam 619

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
Figure 4. Gene expression of Bax and Bcl-2 12 hr after irradiation
in A549 cells irradiated with 2 Gy proton beam or 2 Gy γ-radiation.
Total RNA from A549 cells was isolated and reverse transcribed.
RT-PCR analysis of Bax and Bcl-2 genes was carried out as described
in materials and methods. PCR products were resolved on
1.5% agarose gels containing ethidium bromide. β-actin gene expression
in each group was used as an internal control. Ratio of
intensities of Bax and Bcl-2 band to that of respective β-actin band
as quantified from gel pictures are shown above each gel picture.
Con means unirradiated control, H means proton. Data represents
means ± SE of three independent experiments, significantly different
from unirradiated controls. ∗ p < .05, ∗∗ p < .01.
DISCUSSION
More than two-fold decrease in survival of the A549 cells
as assessed by the clonogenic cell survival assay is indicative
of the fact that the proton beam is more efficient in killing the
tumor cells and may be a more preferred mode of treatment.
The mechanisms of cell death caused by proton treatment and
the signaling pathways that ensue have not yet been investigated
in detail although proton beam therapy is in use for many
cancers (1–6).
The massive activation of DNA-PK and ATM after proton
irradiation when compared with γ [Figures 2, (A) & (B)] was
more or less expected and may be due to the fact that DNA damage
activates phosphatidylinositol 3-kinase-like kinases (DNA-
PK, ATM), which then amplify and channel the signal by activating
downstream kinases (Chk1 and Chk2). These, in turn,
phosphorylate target proteins such as p53, Cdc25A, and Cdc25C
(25) to delay the cell cycle, a process called the DNA damage
checkpoint. In addition to checkpoint control, the downstream
kinases also modulate DNA repair and trigger apoptosis (26).
The lack of activation of ATR after proton irradiation was however
intriguing and was found to be reflecting no activation of
Chk1 (Figure 2).
The phosphorylation of H2AX was found to significantly
increase 4 hr after proton beam irradiation (Figure 3). This
time period of 4 hr was chosen for looking at the activation of
important components involved in repair because by 4 hr after
γ -irradiation most of the repair is complete and the activation of
these factors is reduced to control levels (27). Phosphorylation
of H2AX even at 4 hr indicates the presence of large number
of DSBs at that time indicating very slow repair. It has been
established recently that H2AX at the DNA DSB sites is immediately
phosphorylated upon irradiation, and the phosphorylated
H2AX (γ -H2AX) can be visualized in situ by immunostaining
with a γ -H2AX specific antibody (28, 29). γ -H2AX induction
can be measured quantitatively at physiological doses, and the
numbers of residual γ -H2AX foci can be used to estimate the
kinetics of DSB rejoining. This has become the gold standard
for the detection of DSB (17, 28).
Since ATM protein plays a central DNA DSBs sensing and
repair and determines the cellular response in eukaryotes it was
of interest to look for its phosphorylation at 4 hr after irradiation.
There was significantly higher phosphorylation of ATM at
serine 1981 in A549 cells, which had been exposed to 2 Gy of
proton beam (Figure 3). This indicates that despite significant
activation of ATM till 4 hr after irradiation much of the damage
still persisted as indicated by the presence of significant levels
of γ -H2AX. The activated/phosphorylated ATM further phosphorylates
various downstream target proteins such as H2AX,
Chk2, p53 leading to opening of the chromatin and recruitment
of other proteins involved in DNA repair or cell cycle arrest.
Chk2 which is a another substrate of ATM and is involved in
cell cycle arrest was also found to be phosphorylated at threonine
68 in A549 cells which had been exposed to 2 Gy of proton as
compared to controls (Figure 3), however the activation was not
as intense as observed with ATM or H2AX.
This indicates that small component of ATM activation is also
diverted to cell cycle arrest pathways involving Chk2, CDC25
phosphatase, and CDKs. Chk2 could also be involved in activation
of other proteins such as BRCA1 and p53. Phosphorylation
of p53 at serine 15 was then observed in unirradiated and irradiated
A549 cells at 2 Gy of proton beam (Figure 3).
Whether DNA-PK signals DSBs to the checkpoint machinery
remains controversial, but the emerging consensus is that it does
not (30). DNA-PK may, however, be involved in signalling DNA
damage to the apoptosis machinery (31).
The degree of radiation-induced apoptosis has been shown
to correlate with the p53 wild-type status (32). In addition,
apoptosis is induced when wild-type p53 is transfected into
certain cell lines lacking p53 (33). This indicates that p53 not
only plays a role in regulating the progression through the cell
cycle, it can also induce apoptosis in cells. p53 is not an essential
component of the machinery that carries out apoptosis; however,
620 S. Ghosh et al.

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
it appears to be an activator of apoptosis. Although the exact
means by which p53 activates apoptosis is unclear, evidence
has shown that p53 mediates apoptosis by way of transcriptionindependent
and transcription-dependent mechanisms (34, 35).
p53 is known to regulate the expression of several proteins
involved in the apoptotic pathway and also interacts with BAX,
BCL-XL, and Bcl-2 to exert a direct apoptotic effect at the level
of the mitochondria (36–38).
Increased phosphorylation of p53, upregulation of Bax and
downregulation of Bcl-2 in proton beam irradiated A549 cells
as compared to γ -irradiated cells (Figures 3 and 4) indicate the
activation of apoptotic pathways.
The noteworthy finding of this study is the biphasic activation
of the sensor proteins, ATM, and DNA-PK and no activation
of ATR by proton irradiation and the significant activation
of Chk2 even at the gene level only in the proton beamirradiated
cells (Figure 2). Such biphasic response after irradiation
with proton or other heavy ions has been observed by us
earlier and may be characteristics of particle irradiation (39).
Unlike γ -irradiation, the biphasic induction of ATM and DNA-
PK following proton beam-irradiation could be responsible for
the activation of apoptotic machinery, however, further studies
in this direction will reveal the importance of such biphasic
response.
The use of proton beam therapy has definite advantage over
γ therapy. The mechanism of apoptosis will give the clinician a
handle to manipulate therapy for enhanced cell killing.
DECLARATION OF INTEREST
The authors report no conflicts of interest. The authors alone
are responsible for the content and writing of the paper.
REFERENCES
1. Krengli, M.; Hug, E.B.; Adams, J.A.; Smith, A.R.; Tarbell, N.J.;
Munzenrider, J.E. Proton radiation therapy for retinoblastoma:
comparison of various intraocular tumor locations and beam arrangements.
Int J Radiat Oncol Biol Phys 2005, 61, 583–593.
