Rapid Detection of K-ras Mutations in Bile by ... - Clinical Chemistry

Papers in Press. First published January 12, 2004 as doi:10.1373/clinchem.2003.024505 

Clinical Chemistry 50:3 

000–000 (2004) Molecular Diagnostics 

and Genetics 

Rapid Detection of K-ras Mutations in Bile by 

Peptide Nucleic Acid-Mediated PCR Clamping 

and Melting Curve Analysis: Comparison 

with Restriction Fragment Length 

Polymorphism Analysis 

Chiung-Yu Chen, 1 Shu-Chu Shiesh, 2* and Sheu-Jen Wu 3 

Background: Current methods for detection of K-ras 

gene mutations are time-consuming. We aimed to develop 

a one-step PCR technique using fluorescent hybridization 

probes and competing peptide nucleic acid 

oligomers to detect K-ras mutations in bile and to 

compare the efficacy with restriction fragment length 

polymorphism (RFLP) analysis. 

Methods: Bile samples were obtained from 116 patients 

with biliary obstruction, including gallstone (n 64), 

benign biliary stricture (n 6), pancreatic cancer (n 

20), and cholangiocarcinoma (n 26). The DNA was 

extracted and subjected to K-ras mutation analysis by 

real-time PCR and RFLP analysis. Mutations were confirmed 

by direct sequencing. The sensitivity and specificity 

were calculated according to the clinical results. 

Results: The analysis time for real-time PCR was

2 Chen et al.: Rapid Detection of K-ras Mutations in Bile 

in Japanese cases (13). In general, the frequencies of K-ras 

mutations in biliary duct carcinoma were reported to be 

8–100% in tissue DNA, 5–30% in bile DNA (3, 4, 10), and 

42% in brushing fluids (14). The point mutations reside 

mainly in the first two nucleotides of codon 12. Sequencing 

analysis has revealed that the single-nucleotide substitutions 

of K-ras codon 12 are mainly GAT, GTT, and 

CGT, compared with the wild-type codon GGT (10) for 

patients with pancreatic cancer and GAT, GTT, and TGT/ 

AGT/GCT for patients with cholangiocarcinoma (15). 

In addition to differences in the geographic etiologies 

and carcinogenesis of cholangiocarcinoma, variations in 

the sensitivities of the methods used for detection of the 

K-ras mutation might explain some of the differences in 

K-ras mutation frequencies among studies. K-ras mutations 

are detected mainly by mutation-specific oligonucleotide 

hybridization, PCR-restriction fragment length 

polymorphism (RFLP) analysis, single-strand conformation 

polymorphism analysis, mutant allelic-specific amplification, 

or direct sequencing. These procedures involve 

multiple steps and are time-consuming; they 

therefore are impractical for routine clinical use. With 

recent innovations in molecular technology, a new highspeed 

thermal cycler with online detection has been 

developed to detect N-ras gene mutations in leukemia 

(16). Such real-time systems offer many advantages, including 

speed, reduced risk of contamination, and higher 

accuracy (17). To detect a minimal amount of mutant in 

clinical samples, peptide nucleic acid (PNA) oligomers 

have been used to improve the allele-specific PCR by 

suppressing the amplification of the background wild 

type (18). This PNA-mediated PCR clamping technique, 

followed by ethidium bromide staining (19), a PCR-RFLP 

step (20), or mass spectrophotometry (21), has been 

applied to K-ras mutations in tumor samples. Combining 

PNA-mediated PCR clamping and use of a real-time 

thermal cycler, Sotlar et al. (22) detected the c-kit point 

mutation D816V in skin biopsy samples from patients 

with urticaria pigmentosa. 

We conducted this study to establish a one-step realtime 

PCR method that combines a competing PNA oligomer 

(clamped probe assay) with fluorescent hybridization 

probes and melting curve analysis for the detection of 

K-ras gene codon 12 mutations in bile and to validate their 

clinical use in the differential diagnosis of biliary obstruction. 

Materials and Methods 

collection of bile 

Fasting bile was obtained from patients with biliary 

obstruction via an endoscopic nasal biliary drainage catheter 

or a percutaneous transhepatic biliary drainage catheter 

on the day of biliary drainage. The bile was centrifuged 

at 7500 rpm for 10 min, and the pellets and 

supernatants were stored at 80 °C. The causes of biliary 

obstruction included hepatolithiasis (n 17), choledocholithasis 

(n 47), benign biliary stricture (n 6), pancre- 

atic cancer (n 20), and cholangiocarcinoma (n 26). 

