PDF Download - Global Researchers Journals

Journal of Animal Science Advances
Isolation of Bordetella Bronchiseptica from Pigs in North
East India
Mazumder Y., Das A., Kar D., Shome B. R., Dutta B. K., Rahman H.
J Anim Sci Adv 2012, 2(4): 396-406
Online version is available on: www.grjournals.com

ISSN: 2251-7219
MAZUMDER ET AL.
Original Article
Isolation of Bordetella Bronchiseptica from Pigs in
North East India
1 Mazumder Y., 2 Das A., 3 Kar D., 4 Shome B. R., 5 Dutta B. K., 6 Rahman H.
1 Principal, Epsilon Institution of Clinical Sciences, 5 th Floor, PVS, Sadan, Kodialbail, Mangalore – 575003, Karnataka, India
2 Department of Biotechnology, Bannari Amman institute of Technology, Sathyamangalam, Erode Disctrict – 638401, Tamil nadu,
India
3 Department of Life Science, Assam University, Durgakona, Silchar – 788011, Assam, India
4 Principal Scientist, Project Directorate on Animal Disease Monitoring and Surveillance (PD_ADMAS), Hebbal, Bengaluru – 560024,
Karnataka, India
5 Department of Ecology & Environmental Science, Assam university, Durgakona, Silchar – 788011, Assam, India
6 Project Directorate on Animal Disease Monitoring and Surveillance (PD_ADMAS), Hebbal, Bengaluru – 560024, Karnataka, India
Abstract
The causes of mortality among pigs and piglets suffering from bronchopneumonia with bleed and curvature
of turbinate bone were investigated from an organized piggery in Meghalaya, India. Out of 90 pigs maintained
at the farm, 57 (63.3%) were affected. Out of 18 post mortem samples and 39 nasal swabs from live pigs
processed for bacterial isolation, 47 (69.1%) yielded the isolation of Bordetella bronchiseptica and 5 (8.78%)
yielded both Bordetella bronchiseptica and Pasteurella multocida. In vitro antibiotic sensitivity revealed more
than 50% (28) isolates resistant to ampicillin, doxycycline, erythromycin, chloramphenicol, gentamicin and
ciprofloxacin. The SEM analysis of infected trachea and lungs showed massive mucus deposition and
destruction of cilia along with attachment of bacteria and total destruction of alveolar wall with deposition of
cellular debris respectively. In Congo red binding test, 42 Bordetella isolates gave strong positive reaction. In
haemagglutination test, all the 47 Bordetella bronchiseptica isolates agglutinated with sheep, rabbit, cattle and
pig RBCs. The Bordetella and Pasteurella isolates were further confirmed by polymerase chain reaction (PCR).
The present study established the involvement of B. bronchiseptica as a possible causative agent in
bronchopneumonia of pigs in Meghalaya based on the isolation of the organisms and their characterization.
Key words: Bronchoneumonia, Bordetella bronchiseptica, SEM, Hemagglutination, PCR
* Corresponding Author: dryahyamazumder@gmail.com
Received on: 02 Mar 2012
Accepted on: 28 Mar 2012
Online Published on: 14 Apr 2012
396 J. Anim. Sci. Adv., 2012, 2(4):396-406

ISOLATION OF BIRDETELLA BRONCHISEPTICA FROM PIGS IN …
Introduction
Pig husbandry and pork consumption in general in
hilly states of northeastern India in particular is very
popular. Since more than 70% of the populations in the
region belong to different tribes having non vegetarian
food habits, the pig production plays a vital and
promising enterprise. Pork and pork products play an
important role in the dietary habits of north east India.
95% of tribal populations of the region are nonvegetarian.
24.63 % of total pig population of India is in
North Eastern states. Around 50% of the country’s pork
is consumed in North Eastern Region alone. However,
pork production in NE states is only 15.15 %. Largely
this difference is attributed to the mortality and
morbidity due to various diseases. Pig rearing is mostly
confined to unorganized sector and economic viability
largely depends upon good scientific management and
prevention of disease. Pig diseases like foot and mouth,
swine fever, piglet diarrhoea due to enteric infections
and respiratory tract infections are commonly
encountered. Morbidity due to the disease has been
found to be very high. The problem remains in almost
every farm with variety of clinical manifestation
depending on the seasonal conditions. The role of
Bordetella bronchiseptica in causing respiratory disease
in pigs have seldom been reported from India except
Shome et al., (2006) in which B. bronchiseptica was
found to be the only cause of mild atrophic rhinitis in
pigs. Chronic respiratory disease which leads to
atrophic rhinitis is an upper respiratory tract disease of
pigs characterized by degeneration and atrophy of nasal
turbinate bones in market weight hogs, leading to
visible distortion and shortening of the snout (Goodnow
R. A., 1980; Hamilton et al., 1996). Both Bordetella
bronchiseptica and Pasteurella multocida are involved
in this disease process. Bordetella bronchiseptica is an
upper respiratory tract pathogen, which infects a wide
variety of host species including domestic, laboratory
and wild animals and may also opportunistically infect
human beings (Goodnow R. A., 1980; Cotter and
Miller, 2001). The present report gives detailed
investigation of pneumonia in pigs from an organized
piggery in Meghalaya based on isolation and
identification, phenotypic characters and detection of
toxin genes by polymerase chain reaction of the
causative organism.