2. St Clair, W.H.; Adams, J.A.; Bues, M.; Fullerton, B.C.; La Shell,
S.; Kooy, H.M.; Loeffler, J.S.; Tarbell, N.J. Advantage of protons
compared to conventional X-ray or IMRT in the treatment of a
pediatric patient with medulloblastoma. Int J Radiat Oncol Biol
Phys 2004, 58, 727–734.
3. Miralbell, R.; Crowell, C.; Suit, H.D. Potential improvement of three
dimension treatment planning and proton therapy in the outcome
of maxillary sinus cancer. Int J Radiat Oncol Biol Phys 1992, 22,
305–310.
4. Jones, B.; Dale, R.G.; Cárabe-Fernández, A. Charged particle
therapy for cancer: the inheritance of the Cavendish scientists?
Appl Radiat Isot 2009, 67, 371–377.
5. Chang, J.Y.; Zhang, X.; Wang, X.; Kang, Y.; Riley, B.; Bilton, S.;
Mohan, R.; Komaki, R.; Cox, J.D. Significant reduction of normal tissue
dose by proton radiotherapy compared with three-dimensional
conformal or intensity-modulated radiation therapy in Stage I or
Stage III non-small-cell lung cancer. Int J Radiat Oncol Biol Phys
2006, 65, 1087–1096.
6. Fukumitsu, N.; Sugahara, S.; Nakayama, H.; Fukuda, K.; Mizumoto,
M.; Abei, M.; Shoda, J.; Thono, E.; Tsuboi, K.; Tokuuye, K. A
prospective study of hypofractionated proton beam therapy for patients
with hepatocellular carcinoma. Int J Radiat Oncol Biol Phys
2009, 74, 831–836.
7. Shibuya, K.; Mathers, C.D.; Boschi-Pinto, C.; Lopez, A.D.; Murray,
C.J. Global and regional estimates of cancer mortality and incidence
by site: II. Results for the global burden of disease 2000.
BMC Cancer 2002, 2, 37.
8. Jemal, A.; Siegel, R.; Ward, E.; Hao, Y.; Xu, J.; Murray, T.; Thun,
M.J. Cancer statistics, 2008. CA Cancer J Clin 2008, 58, 71–96.
9. Ferlay, J.; Autier, P.; Boniol, M.; Heanue, M.; Colombet, M.; Boyle,
P. Estimates of the cancer incidence and mortality in Europe in
2006. Ann Oncol 2007, 18, 581–592.
10. Jassem J. The role of radiotherapy in lung cancer: where is the
evidence? Radiother Oncol 2007, 83, 203–213.
11. Kim, Y.S.; Yoon, S.M.; Choi, E.K.; Yi, B.Y.; Kim, J.H.; Ahn, S.D.;
Lee, S.W.; Shin, S.S.; Lee, J.S.; Suh, C.; Kim, S.W.; Kim, D.S.;
Kim, W.S.; Park, H.J.; Park, C.I. Phase II study of radiotherapy
with three-dimensional conformal boost concurrent with paclitaxel
and cisplatin for Stage IIIB non-small-cell lung cancer. Int J Radiat
Oncol Biol Phys 2005, 62, 76–81.
12. Farray, D.; Mirkovic, N.; Albain, K.S. Multimodality therapy for stage
III non-small-cell lung cancer. J Clin Oncol 2005, 23, 3257–3269.
13. Bush, D.A.; Slater, J.D.; Bonnet, R.; Cheek, G.A.; Dunbar, R.D.;
Moyers, M.; Slater, J.M. Proton-beam radiotherapy for early-stage
lung cancer. Chest 1999, 116, 1313–1319.
14. Shioyama, Y.; Tokuuye, K.; Okumura, T.; Kagei, K.; Sugahara, S.;
Ohara, K.; Akine, Y.; Ishikawa, S.; Satoh, H.; Sekizawa, K. Clinical
evaluation of proton radiotherapy for non-small-cell lung cancer.
Int J Radiat Oncol Biol Phys 2003; 56: 7–13.
15. Koto, M.; Miyamoto, T.; Yamamoto, N.; Nishimura, H.; Yamada, S.;
Tsujii, H. Local control and recurrence of stage I non-small cell
lung cancer after carbon ion radiotherapy. Radiother Oncol 2004,
71, 147–156.
16. Maser, R.S.; Monsen, K.J.; Nelms, B.E.; Petrini, J.H. hMre11 and
hRad50 nuclear foci are induced during the normal cellular response
to DNA double-strand breaks. Mol Cell Biol 1997, 17,
6087–6096.
17. Fernandez-Capetillo, O.; Lee, A.; Nussenzweig, M.; Nussenzweig,
A. H2AX: the histone guardian of the genome. DNA Repair 2004,
3, 959–967.
18. Bekker-Jensen, S.; Lukas, C.; Kitagawa, R.; Melander, F.; Kastan,
M.B.; Bartek, J.; Lukas, J. Spatial organization of the mammalian
genome surveillance machinery in response to DNA strand breaks.
J Cell Biol 2006, 173, 195–206.
19. Goto, S.; Watanabe, M.; Yatagai, F. Delayed cell cycle progression
in human lymphoblastoid cells after exposure to high-LET radiation
correlates with extremely localized DNA damage. Radiat Res
2002, 158, 678–686.
20. Stenerlow, B.; Hoglund, E.; Carlsson, J.; Blomquist, E. Rejoining
of DNA fragments produced by radiations of different linear energy
transfer. Int J Radiat Biol 2000, 76, 549–557.
21. Lee, K.B.; Lee, J.S.; Park, J.W.; Huh, T.L.; Lee, Y.M. Low energy
proton beam induces tumor cell apoptosis through reactive oxygen
species and activation of caspases. Exp Mol Med 2008, 40,
118–129
22. Ghosh, S.; Maurya, D.K.; Krishna, M. Role of iNOS in bystander
signaling between macrophages and lymphoma cells. Int J Radiat
Oncol Boil Phy 2008, 72, 1567–1574
23. Rasband, W.S. and Image, J.U.S. National Institutes of Health,
Bethesda, USA, http://rsb.info.nih.gov/ij/ (1997–2006).
24. Khanna, K.K.; Lavin, M.F.; Jackson, S.P.; Mulhern, T.D. ATM, a
central controller of cellular responses to DNA damage. Cell Death
Differ 2001, 8(11), 1052–1065.
25. Lakin, N.D.; Jackson, S.P. Regulation of p53 in response to DNA
damage. Oncogene 1999, 18, 7644–7655.
26. Rich, T.; Allen, R.L.; Wyllie, A.H. Defying death after DNA damage.
Nature 2000, 407, 777–783.