Patients were either diagnosed based on pathology as 

having biliary or pancreatic cancer after surgery or biopsy, 

or by imaging studies and a long-term follow-up 

that showed the progress of index lesions. 

rflp analysis of K-ras codon 12 mutations 

DNA was extracted from the pellet by proteinase K 

treatment followed by the Qiagen DNA Isolation Kit 

(Qiagen). An enriched PCR-RFLP was performed for the 

detection of K-ras codon 12 mutations as described previously 

(10, 23) with minor modifications. In brief, the PCR 

was conducted in a GeneAmp 9700 thermocycler (Applied 

Biosystems) using K1A (5-ACTGAATATAAACTT- 

GTGGTAGTTGGACCT-3) and K1B (5-TCAAAGAATG- 

GTCCTGGACC-3) as primers (23). The primers 

contained a mismatch near the 3 ends (underlined base) 

to generate a BstNI site right upstream of codon 12 in 

cases of wild type, but not in K-ras mutants. The PCR 

mixture contained 100 ng of DNA template, 1 M each of 

the primers, 200 M deoxynucleotide triphosphates, 1.5 

mM MgCl 2,and2UofTaq polymerase in a total volume 

of 50 L. The conditions for the PCR were 94 °C for 5 min, 

followed by 94 °C for 1 min, 55 °C for 90 s, and 72 °C for 

90 s in each cycle for 20 cycles. After PCR, 5 L of the first 

PCR product was digested with 2UofBstNI (Biolabs) at 

60 °C for 8 h. We used 1/1000 of the first digest as a 

template for the second PCR with 30 cycles using K1A 

and K1C (5-GCATATTAAAACAAGATTTAC-3) as 

primers. The second PCR product was digested with 

BstNI again. After digestion, the DNA products were 

separated by electrophoresis on 3% agarose gels at 100 V 

for 1 h and stained with ethidium bromide (Sigma). To 

rule out PCR- and/or incomplete digestion-generated 

artifacts, all cases with K-ras mutations or equivocal 

results were confirmed by repeating PCR-RFLP analysis 

with different dilutions of the first digest. 

clamped probe assay for analysis of K-ras 

mutations 

A set of primers was chosen to amplify a specific 164-bp 

genomic fragment from K-ras exon 1. Hybridization 

probes were designed complementary to specific mutant 

types in K-ras codon 12; the anchor probe was 3-labeled 

with fluorescein, and the sensor probe 5-labeled with 

LC-Red dye and 3-phosphorylated. Two different sensor 

probes were selected to cover the mutation region: (a) 

5-LC-Red 640-labeled oligonucleotide probe to bind the 

K-ras GAT (G12D) mutation (i.e., the 12Asp sensor probe), 

and (b) 5-LC-Red 705-labeled probe to bind the TGT 

(G12C) mutation of K-ras gene (12Cys sensor probe). The 

different dyes labeled on the probes allowed us to perform 

these two assays in the same run. The competing 

wild-type PNA oligomer covered codons 10–14. The 

antisense strand was chosen for the PNA oligomer and 

the detection probes because of its lower purine content 

and, therefore, more precise hybridization results (24).

The primers, probes, and the PNA oligomer were from 

TIB MOLBIOL. The sequences of the primers, probes, and 

the PNA oligomer are listed in Table 1. 

For amplification with the 12Asp sensor probe, we 

mixed the LightCycler DNA Master Hybridization Mixture 

(Taq polymerase, PCR buffer, and deoxynucleotide 

triphosphate mixture; Roche Diagnostics), 5 mM MgCl 2, 

0.3 M anchor probe, 0.15 M sensor probe, 0.15 M PNA 

oligomer, and 0.5 M each of primers K-ras F and K-ras R 

with 10 ng of genomic DNA and added water to a final 

volume of 20 L/capillary. PCR was performed with the 

Roche LightCycler System (Roche Diagnostics). The conditions 

for the 12Cys sensor probe were the same as for 

the 12Asp sensor probe, except that we used 50 ng of 

genomic DNA, 1.5 M PNA oligomer, and 3 mM MgCl 2. 

The PCR protocol consisted of 95 °C for 10 min for initial 

denaturation, 50 cycles of 2sat95°C for denaturation, 

10sat70°C for PNA oligomer binding, 7sat60°C for 

primer annealing and probe binding, and 15 s at 72 °C for 

extension. 

controls 

DNA from the colon cancer cell line SW480, which 

harbors a homozygous GGT-to-GTT mutation at codon 12 

of K-ras, was used as positive control in each run. One 

negative control (DNA from colon cancer cell line HT29 

with wild-type K-ras), and a water negative control (as 

control for contamination) were processed in parallel with 

each batch of samples. Mutation analysis for each bile 

sample was performed at least twice to confirm reproducibility. 

dilution experiments 

We evaluated the sensitivities of the methods for K-ras 

mutation detection by diluting cell line SW480 DNA, 

which carries a homozygous G12V mutation, or a bile 

DNA sample carrying a heterozygous G12C mutation 

(confirmed by sequencing) in wild-type human bile DNA. 

The 1:10 mixture contained 1 ng of mutant DNA and 10 

ng of wild-type DNA. 

melting curve analysis 

After amplification, melting analysis was performed by 

holding the denaturation reaction at 95 °C for 20 s and 

Clinical Chemistry 50, No. 3, 2004 3 

Table 1. DNA sequences of primers, PNA oligomer, and probe for detecting K-ras mutations. 