Materials and Methods
History of animals and sample collection
The crosses of New Hampshire and local pigs
of different age groups having symptoms of
anorexia, dyspnoea, oculo–nasal discharge, high
temperature (105 O F), twisting of the snout and
death at later stages were taken as a part of study.
The samples were collected from a piggery in
Meghalaya. The atmospheric temperature and
humidity was recorded between 25-35 O C and 60-
70% respectively with heavy rainfall during that
period. Out of 90 pigs maintained at the farm, 57
(63.3%) were affected including 18 dead animals.
In every case of death, postmortem was performed
within one to two hours duration. All the internal
organs were thoroughly examined and any
macroscopic and gross lesions observed were
recorded. The nasal swabs from infected pigs,
heart blood, lymph node, lungs, and liver samples
collected from dead animals after post-mortem
examination or from the acute cases of nasal
discharge and from healthy piglets (control) during
slaughtering were scientifically processed for
microbiological investigation.
Scanning electron microscopy of trachea and
lung samples
The trachea and lung pieces from infected
animals and normal tissues collected from healthy
pigs and piglets (control) were subjected for
scanning electron microscopy (SEM) analysis. The
SEM was done commercially from Regional
sophisticated instrumentation centre (RSIC) under
North Eastern Hill University (NEHU), Shillong,
Meghalaya. The specimens were observed,
photographed and analysed under the JEOL JSM-
6360 (Tokiyo, Japan) scanning electron
microscope.
Isolation and identification of bacteria
All the samples were inoculated in sterile 10%
sheep blood agar and incubated aerobically for
24hr at 37 O C. Bacterial colonies were purified
based on the size, shape, color and patterns of
haemolysis on blood agar and were subjected to
motility test and Gram’s staining. In addition an
array of biochemical tests namely catalase,
cytochrome oxidase, indole production, hydrogen
sulphide production, nitrate reduction, Simmon’s
citrate utilization, growth in triple sugar iron agar
397 J. Anim. Sci. Adv., 2012, 2(4):396-406

MAZUMDER ET AL.
slants and urease production were performed to
identify isolates as per standard protocol (Holt et
al., 1994).
Congo red binding test
The Congo red binding test was performed
according to standard procedure (Berkhoff and
Vinal, 1986) using 0.03% Congo red dye in
Trypticase Soya Agar (TSA). The cultures were
spot inoculated into the media plates. Intense brick
red colonies after 48 hrs of incubation were
considered as positive. The reading was observed
from 24 – 48 hrs at 37 O C.
Hemagglutination test
Hemagglutination test was carried out using
0.5% RBC suspension in PBS as per Duguid et al.
(1979). Whole blood was collected in sodium
citrate (0.5% concentration [wt/vol]) from sheep,
cattle, goat, pig, rabbit and duck. Blood cells were
washed twice in phosphate buffered saline (PBS)
and suspended to a final concentration of 0.5%.
Overnight grown bacterial cells were harvested by
low speed centrifugation and washed twice in PBS.
0.5% whole cell bacterial suspensions were made
in PBS. Bacterial test suspensions (0.05 ml) were
placed in round-bottom microtiter plates. After
adding an equal volume of erythrocyte suspension
to each well and mixing, the plates were incubated
at 37 O C for one hr before reading was taken.
Further the plates were kept at 4 O C for overnight to
rule out autoagglutination.
Detection of plasmid
One milliliter of bacterial culture grown
overnight aerobically in brain heart infusion broth
at 37 O C was used for the extraction of plasmid
DNA by alkali lysis method (Birnboim and Doly,
1979). The plasmid DNA was finally dissolved in
35µl of TE-RNase (1mg/ml in 10mM trishydrochloric
acid and 1mM ethylenediamine
tetraacetic acid; pH 8.0) solution, electrophoresed
in 0.7% agarose, dissolved in 1X TAE (trisacetate-EDTA;
pH 8.0) buffer and stained with 0.4
µg/ml ethidium bromide. The molecular weight of
the plasmids was determined by comparing with
known DNA ladder (8 DNA / Hind III digest;
GENEI, Bangalore). The plasmid DNA bands were
visualized and photographed in gel doc system
(Image Master® VDS, Pharmacia Biotech,
Sweden).
Detection of BvgAS toxin gene in B.
bronchiseptica by PCR
To identify and study the virulence of the
organism, isolates of B. bronchiseptica were tested
to detect the bvgAS [B. bronchiseptica bvg locus
(transcription regulators of virulence factors) with
bvgA and bvgS genes] toxin gene by PCR .Freshly
grown bacterial colonies from solid media (Bordet
Gengou agar) plates were suspended in 200µl of
Milli-Q water in a microcentrifuge tube, gently
vortexed and boiled for 10 min in a water bath.
