13.10.2013 Views

discovery - Fred Hutchinson Cancer Research Center

discovery - Fred Hutchinson Cancer Research Center

discovery - Fred Hutchinson Cancer Research Center

SHOW MORE
SHOW LESS

Create successful ePaper yourself

Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.

2008 ANNUAL REPORT<br />

paths of<br />

<strong>discovery</strong><br />

STOCHASTIC MODELS REVEAL THE SPREAD OF DISEASE IN A PANDEMIC OUTBREAK.


pursuing<br />

<strong>discovery</strong><br />

<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong><br />

FRONT COVER: DRESSED IN BRIGHT RED, THE TWO X CHROMOSOMES OF A FEMALE CELL<br />

<strong>Center</strong>’s scientists weave interdisciplinary<br />

paths to nurture collaboration and<br />

insight. Their scientific endeavors are<br />

long and intense, with no shortcuts or<br />

guarantees. Fueled by their passion for<br />

treatments that offer healing and<br />

for life<br />

IN A MALE PANCREAS (CENTER LEFT) REVEAL THE PHENOMENON OF MOTHER-CHILD CELL EXCHANGE.<br />

for preventive steps<br />

to circumvent the<br />

devastation of cancer,<br />

HIV/AIDS and related diseases, they<br />

seek answers in the population and at<br />

the molecular level. Our researchers<br />

strive for breakthrough moments of<br />

<strong>discovery</strong>—<strong>discovery</strong> for life.<br />

Table of Contents<br />

Message from the<br />

President and Director 2<br />

Message from the<br />

Chair of the Board of Trustees 3<br />

<strong>Research</strong> 4<br />

Donors 19<br />

Financial Summary 24<br />

<strong>Center</strong> Boards 26<br />

<strong>Center</strong> Leadership 27


2<br />

Message from the<br />

President and Director<br />

Dr. Lee Hartwell<br />

President and Director<br />

PATHS OF DISCOVERY<br />

The <strong>Hutchinson</strong> <strong>Center</strong> has become one of the world’s premier<br />

research institutions thanks to our scientists who have grappled<br />

with some of the most challenging questions in the biosciences, and our<br />

staff who help bring ideas to fruition.<br />

Over the years, the <strong>Center</strong>’s researchers have refined treatments for<br />

leukemia, lymphoma and other blood diseases. As they have sought to<br />

boost survival rates for once-fatal cancers, their research naturally has<br />

led into new and unexpected directions.<br />

Today, the <strong>Center</strong> remains a world leader in cancer research, but we<br />

have also expanded our work into other areas, breaking new ground in<br />

HIV/AIDS research and other life-threatening diseases.<br />

Consider the research of some of our featured scientists in this annual report. Dr. Richard Nash, an<br />

oncologist and specialist in leukemia, hopes that what we have learned from blood cancers and their<br />

treatment may some day help people with autoimmune diseases such as systemic and multiple sclerosis.<br />

Dr. Stan Riddell studies autoimmune responses to disease and the role our own T-cells play in fighting<br />

cancer. Stan wants to boost the power of the immune system with better defenses by engineering a special<br />

kind of T-cell so that it targets tumors more successfully.<br />

Dr. Anne McTiernan’s work has focused international attention on the <strong>Center</strong>. As a cancer prevention<br />

researcher, Anne’s detailed studies are showing us how exercise and diet could help reduce many cancers<br />

that are caused by obesity and sedentary lifestyles.<br />

These scientists are examples of the exceptional team of researchers here at the <strong>Hutchinson</strong> <strong>Center</strong>,<br />

people whose passion for their work keeps us focused on the future. With your support, we can ensure<br />

that their innovative work stays on the path of <strong>discovery</strong>.<br />

Message from the Chair<br />

of the Board of Trustees<br />

If you have ever faced a life-threatening diagnosis, or watched a family<br />

member, friend or colleague duel cancer, HIV/AIDS or a related<br />

disease, you understand why the scientists at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />

<strong>Research</strong> <strong>Center</strong> are working tirelessly to save lives.<br />

Compassion for you and your loved ones is what drives <strong>Hutchinson</strong><br />

<strong>Center</strong> scientists and staff to seek a better future.<br />

As you will learn in this annual report, this is an exciting time for<br />

scientific research. Technology is playing an increasingly important role<br />

in accelerating the pace of <strong>discovery</strong> —from Drs. Malik and Emerman<br />

using computers to explore an ancient retrovirus to<br />

Drs. Halloran and Longini using statistical models to study the spread of infectious diseases. The<br />

scientists in this report represent the <strong>Center</strong>’s host of talented investigators, all of whom are seeking<br />

answers to challenging questions in daring, new ways. In pursuing the paths of their discoveries, our<br />

scientists follow the mission of the <strong>Center</strong> to eliminate cancer and related diseases.<br />

Contributions like yours are essential to helping the <strong>Hutchinson</strong> <strong>Center</strong> sustain our world-class<br />

research environment and fund these discoveries. Private donations play an instrumental role in the<br />

<strong>Center</strong>’s ability to remain at the forefront of biomedical research by supporting innovative research that<br />

often cannot be funded by government grants alone.<br />

Thank you for sharing my commitment to improving and saving lives and furthering innovative<br />

research at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>.<br />

Sally G. Narodick<br />

Chair, Board of Trustees<br />

SUPPORTING DISCOVERY<br />

3


4<br />

Michael Emerman, Ph.D.<br />

Harmit Malik, Ph.D.<br />

Biologists<br />

U N D E R S T A N D I N G H I V B Y D E L V I N G D E E P L Y<br />

INTO OUR EVOLUTIONARY PAST<br />

When we think about deadly viruses, evolutionary biologist<br />

Dr. Harmit Malik explains, we need to understand that<br />

their complexity and ferocity has been bred through tens of<br />

millions of years of tugging and pulling against the human race.<br />

“In this genetic conflict, either the host is winning or the<br />

virus is winning,” Malik said, pointing to the roughly 8 percent<br />

of the human genome that is made up of old retroviruses that<br />

we carry inside of us like bits of shrapnel from ancient wars.<br />

Today, we face HIV. It crossed<br />

over from chimpanzees to humans<br />

within the last 100 years, so far killing<br />

25 million people and infecting<br />

twice that many. Why does it kill us<br />

and not chimpanzees, which are easily<br />

infected by HIV but not sickened<br />

by it?<br />

Malik and Dr. Michael Emerman,<br />

a molecular biologist, have pondered<br />

such questions for a long time. Most<br />

recently, their collaboration has<br />

yielded important insights into the<br />

evolutionary struggle between viruses and humans. Ultimately,<br />

they hope their research may lead to new drugs to fight HIV.<br />

In one of their most startling collaborations, their labs used<br />

the power of modern computers and DNA technology to<br />

assemble a new version of an extinct retrovirus known as<br />

Pan troglodytes endogenous retrovirus (PtERV), which infected<br />

chimps and gorillas—but not humans—4 million years ago.<br />

By reassembling the retrovirus in such a way that it could<br />

reproduce only once, Malik and Emerman found that a<br />

human protein known as TRIM5α easily defeated PtERV.<br />

Every primate has a version of the TRIM5α protein. In the<br />

rhesus monkey, for example, it kills HIV.<br />

Malik and Emerman also modified the human TRIM5α<br />

protein to resemble a version present in the ancestors of<br />

humans, chimpanzees and gorillas, and found that it no longer<br />

protected against the PtERV.<br />

By modifying TRIM5α, they<br />

also discovered that one version<br />

protected against HIV but not<br />

PtERV. In another modification,<br />

it did the opposite.<br />

Such polar opposites, they<br />

agree, are the result of evolution.<br />

Because our TRIM5α<br />

protein evolved to fight other<br />

retroviruses, it likely left us<br />

vulnerable to HIV, they say.<br />

Is it possible to reproduce a<br />

drug that behaves like a chimp’s TRIM5α does against HIV, or<br />

change the human version ever so slightly so it kills HIV? These<br />

are the kinds of challenges that Emerman and Malik ponder.<br />

The two agree that studying, and in some cases reconstructing,<br />

ancient viruses is not a trivial matter.<br />

In this arms race that’s millions of years old, it pays to<br />

understand the enemy, Malik said.<br />

HIV BREAKS FREE FROM A CONQUERED T-CELL, PREPARED TO INVADE NEW TARGETS.


6<br />

Richard Nash, M.D.<br />

Immunotherapy <strong>Research</strong>er/Oncologist<br />

L E U K E M I A T R E A T M E N T S H O W S P R O M I S E<br />

FOR SYSTEMIC AND MULTIPLE SCLEROSIS<br />

As a hard-working member of the immune system, a T-cell<br />

is an efficient killer, attacking anything it perceives as an<br />

intruder, whether it’s a virus-infected cell, a cancer cell or a<br />

bacterium.<br />

But sometimes, a T-cell attacks a friend—and it goes on<br />

attacking, unchecked, destroying healthy tissue and creating<br />

serious autoimmune diseases such as multiple sclerosis and<br />

lupus. Why the immune system goes so<br />

very wrong has puzzled researchers<br />

for decades.<br />

As many as 80 autoimmune diseases<br />

have been identified, and some of<br />

them are capable of causing serious<br />

complications, even death. One<br />

example is systemic sclerosis (also<br />

known as scleroderma), a disease without<br />

effective treatment. “It’s one of the<br />

most frustrating diseases to treat. There’s<br />

high mortality and no therapies, and it<br />

can hit you in so many ways,” said<br />

Dr. Richard Nash.<br />

By training, Nash is an oncologist,<br />

a researcher in leukemia and other blood cancers. But thanks to<br />

a unique and unexpected insight, he’s now applying his knowledge<br />

in whole new ways. Along with colleagues, he is taking the<br />

<strong>Hutchinson</strong> <strong>Center</strong>’s pioneering leukemia research and applying<br />

it to other diseases, such as systemic sclerosis and MS.<br />

The standard treatment for leukemia and other blood<br />

cancers is chemotherapy, radiation and transplantation of<br />

bone marrow or blood stem cells. Nash is optimistic the same<br />

approach may now help patients with autoimmune diseases.<br />

It has taken some very unlucky patients—a rare few who<br />

had both leukemia and systemic sclerosis—to uncover a<br />

potential new use for transplantation.<br />

With systemic sclerosis, a patient’s skin becomes very hard,<br />

severely limiting movement. When one<br />

of these patients received a stem cell<br />

transplant for cancer, “we saw evidence<br />

of skin improvement. The treatment<br />

suggested that the fibrosis of the skin<br />

was a reversible condition,” Nash said.<br />

“And it appeared to stabilize<br />

the organs.”<br />

With transplantation, it may be<br />

possible to remove the reactive cells that<br />

are triggering the immune system to<br />

attack the body. Currently, Nash’s lab<br />

is conducting three clinical trials to<br />

evaluate the safety and effectiveness<br />

of high-dose chemotherapy and<br />

stem-cell transplantation for systemic sclerosis and MS.<br />

“For me, that’s part of the excitement of being in this<br />

field … we’re doing something different and helping people,<br />

and learning about potential new therapies. To be successful<br />

in any project, collaboration and teamwork are very<br />

important,” he said.<br />

A BRAIN SCAN SHOWS MULTIPLE SCLEROSIS LESIONS THAT COULD BE IMPROVED WITH T-CELL THERAPY.


