discovery - Fred Hutchinson Cancer Research Center
discovery - Fred Hutchinson Cancer Research Center
discovery - Fred Hutchinson Cancer Research Center
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
2008 ANNUAL REPORT<br />
paths of<br />
<strong>discovery</strong><br />
STOCHASTIC MODELS REVEAL THE SPREAD OF DISEASE IN A PANDEMIC OUTBREAK.
pursuing<br />
<strong>discovery</strong><br />
<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong><br />
FRONT COVER: DRESSED IN BRIGHT RED, THE TWO X CHROMOSOMES OF A FEMALE CELL<br />
<strong>Center</strong>’s scientists weave interdisciplinary<br />
paths to nurture collaboration and<br />
insight. Their scientific endeavors are<br />
long and intense, with no shortcuts or<br />
guarantees. Fueled by their passion for<br />
treatments that offer healing and<br />
for life<br />
IN A MALE PANCREAS (CENTER LEFT) REVEAL THE PHENOMENON OF MOTHER-CHILD CELL EXCHANGE.<br />
for preventive steps<br />
to circumvent the<br />
devastation of cancer,<br />
HIV/AIDS and related diseases, they<br />
seek answers in the population and at<br />
the molecular level. Our researchers<br />
strive for breakthrough moments of<br />
<strong>discovery</strong>—<strong>discovery</strong> for life.<br />
Table of Contents<br />
Message from the<br />
President and Director 2<br />
Message from the<br />
Chair of the Board of Trustees 3<br />
<strong>Research</strong> 4<br />
Donors 19<br />
Financial Summary 24<br />
<strong>Center</strong> Boards 26<br />
<strong>Center</strong> Leadership 27
2<br />
Message from the<br />
President and Director<br />
Dr. Lee Hartwell<br />
President and Director<br />
PATHS OF DISCOVERY<br />
The <strong>Hutchinson</strong> <strong>Center</strong> has become one of the world’s premier<br />
research institutions thanks to our scientists who have grappled<br />
with some of the most challenging questions in the biosciences, and our<br />
staff who help bring ideas to fruition.<br />
Over the years, the <strong>Center</strong>’s researchers have refined treatments for<br />
leukemia, lymphoma and other blood diseases. As they have sought to<br />
boost survival rates for once-fatal cancers, their research naturally has<br />
led into new and unexpected directions.<br />
Today, the <strong>Center</strong> remains a world leader in cancer research, but we<br />
have also expanded our work into other areas, breaking new ground in<br />
HIV/AIDS research and other life-threatening diseases.<br />
Consider the research of some of our featured scientists in this annual report. Dr. Richard Nash, an<br />
oncologist and specialist in leukemia, hopes that what we have learned from blood cancers and their<br />
treatment may some day help people with autoimmune diseases such as systemic and multiple sclerosis.<br />
Dr. Stan Riddell studies autoimmune responses to disease and the role our own T-cells play in fighting<br />
cancer. Stan wants to boost the power of the immune system with better defenses by engineering a special<br />
kind of T-cell so that it targets tumors more successfully.<br />
Dr. Anne McTiernan’s work has focused international attention on the <strong>Center</strong>. As a cancer prevention<br />
researcher, Anne’s detailed studies are showing us how exercise and diet could help reduce many cancers<br />
that are caused by obesity and sedentary lifestyles.<br />
These scientists are examples of the exceptional team of researchers here at the <strong>Hutchinson</strong> <strong>Center</strong>,<br />
people whose passion for their work keeps us focused on the future. With your support, we can ensure<br />
that their innovative work stays on the path of <strong>discovery</strong>.<br />
Message from the Chair<br />
of the Board of Trustees<br />
If you have ever faced a life-threatening diagnosis, or watched a family<br />
member, friend or colleague duel cancer, HIV/AIDS or a related<br />
disease, you understand why the scientists at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />
<strong>Research</strong> <strong>Center</strong> are working tirelessly to save lives.<br />
Compassion for you and your loved ones is what drives <strong>Hutchinson</strong><br />
<strong>Center</strong> scientists and staff to seek a better future.<br />
As you will learn in this annual report, this is an exciting time for<br />
scientific research. Technology is playing an increasingly important role<br />
in accelerating the pace of <strong>discovery</strong> —from Drs. Malik and Emerman<br />
using computers to explore an ancient retrovirus to<br />
Drs. Halloran and Longini using statistical models to study the spread of infectious diseases. The<br />
scientists in this report represent the <strong>Center</strong>’s host of talented investigators, all of whom are seeking<br />
answers to challenging questions in daring, new ways. In pursuing the paths of their discoveries, our<br />
scientists follow the mission of the <strong>Center</strong> to eliminate cancer and related diseases.<br />
Contributions like yours are essential to helping the <strong>Hutchinson</strong> <strong>Center</strong> sustain our world-class<br />
research environment and fund these discoveries. Private donations play an instrumental role in the<br />
<strong>Center</strong>’s ability to remain at the forefront of biomedical research by supporting innovative research that<br />
often cannot be funded by government grants alone.<br />
Thank you for sharing my commitment to improving and saving lives and furthering innovative<br />
research at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>.<br />
Sally G. Narodick<br />
Chair, Board of Trustees<br />
SUPPORTING DISCOVERY<br />
3
4<br />
Michael Emerman, Ph.D.<br />
Harmit Malik, Ph.D.<br />
Biologists<br />
U N D E R S T A N D I N G H I V B Y D E L V I N G D E E P L Y<br />
INTO OUR EVOLUTIONARY PAST<br />
When we think about deadly viruses, evolutionary biologist<br />
Dr. Harmit Malik explains, we need to understand that<br />
their complexity and ferocity has been bred through tens of<br />
millions of years of tugging and pulling against the human race.<br />
“In this genetic conflict, either the host is winning or the<br />
virus is winning,” Malik said, pointing to the roughly 8 percent<br />
of the human genome that is made up of old retroviruses that<br />
we carry inside of us like bits of shrapnel from ancient wars.<br />
Today, we face HIV. It crossed<br />
over from chimpanzees to humans<br />
within the last 100 years, so far killing<br />
25 million people and infecting<br />
twice that many. Why does it kill us<br />
and not chimpanzees, which are easily<br />
infected by HIV but not sickened<br />
by it?<br />
Malik and Dr. Michael Emerman,<br />
a molecular biologist, have pondered<br />
such questions for a long time. Most<br />
recently, their collaboration has<br />
yielded important insights into the<br />
evolutionary struggle between viruses and humans. Ultimately,<br />
they hope their research may lead to new drugs to fight HIV.<br />
In one of their most startling collaborations, their labs used<br />
the power of modern computers and DNA technology to<br />
assemble a new version of an extinct retrovirus known as<br />
Pan troglodytes endogenous retrovirus (PtERV), which infected<br />
chimps and gorillas—but not humans—4 million years ago.<br />
By reassembling the retrovirus in such a way that it could<br />
reproduce only once, Malik and Emerman found that a<br />
human protein known as TRIM5α easily defeated PtERV.<br />
Every primate has a version of the TRIM5α protein. In the<br />
rhesus monkey, for example, it kills HIV.<br />
Malik and Emerman also modified the human TRIM5α<br />
protein to resemble a version present in the ancestors of<br />
humans, chimpanzees and gorillas, and found that it no longer<br />
protected against the PtERV.<br />
By modifying TRIM5α, they<br />
also discovered that one version<br />
protected against HIV but not<br />
PtERV. In another modification,<br />
it did the opposite.<br />
Such polar opposites, they<br />
agree, are the result of evolution.<br />
Because our TRIM5α<br />
protein evolved to fight other<br />
retroviruses, it likely left us<br />
vulnerable to HIV, they say.<br />
Is it possible to reproduce a<br />
drug that behaves like a chimp’s TRIM5α does against HIV, or<br />
change the human version ever so slightly so it kills HIV? These<br />
are the kinds of challenges that Emerman and Malik ponder.<br />
The two agree that studying, and in some cases reconstructing,<br />
ancient viruses is not a trivial matter.<br />
In this arms race that’s millions of years old, it pays to<br />
understand the enemy, Malik said.<br />
HIV BREAKS FREE FROM A CONQUERED T-CELL, PREPARED TO INVADE NEW TARGETS.
6<br />
Richard Nash, M.D.<br />
Immunotherapy <strong>Research</strong>er/Oncologist<br />
L E U K E M I A T R E A T M E N T S H O W S P R O M I S E<br />
FOR SYSTEMIC AND MULTIPLE SCLEROSIS<br />
As a hard-working member of the immune system, a T-cell<br />
is an efficient killer, attacking anything it perceives as an<br />
intruder, whether it’s a virus-infected cell, a cancer cell or a<br />
bacterium.<br />
But sometimes, a T-cell attacks a friend—and it goes on<br />
attacking, unchecked, destroying healthy tissue and creating<br />
serious autoimmune diseases such as multiple sclerosis and<br />
lupus. Why the immune system goes so<br />
very wrong has puzzled researchers<br />
for decades.<br />
As many as 80 autoimmune diseases<br />
have been identified, and some of<br />
them are capable of causing serious<br />
complications, even death. One<br />
example is systemic sclerosis (also<br />
known as scleroderma), a disease without<br />
effective treatment. “It’s one of the<br />
most frustrating diseases to treat. There’s<br />
high mortality and no therapies, and it<br />
can hit you in so many ways,” said<br />
Dr. Richard Nash.<br />
By training, Nash is an oncologist,<br />
a researcher in leukemia and other blood cancers. But thanks to<br />
a unique and unexpected insight, he’s now applying his knowledge<br />
in whole new ways. Along with colleagues, he is taking the<br />
<strong>Hutchinson</strong> <strong>Center</strong>’s pioneering leukemia research and applying<br />
it to other diseases, such as systemic sclerosis and MS.<br />
The standard treatment for leukemia and other blood<br />
cancers is chemotherapy, radiation and transplantation of<br />
bone marrow or blood stem cells. Nash is optimistic the same<br />
approach may now help patients with autoimmune diseases.<br />
It has taken some very unlucky patients—a rare few who<br />
had both leukemia and systemic sclerosis—to uncover a<br />
potential new use for transplantation.<br />
With systemic sclerosis, a patient’s skin becomes very hard,<br />
severely limiting movement. When one<br />
of these patients received a stem cell<br />
transplant for cancer, “we saw evidence<br />
of skin improvement. The treatment<br />
suggested that the fibrosis of the skin<br />
was a reversible condition,” Nash said.<br />
“And it appeared to stabilize<br />
the organs.”<br />
With transplantation, it may be<br />
possible to remove the reactive cells that<br />
are triggering the immune system to<br />
attack the body. Currently, Nash’s lab<br />
is conducting three clinical trials to<br />
evaluate the safety and effectiveness<br />
of high-dose chemotherapy and<br />
stem-cell transplantation for systemic sclerosis and MS.<br />
“For me, that’s part of the excitement of being in this<br />
field … we’re doing something different and helping people,<br />
and learning about potential new therapies. To be successful<br />
in any project, collaboration and teamwork are very<br />
important,” he said.<br />
A BRAIN SCAN SHOWS MULTIPLE SCLEROSIS LESIONS THAT COULD BE IMPROVED WITH T-CELL THERAPY.