Supernatant after centrifugation at 10000g for 5
min was used as a template DNA. The
amplification was carried out in 25µl reaction
volume containing 4mM magnesium chloride,
0.4mM of deoxynucleotide triphosphates (dNTPs),
0.5U of Taq DNA polymerase, 150mM trishydrochlroric
acid, pH 8.5 (Promega, USA),
0.5µM primers and 2.5µl of template DNA. The
PCR reactions were performed in iCycler (BioRad,
USA). After initial denaturation at 94 O C for 4 min,
the amplification cycle had 35 repeats of
denaturation, annealing and extension at 94 O C,
55 O C and 72 O C for 1 min each respectively. Final
extension was done at 72 O C for 10 min. The
specific forward and reverse primer pairs for
bvgAS gene of 600bp were 5’-
gctggaattcatgcgcgtgctca -3’ and 5’-
cgatcttcgcaatgtccag -3’ (Pajuelo et al., 2002), were
commercially synthesized (GENSET, USA). B.
bronchiseptica strain (ATCC ® 4617 TM , procured
from Himedia) was used as positive control .The
PCR amplicons (5µl) were electrophoresed in
1.5% agarose gel in TAE buffer, stained with
ethidium bromide and observed in gel doc system.
Detection of KMT1 gene of Pasteurella
multocida
Freshly grown P. multocida colonies on sheep
blood agar were processed for template DNA
preparation as mentioned above. The specific
forward and reverse primer pairs for KMT1 gene of
460bp were KMT1SPF - 5 / -
GCTGTAAACGAACTCGCCAC-3 / and 5’-
ATCCGCTATTTACCCAGTGG-3 / . The PCR
reaction mix was same as mentioned for B.
398 J. Anim. Sci. Adv., 2012, 2(4):396-406

ISOLATION OF BIRDETELLA BRONCHISEPTICA FROM PIGS IN …
bronchiseptica. The cycling parameters were done
at initial denaturation at 95 O C for 4 min, followed
by 30 cycles of 95 O C for 1 min, 55 O C for 1 min,
and 72 O C for 1min and a final extension at 72 O C
for 10 min. Agarose gel electrophoresis, staining
and visualization of gel were done as mentioned
above.
Results and Discussion
Symptoms and postmortem findings
On the onset of pneumonia and respiratory
symptoms, pigs and piglets were isolated from the
group. All the infected animals exhibited severe
respiratory distress, weakness and anorexia,
decreased appetite, reluctance to move followed by
death within three weeks. Out of 57 animals
showing symptoms, 18(31.57%) died of infection
in a herd of 90 pigs. Postmortem examination of all
the animals showed congestion in the lungs,
occlusion of trachea with mucopurulent discharge
and petechial haemorrhages throughout the
trachea. Focal cocci and haemorrhages on the
surface of lung were also noticed in seven pigs.
However rest other internal organs appeared
apparently healthy.
Scanning electron microscopy analysis
The SEM analysis of trachea from control pig
showed normal and healthy architecture with
smooth surface of lengthy cilia (Fig. 1a). The
trachea from infected animal showed rupture of the
membrane over the entire tracheal epithelia. The
affected cilia were constricted at the transitional
region and were broken off. SEM analysis revealed
that both small and large numbers of B.
bronchiseptica cells became entangled with the
cilia. The infected trachea was also characterized
by the loss of more than 90% of cilial density with
reduction in height. Severe necroses in tracheal cell
wall with the presence of fibrilar and globular
appearance of mucus were also observed in
tracheal layer (Fig.1b-1d). SEM analysis of normal
lungs revealed the septa, alveolar cells and edibular
spaces were arranged smoothly and in an
organized manner with equal lining. In the affected
lungs, clear alveolar damage was seen along with
the deposition of heavy cell debris. SEM analysis
399 J. Anim. Sci. Adv., 2012, 2(4):396-406
also revealed the total destruction of edibular
spaces and connecting septa (Fig. 2a-2c.).
Isolation and identification of Bordetella
bronchiseptica and Pasteurella multocida
On sheep blood agar, bacterial colonies were
found to be very small, light white, round, domed
shape and hemolytic. The colonies increased in
size after 48 hr of incubation. Bacteria were
observed to be gram negative, motile small rods
(Fig. 3), able to grow on MacConkey agar and
positive for citrate, oxidase, catalase, nitrate and
urease, with no reaction at all in the butt of a triple
sugar iron agar slant were identified as B.
bronchiseptica. P. multocida were recovered
especially from nutrient agar supplemented with
10% sheep blood. The colonies were small, round,
watery and non hemolytic. The isolates were gram
negative, nonmotile small rods, unable to grow on
MacConkey agar and positive for oxidase, indole,
nitrate, methyl red but negative for citrate and
urease. Upon detailed bacteriological investigation
from 18 dead animals and 50 nasal swabs from live
ailing pigs, 47 B. bronchiseptica and 5 P.
multocida were isolated and identified. No B.
bronchiseptica or P. multocida were isolated from
healthy (control) animals.