J. Lee Nelson, M.D.<br />

Autoimmunity <strong>Research</strong>er/Rheumatologist<br />

D E L V I N G I N T O T H E A U T O I M M U N E I M P L I C A T I O N S O F<br />

MOTHER-CHILD CELL SHARING<br />

It feels like a broken bone that never heals, a constant ache.<br />

Pain relievers and powerful steroids may not make a dent in<br />

the excruciating pain. Nor do they relieve the swelling and<br />

stiffness for many rheumatoid arthritis sufferers. But nature<br />

sometimes offers relief: pregnancy. Like a fog lifting, most<br />

pregnant rheumatoid arthritis patients experience life without<br />

constant pain for the first time in years.<br />

Seeing such transformations made Dr. Lee Nelson yearn for<br />

answers. What could make an autoimmune disease like<br />

rheumatoid arthritis turn off? The answer may lie in the<br />

mother-child cell transfer that happens<br />

during pregnancy.<br />

dUsing e lthe vplacenta i n g as a corridor, i n t o some<br />

cells travel between mom and baby, take<br />

up guest residence in their hosts, and<br />

stick around for decades. Nelson and her<br />

interdisciplinary team study this mixing<br />

of genetically distinct individuals, known<br />

as microchimerism, to identify the good<br />

and bad consequences of these foreign<br />

cells in autoimmune diseases, transplantation,<br />

cancer and pregnancy complications.<br />

Nelson, considered one of the world’s leading researchers<br />

in this investigative frontier, has been studying the role that<br />

microchimerism plays in the initiation and remission of autoimmune<br />

diseases since 1986, the year she began her research<br />

career at the <strong>Hutchinson</strong> <strong>Center</strong>.<br />

The transferred cells can be found in many human tissues.<br />

They are detected by looking for female cells in a male, or male<br />

cells in a female, or through DNA analysis. The presence of<br />

Y chromosomes in a woman, for example, signifies that<br />

she has acquired cells from a male (most likely from a son<br />

during pregnancy).<br />

Scientists had assumed that a normal immune system would<br />

destroy any maternal cells lingering in a child. That thinking<br />

changed when Nelson and her team found maternal cells<br />

survived decades later in healthy adults. That work<br />

provided evidence for the idea that cells transferred from<br />

mother to fetus are stem cells or related cells, capable of becoming<br />

any type of cell, since stem cells can divide indefinitely.<br />

She also found maternal cells in<br />

the pancreas made insulin, suggesting<br />

they may help regenerate the diseased<br />

organ in diabetics. This finding suggests<br />

that microchimerism might one<br />

day be the crux of new therapies if<br />

the non-native cells could be coaxed<br />

to restore damaged tissues.<br />

“We’re trying to hone in on treatments,”<br />

Nelson said. “I would like to<br />

help alleviate suffering in some way.”<br />

Nelson also conducted the first study to look at microchimerism<br />

in an autoimmune disease. She found evidence for the<br />

involvement of adopted fetal cells in scleroderma (also known<br />

as systemic sclerosis), a life-threatening illness that makes the<br />

skin hard and thick and often attacks internal organs.<br />

Once a lone pioneer in this young field, she said, “This was<br />

an interdisciplinary challenge that people had overlooked, and<br />

it was ripe for important questions and big leaps forward.”<br />

Thanks to Nelson, many of those questions are being answered.<br />

THE EXCHANGE OF MICROCHIMERIC CELLS BETWEEN MOTHER AND CHILD MAY HOLD CLUES FOR AUTOIMMUNE DISEASES.<br />

9


10<br />

Robert Gentleman, Ph.D.<br />

Computational Biologist<br />

S earching<br />

M I N I N G G E N O M I C D A T A F O R C A N C E R ’ S<br />

MOLECULAR SECRETS<br />

for the molecular roots Common of cancer duplicate is akin to reads after biological filtering research. Just a decade ago, scientists could only<br />

looking for the proverbial > needle df1 in lapply(split(df1[, which is where Dr. Robert c("sequence", advances now "count")], enable efficient df1$lane), analysis of half head) a million genes.<br />

Gentleman comes in. Technology $s_1_export.txt<br />

and the need to sift through The new tools enable researchers to uncover novel potential<br />

a deluge of genomic information has transformed biology from targets sequence for therapies count as well as to explore the underlying genetic<br />

a purely lab-based science to an 101 information TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA science as well. causes of many human 243 diseases.<br />

102 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 237<br />

Gentleman, head of the <strong>Hutchinson</strong> <strong>Center</strong>’s Herbold There has also been an explosion in the amount of informa-<br />

103 GTGGAAAATTTAGAAATGTCCACTGTAGGACGTGG 177<br />

Computational Biology Program, 104creates CCATATTCCACGTCCTACAGTGGACATTTCTAAAT computing tools to tion available about the 165DNA<br />

sequence of the human genome.<br />

analyze massive amounts of data 105 from AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT biological experiments Consequently, researchers 162 have identified a large number of<br />

and uses mathematics and statistics 106 to CATGATTTTCAGTTTTCTTGCCATATTCCACGTCC generate new insights novel genes within these 158previously<br />

unknown sequences. The<br />

incorporating the existing<br />

data. The approach<br />

$s_2_export.txt<br />

sequence count<br />

challenge currently facing<br />

scientists is to find a way to<br />

helps researchers<br />

251 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 357 organize and catalog this vast<br />

understand cancer at<br />

its most fundamental<br />

level by illuminating<br />

252 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA<br />

253 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT<br />

254 ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />

255 CATGATTTTCAGTTTTCTTGCCATATTCCACGTCC<br />

324<br />

194<br />

184<br />

160<br />

amount of information into a<br />

usable form.<br />

“Technology drove enor-<br />

which cellular proteins 256 GCCATATTCCACGTCCTACAGTGGACATTTCTAAA 151 mous data sets, which drove<br />

interact and how they<br />

the need for clear, statistical<br />

$s_3_export.txt<br />

work together within a<br />

thinking,” Gentleman said.<br />

sequence count<br />

cell. The process also saves both 401 time GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC and money over other “We have no true comprehension 313 of cancer on a molecular level<br />

lab methods.<br />

402 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA yet. We need tools to 291 understand how the genome works and<br />

A former auto mechanic might<br />

403<br />

seem<br />

ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />

like an unlikely we need to know how 235 things interact. If we’re going to go in<br />

404 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT 205<br />

candidate to become a research<br />

405<br />

scientist.<br />

GTGGAAAATTTAGAAATGTCCACTGTAGGACGTGG<br />

But if you follow and poke something, we better know what the domino effect<br />

188<br />

Gentleman’s path from Hondas 406 to Harvard CTGTAGGACGTGGAATATGGCAAGAAAACTGAAAA to the <strong>Hutchinson</strong> will be.” 177<br />

<strong>Center</strong>, his trajectory seems perfectly probable. The former He and his colleagues around the globe collaborate to write<br />

grease monkey has a penchant for<br />

$s_4_export.txt<br />

challenges, so it makes sense free software for the entire scientific community to use. “This is<br />

sequence count<br />

that he’d choose a research endeavor<br />

551 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA<br />

that’s moving at breakneck a high-risk area, which is not where commercial software goes,”<br />

266<br />

speed. For brilliant young minds, 552biocomputing GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC is the most he said. “We’re only interested 232 in being as close to the edge of<br />

challenging field around. 553 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT scientific investigation 187 as we can be. We share to learn. Real<br />

Advances in knowledge and<br />

554<br />

technology<br />

ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />

have transformed change comes from people 164 working well together.”<br />

555 CTGTAGGACGTGGAATATGGCAAGAAAACTGAAAA 161<br />

556 TGTAGGACGTGGAATATGGCAAGAAAACTGAAAAT 139<br />

$s_6_export.txt<br />

sequence count<br />

701 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA 395<br />

702 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 354<br />

703 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT 263<br />

704UNRAVELING ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA VAST DNA SEQUENCES, WRITTEN AS A-G-T-C 232 CODES, REQUIRES POWERFUL TOOLS.<br />

5


M. Elizabeth Halloran, M.D., D.Sc.<br />

Ira Longini, Ph.D.<br />

Biostatisticians<br />

PREDICTING THE SPREAD OF INFECTIOUS DISEASES<br />

When the World Health Organization declared smallpox<br />

eradicated in 1980, there was a giddy overconfidence<br />

that the deadly struggle against the microbial world was ending.<br />

“There was this feeling that we had won the battle against<br />

infectious diseases,” said Dr. Elizabeth Halloran, who studied<br />

tropical diseases in the early 1980s, when there was waning<br />

interest in the topic.<br />

Halloran was not convinced microbes had been subdued,<br />

much less conquered. Nor was Dr. Ira Longini, whose travels<br />

through Latin America brought him face to face with tuberculosis,<br />

syphilis and other infectious<br />

diseases that were presumably under<br />

control.<br />

With research funding and drug<br />

development for such diseases in<br />

full retreat at the time, Halloran and<br />

Longini forged paths in the field of<br />

biomathematics and biostatistics to<br />

study the spread of infectious diseases.<br />

Now, as collaborators, they’re among<br />

the world’s leaders in the field, their<br />

expertise sought widely in the struggle<br />

against new and resurgent infectious diseases. During the last<br />

year, they have consulted with federal and state officials and<br />

have been consulted by world health organizations to help<br />

develop intervention plans to control potential pandemics, such<br />

as avian flu.<br />

Today, the threat of a pandemic flu with the potential to<br />

kill tens of millions is a top concern of public health officials<br />

worldwide. HIV, malaria and tuberculosis kill as many as<br />

6 million people each year. Tuberculosis alone is expected to<br />

infect as many as 1 billion people in the next 20 years.<br />

Small as they are, microbes make up 60 percent of the<br />

planet’s biomass. With so many microbes out there, “We’re<br />

EVERY FEW DECADES, THE INFLUENZA VIRUS TRIGGERS MISERY THROUGHOUT THE WORLD.<br />

further away than ever from closing the book on infectious<br />

diseases,” the Infectious Diseases Society of America declared<br />

last year.<br />

It’s within this context that Halloran and Longini collaborate<br />

to create mathematical models that predict the spread of<br />

disease and simulate intervention strategies to save lives.<br />

Using powerful computers to track the potential path of<br />

infectious diseases, the duo believe their mathematical models<br />

could help save the lives of hundreds of millions of people,<br />

particularly against pandemic flu, which unchecked could<br />

spread across the globe in a matter<br />

of months.<br />

Mathematical models allow researchers<br />

to simulate the spread of disease<br />

through different kinds of settings and<br />

test different kinds of intervention. In<br />

one such model, Longini and Halloran<br />

tracked how quickly pandemic flu would<br />

move across the United States if<br />

nothing were done. In a simulated<br />

60 days, the disease had spread to every<br />

corner of the map. The number of dead:<br />

tens of millions. They developed other models to help predict<br />

which interventions—such as vaccination, keeping children out<br />

of schools and asking people to work from home—would most<br />

effectively control spread of the disease and save the most lives.<br />

It’s a scary scenario, but Longini and Halloran believe the<br />

tools are in place to save the world from disaster. And not just<br />

from influenza.<br />

“We hope that the tools we’re developing will be used for all<br />

emerging diseases,” Longini said.<br />

“You can’t control disease but you can intervene to save<br />

lives,” Halloran said. “You can intervene and change the course<br />

of events.’’<br />

13


14<br />

Stanley Riddell, M.D.<br />

Immunotherapy <strong>Research</strong>er/Oncologist<br />

CANCER KILLERS WITH STAYING POWER<br />

In a perfect world, cancer doesn’t stand a chance of wreaking<br />

havoc. Like a soldier guarding the home shores, the<br />

immune system gives marching orders to a type of white blood<br />

cell known as T-cells to remain vigilant for an invasion of<br />

foreign cells, including cancerous ones. When a T-cell<br />

recognizes an invader, it initiates a process that targets that cell<br />

for destruction.<br />

But cancer is a formidable foe, one that<br />

Dr. Stanley Riddell is all too familiar with<br />

after more than two decades of waging<br />

war against it. “Tumors are very clever and<br />

they utilize evasion strategies to limit the<br />

effectiveness of the immune response,”<br />

he said.<br />

So he’s fortifying the immune system<br />

with better weapons: long-lived T-cells<br />

specially engineered to seek and destroy<br />

cancer.<br />

Through adoptive T-cell therapy,<br />

Riddell and his fellow researchers<br />

extract white blood cells from a cancer<br />

patient and expose them to proteins made<br />

in abundance by tumor cells. Scientists<br />

then identify the few T-cells that recognize the tumor proteins<br />

and stimulate those to divide, generating a billions-strong<br />

population of cancer-fighting cells that can be infused back into<br />

the patient. Ideally, this unique population of T-cells will find<br />

its way to the tumor site and annihilate the cancer cells.<br />

“When you see it work, it is so amazing—the bone marrow<br />

just goes from being full of leukemia to being in remission and<br />

very large tumors simply melt away,” Riddell said.<br />

T-cells, however, have a fatal flaw. They die quickly. And<br />

if an immune response isn’t sustained, cancer eventually<br />

comes back.<br />

Riddell and his colleagues knew immunity could last a<br />

lifetime—that’s how vaccines work. So the researchers reasoned<br />

that perhaps they were starting with the wrong T-cells.<br />

They began advanced testing on different<br />

types of T-cells and found that one<br />

type—central memory cells—had the<br />

staying power the scientists were seeking.<br />

They now had a sustainable starting point<br />

for cancer immunotherapy: T-cells with the<br />

capacity to survive.<br />

Riddell’s next step involves drawing<br />

blood samples from cancer patients, filtering<br />

out their central memory cells and<br />

engineering those cells with receptors to<br />

target tumors.<br />

The approach holds promise for fighting<br />

different types of leukemia, including<br />

chemotherapy-resistant acute lymphoblastic<br />

leukemia in children, and breast,<br />

ovarian and skin cancers. Riddell’s team’s insights may also<br />

strengthen the work of University of Washington researchers<br />

developing potential breast-cancer vaccines.<br />

“We’re really trying to move immunotherapy with central<br />

memory T-cells into the clinic quickly,” Riddell said. “We are<br />

excited by the potential for success and believe that this therapy<br />

can be applied to several types of cancer.”<br />

T-CELLS SWARM A CANCER CELL.