J. Lee Nelson, M.D.<br />
Autoimmunity <strong>Research</strong>er/Rheumatologist<br />
D E L V I N G I N T O T H E A U T O I M M U N E I M P L I C A T I O N S O F<br />
MOTHER-CHILD CELL SHARING<br />
It feels like a broken bone that never heals, a constant ache.<br />
Pain relievers and powerful steroids may not make a dent in<br />
the excruciating pain. Nor do they relieve the swelling and<br />
stiffness for many rheumatoid arthritis sufferers. But nature<br />
sometimes offers relief: pregnancy. Like a fog lifting, most<br />
pregnant rheumatoid arthritis patients experience life without<br />
constant pain for the first time in years.<br />
Seeing such transformations made Dr. Lee Nelson yearn for<br />
answers. What could make an autoimmune disease like<br />
rheumatoid arthritis turn off? The answer may lie in the<br />
mother-child cell transfer that happens<br />
during pregnancy.<br />
dUsing e lthe vplacenta i n g as a corridor, i n t o some<br />
cells travel between mom and baby, take<br />
up guest residence in their hosts, and<br />
stick around for decades. Nelson and her<br />
interdisciplinary team study this mixing<br />
of genetically distinct individuals, known<br />
as microchimerism, to identify the good<br />
and bad consequences of these foreign<br />
cells in autoimmune diseases, transplantation,<br />
cancer and pregnancy complications.<br />
Nelson, considered one of the world’s leading researchers<br />
in this investigative frontier, has been studying the role that<br />
microchimerism plays in the initiation and remission of autoimmune<br />
diseases since 1986, the year she began her research<br />
career at the <strong>Hutchinson</strong> <strong>Center</strong>.<br />
The transferred cells can be found in many human tissues.<br />
They are detected by looking for female cells in a male, or male<br />
cells in a female, or through DNA analysis. The presence of<br />
Y chromosomes in a woman, for example, signifies that<br />
she has acquired cells from a male (most likely from a son<br />
during pregnancy).<br />
Scientists had assumed that a normal immune system would<br />
destroy any maternal cells lingering in a child. That thinking<br />
changed when Nelson and her team found maternal cells<br />
survived decades later in healthy adults. That work<br />
provided evidence for the idea that cells transferred from<br />
mother to fetus are stem cells or related cells, capable of becoming<br />
any type of cell, since stem cells can divide indefinitely.<br />
She also found maternal cells in<br />
the pancreas made insulin, suggesting<br />
they may help regenerate the diseased<br />
organ in diabetics. This finding suggests<br />
that microchimerism might one<br />
day be the crux of new therapies if<br />
the non-native cells could be coaxed<br />
to restore damaged tissues.<br />
“We’re trying to hone in on treatments,”<br />
Nelson said. “I would like to<br />
help alleviate suffering in some way.”<br />
Nelson also conducted the first study to look at microchimerism<br />
in an autoimmune disease. She found evidence for the<br />
involvement of adopted fetal cells in scleroderma (also known<br />
as systemic sclerosis), a life-threatening illness that makes the<br />
skin hard and thick and often attacks internal organs.<br />
Once a lone pioneer in this young field, she said, “This was<br />
an interdisciplinary challenge that people had overlooked, and<br />
it was ripe for important questions and big leaps forward.”<br />
Thanks to Nelson, many of those questions are being answered.<br />
THE EXCHANGE OF MICROCHIMERIC CELLS BETWEEN MOTHER AND CHILD MAY HOLD CLUES FOR AUTOIMMUNE DISEASES.<br />
9
10<br />
Robert Gentleman, Ph.D.<br />
Computational Biologist<br />
S earching<br />
M I N I N G G E N O M I C D A T A F O R C A N C E R ’ S<br />
MOLECULAR SECRETS<br />
for the molecular roots Common of cancer duplicate is akin to reads after biological filtering research. Just a decade ago, scientists could only<br />
looking for the proverbial > needle df1 in lapply(split(df1[, which is where Dr. Robert c("sequence", advances now "count")], enable efficient df1$lane), analysis of half head) a million genes.<br />
Gentleman comes in. Technology $s_1_export.txt<br />
and the need to sift through The new tools enable researchers to uncover novel potential<br />
a deluge of genomic information has transformed biology from targets sequence for therapies count as well as to explore the underlying genetic<br />
a purely lab-based science to an 101 information TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA science as well. causes of many human 243 diseases.<br />
102 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 237<br />
Gentleman, head of the <strong>Hutchinson</strong> <strong>Center</strong>’s Herbold There has also been an explosion in the amount of informa-<br />
103 GTGGAAAATTTAGAAATGTCCACTGTAGGACGTGG 177<br />
Computational Biology Program, 104creates CCATATTCCACGTCCTACAGTGGACATTTCTAAAT computing tools to tion available about the 165DNA<br />
sequence of the human genome.<br />
analyze massive amounts of data 105 from AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT biological experiments Consequently, researchers 162 have identified a large number of<br />
and uses mathematics and statistics 106 to CATGATTTTCAGTTTTCTTGCCATATTCCACGTCC generate new insights novel genes within these 158previously<br />
unknown sequences. The<br />
incorporating the existing<br />
data. The approach<br />
$s_2_export.txt<br />
sequence count<br />
challenge currently facing<br />
scientists is to find a way to<br />
helps researchers<br />
251 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 357 organize and catalog this vast<br />
understand cancer at<br />
its most fundamental<br />
level by illuminating<br />
252 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA<br />
253 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT<br />
254 ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />
255 CATGATTTTCAGTTTTCTTGCCATATTCCACGTCC<br />
324<br />
194<br />
184<br />
160<br />
amount of information into a<br />
usable form.<br />
“Technology drove enor-<br />
which cellular proteins 256 GCCATATTCCACGTCCTACAGTGGACATTTCTAAA 151 mous data sets, which drove<br />
interact and how they<br />
the need for clear, statistical<br />
$s_3_export.txt<br />
work together within a<br />
thinking,” Gentleman said.<br />
sequence count<br />
cell. The process also saves both 401 time GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC and money over other “We have no true comprehension 313 of cancer on a molecular level<br />
lab methods.<br />
402 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA yet. We need tools to 291 understand how the genome works and<br />
A former auto mechanic might<br />
403<br />
seem<br />
ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />
like an unlikely we need to know how 235 things interact. If we’re going to go in<br />
404 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT 205<br />
candidate to become a research<br />
405<br />
scientist.<br />
GTGGAAAATTTAGAAATGTCCACTGTAGGACGTGG<br />
But if you follow and poke something, we better know what the domino effect<br />
188<br />
Gentleman’s path from Hondas 406 to Harvard CTGTAGGACGTGGAATATGGCAAGAAAACTGAAAA to the <strong>Hutchinson</strong> will be.” 177<br />
<strong>Center</strong>, his trajectory seems perfectly probable. The former He and his colleagues around the globe collaborate to write<br />
grease monkey has a penchant for<br />
$s_4_export.txt<br />
challenges, so it makes sense free software for the entire scientific community to use. “This is<br />
sequence count<br />
that he’d choose a research endeavor<br />
551 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA<br />
that’s moving at breakneck a high-risk area, which is not where commercial software goes,”<br />
266<br />
speed. For brilliant young minds, 552biocomputing GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC is the most he said. “We’re only interested 232 in being as close to the edge of<br />
challenging field around. 553 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT scientific investigation 187 as we can be. We share to learn. Real<br />
Advances in knowledge and<br />
554<br />
technology<br />
ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA<br />
have transformed change comes from people 164 working well together.”<br />
555 CTGTAGGACGTGGAATATGGCAAGAAAACTGAAAA 161<br />
556 TGTAGGACGTGGAATATGGCAAGAAAACTGAAAAT 139<br />
$s_6_export.txt<br />
sequence count<br />
701 TAGGACGTGGAATATGGCAAGAAAACTGAAAATCA 395<br />
702 GTAGGACGTGGAATATGGCAAGAAAACTGAAAATC 354<br />
703 AGGACGTGGAATATGGCAAGAAAACTGAAAATCAT 263<br />
704UNRAVELING ACTGTAGGACGTGGAATATGGCAAGAAAACTGAAA VAST DNA SEQUENCES, WRITTEN AS A-G-T-C 232 CODES, REQUIRES POWERFUL TOOLS.<br />
5
M. Elizabeth Halloran, M.D., D.Sc.<br />
Ira Longini, Ph.D.<br />
Biostatisticians<br />
PREDICTING THE SPREAD OF INFECTIOUS DISEASES<br />
When the World Health Organization declared smallpox<br />
eradicated in 1980, there was a giddy overconfidence<br />
that the deadly struggle against the microbial world was ending.<br />
“There was this feeling that we had won the battle against<br />
infectious diseases,” said Dr. Elizabeth Halloran, who studied<br />
tropical diseases in the early 1980s, when there was waning<br />
interest in the topic.<br />
Halloran was not convinced microbes had been subdued,<br />
much less conquered. Nor was Dr. Ira Longini, whose travels<br />
through Latin America brought him face to face with tuberculosis,<br />
syphilis and other infectious<br />
diseases that were presumably under<br />
control.<br />
With research funding and drug<br />
development for such diseases in<br />
full retreat at the time, Halloran and<br />
Longini forged paths in the field of<br />
biomathematics and biostatistics to<br />
study the spread of infectious diseases.<br />
Now, as collaborators, they’re among<br />
the world’s leaders in the field, their<br />
expertise sought widely in the struggle<br />
against new and resurgent infectious diseases. During the last<br />
year, they have consulted with federal and state officials and<br />
have been consulted by world health organizations to help<br />
develop intervention plans to control potential pandemics, such<br />
as avian flu.<br />
Today, the threat of a pandemic flu with the potential to<br />
kill tens of millions is a top concern of public health officials<br />
worldwide. HIV, malaria and tuberculosis kill as many as<br />
6 million people each year. Tuberculosis alone is expected to<br />
infect as many as 1 billion people in the next 20 years.<br />
Small as they are, microbes make up 60 percent of the<br />
planet’s biomass. With so many microbes out there, “We’re<br />
EVERY FEW DECADES, THE INFLUENZA VIRUS TRIGGERS MISERY THROUGHOUT THE WORLD.<br />
further away than ever from closing the book on infectious<br />
diseases,” the Infectious Diseases Society of America declared<br />
last year.<br />
It’s within this context that Halloran and Longini collaborate<br />
to create mathematical models that predict the spread of<br />
disease and simulate intervention strategies to save lives.<br />
Using powerful computers to track the potential path of<br />
infectious diseases, the duo believe their mathematical models<br />
could help save the lives of hundreds of millions of people,<br />
particularly against pandemic flu, which unchecked could<br />
spread across the globe in a matter<br />
of months.<br />
Mathematical models allow researchers<br />
to simulate the spread of disease<br />
through different kinds of settings and<br />
test different kinds of intervention. In<br />
one such model, Longini and Halloran<br />
tracked how quickly pandemic flu would<br />
move across the United States if<br />
nothing were done. In a simulated<br />
60 days, the disease had spread to every<br />
corner of the map. The number of dead:<br />
tens of millions. They developed other models to help predict<br />
which interventions—such as vaccination, keeping children out<br />
of schools and asking people to work from home—would most<br />
effectively control spread of the disease and save the most lives.<br />
It’s a scary scenario, but Longini and Halloran believe the<br />
tools are in place to save the world from disaster. And not just<br />
from influenza.<br />
“We hope that the tools we’re developing will be used for all<br />
emerging diseases,” Longini said.<br />
“You can’t control disease but you can intervene to save<br />
lives,” Halloran said. “You can intervene and change the course<br />
of events.’’<br />
13
14<br />
Stanley Riddell, M.D.<br />
Immunotherapy <strong>Research</strong>er/Oncologist<br />
CANCER KILLERS WITH STAYING POWER<br />
In a perfect world, cancer doesn’t stand a chance of wreaking<br />
havoc. Like a soldier guarding the home shores, the<br />
immune system gives marching orders to a type of white blood<br />
cell known as T-cells to remain vigilant for an invasion of<br />
foreign cells, including cancerous ones. When a T-cell<br />
recognizes an invader, it initiates a process that targets that cell<br />
for destruction.<br />
But cancer is a formidable foe, one that<br />
Dr. Stanley Riddell is all too familiar with<br />
after more than two decades of waging<br />
war against it. “Tumors are very clever and<br />
they utilize evasion strategies to limit the<br />
effectiveness of the immune response,”<br />
he said.<br />
So he’s fortifying the immune system<br />
with better weapons: long-lived T-cells<br />
specially engineered to seek and destroy<br />
cancer.<br />
Through adoptive T-cell therapy,<br />
Riddell and his fellow researchers<br />
extract white blood cells from a cancer<br />
patient and expose them to proteins made<br />
in abundance by tumor cells. Scientists<br />
then identify the few T-cells that recognize the tumor proteins<br />
and stimulate those to divide, generating a billions-strong<br />
population of cancer-fighting cells that can be infused back into<br />
the patient. Ideally, this unique population of T-cells will find<br />
its way to the tumor site and annihilate the cancer cells.<br />
“When you see it work, it is so amazing—the bone marrow<br />
just goes from being full of leukemia to being in remission and<br />
very large tumors simply melt away,” Riddell said.<br />
T-cells, however, have a fatal flaw. They die quickly. And<br />
if an immune response isn’t sustained, cancer eventually<br />
comes back.<br />
Riddell and his colleagues knew immunity could last a<br />
lifetime—that’s how vaccines work. So the researchers reasoned<br />
that perhaps they were starting with the wrong T-cells.<br />
They began advanced testing on different<br />
types of T-cells and found that one<br />
type—central memory cells—had the<br />
staying power the scientists were seeking.<br />
They now had a sustainable starting point<br />
for cancer immunotherapy: T-cells with the<br />
capacity to survive.<br />
Riddell’s next step involves drawing<br />
blood samples from cancer patients, filtering<br />
out their central memory cells and<br />
engineering those cells with receptors to<br />
target tumors.<br />
The approach holds promise for fighting<br />
different types of leukemia, including<br />
chemotherapy-resistant acute lymphoblastic<br />
leukemia in children, and breast,<br />
ovarian and skin cancers. Riddell’s team’s insights may also<br />
strengthen the work of University of Washington researchers<br />
developing potential breast-cancer vaccines.<br />
“We’re really trying to move immunotherapy with central<br />
memory T-cells into the clinic quickly,” Riddell said. “We are<br />
excited by the potential for success and believe that this therapy<br />
can be applied to several types of cancer.”<br />
T-CELLS SWARM A CANCER CELL.
