Bloch and Richard T. Lee P. Christian Schulze, Heling Liu, Elizabeth ...

Nitric Oxide−Dependent 

Suppression of Thioredoxin-Interacting Protein Expression 

Enhances Thioredoxin Activity 

P. Christian Schulze, Heling Liu, Elizabeth Choe, Jun Yoshioka, Anath Shalev, Kenneth D. 

Bloch and Richard T. Lee 

Arterioscler Thromb Vasc Biol. 2006;26:2666-2672; originally published online October 5, 

2006; 

doi: 10.1161/01.ATV.0000248914.21018.f1 

Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272 

Greenville Avenue, Dallas, TX 75231 

Copyright © 2006 American Heart Association, Inc. All rights reserved. 

Print ISSN: 1079-5642. Online ISSN: 1524-4636 

The online version of this article, along with updated information and services, is located on the 

World Wide Web at: 

http://atvb.ahajournals.org/content/26/12/2666 

Data Supplement (unedited) at: 

http://atvb.ahajournals.org/content/suppl/2006/10/15/01.ATV.0000248914.21018.f1.DC1.html 

Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published 

in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the 

Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for 

which permission is being requested is located, click Request Permissions in the middle column of the Web 

page under Services. Further information about this process is available in the Permissions and Rights 

Question and Answer document. 

Reprints: Information about reprints can be found online at: 

http://www.lww.com/reprints 

Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online 

at: 

http://atvb.ahajournals.org//subscriptions/ 

Downloaded from 

http://atvb.ahajournals.org/ by guest on July 30, 2013

Nitric Oxide–Dependent Suppression of 

Thioredoxin-Interacting Protein Expression Enhances 

Thioredoxin Activity 

P. Christian Schulze, Heling Liu, Elizabeth Choe, Jun Yoshioka, Anath Shalev, 

Kenneth D. Bloch, Richard T. Lee 

Objective—Cellular redox balance is regulated by enzymatic and nonenzymatic systems and freely diffusible nitric oxide 

(NO) promotes antioxidative mechanisms. We show the NO-dependent transcriptional regulation of the antioxidative 

thioredoxin system. 

Methods and Results—Incubation of rat pulmonary artery smooth muscle cells (RPaSMC) with the NO donor compound 

S-nitroso-glutathione (GSNO, 100 mol/L) suppressed thioredoxin-interacting protein (Txnip), an inhibitor of 

thioredoxin function, by 7118% and enhanced thioredoxin reductase 2.70.2 fold (n6; both P0.001 versus 

control). GSNO increased thioredoxin activity (1.90.5-fold after 4 hours; P0.05 versus control). Promoter deletion 

analysis revealed that NO suppression of Txnip transcription is mediated by cis-regulatory elements between 1777 and 

1127 bp upstream of the start codon. Hyperglycemia induced Txnip promoter activity (3.90.2-fold; P0.001) and 

abolished NO effects (37.41.0% at 5.6 mmol/L glucose versus 12.42.1% at 22.4 mmol/L glucose; P0.05). 

Immunoprecipitation experiments demonstrated that GSNO stimulation and mutation of thioredoxin at Cys69, a site of 

nitrosylation, had no effect on the Txnip/thioredoxin interaction. 

Conclusions—NO can regulate cellular redox state by changing expression of Txnip and thioredoxin reductase. This 

represents a novel antioxidative mechanism of NO independent of posttranslational protein S-nitrosylation of 

thioredoxin. (Arterioscler Thromb Vasc Biol. 2006;26:2666-2672.) 

Key Words: atherosclerosis diabetes mellitus nitric oxide oxidative stress thioredoxin 

