towards improved death receptor targeted therapy for ... - TI Pharma
towards improved death receptor targeted therapy for ... - TI Pharma towards improved death receptor targeted therapy for ... - TI Pharma
TRAIL‐induced migration and invasion Western blotting Western blot analysis was performed as described before [13]. The following primary antibodies were used all from Cell Signalling Technology Inc. (Danvers, MA, USA): anti‐p‐ Src (Tyr416) (#2101), anti‐Src (#2109), anti‐p‐Akt (Ser473) (#9271), anti‐Akt (#9272), anti‐ p‐ERK 42/44 (Thr202/Tyr204) (#9101), anti‐ERK (#9102), anti‐p‐STAT3 (Ser727) (#9134), anti‐STAT3 (#9132), and RIP (#3493). β‐Actin was from Sigma‐Aldrich. The bands were analyzed and the activities of the kinases were determined by calculating the ratio between the phosphorylated form and the total kinase. Gene silencing For silencing the expression of genes pSUPER.retro was used similarly as described previously [18]. Targeted short hairpin (sh)RNA sequences were inserted into the BglII and HindIII sites of the pSUPER.retro vector. All cloned shRNA sequences were verified by DNA sequencing. Retroviruses were packaged and introduced into cells as described previously [19]. A549 and H460 cells were retrovirally infected with control pSUPER.retro or pSUPER.retro‐shRIP1 (RIP1‐targeting sequence #1, 5'‐ GAGCAGCAGTTGATAATGT‐3'; RIP1‐targeting sequence #2 5'‐ TACCACTAGTCTGACGGATAA‐3') or pSUPER.retro‐shSrc (5'‐GGACCTTCCTCGTGCGAGA‐3') for 24 h. Infected cells were selected with 2 µg/ml puromycin. Cell death measurement Cell death measurements were performed by FACS analysis as described previously [20]. In brief, cells were seeded at a density of 400,000 cells/well in 6‐wells plates. After treatment, cells were trypsinized, resuspended in medium collected from the matching sample and centrifuged for 5 min at 1,200 rpm. Subsequently, cells were stained with propidium iodide (Sigma‐Aldrich) buffer (0.1 mg/ml with 0.1 % RNAse A (Qiagen, Venlo, the Netherlands) in dark on ice. DNA content of the cells was analyzed by FACS (Becton Dickinson, Immunocytometry Systems, San Jose, CA, USA) with an acquisition of 10,000 events. The sub‐G1 peak was used to determine the extent of cell death. ‐ 65 ‐
Chapter 4 RESULTS TRAIL induces a spectrum from pro‐apoptotic to pro‐invasive responses in different NSCLC cells TRAIL resistance of cancer cells hampers therapeutic exploitation of the TRAIL apoptotic pathway and may even provoke counterproductive effects. Also in vitro, different NSCLC cell lines differ markedly in their sensitivity to TRAIL as judged by the capacity of a 24 h TRAIL treatment to diminish cell viability as measured in MTT assays (Fig. 1A and B). Whereas H460 cells are highly sensitive for TRAIL (IC50 ≈ 10 ng/ml), H322 cells require higher concentrations to respond with cell death to TRAIL treatment (IC50 ≈ 81 ng/ml), and SW1573 and A549 cells seem incapable of inducing an apoptotic response to TRAIL (IC50 > 200 ng/ml). Figure 1. Cytotoxic effects of TRAIL in different NSCLC cell lines. (A) Cell growth was measured using an MTT assay following 24 h treatment with increasing concentrations of TRAIL. (B) calculated IC 50 values for TRAIL in the different NSCLC cells. Importantly, resistance to cell death is associated with TRAIL‐induced pro‐invasive effects in NSCLC. In wound healing assays, TRAIL treatment resulted in 2 to 3‐fold increased migratory activity of A549 cells when compared to untreated cells (Fig. 2A and B). Also, SW1573 cells showed an increase in migration activity in this assay upon TRAIL challenge, whereas TRAIL failed to induce migration in H322 and H460 cells in line with apoptosis activation in these cells. MTT assays performed in parallel showed that the enhanced ‘wound healing’ in A549 cells is not due to a TRAIL‐mediated increase in proliferation (Fig. 2E). Consistently, a decreased potential to respond to TRAIL stimulation with apoptosis is associated with increased invasion as detected in matrigel‐transwell assays. TRAIL apoptosis‐resistant A549 cells exhibited approximately a 2‐fold increase in invasive capacity following TRAIL stimulation when compared to untreated cells (Fig. 2C and D). ‐ 66 ‐
- Page 15 and 16: Chapter 1 Reference List 1. Jemal A
- Page 17 and 18: Chapter 2 ABSTRACT Tumor necrosis f
- Page 19 and 20: Chapter 2 INTRODUCTION The death li
- Page 21 and 22: Chapter 2 In preclinical studies, a
- Page 23 and 24: Chapter 2 Table 1| Summary of the k
- Page 25 and 26: Chapter 2 proliferation could be pr
- Page 27 and 28: Chapter 2 Figure 2. Canonical and n
- Page 29 and 30: Chapter 2 associated with TRAIL res
- Page 31 and 32: Chapter 2 adhesion molecules [109].