16<br />

Anne McTiernan, M.D., Ph.D.<br />

<strong>Cancer</strong> Prevention <strong>Research</strong>er<br />

T A K I N G S T E P S T O W A R D C A N C E R P R E V E N T I O N<br />

We all know that exercise is good for us. But what kind<br />

and how much?<br />

As a cancer prevention researcher and pragmatist,<br />

Dr. Anne McTiernan has no illusions about most folks’ commitment<br />

to exercise. She understands that people want to know<br />

exactly what they have to do—and how little they need to<br />

do—to reap healthy rewards.<br />

Thanks to McTiernan’s work, some specific answers now<br />

exist about the role of exercise and weight loss in<br />

reducing the risk of cancer. As director<br />

of the <strong>Hutchinson</strong> <strong>Center</strong>’s Prevention<br />

<strong>Center</strong>—a state-of-the-art facility for<br />

conducting research on exercise and<br />

diet—she designs studies with the aim<br />

of reducing the 25 percent of cancers<br />

caused by excess weight and sedentary<br />

lifestyles.<br />

Fewer than one-quarter of<br />

Americans get minimum daily exercise,<br />

even though regular physical activity<br />

reduces body fat, lowers blood pressure,<br />

cholesterol and the risk of diabetes and<br />

cancer, and improves bone and joint<br />

health, sex drive, sleep and memory.<br />

“We have such an epidemic of<br />

obesity and lack of exercise, which is one reason I’ve gravitated<br />

to exercise and weight control,” McTiernan said. “It’s an area of<br />

study that could have a significant impact.”<br />

Exercise trials are uncommon because they’re expensive and<br />

difficult to fund. McTiernan’s group is the first to specifically<br />

look at the effects increased physical activity and weight loss<br />

have on reducing the chance of getting cancer.<br />

Such risk reduction has been difficult to quantify in the<br />

past, but McTiernan has been able to definitely gauge impacts<br />

by measuring so-called biomarkers in research participants.<br />

Among her most important findings, overweight postmenopausal<br />

women who exercised for 45 minutes five days<br />

a week, whittled away unhealthy belly fat and lowered their<br />

estrogen and testosterone levels, hormones that in excess can<br />

contribute to cancer. In a different study, women who walked<br />

leisurely just one to three hours a week<br />

lowered their risk of dying from breast<br />

cancer by one-quarter compared to<br />

sedentary women; those who walked<br />

three to eight hours weekly cut their<br />

risk in half. Another study showed that<br />

exercise six days a week brought both<br />

sexes significant fat loss and a lowered<br />

risk of colon cancer in men.<br />

McTiernan’s groundbreaking work<br />

has put the <strong>Hutchinson</strong> <strong>Center</strong> at the<br />

forefront of the field, earning her an<br />

invitation to join a federal scientific<br />

advisory committee to develop the<br />

nation’s first guidelines to focus on<br />

physical activity—and the first to<br />

recognize the impact of exercise on cancer-risk reduction.<br />

“We’re trying to get specific answers for people: do I need to<br />

lose 50 pounds or will 5 percent of my body weight do it? Will<br />

exercising 20 minutes a day help?” McTiernan said. “Nothing<br />

is guaranteed, but exercise and weight control are like wearing a<br />

seat belt. It reduces your risk.”<br />

EXERCISE AND HEALTHY EATING ARE POWERFUL ANTI-CARCINOGENS.


“THE SEEDS OF<br />

GREAT DISCOVERIES<br />

ARE CONSTANTLY<br />

“THE SEEDS OF GREAT DISCOVERIES ARE CONSTANTLY<br />

FLOATING AROUND, BUT THEY ONLY<br />

FLOATING AROUND, BUT THEY ONLY TAKE ROOT IN<br />

TAKE ROOT IN MINDS<br />

WELL PREPARED<br />

MINDS WELL PREPARED<br />

TO RECEIVE THEM.”<br />

— JOSEPH HENRY<br />

TO RECEIVE THEM.”<br />

A RETROVIRUS’ PATH BECOMES EVIDENT IN AN EVOLUTIONARY TREE.<br />

Donors<br />

PRIVATE CONTRIBUTORS<br />

FISCAL YEAR 2008<br />

Private contributors fund many critical<br />

programs at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />

<strong>Research</strong> <strong>Center</strong>. During this fiscal year,<br />