Efficient Cell killing by Proton Beam 621

Cancer Invest Downloaded from informahealthcare.com by University of Chicago Library on 06/10/11
For personal use only.
27. Wang, H.; Zeng, Z.C.; Bui, T.A.; DiBiase, S.J.; Qin, W.; Xia,
F.; Powell, S.N.; Iliakis, G. Nonhomologous end-joining of ionizing
radiation-induced DNA double-stranded breaks in human tumor
cells deficient in BRCA1 or BRCA2. Cancer Res 2001, 61,
270–277
28. Rogakou, E.P.; Pilch, D.R.; Orr, A.H.; Ivanova, V.S.; Bonner,
W.M. DNA double-stranded breaks induce histone H2AX phosphorylation
on serine 139. J Biol Chem 1998, 273, 5858–
5868.
29. Olive, P.L.; Banath, J.P. Phosphorylation of histone H2AX as a
measure of radiosensitivity. Int J Radiat Oncol Biol Phys 2004, 58,
331–335.
30. Burma, S.; Kurimasa, A.; Xie, G.; Taya, Y.; Araki, R.; Abe, M.;
Crissman, H.A.; Ouyang, H.; Li, G.C.; Chen, D.J. DNA-dependent
protein kinase-independent activation of p53 in response to DNA
damage. J Biol Chem 1999, 274, 17139–17143.
31. Wang, S.; Guo, M.; Ouyang, H.; Li, X.; Cordon-Cardo, C.; Kurimasa,
A.; Chen, D.J.; Fuks, Z.; Ling, C.C.; Li, G.C. The catalytic
subunit of DNA-dependent protein kinase selectively regulates
p53-dependent apoptosis but not cell-cycle arrest. Proc Natl Acad
Sci USA 2000, 97, 1584–1588.
32. Fei, P.; Bernhard, E.J.; El-Deiry, W.S. Tissue-specific induction of
p53 targets in vivo. Cancer Res 2002, 62, 7316–7327.
33. Yonish-Rouach, E.; Resnitzky, D.; Lotem, J.; Sachs, L.; Kimchi, A.;
Oren, M. Wild-type p53 induces apoptosis of myeloid leukaemic
cells that is inhibited by interleukin-6. Nature 1991, 352, 345–347.
34. Sabbatini, P.; Lin, J.; Levine, A.J.; White, E. Essential role for
p53-mediated transcription in E1A-induced apoptosis. Genes Dev
1995, 9, 2184–2192.
35. Caelles, C.; Helmberg, A.; Karin, M. p53-dependent apoptosis in
the absence of transcriptional activation of p53-target genes. Nature
1994, 370, 220–223.
36. Polyak, K.; Xia, Y.; Zweier, J.L.; Kinzler, K.W.; Vogelstein, B. A
model for p53-induced apoptosis. Nature 1997, 389, 300–305.
37. Mihara, M.; Erster, S.; Zaika, A.; Petrenko, O.; Chittenden, T.; Pancoska,
P.; Moll, U.M. p53 has a direct apoptogenic role at the
mitochondria. Mol Cell 2003, 11, 577–590.
38. Fei, P.; El-Deiry, W.S. p53 and radiation responses. Oncogene
2003, 22, 5774–5783.
39. Mitra, A.K.; Bhat, N.; Sarma, A.; Krishna, M. Alteration in the expression
of signaling parameters following carbon ion irradiation.
Mol Cell Biochem 2005, 276(1–2), 169–173.
622 S. Ghosh et al.

doi:10.1016/j.ijrobp.2008.08.006
Int. J. Radiation Oncology Biol. Phys., Vol. 72, No. 5, pp. 1567–1574, 2008
Copyright Ó 2008 Elsevier Inc.
Printed in the USA. All rights reserved
0360-3016/08/$–see front matter
BIOLOGY CONTRIBUTION
ROLE OF iNOS IN BYSTANDER SIGNALING BETWEEN MACROPHAGES AND
LYMPHOMA CELLS
SOMNATH GHOSH, M.SC.,* DHARMENDRA KUMAR MAURYA, PH.D.,* AND MALINI KRISHNA, PH.D.*
*Radiation Biology and Health Science Division, Bhabha Atomic Research Centre, Mumbai, India
Purpose: The present report describes the bystander effects of radiation between similar and dissimilar cells and
the role of iNOS in such communication.
Materials and Methods: EL-4 and RAW 264.7 cells were exposed to 5 Gy g-irradiation. The medium from irradiated
cells was transferred to unirradiated cells.
Results: Irradiated EL-4 cells as well as those cultured in the presence of medium from g-irradiated EL-4 cells
showed an upregulation of NF-kB, iNOS, p53, and p21/waf1 genes. The directly irradiated and the bystander
EL-4 cells showed an increase in DNA damage, apoptosis, and NO production. Bystander signaling was also found
to exist between RAW 264.7 (macrophage) and EL-4 (lymphoma) cells. Unstimulated or irradiated RAW 264.7
cells did not induce bystander effect in unirradiated EL-4 cells, but LPS stimulated and irradiated RAW 264.7 cells
induced an upregulation of NF-kB and iNOS genes and increased the DNA damage in bystander EL-4 cells. Treatment
of EL-4 or RAW 264.7 cells with L-NAME significantly reduced the induction of gene expression and DNA
damage in the bystander EL-4 cells, whereas treatment with cPTIO only partially reduced the induction of gene
expression and DNA damage in the bystander EL-4 cells.
Conclusions: It was concluded that active iNOS in the irradiated cells was essential for bystander response.
Ó 2008 Elsevier Inc.
Radiation, Bystander signaling, Nuclear factor-kB, iNOS, p53 and p21.
INTRODUCTION
It is now apparent that the target for biologic effects of ionizing
radiation is not solely the irradiated cell, but also the surrounding
cells and tissues. Preliminary evidence indicates
that similar signal transduction pathways are activated in directly
irradiated cells and the bystander cells and contribute to
the induction of bystander DNA damage (1). Many genes
have been shown to be activated in bystander cells (2), but
evidence for genes that are involved in the signaling pathways
is lacking.
Several factors involving soluble growth factors (3, 4), oxidative
metabolites (5), and those that pass through gap junction
(5–7) have been implicated. Among the various
compounds that could transmit the signal from irradiated
cells to bystander cells, nitric oxide (NO), by virtue of its diffusible
nature and long life in vivo is a promising candidate
(8–10). The accumulation of inducible nitric oxide synthase
(iNOS) and the increased activity of constitutive NOS have
been known to be an early signaling event induced by radiation.