Congo red binding and Hemagglutination
test
Out of 47 B. bronchiseptica isolates, 42
produced intense red coloured colonies after 24 to
48 hours of incubation at 37 o C. Rest 5 isolates
failed to bind Congo red dye and appeared like
pale coloured colonies. The hemagglutinating
reaction of the B. bronchiseptica isolates gave a
strong positive reaction with sheep, rabbit, cattle
and pig RBCs. However the isolates failed to
elucidate any hemagglutination reaction with
RBCs from other animal species (viz, goat and
duck).
Plasmid profiling
Alkali-lysis method of plasmid isolation
resulted in high plasmid yield. The intensity of
plasmids was almost equal in all the isolates as was
evident from the plasmid profiling. All the B.
bronchiseptica isolates showed the presence of

MAZUMDER ET AL.
plasmids. The isolates were having either single or
double plasmids in the molecular range of 25-26
and 14-16 kb (Fig. 4) respectively. Out of forty
seven, twelve (25.53%) of the B. bronchiseptica
isolates harboured single plasmid, whereas thirty
five (74.47%) isolates harboured double plasmids.
The identical 25-26 kb plasmid was found
common in all B. bronchiseptica isolates.
Detection of BvgAS toxin gene in B.
bronchiseptica by PCR
Extraction of DNA by snap-chill method (10
minutes boiling and chilling in crushed ice) turned
out to be an efficient method of DNA template
a
preparation for PCR as the results of this method
was equally good and comparable to that of PCR
employing pure DNA extracted by DNA extraction
kit. The primer pairs used in the PCR analysis
amplified the desired amplicon size from all the 47
B. bronchiseptica isolates. All the B.
bronchiseptica isolates produced an amplicon sizes
of 600 bp and 599bp representing bvgAS (Fig. 5)
genes respectively. Specificity of the primer was
confirmed, as there was no amplification of any
product when DNA templates from Pasteurella
multocida, Staphylococcus aureus, Streptococcus
spp, were used.
b
c
D
Fig. 1: Scanning electron micrograph of trachea. (a) trachea from control pig showing normal
architecture of tracheal epithelium with lengthy wavy cilia. (x7500); (b) tracheal epithelium of
infected pig showing matting and reduction in height of cilia (x 4000). (c) tracheal epithelium
showing colonization of bacteria on abnormal discocyte and matted cilia. (x4500). (d) tracheal
epithelium showing porous surface of epithelial layer with the presence of fibrilar and globular
appearance of mucus. (x4000).
400 J. Anim. Sci. Adv., 2012, 2(4):396-406

ISOLATION OF BIRDETELLA BRONCHISEPTICA FROM PIGS IN …
a
b
c
Fig. 2: Scanning electron micrograph of pig lung. (a): lung from control shows normal architecture
of the alveoli (x 950). (b-c): infected lung showing thickening of the alveolar wall, obliteration of
alveolar lumen with red blood cells, macrophages, fibrin and cellular debris and destruction of
edibular spaces and connecting septa (x 950 and x1500) respectively.
a
b
Fig. 3: Ultra structure of B. bronchiseptica. (a) Scanning electron micrograph showing cluster of
rods at x 6500; (b) Gram’s smear showing small rods at x 1000 under LEICA compound
microscope. Bar range is 2 µm. Acceleration voltage is 20 kv.
401 J. Anim. Sci. Adv., 2012, 2(4):396-406

MAZUMDER ET AL.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M MW (kb)
Fig. 4: Plasmid DNA of B. bronchiseptica isolates; lanes 1-2, 4-9 and 12-15: B. bronchiseptica isolates
showing double plasmids; lanes 3, 10-11: B. bronchiseptica isolates showing single plasmids; Lane M: λ
DNA / Hind III digest molecular weight marker in kilobase (GENEI, Bangalore).
MW (bp) P 2 3 4 5 6 7 8 9 N M MW (bp)
23.1
9.4
6.5
4.3
2.3
2.0
10000
2000
600
500
100
Fig. 5: Detection of BvgAS toxin gene of B. bronchiseptica isolates by PCR. Lane p: Positive control
(ATCC ® 4617), Lanes 2-9: B. bronchiseptica field isolates showing BvgAS toxin (600 bp fragment) gene;
Lane N: Negative control (P. multocida). M: 100 bp DNA ladder mix (MBI Fermentas).
MW (bp) N 1 2 3 4 5 M MW (bp)
10000
2000
460
500
400
100
Fig. 6: Detection of KMT1 toxin gene of P. multocida isolates by PCR. Lane N: Negative control (B.
bronchiseptica); Lane 1: Positive control (Laboratory maintained strain) 2-5: P. multocida isolates showing
KMT1 toxin (460 bp fragment) gene. M: 100 bp DNA ladder mix (MBI Fermentas).