The thioredoxin system is a ubiquitous thiol-reducing 

system that includes thioredoxin, thioredoxin reductase, 

and NADPH. 1 The thioredoxin system is an essential component 

of cellular redox balance, and targeted deletion of the 

thioredoxin gene in mice leads to early embryonic lethality. 2 

In addition to its antioxidative function, thioredoxin mediates 

anti-apoptotic effects through interaction with apoptosissignaling 

kinase-1 (ASK-1) mediating its ubiquitindependent 

degradation. 3,4 Furthermore, thioredoxin functions 

as a transcriptional co-activator through interaction with 

transcription factors such as NF-B and ref1. 5,6 The thioredoxin 

system is inhibited by thioredoxin-interacting protein 

(Txnip), which blocks thioredoxin’s antioxidative function. 7–9 

Several studies have identified Txnip as a critical regulator of 

diverse signaling events in mammalian cells because of its 

direct control of thioredoxin activity. 10–13 Recently, 

S-nitrosylation of thioredoxin at Cys69 has been identified as 

a posttranslational mechanism enhancing thioredoxin antioxidative 

and anti-apoptotic activity both in vitro14 and in vivo. 15 

Nitric oxide (NO) has diverse functions including vasodilator, 

neurotransmitter and anti-thrombotic activities. 16 In the 

cardiovascular system, the main physiological source of NO 

is the endothelium, although other cell types may be induced 

to synthesize NO, particularly after exposure to inflammatory 

cytokines. 17 NO relaxes smooth muscle cells and controls 

vascular cell proliferation, migration, and apoptosis. 18 Further, 

NO has antioxidative properties that remain incompletely 

understood. 

Here we report that expression of the gene encoding Txnip 

is robustly suppressed by NO in rat pulmonary artery smooth 

muscle cells (RPaSMC). NO did not affect Txnip mRNA 

stability. Hyperglycemia enhanced Txnip expression and 

abolished NO’s suppressive effects; this induction was mediated 

by a carbohydrate-response element which was not 

responsive to exogenous NO. Further, NO simultaneously 

induced expression of thioredoxin reductase. The net effect of 

these transcriptional effects was to increase thioredoxin 

Original received September 28, 2005; final version accepted September 13, 2006. 

From Cardiovascular Division (P.C.S., J.Y., R.T.L.), Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, 

Mass; Cardiovascular Research Center (H.L., E.C., K.D.B.), Massachusetts General Hospital, Harvard Medical School, Charlestown, Mass; Department 

of Medicine (A.S.), University of Wisconsin-Madison, Madison, Wis. 

Current affiliation for P.C.S. is Department of Medicine, Boston University Medical Center, Boston, Mass. 

Correspondence to P. Christian Schulze, MD, PhD, Department of Medicine, Boston University Medical Center, 80 E Concord St, Evans 124, Boston, 

MA 02115-2526. E-mail christian.schulze@bmc.org 

*P.C.S. and H.L. contributed equally to this work. 

© 2006 American Heart Association, Inc. 

Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org DOI: 10.1161/01.ATV.0000248914.21018.f1 


http://atvb.ahajournals.org/ 2666 by guest on July 30, 2013

activity. NO and mutation of thioredoxin at Cys69, a site of 

nitrosylation, had no effect on the ability of Txnip to interact 

with thioredoxin. Our findings reveal a novel NO-mediated 

mechanism independent of S-nitrosylation leading to enhanced 

thioredoxin function. 

Methods and Results 

Methods 

Cell Culture 

Primary cultures of RPaSMC were prepared from adult Sprague- 

Dawley rats as previously described. Cells were exposed to 

S-nitroso-glutathione (GSNO) (100 mol/L), PAPA NONOate 

(NOC-15) (500 mol/L), and S-nitroso-N-acetylpenicillamine 

(SNAP) (100 mol/L); 1H-[1,2,4]oxadiazolo-[4,3-a]quinoxalin-1one 

(ODQ) (10 mol/L), an inhibitor of guanylate cyclase, 19 for 

varying durations. Transfection of 293 cells was performed at 70% 

confluence followed by incubation for 48 hours. 

Northern Analysis 

RNA was extracted from RPaSMC and mRNA expression detected 

using specific cDNA probes against thioredoxin, Txnip, and thioredoxin 

reductase. 

Quantitative Real-Time Polymerase Chain Reaction 

Txnip gene expression was analyzed by real-time polymerase chain 

reaction (LightCycler, Roche) using specific oligonucleotides 

against Txnip and -tubulin. 

Western Analysis 

RPaSMC were harvested, cellular proteins isolated, and 50 g of 

protein subjected to gel electrophoresis followed by transfer to 

nitrocellulose membranes. The membranes were blocked 5% nonfat 

milk/phosphate-buffered saline and then incubated with antibodies 

directed against Txnip, thioredoxin reductase, or thioredoxin. 