16<br />
Anne McTiernan, M.D., Ph.D.<br />
<strong>Cancer</strong> Prevention <strong>Research</strong>er<br />
T A K I N G S T E P S T O W A R D C A N C E R P R E V E N T I O N<br />
We all know that exercise is good for us. But what kind<br />
and how much?<br />
As a cancer prevention researcher and pragmatist,<br />
Dr. Anne McTiernan has no illusions about most folks’ commitment<br />
to exercise. She understands that people want to know<br />
exactly what they have to do—and how little they need to<br />
do—to reap healthy rewards.<br />
Thanks to McTiernan’s work, some specific answers now<br />
exist about the role of exercise and weight loss in<br />
reducing the risk of cancer. As director<br />
of the <strong>Hutchinson</strong> <strong>Center</strong>’s Prevention<br />
<strong>Center</strong>—a state-of-the-art facility for<br />
conducting research on exercise and<br />
diet—she designs studies with the aim<br />
of reducing the 25 percent of cancers<br />
caused by excess weight and sedentary<br />
lifestyles.<br />
Fewer than one-quarter of<br />
Americans get minimum daily exercise,<br />
even though regular physical activity<br />
reduces body fat, lowers blood pressure,<br />
cholesterol and the risk of diabetes and<br />
cancer, and improves bone and joint<br />
health, sex drive, sleep and memory.<br />
“We have such an epidemic of<br />
obesity and lack of exercise, which is one reason I’ve gravitated<br />
to exercise and weight control,” McTiernan said. “It’s an area of<br />
study that could have a significant impact.”<br />
Exercise trials are uncommon because they’re expensive and<br />
difficult to fund. McTiernan’s group is the first to specifically<br />
look at the effects increased physical activity and weight loss<br />
have on reducing the chance of getting cancer.<br />
Such risk reduction has been difficult to quantify in the<br />
past, but McTiernan has been able to definitely gauge impacts<br />
by measuring so-called biomarkers in research participants.<br />
Among her most important findings, overweight postmenopausal<br />
women who exercised for 45 minutes five days<br />
a week, whittled away unhealthy belly fat and lowered their<br />
estrogen and testosterone levels, hormones that in excess can<br />
contribute to cancer. In a different study, women who walked<br />
leisurely just one to three hours a week<br />
lowered their risk of dying from breast<br />
cancer by one-quarter compared to<br />
sedentary women; those who walked<br />
three to eight hours weekly cut their<br />
risk in half. Another study showed that<br />
exercise six days a week brought both<br />
sexes significant fat loss and a lowered<br />
risk of colon cancer in men.<br />
McTiernan’s groundbreaking work<br />
has put the <strong>Hutchinson</strong> <strong>Center</strong> at the<br />
forefront of the field, earning her an<br />
invitation to join a federal scientific<br />
advisory committee to develop the<br />
nation’s first guidelines to focus on<br />
physical activity—and the first to<br />
recognize the impact of exercise on cancer-risk reduction.<br />
“We’re trying to get specific answers for people: do I need to<br />
lose 50 pounds or will 5 percent of my body weight do it? Will<br />
exercising 20 minutes a day help?” McTiernan said. “Nothing<br />
is guaranteed, but exercise and weight control are like wearing a<br />
seat belt. It reduces your risk.”<br />
EXERCISE AND HEALTHY EATING ARE POWERFUL ANTI-CARCINOGENS.
“THE SEEDS OF<br />
GREAT DISCOVERIES<br />
ARE CONSTANTLY<br />
“THE SEEDS OF GREAT DISCOVERIES ARE CONSTANTLY<br />
FLOATING AROUND, BUT THEY ONLY<br />
FLOATING AROUND, BUT THEY ONLY TAKE ROOT IN<br />
TAKE ROOT IN MINDS<br />
WELL PREPARED<br />
MINDS WELL PREPARED<br />
TO RECEIVE THEM.”<br />
— JOSEPH HENRY<br />
TO RECEIVE THEM.”<br />
A RETROVIRUS’ PATH BECOMES EVIDENT IN AN EVOLUTIONARY TREE.<br />
Donors<br />
PRIVATE CONTRIBUTORS<br />
FISCAL YEAR 2008<br />
Private contributors fund many critical<br />
programs at <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />
<strong>Research</strong> <strong>Center</strong>. During this fiscal year,<br />
individuals, corporations, foundations<br />
and other organizations donated $33.7<br />
million through contributions, memorial<br />
and honor donations, and in-kind gifts.<br />
The following donors contributed $5,000<br />
or more between July 1, 2007, and June<br />
30, 2008. President’s Circle members —<br />
donors who have made contributions of<br />
$10,000 or more in flexible funding — are<br />
indicated by (PC). Charter members<br />
of the President’s Circle are indicated<br />
by (PC*). Corporate Affiliates members—<br />
corporations that have made contributions<br />
of $10,000 or more in flexible funding —<br />
are indicated by (CA).<br />
Nobel Laureates Circle<br />
The Nobel Laureates Circle recognizes<br />
contributors who have made cumulative<br />
gifts of $1 million or more. These key<br />
contributors are permanent members of<br />
the Circle which was established in 2001<br />
to honor the <strong>Hutchinson</strong> <strong>Center</strong>’s Nobel<br />
Prize recipients, Drs. E. Donnall Thomas<br />
(1990), Lee Hartwell (2001) and Linda<br />
Buck (2004). By giving at this level,<br />
members of the Nobel Laureates Circle are<br />
at the forefront of philanthropic leadership<br />
and make a significant impact on the<br />
<strong>Hutchinson</strong> <strong>Center</strong>’s mission to eliminate<br />
cancer and related diseases as causes of<br />
human suffering and death.<br />
Madeline and Howell E. Adams, Jr.<br />
Mr. Paul G. Allen<br />
American <strong>Cancer</strong> Society<br />
Amgen Foundation<br />
Anonymous (3)<br />
Robert M. Arnold<br />
Avon Foundation<br />
Bill & Melinda Gates Foundation<br />
Burroughs Wellcome Fund<br />
Canary Foundation<br />
Cell Therapeutics, Inc.<br />
Charles E. Stuart Charitable Foundation<br />
Mylo and Marion Charlston<br />
Damon Runyon <strong>Cancer</strong> <strong>Research</strong><br />
Foundation<br />
David Worthington Garner Trust<br />
Delta Tau Delta Fraternity<br />
Dorothy W. Day Trust<br />
J. Orin and Charlene Edson<br />
Clairmont L. & Evelyn S. Egtvedt<br />
Entertainment Industry Foundation<br />
Erna M. Jorgensen Trust<br />
The Eucalyptus Foundation<br />
Fannie E. Rippel Foundation<br />
Friends of José Carreras<br />
International Leukemia Foundation<br />
Bill and Melinda Gates<br />
Bob and Eileen Gilman Family<br />
The GM Foundation<br />
Calvin A. Gorman Estate<br />
Alice Coulon Hanson<br />
Lee Hartwell and<br />
Theresa Naujack Hartwell<br />
Bob and Pat Herbold<br />
Arthur P. Holm Estate<br />
Howard Hughes Medical Institute<br />
Yvonne Twining Humber Estate<br />
J. Orin Edson Foundation<br />
Jacob Green Charity Golf Classic<br />
James B. Pendleton Charitable Trust<br />
James S. McDonnell Foundation<br />
Nelda Kleinschmidt<br />
Lance Armstrong Foundation<br />
The Leukemia & Lymphoma Society<br />
Listwin Family Foundation<br />
Lucille P. Markey Charitable Trust<br />
M. J. Murdock Charitable Trust<br />
Mr. John A. McCone and<br />
Mrs. Theiline Pigott McCone<br />
Microsoft Corporation<br />
Moneytree, Inc.<br />
The Moyer Foundation<br />
Craig and Marie Mundie<br />
Muscular Dystrophy Association<br />
The Norcliffe Foundation<br />
Dorothy and Everett O’Neill<br />
The Paul G. Allen Family Foundation<br />
Prostate <strong>Cancer</strong> Foundation<br />
James and Sherry Raisbeck<br />
Richard C. Goldstein Private Foundation<br />
Jim Roberts and Pam Becker<br />
Safeway Inc.<br />
James G. Scripps Estate<br />
The Seattle Foundation<br />
Susan G. Komen for the Cure<br />
Herman E. Tenzler Estate<br />
Dr. and Mrs. E. Donnall Thomas<br />
Mikal and Lynn Thomsen<br />
Hazel Johnson Toly Estate<br />
Bonnie and Jim Towne<br />
United Way of King County<br />
W. M. Keck Foundation<br />
Richard W. Weiland †<br />
The William Randolph<br />
Hearst Foundations<br />
<strong>Research</strong> Benefactors<br />
$1 million or more<br />
Avon Foundation<br />
Canary Foundation<br />
Entertainment Industry Foundation<br />
The Eucalyptus Foundation<br />
Friends of José Carreras<br />
International Leukemia Foundation<br />
Alice Coulon Hanson<br />
Hutch Holiday Gala<br />
(Grace Heffernan Arnold Guild<br />
and Gala Board of Trustees)<br />
The Leukemia & Lymphoma Society<br />
Listwin Family Foundation<br />
Safeway Inc.<br />
Richard W. Weiland Estate<br />
<strong>Research</strong> Patrons<br />
$500,000 - $999,999<br />
Anonymous (1)<br />
Peter Jerome Cervenak Estate<br />
Charles E. Stuart Charitable Foundation<br />
Climb to Fight Breast <strong>Cancer</strong><br />
(CFBC Committee)<br />
J. Orin and Charlene Edson PC<br />
Bob and Eileen Gilman Family<br />
Bob and Pat Herbold PC*<br />
Susie Morganti PC<br />
The Paul G. Allen Family Foundation<br />
Sam and Betty Lebid Foundation<br />
<strong>Research</strong> Partners<br />
$250,000 - $499,999<br />
American <strong>Cancer</strong> Society<br />
Apoptos Inc.<br />
Bill & Melinda Gates Foundation<br />
Damon Runyon <strong>Cancer</strong> <strong>Research</strong><br />
Foundation<br />
Edna Williams Curl Trust<br />
Fate Therapeutics<br />
Giles W. and Elise G. Mead Foundation<br />
Hutch Award Luncheon<br />
(Hutch Award Luncheon Committee)<br />
J. Orin Edson Foundation<br />
James B. Pendleton Charitable Trust<br />
Lance Armstrong Foundation<br />
M. J. Murdock Charitable Trust<br />
Marsha Rivkin <strong>Center</strong> for<br />
Ovarian <strong>Cancer</strong> <strong>Research</strong><br />
National Marrow Donor Program<br />
Pete Gross House Luncheon<br />
(Pete Gross House Council)<br />
Premier Chefs Dinner (Magnolia Guild<br />
and Chefs Advisory Board)<br />
Doris L. Sather Estate<br />
The Seattle Foundation<br />