402 J. Anim. Sci. Adv., 2012, 2(4):396-406

ISOLATION OF BIRDETELLA BRONCHISEPTICA FROM PIGS IN …
Detection of KMT1 gene of Pasteurella
multocida
The KMT1 toxin gene of P. multocida was
detected by PCR analysis (Fig. 6). The presence of
this gene fragment proved the isolates as P.
multocida.
B. bronchiseptica is a primary etiologic agent
of swine atrophic rhinitis and primary
bronchopneumonia in piglets. Moderate and severe
outbreaks are of considerable economic
importance because they are often accompanied by
a reduced growth rate and inefficient feed
conversion (De Jong, 1992; Giles, 1992). In the
present study, out of 57 samples processed
comprising 18 postmortem (PM) samples from
trachea and lungs and 39 nasal swabs from live
ailing animals for isolation, 47(82.45%) samples
comprising all the PM samples yielded B.
bronchiseptica and 5(8.78%) samples comprising 2
PM samples yielded both B. bronchiseptica and P.
multocida. Zhao et. al., (2011) reported about the
isolation of 652 B. bronchiseptica isolates from
pigs with respiratory disease and suggested that B .
bronchiseptica infection is highly prevalent in pig
farms in China, and is often accompanied by coinfection
with other bacteria. Shome et al., (2006)
for the first time reported about the involvement of
only B. bronchiseptica in mild atrophic rhinitis in
pigs from Meghalaya, India. Cowart et al. (1989)
reported isolation of B. bronchiseptica from
maximum cases of atrophic rhinitis and rarely
isolated P. multocida. Similarly, Stehmann and
Mehlhorn (1994) reported the involvement of B.
bronchiseptica in atrophic rhinitis but never
Pasteurella multocida. Xin et al., (1997) also
reported an outbreak of an infectious disease,
affecting 3- to 7-week-old piglets and confirmed
the disease condition as bordetellosis based on
epidemiological investigations, clinical signs, PM
examination and pathogen isolation and
identification. Ying et al., (1995) could isolate 661
strains of B. bronchiseptica from 21 pig farms in 6
provinces or cities in China, with a mean positive
detection rate of 61.1% (maximum 93.3%) while
toxin producing P. multocida were also isolated at
an average rate of 9.2%. Yu and Tong (1995)
reported about the outbreak of infectious atrophic
rhinitis wherein two bacteria were isolated and
identified as B. bronchiseptica and P. multocida.
In in-vitro antibiotic sensitivity, more than 50%
isolates exhibited resistance to ampicillin,
doxycycline, erythromycin, chloramphenicol,
gentamicin and ciprofloxacin. Similarly, Wettstein
and Frey (2004) reported 59% B. bronchiseptica
isolated from different animal species suffering
from respiratory tract diseases resistant to
ampicillin. The high resistance of B.
bronchiseptica was reported for ciprofloxacin,
gentamicin, amikacin, kanamycin and tobramycin
with sensitivity to chloramphenicol and
tetracycline (Cho and Cho, 1998). In another
report, 98.6% of the B. bronchiseptica isolates out
of 243 isolates were susceptible to florfenicol
(Shin et. al., 2005). In the present study 42 isolates
were CR positive while 5 showed negative
reaction. In B. bronchiseptica the dye affinity
correlates to the expression of virulence factors
regulated by the bvgAS locus (ward et al., 1992). A
solid medium supplemented with CR has been
described for the phenotype characterization; in
this medium, the Bvg + strains bind the dye and
produce red colonies while the Bvg - strains
produce pale colonies (Parton, 1988). From the
present results, it is clearly seen that the isolates
are divided in both Bvg+ (89.36%) and Bvg -
(10.63%) phases. This suggests the virulence
nature of the isolates. Friedman et al., (2001)
showed that Congo red binding and urease activity
assays are useful for selection of virulent (Bvg + )
Bordetella bronchiseptica cultures.
The ability of Bordetella bronchiseptica in
agglutinating erythrocytes has been recognized
since the early reports of Keogh et al. (1947). Most
clinical isolates of B. bronchiseptica possess pilli,
agglutinate sheep RBCs and attach to respiratory
epithelial cells, as a first step in establishing
infection. An association of adhesion, palliation,
hemagglutinating properties, and virulence is well
recognized among many bacterial species which
colonize mucosal surfaces (Arp and Jensen, 1980,
Salit, 1981). Virulent B. bronchiseptica expresses
adhesins and toxins that mediate adherence to the
upper airway epithelium, an essential early step in
pathogenesis (Edwards et al., (2005). In the present
study, all the B. bronchiseptica isolates
403 J. Anim. Sci. Adv., 2012, 2(4):396-406

MAZUMDER ET AL.
agglutinated with sheep, rabbit, cattle and pig RBC
and failed to agglutinate with RBC’S of other
animal species. Bemis and Plotkin (1982) found 81
and 91% of forty three canine and eleven swine
isolates respectively agglutinated horse, dog, pig,
guinea pig and sheep RBCs. In contrast, Joubert et
al. (1960) observed that an isolate of swine origin
agglutinated human type O and sheep RBCs but
not horse RBCs. Thibault et al. (1955) observed
that at least 65% of 17 B. bronchiseptica isolates of
human, dog, cat, pig, rabbit, guinea pig, or rat
origin agglutinated human, monkey, guinea pig,
pig, sheep, chicken, and horse RBCs. Kang et al.