individuals, corporations, foundations<br />

and other organizations donated $33.7<br />

million through contributions, memorial<br />

and honor donations, and in-kind gifts.<br />

The following donors contributed $5,000<br />

or more between July 1, 2007, and June<br />

30, 2008. President’s Circle members —<br />

donors who have made contributions of<br />

$10,000 or more in flexible funding — are<br />

indicated by (PC). Charter members<br />

of the President’s Circle are indicated<br />

by (PC*). Corporate Affiliates members—<br />

corporations that have made contributions<br />

of $10,000 or more in flexible funding —<br />

are indicated by (CA).<br />

Nobel Laureates Circle<br />

The Nobel Laureates Circle recognizes<br />

contributors who have made cumulative<br />

gifts of $1 million or more. These key<br />

contributors are permanent members of<br />

the Circle which was established in 2001<br />

to honor the <strong>Hutchinson</strong> <strong>Center</strong>’s Nobel<br />

Prize recipients, Drs. E. Donnall Thomas<br />

(1990), Lee Hartwell (2001) and Linda<br />

Buck (2004). By giving at this level,<br />

members of the Nobel Laureates Circle are<br />

at the forefront of philanthropic leadership<br />

and make a significant impact on the<br />

<strong>Hutchinson</strong> <strong>Center</strong>’s mission to eliminate<br />

cancer and related diseases as causes of<br />

human suffering and death.<br />

Madeline and Howell E. Adams, Jr.<br />

Mr. Paul G. Allen<br />

American <strong>Cancer</strong> Society<br />

Amgen Foundation<br />

Anonymous (3)<br />

Robert M. Arnold<br />

Avon Foundation<br />

Bill & Melinda Gates Foundation<br />

Burroughs Wellcome Fund<br />

Canary Foundation<br />

Cell Therapeutics, Inc.<br />

Charles E. Stuart Charitable Foundation<br />

Mylo and Marion Charlston<br />

Damon Runyon <strong>Cancer</strong> <strong>Research</strong><br />

Foundation<br />

David Worthington Garner Trust<br />

Delta Tau Delta Fraternity<br />

Dorothy W. Day Trust<br />

J. Orin and Charlene Edson<br />

Clairmont L. & Evelyn S. Egtvedt<br />

Entertainment Industry Foundation<br />

Erna M. Jorgensen Trust<br />

The Eucalyptus Foundation<br />

Fannie E. Rippel Foundation<br />

Friends of José Carreras<br />

International Leukemia Foundation<br />

Bill and Melinda Gates<br />

Bob and Eileen Gilman Family<br />

The GM Foundation<br />

Calvin A. Gorman Estate<br />

Alice Coulon Hanson<br />

Lee Hartwell and<br />

Theresa Naujack Hartwell<br />

Bob and Pat Herbold<br />

Arthur P. Holm Estate<br />

Howard Hughes Medical Institute<br />

Yvonne Twining Humber Estate<br />

J. Orin Edson Foundation<br />

Jacob Green Charity Golf Classic<br />

James B. Pendleton Charitable Trust<br />

James S. McDonnell Foundation<br />

Nelda Kleinschmidt<br />

Lance Armstrong Foundation<br />

The Leukemia & Lymphoma Society<br />

Listwin Family Foundation<br />

Lucille P. Markey Charitable Trust<br />

M. J. Murdock Charitable Trust<br />

Mr. John A. McCone and<br />

Mrs. Theiline Pigott McCone<br />

Microsoft Corporation<br />

Moneytree, Inc.<br />

The Moyer Foundation<br />

Craig and Marie Mundie<br />

Muscular Dystrophy Association<br />

The Norcliffe Foundation<br />

Dorothy and Everett O’Neill<br />

The Paul G. Allen Family Foundation<br />

Prostate <strong>Cancer</strong> Foundation<br />

James and Sherry Raisbeck<br />

Richard C. Goldstein Private Foundation<br />

Jim Roberts and Pam Becker<br />

Safeway Inc.<br />

James G. Scripps Estate<br />

The Seattle Foundation<br />

Susan G. Komen for the Cure<br />

Herman E. Tenzler Estate<br />

Dr. and Mrs. E. Donnall Thomas<br />

Mikal and Lynn Thomsen<br />

Hazel Johnson Toly Estate<br />

Bonnie and Jim Towne<br />

United Way of King County<br />

W. M. Keck Foundation<br />

Richard W. Weiland †<br />

The William Randolph<br />

Hearst Foundations<br />

<strong>Research</strong> Benefactors<br />

$1 million or more<br />

Avon Foundation<br />

Canary Foundation<br />

Entertainment Industry Foundation<br />

The Eucalyptus Foundation<br />

Friends of José Carreras<br />

International Leukemia Foundation<br />

Alice Coulon Hanson<br />

Hutch Holiday Gala<br />

(Grace Heffernan Arnold Guild<br />

and Gala Board of Trustees)<br />

The Leukemia & Lymphoma Society<br />

Listwin Family Foundation<br />

Safeway Inc.<br />

Richard W. Weiland Estate<br />

<strong>Research</strong> Patrons<br />

$500,000 - $999,999<br />

Anonymous (1)<br />

Peter Jerome Cervenak Estate<br />

Charles E. Stuart Charitable Foundation<br />

Climb to Fight Breast <strong>Cancer</strong><br />

(CFBC Committee)<br />

J. Orin and Charlene Edson PC<br />

Bob and Eileen Gilman Family<br />

Bob and Pat Herbold PC*<br />

Susie Morganti PC<br />

The Paul G. Allen Family Foundation<br />

Sam and Betty Lebid Foundation<br />

<strong>Research</strong> Partners<br />

$250,000 - $499,999<br />

American <strong>Cancer</strong> Society<br />

Apoptos Inc.<br />

Bill & Melinda Gates Foundation<br />

Damon Runyon <strong>Cancer</strong> <strong>Research</strong><br />

Foundation<br />

Edna Williams Curl Trust<br />

Fate Therapeutics<br />

Giles W. and Elise G. Mead Foundation<br />

Hutch Award Luncheon<br />

(Hutch Award Luncheon Committee)<br />

J. Orin Edson Foundation<br />

James B. Pendleton Charitable Trust<br />

Lance Armstrong Foundation<br />

M. J. Murdock Charitable Trust<br />

Marsha Rivkin <strong>Center</strong> for<br />

Ovarian <strong>Cancer</strong> <strong>Research</strong><br />

National Marrow Donor Program<br />

Pete Gross House Luncheon<br />

(Pete Gross House Council)<br />

Premier Chefs Dinner (Magnolia Guild<br />

and Chefs Advisory Board)<br />

Doris L. Sather Estate<br />

The Seattle Foundation<br />

Susan G. Komen for the Cure<br />

Mae Sim Thomas Estate<br />

Washington State Department of Health<br />

Wayne D. Kuni and<br />

Joan E. Kuni Foundation<br />

<strong>Research</strong> Associates<br />

$100,000 - $249,999<br />

American Society of Clinical Oncology<br />

American Society of Hematology<br />

Amgen Foundation<br />

The Anderson Foundation PC*<br />

Burroughs Wellcome Fund<br />

Charles Epstein Trust<br />

The Christopher Harper Trust<br />

Dr. and Mrs. Edmund R. Clarke<br />

Roger and Gloria Crouch PC*<br />

Mike and Karen Dunlop PC*<br />

John and Christine Enslein<br />

Erna M. Jorgensen Trust<br />

Fanconi Anemia <strong>Research</strong> Fund, Inc.<br />

Fisher Radio Seattle’s AM 570 KVI<br />

Friends of the Hutch<br />

Calvin A. Gorman Estate<br />

The Greater Kansas City<br />

Community Foundation<br />

Howard Hughes Medical Institute<br />

Intel Corporation<br />

Jacob Green Charity Golf Classic<br />

The John C. and Karyl Kay Hughes<br />

Foundation PC*<br />

Thomas “Red” Kelly Estate<br />

Lymphoma <strong>Research</strong> Foundation<br />

Phoebe P. Marriott Estate<br />

Merck & Co., Inc.<br />

Microsoft Corporation<br />

The Moyer Foundation<br />

Muscular Dystrophy Association<br />

Prostate <strong>Cancer</strong> <strong>Research</strong> Institute<br />

Richard C. Goldstein Private Foundation<br />

The Rona Jaffe Foundation PC<br />

Satellite Healthcare<br />

Loretta V. Schossow Estate<br />

John A. Tershin Estate<br />

Mikal and Lynn Thomsen PC*<br />

Travel & Leisure Auction<br />

(Margaret E. Martindale Guild)<br />

United Way of King County<br />

The V Foundation for <strong>Cancer</strong> <strong>Research</strong><br />

W. M. Keck Foundation<br />

<strong>Research</strong> Fellows<br />

$50,000 - $99,999<br />

American Airlines<br />

American Heart Association<br />

Anonymous (1) PC*<br />

Anonymous (1) PC<br />

The Bayley Family Foundation<br />

David and Joanna Beitel PC*<br />

Todd, Mary and Geary Britton-Simmons<br />

Costco Wholesale Corporation<br />

Cuyamaca Foundation<br />

David Worthington Garner Trust<br />

Delta Tau Delta Fraternity<br />

Dorothy A. Jarosek Trust<br />

Mark and Carolyn Edson PC*<br />

Clairmont L. & Evelyn S. Egtvedt<br />

Employees Community Fund<br />

of the Boeing Company<br />

Fidelity Charitable Gift Fund<br />

Jane B. Folkrod<br />

Edward and Karen Fritzky Family PC*<br />

Florence Galbraith Estate<br />

Genentech, Inc.<br />

David and Patricia Giuliani PC*<br />

Rochelle Greenberg<br />

Mr. David W. Hansen and<br />

Ms. Trish M. King PC*<br />

Francis E. Hart Estate<br />

Inserra Family Foundation<br />

Jeffrey Rosenzweig Foundation for<br />

Pancreatic <strong>Cancer</strong> <strong>Research</strong><br />

Lisa Johnson of Johnson<br />

International Industries PC<br />

Grace M. Kaylor Estate<br />

Mrs. Yvonne Gemmell Keene<br />

KOMO 4 Television<br />

Laird Norton Tyee Trust Company<br />

Linsco Private Ledger<br />

Martin-Fabert Foundation<br />

The Michael Miyauchi Foundation<br />

National Childhood <strong>Cancer</strong> Foundation<br />

Ocean Spray<br />

19<br />

21


20<br />

Donors<br />

Olympia Guild<br />

Ora Lee A. Anderson Trust<br />

Pancreatic <strong>Cancer</strong> Action Network<br />

Phi Beta Psi Sorority<br />

Platt Electric CA<br />

Satya and Rao Remala Foundation PC*<br />

The Stack Foundation<br />

Samuel † and Althea Stroum<br />

Suskin Foundation<br />

John T. Toland Estate<br />

University of Washington<br />

Kenneth L. and Evelyn L. Walters PC*<br />

Washington <strong>Research</strong> Foundation<br />

Yvonne M. Betson Trust<br />

<strong>Research</strong> Sponsors<br />

$25,000 - $49,999<br />

Alaska Airlines<br />

Anonymous (2) PC*<br />

Anonymous (1) PC<br />

Bank of America Corporation<br />

Bayley Construction CA<br />

Carl and Renée Behnke PC*<br />

Sally Skinner Behnke PC*<br />

Anselmo Belmondo Estate<br />

Leslie Burrows<br />

<strong>Cancer</strong> <strong>Research</strong> Institute<br />

Carlyle, Inc.<br />

Children’s Hospital &<br />

Regional Medical <strong>Center</strong><br />

Click Wine Group<br />

Community Foundation for<br />

Southwest Washington<br />

Driving for a Cure<br />

Jack and Sheri Edson PC*<br />

Edward Jones<br />

Carol and Karl Ege PC*<br />

Eli Lilly and Company<br />

Elmo Zumwalt III Guild<br />

Mrs. Ruth E. File PC<br />

Cathryn Fortune and John Shimer<br />

Fortune Family Foundation PC*<br />

The Foster Foundation<br />

Alan and Mary Frazier PC*<br />

Frazier Healthcare Ventures<br />

<strong>Fred</strong> <strong>Hutchinson</strong> Team Shootout<br />

Grand Chapter of Washington -<br />

Order of the Eastern Star<br />

Erik and Susan Hansen PC*<br />

Mr. and Mrs. John Harnish<br />

Harold & John Steinberg<br />

Memorial Nursing Scholarship<br />

The Helen Hay Whitney Foundation<br />

Alan and Wendy Higginson PC<br />

<strong>Fred</strong> and Dawn Hines PC*<br />

Mr. and Mrs. Charles Hogan<br />

Human Frontier Science Program<br />

Maxine Isham Estate<br />

Edith G. Iverson Estate<br />

Henry and Mary Ann James PC*<br />

Mr. and Mrs. J. Michael Johnston PC*<br />

David Jones and<br />

Maryanne Tagney-Jones PC*<br />

King County Combined<br />

Federal Campaign<br />

Klingman Open<br />

Mike and Debbie Koss PC*<br />

The Lambeth Family Designated Fund<br />

Laura A. Landro and Richard E. Salomon<br />

Rae and Mark Lembersky PC*<br />

Life Possibilities<br />

Donors<br />

“THERE’S A HUGE LEVEL OF COMMITMENT IN SCIENCE.<br />

YOU DON’T GO HOME JUST BECAUSE IT’S A CERTAIN TIME;<br />

Benito and Carmen Lopez PC*<br />

David Mann and<br />

Ann Thomson Mann PC*<br />

Maxim Group LLC<br />

Mary Jane McElyea Estate<br />

MDRT Foundation<br />

Merrill Lynch, Pierce,<br />

Fenner & Smith, Inc.<br />

Mo-dazz for the Arts<br />

National Breast <strong>Cancer</strong> Foundation, Inc.<br />

News Talk 710 KIRO<br />

Novartis<br />

Carol-Ann O’Mack and<br />

John Deininger PC*<br />

Mr. and Mrs. Carroll O’Mack PC*<br />

Milton and Ruth Rubin PC*<br />

Russell Investments<br />

Ryan Hill <strong>Research</strong> Foundation at<br />

Virginia Mason Medical <strong>Center</strong><br />

SASCO<br />

Schwab Charitable Fund<br />

George H.J. Shaw<br />

Jack C. Shaw and Wenonah Shaw<br />

Sheldon Manufacturing, Inc.<br />

Frank and Harriet Shrontz PC*<br />

Lorene Spurling Estate<br />

Howard and Cynthia Steinberg<br />

Gregory and Charlene Steinhauer PC*<br />

Jonathan G. Thomason and<br />

Megan L. Thomason PC*<br />

Union Bank of California<br />

Doug and Maggie Walker PC*<br />

Washington State Employee<br />

Combined Fund Drive<br />

Wyner/Stokes Foundation<br />

Yvonne M. Betson Trust –<br />

Jeff and Ethel Maxwell PC*<br />

Mark and Donette Zbikowski PC<br />

Zillow.com<br />

Joseph and Janet Zinn PC*<br />

<strong>Research</strong> Supporters<br />

$10,000 - $24,999<br />

Charles M. Ackerman and<br />

Barbara Clanton Ackerman<br />

Acme Food Sales, Inc.<br />

Mr. and Mrs. Mike Adair<br />

Alexandria Real Estate Equities, Inc.<br />

American <strong>Research</strong> &<br />

Management Company<br />

Mr. and Mrs. James K. Anderson, Jr.<br />

Ric and Kaylene AndersonPC* Anonymous (7) PC*<br />

Anonymous (4) PC<br />

Dr. <strong>Fred</strong>erick and Dita AppelbaumPC* Ms. Doree R. Armstrong<br />