Gamma irradiation–induced DNA damage is known to
enhance NO production in lipopolysaccharide (LPS)-stimulated
macrophages (11). It is likely that stimulated and unstimulated
macrophage behave differently where bystander
response is concerned.
Although abscopal effects have been deemed responsible
for retarding the growth of a similar tumors located at a distant
site in the mice (12), their contribution in transferring signals
between dissimilar cells have not been extensively examined.
To validate the presence of abscopal effects in vitro, we have
used two dissimilar cell lines viz. EL-4 cells, a lymphoma cell
line and RAW 264.7 cells, a macrophage cell line. Because
there is extensive intercellular communications between dissimilar
cells during immune responses, the leukocytes and
lymphocytes were deemed suitable candidates to study
bystander effects.
The present report looks at the mechanism of bystander response
in similar cells (EL-4 Vs EL-4 cells) and whether the
state of activation of RAW 264.7 cells affects the bystander
response in dissimilar cells (EL-4 Vs RAW 264.7).
METHODS AND MATERIALS
Cell culture, reagents, and irradiation schedule
Mouse lymphoma cell line, EL-4 and mouse macrophage RAW
264.7 cells were grown in RPMI 1640 (Sigma, St. Louis, Mo),
Reprint requests to: Dr. Malini Krishna, Ph.D., Bhabha Atomic
Research Centre, Radiation Biology and Health Science Division,
Trombay, Mumbai, Mumbai, Maharashtra 400085, India. Tel:
(+91) 22-25593868; Fax: (+91) 22-2550 5151; E-mail: malini@
barc.gov.in
1567
Conflict of interest: none
Received April 25, 2008, and in revised form July 30, 2008.
Accepted for publication Aug 2, 2008.

1568 I. J. Radiation Oncology d Biology d Physics Volume 72, Number 5, 2008
supplemented with 10% fetal calf serum (Sigma, St. Louis, Mo).
Cells were maintained at 37 C in humidified atmosphere with 5%
CO 2 .
EL-4 and RAW 264.7 cells were resuspended in RPMI medium at
a density of 1 10 6 cells/mL and exposed to 5 Gy g irradiation using
Gamma Cell 220 irradiator (Atomic Energy of Canada Ltd), at
a dose rate of 4.74 Gy/min. Medium from irradiated cells was transferred
to unirradiated cells (1 h postirradiation). Some group of
RAW 264.7 cells were stimulated with 500 ng/mL of bacterial
lipopolysaccharide (LPS, Sigma, St. Louis, Mo) for 3 h and then
the medium was replaced before irradiation.
Before designing the experiment, there were two aspects that had
to be taken care of. One was the likelihood that the replacement of
the medium itself caused transient expression of certain signaling
factors and second that the components of the medium, which include
proteins such as growth factors, which are unavoidably exposed
to radiation, contribute to the changes in the bystander cell.
The experimental design, therefore, consisted of the following
sets: (a) control unirradiated cells, (b) g-irradiated cells, (c) EL-4
cells receiving medium from unirradiated EL-4 cells or RAW
264.7 cells or LPS-stimulated RAW 264.7 cells, (d) EL-4 cells receiving
medium from g-irradiated EL-4 cells or irradiated RAW
264.7 cells or LPS-stimulated and irradiated RAW 264.7 cells,
and (e) EL-4 cells receiving g-irradiated medium. The cells (EL-4
and RAW 264.7) were also divided into two groups; one was treated
with 20 mM cPTIO (NO scavenger; Molecular Probe, Invitrogen,
Carlsbad, CA) and the other with 1 mmol L-NAME (NOS inhibitor;
Sigma, St. Louis, MO). L-NAME was washed off after 30 min so
that it is not present in the bystander cells during incubation.
Measurement of DNA damage
DNA damage in all the groups of EL-4 cells after exposure to different
conditioned media was measured after 2 h by alkaline single
cell gel electrophoresis (comet assay) (13).
Semiquantitative reverse transcriptional polymerase chain
reaction
Total RNA from all the groups of EL-4 cells (1 10 6 cells) was
extracted 2 h after exposure to different conditioned media and eluted
in 30 mL RNAase free water using RNA tissue kit (Roche, Mannheim,
Germany). Equal amount of RNA in each group was reverse transcribed
using cMaster RT kit (Eppendorf, Hamburg, Germany).
Equal amount (2 mL) of cDNA in each group was used for specific
amplification of b-actin, NF-kB (p65), iNOS, p21, or p53 gene using
gene specific primers (Table 1). The polymerase chain reaction (PCR)
condition were 94 C, 5 min initial denaturation followed by 30 cycles
of 94 C 45 s, 55–62 C 45 s (depending on the annealing temperature
of specific primers given in Table 1), 72 C 45 s, and final extension at
72 C for 10 min. Equal amount of each PCR product (10 mL) was run
on 1.5% agarose gel containing ethidium bromide in tris borate
EDTA buffer at 60 V. The bands in the gel were visualized under
an ultraviolet lamp and relative intensities were quantified using
Gel doc software (Syngene, Nuffied Road, Cambridge, UK).
NO production in EL-4 cells
All the groups of EL-4 cells after exposure to different conditioned
media were cultured for 24 h. The production of NO in the
culture supernatants was measured by assaying NO 2 – using colorimetric
Griess reaction (14).
Table 1. The sequences of gene specific primers and their
annealing temperature (Tm) used in reverse transcriptasepolymerase
chain reaction experiments
Gene
Primer sequence
Apoptosis in EL-4 cells
Apoptosis in control unirradiated cells, cells exposed to radiation,
and the cells exposed to different conditioned media as mentioned
previously was measured by DNA fragmentation assay (15).
The characterization and quantification of apoptosis was further
confirmed by confocal microscopy (Carl Zeiss, LSM 510 META,
Carl Zeiss Micro Imaging GMBH, Jena, Germany) using an annexin
V/PI-staining kit (Roche, Mannheim, Germany) according to the
manufacturer’s instructions. Five fields of cells for each group
(1,000 cells) were counted to generate apoptotic index. Annexin-V
binds to phosphatidylserine is a marker of early apoptosis
and binding of PI indicates necrosis.
Statistical analysis
The data were imported to Excel work sheets, and graphs were
made using Origin version 5.0. One-way analysis of variance with
Tukey-Kramer multiple comparisons as posttest for p < 0.05 used
to study the significant level. Data were insignificant at p > 0.05.
Each point represented as mean standard error of the mean.