Name DNA sequence, a 5–3 Position, b nt 

K-ras F c 

AGGCCTGCTGAAAATGACTG 83–102 

K-ras R GGTCCTGCACCAGTAATATGCA 246–225 

Anchor CGTCCACAAAATGATTCTGAATTAGCTGTATCGTCAAGGCACT-Flu 186–144 

12Asp LC-Red 640-CCTACGCCATCAGCTCCA-P 139–122 

12Cys LC-Red 705-TTGCCTACGCCACAAGCTCCAA-P 142–121 

PNA (NH2–CONH2) CCTACGCCACCAGCTCC 139–123 

a LC-Red 640 and LC-Red 705 are fluorophores. The 3 end of the mutation probe was phosphorylated to prevent probe elongation by Taq polymerase during PCR. 

Bold, codon 12; underlined, mutated base. 

b The base numbering is according to GenBank accession no. L00045. 

c F, forward; R, reverse; Flu, fluorescein; LC-Red 640, LightCycler-Red 640; P, phosphorylated; LC-Red 705, LightCycler-Red 705. 

hybridization at 40 °C for 20 s, followed by heating from 

40 °C to85°C at0.3°C/s with continuous monitoring of 

fluorescence at 640 nm (for LC-Red 640 in channel 2) or 

705 nm (for LC-Red 705 in channel 3). The change of 

fluorescence was converted to a melting peak (T m)by 

plotting the negative derivative of the fluorescent signal 

corresponding to the temperature (dF/dT) with the 

software. The K-ras gene mutation was identified by 

comparing the T m of each patient’s result with that of the 

DNA positive control. 

To optimize the PCR condition, we adjusted the Mg 2 , 

PNA oligomer, and DNA concentrations. Mg 2 titration 

experiments were done with a patient sample harboring 

the K-ras codon 12 TGT (G12C) mutant as determined by 

the clamped probe assay and direct sequencing. The 

clamped probe assay and melting curve analysis were 

performed as described above except that the MgCl 2 

concentration used was varied from 1 to 7 mM (total of 

seven concentrations). 

dna sequencing 

The DNA from those samples that gave positive results 

with either by RFLP analysis or the clamped probe assay 

was further analyzed by direct sequencing. The second 

PCR product, visualized as a 129-bp band on the electrophoresis 

gel, was purified by use of a QIAquick Gel 

Extraction Kit (Qiagen), and concentrated (from 250 L to 

15 L) in a vacuum centrifuge dryer (Hetovac; VR-1). 

Bidirectional DNA sequencing of PCR products was carried 

out on an ABI PRISM 377 sequencer (Applied Biosystems) 

with a Big Dye Terminator Cycle Sequencing 

Ready Reaction Kit. 

statistical analysis 

All data are expressed as the mean (SD). The statistical 

analysis was performed with SPSS 8.0 for Windows 

software (SPSS). 

Results 

demographic data for patients 

We had bile from 116 patients for analysis of K-ras codon 

12 mutations (Table 2). The diagnosis of cholangiocarcinoma 

(n 26) or pancreatic cancer (n 20) was confirmed 

pathologically in 34 patients (74%). Patients with-


Table 2. Demographic data for patients. 

Group M:F 

Mean (SD) 

age, years 

Mean (SD) 

follow-up, months 

Pancreatic cancer 12:8 64.1 (13.4) 8.9 (13.3) 

Cholangiocarcinoma 13:13 67.0 (9.5) 6.2 (7.2) 

Hepatolithiasis 7:10 55.8 (15.6) 18.4 (17.6) a,b 

Choledocholithasis 29:18 67.3 (15.1) 13.3 (13.1) b 

Benign biliary stricture 4:2 57.8 (17.5) 20.6 (15.4) b 

a P 0.05 between this group and pancreatic cancer group. 

b P 0.05 between this group and the cholangiocarcinoma group by one-way 

ANOVA. 

out a pathology diagnosis were diagnosed based on the 

severe and lethal course of the disease, which accounts for 

the shorter follow-up period in these patients than for 

patients with benign biliary obstruction. The patients who 

were diagnosed with benign biliary stricture included 

those with chronic pancreatitis (n 2), pancreatic tuberculosis 

(n 1), papillary stenosis (n 2), and serous 

adenoma of the pancreas (n 1). None of the patients 

with gallstones or benign biliary obstructions developed 

biliary malignancies during a follow-up period of 15.2 

(14.6) months. 

analysis of mutant and wild-type K-ras by 

clamped probe assay 

Real-time PCR with the clamped probe assay accurately 

identified the K-ras mutation from the wild-type genome. 