Robert M. ArnoldPC Stephen D. ArnoldPC* Athena Partners<br />

The Ayco Charitable Foundation<br />

Peggie F. Nishimura Bain † PC*<br />

Joe and Karyn BarerPC Mrs. and Mr. Angela K. Barrie<br />

Ron and Joan BayleyPC Bell Lumber & Pole<br />

Mr. and Mrs. Jerry J. Belur<br />

Ben Bridge Jeweler<br />

Yahn Bernier and<br />

Beth McCaw<br />

Evva M. Betts Estate<br />

BK Invitational Golf Tournament<br />

Bill and Jeanne Bliss PC<br />

bmi<br />

The Boeing Company<br />

Bonneville Seattle<br />

Mr. and Mrs. Louis L. Borick PC<br />

Cathy Boshaw and Doug Edlund PC*<br />

Edgar and Elisabeth Bottler PC*<br />

Mr. and Mrs. Erik P. Breivik PC*<br />

Sally V. Brotman PC*<br />

Glen A. Buettgenbach PC*<br />

Shari and <strong>Fred</strong>erick Burns PC*<br />

Mr. Gary L. Bylund PC*<br />

CAC Real Estate Management Co., Inc.<br />

<strong>Cancer</strong> <strong>Center</strong> for Detection<br />

and Prevention<br />

Cangen Biotechnologies<br />

Mr. Joseph A. Carbone PC<br />

Carlson Family Foundation PC*<br />

Mrs. Cecelia C. Carr PC*<br />

Mr. and Mrs. John H. Case<br />

Celgene<br />

Spencer W. Chaffey Estate<br />

Vibhas and Arundhati Chandorkar PC*<br />

Charles B. See Foundation PC*<br />

Brad and Judy Chase PC*<br />

Dr. and Mrs. Martin A. “Mac” Cheever<br />

Dale Chihuly<br />

Chihuly, Inc.<br />

Mr. Ryan A. Christensen<br />

The Church of Jesus Christ of<br />

Latter-Day Saints Foundation<br />

Citi Global Impact Funding Trust, Inc.<br />

Continental Airlines<br />

Cornerstone Advisors, Inc.<br />

Thomas G. Corrigan Estate<br />

CRAVE<br />

Mr. and Mrs. Thomas J. Cusick III<br />

Dick and Jill Davis<br />

Mr. Steve Davis and Mr. Bob Evans PC<br />

Dr. H. Joachim Deeg and<br />

Mrs. Francoise Deeg-Le Gal<br />

Dick and Chris DiCerchio PC*<br />

Eric and Holly Dillon PC*<br />

The Dolsen Foundation PC*<br />

Mac and Patti Douglas PC<br />

Jan Dulet PC*<br />

Mr. and Mrs. Kevin P. Eagan PC*<br />

Barbara Feasey and Bill Bryant PC*<br />

Fidelity Brokerage Services LLC<br />

Phelps and Christel Fisher<br />

Myrtle I. Forrest Estate<br />

Foss Maritime Company<br />

Mr. Robert Frey<br />

Mrs. E. Peter Garrett<br />

The Geiger Family Foundation PC*<br />

Bruce and Alice Geismar PC*<br />

Gene Juarez Salons & Spa<br />

Mr. and Mrs. Robert L. Gerth PC*<br />

Mr. Miles Gilburne and Ms. Nina Zolt PC<br />

Aaron and Betty Gilman Family<br />

Mr. and Mrs. Wayne C. Gott PC*<br />

Ken and Betsy Greenbaum PC*<br />

Mark Groudine and Cynthia Putnam<br />

Thomas and Jennifer Hanly PC<br />

John and Suzanne Hansen PC<br />

Mr. and Mrs. Mark C. Hansen<br />

Lee Hartwell and<br />

Theresa Naujack Hartwell PC*<br />

Jeff and Candace Havens PC<br />

Hal and Jerry Haynes<br />

Elizabeth Hebert and Donald Guthrie PC*<br />

Conrad Hewitt<br />

The HG Foundation<br />

Mr. and Mrs. Mike Hickey PC*<br />

Pete and Leslie Magid Higgins PC*<br />

Mr. and Mrs. Neal Hooberman<br />

Peter and Margaret Horvitz PC*<br />

Mr. Bradley J. Horwitz<br />

The Horwitz Family<br />

Memorial Foundation PC<br />

Mr. Norman E. Hubbard and<br />

Ms. Lynne Thompson PC<br />

The <strong>Hutchinson</strong> Family PC*<br />

The Ildhuso Family PC*<br />

Infinity Pharmaceuticals<br />

Mr. and Mrs. Chris R. Ishii PC*<br />

Jeremy and Jacquelyn Jaech PC*<br />

Mrs. Kristen Jarvis<br />

Jean E. Thomson Foundation PC*<br />

Jewish Community Foundation<br />

of Greater Hartford<br />

Mike and Diane Johansson PC*<br />

John L. Scott Real Estate<br />

John M. Gilbertson Foundation<br />

John R. and Paula Blood Family Trust<br />

Arnold Kas PC*<br />

Donna Kelly<br />

Kenneth and Dorothy L. Anderson<br />

Family Foundation<br />

Keyes Foundation PC*<br />

King County Employee<br />

Charitable Campaign<br />

The Kinsman Foundation<br />

Nelda Kleinschmidt<br />

KMS Financial Service<br />

James and Lorna Kneeland<br />

Reg and Ann Koehler PC*<br />

Judy Kornell<br />

Jackie and Skip Kotkins PC*<br />

Mrs. <strong>Fred</strong>erick Kullman<br />

Mr. and Mrs. Roger W. Kuula PC*<br />

Sandra L. La Haye PC*<br />

Lane Powell PC CA<br />

Lehman Brothers<br />

The Lester and Bernice Smith<br />

Foundation PC*<br />

Jim and Maureen Lico PC<br />

The Louis L. Borick Foundation PC*<br />

Dan Madsen and Amanda King<br />

Mark and Nikki Mahan PC*<br />

Mandarin Oriental, New York<br />

David and Nathan<br />

Mandelbaum Family PC*<br />

Mariners Care<br />

Mattaini Family Foundation PC*<br />

Matthews Cellars<br />

Bev and Jim Mauser<br />

Trish and Peter May<br />

John and Liz McAdam PC*<br />

Rob and Teddy McGregor PC<br />

Mikimoto Co. Ltd.<br />

Rick and Joyce Miner PC<br />

Mr. and Mrs. Michael J. Mitrovich<br />

Monterey Fund, Inc.<br />

Mr. and Mrs. Thomas G. Mormino<br />

Joan Morse and Dean Hachamovitch PC<br />

Karen and Jamie Moyer PC*<br />

Muckleshoot Indian Tribe PC<br />

Shan and Lee Mullin PC*<br />

Kit and Sally Narodick PC*<br />

Paul and Carol Neiman<br />

Robert Nelsen and Ellyn Hennecke PC*<br />

Martin and Vicki Nelson PC*<br />

Nintendo of America Inc.<br />

Northern Trust<br />

Northern Trust Bank, FSB<br />

NSB Postech<br />

Lee and Deborah Oatey<br />

Mr. Bruce A. Oberg<br />

Mr. and Mrs. James Odom<br />

Osiris Therapeutics, Inc.<br />

PDL Biopharma, Inc.<br />

Harry Jonathan Pearce PC*<br />

Ms. Pamela S. Pearson and<br />

Mr. Michael Voegtlin<br />

Mark and Nancy Pellegrino PC*<br />

Pete and Wilma Olsen Foundation PC*<br />

Donald and Diane Peterson PC*<br />

Pfizer Inc.<br />

John B. Piacentini Family PC*<br />

Paul and Beth Picardo PC*<br />

Dean and Gwenn Polik and<br />

Valerie Polack PC*<br />

Arlen and Debra Prentice PC*<br />

The Pride Foundation<br />

Proteolix, Inc.<br />

Puget Sound Energy<br />

Bruce and Celia Pym PC*<br />

P. S. Radhakrishnan<br />

Alexandra Rector<br />

Residence Inn by Marriott -<br />

Seattle Downtown/Lake Union<br />

Jim Roberts and Pam Becker PC*<br />

Ronald D. and Joan A. Roberts PC<br />

Mrs. R. Elaine Robinson PC<br />

Mr. Tom Robinson and<br />

Ms. Carla Murray PC<br />

Roke Foundation<br />

Michael B. Rubin and Sharon K. Birzer<br />

Jon and Judy Runstad PC*<br />

Sajasa Construction, Inc. CA<br />

Don E. Sandberg Estate<br />

Sandberg Northwest Volvo<br />

Savings & Finance Commercial<br />

Bank Limited<br />

Scandinavian Airlines<br />

Schnitzer Investment Corp.<br />

Keith and Jennifer Schorsch PC*<br />

Jim and Bet Schuler<br />

Schwartz Brothers Restaurants CA<br />

Seattle <strong>Cancer</strong> Care Alliance<br />

Bill and Marlene Semple PC*<br />

The Sign of the Orz<br />

Jim and Jan Sinegal PC*<br />

Singapore Airlines<br />

SiRAS.com<br />

Nate and Luanne Skow PC<br />

Mr. and Mrs. Philip M. Smart, Jr.<br />

Mr. and Mrs. Steven Smith PC*<br />

Sound Community Bank/Laurie Stewart<br />

Doug and Marilyn Southern PC*<br />

Sports Radio 950 KJR<br />

Tom and Diane St. John PC*<br />

Michael and Debbie Stein PC*<br />

Allyn Stellmacher and Terry Samilson PC<br />

John and Sherry Stilin PC<br />

Cynthia Stroum PC*<br />

The Stroum Family Foundation<br />

Symetra Financial<br />

Dr. and Mrs. E. Donnall Thomas PC*<br />

Thrasher Koffey Foundation<br />

Bonnie and Jim Towne PC*<br />

YOU GO HOME WHEN YOUR RESEARCH IS THE BEST IT CAN BE.”<br />

Turner Construction Company CA<br />

United Jewish Foundation of<br />

Metropolitan Detroit<br />

University Mechanical Contractors, Inc.<br />

Tom and Margo Van Halm PC*<br />

Van Sloun Foundation<br />

Neil and Sylvia Van Sloun PC*<br />

Lawrence Votta and Maria Martinez<br />

W Real Estate Services<br />

Hans and Anne Marie Wachtmeister PC*<br />

Shannon and Lucy Wall Estate<br />

Mr. Joseph N. Walter and<br />

Ms. Kathy L. Mares PC<br />

Washington Holdings<br />

Jim and Diane Watson<br />

John W. and Elizabeth Weaver PC<br />

Nancy Weintraub<br />

Nancy L. Wells PC*<br />

Ms. Mary H. Wiese<br />

Doug and Ann Williams PC*<br />

Mr. Donald Williamson PC<br />

The Woldenberg Foundation<br />

Patricia C. Youngman<br />

Melinda Yount PC<br />

Janet and Richard Yulman PC*<br />

Zimmer Gunsul Frasca Architects LLP CA<br />

ZymoGenetics, Inc. CA<br />

<strong>Research</strong> Friends<br />

$5,000 - $9,999<br />

Aero Controls, Inc.<br />

Affiliated Engineers Inc<br />

Akiko Mikami Shimatsu Foundation<br />

Anonymous (2)<br />

Anthropologie<br />

Mr. and Mrs. Ron R. Bailey<br />

Ballard Technology, Inc.<br />

Betty Banghart<br />

Charles and Linda Barbo<br />

BarclayDean<br />

The Barton Family Foundation<br />

BD Biosciences<br />

Bear Stearns & Co. Inc.<br />

Benaroya Foundation<br />

Ms. Jayme L. Benson<br />

Mr. and Mrs. Bradley J. Berg<br />

Mr. Arnie Bergh<br />

Beta Sigma Phi, Xi Gamma Zeta<br />

The Bishop Family Legacy Foundation<br />

Dr. and Mrs. Joel M. Blumberg<br />

Mr. and Mrs. Peter C. Boal<br />

The Bob Tonkin Memorial Classic<br />

Sandra A. Boeskov<br />

Bonhams & Butterfields<br />

Mabel L. Bonnichsen Estate<br />

Paul and Lynn Bordelon<br />

Mr. and Mrs. Philip Borden<br />

Robert James Bracken Estate<br />

Mr. and Mrs. Mark S. Britton<br />

Mr. James Brownrigg<br />

Builders Financial Services LLC<br />

<strong>Fred</strong> and Joan Burnstead<br />

CAC Group<br />

Mr. and Mrs. Bob Carr<br />

Dr. Bruce L. A. Carter and<br />

Ms. Jean Enersen<br />

Cathay Pacific<br />

Madam Ho Ching<br />

Robert Christiansen<br />

Clovis Foundation<br />

Roger and Kimberly Collins<br />

Combined Federal Campaign<br />

Kitsap-Mason Counties<br />

Eva Corets and Josh Beloff<br />

Larry and Vickie Culver<br />

Mr. and Mrs. Michael L. Darland<br />

Mr. and Mrs. Matthew J. Deines<br />

Delta Dental Washington Dental Service<br />

Mr. and Mrs. Eugene W. Devlin<br />

Mr. and Mrs. Donald A. Dick<br />

Larry and Gayle Dickenson<br />

The Diffenbaugh Foundation<br />

Mr. and Mrs. John D. Diffenbaugh<br />

Direct Resources Group, Inc.<br />

Mr. and Mrs. Matthew J. Doron<br />

Julie Edsforth and Jabe Blumenthal<br />

El Gaucho<br />

Mr. and Mrs. Thomas A. Ellison<br />

Mr. and Mrs. Steven J. Elsoe<br />

Joan Enticknap<br />

Mr. and Mrs. Joseph Faltermeier<br />

Mr. Justin B. Field<br />

Fingerprint Communications, LLC<br />

Fischer Family<br />

Mr. Jim Ford<br />

Mr. Lloyd D. Frink and Ms. Janet Angell<br />

June B. Gasparovich Estate<br />

Mr. John Gebert, Jr.<br />

Genzyme Corporation<br />

<strong>Fred</strong>erick M. Goldberg and<br />

Carolyn Lakewold<br />

Goldman, Sachs & Co.<br />

Roger and Jennifer Grambihler<br />

Grand Foundation<br />

Dr. and Mrs. John W. Green<br />

Mr. Leonard W. Green<br />

Nancy Greenwood Vehrs and Jeff Vehrs<br />

Guy Carpenter & Company, LLC<br />

GW Cadbury Charitable Trust<br />

Mr. Felix R. Harke<br />

Harris myCFO Foundation<br />

Harry and Faye Rosenberg Trust<br />

Mr. and Mrs. O. Peder Haslestad<br />

Ms. Jean S. Heidt<br />

The Hemp Family LLC<br />

Richard and Marilyn Herzberg<br />

Mr. and Mrs. Harold W. Hill<br />

Mr. and Mrs. Richard Holland<br />