RESULTS
Tm
( C)
55
b-Actin Forward 5 0 -
TGGAATCCTGTGGCATCCATGAAAC-3 0
Reverse 5 0 -
TAAAACGCAGCTCAGTAACAGTCCG-3 0
iNOS Forward 5 0 -CTCTGACAGCCCAGAGTTCC-3 0 62
Reverse 5 0 -AGGCAAAGGAGGAGAAGGAG-3 0
p21 Forward 5 0 -GCCTTAGCCCTCACTCTGTG-3 0 58
Reverse 5 0 -GGTTGGGAGGGGCTTAAATA-3 0
p53 Forward 5 0 -CGGGTGGAAGGAAATTTGTA-3 0 58
Reverse 5 0 -CTTCTGTACGGCGGTCTCTC -3 0
p65 Forward 5 0 -ACAACTGAGCCCATGCTGAT-3 0 50
Reverse 5 0 -GAGAGGTCCATGTCCGCAAT-3 0
Bystander effect in similar cells (EL-4 Vs EL-4)
The expression of NF-kB (p65), iNOS, p53, and p21 genes
were significantly upregulated in irradiated as well as in bystander
cells (Fig. 1 A–D, Lanes 2, 3). However, in the cells
cultured in the presence of only irradiated medium, there was
a marginal upregulation of p53 but no upregulation of p21
(data not shown). The expression of p53 gene in these cells
was significantly lower than irradiated cells as well as bystander
cells.
Because the expressions of iNOS gene was significantly
upregulated in irradiated and bystander cells (Fig. 1B, Lanes
2, 3), it was of interest to look for NO production in these
cells and expectedly NO production was also found to be significantly
enhanced in irradiated and bystander cells (Fig. 2,
Lanes 2, 3).
Damage to cellular DNA, expressed as tail length
(Fig. 3A), percent DNA in tail (Fig. 3B), Olive tail moment
(Fig. 3C) and tail moment (Fig. 3D) was significantly higher
in irradiated EL-4 cells and bystander cells as compared with
the unirradiated control cells (Fig. 3A–D, Lanes 2, 3).

Bystander effect: role of iNOS d S. GHOSH et al. 1569
Fig. 1. Gene expression of inducible nitric oxide synthase (iNOS),
p21, p53, and NF-kB (p65) in EL-4 cells cultured for 2 h in presence
of different conditioned media. Total RNA from EL-4 cells was isolated
and reverse transcribed. Reverse transcriptase-polymerase
chain reaction (PCR) analysis of iNOS, p21, p53, and NF-kB
(p65) genes was carried out as described in materials and methods.
PCR products were resolved on 1.5% agarose gels containing ethidium
bromide. b-Actin gene expression in each group was used as an
internal control. Ratio of intensities of (A) NF-kB (p65), (B) iNOS,
(C) p53, and (D) p21band to that of respective b-actin band as quantified
from gel pictures are shown above each gel picture. Key: Lane
1, control unirradiated EL-4 cells; Lane 2, g irradiated EL-4 cells;
Lane 3, unirradiated EL-4 cells receiving medium from g-irradiated
EL-4 cells. Data represent means SE of three independent experiments;
significantly different from unirradiated controls: *p < 0.05,
**p < 0.01.
There was a clear DNA ladder formation (a hallmark of apoptosis)
in irradiated and bystander EL-4 cells. Apoptosis
was found to be higher in irradiated cells than bystander cells
(Fig. 4, Lanes 2, 3). Apoptosis in irradiated and bystander
EL-4 cells was further confirmed by annexin V/PI assay
(Fig. 5).
EL-4 cells that had received only irradiated medium or
medium from unirradiated control cells did not show any
upregulation of NF-kB and iNOS or NO production or
DNA damage or apoptosis (data not shown).
Bystander effect in dissimilar cells (EL-4 Vs RAW 264.7)
Having confirmed the existence of bystander signaling between
similar cells (EL-4 Vs EL-4), the work was extended to
determine if bystander effects can be demonstrated between
different cell type (RAW 264.7 and EL-4) and whether the
Fig. 2. Nitric oxide (NO) production from EL-4 cells cultured for 24
h in the presence of different conditioned media. The culture supernatant
from each group of EL-4 cells was used for determination of
NO 2 – with Griess reagent. Key: Lane 1, control unirradiated EL-4
cells; Lane 2, g irradiated EL-4 cells; Lane 3, unirradiated EL-4 cells
receiving medium from g irradiated EL-4 cells. Data represent
means SE of three independent experiments; significantly different
from unirradiated controls: *p < 0.05, **p < 0.01.
state of stimulation of macrophages (RAW 264.7) affects bystander
response. The expression of NF-kB was not altered in
EL-4 cells that had received medium from either unstimulated
RAW 264.7 cells or irradiated RAW 264.7 cells, but
the expression of iNOS was downregulated (Fig. 6, Lanes
3, 5). In EL-4 cells that had received medium from LPS stimulated
RAW 264.7 cells there was an upregulation of iNOS
gene (Fig. 6, Lane 4). The expression of both the genes
(NF-kB and iNOS) was significantly upregulated in EL-4
cells that had received medium from LPS stimulated and
irradiated RAW 264.7 cells (Fig. 6, Lane 2).
The EL-4 cells that had received medium from unstimulated
RAW 264.7 cells or LPS-stimulated RAW 264.7 cells
or irradiated RAW 264.7 cells did not show any increase in
DNA damage (Fig. 7, Lanes 3–5). But there was significantly
higher DNA damage in EL-4 cells that had received medium
from LPS stimulated and irradiated RAW 264.7 cells
(p < 0.01) (Fig. 7, Lane, 2).
Effect of L-NAME and cPTIO on Bystander response
Because the expressions of NF-kB and iNOS gene were
significantly upregulated in irradiated and bystander cells
(Fig. 8, Lanes 2, 3), it was of interest to determine what

1570 I. J. Radiation Oncology d Biology d Physics Volume 72, Number 5, 2008
Fig. 3. DNA damage in EL-4 cells cultured for 2 h in presence of
different conditioned media was measured using single-cell gel electrophoresis
(‘‘comet assay’’). (A) Tail length, (B) % DNA in tail, (C)
olive tail moment, and (D) tail moment. Key: Lane 1, control unirradiated
EL-4 cells; Lane 2, g-irradiated EL-4 cells; Lane 3, unirradiated
EL-4 cells receiving medium from g-irradiated EL-4 cells. Data
represent means SE of three independent experiments; significantly
different from unirradiated controls: *p < 0.05, **p < 0.01.
