towards improved death receptor targeted therapy for ... - TI Pharma

p38 and JNK induction by TRAIL
rabbit‐IRDye (800CW;926‐32211 and 680;#926‐32221) were used. Protein expression was
visualized with the Odyssey Infrared Imager (Westburg, Leusden, the Netherlands), at a 84
µm resolution, 0 mm offset and with high quality [17].
RNA interference
H460 cells were plated at a density of 7.5 x10 4
cells in 6‐well tissue culture plates and
allowed to attach overnight. The next day, cells were incubated with serum‐free medium
and transfected with 100 nM SignalSilence® p38 MAPK siRNA I (#6564), 100 nM
SignalSilence® SAPK/JNK siRNA I (#6232), SignalSilence® Control siRNA (Fluorescein
Conjugate) (#6201) (all from Cell Signaling Technology Inc), 20 pmol Mcl‐1 siRNA
(Dharmacon, M‐004501‐08) or scrambled siRNA (Invitrogen) using Lipofectamine 2000
(Invitrogen) according to the manufacturer’s protocol. Cells were then incubated for a
minimum of 24 h before assaying for expression.
For short hairpin (sh)RNA mediated silencing pSUPER.retro plasmid was used similarly as
described previously [18]. Targeted shRNA sequences were inserted into the BglII and
HindIII sites of the pSUPER.retro vector. All cloned shRNA sequences were verified by DNA
sequencing. Retroviruses were packaged and introduced into cells as described previously
[19]. H460 cells were retrovirally infected with control pSUPER.retro or pSUPER.retro‐
shRIP1 (RIP1‐targeting sequence #1, 5'‐ GAGCAGCAGTTGATAATGT‐3'; RIP1‐targeting
sequence #2 5'‐ TACCACTAGTCTGACGGATAA‐3') for 24 h. Infected cells were selected with
2 µg/ml puromycin.
Quantitative RT‐PCR
Total RNA was extracted using the QiaAmp RNA mini‐Kit (Qiagen, San Diego, CA), and
yields and purity were checked at 260‐280 nm with NanoDrop®‐1000‐Detector
(NanoDrop‐Technologies, Wilmington, NC). RNA (500 ng) was reverse transcribed using
the DyNAmo cDNA Synthesis Kit (Thermo Scientific, Vantaa, Finland), according to the
manufacturers’ instruction. Primers and probes to specifically amplify Mcl‐1 and Bcl‐2
were obtained from Applied Biosystems Assay‐on‐Demand Gene expression products
(Hs01050896_m1, and Hs00608023_m1). The real‐time quantitative PCR was performed in
a 25 μl reaction volume containing TaqMan Universal master mix (Applied Biosystems,
Forster City, CA). All reactions were performed in triplicate using the ABI PRISM 7500
sequence detection system instrument (Applied Biosystems). Samples were amplified
using the following thermal profile: 50 °C for 2 min, 95 °C for 10 min, 40 cycles of
denaturation at 95 °C for 15 sec followed by annealing and extension at 60 °C for 1 min.
Amplifications were normalized to β‐actin, whose values were the closest to the geometric
mean values observed for three housekeeping genes in preliminary analysis. Preliminary
experiments were carried out with dilutions of cDNA obtained from Quantitative PCR
Human Reference Total RNA (Stratagene, La Jolla, CA) to demonstrate that the efficiencies
‐ 43 ‐