Hotel 1000<br />

Mr. and Mrs. Hong B. Huey<br />

Integra Chemical<br />

Interstate Distributor Co.<br />

Mr. and Mrs. Claude A. Ising<br />

The Joby Foundation Inc.<br />

Mr. and Mrs. Jon Jones<br />

Kate Shea Foundation<br />

Mr. and Mrs. Mel Katten<br />

Keith L. Betts and Marian L. Betts Trust<br />

Olive Kerry Estate<br />

KIRO Television<br />

Kitsap Bank<br />

Mr. and Mrs. Tim Kittilsby<br />

Mr. Justin Knight<br />

Carolyn and Kevin Koester<br />

Nora Korg<br />

Kosan Biosciences<br />

KPFF Consulting Engineers<br />

Yvonne P. and Jack Lamey<br />

Mr. and Mrs. Brad Lange<br />

Lease Crutcher Lewis<br />

Mr. James C. Logsdon<br />

Mr. John C. Logsdon<br />

—DR. STANLEY RIDDELL<br />

Mr. Michael A. Logsdon<br />

Lopez, Hodes, Restaino,<br />

Millman and Skikos<br />

Louise H. & Edward R.<br />

Meyer Memorial Trust<br />

MagicHour Films<br />

Jon and Nancy Magnusson<br />

Helen and David Mandley<br />

Joyce E. Marshall Estate<br />

Mr. and Mrs. Mario Mazzola<br />

Bruce and Jolene McCaw<br />

Mark A. and Marna L. McNaughton<br />

MDS Analytical Technologies<br />

Jessica Meisels<br />

Mellon Bank N.A.<br />

Merchant & Gould<br />

Necia G. Miles Estate<br />

Mr. and Mrs. John F. Miller, Jr.<br />

Richard and Kathryn Miyauchi<br />

Mr. and Mrs. R. David Mushen<br />

Karin and Scott Nagel<br />

National Brain Tumor Foundation<br />

NC Machinery Company<br />

Myrtle M. Nelsen Estate<br />

Mr. and Mrs. Eugene K. Neuberger<br />

Mr. and Mrs. Wayne E. Niemuth<br />

North American Management Corp.<br />

North Mason <strong>Cancer</strong> Crusaders<br />

Pamela B. Katten Memorial<br />

Leukemia <strong>Research</strong> Foundation<br />

Christopher P. Parios and Susan Wyant<br />

Mr. Paul S. Pariser<br />

Mrs. Terry Pero<br />

Mr. and Mrs. Wayne M. Perry<br />

Elsbeth Pfeiffer<br />

Mr. and Mrs. John M. Pinkerton<br />

Mr. and Mrs. Matt Pool<br />

Mr. and Mrs. Stephen S. Poore<br />

Precor, Inc.<br />

Q13 FOX/MYQ2<br />

James and Sherry Raisbeck<br />

James V. Ramsdell, Jr.<br />

Raymond James & Associates, Inc.<br />

REB Enterprises, Inc.<br />

Mrs. Sally Reiquam<br />

Chad and Carol Richardson<br />

Ms. Lynn Ristig and Mr. Craig Shrontz<br />

Thurston and Catherine Roach<br />

Mr. and Mrs. Henry M. Robinett<br />

Robinett Investment Co., LLC<br />

John McVickar Robinson and<br />

Elizabeth W. Robinson<br />

Nea Lynn Robinson<br />

Mr. and Mrs. Gene E. Roeglin<br />

Rose-Marie and Jack R.<br />

Anderson Foundation<br />

Rowan University<br />

Kimberly Y. Ruhana and<br />

George W. Ruhana<br />

S*Bio<br />

Mrs. Colleen E. Schafer<br />

Mr. and Ms. Alan D. Sclater<br />

Ruth Martens Scott<br />

Seattle Genetics, Inc.<br />

Seattle Seahawks<br />

Seredigm<br />

Ms. Amy E. Shigo<br />

Andrew Short<br />

Mr. and Mrs. Raymond Sich<br />

Siemens Building Technologies, Inc.<br />

Mr. and Mrs. John Skovron<br />

21


22<br />

Donors<br />

Mr. Laurence H. Smead<br />

Ned and Carolyn Snow<br />

Ronald and Angela Souza<br />

Mr. and Mrs. Frank L. and<br />

Esther A. Springer<br />

Stafford Frey Cooper<br />

Laurie Stewart<br />

Ms. Edith S. Sullivan<br />

The Swanson Family<br />

Ms. Myra H. Tanita<br />

Team Photogenic<br />

Mr. and Mrs. Bruce G. Thayer<br />

Mr. and Mrs. Thomas M. Todaro<br />

Mr. and Mrs. Frank J. Tonkin, Jr.<br />

Trident Seafoods Corporation<br />

Gary and Amanda Tucci<br />

Ueland Foundation<br />

United Way of Tri-State<br />

The UPS Foundation<br />

UW Medicine<br />

Mr. Neil R. Wachter<br />

Washington Mutual Foundation<br />

David and Marsha Weil<br />

Michael and Paula Weintraub<br />

Windstar Cruises<br />

Mr. Chuck Wolfe<br />

Christine and William Woodcock<br />

Woods & Associates<br />

Mr. and Mrs. Scott Allan Wroblewski<br />

Mark A. Young and Kelly Johnson<br />

Zaaz, Inc.<br />

Legacy Partners in <strong>Research</strong><br />

Legacy Partners in <strong>Research</strong> are individuals<br />

who support the <strong>Hutchinson</strong> <strong>Center</strong><br />

through a bequest in their will, life income<br />

gift, life insurance, retirement assets or<br />

other planned gifts. As Legacy Partners in<br />

<strong>Research</strong>, they create a legacy for themselves<br />

and their families and play a pivotal<br />

role in benefiting future generations.<br />

Charles M. Ackerman and<br />

Barbara Clanton Ackerman<br />

Mr. Donald D. Ackley<br />

Dorothy J. Albro<br />

Arleta Rae Allen<br />

June M. Allen<br />

Ms. Chelea Alwine<br />

Jan A. Amen<br />

Alex and Helen Andersen<br />

Ms. Glenda W. Anderson<br />

Glenn and Lois Anderson<br />

Mrs. Grace Anderson<br />

Stuart L. and Karen C. Anderson<br />

Ms. Victoria Andrews<br />

Anonymous (122)<br />

<strong>Fred</strong>erick J. and Jane C. Artz<br />

Robert and Clodagh Ash<br />

Dr. Elizabeth Atwood<br />

N. Faye Bachmeier<br />

Patricia M. Bartlett<br />

Mr. Alfred A. Baston<br />

Thomas P. and I. Georgina Bayley<br />

Ms. Diana Beckers<br />

Barbara M. Bedayan<br />

Rod Belcher<br />

Mr. Will H. Bennett<br />

Mrs. Constance M. Benston<br />

Marc A. Berger<br />

Mrs. Sidonia Berglund<br />

“WHEN RESEARCH DOESN’T TURN OUT THE WAY YOU EXPECT IT TO,<br />

Yahn Bernier and Beth McCaw<br />

Mr. and Mrs. Harry C. Berryman<br />

Henry A. and Marjorie M. Bickel<br />

Sandra Kailes Biller<br />

Ellen O. Blackstone<br />

Sandra A. Boeskov<br />

Barbara A. Bonamy<br />

Christine Borgen<br />

Robert and Sheila Bosanko<br />

Arthur R. and Bernice J. Bowers<br />

Sandra Brentlinger<br />

Elmore G. and Dorcas Brolin<br />

Glen A. Buettgenbach<br />

Mr. and Mrs. Angelo Bulgarelli<br />

Mrs. Jennie K. Burwell<br />

Mr. and Mrs. Jack and Patty Bush<br />

Stephen D. Cameron<br />

Clint and Ruth Cannon<br />

Phillip and Violette Carlson<br />

Mrs. Lucy Carney<br />

Douglas A. Case<br />

Hazel E. Case<br />

Mary E. Cederlund<br />

Cora Chads<br />

Mylo and Marion Charlston<br />

Ms. Barbara Chester<br />

Mr. Lawrence N. Christian<br />

Susan L. Christiansen<br />

Dr. and Mrs. Edmund R. Clarke<br />

Emanuel and Susan Cohen<br />

Mr. Milton M. Cohen<br />

Gladys M. Collins<br />

Bob and Sylvia Cook<br />

<strong>Fred</strong> Corrado<br />

Mr. Martin J. Costello<br />

Mary Pat Cotty<br />

Mr. and Mrs. Fenwick J. Crane<br />

Roger and Gloria Crouch<br />

Lamont Crumley and<br />

D. Dianne Wilson-Crumley<br />

Margaret Cullor<br />

Mrs. Leah Currie<br />

Daryl Drew Charitable Foundation<br />

Mr. Roy V. De Britz<br />

Joan A. De Bruin<br />

Tillie I. De Leon<br />

Mr. and Mrs. Henry W. and<br />

Frances C. Decker<br />

Lou Denney<br />

Leslie and Deborah Disch<br />

Chris and Viki Parrott Dragich<br />

Wayne D. and Susan E. DuPont<br />

Mr. James P. Dye<br />

Peter S. and Sandra W. Dyer<br />

Mr. and Mrs. Robert L. Ecker<br />

Demerise Eddy<br />

Cecil David Enman and Norma J. Enman<br />

Thomas G. and Kay Nozaki Ewing<br />

June Faralla<br />

Mr. Richard Faulstich<br />

John and Rosemary Fedorochko<br />

Mary Jane Fee<br />

Clifford H. Fiscus<br />

Mrs. Lorraine M. Flanagan<br />

Anton M. and Barbara C. Fleischman<br />

Jane B. Folkrod<br />

Bob and Lanie Franza<br />

Richard and Linda Frasch<br />

Bill and Deryn Fulton<br />

Larry Gahlhoff<br />

Ken and Lisa Geisen<br />

Jane Gerhardt<br />

James D. and Paula J. Gillmore<br />

Eileen Goebel<br />

Richard Goldstein<br />

Ms. Rosemary Goransson<br />

Mr. and Mrs. Wayne C. Gott<br />

Mr. Mark J. Gralia<br />

Ron and Cathy Grant<br />

Mrs. Norman Groudine<br />

John and Ann Guerin<br />

Donald and Pauline Hagan<br />

Ms. Helen Hamilton<br />

Sharla and Don Hamilton<br />

Martha W. Hanscom<br />

Arthur H. Hansen<br />

Alice Coulon Hanson<br />

Mary Alberta Hargrove<br />

Andy and Carol Harris<br />

Mr. and Mrs. Robert Harrower, Jr.<br />

Mrs. Mary E. Harvill<br />

Peder and Theodora Haslestad<br />

John and Roberta Hayes<br />

Hal and Jerry Haynes<br />

Dr. <strong>Fred</strong>erick and Margaret Hazeltine<br />

Patricia and Robert D. Heffernan, Jr.<br />

Mr. and Mrs. Severt S. Hegland, Jr.<br />

Ms. Jean S. Heidt<br />

Mr. and Mrs. David C. Henderson<br />

Ralph and Gail Hendrickson<br />

Gregory and Anne-Marie Henry<br />

Conrad W. Hewitt<br />

Larry and Marcia Hilberg<br />

Mrs. K. L. Hillard<br />

Vivian and Les Houle<br />

Mr. and Mrs. James W. Howard<br />

Barbara Howell<br />

Mr. and Mrs. George C. Hudspeth<br />

Mr. and Mrs. Paul S. Hunter<br />

Floyd and Barbara Hutton<br />

Mr. and Mrs. James G. Hutton<br />

Dr. and Mrs. Gordon L. Imlay<br />

David and Gigi Jack<br />

Douglas L. Jacobs<br />

Dorothy Doyle Johnson<br />

Mr. Douglas B. Johnson<br />

James A. and Holly F. Johnson<br />

Richard P. and Caroline I. Jones<br />

Thomas M. Jones and Judith A. Edwards<br />

Elaine N. Kaald<br />

Ellen Kam<br />

Miyoko Kaneta<br />

Ms. Heidi Kass<br />

Ms. Deborah Kaufman<br />

Brant A. Keeney<br />

James M. and Lavina S. Kemp<br />

Mr. and Mrs. Donald N. Kinkead<br />

Mr. Robert G. Kinney<br />

Mrs. Nelda S. Kleinschmidt<br />

<strong>Fred</strong>erick and Julianne Klippert<br />

Nora Korg<br />

Mr. and Mrs. Gary A. Krape<br />

Mr. and Mrs. David Kremers<br />

Donna L. Kyle<br />

Larry and Linda LaBolle<br />

Mr. William M. and<br />

Dr. Geraldine K. Landis<br />

Mr. and Mrs. Gus Lange<br />

Lolita Lanning<br />

Gloria L. Larkin<br />

E. Margaret Lawrence<br />

Roy and Vel Leonard<br />

FIGURE OUT WHY.<br />

Martha LePrell<br />

Joe and Lyn Lightfoot<br />

Mr. and Mrs. Stephen H. Lindquist<br />

Ralph and Lynda Lipe<br />

Paul S. MacMichael<br />

Mr. Edward E. Maloof<br />

Wilbur C. Mann<br />

Stephanie D. Mapelli<br />

Mr. and Mrs. Robert J. Margulis<br />

Dr. and Mrs. Herbert A. Marra<br />

Hank, Fuchsia and Marcia Martin<br />

Jeff and Ethel Maxwell<br />

Mr. and Mrs. Robert McDaniel<br />

Mrs. Alma L. McDonald<br />

Mary Jane McElyea<br />

Marcia McGreevy-Lewis and<br />

Robert D. Lewis, M.D.<br />

Douglas G. and Ruth J. McKnight<br />

Barbara F. Meehan<br />

Elinor K. Menter<br />

Robert Miller and Marlys Owen-Jones<br />

Mrs. Anne A. Moldrem<br />

Johnny and Susie Morganti<br />

Mrs. Gladys M. Morrison<br />

Mr. and Mrs. James A. Morrison<br />

Judy Mukai<br />

Mr. and Mrs. Al Neelley<br />

Nick and Carol Westlund<br />

Supporting Organization<br />

Miss Elsa Nordin<br />

Mrs. Ella Nuckolls<br />

Everett and Dorothy O’Neill<br />

Mrs. Jean B. O’Neill<br />

Mr. Charles L. O’Shea<br />

Alice Oehler<br />

Carole A. Olson<br />

Miss Elvi M. Olsson<br />

Mr. Stanford E. Opdyke<br />

Robert B. Overhus<br />

Mrs. James Owen<br />

Stanley Ozbolt<br />

Mr. and Mrs. Geoffrey and Netta Page<br />

Kenneth and Lorrayne Palmer<br />

Mr. and Mrs. Jack G. Parks<br />

T. Keith and Janet Patrick<br />

Harry and Katherine Pearce<br />

Kristian Pearson<br />

<strong>Fred</strong>erick and Elizabeth Pedersen<br />

Mary R. Pelan<br />

Daniel J. Peters<br />

George and Cynthia Pierce<br />

Julia B. Poduch<br />