Susan G. Komen for the Cure<br />
Mae Sim Thomas Estate<br />
Washington State Department of Health<br />
Wayne D. Kuni and<br />
Joan E. Kuni Foundation<br />
<strong>Research</strong> Associates<br />
$100,000 - $249,999<br />
American Society of Clinical Oncology<br />
American Society of Hematology<br />
Amgen Foundation<br />
The Anderson Foundation PC*<br />
Burroughs Wellcome Fund<br />
Charles Epstein Trust<br />
The Christopher Harper Trust<br />
Dr. and Mrs. Edmund R. Clarke<br />
Roger and Gloria Crouch PC*<br />
Mike and Karen Dunlop PC*<br />
John and Christine Enslein<br />
Erna M. Jorgensen Trust<br />
Fanconi Anemia <strong>Research</strong> Fund, Inc.<br />
Fisher Radio Seattle’s AM 570 KVI<br />
Friends of the Hutch<br />
Calvin A. Gorman Estate<br />
The Greater Kansas City<br />
Community Foundation<br />
Howard Hughes Medical Institute<br />
Intel Corporation<br />
Jacob Green Charity Golf Classic<br />
The John C. and Karyl Kay Hughes<br />
Foundation PC*<br />
Thomas “Red” Kelly Estate<br />
Lymphoma <strong>Research</strong> Foundation<br />
Phoebe P. Marriott Estate<br />
Merck & Co., Inc.<br />
Microsoft Corporation<br />
The Moyer Foundation<br />
Muscular Dystrophy Association<br />
Prostate <strong>Cancer</strong> <strong>Research</strong> Institute<br />
Richard C. Goldstein Private Foundation<br />
The Rona Jaffe Foundation PC<br />
Satellite Healthcare<br />
Loretta V. Schossow Estate<br />
John A. Tershin Estate<br />
Mikal and Lynn Thomsen PC*<br />
Travel & Leisure Auction<br />
(Margaret E. Martindale Guild)<br />
United Way of King County<br />
The V Foundation for <strong>Cancer</strong> <strong>Research</strong><br />
W. M. Keck Foundation<br />
<strong>Research</strong> Fellows<br />
$50,000 - $99,999<br />
American Airlines<br />
American Heart Association<br />
Anonymous (1) PC*<br />
Anonymous (1) PC<br />
The Bayley Family Foundation<br />
David and Joanna Beitel PC*<br />
Todd, Mary and Geary Britton-Simmons<br />
Costco Wholesale Corporation<br />
Cuyamaca Foundation<br />
David Worthington Garner Trust<br />
Delta Tau Delta Fraternity<br />
Dorothy A. Jarosek Trust<br />
Mark and Carolyn Edson PC*<br />
Clairmont L. & Evelyn S. Egtvedt<br />
Employees Community Fund<br />
of the Boeing Company<br />
Fidelity Charitable Gift Fund<br />
Jane B. Folkrod<br />
Edward and Karen Fritzky Family PC*<br />
Florence Galbraith Estate<br />
Genentech, Inc.<br />
David and Patricia Giuliani PC*<br />
Rochelle Greenberg<br />
Mr. David W. Hansen and<br />
Ms. Trish M. King PC*<br />
Francis E. Hart Estate<br />
Inserra Family Foundation<br />
Jeffrey Rosenzweig Foundation for<br />
Pancreatic <strong>Cancer</strong> <strong>Research</strong><br />
Lisa Johnson of Johnson<br />
International Industries PC<br />
Grace M. Kaylor Estate<br />
Mrs. Yvonne Gemmell Keene<br />
KOMO 4 Television<br />
Laird Norton Tyee Trust Company<br />
Linsco Private Ledger<br />
Martin-Fabert Foundation<br />
The Michael Miyauchi Foundation<br />
National Childhood <strong>Cancer</strong> Foundation<br />
Ocean Spray<br />
19<br />
21
20<br />
Donors<br />
Olympia Guild<br />
Ora Lee A. Anderson Trust<br />
Pancreatic <strong>Cancer</strong> Action Network<br />
Phi Beta Psi Sorority<br />
Platt Electric CA<br />
Satya and Rao Remala Foundation PC*<br />
The Stack Foundation<br />
Samuel † and Althea Stroum<br />
Suskin Foundation<br />
John T. Toland Estate<br />
University of Washington<br />
Kenneth L. and Evelyn L. Walters PC*<br />
Washington <strong>Research</strong> Foundation<br />
Yvonne M. Betson Trust<br />
<strong>Research</strong> Sponsors<br />
$25,000 - $49,999<br />
Alaska Airlines<br />
Anonymous (2) PC*<br />
Anonymous (1) PC<br />
Bank of America Corporation<br />
Bayley Construction CA<br />
Carl and Renée Behnke PC*<br />
Sally Skinner Behnke PC*<br />
Anselmo Belmondo Estate<br />
Leslie Burrows<br />
<strong>Cancer</strong> <strong>Research</strong> Institute<br />
Carlyle, Inc.<br />
Children’s Hospital &<br />
Regional Medical <strong>Center</strong><br />
Click Wine Group<br />
Community Foundation for<br />
Southwest Washington<br />
Driving for a Cure<br />
Jack and Sheri Edson PC*<br />
Edward Jones<br />
Carol and Karl Ege PC*<br />
Eli Lilly and Company<br />
Elmo Zumwalt III Guild<br />
Mrs. Ruth E. File PC<br />
Cathryn Fortune and John Shimer<br />
Fortune Family Foundation PC*<br />
The Foster Foundation<br />
Alan and Mary Frazier PC*<br />
Frazier Healthcare Ventures<br />
<strong>Fred</strong> <strong>Hutchinson</strong> Team Shootout<br />
Grand Chapter of Washington -<br />
Order of the Eastern Star<br />
Erik and Susan Hansen PC*<br />
Mr. and Mrs. John Harnish<br />
Harold & John Steinberg<br />
Memorial Nursing Scholarship<br />
The Helen Hay Whitney Foundation<br />
Alan and Wendy Higginson PC<br />
<strong>Fred</strong> and Dawn Hines PC*<br />
Mr. and Mrs. Charles Hogan<br />
Human Frontier Science Program<br />
Maxine Isham Estate<br />
Edith G. Iverson Estate<br />
Henry and Mary Ann James PC*<br />
Mr. and Mrs. J. Michael Johnston PC*<br />
David Jones and<br />
Maryanne Tagney-Jones PC*<br />
King County Combined<br />
Federal Campaign<br />
Klingman Open<br />
Mike and Debbie Koss PC*<br />
The Lambeth Family Designated Fund<br />
Laura A. Landro and Richard E. Salomon<br />
Rae and Mark Lembersky PC*<br />
Life Possibilities<br />
Donors<br />
“THERE’S A HUGE LEVEL OF COMMITMENT IN SCIENCE.<br />
YOU DON’T GO HOME JUST BECAUSE IT’S A CERTAIN TIME;<br />
Benito and Carmen Lopez PC*<br />
David Mann and<br />
Ann Thomson Mann PC*<br />
Maxim Group LLC<br />
Mary Jane McElyea Estate<br />
MDRT Foundation<br />
Merrill Lynch, Pierce,<br />
Fenner & Smith, Inc.<br />
Mo-dazz for the Arts<br />
National Breast <strong>Cancer</strong> Foundation, Inc.<br />
News Talk 710 KIRO<br />
Novartis<br />
Carol-Ann O’Mack and<br />
John Deininger PC*<br />
Mr. and Mrs. Carroll O’Mack PC*<br />
Milton and Ruth Rubin PC*<br />
Russell Investments<br />
Ryan Hill <strong>Research</strong> Foundation at<br />
Virginia Mason Medical <strong>Center</strong><br />
SASCO<br />
Schwab Charitable Fund<br />
George H.J. Shaw<br />
Jack C. Shaw and Wenonah Shaw<br />
Sheldon Manufacturing, Inc.<br />
Frank and Harriet Shrontz PC*<br />
Lorene Spurling Estate<br />
Howard and Cynthia Steinberg<br />
Gregory and Charlene Steinhauer PC*<br />
Jonathan G. Thomason and<br />
Megan L. Thomason PC*<br />
Union Bank of California<br />
Doug and Maggie Walker PC*<br />
Washington State Employee<br />
Combined Fund Drive<br />
Wyner/Stokes Foundation<br />
Yvonne M. Betson Trust –<br />
Jeff and Ethel Maxwell PC*<br />
Mark and Donette Zbikowski PC<br />
Zillow.com<br />
Joseph and Janet Zinn PC*<br />
<strong>Research</strong> Supporters<br />
$10,000 - $24,999<br />
Charles M. Ackerman and<br />
Barbara Clanton Ackerman<br />
Acme Food Sales, Inc.<br />
Mr. and Mrs. Mike Adair<br />
Alexandria Real Estate Equities, Inc.<br />
American <strong>Research</strong> &<br />
Management Company<br />
Mr. and Mrs. James K. Anderson, Jr.<br />
Ric and Kaylene AndersonPC* Anonymous (7) PC*<br />
Anonymous (4) PC<br />
Dr. <strong>Fred</strong>erick and Dita AppelbaumPC* Ms. Doree R. Armstrong<br />
Robert M. ArnoldPC Stephen D. ArnoldPC* Athena Partners<br />
The Ayco Charitable Foundation<br />
Peggie F. Nishimura Bain † PC*<br />
Joe and Karyn BarerPC Mrs. and Mr. Angela K. Barrie<br />
Ron and Joan BayleyPC Bell Lumber & Pole<br />
Mr. and Mrs. Jerry J. Belur<br />
Ben Bridge Jeweler<br />
Yahn Bernier and<br />
Beth McCaw<br />
Evva M. Betts Estate<br />
BK Invitational Golf Tournament<br />
Bill and Jeanne Bliss PC<br />
bmi<br />
The Boeing Company<br />
Bonneville Seattle<br />
Mr. and Mrs. Louis L. Borick PC<br />
Cathy Boshaw and Doug Edlund PC*<br />
Edgar and Elisabeth Bottler PC*<br />
Mr. and Mrs. Erik P. Breivik PC*<br />
Sally V. Brotman PC*<br />
Glen A. Buettgenbach PC*<br />
Shari and <strong>Fred</strong>erick Burns PC*<br />
Mr. Gary L. Bylund PC*<br />
CAC Real Estate Management Co., Inc.<br />
<strong>Cancer</strong> <strong>Center</strong> for Detection<br />
and Prevention<br />
Cangen Biotechnologies<br />
Mr. Joseph A. Carbone PC<br />
Carlson Family Foundation PC*<br />
Mrs. Cecelia C. Carr PC*<br />
Mr. and Mrs. John H. Case<br />
Celgene<br />
Spencer W. Chaffey Estate<br />
Vibhas and Arundhati Chandorkar PC*<br />
Charles B. See Foundation PC*<br />
Brad and Judy Chase PC*<br />
Dr. and Mrs. Martin A. “Mac” Cheever<br />
Dale Chihuly<br />
Chihuly, Inc.<br />
Mr. Ryan A. Christensen<br />
The Church of Jesus Christ of<br />
Latter-Day Saints Foundation<br />
Citi Global Impact Funding Trust, Inc.<br />
Continental Airlines<br />
Cornerstone Advisors, Inc.<br />
Thomas G. Corrigan Estate<br />
CRAVE<br />
Mr. and Mrs. Thomas J. Cusick III<br />
Dick and Jill Davis<br />
Mr. Steve Davis and Mr. Bob Evans PC<br />
Dr. H. Joachim Deeg and<br />
Mrs. Francoise Deeg-Le Gal<br />
Dick and Chris DiCerchio PC*<br />
Eric and Holly Dillon PC*<br />
The Dolsen Foundation PC*<br />
Mac and Patti Douglas PC<br />
Jan Dulet PC*<br />
Mr. and Mrs. Kevin P. Eagan PC*<br />
Barbara Feasey and Bill Bryant PC*<br />
Fidelity Brokerage Services LLC<br />
Phelps and Christel Fisher<br />
Myrtle I. Forrest Estate<br />
Foss Maritime Company<br />
Mr. Robert Frey<br />
Mrs. E. Peter Garrett<br />
The Geiger Family Foundation PC*<br />
Bruce and Alice Geismar PC*<br />
Gene Juarez Salons & Spa<br />
Mr. and Mrs. Robert L. Gerth PC*<br />
Mr. Miles Gilburne and Ms. Nina Zolt PC<br />
Aaron and Betty Gilman Family<br />
Mr. and Mrs. Wayne C. Gott PC*<br />
Ken and Betsy Greenbaum PC*<br />
Mark Groudine and Cynthia Putnam<br />
Thomas and Jennifer Hanly PC<br />
John and Suzanne Hansen PC<br />
Mr. and Mrs. Mark C. Hansen<br />
Lee Hartwell and<br />
