towards improved death receptor targeted therapy for ... - TI Pharma
towards improved death receptor targeted therapy for ... - TI Pharma towards improved death receptor targeted therapy for ... - TI Pharma
p38 and JNK induction by TRAIL rabbit‐IRDye (800CW;926‐32211 and 680;#926‐32221) were used. Protein expression was visualized with the Odyssey Infrared Imager (Westburg, Leusden, the Netherlands), at a 84 µm resolution, 0 mm offset and with high quality [17]. RNA interference H460 cells were plated at a density of 7.5 x10 4 cells in 6‐well tissue culture plates and allowed to attach overnight. The next day, cells were incubated with serum‐free medium and transfected with 100 nM SignalSilence® p38 MAPK siRNA I (#6564), 100 nM SignalSilence® SAPK/JNK siRNA I (#6232), SignalSilence® Control siRNA (Fluorescein Conjugate) (#6201) (all from Cell Signaling Technology Inc), 20 pmol Mcl‐1 siRNA (Dharmacon, M‐004501‐08) or scrambled siRNA (Invitrogen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. Cells were then incubated for a minimum of 24 h before assaying for expression. For short hairpin (sh)RNA mediated silencing pSUPER.retro plasmid was used similarly as described previously [18]. Targeted shRNA sequences were inserted into the BglII and HindIII sites of the pSUPER.retro vector. All cloned shRNA sequences were verified by DNA sequencing. Retroviruses were packaged and introduced into cells as described previously [19]. H460 cells were retrovirally infected with control pSUPER.retro or pSUPER.retro‐ shRIP1 (RIP1‐targeting sequence #1, 5'‐ GAGCAGCAGTTGATAATGT‐3'; RIP1‐targeting sequence #2 5'‐ TACCACTAGTCTGACGGATAA‐3') for 24 h. Infected cells were selected with 2 µg/ml puromycin. Quantitative RT‐PCR Total RNA was extracted using the QiaAmp RNA mini‐Kit (Qiagen, San Diego, CA), and yields and purity were checked at 260‐280 nm with NanoDrop®‐1000‐Detector (NanoDrop‐Technologies, Wilmington, NC). RNA (500 ng) was reverse transcribed using the DyNAmo cDNA Synthesis Kit (Thermo Scientific, Vantaa, Finland), according to the manufacturers’ instruction. Primers and probes to specifically amplify Mcl‐1 and Bcl‐2 were obtained from Applied Biosystems Assay‐on‐Demand Gene expression products (Hs01050896_m1, and Hs00608023_m1). The real‐time quantitative PCR was performed in a 25 μl reaction volume containing TaqMan Universal master mix (Applied Biosystems, Forster City, CA). All reactions were performed in triplicate using the ABI PRISM 7500 sequence detection system instrument (Applied Biosystems). Samples were amplified using the following thermal profile: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 sec followed by annealing and extension at 60 °C for 1 min. Amplifications were normalized to β‐actin, whose values were the closest to the geometric mean values observed for three housekeeping genes in preliminary analysis. Preliminary experiments were carried out with dilutions of cDNA obtained from Quantitative PCR Human Reference Total RNA (Stratagene, La Jolla, CA) to demonstrate that the efficiencies ‐ 43 ‐
Chapter 3 of amplification of the target and reference genes are approximately equal and to determine the absolute value of the slope of standard cDNA concentration versus CT, where CT is the threshold cycle, as reported previously [20]. ‐ 44 ‐
- Page 2 and 3: TRAIL-induced kinases activation an
- Page 4 and 5: TRAIL‐induced kinases activation
- Page 6: “In order to be irreplaceable one
- Page 9 and 10: ‐ 8 ‐
- Page 11 and 12: Chapter 1 GENERAL INTRODUCTION Canc
- Page 13 and 14: Chapter 1 OUTLINE OF THE THESIS As
- Page 15 and 16: Chapter 1 Reference List 1. Jemal A
- Page 17 and 18: Chapter 2 ABSTRACT Tumor necrosis f
- Page 19 and 20: Chapter 2 INTRODUCTION The death li
- Page 21 and 22: Chapter 2 In preclinical studies, a
- Page 23 and 24: Chapter 2 Table 1| Summary of the k
- Page 25 and 26: Chapter 2 proliferation could be pr
- Page 27 and 28: Chapter 2 Figure 2. Canonical and n
- Page 29 and 30: Chapter 2 associated with TRAIL res
- Page 31 and 32: Chapter 2 adhesion molecules [109].
- Page 33 and 34: Chapter 2 Reference List 1. Ashkena
- Page 35 and 36: Chapter 2 37. Tolcher AW, Mita M, M
- Page 37 and 38: Chapter 2 melanoma cells from TRAIL
- Page 39 and 40: Chapter 2 and ERK pathways. Circula
- Page 41 and 42: Chapter 3 ABSTRACT Tumor necrosis f
- Page 43: Chapter 3 inhibitors and TRAIL rece
- Page 47 and 48: Chapter 3 P38 and JNK have opposing
- Page 49 and 50: Chapter 3 Figure 2 (continued). (e)
- Page 51 and 52: Chapter 3 previously established H4
- Page 53 and 54: Chapter 3 effect on TRAIL‐induced
- Page 55 and 56: Chapter 3 induced apoptosis in H460
- Page 57 and 58: Chapter 3 Reference List 1. Jemal A
- Page 59 and 60: Chapter 3 40. Domina AM, Vrana JA,
- Page 61 and 62: Chapter 4 ABSTRACT Tumor necrosis f
- Page 63 and 64: Chapter 4 role in the activation of
- Page 65 and 66: Chapter 4 the tip with a diameter o
- Page 67 and 68: Chapter 4 RESULTS TRAIL induces a s
- Page 69 and 70: Chapter 4 vehicle control or with 5
- Page 71 and 72: Chapter 4 Non‐canonical TRAIL res
- Page 73 and 74: Chapter 4 A549‐shRIP1 cells clear
- Page 75 and 76: Chapter 4 Figure 7. Inhibition of S
- Page 77 and 78: Chapter 4 DISCUSSION The TRAIL rece
- Page 79 and 80: Chapter 4 Src‐independent mechani
- Page 81 and 82: Chapter 4 variants. Cell Death Dis
- Page 83 and 84: Chapter 4 ‐ 82 ‐
- Page 85 and 86: Chapter 5 ABSTRACT TRAIL is an inte
- Page 87 and 88: Chapter 5 targets and subsequent pr
- Page 89 and 90: Chapter 5 RESULTS Synergistic activ
- Page 91 and 92: Chapter 5 ng/ml TRAIL (Fig. 3B). Ap
- Page 93 and 94: Chapter 5 by sub‐G1 levels in the
Chapter 3<br />
of amplification of the target and reference genes are approximately equal and to<br />
determine the absolute value of the slope of standard cDNA concentration versus CT,<br />
where CT is the threshold cycle, as reported previously [20].<br />
‐ 44 ‐
Change language