Nuclear Run-off Experiments 

Nuclear run-off assays were performed as previously described. 20 

cDNA probes were created using oligonucleotides for Txnip, 

-tubulin, and thioredoxin. 

mRNA Stability 

Cells were pretreated with actinomycin D before stimulation. RNA 

was extracted and gene expression measured as described before. 21 

Plasmid Construction and Transient 

Transfection Experiments 

The human Txnip promoter region including 1777 bp upstream of 

the ATG start codon was cloned from human genomic DNA using 

primers 1 to 6 (supplemental Table I, available online at http:// 

atvb.ahajournals.org). Transcriptional activity was assessed under 

stimulation with GSNO at 5.6 mmol/L and 22.4 mmol/L glucose. 

Further, full-length human Txnip was cloned into a mammalian 

expression vector (pcDNA3.1, Invitrogen). Expression plasmids for 

human wild-type thioredoxin or mutant thioredoxin with a serine 

replacing cysteine 69 (C69S) were kindly provided by Dr Judith 

Haendeler (Molecular Cardiology, University of Frankfurt, Germany). 

Equal amounts of empty expression plasmids served as 

control vectors. 

Immunoprecipitation 

Protein G sepharose beads were incubated with anti-Txnip antibody 

and equal amounts of total protein lysates were incubated with 

antibody-bead complexes for 2 hours rotating at 4°C. Beads were 

washed 3 times, resuspended, and the supernatant electrophoresed. 

Signals were visualized by enhanced chemiluminescence. 

Thioredoxin Activity Assay 

Thioredoxin activity was measured using the insulin disulfide 

reduction assay as previously described. 12 

Schulze et al NO Regulates Thioredoxin Through Txnip 2667 

Measurement of Oxidative Stress 

Cells were incubated with 2,7-DCFDA for 45 minutes, washed in 

phosphate-buffered saline, and fluorescence measured using a fluorometer 

(Perkin Elmer) at 595 nm. 

Statistical Analysis 

All experiments were performed at least 3 times and data are 

expressed as meanSD. Data were analyzed by Student t test or 

1-way ANOVA with post-hoc analysis. P0.05 was considered 

statistically significant. 

Results 

NO Reduces Txnip and Enhances Thioredoxin 

Reductase Gene Expression 

We performed Northern analyses using total RNA prepared 

from RPaSMC exposed to GSNO (100 mol/L for 1, 2, 4, 6, 

and 16 hours; 0, 10, 100, and 500 mol/L for 2 hours). GSNO 

decreased Txnip gene expression and increased thioredoxin 

reductase gene expression in a time- and dose-dependent 

manner in RPaSMC. Txnip mRNA levels decreased rapidly 

within 1 hour after exposure to GSNO (7118%) and 

returned to baseline 4 hours after exposure to GSNO (Figure 

1A). Txnip mRNA levels decreased in RPaSMC exposed to 

100 mol/L and 500 mol/L of GSNO for 2 hours (Figure 

1B). Thioredoxin reductase mRNA levels increased in 

RPaSMC within 2 hours after exposure to GSNO (2.70.2fold) 

and returned to baseline 16 hours after exposure to 

GSNO (Figure 1A). The thioredoxin reductase mRNA levels 

increased with 100 mol/L and 500 mol/L GSNO after 2 

hours of exposure (Figure 1B). 

NO Decreases Txnip Protein Levels, Increases 

Thioredoxin Reductase Levels, and Enhances 

Thioredoxin Activity 

Incubation of RPaSMC with GSNO decreased Txnip protein 

levels in a time- and dose-dependent manner (Figure 1C). 

Further, protein levels of thioredoxin reductase increased 

under GSNO stimulation (Figure 1D). The suppression of 

Txnip was also induced by treatment of RPaSMC with the 

NO donor compounds NOC-15 and SNAP (Figure 1E). In 

contrast, endogenous thioredoxin protein levels in RPaSMC 

remain unchanged throughout 4 hours of GSNO incubation 

(Figure 1C). 

To examine the mechanisms by which NO regulates Txnip 

and thioredoxin reductase gene expression, we evaluated the 

role of soluble guanylate cyclase. RPaSMC were exposed to 

100 mol/L of GSNO for 2 hours (Txnip) and 4 hours 

(thioredoxin reductase) in the presence or absence of the 

soluble guanylate cyclase inhibitor ODQ at a concentration 

previously shown to inhibit guanylate cyclase in RPaSMC 

(10 mol/L). 19 Pretreatment with ODQ did not inhibit the 

GSNO-mediated changes in Txnip or thioredoxin reductase 

gene expression (Figure 1F). ODQ itself had no effect on 

gene expression of Txnip or thioredoxin reductase. 