In the absence of PNA oligomer, we observed a melting 

peak at 66.3 °C for the wild type with the 12Cys sensor 

probe. The addition of PNA oligomer successfully suppressed 

the amplification of the wild type. For the 12Cys 

sensor probe, Mg 2 titration experiments showed that the 

reaction with 3 mM MgCl 2 provided the highest melting 

peak for bile DNA with the K-ras codon 12TGT mutant 

(Fig. 1 in the Data Supplement that accompanies the 

online version of this article at http://www.clinchem. 

org/content/vol50/issue3/). The effects of various 

amounts of PNA oligomer, Mg 2 , and DNA template on 

the melting curves obtained with the 12Cys probe are 

shown in Fig. 2 in the online Data Supplement. In the 

presence of 1.5 M PNA oligomer, 3 mM Mg 2 , and 50 ng 

of DNA, the clamped probe assay showed the least 

wild-type background and best mutant signal and was 

applied to the rest of the reactions. Table 3 and Figs. 3 and 

4 provide the results of testing for K-ras codon 12 mutations. 

The melting curve analysis showed that the 12Cys 

sensor probe can detect four kinds of K-ras codon 12 

mutations: GAT, GTT, AGT, and TGT mutants with mean 

(SD) melting temperatures of 65.1 (0.18), 66.5 (0.29), 67.8 

(0.17), and 70.6 (0.22) °C, respectively (Fig. 1 and Table 3). 

With the 12Asp sensor probe, we observed a melting peak 

at 62.5 °C for the wild type in the absence of PNA 

oligomer. The 12Asp sensor probe can detect only two 

kinds of point mutation, however: the GTT and GAT 

Table 3. Melting temperatures of mutants by real-time PCR 

with PNA and codon 12 mutation-specific sensor probes. 

Mean (SD) T m, °C 

Mutant No. of cases 12Cys probe 12Asp probe 

G12D (GAT) 8 65.14 (0.18) 67.1 (0.40) 

G12C (TGT) 2 70.65 (0.22) a 

G12S (AGT) 1 67.8 (0.17) b 

a 

G12V (GTT) 5 66.5 (0.29) 61.9 (0.45) c 

a No melting peaks detected. 

b Obtained by repeating the measurement in five different runs. 

c One case was not detected by 12Asp probe. 

mutations with melting temperatures of 61.9 (0.45) and 

67.1 (0.40) °C, respectively (Fig. 2). 

rflp analysis of mutant and wild-type K-ras 

Typical RFLP results are shown in Fig. 3. PCR with 

primers K1A and K1B gave rise to a 157-bp fragment 

containing two BstNI restriction sites if codon 12 was wild 

type and one BstNI site if codon 12 contained a mutation 

in either of its first two bases. Hence, BstNI cut the 

amplified wild-type fragment twice to yield 29-, 114-, and 

14-bp fragments, but cut K-ras codon 12 mutant once to 

generate 143- and 14-bp fragments. When a second PCR 

was performed with primers K1A and K1C, the mutant 

K-ras fragment after amplification was 129 bp, which was 

no longer cut by BstNI, whereas the wild-type fragment 

was further cleaved by BstNI to a 100-bp fragment. If we 

counted those with a single band of 129 bp or heterozygous 

bands of 129 and 100 bp as mutants, the frequency of 

K-ras mutations in bile would be 40% (28 of 70) and 59% 

(27 of 46) in benign and malignant cases, respectively. To 

avoid possible errors from PCR or incomplete digestion, 

mutations were counted only in those with a single band 

of 129 bp or a predominant band of 129 bp (signal of 

129-bp band greater than that of 100-bp band) on the 

second PCR product after digestion. 

comparison of different methods for 

detecting K-ras mutations 

The clamped probe assay detected K-ras codon 12 mutants 

within 1 h, whereas the RFLP analysis took 3 days to 

complete. Overall, 15 of 116 cases tested positive for a 

mutation in codon 12 of K-ras with the RFLP method, 

whereas 16 had mutations with the clamped probe assay 

using a 12Cys sensor probe and 12 had mutations with the 

12Asp sensor probe (Table 4). The positive samples detected 

by RFLP analysis or clamped probe assay were 

subjected to direct sequencing. In 17 cases, sequence 

results showed 15 mutations. In malignant cases, there 

was one K-ras mutation detected by the clamped probe 

assay (using a 12Cys or 12Asp probe) but not by RFLP 

analysis or sequencing, one detected by the clamped 

probe assay and sequencing but not by RFLP analysis, one 

detected by the clamped probe assay and RFLP analysis

Fig. 1. Representative melting curves obtained with the clamped probe assay with the 12Cys sensor probe. 

Results show GAT (G12D), GTT (G12V), AGT (G12S), and TGT (G12C) mutations at codon 12 of the K-ras gene. 

but not by sequencing, and one detected by RFLP analysis 

and sequencing but not by the clamped probe assay. 