Theresa Naujack Hartwell PC*<br />
Jeff and Candace Havens PC<br />
Hal and Jerry Haynes<br />
Elizabeth Hebert and Donald Guthrie PC*<br />
Conrad Hewitt<br />
The HG Foundation<br />
Mr. and Mrs. Mike Hickey PC*<br />
Pete and Leslie Magid Higgins PC*<br />
Mr. and Mrs. Neal Hooberman<br />
Peter and Margaret Horvitz PC*<br />
Mr. Bradley J. Horwitz<br />
The Horwitz Family<br />
Memorial Foundation PC<br />
Mr. Norman E. Hubbard and<br />
Ms. Lynne Thompson PC<br />
The <strong>Hutchinson</strong> Family PC*<br />
The Ildhuso Family PC*<br />
Infinity Pharmaceuticals<br />
Mr. and Mrs. Chris R. Ishii PC*<br />
Jeremy and Jacquelyn Jaech PC*<br />
Mrs. Kristen Jarvis<br />
Jean E. Thomson Foundation PC*<br />
Jewish Community Foundation<br />
of Greater Hartford<br />
Mike and Diane Johansson PC*<br />
John L. Scott Real Estate<br />
John M. Gilbertson Foundation<br />
John R. and Paula Blood Family Trust<br />
Arnold Kas PC*<br />
Donna Kelly<br />
Kenneth and Dorothy L. Anderson<br />
Family Foundation<br />
Keyes Foundation PC*<br />
King County Employee<br />
Charitable Campaign<br />
The Kinsman Foundation<br />
Nelda Kleinschmidt<br />
KMS Financial Service<br />
James and Lorna Kneeland<br />
Reg and Ann Koehler PC*<br />
Judy Kornell<br />
Jackie and Skip Kotkins PC*<br />
Mrs. <strong>Fred</strong>erick Kullman<br />
Mr. and Mrs. Roger W. Kuula PC*<br />
Sandra L. La Haye PC*<br />
Lane Powell PC CA<br />
Lehman Brothers<br />
The Lester and Bernice Smith<br />
Foundation PC*<br />
Jim and Maureen Lico PC<br />
The Louis L. Borick Foundation PC*<br />
Dan Madsen and Amanda King<br />
Mark and Nikki Mahan PC*<br />
Mandarin Oriental, New York<br />
David and Nathan<br />
Mandelbaum Family PC*<br />
Mariners Care<br />
Mattaini Family Foundation PC*<br />
Matthews Cellars<br />
Bev and Jim Mauser<br />
Trish and Peter May<br />
John and Liz McAdam PC*<br />
Rob and Teddy McGregor PC<br />
Mikimoto Co. Ltd.<br />
Rick and Joyce Miner PC<br />
Mr. and Mrs. Michael J. Mitrovich<br />
Monterey Fund, Inc.<br />
Mr. and Mrs. Thomas G. Mormino<br />
Joan Morse and Dean Hachamovitch PC<br />
Karen and Jamie Moyer PC*<br />
Muckleshoot Indian Tribe PC<br />
Shan and Lee Mullin PC*<br />
Kit and Sally Narodick PC*<br />
Paul and Carol Neiman<br />
Robert Nelsen and Ellyn Hennecke PC*<br />
Martin and Vicki Nelson PC*<br />
Nintendo of America Inc.<br />
Northern Trust<br />
Northern Trust Bank, FSB<br />
NSB Postech<br />
Lee and Deborah Oatey<br />
Mr. Bruce A. Oberg<br />
Mr. and Mrs. James Odom<br />
Osiris Therapeutics, Inc.<br />
PDL Biopharma, Inc.<br />
Harry Jonathan Pearce PC*<br />
Ms. Pamela S. Pearson and<br />
Mr. Michael Voegtlin<br />
Mark and Nancy Pellegrino PC*<br />
Pete and Wilma Olsen Foundation PC*<br />
Donald and Diane Peterson PC*<br />
Pfizer Inc.<br />
John B. Piacentini Family PC*<br />
Paul and Beth Picardo PC*<br />
Dean and Gwenn Polik and<br />
Valerie Polack PC*<br />
Arlen and Debra Prentice PC*<br />
The Pride Foundation<br />
Proteolix, Inc.<br />
Puget Sound Energy<br />
Bruce and Celia Pym PC*<br />
P. S. Radhakrishnan<br />
Alexandra Rector<br />
Residence Inn by Marriott -<br />
Seattle Downtown/Lake Union<br />
Jim Roberts and Pam Becker PC*<br />
Ronald D. and Joan A. Roberts PC<br />
Mrs. R. Elaine Robinson PC<br />
Mr. Tom Robinson and<br />
Ms. Carla Murray PC<br />
Roke Foundation<br />
Michael B. Rubin and Sharon K. Birzer<br />
Jon and Judy Runstad PC*<br />
Sajasa Construction, Inc. CA<br />
Don E. Sandberg Estate<br />
Sandberg Northwest Volvo<br />
Savings & Finance Commercial<br />
Bank Limited<br />
Scandinavian Airlines<br />
Schnitzer Investment Corp.<br />
Keith and Jennifer Schorsch PC*<br />
Jim and Bet Schuler<br />
Schwartz Brothers Restaurants CA<br />
Seattle <strong>Cancer</strong> Care Alliance<br />
Bill and Marlene Semple PC*<br />
The Sign of the Orz<br />
Jim and Jan Sinegal PC*<br />
Singapore Airlines<br />
SiRAS.com<br />
Nate and Luanne Skow PC<br />
Mr. and Mrs. Philip M. Smart, Jr.<br />
Mr. and Mrs. Steven Smith PC*<br />
Sound Community Bank/Laurie Stewart<br />
Doug and Marilyn Southern PC*<br />
Sports Radio 950 KJR<br />
Tom and Diane St. John PC*<br />
Michael and Debbie Stein PC*<br />
Allyn Stellmacher and Terry Samilson PC<br />
John and Sherry Stilin PC<br />
Cynthia Stroum PC*<br />
The Stroum Family Foundation<br />
Symetra Financial<br />
Dr. and Mrs. E. Donnall Thomas PC*<br />
Thrasher Koffey Foundation<br />
Bonnie and Jim Towne PC*<br />
YOU GO HOME WHEN YOUR RESEARCH IS THE BEST IT CAN BE.”<br />
Turner Construction Company CA<br />
United Jewish Foundation of<br />
Metropolitan Detroit<br />
University Mechanical Contractors, Inc.<br />
Tom and Margo Van Halm PC*<br />
Van Sloun Foundation<br />
Neil and Sylvia Van Sloun PC*<br />
Lawrence Votta and Maria Martinez<br />
W Real Estate Services<br />
Hans and Anne Marie Wachtmeister PC*<br />
Shannon and Lucy Wall Estate<br />
Mr. Joseph N. Walter and<br />
Ms. Kathy L. Mares PC<br />
Washington Holdings<br />
Jim and Diane Watson<br />
John W. and Elizabeth Weaver PC<br />
Nancy Weintraub<br />
Nancy L. Wells PC*<br />
Ms. Mary H. Wiese<br />
Doug and Ann Williams PC*<br />
Mr. Donald Williamson PC<br />
The Woldenberg Foundation<br />
Patricia C. Youngman<br />
Melinda Yount PC<br />
Janet and Richard Yulman PC*<br />
Zimmer Gunsul Frasca Architects LLP CA<br />
ZymoGenetics, Inc. CA<br />
<strong>Research</strong> Friends<br />
$5,000 - $9,999<br />
Aero Controls, Inc.<br />
Affiliated Engineers Inc<br />
Akiko Mikami Shimatsu Foundation<br />
Anonymous (2)<br />
Anthropologie<br />
Mr. and Mrs. Ron R. Bailey<br />
Ballard Technology, Inc.<br />
Betty Banghart<br />
Charles and Linda Barbo<br />
BarclayDean<br />
The Barton Family Foundation<br />
BD Biosciences<br />
Bear Stearns & Co. Inc.<br />
Benaroya Foundation<br />
Ms. Jayme L. Benson<br />
Mr. and Mrs. Bradley J. Berg<br />
Mr. Arnie Bergh<br />
Beta Sigma Phi, Xi Gamma Zeta<br />
The Bishop Family Legacy Foundation<br />
Dr. and Mrs. Joel M. Blumberg<br />
Mr. and Mrs. Peter C. Boal<br />
The Bob Tonkin Memorial Classic<br />
Sandra A. Boeskov<br />
Bonhams & Butterfields<br />
Mabel L. Bonnichsen Estate<br />
Paul and Lynn Bordelon<br />
Mr. and Mrs. Philip Borden<br />
Robert James Bracken Estate<br />
Mr. and Mrs. Mark S. Britton<br />
Mr. James Brownrigg<br />
Builders Financial Services LLC<br />
<strong>Fred</strong> and Joan Burnstead<br />
CAC Group<br />
Mr. and Mrs. Bob Carr<br />
Dr. Bruce L. A. Carter and<br />
Ms. Jean Enersen<br />
Cathay Pacific<br />
Madam Ho Ching<br />
Robert Christiansen<br />
Clovis Foundation<br />
Roger and Kimberly Collins<br />
Combined Federal Campaign<br />
Kitsap-Mason Counties<br />
Eva Corets and Josh Beloff<br />
Larry and Vickie Culver<br />
Mr. and Mrs. Michael L. Darland<br />
Mr. and Mrs. Matthew J. Deines<br />
Delta Dental Washington Dental Service<br />
Mr. and Mrs. Eugene W. Devlin<br />
Mr. and Mrs. Donald A. Dick<br />
Larry and Gayle Dickenson<br />
The Diffenbaugh Foundation<br />
Mr. and Mrs. John D. Diffenbaugh<br />
Direct Resources Group, Inc.<br />
Mr. and Mrs. Matthew J. Doron<br />
Julie Edsforth and Jabe Blumenthal<br />
El Gaucho<br />
Mr. and Mrs. Thomas A. Ellison<br />
Mr. and Mrs. Steven J. Elsoe<br />
Joan Enticknap<br />
Mr. and Mrs. Joseph Faltermeier<br />
Mr. Justin B. Field<br />
Fingerprint Communications, LLC<br />
Fischer Family<br />
Mr. Jim Ford<br />
Mr. Lloyd D. Frink and Ms. Janet Angell<br />
June B. Gasparovich Estate<br />
Mr. John Gebert, Jr.<br />
Genzyme Corporation<br />
<strong>Fred</strong>erick M. Goldberg and<br />
Carolyn Lakewold<br />
Goldman, Sachs & Co.<br />
Roger and Jennifer Grambihler<br />
Grand Foundation<br />
Dr. and Mrs. John W. Green<br />
Mr. Leonard W. Green<br />
Nancy Greenwood Vehrs and Jeff Vehrs<br />
Guy Carpenter & Company, LLC<br />
GW Cadbury Charitable Trust<br />
Mr. Felix R. Harke<br />
Harris myCFO Foundation<br />
Harry and Faye Rosenberg Trust<br />
Mr. and Mrs. O. Peder Haslestad<br />
Ms. Jean S. Heidt<br />
The Hemp Family LLC<br />
Richard and Marilyn Herzberg<br />
Mr. and Mrs. Harold W. Hill<br />
Mr. and Mrs. Richard Holland<br />
Hotel 1000<br />
Mr. and Mrs. Hong B. Huey<br />
Integra Chemical<br />
Interstate Distributor Co.<br />
Mr. and Mrs. Claude A. Ising<br />
The Joby Foundation Inc.<br />
Mr. and Mrs. Jon Jones<br />
Kate Shea Foundation<br />
Mr. and Mrs. Mel Katten<br />
Keith L. Betts and Marian L. Betts Trust<br />
Olive Kerry Estate<br />
KIRO Television<br />
Kitsap Bank<br />
Mr. and Mrs. Tim Kittilsby<br />
Mr. Justin Knight<br />
Carolyn and Kevin Koester<br />
Nora Korg<br />
Kosan Biosciences<br />
KPFF Consulting Engineers<br />
Yvonne P. and Jack Lamey<br />
Mr. and Mrs. Brad Lange<br />
Lease Crutcher Lewis<br />
Mr. James C. Logsdon<br />
Mr. John C. Logsdon<br />
—DR. STANLEY RIDDELL<br />
Mr. Michael A. Logsdon<br />
Lopez, Hodes, Restaino,<br />
Millman and Skikos<br />
Louise H. & Edward R.<br />
Meyer Memorial Trust<br />
MagicHour Films<br />
Jon and Nancy Magnusson<br />
Helen and David Mandley<br />
Joyce E. Marshall Estate<br />
Mr. and Mrs. Mario Mazzola<br />
Bruce and Jolene McCaw<br />
Mark A. and Marna L. McNaughton<br />
MDS Analytical Technologies<br />
Jessica Meisels<br />
Mellon Bank N.A.<br />
Merchant & Gould<br />
Necia G. Miles Estate<br />
Mr. and Mrs. John F. Miller, Jr.<br />
Richard and Kathryn Miyauchi<br />
Mr. and Mrs. R. David Mushen<br />
Karin and Scott Nagel<br />
National Brain Tumor Foundation<br />
NC Machinery Company<br />
Myrtle M. Nelsen Estate<br />
Mr. and Mrs. Eugene K. Neuberger<br />
Mr. and Mrs. Wayne E. Niemuth<br />
North American Management Corp.<br />
North Mason <strong>Cancer</strong> Crusaders<br />
Pamela B. Katten Memorial<br />
Leukemia <strong>Research</strong> Foundation<br />