Fig. 4. DNA fragmentation assay of EL-4 cells. EL-4 cells cultured
for 24 h in the presence of different conditioned media. DNAs of
each group of cells were isolated as described in Methods and Materials
section and electrophoresed on 1.8% agarose gel containing
ethidium bromide. Key: Lane M, DNA molecular weight marker;
Lane 1, control unirradiated EL-4 cells; Lane 2, g irradiated EL-4
cells; Lane 3, unirradiated EL-4 cells receiving medium from g-
irradiated EL-4 cells. Data shown from representative experiment
of three independent experiments.
transmits the signal to the bystanding cells. The response was
looked at in the presence of cPTIO or L-NAME. L-NAME
was washed out before irradiation so that the bystander cells
are not exposed to L-NAME, and iNOS is inhibited only in
the irradiated cells. The addition of cPTIO, which scavenges
the NO released in the medium, did not affect the expression
of iNOS gene if the bystanding cell was of same origin, although
NF-kB was somewhat inhibited (Fig. 8, compare
Lanes 5 and 3). The addition of L-NAME, which inhibits
the iNOS in the irradiated cells, completely inhibited the bystander
response in the EL-4 cells (Fig. 8, compare Lanes 4
and 3).
However, both L-NAME and cPTIO inhibited the expression
of NF-kB and iNOS in the bystander EL-4 cells if the
medium was from LPS stimulated and irradiated RAW
264.7 cells (Fig. 8, Lanes 6, 7) (i.e., the cell type was different),
indicating that the bystander response was dependent on
the cells type and the state of stimulation of the irradiated
cells.
DNA damage was significantly higher in irradiated and
bystander cells (Fig. 9, Lanes 2, 3). However, the EL-4 cells
that had received medium either from L-NAME–treated and
irradiated EL-4 cells or from LPS-stimulated, L-NAMEtreated
and irradiated RAW 264.7 cells did not show any increase
in DNA damage (Fig. 9, Lanes 4, 6). Similarly, the EL-
4 cells that had received medium either from cPTIO-treated
and irradiated EL-4 cells or from LPS-stimulated, cPTIOtreated
and irradiated RAW 264.7 cells did not show any increase
in DNA damage (Fig. 9, Lanes 5, 7). Neither L-NAME
nor cPTIO itself had any effect on DNA damage in EL-4 cells
(Fig. 9, Lanes 8, 9).
DISCUSSION
In an attempt to understand bystander signaling, several
studies have been made between the same cell lines (1, 2,
16). However, it is not known whether bystander effect is
extendable to dissimilar cells, particularly those cells that
communicate with each other under physiologic situations
like the macrophages and lymphocytes. In immunology,
there is an immense cross-talk between the lymphocytes
and the macrophages. This could make them more prone to
bystander signaling.

Bystander effect: role of iNOS d S. GHOSH et al. 1571
Fig. 5. Apoptosis assay of control, irradiated, and bystander EL-4 cells by Annexin-PI staining. EL-4 cells cultured for 18 h
in the presence of different conditioned media. The EL-4 cells were stained using an annexin V/PI-staining kit. Characterization
and quantification of apoptosis was done by confocal microscopy. Key: (A) Annexin-V; (B) PI; (C) DAPI; (D)
Merge image of annexin-v, PI, and DAPI. Data represent means SE of three independent experiments; significantly
different from unirradiated controls: **p < 0.01.
There are numerous reports on the activation of signaling
factors in the bystanding cells (1,2). However, not much is
known about the genes that are activated in the bystanding
cells in response to these signals. In our earlier work, we
had shown that NF-kB and p21 levels were elevated in
K562 cells (16). The present study was carried out to investigate
which genes are activated in the bystanding cell and
whether the state of activation of the irradiated cell alters
the bystander response. The study was restricted only to the
genes because, from our experience, even the change of irradiated
medium leads to an activation of NF-kB (16). Additionally,
minor stresses are known to alter the state of
phosphorylation of signaling proteins. Our present results revealed
a significant increase in DNA damage in the bystander
cells, but only in those cells that had received medium from
irradiated cells (Fig. 3). Because the cells treated only with
irradiated medium did not show any DNA damage or NO
production (results not shown), the signals that caused the
damage in the bystander cells must be coming from the irradiated
cells themselves. The expression of cell cycle–related
genes (p53 and p21) was significantly upregulated in bystander
similar cells (Fig. 1C, D, Lane 3). Our results are in
agreement with the work on bystander signaling (1,2). The
first report describing the induction of sister chromatid exchanges
was examined in Chinese hamster ovary cells. Because
Chinese hamster ovary cells contain mutant p53, p53
could not be involved in the bystander induction of sister
chromatid exchanges (17). If the p53 of the bystander cell
is mutated, there should be less DNA repair and in fact
more bystander effect can be seen when assessed in terms
of DNA damage.
A clear cause and effect relationship was established between
DNA damage, gene expression, and cell survival and
was evident in the form of increase apoptosis in bystander
cells (Fig. 4, Lane 3, Fig. 5).
An increased expression of NF-kB gene (p65) could lead
to the activation of iNOS gene because the promoter of the
iNOS gene contains binding sites for NF-kB. NF-kB is
known to be activated by several oxidative stresses including
ionization radiation (18–23). As a consequence of iNOS gene

1572 I. J. Radiation Oncology d Biology d Physics Volume 72, Number 5, 2008
Fig. 6. Gene expression of NF-kB (p65) and iNOS gene in EL-4
cells that had received medium from irradiated RAW 264.7 cells.
EL-4 cells cultured for 2 h in presence of different conditioned media.
b-Actin gene expression in each group was used as an internal
control. Ratio of intensities of NF-kB (p65) and iNOS band to that of
respective b-actin band as quantified from gel pictures are shown
above each gel picture. Key: Lane 1, control EL-4 cells; Lane 2,
EL-4 cells receiving medium from lipopolysaccharide (LPS)-stimulated
(500 ng/mL) and g-irradiated RAW 264.7 cells; Lane 3, EL-4
cells receiving medium from g-irradiated RAW 264.7 cells without
LPS stimulation; Lane 4, EL-4 cells receiving medium from LPSstimulated
RAW 264.7 cells; Lane 5, EL-4 cells receiving medium
from unirradiated RAW 264.7 cells. Data represent means SE of
three independent experiments; significantly different from unirradiated
controls: *p < 0.05, **p < 0.01.
upregulation and increased production of NO, many forms of
reactive nitrogen species would be formed leading to covalent
modification of proteins and the expression of various
other genes (24).
Having confirmed the existence of bystander effect between
similar cells (EL-4 Vs EL-4), the work was extended
to look for the existence of cross-bystander effect between
EL-4 and RAW 264.7 cells (i.e., lymphocytes and macrophages).