Bradford and Sandra Porter<br />

Deirdre and Dickson Preston<br />

Marietta E. Priebe<br />

Mr. Ross Purintun<br />

Mr. and Mrs. Robert and Teresa Quigley<br />

Gustav and Claire T. Raaum<br />

Sherry Y. Rae<br />

Mrs. Della L. Ramsden<br />

Weldin and Jo Ann Read<br />

Mrs. Sally Reiquam<br />

Bruce and Karen Richards<br />

Douglass and Lea Richter<br />

Mr. and Mrs. Joe A. Riedel, Jr.<br />

Mrs. Margaret Robarge<br />

Marilyn H. Rogers<br />

Claudia Rollins<br />

Mr. and Mrs. Thomas E. Roth<br />

Milton and Ruth Rubin<br />

Mr. and Mrs. Allan N. Rumpf<br />

THAT ANSWER IS USUALLY MUCH MORE INTERESTING THAN IF IT HAD TURNED OUT.”<br />

Mr. Robert H. Rutledge<br />

Cynthia and Gerry Salkowski<br />

Sam and Betty Lebid Foundation<br />

Mary L. Sanderson-Schinman<br />

Patricia L. Schaumberg<br />

Brent and Susan Schlosstein<br />

Loretta Schossow<br />

Ms. Rosalyn H. Schuknecht<br />

Robert E. Schultz<br />

Mr. Casey Sepanski<br />

Dorothy L. Shattuck<br />

Barbara Jean Shenk<br />

Pam and Geoff Sheridan<br />

Pearl L. Shernoff<br />

Mr. C. Larry Shull<br />

Ms. Annette Siversen<br />

Mr. Eugene G. Sivertson<br />

Bernice and George Smith<br />

Mrs. Phyllis H. Smith<br />

Dr. and Mrs. Richard Smith<br />

Ruth B. Smith<br />

Samuel E. and J. Michelle Smith<br />

Joseph T. Smudin<br />

Mr. Frank W. Soderling<br />

Gregory P. Sokolowski<br />

Herba Irene Solstad<br />

Mary and Steve Solum<br />

Mrs. Kathleen P. Spading<br />

Josephine and Stephen Spear<br />

James Speckbrock<br />

Mr. and Mrs. Frank L. and<br />

Esther A. Springer<br />

Mrs. Caren A. Staley<br />

Evelyn Casey Steen<br />

Mrs. Idalene Strang<br />

Janet Swanson<br />

Connie Taylor<br />

Ken and Judy Thomas<br />

Dick and Ruth Thomassen<br />

Mr. and Mrs. Charles M. and<br />

Marjorie J. Thorne<br />

Capt. Donald A. Thornton<br />

Olive Tice<br />

Mr. and Mrs. Michael J. Toennessen<br />

Claribel Trigve<br />

Mr. and Mrs. David T. Troxel<br />

Karl R. and Marcile H. Turner<br />

Mrs. Walter A. Turner<br />

Mr. and Mrs. Robert E. Vallat<br />

Mary C. Vanderzicht<br />

Jean Baur Viereck<br />

Mr. Jerry Warfield<br />

William H. Warner<br />

Jim and Diane Watson<br />

Mrs. Robert E. Weaver<br />

Steve and Dana Weiner<br />

Lewis G. Weiss<br />

Sandra E. Weiss<br />

Catherine and Steven Wells<br />

Anne T. White<br />

Mrs. Edward Whitley<br />

William and Susanna Wiegant<br />

Christopher L. and Ruby D. Wilde<br />

Carl H. Wittenberg<br />

Ms. Dawn M. Wood<br />

Penny M. Woods<br />

Sarah Woods<br />

James and Herma Wyn<br />

Patricia C. Youngman<br />

Mrs. Veva J. Zard<br />

Mrs. Arline Zidell<br />

Inner Circle<br />

The Inner Circle is comprised of current<br />

and former faculty, staff and their spouses;<br />

past and present members of the Board<br />

of Trustees, Board of Ambassadors and<br />

Senior Council and their spouses; as well<br />

as past members of the former Foundation<br />

Board of Directors and their spouses.<br />

It recognizes those who support the<br />

<strong>Hutchinson</strong> <strong>Center</strong> through a bequest in<br />

their will, life income gift, life insurance,<br />

retirement assets or other planned gifts.<br />

Steven J. and Lisa M. Anderson<br />

Anonymous (6)<br />

Robert M. Arnold<br />

Rich and Leslie Begert<br />

Carl and Renée Behnke<br />

Sally Skinner Behnke<br />

Brian R. and Shelley J. Buck<br />

William W. and<br />

Kathy Lynn Christoffersen<br />

Mr. and Mrs. John D. Eastham<br />

Karl and Carol Ege<br />

Robert N. and Ingrid Lahti Eisenman<br />

Noemi A. Epstein<br />

Ms. Linda L. Gainer<br />

Janice A. and Robert L. Gerth<br />

Kenneth and Beryl Goodchild<br />

Dr. William Grady and<br />

Dr. Karen Tsuchiya<br />

Sheri Ray Greaves<br />

Marcia and Glenn Harrington<br />

Debra and Chuck Holland<br />

Deborah E. Kirsner<br />

Lynette A. Klein<br />

Reginald S. Koehler III<br />

Judy Kornell<br />

Shelley M. Kuni<br />

Ms. Karen E. Lane<br />

Jerrold D. Liebermann and Linda J. Harris<br />

Jeffrey and Ethel Maxwell<br />

Rachelle A. McCallum<br />

Patricia McCowan<br />

Neil and Nancy McReynolds<br />

Karen and Jamie Moyer<br />

Shan and Lee Mullin<br />

Han and Shawn Nachtrieb<br />

Paul and Carol Neiman<br />

Martin and Vicki Nelson<br />

Dr. Gilbert S. Omenn and<br />

Martha A. Darling<br />

John and Deanna Oppenheimer<br />

Guy and Arlene Ott<br />

John and Jean Rolfe<br />

Michael T. and Nancy A. Ryan<br />

Marilla Satterwhite<br />

Dr. and Mrs. E. Donnall Thomas<br />

Mrs. Barbara Thrasher<br />

Seattle <strong>Cancer</strong> Care Alliance<br />

The Seattle <strong>Cancer</strong> Care Alliance (SCCA)<br />

unites the adult and pediatric cancercare<br />

services of <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />

<strong>Research</strong> <strong>Center</strong>, UW Medicine and<br />

Children’s Hospital and Regional Medical<br />

<strong>Center</strong>. In fiscal year 2008, 1,182 donors<br />

contributed more than $2.1 million to<br />

the SCCA to support efforts to provide<br />

premier, patient-focused care and access to<br />

groundbreaking clinical research to patients<br />

from around the world.<br />

<strong>Research</strong> Benefactors<br />

$1 million or more<br />

Safeway Inc.<br />

<strong>Research</strong> Fellows<br />

$50,000 - $99,999<br />

Entertainment Industry Foundation<br />

The Madhouse Project<br />

Seattle Symphony<br />

Thomas C. Wright Foundation<br />

<strong>Research</strong> Sponsors<br />

$25,000 - $49,999<br />

<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

Lisa Lund Fund<br />

<strong>Research</strong> Supporters<br />

$10,000 - $24,999<br />

Auburn Regional Medical <strong>Center</strong><br />

Broadway Across America/Live Nation<br />

Central Washington Hospital<br />

Children’s Hospital &<br />

Regional Medical <strong>Center</strong><br />

Fairfax Hospital<br />

Ms. Catherine L. Fallen<br />

Harrison Medical <strong>Center</strong><br />

Highline Medical <strong>Center</strong><br />

Legacy Salmon Creek<br />

Perkins Coie LLP<br />

Sacred Heart Medical <strong>Center</strong><br />

Seattle <strong>Center</strong> Marketing<br />

St. Joseph Hospital<br />

St. Joseph Hospital & Medical <strong>Center</strong><br />

Virginia Mason Clinic/Medical <strong>Center</strong><br />

Yakima Valley Memorial Hospital <strong>Center</strong><br />

for Child Health Services<br />

<strong>Research</strong> Friends<br />

$5,000 - $9,999<br />

Mr. and Mrs. Rajeev Bajaj<br />

Charles B. See Foundation<br />

Mr. Ray Hickey<br />

Holy Family Hospital<br />

Meghan’s Mountain Charitable<br />

Foundation, Inc.<br />

Pacific NW 4 Wheel Drive Association<br />

PeaceHealth Saint John Medical <strong>Center</strong><br />

Providence Everett Medical <strong>Center</strong><br />

Providence Saint Peter Hospital<br />

Saint Francis Hospital<br />

The Schneider Family Foundation<br />

Mrs. Barbara Stief<br />

United Way of King County<br />

—DR. LEE NELSON<br />

Marsha Rivkin <strong>Center</strong> for Ovarian<br />

<strong>Cancer</strong> <strong>Research</strong><br />

In partnership with the <strong>Hutchinson</strong> <strong>Center</strong><br />

and Swedish Medical <strong>Center</strong>, the Marsha<br />

Rivkin <strong>Center</strong> for Ovarian <strong>Cancer</strong> <strong>Research</strong><br />

is a nonprofit organization dedicated to<br />

saving lives and reducing suffering through<br />

improved treatment, early detection<br />

and prevention of ovarian cancer. The<br />

Rivkin <strong>Center</strong> funds pilot studies, issues<br />

scientific scholar awards, conducts ovarian<br />

symposiums and provides ovarian-cancer<br />

screening in conjunction with cutting-edge<br />

research projects.<br />

Marsha Rivkin <strong>Center</strong> Contributors<br />

The following donors contributed<br />

$5,000 or more between January 1 and<br />

December 31, 2007.<br />

$100,000 - $249,999<br />

Bensussen Deutsch & Associates Inc.<br />

Fisher Foundation for Family Health<br />

$50,000 - $99,999<br />

98.9 KWJZ<br />

Janet L. Brown Estate<br />

$25,000 - $49,999<br />

Chuck and Karen Lytle<br />

$10,000 - $24,999<br />

Anonymous (1)<br />

Donna R. Benaroya<br />

Eric and Gloria Bensussen<br />

Bob Bridge Toyota<br />

Ms. Lynda M. Gilman<br />

KING 5 Television<br />

Ladies Auxiliary VFW<br />

The Lester & Bernice Smith Foundation<br />

Martin-Fabert Foundation<br />

David and Mette Naness<br />

Swedish Medical <strong>Center</strong> First Hill Auxiliary<br />

$5,000 - $9,999<br />

Mr. and Mrs. Wayne Anderson<br />

Apple American Group<br />

Athena Partners<br />

Bank of America<br />

Cell Therapeutics,<br />

Drs. James and Sue Bianco<br />

Mr. Mark J. Craemer<br />

Grandmasters, LLC<br />

Mr. Luther Haugan<br />

Health Care Property Investors, Inc<br />

Mr. David A. Hoffman<br />

Jim and Lorna Kneeland<br />

MaryAnne and Richard Kobylka<br />

Mrs. Lisa Kreissler and Mr. Allen Derheim<br />

Allan B. Learned<br />

Mr. C. Eric Morse<br />

Mr. and Mrs. Paul Russo<br />

The Schuler Family Foundation,<br />

Mr. and Mrs. James K. Schuler<br />

Mr. and Mrs. Frank Sixt<br />

Stuart and Karen Sloan<br />

† Deceased<br />

CA Corporate Affilitates<br />

PC President’s Circle<br />

PC* President’s Circle charter member<br />

23


24<br />

Financial<br />

Summary<br />

OPERATING REVENUES<br />

FISCAL YEAR 2008<br />

n <strong>Research</strong> Grants and Contracts 78%<br />

n Net Contributions 7%<br />

n Investment Income 4%<br />

n Other Income 11%<br />

OPERATING EXPENSES<br />

FISCAL YEAR 2008<br />

n Program Services– <strong>Research</strong> 77%<br />

n Facilities and Administration 21%<br />

n Fundraising 2%<br />

<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

Fiscal Years 2008 and 2007<br />

Revenues and Other Support<br />

(in thousands of dollars)<br />

2008<br />

(Unaudited)<br />

2007<br />

(Audited)<br />

<strong>Research</strong> Grants and Contracts $294,244 $273,621<br />

Net Contributions 27,634 27,669<br />

Investment Income 15,936 20,930<br />

Other Income 43,299 33,990<br />

Total Revenues $381,113 $356,210<br />

Expenses<br />

(in thousands of dollars)<br />

Program Services – <strong>Research</strong> $286,905 $262,755<br />

Facilities and Administration 77,538 73,061<br />

Fundraising 6,861 5,616<br />

Total Expenses $371,304 $341,432<br />

Change in Net Assets from Operations $ 9,809 $ 14,778<br />

Change in Net Assets from Financing Activities – 19,243 8,592<br />

Total Increase/(Decrease) in Net Assets – 9,434 23,370<br />

Net Assets Balance at Beginning of Year 209,676 186,306<br />

Net Assets Balance at End of Year $200,242 $209,676<br />

Thank you for joining us in our mission to eliminate cancer and related<br />

diseases as causes of suffering and death. Private donations like yours<br />

are essential for allowing <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong> to<br />