We assessed the sensitivities of these methods for 

detection of K-ras mutations by dilution experiments 

using various amounts of homozygous G12V mutant 

SW480 DNA or heterozygous G12C mutant bile DNA in 

wild-type bile DNA. In RFLP analysis, the mutation was 

detectable in the 1:100 mixture of SW480 and wild-type 

DNA and the 1:10 mixture of G12C mutant and wild-type 

bile DNA (Figs. 3, B and C). In direct sequencing of 

concentrated PCR products, the mutation was detectable 

in the 1:20 mixture of SW480 and wild-type DNA and the 

1:10 mixture of G12C mutant and wild-type bile DNA. 

The clamped probe assay detected SW480 K-ras DNA 

mutation in a 3000-fold excess of wild-type bile DNA 

when we used the 12Cys sensor probe and 1000-fold 

when we used the 12Asp sensor probe. However, for 

detection of G12C mutant bile DNA, the mutation-specific 


melting peak was detected only down to a 20-fold excess 

of wild-type bile DNA (Fig. 4) 

clinical performance of different methods for 

the diagnosis of pancreaticobiliary 

malignancies 

In bile, K-ras codon 12 mutations were detected in 16 of 46 

(35%) patients with malignancy by the clamped probe 

assay using the 12Cys sensor probe, 12 (26%) by the assay 

using the 12Asp sensor probe, and 15 (33%) by RFLP 

analysis. All benign cases were wild type by these methods. 

Discussion 

Mutations in the ras oncogene are frequent in malignant 

pancreatic disease (10, 25, 26) and variable in cholangiocarcinoma 

(3, 27–29). K-ras codon 12 mutations have been 

detected in 80–95% of infiltrating pancreatic ductal carci-


Fig. 2. Representative melting curves obtained with the clamped probe assay with the 12Asp sensor probe. 

Curves represent GAT (G12D) and GTT (G12V) mutations at codon 12 of the K-ras gene. 

noma cases (30) and in 67% of cases with perihilar and 

50% of cases with intrahepatic cholangiocarcinoma (29). 

However, lower frequencies of K-ras gene mutations 

assessed from bile samples were found. In this study, we 

developed a one-step real-time PCR and detected K-ras 

mutations in approximately one-third of patients with a 

malignant etiology for the biliary stenosis, whereas mutations 

were not present in any bile from patients with 

benign obstructions. The mutation frequency in bile was 

comparable to the frequencies reported in previous studies 

(3, 4, 8, 31). This low frequency may be explained by 

the scirrhous nature of cholangiocarcinoma; the extraductal 

growth of pancreatic cancer, which makes it difficult 

for the cancer cells to be exfoliated into the bile; and/or 

the PCR inhibitors present in bile. Nevertheless, the high 

specificity of K-ras gene analysis in diagnosing biliary 

malignancies remains valuable for clinical use. 

The ideal method for K-ras gene analysis in clinical 

practice would be rapid and accurate enough to allow for 

high-throughput screening. The results of the present 

study indicate that real-time PCR using fluorescence 

hybridization probes with a PNA clamping reaction and 

melting curve analysis may offer a promising method to 

accurately identify K-ras gene mutations in patients with 

biliary obstruction. The absence of post-PCR manipulation 

reduces the risk for carryover contamination and 

false-positive results. This detection procedure also eliminates 

the need for the restriction enzyme digestion, 

electrophoresis, and staining steps required in the RFLP and 

single-strand conformation polymorphism methods. Because 

rapid temperature changes are possible in the closed 

glass capillary, PCR occurs under rapid cycling conditions 

and the entire process can be completed within 1 h. Together, 

these advantages make this assay feasible and promising 

for screening larger numbers of clinical samples. 

In this study, we found a high frequency of G-to-A 

transitions (n 9) and G-to-T transversions (n 7) within 

codon 12, which is in agreement with the literature 

(3, 13, 15). Using a mutant-specific sensor probe and 

melting curve analysis, we are able to identify different 

K-ras mutations. The different affinities between the mutant-specific 

sensor probe and K-ras mutations lead to

changes in DNA thermal stability, which in turn lead to 

different melting temperatures. The technique has also 

been applied successfully in the point mutation of c-kit (22) 

and the genotyping of hepatitis C virus (32). The present 

study demonstrates that the 12Cys sensor probe plus melting 

curve analysis can be used to identify at least four types 

of K-ras mutations, including the frequently encountered 

GAT and GTT mutants, with high specificity. This assay 

therefore possesses another advantage: that of eliminating 

the need for expensive direct DNA sequencing. 

The positive rate for K-ras mutations in bile from 

patients with pancreaticobiliary malignancies was 35% 

(16 of 46) by clamped probe assay with 12Cys sensor 

probe and 33% (15 of 46) by RFLP analysis. The positive 

samples were confirmed by sequencing, which showed 

mutations in 14 of 16 cases identified by the clamped 

probe assay. Because we concentrated the PCR product 

17-fold before sequencing, the sensitivity of direct sequencing 

was then comparable to that of the clamped 

probe assay, indicating the superior sensitivity of the 

Table 4. Frequency of codon 12 K-ras mutations in bile 

from patients with biliary obstructions detected by RFLP 

analysis and clamped probe assay. 