The changes in gene and protein expression of Txnip and 

thioredoxin reductase predict that GSNO will increase thioredoxin 

activity in RPaSMC. Consistent with previous findings 

in endothelial cells, 14 GSNO increased thioredoxin activity in 

RPaSMC. Incubation with 100 mol/L GSNO increased 

thioredoxin activity levels 1.60.3-fold at 1 hour (P0.02 



2668 Arterioscler Thromb Vasc Biol. December 2006 

versus unstimulated cells), 1.70.2-fold at 2 hours (P0.01 

versus unstimulated cells), and 1.90.5-fold after 4 hours of 

stimulation (P0.05 versus unstimulated cells) (Figure 1G). 

Further, GSNO increased thioredoxin activity 1.50.5-fold at 

10 mol/L (pNS), 1.90.5-fold at 100 mol/L (P0.05 

versus unstimulated cells), and 1.90.2-fold at 500 mol/L 

(P0.001 versus unstimulated cells) of GSNO stimulation 

(Figure 1H). The increase of thioredoxin activity after 4 hours 

of GSNO stimulation was reflected in a decrease by 5315% 

Figure 1. Regulation of Txnip and thioredoxin 

reductase expression. A, GSNO 

stimulation resulted in a time-dependent 

reduction of Txnip mRNA and induction 

of thioredoxin reductase mRNA. B, Incubation 

with increasing levels of GSNO 

resulted in a concentration-dependent 

reduction of Txnip mRNA and an 

increase in thioredoxin reductase mRNA. 

C, Stimulation with GSNO resulted in 

time-dependent reduction of Txnip protein 

levels while thioredoxin protein levels 

remain unchanged. D, Stimulation of 

RPaSMC with GSNO induces protein 

levels of thioredoxin reductase. E, Stimulation 

with the NO donors GSNO, NOC- 

15, and SNAP resulted in comparable 

reduction of Txnip protein levels. F, Preincubation 

with the pharmacological inhibitor 

ODQ did not inhibit the GSNOinduced 

effects on Txnip and thioredoxin 

reductase expression (representative 

blots from 3 independent experiments). 

G, Incubation of RPaSMC with GSNO 

resulted in a time-dependent increase of 

thioredoxin activity by 1.6-fold at 1 hour, 

1.7-fold at 2 hours, and 1.8-fold after 4 

hours (n3 per data point). H, GSNO 

increased thioredoxin activity 1.5-fold at 

10 m, 1.8-fold at 100 m, and 1.8-fold 

at 500 m GSNO (stimulation for 2 

hours; n3 per data point). 

in levels of hydrogen peroxide as measured by DCFDA 

fluorescence (P0.05 versus unstimulated cells). 

NO Suppresses Txnip mRNA Expression Without 

Changing Its Stability 

To determine whether GSNO reduces Txnip mRNA accumulation 

by decreasing the rate of synthesis or by increasing the 

rate of degradation, RPaSMCs were pretreated with actinomycin 

D (5 g/mL) to inhibit transcriptional activity and then 



exposed to 100 mol/L GSNO for several time intervals. The 

half-life of Txnip mRNA was not affected by GSNO stimulation 

(1.00.2 hour versus 0.80.2 hour; PNS) (Figure 

2A). Using nuclear run-off experiments, we observed that de 

novo synthesis of Txnip mRNA was reduced in cells exposed 

to GSNO (Figure 2B). Assessment of specific radioactive 

count activity revealed a reduction of de novo Txnip mRNA 


Figure 2. GSNO does not alter Txnip 

mRNA stability. A, RPaSMCs were pretreated 

with actinomycin D to inhibit 

transcriptional activity and then exposed 

to GSNO for 2, 4 and 6 hours. The halflife 

of Txnip mRNA was not affected by 

GSNO. B, De novo Txnip mRNA synthesis 

decreased from 0.280.03 to 

0.190.05 (P0.05) under GSNO stimulation 

while levels of thioredoxin mRNA 

remained stable (0.40.02 vs 0.390.15; 

all n3 per data point). 

levels from 0.280.03 to 0.190.05 (n3; P0.05), 

whereas levels of de novo thioredoxin mRNA remained 

stable (0.40.02 versus 0.390.15; n3; PNS). 

NO Effects on Txnip Promoter Activity 

While several studies have previously investigated the transcriptional 

regulation of thioredoxin reductase, 22,23 little is 

Figure 3. Deletion analysis of the human Txnip promoter. A, Schematic representation of the human Txnip promoter and deletion constructs. 