Christopher P. Parios and Susan Wyant<br />
Mr. Paul S. Pariser<br />
Mrs. Terry Pero<br />
Mr. and Mrs. Wayne M. Perry<br />
Elsbeth Pfeiffer<br />
Mr. and Mrs. John M. Pinkerton<br />
Mr. and Mrs. Matt Pool<br />
Mr. and Mrs. Stephen S. Poore<br />
Precor, Inc.<br />
Q13 FOX/MYQ2<br />
James and Sherry Raisbeck<br />
James V. Ramsdell, Jr.<br />
Raymond James & Associates, Inc.<br />
REB Enterprises, Inc.<br />
Mrs. Sally Reiquam<br />
Chad and Carol Richardson<br />
Ms. Lynn Ristig and Mr. Craig Shrontz<br />
Thurston and Catherine Roach<br />
Mr. and Mrs. Henry M. Robinett<br />
Robinett Investment Co., LLC<br />
John McVickar Robinson and<br />
Elizabeth W. Robinson<br />
Nea Lynn Robinson<br />
Mr. and Mrs. Gene E. Roeglin<br />
Rose-Marie and Jack R.<br />
Anderson Foundation<br />
Rowan University<br />
Kimberly Y. Ruhana and<br />
George W. Ruhana<br />
S*Bio<br />
Mrs. Colleen E. Schafer<br />
Mr. and Ms. Alan D. Sclater<br />
Ruth Martens Scott<br />
Seattle Genetics, Inc.<br />
Seattle Seahawks<br />
Seredigm<br />
Ms. Amy E. Shigo<br />
Andrew Short<br />
Mr. and Mrs. Raymond Sich<br />
Siemens Building Technologies, Inc.<br />
Mr. and Mrs. John Skovron<br />
21
22<br />
Donors<br />
Mr. Laurence H. Smead<br />
Ned and Carolyn Snow<br />
Ronald and Angela Souza<br />
Mr. and Mrs. Frank L. and<br />
Esther A. Springer<br />
Stafford Frey Cooper<br />
Laurie Stewart<br />
Ms. Edith S. Sullivan<br />
The Swanson Family<br />
Ms. Myra H. Tanita<br />
Team Photogenic<br />
Mr. and Mrs. Bruce G. Thayer<br />
Mr. and Mrs. Thomas M. Todaro<br />
Mr. and Mrs. Frank J. Tonkin, Jr.<br />
Trident Seafoods Corporation<br />
Gary and Amanda Tucci<br />
Ueland Foundation<br />
United Way of Tri-State<br />
The UPS Foundation<br />
UW Medicine<br />
Mr. Neil R. Wachter<br />
Washington Mutual Foundation<br />
David and Marsha Weil<br />
Michael and Paula Weintraub<br />
Windstar Cruises<br />
Mr. Chuck Wolfe<br />
Christine and William Woodcock<br />
Woods & Associates<br />
Mr. and Mrs. Scott Allan Wroblewski<br />
Mark A. Young and Kelly Johnson<br />
Zaaz, Inc.<br />
Legacy Partners in <strong>Research</strong><br />
Legacy Partners in <strong>Research</strong> are individuals<br />
who support the <strong>Hutchinson</strong> <strong>Center</strong><br />
through a bequest in their will, life income<br />
gift, life insurance, retirement assets or<br />
other planned gifts. As Legacy Partners in<br />
<strong>Research</strong>, they create a legacy for themselves<br />
and their families and play a pivotal<br />
role in benefiting future generations.<br />
Charles M. Ackerman and<br />
Barbara Clanton Ackerman<br />
Mr. Donald D. Ackley<br />
Dorothy J. Albro<br />
Arleta Rae Allen<br />
June M. Allen<br />
Ms. Chelea Alwine<br />
Jan A. Amen<br />
Alex and Helen Andersen<br />
Ms. Glenda W. Anderson<br />
Glenn and Lois Anderson<br />
Mrs. Grace Anderson<br />
Stuart L. and Karen C. Anderson<br />
Ms. Victoria Andrews<br />
Anonymous (122)<br />
<strong>Fred</strong>erick J. and Jane C. Artz<br />
Robert and Clodagh Ash<br />
Dr. Elizabeth Atwood<br />
N. Faye Bachmeier<br />
Patricia M. Bartlett<br />
Mr. Alfred A. Baston<br />
Thomas P. and I. Georgina Bayley<br />
Ms. Diana Beckers<br />
Barbara M. Bedayan<br />
Rod Belcher<br />
Mr. Will H. Bennett<br />
Mrs. Constance M. Benston<br />
Marc A. Berger<br />
Mrs. Sidonia Berglund<br />
“WHEN RESEARCH DOESN’T TURN OUT THE WAY YOU EXPECT IT TO,<br />
Yahn Bernier and Beth McCaw<br />
Mr. and Mrs. Harry C. Berryman<br />
Henry A. and Marjorie M. Bickel<br />
Sandra Kailes Biller<br />
Ellen O. Blackstone<br />
Sandra A. Boeskov<br />
Barbara A. Bonamy<br />
Christine Borgen<br />
Robert and Sheila Bosanko<br />
Arthur R. and Bernice J. Bowers<br />
Sandra Brentlinger<br />
Elmore G. and Dorcas Brolin<br />
Glen A. Buettgenbach<br />
Mr. and Mrs. Angelo Bulgarelli<br />
Mrs. Jennie K. Burwell<br />
Mr. and Mrs. Jack and Patty Bush<br />
Stephen D. Cameron<br />
Clint and Ruth Cannon<br />
Phillip and Violette Carlson<br />
Mrs. Lucy Carney<br />
Douglas A. Case<br />
Hazel E. Case<br />
Mary E. Cederlund<br />
Cora Chads<br />
Mylo and Marion Charlston<br />
Ms. Barbara Chester<br />
Mr. Lawrence N. Christian<br />
Susan L. Christiansen<br />
Dr. and Mrs. Edmund R. Clarke<br />
Emanuel and Susan Cohen<br />
Mr. Milton M. Cohen<br />
Gladys M. Collins<br />
Bob and Sylvia Cook<br />
<strong>Fred</strong> Corrado<br />
Mr. Martin J. Costello<br />
Mary Pat Cotty<br />
Mr. and Mrs. Fenwick J. Crane<br />
Roger and Gloria Crouch<br />
Lamont Crumley and<br />
D. Dianne Wilson-Crumley<br />
Margaret Cullor<br />
Mrs. Leah Currie<br />
Daryl Drew Charitable Foundation<br />
Mr. Roy V. De Britz<br />
Joan A. De Bruin<br />
Tillie I. De Leon<br />
Mr. and Mrs. Henry W. and<br />
Frances C. Decker<br />
Lou Denney<br />
Leslie and Deborah Disch<br />
Chris and Viki Parrott Dragich<br />
Wayne D. and Susan E. DuPont<br />
Mr. James P. Dye<br />
Peter S. and Sandra W. Dyer<br />
Mr. and Mrs. Robert L. Ecker<br />
Demerise Eddy<br />
Cecil David Enman and Norma J. Enman<br />
Thomas G. and Kay Nozaki Ewing<br />
June Faralla<br />
Mr. Richard Faulstich<br />
John and Rosemary Fedorochko<br />
Mary Jane Fee<br />
Clifford H. Fiscus<br />
Mrs. Lorraine M. Flanagan<br />
Anton M. and Barbara C. Fleischman<br />
Jane B. Folkrod<br />
Bob and Lanie Franza<br />
Richard and Linda Frasch<br />
Bill and Deryn Fulton<br />
Larry Gahlhoff<br />
Ken and Lisa Geisen<br />
Jane Gerhardt<br />
James D. and Paula J. Gillmore<br />
Eileen Goebel<br />
Richard Goldstein<br />
Ms. Rosemary Goransson<br />
Mr. and Mrs. Wayne C. Gott<br />
Mr. Mark J. Gralia<br />
Ron and Cathy Grant<br />
Mrs. Norman Groudine<br />
John and Ann Guerin<br />
Donald and Pauline Hagan<br />
Ms. Helen Hamilton<br />
Sharla and Don Hamilton<br />
Martha W. Hanscom<br />
Arthur H. Hansen<br />
Alice Coulon Hanson<br />
Mary Alberta Hargrove<br />
Andy and Carol Harris<br />
Mr. and Mrs. Robert Harrower, Jr.<br />
Mrs. Mary E. Harvill<br />
Peder and Theodora Haslestad<br />
John and Roberta Hayes<br />
Hal and Jerry Haynes<br />
Dr. <strong>Fred</strong>erick and Margaret Hazeltine<br />
Patricia and Robert D. Heffernan, Jr.<br />
Mr. and Mrs. Severt S. Hegland, Jr.<br />
Ms. Jean S. Heidt<br />
Mr. and Mrs. David C. Henderson<br />
Ralph and Gail Hendrickson<br />
Gregory and Anne-Marie Henry<br />
Conrad W. Hewitt<br />
Larry and Marcia Hilberg<br />
Mrs. K. L. Hillard<br />
Vivian and Les Houle<br />
Mr. and Mrs. James W. Howard<br />
Barbara Howell<br />
Mr. and Mrs. George C. Hudspeth<br />
Mr. and Mrs. Paul S. Hunter<br />
Floyd and Barbara Hutton<br />
Mr. and Mrs. James G. Hutton<br />
Dr. and Mrs. Gordon L. Imlay<br />
David and Gigi Jack<br />
Douglas L. Jacobs<br />
Dorothy Doyle Johnson<br />
Mr. Douglas B. Johnson<br />
James A. and Holly F. Johnson<br />
Richard P. and Caroline I. Jones<br />
Thomas M. Jones and Judith A. Edwards<br />
Elaine N. Kaald<br />
Ellen Kam<br />
Miyoko Kaneta<br />
Ms. Heidi Kass<br />
Ms. Deborah Kaufman<br />
Brant A. Keeney<br />
James M. and Lavina S. Kemp<br />
Mr. and Mrs. Donald N. Kinkead<br />
Mr. Robert G. Kinney<br />
Mrs. Nelda S. Kleinschmidt<br />
<strong>Fred</strong>erick and Julianne Klippert<br />
Nora Korg<br />
Mr. and Mrs. Gary A. Krape<br />
Mr. and Mrs. David Kremers<br />
Donna L. Kyle<br />
Larry and Linda LaBolle<br />
Mr. William M. and<br />
Dr. Geraldine K. Landis<br />
Mr. and Mrs. Gus Lange<br />
Lolita Lanning<br />
Gloria L. Larkin<br />
E. Margaret Lawrence<br />
Roy and Vel Leonard<br />
FIGURE OUT WHY.<br />
Martha LePrell<br />
Joe and Lyn Lightfoot<br />
Mr. and Mrs. Stephen H. Lindquist<br />
Ralph and Lynda Lipe<br />
Paul S. MacMichael<br />
Mr. Edward E. Maloof<br />
Wilbur C. Mann<br />
Stephanie D. Mapelli<br />
Mr. and Mrs. Robert J. Margulis<br />
Dr. and Mrs. Herbert A. Marra<br />
Hank, Fuchsia and Marcia Martin<br />
Jeff and Ethel Maxwell<br />
Mr. and Mrs. Robert McDaniel<br />
Mrs. Alma L. McDonald<br />
Mary Jane McElyea<br />
Marcia McGreevy-Lewis and<br />
Robert D. Lewis, M.D.<br />
Douglas G. and Ruth J. McKnight<br />
Barbara F. Meehan<br />
Elinor K. Menter<br />
Robert Miller and Marlys Owen-Jones<br />
Mrs. Anne A. Moldrem<br />
Johnny and Susie Morganti<br />
Mrs. Gladys M. Morrison<br />
Mr. and Mrs. James A. Morrison<br />
Judy Mukai<br />
Mr. and Mrs. Al Neelley<br />
Nick and Carol Westlund<br />
Supporting Organization<br />
Miss Elsa Nordin<br />
Mrs. Ella Nuckolls<br />
Everett and Dorothy O’Neill<br />
Mrs. Jean B. O’Neill<br />
Mr. Charles L. O’Shea<br />
Alice Oehler<br />
Carole A. Olson<br />
Miss Elvi M. Olsson<br />
Mr. Stanford E. Opdyke<br />
Robert B. Overhus<br />
Mrs. James Owen<br />
Stanley Ozbolt<br />
Mr. and Mrs. Geoffrey and Netta Page<br />
Kenneth and Lorrayne Palmer<br />
Mr. and Mrs. Jack G. Parks<br />
T. Keith and Janet Patrick<br />
Harry and Katherine Pearce<br />
Kristian Pearson<br />
<strong>Fred</strong>erick and Elizabeth Pedersen<br />
Mary R. Pelan<br />
Daniel J. Peters<br />
George and Cynthia Pierce<br />
Julia B. Poduch<br />
Bradford and Sandra Porter<br />
Deirdre and Dickson Preston<br />
Marietta E. Priebe<br />
Mr. Ross Purintun<br />
Mr. and Mrs. Robert and Teresa Quigley<br />
Gustav and Claire T. Raaum<br />
Sherry Y. Rae<br />
Mrs. Della L. Ramsden<br />
Weldin and Jo Ann Read<br />
Mrs. Sally Reiquam<br />
Bruce and Karen Richards<br />
Douglass and Lea Richter<br />
Mr. and Mrs. Joe A. Riedel, Jr.<br />
Mrs. Margaret Robarge<br />
Marilyn H. Rogers<br />
Claudia Rollins<br />
Mr. and Mrs. Thomas E. Roth<br />
Milton and Ruth Rubin<br />
Mr. and Mrs. Allan N. Rumpf<br />
THAT ANSWER IS USUALLY MUCH MORE INTERESTING THAN IF IT HAD TURNED OUT.”<br />
Mr. Robert H. Rutledge<br />
Cynthia and Gerry Salkowski<br />
Sam and Betty Lebid Foundation<br />