There was a significant upregulation of NF-kB and
iNOS genes in EL-4 cells that had received medium from
LPS stimulated and irradiated RAW 264.7 cells (Fig. 6,
Lane 2) and expectedly the DNA damage was also significantly
higher in these cells (Fig. 7, Lane 2). A noteworthy
finding of this study is that the unirradiated EL-4 cells that
had received medium from LPS-stimulated RAW 264.7 cells
also showed upregulation of iNOS gene but not NF-kB gene
(Fig. 6, Lane 4). The LPS treatment of macrophage upregulates
many genes in the macrophage hence their response to
irradiation will be different from unstimulated macrophage.
Another noteworthy finding of this study is that the addition
of medium from nonirradiated RAW 264.7 cells resulted in
significantly decrease in iNOS gene expression in EL-4 cells
Fig. 7. DNA damage in EL-4 cells cultured for 2 h in presence of
different conditioned media was measured using single-cell gel electrophoresis
(‘‘comet assay’’) and expressed as tail length. Key: Lane
1, control EL-4 cells; Lane 2, EL-4 cells receiving medium from
LPS-stimulated (500 ng/mL) and g-irradiated RAW 264.7 cells;
Lane 3, EL-4 cells receiving medium from g irradiated RAW
264.7 cells without lipopolysaccharide stimulation; Lane 4, EL-4
cells receiving medium from LPS-stimulated RAW 264.7 cells;
Lane 5, EL-4 cells receiving medium from unirradiated RAW
264.7 cells. Data represent means SE of three independent; significantly
different from unirradiated controls: *p < 0.01.
relative to the control (Fig. 6, Lane 5). Nonirradiated macrophages
may release some factor that is responsible for down
regulation of iNOS in EL-4 cells. Further studies in this direction
will reveal the nature of the factor. It is clear from these
results that effective cross-bystander effects exists between
these two cell lines only when the RAW 264.7 cells are
both stimulated and irradiated. Other studies have looked at
only the clonogenic survival of dissimilar bystander cells (25).
Numerous studies have implicated extracellular secreted
signaling proteins in mediating the bystander effect (5), but
the strongest contenders have been reactive oxygen and nitrogen
species (26). To investigate what factors are involved in
radiation induced bystander effect, the cells were treated with
either L-NAME (NOS inhibitor) or cPTIO (NO scavenger).
The effect of cPTIO and L-NAME in bystander response
between similar cell (EL-4 Vs EL-4) was different in that
treatment with L-NAME reduces the bystander induction of
NF-kB as well as iNOS gene expression in EL-4 cells receiving
medium from irradiated EL-4 cells (Fig. 8, Lane 4), but
the treatment with cPTIO reduces the bystander induction
of only NF-kB gene expression and not iNOS gene expression
(Fig. 8, Lane 5). These results demonstrate that the activated
NOS in the irradiated cell is essential for gene
expression in the bystanding cell.
The addition of either L-NAME or cPTIO reduces the
bystander induction of NF-kB as well as iNOS gene expression
in EL-4 cells receiving medium from LPS stimulated
and irradiated RAW 264.7 cells (Fig. 8, Lanes 6, 7), indicating
that both activation of iNOS in the irradiated cell and NO
production play a role in cross-bystander effect.

Bystander effect: role of iNOS d S. GHOSH et al. 1573
Fig. 8. Gene expression of NF-kB (p65) and iNOS gene in EL-4
cells that had received medium from irradiated cells. EL-4 cells cultured
for 2 h in presence of different conditioned media. b-Actin
gene expression in each group was used as an internal control. Ratio
of intensities of NF-kB (p65) and inducible nitric oxide synthase
band to that of respective b-actin band as quantified from gel pictures
are shown above each gel picture. Key: Lane 1, control EL-
4 cells; Lane 2, g-irradiated EL-4 cells; Lane 3, EL-4 cells receiving
medium from g-irradiated EL-4 cells; Lane 4, EL-4 cells receiving
medium from L-NAME treated and g-irradiated EL-4 cells; Lane 5,
EL-4 cells receiving medium from cPTIO-treated and g-irradiated
EL-4 cells; Lane 6, EL-4 cells receiving medium from LPS-stimulated
(500 ng/mL), L-NAME treated and g-irradiated RAW 264.7
cells; Lane 7, EL-4 cells receiving medium from lipopolysaccharide-stimulated
(500 ng/mL), cPTIO-treated and g-irradiated
RAW 264.7 cells. Data represent means SE of three independent
experiments; significantly different from unirradiated controls:
*p < 0.05, **p < 0.01.
The treatment with L-NAME or cPTIO also reduces the
bystander induction of DNA damage in EL-4 cells receiving
medium from irradiated EL-4 cells or LPS-stimulated and
LPS-irradiated RAW 264.7 cells (Fig. 9, Lanes 4–7), demonstrating
that NO contributes to the DNA damage in bystander
EL-4 cells. NO is generated endogenously from L-arginine
by inducible NO synthases (27, 28) that can be stimulated
by radiation in mammalian cells (8). It is believed that NO itself
does not induce DNA strand breaks, although one of its
oxidation product, peroxynitrite, is toxic and can cause DNA
Fig. 9. DNA damage in EL-4 cells cultured for 2 h in presence of
different conditioned media was measured using single-cell gel electrophoresis
(‘‘comet assay’’) and expressed as tail length. Key: Lane
1, control EL-4 cells; Lane 2, g-irradiated EL-4 cells; Lane 3, EL-4
cells receiving medium from g-irradiated EL-4 cells; Lane 4, EL-4
cells receiving medium from L-NAME treated and g-irradiated EL-
4 cells; Lane 5, EL-4 cells receiving medium from cPTIO treated
and g-irradiated EL-4 cells; Lane 6, EL-4 cells receiving medium
from lipopolysaccharide (LPS)-stimulated (500 ng/mL), L-
NAME-treated, and g-irradiated RAW 264.7 cells; Lane 7, EL-4
cells receiving medium from LPS-stimulated (500 ng/mL),
cPTIO-treated, and g-irradiated RAW 264.7 cells; Lane 8, EL-4
cells treated with L-NAME; Lane 9, EL-4 cells treated with cPTIO.
Data represent means SE of three independent experiments;
significantly different from unirradiated controls: *p < 0.05,
**p < 0.01.
damage by both attacking deoxyribose and direct oxidation
of purine and pyrimidine (29). Radiation-induced NO has
the possibility of attacking nearby cells within their diffusion
distance of less than 0.5 mm (30, 31). However, because of
their having very short half-lives, they may not be direct contributors
to the cellular damage in the bystander population.
