novel approaches to expression and detection of oestrus in dairy cows

More documents

Recommendations

Info

The supernatant, following centrifugation with Protein Precipitation Solution, was removed into a 15ml tube containing 3ml isopropanol 100% and inverted approximately 50 times. The DNA was precipitated out of solution using isopropanol. After centrifuging (DuPont Sorvall RC5C) for 10 minutes a small white pellet remained. If no pellet was present then the sample was stored at -21˚C overnight and re-centrifuged. The supernatant was pipetted off carefully avoiding the pellet and surrounding area. The supernatant was then washed with 2ml 70% ethanol (Sigma-Aldrich, Dorset, UK), inverted several times and centrifuged for 10 minutes. After centrifugation the DNA pellet was air dried and rehydrated with 250µl DNA Hydration Solution (supplied with the kit) and incubated at 65˚C for 1 hour (Techne DRI-BLOCK DB.3A). Concentrations were measured by nanodrop prior to PCR. 3.2.4.2 PCR 100ng genomic DNA (gDNA) was then amplified by PCR using primers specific for the GnRH-R. Primers were designed using the DNA sequence obtained from the NCBI Genbank for locus AF034950 Bos taurus GnRH-R. The sequence for the forward primer was 5’ GGTTTTTTTTTTAGAAAAC 3’ and the sequence for the reverse primer was 5’ GAACAGTGGTTTTCATTCTG 3’. Purified primers were obtained (HPSF; high purity salt free) from Sigma (Sigma-Aldrich, Dorset, UK). PCR reactions were assembled as described in Table 3.2 and performed using the Eppendorf Mastercycler (Eppendorf, Stevenage, UK), with the following thermal cycling conditions: 95˚C for 30 seconds, 30 cycles of 95˚C for 30 seconds, 59˚C for 30 seconds, 68˚C for 30 seconds and final extension of 68˚C for 5 minutes. Table 3.2 PCR reaction reagents Reagent Volume (μl) Quick-Load Taq 2X Master Mix 25 MgCl 2 (25mM) 1 Forward Primer (10μM) 2 Reverse Primer (10μM) 2 Water To top up to 50μl 3.2.4.3 DNA Clean Up PCR products were mixed with loading dye and run on 1% agarose gel in TAE buffer with ethidium bromide slowly at 65V until sufficient separation 74
was achieved. PCR products were removed from the gel using the QIAquick Gel Extraction Kit (Qiagen, Sussex, UK). The DNA band was excised using a scalpel under a UV light machine and dissolved at 50˚C on a heat block (Techne DRI-BLOCK DB.3A) in 3 volumes of Buffer QG (supplied with the kit) to bind the DNA. Samples in solution were added to a QIAquick spin column in a 2ml collection tube (both supplied with the kit), and samples centrifuged (MiniSpin, Eppendorf, Stevenage, UK) at 10000rpm for 1 minute. 700µl of Buffer PE (supplied with the kit) was then added to the column, centrifuged at 10000rpm for 1 minute, and the process repeated to wash the DNA. The empty column and collecting tube were then centrifuged for 1 minute to remove the residual alcohol, before eluting the DNA with 30µl of 2mM Tris solution, pH 7.0-8.5 and centrifuging for 1 minute to collect the purified PCR product. 3.2.4.4 DNA Sequencing Samples were sent for sequencing (Beckman CEQ8000 Sequencer) with the PCR primers detailed in section 3.2.4.2 for the promoter region of the bovine GnRH receptor gene, which identified the SNPs at positions 966 and 1189. 3.2.5 Statistical Analyses Statistical analysis was carried out using Genstat 14th edition (VSN International Ltd, Hemel Hempstead, UK). Activity data were analysed as generalized linear mixed models (GLMM) using the residual maximum likelihood (REML) procedure, with Poisson distribution and logarithmic link function. The model fitted fixed effects for SNPs (variates; wildtype homozygote, 0; heterozygote, 1; mutant homozygote, 2). For the random effects of the model, individual cows represented subjects to allow for multiple oestruses per cow but only 1 SNP per cow. The significance of fixed effects was assessed by Wald tests. The resulting model was: Y il = µ + S i + C l + ε il Other variables were then included into the statistical model fitted as fixed effects for SNPs (variates; wildtype homozygote, 0; heterozygote, 1; mutant homozygote, 2), parity (classified according to lactation number as 1, 2 and ≥3) and oestrus time period (classified as Jan-Mar, 1; Apr-Jun, 2; Jul-Sept, 3; Oct-Dec, 4). This was to account for the combined effects on activity, eliminating external cow factors and seasonal effects to 75
Page 1 and 2:
NOVEL APPROACHES TO EXPRESSION AND
Page 3 and 4:
TABLE OF CONTENTS TABLE OF CONTENTS
Page 5 and 6:
2.2.3 Statistical Analyses ........
Page 7 and 8:
5.3 RESULTS .......................
Page 9 and 10:
Furthermore, automated software was
Page 11 and 12:
LIST OF FIGURES Figure 1.1 Hormonal
Page 13 and 14:
LIST OF TABLES Table 1.1 Trends in
Page 15 and 16:
LIST OF ABBREVIATIONS ˚ ˚C μM 2D
Page 17 and 18:
CHAPTER 1 - Introduction & Literatu
Page 19 and 20:
the past 50 years and duration of o
Page 21 and 22:
Oestrus growing follicle (Staigmill
Page 23 and 24:
ecomes the main inhibitor of FSH an
Page 25 and 26:
calf at 40-50 days post partum; inv
Page 27 and 28:
al., 2006). However, aged sperm hav
Page 29 and 30:
can occur within 2-3 days, but if t
Page 31 and 32:
educes the incidence of problem cow
Page 33 and 34:
oestradiol, the LH surge and ovulat
Page 35 and 36:
The secondary signs of oestrus can
Page 37 and 38:
There are also changes in normal be
Page 39 and 40: engage in more natural behaviours i
Page 41 and 42: 1983). Exact explanations and mecha
Page 43 and 44: 2006) and disruption of LH secretio
Page 45 and 46: 1.4.3.2 Milk Yield and Nutrition Di
Page 47 and 48: influence the ability of the ovary
Page 49 and 50: cyclicity can be delayed if dietary
Page 51 and 52: indication for the optimal time to
Page 53 and 54: calving), 3) pre-breeding heat date
Page 55 and 56: 1.5.2 Physiological Changes Physiol
Page 57 and 58: 1.5.2.3 Body and Milk Temperature T
Page 59 and 60: physical activity and stage of the
Page 61 and 62: caused by the general environment t
Page 63 and 64: may be gained. This is because data
Page 65 and 66: In summary the objective was to for
Page 67 and 68: diet, with concentrates at milking.
Page 69 and 70: oestrus was defined as 3 consecutiv
Page 71 and 72: The interaction between parity and
Page 73 and 74: individual oestrus was not signific
Page 75 and 76: Table 2.4 The effects of the intera
Page 77 and 78: (361 vs. 578 points, respectively,
Page 79 and 80: oestrous expression with increasing
Page 81 and 82: the blood (Sangsritavong et al., 20
Page 83 and 84: CHAPTER 3 - Single Nucleotide Polym
Page 85 and 86: population owing to previous select
Page 87 and 88: Table 3.1 Cont. Follicle Stimulatin
Page 89: 3.2.4 Sequencing of DNA in the Labo
Page 93 and 94: 3.4 DISCUSSION The objectives of th
Page 95 and 96: fertility and oestrous expression.
Page 97 and 98: CHAPTER 4 - Development of a Novel
Page 99 and 100: In summary UWB seems a good option
Page 101 and 102: Initial tests were carried out to i
Page 103 and 104: Therefore this demonstrates that X
Page 105 and 106: which is most important for achievi
Page 107 and 108: Figure 4.9 Horizontal - Vertical Di
Page 109 and 110: that UWB is matching the ‘truth
Page 111 and 112: mounting cow. For example height ch
Page 113 and 114: Backpack 1 st put on in AI stalls E
Page 115 and 116: Cows’ behaviour was assessed at 5
Page 117 and 118: or that the cows were in an area of
Page 119 and 120: plane, but mostly in achieving high
Page 121 and 122: Develop techniques for analysis of
Page 123 and 124: in elastic silicone moulded over a
Page 125 and 126: and time of mount, duration of moun
Page 127 and 128: observed matched with increases in
Page 129 and 130: 5.3 RESULTS Results demonstrate pos
Page 131 and 132: Figure 5.2 Graph showing mounting b
Page 133 and 134: Table 5.1 Results from POC 2 showin
Page 135 and 136: Table 5.3 Efficiency and accuracy o
Page 137 and 138: oestrus and oestrus it is clear to
Page 139 and 140: P4 Concentration, ng/ml P4 Concentr
Page 141 and 142:
P4 Concentration, ng/ml P4 Concentr
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
Activity Activity Activity Activity
Page 149 and 150:
Page 151 and 152:
Page 153 and 154:
5.4 DISCUSSION The aim of this work
Page 155 and 156:
averaged 70% which was lower than t
Page 157 and 158:
when the cows lie down, especially
Page 159 and 160:
the level of oestrous activity was
Page 161 and 162:
technology larger herds must be mon
Page 163 and 164:
monitoring could also monitor non-l
Page 165 and 166:
antennae which could affect accurac
Page 167 and 168:
predispose cows to illness e.g. met
Page 169 and 170:
CHAPTER 6 - Overall Discussion & Co
Page 171 and 172:
oestrus, h 2 =0.27 (Lovendahl et al
Page 173 and 174:
The final section of this thesis de
Page 175 and 176:
ate. By using UWB in a commercial s
Page 177 and 178:
provides an insight the potential o
Page 179 and 180:
BLOWEY, R. (2005) Factors associate
Page 181 and 182:
ovine gonadotrophin releasing hormo
Page 183 and 184:
GINTHER, O. J., KOT, K., KULICK, L.
Page 185 and 186:
associated with embryonic survival
Page 187 and 188:
ody condition at parturition on end
Page 189 and 190:
Signs in a 24-h Tie-Stalled Dairy H
Page 191 and 192:
SHERMAN, E. L., NKRUMAH, J. D., MUR
Page 193 and 194:
Influence of negative energy balanc
show all

novel approaches to expression and detection of oestrus in dairy cows

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?