Mary L. Sanderson-Schinman<br />
Patricia L. Schaumberg<br />
Brent and Susan Schlosstein<br />
Loretta Schossow<br />
Ms. Rosalyn H. Schuknecht<br />
Robert E. Schultz<br />
Mr. Casey Sepanski<br />
Dorothy L. Shattuck<br />
Barbara Jean Shenk<br />
Pam and Geoff Sheridan<br />
Pearl L. Shernoff<br />
Mr. C. Larry Shull<br />
Ms. Annette Siversen<br />
Mr. Eugene G. Sivertson<br />
Bernice and George Smith<br />
Mrs. Phyllis H. Smith<br />
Dr. and Mrs. Richard Smith<br />
Ruth B. Smith<br />
Samuel E. and J. Michelle Smith<br />
Joseph T. Smudin<br />
Mr. Frank W. Soderling<br />
Gregory P. Sokolowski<br />
Herba Irene Solstad<br />
Mary and Steve Solum<br />
Mrs. Kathleen P. Spading<br />
Josephine and Stephen Spear<br />
James Speckbrock<br />
Mr. and Mrs. Frank L. and<br />
Esther A. Springer<br />
Mrs. Caren A. Staley<br />
Evelyn Casey Steen<br />
Mrs. Idalene Strang<br />
Janet Swanson<br />
Connie Taylor<br />
Ken and Judy Thomas<br />
Dick and Ruth Thomassen<br />
Mr. and Mrs. Charles M. and<br />
Marjorie J. Thorne<br />
Capt. Donald A. Thornton<br />
Olive Tice<br />
Mr. and Mrs. Michael J. Toennessen<br />
Claribel Trigve<br />
Mr. and Mrs. David T. Troxel<br />
Karl R. and Marcile H. Turner<br />
Mrs. Walter A. Turner<br />
Mr. and Mrs. Robert E. Vallat<br />
Mary C. Vanderzicht<br />
Jean Baur Viereck<br />
Mr. Jerry Warfield<br />
William H. Warner<br />
Jim and Diane Watson<br />
Mrs. Robert E. Weaver<br />
Steve and Dana Weiner<br />
Lewis G. Weiss<br />
Sandra E. Weiss<br />
Catherine and Steven Wells<br />
Anne T. White<br />
Mrs. Edward Whitley<br />
William and Susanna Wiegant<br />
Christopher L. and Ruby D. Wilde<br />
Carl H. Wittenberg<br />
Ms. Dawn M. Wood<br />
Penny M. Woods<br />
Sarah Woods<br />
James and Herma Wyn<br />
Patricia C. Youngman<br />
Mrs. Veva J. Zard<br />
Mrs. Arline Zidell<br />
Inner Circle<br />
The Inner Circle is comprised of current<br />
and former faculty, staff and their spouses;<br />
past and present members of the Board<br />
of Trustees, Board of Ambassadors and<br />
Senior Council and their spouses; as well<br />
as past members of the former Foundation<br />
Board of Directors and their spouses.<br />
It recognizes those who support the<br />
<strong>Hutchinson</strong> <strong>Center</strong> through a bequest in<br />
their will, life income gift, life insurance,<br />
retirement assets or other planned gifts.<br />
Steven J. and Lisa M. Anderson<br />
Anonymous (6)<br />
Robert M. Arnold<br />
Rich and Leslie Begert<br />
Carl and Renée Behnke<br />
Sally Skinner Behnke<br />
Brian R. and Shelley J. Buck<br />
William W. and<br />
Kathy Lynn Christoffersen<br />
Mr. and Mrs. John D. Eastham<br />
Karl and Carol Ege<br />
Robert N. and Ingrid Lahti Eisenman<br />
Noemi A. Epstein<br />
Ms. Linda L. Gainer<br />
Janice A. and Robert L. Gerth<br />
Kenneth and Beryl Goodchild<br />
Dr. William Grady and<br />
Dr. Karen Tsuchiya<br />
Sheri Ray Greaves<br />
Marcia and Glenn Harrington<br />
Debra and Chuck Holland<br />
Deborah E. Kirsner<br />
Lynette A. Klein<br />
Reginald S. Koehler III<br />
Judy Kornell<br />
Shelley M. Kuni<br />
Ms. Karen E. Lane<br />
Jerrold D. Liebermann and Linda J. Harris<br />
Jeffrey and Ethel Maxwell<br />
Rachelle A. McCallum<br />
Patricia McCowan<br />
Neil and Nancy McReynolds<br />
Karen and Jamie Moyer<br />
Shan and Lee Mullin<br />
Han and Shawn Nachtrieb<br />
Paul and Carol Neiman<br />
Martin and Vicki Nelson<br />
Dr. Gilbert S. Omenn and<br />
Martha A. Darling<br />
John and Deanna Oppenheimer<br />
Guy and Arlene Ott<br />
John and Jean Rolfe<br />
Michael T. and Nancy A. Ryan<br />
Marilla Satterwhite<br />
Dr. and Mrs. E. Donnall Thomas<br />
Mrs. Barbara Thrasher<br />
Seattle <strong>Cancer</strong> Care Alliance<br />
The Seattle <strong>Cancer</strong> Care Alliance (SCCA)<br />
unites the adult and pediatric cancercare<br />
services of <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong><br />
<strong>Research</strong> <strong>Center</strong>, UW Medicine and<br />
Children’s Hospital and Regional Medical<br />
<strong>Center</strong>. In fiscal year 2008, 1,182 donors<br />
contributed more than $2.1 million to<br />
the SCCA to support efforts to provide<br />
premier, patient-focused care and access to<br />
groundbreaking clinical research to patients<br />
from around the world.<br />
<strong>Research</strong> Benefactors<br />
$1 million or more<br />
Safeway Inc.<br />
<strong>Research</strong> Fellows<br />
$50,000 - $99,999<br />
Entertainment Industry Foundation<br />
The Madhouse Project<br />
Seattle Symphony<br />
Thomas C. Wright Foundation<br />
<strong>Research</strong> Sponsors<br />
$25,000 - $49,999<br />
<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
Lisa Lund Fund<br />
<strong>Research</strong> Supporters<br />
$10,000 - $24,999<br />
Auburn Regional Medical <strong>Center</strong><br />
Broadway Across America/Live Nation<br />
Central Washington Hospital<br />
Children’s Hospital &<br />
Regional Medical <strong>Center</strong><br />
Fairfax Hospital<br />
Ms. Catherine L. Fallen<br />
Harrison Medical <strong>Center</strong><br />
Highline Medical <strong>Center</strong><br />
Legacy Salmon Creek<br />
Perkins Coie LLP<br />
Sacred Heart Medical <strong>Center</strong><br />
Seattle <strong>Center</strong> Marketing<br />
St. Joseph Hospital<br />
St. Joseph Hospital & Medical <strong>Center</strong><br />
Virginia Mason Clinic/Medical <strong>Center</strong><br />
Yakima Valley Memorial Hospital <strong>Center</strong><br />
for Child Health Services<br />
<strong>Research</strong> Friends<br />
$5,000 - $9,999<br />
Mr. and Mrs. Rajeev Bajaj<br />
Charles B. See Foundation<br />
Mr. Ray Hickey<br />
Holy Family Hospital<br />
Meghan’s Mountain Charitable<br />
Foundation, Inc.<br />
Pacific NW 4 Wheel Drive Association<br />
PeaceHealth Saint John Medical <strong>Center</strong><br />
Providence Everett Medical <strong>Center</strong><br />
Providence Saint Peter Hospital<br />
Saint Francis Hospital<br />
The Schneider Family Foundation<br />
Mrs. Barbara Stief<br />
United Way of King County<br />
—DR. LEE NELSON<br />
Marsha Rivkin <strong>Center</strong> for Ovarian<br />
<strong>Cancer</strong> <strong>Research</strong><br />
In partnership with the <strong>Hutchinson</strong> <strong>Center</strong><br />
and Swedish Medical <strong>Center</strong>, the Marsha<br />
Rivkin <strong>Center</strong> for Ovarian <strong>Cancer</strong> <strong>Research</strong><br />
is a nonprofit organization dedicated to<br />
saving lives and reducing suffering through<br />
improved treatment, early detection<br />
and prevention of ovarian cancer. The<br />
Rivkin <strong>Center</strong> funds pilot studies, issues<br />
scientific scholar awards, conducts ovarian<br />
symposiums and provides ovarian-cancer<br />
screening in conjunction with cutting-edge<br />
research projects.<br />
Marsha Rivkin <strong>Center</strong> Contributors<br />
The following donors contributed<br />
$5,000 or more between January 1 and<br />
December 31, 2007.<br />
$100,000 - $249,999<br />
Bensussen Deutsch & Associates Inc.<br />
Fisher Foundation for Family Health<br />
$50,000 - $99,999<br />
98.9 KWJZ<br />
Janet L. Brown Estate<br />
$25,000 - $49,999<br />
Chuck and Karen Lytle<br />
$10,000 - $24,999<br />
Anonymous (1)<br />
Donna R. Benaroya<br />
Eric and Gloria Bensussen<br />
Bob Bridge Toyota<br />
Ms. Lynda M. Gilman<br />
KING 5 Television<br />
Ladies Auxiliary VFW<br />
The Lester & Bernice Smith Foundation<br />
Martin-Fabert Foundation<br />
David and Mette Naness<br />
Swedish Medical <strong>Center</strong> First Hill Auxiliary<br />
$5,000 - $9,999<br />
Mr. and Mrs. Wayne Anderson<br />
Apple American Group<br />
Athena Partners<br />
Bank of America<br />
Cell Therapeutics,<br />
Drs. James and Sue Bianco<br />
Mr. Mark J. Craemer<br />
Grandmasters, LLC<br />
Mr. Luther Haugan<br />
Health Care Property Investors, Inc<br />
Mr. David A. Hoffman<br />
Jim and Lorna Kneeland<br />
MaryAnne and Richard Kobylka<br />
Mrs. Lisa Kreissler and Mr. Allen Derheim<br />
Allan B. Learned<br />
Mr. C. Eric Morse<br />
Mr. and Mrs. Paul Russo<br />
The Schuler Family Foundation,<br />
Mr. and Mrs. James K. Schuler<br />
Mr. and Mrs. Frank Sixt<br />
Stuart and Karen Sloan<br />
† Deceased<br />
CA Corporate Affilitates<br />
PC President’s Circle<br />
PC* President’s Circle charter member<br />
23
24<br />
Financial<br />
Summary<br />
OPERATING REVENUES<br />
FISCAL YEAR 2008<br />
n <strong>Research</strong> Grants and Contracts 78%<br />
n Net Contributions 7%<br />
n Investment Income 4%<br />
n Other Income 11%<br />
OPERATING EXPENSES<br />
FISCAL YEAR 2008<br />
n Program Services– <strong>Research</strong> 77%<br />
n Facilities and Administration 21%<br />
n Fundraising 2%<br />
<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
Fiscal Years 2008 and 2007<br />
Revenues and Other Support<br />
(in thousands of dollars)<br />
2008<br />
(Unaudited)<br />
2007<br />
(Audited)<br />
<strong>Research</strong> Grants and Contracts $294,244 $273,621<br />
Net Contributions 27,634 27,669<br />
Investment Income 15,936 20,930<br />
Other Income 43,299 33,990<br />
Total Revenues $381,113 $356,210<br />
Expenses<br />
(in thousands of dollars)<br />
Program Services – <strong>Research</strong> $286,905 $262,755<br />
Facilities and Administration 77,538 73,061<br />
Fundraising 6,861 5,616<br />
Total Expenses $371,304 $341,432<br />
Change in Net Assets from Operations $ 9,809 $ 14,778<br />
Change in Net Assets from Financing Activities – 19,243 8,592<br />
Total Increase/(Decrease) in Net Assets – 9,434 23,370<br />
Net Assets Balance at Beginning of Year 209,676 186,306<br />
Net Assets Balance at End of Year $200,242 $209,676<br />