Group Patient RFLP 12Asp 12Cys 

Pancreatic cancer 20 6 4 6 

Cholangiocarcinoma 26 9 8 10 

Hepatolithiasis 17 0 0 0 

Choledocholithasis 47 0 0 0 

Benign biliary stricture 6 0 0 0 

Total 116 15 12 16 


Clamped probe 

assay 

Fig. 3. PCR-RFLP analysis of K-ras mutations. 

(A), the gel on the left (mutant result) shows a single 129-bp 

band for P2 (the second PCR product) and D2 (after enzyme 

digestion of P2). The gel on the right (wild-type result) shows 

a single 129-bp band for P2 (the second PCR product) and 

100-bp band for D2 (after enzyme digestion of P2). (B), 

dilution experiment using mixtures of DNA from a cell line 

SW480, which harbors a homozygous K-ras codon 12 mutation 

(G12V), and DNA from a bile sample with wild-type K-ras. 

Lane pairs: 1, 1:2 mixture; 2, 1:10 mixture; 3, 1:20 mixture; 

4, 1:50 mixture; 5, 1:100 mixture; 6, 1:1000 mixture. The 

band on the left in each lane pair represent the second PCR 

product; the band on the right represent the result of enzyme 

digestion of the second PCR product. (C), dilution experiment 

using mixtures of DNA from a bile sample harboring a 

heterozygous K-ras codon 12 mutation (G12C) and DNA from 

a bile sample with wild-type K-ras. Lane M, DNA marker. 

clamped probe assay. Our study also demonstrated that 

the 12Cys sensor probe detected more kinds of K-ras 

codon 12 mutations with higher sensitivities than the 

12Asp sensor probe. Because most of the K-ras codon 12 

mutations in our study were G-to-A transitions (GAT) 

and G-to-T transversions (GTT), both of which were 

readily detected by both sensor probes, the negative 

predictive value was similar regardless of whether the 

12Cys or the 12Asp sensor probe was used. The advantage 

of the 12Cys sensor probe, however, may be demonstrated 

in other clinical settings when larger numbers of 

mutants other than GAT and GTT are present. 

The PNA oligomer used to suppress the amplification 

of the wild-type DNA was designed to bind complementary 

sequences with higher thermal stability than DNA or 

RNA and cannot be extended by DNA polymerase (18). 

Use of the PNA oligomer molecule, which allowed sensitive 

detection of a mutation in a minor fraction of tumor 

cells in bile, was therefore key to our method. Our results 

showed that the addition of 1.5 M PNA oligomer completely 

suppressed the wild-type melting signal in 50 ng 

of bile DNA and allowed detection of the mutation in a 

3000-fold excess of wild-type bile DNA. The ratio of PNA 

oligomer and target DNA we used was different from that 

used by Sotlar et al. (22); they used 0.75 M PNA oligomer 

in 100 ng of template DNA to detect c-kit mutations with a 

detection limit of 1:2000 (22). This may be attributable to the 

different types of samples and target genes used in their 

study and the present study. Furthermore, the specific 

melting peak for wild type in our study was similar to that 

for the G12V mutation; therefore, a high PNA oligomer 

concentration is needed to completely suppress the amplification 

of wild-type DNA and thus to prevent false positives.


Fig. 4. Serial dilution experiment showing the sensitivity of the clamped probe assay. 

(A), DNA from cell line SW480, which harbors a homozygous K-ras codon 12 mutation (G12V), was diluted into DNA from a bile sample with wild-type (WT) K-ras. (B), 

DNA from a bile sample harboring a heterozygous K-ras codon 12 mutation (G12C) was diluted into DNA from bile with wild-type K-ras. 

However, increases in the PNA oligomer concentration may 

lower the amplification of the mutant alleles, reducing the 

sensitivity of the method. Thus, the ratio of PNA oligomer to 

template DNA is critical for the detection of mutations with 

good specificity and sensitivity. When Sun et al. (21) used 

PNA oligomer and matrix-assisted laser-desorption/ionization 

time-of-light mass spectrometry for enrichment of K-ras 

and p53 mutants in the presence of excess amounts of 

wild-type DNA, the detection limit was reported to be as 

few as 3 mutant alleles in the presence of 10 000-fold excess 

of wild-type alleles. These results indicate the potential of 

this technique in high-throughput screening applications. 

