Structure of the SAM-II riboswitch bound to S-adenosylmethionine

cassettes that facilitate easy analysis of all the nucleotide positions 9 . The resulting
PCR fragment was further amplified using a 5’ primer containing a T7 promoter (5’-
CTAATACGACTCACTATAGGCCTTCGGGCCAA) and a 3’ primer corresponding
to the terminus of the 3’- structure cassette (3’-
GAACCGGACCGAAGCCCGATTTGGATCCGGCGAACCGGATC). RNA was
transcribed and purified as described above. The final concentration of the RNA was
calculated from the UV absorption at 260 nM and an extinction coefficient of
1,316,100 M -1 cm -1 .
Selective 2’-hydroxyl acylation analyzed by primer extension (SHAPE) using
the chemical reagent N-methylisatoic acid (NMIA) was performed essentially as
previously described by the Weeks laboratory 9 . Briefly, 2 pmols of SAM-II RNA in
11 µl of 0.5x TE buffer was subjected to heat denaturation by incubating at 90 °C for
3 minutes followed by refolding on ice for one minute at which point 1 µl of different
concentrations of SAM (typically serial stock concentration dilutions of 200 µM, 100
µM, 20 µM, and 10 µM) and 6 µl of folding buffer (333 mM K + -HEPES, pH 8.0, 20
mM MgCl2, 333 mM NaCl) were added. Reactions were allowed to incubate on ice
for a full 10 minutes. The final concentrations of SAM with respect to the RNA
ranged from 20x to 1x while the final concentration of MgCl2 was 6 mM. Prior to
incubation with NMIA, RNA samples were separated into two 9 µl reactions in thin-
walled PCR tubes and allowed to equilibrate at 25 °C for five minutes. A 65 mM
NMIA stock was prepared in anhydrous DMSO (Sigma) immediately prior to its
addition to the reaction as a chemical probing reagent. NMIA was added in 1 µl
amounts to each reaction, while the same amount of DMSO was added to each