Numbers refer to base pairs upstream of the ATG codon. B, Transfection of Txnip promoter constructs reveals activation of the 

Txnip promoter in RPaSMCs. Luciferase activities are expressed as percentages of full-length promoter activity. Empty vector transfected 

cells served as control. C, GSNO stimulation of RPaSMC’s transfected with the Txnip promoter constructs showed strong suppression 

of luciferase activity only in cells transfected with the 1777 Txnip promoter (*P0.05 vs nonstimulated cells; n5 per data 

point). D, Transfection of RPaSMC with full-length Txnip promoter constructs followed by incubation in high glucose (22.4 mmol/L) or 

low glucose (5.6 mmol/L) medium revealed a strong induction of Txnip promoter activity in RPaSMCs under hyperglycemic conditions. 

Stimulation of transfected cells with GSNO reduced Txnip promoter activity at 5.6 mmol/L glucose but had no effect at 22.4 mmol/L 

glucose (*P0.05 vs nonstimulated cells; #P0.001 vs low glucose; n5 per data point). 




Figure 4. GSNO stimulation does not affect Txnip/thioredoxin 

binding; 293 cells were transfected with plasmids for overexpression 

of wildtype Txnip and Xpress-tagged thioredoxin (wildtype 

or C69S mutated thioredoxin). Immunoprecipitation using 

anti-Txnip antibodies followed by Western analysis for the 

Xpress-tag revealed no differences of Txnip/thioredoxin binding 

in response to GSNO stimulation. 

known about the specific transcriptional regulation of Txnip 

expression by NO. To investigate the mechanisms underlying 

NO’s suppressive effects on Txnip expression, RPaSMCs 

were transfected with a series of constructs of the human 

Txnip promoter driving expression of firefly luciferase (Figure 

3A). Basal expression of those constructs reveals that the 

Txnip promoter was active in RPaSMC’s (Figure 3B). Incubation 

of RPaSMCs transfected with the Txnip promoter 

constructs in the presence of GSNO strongly suppressed 

luciferase activity only in cells transfected with the fulllength 

(1777) Txnip promoter (4212% of unstimulated 

cells; P0.001) (Figure 3C). This finding suggests the 

presence of an NO-responsive cis-regulatory element in the 

Txnip promoter between 1777 and 1127 bp upstream of 

the ATG codon. 

High Glucose Prevents NO Effects on Txnip 

Promoter Activity 

Increased glucose levels induce Txnip gene expression both 

in vitro and in vivo. 21,24,25 We, therefore, tested whether high 

glucose (22.4 mmol/L) induces Txnip promoter activity in 

RPaSMC’s. Transfection of RPaSMC with full-length Txnip 

promoter constructs followed by incubation in high glucose 

(22.4 mmol/L) or low glucose (5.6 mmol/L) revealed a strong 

induction of Txnip promoter activity in RPaSMC’s under 

hyperglycemic conditions (3.80.3 fold of unstimulated 

cells; P0.001) (Figure 3D). Incubation of transfected cells 

with GSNO reduced Txnip promoter activity at 5.6 mmol/L 

glucose (-456% versus unstimulated cells; P0.05) but had 

no effect at 22.4 mmol/L demonstrating that NO’s effects are 

restricted to normoglycemic conditions. 

Glucose stimulates Txnip expression in pancreatic -cells 

through a carbohydrate response element (ChRE) (400 bp 

upstream of the ATG codon). 24 To test whether this regulation 

also occurs in RPaSMCs, we transfected cells with 

promoter constructs containing the ChRE site (400) and 

constructs with a mutated ChRE site (400 ChRE ). Hypergly- 

cemia induced a 2-fold induction of Txnip promoter activity 

in cells transfected with wild-type constructs. Mutation of the 

ChRE site completely abolished glucose’s induction of Txnip 

promoter activity (supplemental Figure I, available online at 

http://atvb.ahajournals.org). 

