Bloch and Richard T. Lee P. Christian Schulze, Heling Liu, Elizabeth ...

More documents

Recommendations

Info

Glucose GSNO - 400 5.6 mM - - 400 5.6 mM + - 400 22.4 mM - - 400 22.4 mM + - 400 ΔChRE 5.6 mM - - 400 ΔChRE 5.6 mM + - 400 ΔChRE 22.4 mM - - 400 ΔChRE 22.4 mM + * * 0 50 100 150 Relative luciferase expression [% maximum] Supplemental Figure 1
<strong>Schulze</strong> et al. NO regulates thioredoxin through Txnip-Supplemental Material - R1; page 6 TABLE I. Oligonucleotides used for the promoter construction To be published on-line only. Sequence (5’-3’) Use 1. GCACAGATATAGGAAGGGTC -1777 5’ cloning primer 2. ATGTAAACACGCCCCTCCTA -1127 5’ cloning primer 3. GGCTAAGACTAGGCATGAAA -747 5’ cloning primer 4. CGCCGCTCCAGAGCGCAACA -527 5’ cloning primer 5. CCCACGCGTCACGAGGGCAGCACGAGCC -400 5’ cloning primer 6. CCCACGCGTTGGTCACGCAGCACGAGCC -400 ΔChRE 5’ cloning primer 5. GCCAGCGCTCGCGTGGCTCT -377 5’ cloning primer 6. GCCTCGAGCTCCAAATCGAGGAAAACCC 3’ cloning primer Downloaded from http://atvb.ahajournals.org/ by guest on July 30, 2013
Page 1 and 2: Nitric Oxide−Dependent Suppressio
Page 3 and 4: activity. NO and mutation of thiore
Page 5 and 6: exposed to 100 mol/L GSNO for sever
Page 7 and 8: ole in the pathogenesis of vascular
Page 9 and 10: Supplemental Material METHODS Schul
Page 11 and 12: Schulze et al. NO regulates thiored
Page 13: Supplemental Figure Schulze et al.

Bloch and Richard T. Lee P. Christian Schulze, Heling Liu, Elizabeth ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?