rapidly respond to novel research opportunities that can lead to important<br />

medical breakthroughs.<br />

Financial support from our donors enables us to attract and retain<br />

the world’s top scientists, provide our researchers with state-of-the-art<br />

technology needed to advance their work and launch innovative pilot<br />

projects to explore new ways to eliminate cancer and related diseases.<br />

Private gifts also leverage significant additional investment by allowing<br />

investigators to successfully compete for prestigious foundation grants that<br />

do not cover the full cost of research.<br />

The many accomplishments that keep the <strong>Hutchinson</strong> <strong>Center</strong> at<br />

the forefront of biomedical research could not be achieved without your<br />

generous gifts.<br />

SOURCES OF CONTRIBUTIONS<br />

FISCAL YEAR 2008<br />

n Planned Giving 29%<br />

n Principal/Major Gifts 23%<br />

n Foundation Relations 17%<br />

n Annual Giving 12%<br />

n Special Events 10%<br />

n President’s Circle 8%<br />

n Corporate Relations 1%<br />

USES OF CONTRIBUTIONS<br />

FISCAL YEAR 2008<br />

n Direct <strong>Research</strong> Investments 80%<br />

and Patient Care<br />

n Fundraising Expenses 20%<br />

25


26<br />

<strong>Center</strong> Boards<br />

FISCAL YEAR 2008<br />

Board of Trustees<br />

Sally G. Narodick, Chair<br />

Douglas W. Walker, Vice Chair<br />

Jeffrey P. Maxwell, Treasurer<br />

Steve Davis, Secretary<br />

Ronald E. Bayley<br />

Richard P. Begert<br />

Edward D. Davila, M.D.<br />

Karl J. Ege<br />

Alan D. Frazier<br />

Robert J. Herbold<br />

Peter A. Horvitz<br />

Henry James<br />

Richard E. Jones<br />

Henry L. Kotkins, Jr.<br />

Don J. Listwin<br />

Gary Locke<br />

Patricia B. May<br />

Joan Ellen Morse<br />

Karen Moyer<br />

Robert T. Nelsen<br />

Martin O. Nelson, Jr.<br />

Charlotte H. Reed<br />

John Thurston Roach<br />

Keith M. Schorsch<br />

Stephen V. Sundborg, S.J.<br />

Douglas E. Williams, Ph.D.<br />

Board of Ambassadors<br />

Richard W. Anderson, Co-chair<br />

Carl G. Behnke, Co-chair<br />

Jean B. Rolfe, Co-chair<br />

Constance M. Anderson<br />

Robert M. Arnold<br />

Robert E. Bayley<br />

Sally S. Behnke<br />

Ronald J. Berenson, M.D.<br />

Deborah L. Bevier<br />

Eric S. Bremner<br />

<strong>Fred</strong> Brown<br />

Philip K. Bussey<br />

Hugh Chang<br />

William W. Christoffersen<br />

Rudolph F. Crew. Ed.D.<br />

David R. Davis, M.D.<br />

Barbara R. Ells<br />

Phelps K. Fisher<br />

Edward V. Fritzky<br />

Ben J. Gantt, Jr.<br />

Jack M. Geoffroy †<br />

Robert L. Gerth<br />

Denver C. Ginsey<br />

Kenneth J. Goodchild<br />

S. John Goodwin<br />

Slade Gorton<br />

Stephen M. Graham<br />

Kenneth S. Greenbaum<br />

Irving M. Haug<br />

Charles L. Hirsch<br />

Ronald S. Howell<br />

John L. <strong>Hutchinson</strong><br />

Jeremy A. Jaech<br />

Julius P. Johnston III<br />

Kay D. Jones<br />

Perrin Kaplan<br />

Reginald S. Koehler III<br />

David C. Lycette<br />

David A. Mann<br />

Patricia A. McDonald<br />

Neil L. McReynolds<br />

J. Shan Mullin<br />

Craig J. Mundie<br />

Amb. Della Newman<br />

Gilbert S. Omenn, M.D., Ph.D.<br />

Admiral William A. Owens<br />

Nancy D. Pellegrino<br />

Bruce M. Pym<br />

Charles E. Riley<br />

H. Jon Runstad<br />

Katherine J. Savitt<br />

Harriet Shrontz<br />

The Honorable<br />

Charles Z. Smith<br />

Alessandra Spencer<br />

Michael A. Stein<br />

Cynthia Stroum<br />

Gerald R. Swanson<br />

Rev. Robert V. Taylor<br />

Bonnie A. Towne<br />

George A. Walker<br />

Mary H. Wiese<br />

Scott F. Wilson<br />

John C. Woodin<br />

Cindy Zehnder<br />

Senior Council<br />

Constance M. Anderson<br />

Robert M. Arnold<br />

Robert E. Bayley<br />

Sally S. Behnke<br />

Deborah L. Bevier<br />

Eric S. Bremner<br />

William W. Christoffersen<br />

Vincent F. Coviello, Jr.<br />

David R. Davis, M.D.<br />

Barbara R. Ells<br />

Phelps K. Fisher<br />

David B. Frohnmayer<br />

Ben J. Gantt, Jr.<br />

Jack M. Geoffroy<br />

Denver C. Ginsey<br />

Slade Gorton<br />

Irving M. Haug<br />

Frank H. Hopkins<br />

John L. <strong>Hutchinson</strong><br />

Kay D. Jones<br />

Reginald S. Koehler III<br />

Stanley M. Little, Jr.<br />

David C. Lycette<br />

Patricia A. McDonald<br />

Neil L. McReynolds<br />

J. Shan Mullin<br />

Amb. Della Newman<br />

Gilbert S. Omenn, M.D., Ph.D.<br />

George B. Rathmann, Ph.D.<br />

Charles E. Riley<br />

Jean B. Rolfe<br />

James F. Ryan<br />

Harriet Shrontz<br />

The Honorable<br />

Charles Z. Smith<br />

Cynthia Stroum<br />

Rev. William J. Sullivan, S.J.<br />

Gerald R. Swanson<br />

James G. Talbot<br />

Bonnie A. Towne<br />

George A. Walker<br />

Cindy Zehnder<br />

† Deceased<br />

<strong>Center</strong> Leadership<br />

Lee Hartwell, Ph.D.<br />

President and Director<br />

Myra Tanita<br />

Executive Vice President and<br />

Chief Operating Officer<br />

Mark Groudine, M.D., Ph.D.<br />

Executive Vice President and<br />

Deputy Director<br />

<strong>Fred</strong>erick Appelbaum, M.D.<br />

Senior Vice President and Director<br />

Clinical <strong>Research</strong> Division<br />

Barbara Trask, Ph.D.<br />

Senior Vice President and Director<br />

Human Biology Division<br />

James Roberts, M.D., Ph.D.<br />

Senior Vice President and Director<br />

Basic Sciences Division<br />

Ross Prentice, Ph.D.<br />

Senior Vice President and Director<br />

Public Health Sciences Division<br />

Larry Corey, M.D.<br />

Senior Vice President and Co-Director<br />

Vaccine and Infectious<br />

Disease Institute<br />

Scott Rusch<br />

Vice President<br />

Facilities and Operations<br />

Bob Robbins, Ph.D.<br />

Vice President<br />

Information Technology<br />

Janell Baldwin<br />

Vice President<br />

Shared Resources<br />

Han Nachtrieb<br />

Vice President<br />

Human Resources<br />

Doug Shaeffer<br />

Vice President<br />

General Counsel<br />

Ulrich Mueller, Ph.D.<br />

Vice President<br />

Industry Relations and<br />

Technology Transfer<br />

Randy Main<br />

Vice President of Finance<br />

and Chief Financial Officer<br />

Nancy Wells<br />

Vice President<br />

Development<br />

Linda Gainer<br />

Vice President<br />

External Affairs and<br />

Communications<br />

<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

At <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>, our interdisciplinary teams of worldrenowned<br />

scientists and humanitarians work together to prevent, diagnose and treat<br />

cancer, HIV/AIDS and related diseases. Our researchers, including three Nobel laureates,<br />

bring a relentless pursuit and passion for health, knowledge and hope to their work and<br />

the world.<br />

With research excellence that spans the full spectrum of cancer research, we are<br />

uniquely qualified not only to discover, but to implement lifesaving breakthroughs.<br />

To achieve our goal of improving human health around the world, our scientists lead studies<br />

in the following areas: Early Detection and Intervention, Immunotherapy, Tumor <strong>Research</strong>,<br />

Fundamental <strong>Research</strong>, Leukemia and Lymphoma <strong>Research</strong>, International <strong>Research</strong>,<br />

Prevention <strong>Research</strong>, and Childhood <strong>Cancer</strong>s.<br />

In addition to our groundbreaking research, we also provide a range of support services<br />

for the patients and families who come to the <strong>Hutchinson</strong> <strong>Center</strong> for lifesaving treatment.<br />

Programs include the Pete Gross House and Hutch School, <strong>Cancer</strong> Information Service,<br />

the Long-Term Follow-Up Program as well as the <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

Survivorship Program, part of the LIVESTRONGTM Survivorship <strong>Center</strong> of Excellence<br />

Network, and the <strong>Cancer</strong> Prevention Clinic located at the Seattle <strong>Cancer</strong> Care Alliance.<br />

Annual Report<br />

published by the External Affairs<br />

and Communications Department<br />

<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

PO Box 19024<br />

Seattle, WA 98109-1024<br />

206.667.5000<br />

www.fhcrc.org<br />

© 2008 <strong>Fred</strong> <strong>Hutchinson</strong><br />

<strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />

Gordon Todd<br />

Editor<br />

Barbara Hoberecht<br />

Art Director<br />

Susie Fitzhugh<br />

Portrait Photographer<br />

Ignacio Lobos<br />

Colleen Steelquist<br />

Writers<br />

Photo credits:<br />

Meghan Mullarky, cover; Ignacio Lobos, page 17;<br />

Dr. Florian Hladik, page 28<br />

Printed on recycled paper<br />

27


dedicated to<br />

a future<br />

HIV HIDES IN A DENDRITIC CELL OF THE GENITAL LINING.<br />

of <strong>discovery</strong><br />

“DISCOVERY IS SEEING WHAT EVERYBODY HAS SEEN,<br />

AND THINKING WHAT NOBODY HAS THOUGHT.”<br />

—ALBERT SZENT-GYÖRGYI<br />

THE EXPLORATORY NATURE OF SCIENTIFIC INVESTIGATION IS DISPLAYED IN DR. MICHAEL EMERMAN’S NOTES.<br />

BACK COVER: STOCHASTIC MODELS REVEAL THE SPREAD OF DISEASE IN A PANDEMIC OUTBREAK.


Seattle’s reputation as a leader in high technology and biotechnology and the allure of the region’s<br />

natural beauty attract the world’s best minds to <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>.<br />

We draw inspiration from our diverse landscape—from rivers and ocean to mountains and forest.<br />

At the <strong>Hutchinson</strong> <strong>Center</strong>, we live and breathe a life of science.<br />

Mail Stop J5-200, PO Box 19024, Seattle, WA 98109-1024 206.667.4399 1.800.279.1618 www.fhcrc.org

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!