(1970) found that 1 of 12, 1 of 4, 1 of 3, and 1 of 1
B. bronchiseptica isolates from pigs, guinea pigs,
rabbits, and dogs, respectively, agglutinated horse
RBCs. Since piliation or other attachment factors
or both are important in the pathogenesis of B.
bronchiseptica infections, it was suggested that the
hemagglutination reaction might provide a means
of distinguishing B. bronchiseptica isolates from
different animal species.
Plasmids are autonomous self-replicating
structures possessing genes that directly or
indirectly confer some unique properties to their
host bacterium and often used as epidemiological
marker for typing of the bacterial strains. Plasmid
DNA of the present study isolates were extracted
and purified by alkali-lysis method and resulted in
high plasmid yield. In the present study all the B.
bronchiseptica isolates showed the distribution of
either single or double plasmids in the molecular
range of 25-26 and 14-16 kb, respectively.
Similarly, Lax and Walker (1986) observed single
plasmid of 8.7-44 kb in 6 out of 14 B.
bronchiseptica isolates from pigs. Broad range of
plasmid in B. bronchiseptica strains having low
and high molecular weight of 2.6 and 27-30kb was
also documented by Antoine and Locht (1991).
Speakman et. al., (1997) observed 20 and 51 kb
plasmids in 10 B. bronchiseptica, isolated from
cats. Graham and Abruzzo (1982) examined
twenty seven isolates of B. bronchiseptica and
found eleven of the isolates contained plasmids.
Plasmid profiling differentiated the B.
bronchiseptica isolates into two groups and could
be a useful tool for strain differentiation of B.
bronchiseptica.
The PCR analysis revealed the presence of
bvgAS gene [B. bronchiseptica bvg locus
(transcription regulators of virulence factors) with
bvgA and bvgS genes] in all the 47 B.
bronchiseptica isolates. This gene regulates the
expression and the production of all other
virulence factors that have been identified in B.
bronchiseptica. This gene sequence also
established the isolates as B. bronchiseptica.
Pajuelo et al., (2002) identified a B. bronchiseptica
strain isolated from AIDS patient by analyzing the
isolate for the presence of B. bronchiseptica
specific DNA sequences of 600 bp DNA fragment
encompassing the linker-encoding sequences and
some of the transmitter-encoding sequences of
bvgAS gene by polymerase chain reaction. The
polymerase chain reaction assay described in the
present study may prove to an improvement of the
present methods for surveillance of bordetellosis
and may provide a more accurate means for the
diagnosis of B. bronchiseptica for Indian isolates.
B. bronchiseptica is an opportunistic bacterium in
humans, but can be pathogenic, especially in
severely immunocompromised subjects (Woolfrey
and Moody, 1991). Isolation of B. bronchiseptica
from the respiratory tract (Hovette et al., 2001) or
from the blood (Qureshi et al., 1992) of human
immunodeficiency virus (HIV)-infected patients
with respiratory diseases has been increasingly
reported. This circumstance has prompted some
investigators to propose the inclusion of B.
bronchiseptica in the list of opportunistic
pathogens causing diseases associated with
exposure of HIV-infected patients to animals
(Libanore et al., 1995; Woodward et al., 1995).
Since it is an emerging zoonotic disease, awareness
regarding the disease is warranted. This report is
the first detailed report of B. bronchiseptica
involvement in bronchopneumonia cases of pigs
from india. The bronchopneumonia ultimately
leads to atrophic rhinitis, which is an acute
infectious disease in pigs and wherein B.
bronchiseptica is isolated in pure form or found
along with P. multocida.
Conclusion
Systematic studies on B. bronchiseptica
infection in pigs have seldom been undertaken in
404 J. Anim. Sci. Adv., 2012, 2(4):396-406

ISOLATION OF BIRDETELLA BRONCHISEPTICA FROM PIGS IN …
India and especially from North East India, which
holds sizable pig population. In the present study,
all the samples yielded only B. bronchiseptica and
rarely infection of B. bronchiseptica with P.
multocida. The present findings suggested that B.
bronchiseptica is the most predominant type
associated with the bronchopneumonia in pigs in
Meghalaya, India. Based on the reports and results
obtained, B. bronchiseptica was found to be the
primary etiological agent for the acute respiratory
disease in pigs which is affecting the pig industries
in this part of North East India. Since B.
bronchiseptica can cause diseases in animal and
human by entering into the food chain, therefore
consumption of pork for human has a crucial
impact on public health. As the disease is having
public health importance, good management
practices, awareness regarding the disease is in
first priority. Eventhough the present finding is
based on the isolation of B. bronchiseptica and P.
multocida from the state of Meghalaya, further
systematic studies from other pig producing states
in the North Eastern region will give the actual
picture of the causative agents for
bronchopneumonia in pigs before taking further
steps towards controlling the disease caused by
these organisms.