The clamped probe assay, however, had a diagnostic 

sensitivity similar to that of RFLP analysis. It could only 

detect the mutation in a 1:20 mixture of heterozygous 

mutant bile DNA and wild-type bile DNA. This may be 

attributable to the presence of PCR inhibitors in bile 

samples. Iron-containing proteins and their breakdown 

products, such as bilirubin, and bile salts have been 

identified as major inhibitors in PCR of blood samples, 

including real-time DNA amplification with the Light- 

Cycler Instrument (33, 34). The underlying mechanisms 

may involve the inactivation of thermostable DNA polymerase 

and/or degradation of the nucleic acids. Because 

bile contains higher concentrations of bile salts and bilirubin 

than blood samples, the different extents of inhibitory effects 

of these substances in RFLP analysis and the clamped probe 

assay may explain the different detection limits for the 

SW480 cell line and mutant bile DNA. Although bovine 

serum albumin was reported to be the most efficient amplification 

facilitator (34), we found no improvement in the 

sensitivity with the addition of 4 g/L bovine serum 

albumin in the clamped probe assay. Further studies are 

needed to determine ways to minimize the inhibitory 

effects of bile components in PCR and thus improve the 

detection sensitivity of the clamped probe assay. 

In conclusion, we present a practical method for rapid 

analysis of K-ras mutations in bile. Because K-ras gene 

mutations are frequently detected in other gastrointestinal 

malignancies, such as colon cancer, this method may be 

promising for the analysis of other body fluids (such as 

stool) as a mass-screening tool for gastrointestinal cancers.

We thank Hsiu-Chen Chiu and Ping-Hong Chen for 

excellent technical assistance. This work was supported 

by National Science Council grants NSC90-2320-B006-056, 

NSC91-2323-B006-011, and NSC92-2314-B006-044. 

References 

1. Bishop JM. Molecular themes in oncogenesis. Cell 1991;64:235– 

48. 

2. Tahey M, McCormick F. A cytoplasmic protein stimulates normal 

N-ras p21 GTPase, but does not affect oncogenic mutants. 

Science 1987;238:542–5. 

3. Muller P, Ostwald C, Puschel K, Brinkmann B, Plath F, Kroger J, et 

al. Low frequency of p53 and ras mutations in bile of patients with 

hepato-biliary disease: a prospective study in more than 100 

patients. Eur J Clin Invest 2001;31:240–7. 

4. Saurin JC, Joly-Pharaboz MO, Pernas P, Henry L, Ponchon T, 

Madjar JJ. Detection of K-ras point mutations in bile specimens for 

the differential diagnosis of malignant and benign biliary strictures. 

Gut 2000;47:357–61. 

5. Lee JG, Leung JW, Cotton PB, Layfield LJ, Mannon PJ. Diagnostic 

ultility of K-ras mutational analysis on bile obtained by endoscopic 

retrograde cholangiopancreatography. Gastrointest Endosc 1995; 

42:317–20. 

6. Uehara H, Nakaizumi A, Tatsuta M, Baba M, Takenaka A, Uedo N, 

et al. Diagnosis of pancreatic cancer by detecting telomerase 

activity in pancreatic juice: comparison with K-ras mutations. Am J 

Gastroenterol 1999;94:2513–8. 

7. Berthelemy P, Bouisson M, Escourrou J, Vaysse N, Rumeau JL, 

Pradayrol L. Identification of K-ras mutations in pancreatic juice in 

the early diagnosis of pancreatic cancer. Ann Intern Med 1995; 

123:188–91. 

8. Iguchi H, Sugano K, Fukayama N, Ohkura H, Sadamoto K, Ohkoshi 

K, et al. Analysis of Ki-ras codon 12 mutations in the duodenal 

juice of patients with pancreatic cancer. Gastroenterology 1996; 

110:221–6. 

9. Caldas C, Hahn SA, Hruban RH, Redston MS, Yeo CJ, Kern SE. 

Detection of K-ras mutations in the stool of patients with pancreatic 

adenocarcinoma and pancreatic ductal hyperplasia. Cancer 

Res 1994;54:3568–73. 

10. Hruban RH, van Mansfeld ADM, Offenhaus GJA, van Weering DH, 

Allison DC, Goodman SN, et al. K-ras oncogene activation in 

adenocarcinoma of the human pancreas: a study of 82 carcinomas 

using a combination of mutant enriched polymerase chain 

reaction analysis and allele specific oligonucleotide hybridization. 

Am J Pathol 1993;143:545–54. 

11. Momoi H, Itoh T, Nozaki Y, Arima Y, Okabe H, Satoh S, et al. 

Microsatellite instability and alternative genetic pathway in intrahepatic 

cholangiocarcinoma. J Hepatol 2001;35:235–44. 

12. Hidaka E, Yanagisawa A, Seki M, Takano K, Setoguchi T, Kato Y. 

High frequency of K-ras mutations in biliary duct carcinomas of 

cases with a long common channel in the papilla of vater. Cancer 

Res 2000;60:522–4. 

13. Kubicka S, Kuhnel F, Flemming P, Hain B, Kezmic N, Rudolph KL, 

et al. K-ras mutations in the bile of patients with primary sclerosing 

cholangitis. Gut 2001;48:403–8. 

14. Sturm PD, Rauws EA, Hruban RH, Caspers E, Ramsorekh TB, 

Huibregtse K, et al. Clinical value of K-ras codon 12 analysis and 

endobiliary brush cytology for the diagnosis of malignant extrahepatic 

bile duct stenosis. Clin Cancer Res 1999;5:629–35. 