- Page 33 and 34: Chapter 2 Reference List 1. Ashkena
- Page 35 and 36: Chapter 2 37. Tolcher AW, Mita M, M
- Page 37 and 38: Chapter 2 melanoma cells from TRAIL
- Page 39 and 40: Chapter 2 and ERK pathways. Circula
- Page 41 and 42: Chapter 3 ABSTRACT Tumor necrosis f
- Page 43 and 44: Chapter 3 inhibitors and TRAIL rece
- Page 45 and 46: Chapter 3 of amplification of the t
- Page 47 and 48: Chapter 3 P38 and JNK have opposing
- Page 49 and 50: Chapter 3 Figure 2 (continued). (e)
- Page 51 and 52: Chapter 3 previously established H4
- Page 53 and 54: Chapter 3 effect on TRAIL‐induced
- Page 55 and 56: Chapter 3 induced apoptosis in H460
- Page 57 and 58: Chapter 3 Reference List 1. Jemal A
- Page 59 and 60: Chapter 3 40. Domina AM, Vrana JA,
- Page 61 and 62: Chapter 4 ABSTRACT Tumor necrosis f
- Page 63 and 64: Chapter 4 role in the activation of
- Page 65: Chapter 4 the tip with a diameter o
- Page 69 and 70: Chapter 4 vehicle control or with 5
- Page 71 and 72: Chapter 4 Non‐canonical TRAIL res
- Page 73 and 74: Chapter 4 A549‐shRIP1 cells clear
- Page 75 and 76: Chapter 4 Figure 7. Inhibition of S
- Page 77 and 78: Chapter 4 DISCUSSION The TRAIL rece
- Page 79 and 80: Chapter 4 Src‐independent mechani
- Page 81 and 82: Chapter 4 variants. Cell Death Dis
- Page 83 and 84: Chapter 4 ‐ 82 ‐
- Page 85 and 86: Chapter 5 ABSTRACT TRAIL is an inte
- Page 87 and 88: Chapter 5 targets and subsequent pr
- Page 89 and 90: Chapter 5 RESULTS Synergistic activ
- Page 91 and 92: Chapter 5 ng/ml TRAIL (Fig. 3B). Ap
- Page 93 and 94: Chapter 5 by sub‐G1 levels in the
- Page 95 and 96: Chapter 5 DISCUSSION In the present
- Page 97 and 98: Chapter 5 Reference List 1. Jemal A
- Page 99 and 100: Chapter 5 ‐ 98 ‐
- Page 101 and 102: Chapter 6 ABSTRACT TRAIL is a tumor
- Page 103 and 104: Chapter 6 various stress stimuli [1
- Page 105 and 106: Chapter 6 Subsequently, the membran
- Page 107 and 108: Chapter 6 B H460 A549 Figure 1. Rep
- Page 109 and 110: Chapter 6 TRAIL‐dependent cell de
- Page 111 and 112: Chapter 6 B H460 A549 C Figure 4 (c
- Page 113 and 114: Chapter 6 Figure 5 (continued). Mec
- Page 115 and 116: Chapter 6 regulation and checkpoint
Chapter 4<br />
RESULTS<br />
TRAIL induces a spectrum from pro‐apoptotic to pro‐invasive responses in different<br />
NSCLC cells<br />
TRAIL resistance of cancer cells hampers therapeutic exploitation of the TRAIL apoptotic<br />
pathway and may even provoke counterproductive effects. Also in vitro, different NSCLC<br />
cell lines differ markedly in their sensitivity to TRAIL as judged by the capacity of a 24 h<br />
TRAIL treatment to diminish cell viability as measured in MTT assays (Fig. 1A and B).<br />
Whereas H460 cells are highly sensitive <strong>for</strong> TRAIL (IC50 ≈ 10 ng/ml), H322 cells require<br />
higher concentrations to respond with cell <strong>death</strong> to TRAIL treatment (IC50 ≈ 81 ng/ml),<br />
and SW1573 and A549 cells seem incapable of inducing an apoptotic response to TRAIL<br />
(IC50 > 200 ng/ml).<br />
Figure 1. Cytotoxic effects of TRAIL in different NSCLC cell lines. (A) Cell growth was measured using<br />
an MTT assay following 24 h treatment with increasing concentrations of TRAIL. (B) calculated IC 50<br />
values <strong>for</strong> TRAIL in the different NSCLC cells.<br />
Importantly, resistance to cell <strong>death</strong> is associated with TRAIL‐induced pro‐invasive effects<br />
in NSCLC. In wound healing assays, TRAIL treatment resulted in 2 to 3‐fold increased<br />
migratory activity of A549 cells when compared to untreated cells (Fig. 2A and B). Also,<br />
SW1573 cells showed an increase in migration activity in this assay upon TRAIL challenge,<br />
whereas TRAIL failed to induce migration in H322 and H460 cells in line with apoptosis<br />
activation in these cells. MTT assays per<strong>for</strong>med in parallel showed that the enhanced<br />
‘wound healing’ in A549 cells is not due to a TRAIL‐mediated increase in proliferation (Fig.<br />
2E). Consistently, a decreased potential to respond to TRAIL stimulation with apoptosis is<br />
associated with increased invasion as detected in matrigel‐transwell assays. TRAIL<br />
apoptosis‐resistant A549 cells exhibited approximately a 2‐fold increase in invasive<br />
capacity following TRAIL stimulation when compared to untreated cells (Fig. 2C and D).<br />
‐ 66 ‐
Change language