Acknowledgement
This research is the part of Ph.D work of first
author and was carried out in collaboration with
Division of Animal Health, ICAR Research
complex for NEH Region, Umiam, Meghjalaya,
India and department of Life Science, Assam
University, Silchar, Assam, and India. Authors
gratefully acknowledge or wish to thank the
Director, ICAR Research complex for NEH
Region, Umiam, Meghjalaya and Vice Chancellor
of Assam University, Silchar, India for providing
the facilities to work.
References
Antoine R, Locht C (1991). New broad-host-range plasmid
isolated from Bordetella bronchiseptica. Abstract in
General Meeting of American Society of Microbiology
Meet, 181.
Arp L H, Jensen AE (1980). Piliation, hemagglutination,
motility and generation time of Escherichia coli that are
405 J. Anim. Sci. Adv., 2012, 2(4):396-406
virulent or avirulent for turkeys. Avian Dis., 24: 153 –
161.
Bemis DA, Plotkin BJ (1982). Hemagglutination by
Bordetella bronchiseptica. J. Clin. Microbiol., 15(6):
1120-1127.
Berkhoff HA, Vinal AC (1986). Congo red medium to
distinguish between invasive and non-invasive
Escherichia coli pathogenic for poultry. Avian Dis., 30:
117- 121.
Birnboim HC, Doly J (1979). A rapid alkaline extraction
procedure for screening recombinant plasmid DNA.
Nucleic Acids Res., 7: 1513–23.
Cho J G, Cho JG (1998). Antimicrobial susceptibility of
Bordetella bronchiseptica isolates from pigs. Korean
journal of veterinary clinical medicine., 150: 30-35.
Cotter PA, Miller JF (2001). Bordetella. In Principles of
Bacterial Pathogenesis. Academic press, San Diego,
CA, 621-671.
Cowart RP, Backstrom L, Brim TA (1989). Pasteurella
multocida and Bordetella bronchiseptica in atrophic
rhinitis and pneumonia in swine. Canadian Journal of
Veterinary Research., 53: 295-300.
De Jong MF, (1992). (Progressive) atrophic rhinitis, In A. D.
Leman, B. E. Straw, W. L. Mengeling, S.D’Allaire and
D. J. Taylor (ed), Diseases of swine, Iowa State
University Press, Ames, 414-435.
Duguid JP, Clegg S, Wilson M I, (1979). The fimbrial and
nonfimbrial haemagglutinins of Escherichia coli. J.
Med. Microbiol., 12: 213-227.
Edwards JA, Groathouse NA, Boitano S (2005). Bordetella
bronchiseptica adherence to cilia is mediated by
multiple adhesin factors and blocked by surfactant
protein A. Infect Immun., 73: 3618-26.
Elias B (1989). Report on the observations on the outbreaks
of infectious atrophic rhinitis in Hungary. Allatorvostudomanyi
Egyetem, Budapest, Hungary. Magyar-
Allatorvosok-Lapja., 44(10): 587-593.
Friedman LE, Passerini de Rossi BN, Messina MT, Franco
MA (2001). Phenotype evaluation of Bordetella
bronchiseptica cultures by urease activity and Congo
red affinity. Letters in Applied Microbiology., 33: 285-
290.
Garcia San Miguel L, Quereda C, Martinez M, Martin-Davila
P, Cobo J, Guerrero A (1998). Bordetella
bronchiseptica cavitary pneumonia in a patient with
AIDS. Eur. J. Clin. Microbiol. Infect. Dis., 17: 675–
676.
Giles CJ (1992). Bordetellosis, In A. D. Leman, B. E. Straw,
W. L. Mengeling, S.D’Allaire and D. J. Taylor (ed),
Diseases of swine, Iowa State University Press, Ames.,
436-445.
Goodnow RA (1980). Biology of Bordetella bronchiseptica.
Microbiol. Rev., 44, 722-738.
Hamilton TD, Roe JM, Webster AJF (1996). Synergistic role
of gaseous ammonia in etiology of Pasteurella
multocida- induced atrophic rhinitis in swine. J. Clin.
Microbiol., 34: 2185-2190.

MAZUMDER ET AL.
Holt JG, Kreig NR, Sneath PHA, Staley JT, Williams ST
(1994). Bergey’sManual of Determinative Bacteriology.
Williams and Wilkins, Baltimore, USA.
Hovette PP, Colbacchini P, Camara C, Aubron MCN_Dir,
Passeron T (2001). Bordetella bronchiseptica infection
in a Senegalese HIV positive patient: carrier state or
illness? Presse Med., 30: 902.
Joubert L, Courtieu AL, Oudar J, (1960). Pneumonie
enzootique du porc a Bordetella bronchiseptica. Bull.