Thank you for joining us in our mission to eliminate cancer and related<br />
diseases as causes of suffering and death. Private donations like yours<br />
are essential for allowing <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong> to<br />
rapidly respond to novel research opportunities that can lead to important<br />
medical breakthroughs.<br />
Financial support from our donors enables us to attract and retain<br />
the world’s top scientists, provide our researchers with state-of-the-art<br />
technology needed to advance their work and launch innovative pilot<br />
projects to explore new ways to eliminate cancer and related diseases.<br />
Private gifts also leverage significant additional investment by allowing<br />
investigators to successfully compete for prestigious foundation grants that<br />
do not cover the full cost of research.<br />
The many accomplishments that keep the <strong>Hutchinson</strong> <strong>Center</strong> at<br />
the forefront of biomedical research could not be achieved without your<br />
generous gifts.<br />
SOURCES OF CONTRIBUTIONS<br />
FISCAL YEAR 2008<br />
n Planned Giving 29%<br />
n Principal/Major Gifts 23%<br />
n Foundation Relations 17%<br />
n Annual Giving 12%<br />
n Special Events 10%<br />
n President’s Circle 8%<br />
n Corporate Relations 1%<br />
USES OF CONTRIBUTIONS<br />
FISCAL YEAR 2008<br />
n Direct <strong>Research</strong> Investments 80%<br />
and Patient Care<br />
n Fundraising Expenses 20%<br />
25
26<br />
<strong>Center</strong> Boards<br />
FISCAL YEAR 2008<br />
Board of Trustees<br />
Sally G. Narodick, Chair<br />
Douglas W. Walker, Vice Chair<br />
Jeffrey P. Maxwell, Treasurer<br />
Steve Davis, Secretary<br />
Ronald E. Bayley<br />
Richard P. Begert<br />
Edward D. Davila, M.D.<br />
Karl J. Ege<br />
Alan D. Frazier<br />
Robert J. Herbold<br />
Peter A. Horvitz<br />
Henry James<br />
Richard E. Jones<br />
Henry L. Kotkins, Jr.<br />
Don J. Listwin<br />
Gary Locke<br />
Patricia B. May<br />
Joan Ellen Morse<br />
Karen Moyer<br />
Robert T. Nelsen<br />
Martin O. Nelson, Jr.<br />
Charlotte H. Reed<br />
John Thurston Roach<br />
Keith M. Schorsch<br />
Stephen V. Sundborg, S.J.<br />
Douglas E. Williams, Ph.D.<br />
Board of Ambassadors<br />
Richard W. Anderson, Co-chair<br />
Carl G. Behnke, Co-chair<br />
Jean B. Rolfe, Co-chair<br />
Constance M. Anderson<br />
Robert M. Arnold<br />
Robert E. Bayley<br />
Sally S. Behnke<br />
Ronald J. Berenson, M.D.<br />
Deborah L. Bevier<br />
Eric S. Bremner<br />
<strong>Fred</strong> Brown<br />
Philip K. Bussey<br />
Hugh Chang<br />
William W. Christoffersen<br />
Rudolph F. Crew. Ed.D.<br />
David R. Davis, M.D.<br />
Barbara R. Ells<br />
Phelps K. Fisher<br />
Edward V. Fritzky<br />
Ben J. Gantt, Jr.<br />
Jack M. Geoffroy †<br />
Robert L. Gerth<br />
Denver C. Ginsey<br />
Kenneth J. Goodchild<br />
S. John Goodwin<br />
Slade Gorton<br />
Stephen M. Graham<br />
Kenneth S. Greenbaum<br />
Irving M. Haug<br />
Charles L. Hirsch<br />
Ronald S. Howell<br />
John L. <strong>Hutchinson</strong><br />
Jeremy A. Jaech<br />
Julius P. Johnston III<br />
Kay D. Jones<br />
Perrin Kaplan<br />
Reginald S. Koehler III<br />
David C. Lycette<br />
David A. Mann<br />
Patricia A. McDonald<br />
Neil L. McReynolds<br />
J. Shan Mullin<br />
Craig J. Mundie<br />
Amb. Della Newman<br />
Gilbert S. Omenn, M.D., Ph.D.<br />
Admiral William A. Owens<br />
Nancy D. Pellegrino<br />
Bruce M. Pym<br />
Charles E. Riley<br />
H. Jon Runstad<br />
Katherine J. Savitt<br />
Harriet Shrontz<br />
The Honorable<br />
Charles Z. Smith<br />
Alessandra Spencer<br />
Michael A. Stein<br />
Cynthia Stroum<br />
Gerald R. Swanson<br />
Rev. Robert V. Taylor<br />
Bonnie A. Towne<br />
George A. Walker<br />
Mary H. Wiese<br />
Scott F. Wilson<br />
John C. Woodin<br />
Cindy Zehnder<br />
Senior Council<br />
Constance M. Anderson<br />
Robert M. Arnold<br />
Robert E. Bayley<br />
Sally S. Behnke<br />
Deborah L. Bevier<br />
Eric S. Bremner<br />
William W. Christoffersen<br />
Vincent F. Coviello, Jr.<br />
David R. Davis, M.D.<br />
Barbara R. Ells<br />
Phelps K. Fisher<br />
David B. Frohnmayer<br />
Ben J. Gantt, Jr.<br />
Jack M. Geoffroy<br />
Denver C. Ginsey<br />
Slade Gorton<br />
Irving M. Haug<br />
Frank H. Hopkins<br />
John L. <strong>Hutchinson</strong><br />
Kay D. Jones<br />
Reginald S. Koehler III<br />
Stanley M. Little, Jr.<br />
David C. Lycette<br />
Patricia A. McDonald<br />
Neil L. McReynolds<br />
J. Shan Mullin<br />
Amb. Della Newman<br />
Gilbert S. Omenn, M.D., Ph.D.<br />
George B. Rathmann, Ph.D.<br />
Charles E. Riley<br />
Jean B. Rolfe<br />
James F. Ryan<br />
Harriet Shrontz<br />
The Honorable<br />
Charles Z. Smith<br />
Cynthia Stroum<br />
Rev. William J. Sullivan, S.J.<br />
Gerald R. Swanson<br />
James G. Talbot<br />
Bonnie A. Towne<br />
George A. Walker<br />
Cindy Zehnder<br />
† Deceased<br />
<strong>Center</strong> Leadership<br />
Lee Hartwell, Ph.D.<br />
President and Director<br />
Myra Tanita<br />
Executive Vice President and<br />
Chief Operating Officer<br />
Mark Groudine, M.D., Ph.D.<br />
Executive Vice President and<br />
Deputy Director<br />
<strong>Fred</strong>erick Appelbaum, M.D.<br />
Senior Vice President and Director<br />
Clinical <strong>Research</strong> Division<br />
Barbara Trask, Ph.D.<br />
Senior Vice President and Director<br />
Human Biology Division<br />
James Roberts, M.D., Ph.D.<br />
Senior Vice President and Director<br />
Basic Sciences Division<br />
Ross Prentice, Ph.D.<br />
Senior Vice President and Director<br />
Public Health Sciences Division<br />
Larry Corey, M.D.<br />
Senior Vice President and Co-Director<br />
Vaccine and Infectious<br />
Disease Institute<br />
Scott Rusch<br />
Vice President<br />
Facilities and Operations<br />
Bob Robbins, Ph.D.<br />
Vice President<br />
Information Technology<br />
Janell Baldwin<br />
Vice President<br />
Shared Resources<br />
Han Nachtrieb<br />
Vice President<br />
Human Resources<br />
Doug Shaeffer<br />
Vice President<br />
General Counsel<br />
Ulrich Mueller, Ph.D.<br />
Vice President<br />
Industry Relations and<br />
Technology Transfer<br />
Randy Main<br />
Vice President of Finance<br />
and Chief Financial Officer<br />
Nancy Wells<br />
Vice President<br />
Development<br />
Linda Gainer<br />
Vice President<br />
External Affairs and<br />
Communications<br />
<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
At <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>, our interdisciplinary teams of worldrenowned<br />
scientists and humanitarians work together to prevent, diagnose and treat<br />
cancer, HIV/AIDS and related diseases. Our researchers, including three Nobel laureates,<br />
bring a relentless pursuit and passion for health, knowledge and hope to their work and<br />
the world.<br />
With research excellence that spans the full spectrum of cancer research, we are<br />
uniquely qualified not only to discover, but to implement lifesaving breakthroughs.<br />
To achieve our goal of improving human health around the world, our scientists lead studies<br />
in the following areas: Early Detection and Intervention, Immunotherapy, Tumor <strong>Research</strong>,<br />
Fundamental <strong>Research</strong>, Leukemia and Lymphoma <strong>Research</strong>, International <strong>Research</strong>,<br />
Prevention <strong>Research</strong>, and Childhood <strong>Cancer</strong>s.<br />
In addition to our groundbreaking research, we also provide a range of support services<br />
for the patients and families who come to the <strong>Hutchinson</strong> <strong>Center</strong> for lifesaving treatment.<br />
Programs include the Pete Gross House and Hutch School, <strong>Cancer</strong> Information Service,<br />
the Long-Term Follow-Up Program as well as the <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
Survivorship Program, part of the LIVESTRONGTM Survivorship <strong>Center</strong> of Excellence<br />
Network, and the <strong>Cancer</strong> Prevention Clinic located at the Seattle <strong>Cancer</strong> Care Alliance.<br />
Annual Report<br />
published by the External Affairs<br />
and Communications Department<br />
<strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
PO Box 19024<br />
Seattle, WA 98109-1024<br />
206.667.5000<br />
www.fhcrc.org<br />
© 2008 <strong>Fred</strong> <strong>Hutchinson</strong><br />
<strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong><br />
Gordon Todd<br />
Editor<br />
Barbara Hoberecht<br />
Art Director<br />
Susie Fitzhugh<br />
Portrait Photographer<br />
Ignacio Lobos<br />
Colleen Steelquist<br />
Writers<br />
Photo credits:<br />
Meghan Mullarky, cover; Ignacio Lobos, page 17;<br />
Dr. Florian Hladik, page 28<br />
Printed on recycled paper<br />
27
dedicated to<br />
a future<br />
HIV HIDES IN A DENDRITIC CELL OF THE GENITAL LINING.<br />
of <strong>discovery</strong><br />
“DISCOVERY IS SEEING WHAT EVERYBODY HAS SEEN,<br />
AND THINKING WHAT NOBODY HAS THOUGHT.”<br />
—ALBERT SZENT-GYÖRGYI<br />
THE EXPLORATORY NATURE OF SCIENTIFIC INVESTIGATION IS DISPLAYED IN DR. MICHAEL EMERMAN’S NOTES.<br />
BACK COVER: STOCHASTIC MODELS REVEAL THE SPREAD OF DISEASE IN A PANDEMIC OUTBREAK.
Seattle’s reputation as a leader in high technology and biotechnology and the allure of the region’s<br />
natural beauty attract the world’s best minds to <strong>Fred</strong> <strong>Hutchinson</strong> <strong>Cancer</strong> <strong>Research</strong> <strong>Center</strong>.<br />
We draw inspiration from our diverse landscape—from rivers and ocean to mountains and forest.<br />
At the <strong>Hutchinson</strong> <strong>Center</strong>, we live and breathe a life of science.<br />
Mail Stop J5-200, PO Box 19024, Seattle, WA 98109-1024 206.667.4399 1.800.279.1618 www.fhcrc.org