15. Boberg KM, Schrumpf E, Bergquist A, Broome U, Pares A, Remotti 

H, et al. Cholangiocarcinoma in primary sclerosing cholangitis: 

K-ras mutations and Tp53 dysfunction are implicated in the 

neoplastic development. J Hepatol 2000;32:374–80. 


16. Nakao M, Janssen JWG, Seriu T, Bartram CR. Rapid and reliable 

detection of N-ras mutations in acute lymphoblastic leukemia by 

melting curve analysis using LightCycler technology. Leukemia 

2000;14:312–5. 

17. Fox CA, Parkes HC. Emerging homogeneous DNA-based technologies 

in the clinical laboratories. Clin Chem 2001;47:990–1000. 

18. Ørum H, Nielsen PE, Egholm M, Berg RH, Burchardt O, Stanley C. 

Single base pair mutation analysis by PNA directed PCR-clamping. 

Nucleic Acids Res 1993;21:5332–6. 

19. Thiede C, Bayerdorffer E, Blasczyk R, Wittig B, Neubauer A. Simple 

and sensitive detection of mutations in the ras proto-oncogenes 

using PNA-mediated PCR clamping. Nucleic Acids Res 1996;24: 

983–4. 

20. Behn M, Thiede, Neubauer A, Pankow W, Schuermann M. Facilitated 

detection of oncogene mutations from exfoliated tissue 

material by a PNA-mediated “enriched PCR” protocol. J Pathol 

2000;190:69–75. 

21. Sun X, Jung K, Wu L, Sidransky D, Guo B. Detection of tumor 

mutations in the presence of the excess amounts of normal DNA. 

Nat Biotechnol 2002;20:186–9. 

22. Sotlar K, Escribano L, Landt O, Mohrle S, Lass U, Horny HP, et al. 

One-step detection of c-kit point mutations using peptide nucleic 

acid-mediated polymerase chain reaction clamping and hybridization 

probes. Am J Pathol 2003;162:737–46. 

23. Su WC, Shiesh SC, Liu HS, Chen CY, Chow NH, Lin XZ. Expression 

of oncogene products HER2/New and Ras and fibrosis-related 

growth factors bFGF, TGF-, and PDGF in bile from biliary malignancies 

and inflammatory disorders. Dig Dis Sci 2001;46:1387–92. 

24. Li Y, Zon G, Wilson WD. NMR and molecular modeling evidence for 

a G. A. mismatch base pair in a purine-rich DNA duplex. Proc Natl 

Acad Sci U S A 1991;88:26–30. 

25. Tada M, Omata M, Ohto M. Clinical application of ras gene 

mutation for diagnosis of pancreatic adenocarcinoma. Gastroenterology 

1991;100:233–8. 

26. Scarpa A, Capelli P, Villanueva A, Zamboni G, Lluis F, Accolla R, et 

al. Pancreatic cancer in Europe: Ki-ras mutation pattern shows 

geographical differences. Int J Cancer 1994;57:167–71. 

27. Tada M, Omata M, Ohto M. High incidence of ras gene mutation in 

intrahepatic cholangiocarcinoma. Cancer 1992;69:1115–8. 

28. Watanabe M, Asaka M, Tanaka J, Kurosawa M, Kasai M, Miyazaki 

T. Point mutation of K-ras gene codon 12 in biliary tract tumors. 

Gastroenterology 1994;107:1147–53. 

29. Ohashi K, Nakajima Y, Kanehiro H, Tsutsumi M, Taki J, Aomatsu 

Y, et al. Ki-ras mutations and p53 protein expression in intrahepatic 

cholangiocarcinomas: relation to gross tumor morphology. 

Gastroenterology 1995;109:1612–7. 

30. Inoue S, Tezel E, Nakao A. Molecular diagnosis of pancreatic 

cancer. Hepatogastroenterology 2001;48:933–8. 

31. Tannapfel A, Benicke M, Katalinic A, Uhlmann D, Kockerling F, 

Hauss J, et al. Frequency of p16 INK4A alterations and K-ras 

mutations in intrahepatic cholangiocarcinoma of the liver. Gut 

2000;47:721–7. 

32. Bullock GC, Bruns DE, Haverstick DM. Hepatitis C genotype 

determination by melting curve analysis with a single set of 

fluorescence resonance energy transfer probes. Clin Chem 2002; 

48:2147–54. 

33. Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K. 

Identification of heme compound copurified with deoxyribonucleic 

acid (DNA) from bloodstains, a major inhibitor of polymerase chain 

reaction (PCR) amplification. J Forensic Sci 1994;39:362–72. 

34. Abu Al-Soud W, Radstrom P. Purification of characterization of 

PCR-inhibitory components in blood cells. J Clin Microbiol 2001; 

39:485–93.

Rapid Detection of K-ras Mutations in Bile by ... - Clinical Chemistry

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?