Soc. Sci. Vet. Med. Comp. Lyon., 63: 329-344.
Kang BK, Koshimizu K, Ogata M (1970). Studies on the
etiology of infectious atrophic rhinitis of swine. II.
Agglutination test on Bordetella bronchiseptica
infection. Jpn. J. Vet. Sci., 32: 295-306.
Keogh EV, North EA, Warburton MF (1947).
Hemagglutinins of the hemophilus group. Nature
(London)., 160: 63.
Lax AJ, Walker CA (1986). Plasmids related to RSF1010
from Bordetella bronchiseptica. Plasmid., 15(3): 210-
16.
Libanore M, Rossi MR, Pantaleone M, Bicocchi R, Carradori
S, Sighinolfi L, Ghinelli F (1995). Bordetella
bronchiseptica pneumonia in an AIDS patient: a new
opportunistic infection. Infection., 23: 312–313.
Pajuelo BL, Villanueva JL, Cuesta JR, Irigary NV, Wittel
MB, Curiel AG, de Tejada GM (2002). Cavitary
Pneumonia in an AIDS patient Caused by unusual
Bordetella bronchiseptica variant producing reduced
amounts of pertactin and other major Antigens. J. Clin.
Microbiol., 40(9): 3146-3154.
Parton R (1988). Differentiation of phase I and variants strain
of Bordetella pertusis on Congo Red media. J of Med
Microbiol., 26: 301-306.
Qureshi MN, Lederman J, Neibart E, Bottone EJ (1992).
Bordetella bronchiseptica recurrent bacteraemia in the
setting of a patient with AIDS and indwelling Broviac
catheter. Int. J. STD AIDS., 3: 291–293.
Salit IE (1981). Hemagglutination by Neisseria meningitides.
Can. J. Micrbiol., 27, 585-593.
Shome BR, Shome R, Rahman H, Mazumder Y, Das A,
Rahman MM, Bujarbaruah KM (2006).
Characterization of Bordetella bronchiseptica
associated with atrophic rhinitis outbreak in pigs. Indian
Journal of Animal Science., 76 (6): 433-436.
Speakman AJ, Binns SH, Osborn AM, Corkill JE, Kariuki S,
Saunders JR, Dawson S, Gaskell RM, Hart CA (1997).
Characterization of antibiotic resistance plasmids from
Bordetella bronchiseptica. J. Antimicro. Chemothe., 40:
811–816
Stehmann R, Mehlhorn G (1994). Atrophic rhinitis as a
primary Bordetella bronchiseptica infection with
environmental influence. Proceedings of the 8 th
International Congress on Animal Hygiene, St.Paul,
Minnesota, USA. 21 ref.
Thibault P, Szturm-Rubinsten S, (1955). Piechaud-Bourbon
D, Haemophilius bronchisepticus et Alcaligenes
faecalis. I. De quelques caracteres differentials. Ann.
Inst. Pasteur., 88: 246.
Ward MJ, Duggelby CJ, parton R, Coote jG (1992). High
frequency of independent IS50 tranposition during Tn5
mutagenisis of Bordetella pertusis virulence associated
genes. Lett. in Appl. Microbiol., 15: 137–141.
Wettstein K, Frey J (2004). Comparison of antimicrobial
resistance pattern of selected respiratory tract pathogens
isolated from different animal species. Schweiz Arch.
Teerheilkd., 146: 417-22.
Woodward DR, Cone LA, Fostvedt K (1995). Bordetella
bronchiseptica infection in patients with AIDS. Clin.
Infect. Dis., 20: 193–194.
Woolfrey BF, Moody JA, (1991). Human infections
associated with Bordetella bronchiseptica. Clinical
Microbiol. Rev., 4: 243-55.
Xin LZ, Jiang Y, HuiZhen L, BinBiao H, Le H, Lu-ZX, Yan-
J, Liang-HZ, Hong-BB, Han-L (1997). Diagnosis of
bordetellosis in piglets. Chinese-Journal-of-Veterinary-
Medicine., 23: 12-13.
Ying QT, YaHua Z, ShiXiang Y, LiuZhan Y, ShuCheng Z,
XuFu Y, Liu-Jie, Qi-TY, Zhang YH, Yuan SX, Yang
LZ, Zhang SC, Yang XF, Liu J (1995). Pathogenic
investigation of infectious atrophic rhinitis in pigs in
some parts of China. Chinese-Journal-of-Veterinary-
Science-and-Technology., 25(4): 15-16.
Yu TG, Tong GY (1995). Investigation of an epidemic of
atrophic rhinitis. Chinese-Journal-of-Veterinary-
Medicine., 21(8): 14-15.
Zhao Z, Wang C, Xue Y, Tang X, Wu B, Cheng X, He Q,
Chen H (2011). The occurrence of Bordetella
bronchiseptica in pigs with clinical respiratory disease.
Vet. J., 188(3): 337-40.
406 J. Anim. Sci. Adv., 2012, 2(4):396-406