This is confirmed by the fact that inclusion of cPTIO in the
medium only marginally inhibits the bystander response in
similar cells (Fig. 8, Lane 5). Contrarily, it has also been reported
that NO is involved in the bystander responses caused
by the conditioned medium harvested from irradiated cells
(32). Therefore some long-lived bioactive factors downstream
of NO are most likely involved in this bystander
response.
REFERENCES
1. Azzam EI, De Toledo SM, Spitz DR, et al. Oxidative metabolism
modulates signal transduction and micronucleus formation
in bystander cells from alphaparticle- irradiated normal human
fibroblast cultures. Cancer Res 2002;62:5436–5442.
2. Azzam EI, De Toledo SM, Gooding T, et al. Intercellular communication
is involved in the bystander regulation of gene expression
in human cells exposed to very low fluences of
a particles. Radiat Res 1998;150:497–504.
3. Mothersill C, Seymour C. Radiation-induced bystander effects,
carcinogenesis and models. Oncogene 2003;22:7028–7033.
4. Mothersill C, Seymour C. Radiation-induced bystander effects:
Are they good, bad or both? Med Confl Surviv 2005;21:
101–110.
5. Azzam EI, De Toledo SM, Little JB. Oxidative metabolism, gap
junctions and the ionizing radiation-induced bystander effect.
Oncogene 2003;22:7050–7057.

1574 I. J. Radiation Oncology d Biology d Physics Volume 72, Number 5, 2008
6. Hall EJ, Hei TK. Genomic instability and bystander effects induced
by high-LET radiation. Oncogene 2003;22:7034–7042.
7. Prise KM, Folkard M, Michael BD. Bystander responses induced
by low LET radiation. Oncogene 2003;22:7043–7049.
8. Matsumoto H, Hayashi S, Hatashita M, et al. Induction of radioresistance
to accelerated carbon-ion beams in recipient cells by
nitric oxide excreted from irradiated donor cells of human glioblastoma.
Int J Radiat Biol 2000;76:1649–1657.
9. Matsumoto H, Hayashi S, Hatashita M, et al. Induction of radioresistance
by a nitric oxide-mediated bystander effect. Radiat
Res 2001;155:387–396.
10. Shao C, Furusawa Y, Aoki M, et al. Nitric oxide-mediated bystander
effect induced by heavy-ions in human salivary gland
tumour cells. Int J Radiat Biol 2002;78:837–844.
11. Iluki Y, Mizuno S, Goto R. g-irradiation-induced DNA damage
enhance NO production via NF-kB activation in RAW 264.7
cells. Biochim Biophys Acta 2003;1593:159–167.
12. Camphausen K, Moses MA, Menard C, et al. Radiation abscopal
antitumor effect is mediated through p53. Cancer Res 2003;
63:1990–1993.
13. Maurya DK, Adhikari S, Nair CK, et al. DNA protective properties
of vanillin against gamma-radiation under different conditions:
possible mechanisms. Mutat Res 2007;634:69–80.
14. Green LC, Wagner DA, Glogowski J, et al. Analysis of nitrate,
nitrite and [15N] nitrate in biological fluids. Anal Biochem
1982;126:131–138.
15. Jeon SH, Kang MG, Kim YH, et al. A new mouse gene, SRG3,
related to the SWI3 of Saccharomyces cerevisiae, is required for
apoptosis induced by glucocorticoids in a thymoma cell line.
J Exp Med 1997;185:1827–1836.
16. Mitra AK, Krishna M. Radiation-induced bystander effect: activation
of signaling molecules in K562 erythroleukemia cells.
J Cell Biochem 2007;100:991–997.
17. Nagasawa H, Little JB. Induction of sister chromatid exchanges
by extremely low doses of a-particles. Cancer Res 1992;52:
6394–6396.
18. Brach MA, Hass R, Sherman ML, et al. Ionizing radiation induces
expression and binding activity of the nuclear factor
kB. J Clin Invest 1991;88:691–695.
19. Ginn-Pease ME, Whisler RL. Redox signals and NF-kB activation
in T cells. Free Radic Biol Med 1998;25:346–361.
20. Zhou H, Ivanov VN, Lien YC, et al. Mitochondrial function and
nuclear factor-kappa-mediated signaling in radiation induced
bystander effects. Cancer Res 2008;68:2233–2240.
21. Li N, Karin M. Ionizing radiation and short wavelength UV activate
NF-kB through two distinct mechanisms. Proc Natl Acad
Sci U S A 1998;95:13012–13017.
22. Lowenstein CJ, Alley EW, Raval P, et al. Macrophage nitric oxide
synthase gene: two upstream regions mediate induction by
interferon g and lipopolysaccharide. Proc Natl Acad Sci U S A
1993;90:9730–9734.
23. Xie QW, Whisnant R, Nathan C. Promoter of the mouse gene
encoding calcium-independent nitric oxide synthase confers inducibility
by interferon g and bacterial lipopolysaccharide.
J Exp Med 1993;177:1779–1784.
24. Martinez-Ruiz A, Lamas S. Signalling by NO-induced protein
S-nitrosylation and S-glutathionylation: Convergences and divergences.
Cardiovasc Res 2007;75:220–228.
25. Mothersill C, Seymour C. Medium from irradiated human epithelial
cells but not human fibroblasts reduces the clonogenic
survival of unirradiated cells. Int J Radiat Biol 1997;71:
421–427.
26. Kadhim MA, Moore SR, Goodwin EH. Interrelationships
amongst radiation-induced genomic instability, bystander effects,
and the adaptive response. Mutat Res 2004;568:21–32.
27. Maragos CM, Morley D, Wink DA, et al. Complexes of NO
with nucleophiles as agents for the controlled biological release
of nitric oxide: Vasorelaxant effects. J Med Chem 1991;34:
3242–3247.
28. Nathan C. Nitric oxide as a secretory product of mammalian
cells. FASEB J 1992;6:3051–3064.
29. Tamir S, Tannenbaum SR. The role of nitric oxide (NO) in the
carcinogenic process. Biochim Biophys Acta 1996;1288:
F31–F36.
30. Lancaster JR Jr. Diffusion of free nitric oxide. Methods Enzymol
1996;268:31–50.
31. Saran M, Bors W. Signaling by O2- and NO: How far can either
radical, or any specific reaction product, transmit a message under
in vivo conditions? Chem Biol Interact 1994;90:35–45.
32. Shao C, Stewart V, Folkard M, et al. Nitric oxide-mediated signaling
in the bystander response of individually targeted glioma
cells. Cancer Res 2003;63:8437–8442.