GSNO Stimulation Does Not Affect the 

Thioredoxin/Txnip Interaction 

It has been shown previously that S-nitrosylation of thioredoxin 

at Cys69 by NO enhances thioredoxin activity. 14 

Because Txnip may bind to thioredoxin at its reactive 

cysteine residues of thioredoxin, 7–9 we tested whether NO 

modulates Txnip/thioredoxin binding. For these experiments, 

we used 293 cells because they have a higher transfection 

efficiency than do RPaSMC. Whereas 293 cells have very 

low levels of Txnip at baseline, transfection of cells with an 

expression plasmid resulted in robust protein expression of 

Txnip. To assess the role of thioredoxin independent from its 

S-nitrosylation at Cys69 by NO, wild-type thioredoxin and 

C69S-mutated thioredoxin, which is resistant to 

S-nitrosylation, 14,15 were overexpressed in 293 cells. Cells 

were stimulated with 100 mol/L GSNO for 2 hours. Immunoprecipitation 

of Txnip followed by Western analysis for 

Xpress–thioredoxin by anti-Xpress antibodies revealed no 

differences of Txnip/thioredoxin binding in the presence or 

absence of NO (Figure 4). These data show that the binding 

of Txnip to thioredoxin is NO-independent and that the 

regulation of Txnip levels by NO represents an additional 

regulatory mechanism by which NO modulates thioredoxin 

function. 

Discussion 

In the current study, we provide evidence that exogenous 

administration of NO results in enhanced activity of thioredoxin 

through transcriptional regulation of Txnip, the endogenous 

inhibitor of thioredoxin, and thioredoxin reductase. NO 

suppresses expression of Txnip and induces expression of 

thioredoxin reductase through redox-dependent mechanisms 

independent of soluble guanylate cyclase. Promoter analysis 

revealed that cis-regulatory elements 1127 bp upstream of 

the ATG codon mediate NO’s effects on Txnip transcription. 

Hyperglycemia induced Txnip promoter activity through a 

carbohydrate-response element, which is not affected by NO 

stimulation. The interaction of thioredoxin with Txnip was 

not affected by stimulation with NO excluding S-nitrosylation 

of thioredoxin as a factor regulating the Txnip/thioredoxin 

interaction. These findings reveal a novel mechanism by 

which NO regulates thioredoxin activity. 

The thioredoxin system is a major thiol reducing system 

of the cell and has antioxidative and anti-apoptotic functions 

mediated by reactive cysteines (Cys32 and Cys35). 1 

Thioredoxin forms a disulfide bond on oxidation and in 

turn is reduced by thioredoxin reductase and NADPH. 

Thioredoxin also binds to transcription factors as well as 

ASK-1 targeting the latter for ubiquitination and degradation. 

4,5,26 Recently, Txnip has been described as an endogenous 

inhibitor of thioredoxin. 7–9 The interaction of thioredoxin 

with Txnip can lead to increased levels of 

reactive oxygen species. 8,21 This mechanism may play a 



ole in the pathogenesis of vascular oxidative stress in 

diabetes mellitus since hyperglycemia directly induces 

Txnip expression in vascular smooth muscle cells. 21,25 

The current study reveals a time- and concentrationdependent 

increase in thioredoxin activity in response to 

exogenous administration of NO in RPaSMC. Increased 

thioredoxin activity is accompanied by changes in expression 

of 2 central regulators of thioredoxin function: thioredoxin 

reductase and the thioredoxin inhibitor Txnip. 

The transcriptional regulation of these molecules is independent 

of the NO donor compound applied and was 

observed in cells stimulated with GSNO, NOC-15, and 

SNAP. Intriguingly, our results demonstrate a 

concentration-dependent regulation of these effects up to 

500 mol/L of GSNO which is consistent with the NOdependent 

increase in thioredoxin activity. 

NO signaling targets several transcription factors, ion 

channels, G-proteins, protein tyrosine kinases, Janus kinases, 

mitogen-activated protein kinases, and caspases. 16 

NO signals in part via activation of the soluble guanylate 

cyclase leading to increased cGMP production. cGMP 

effector proteins include cGMP-dependent protein kinase, 

cyclic nucleotide-regulated ion channels, and phosphodiesterases, 

which hydrolyze cGMP and/or cAMP. 27 Our 

experiments show that the transcriptional regulation of 

Txnip and thioredoxin reductase by NO are independent of 

soluble guanylate cyclase. 

Several studies have investigated the transcriptional 

regulation of thioredoxin reductase by NO. Park et al 

showed induction of thioredoxin reductase expression by 

NO and peroxynitrite and the inhibition of this mechanism 

by NAC. 22 Recently, Sakurai et al demonstrated the 

induction of thioredoxin reductase by cadmium and identified 

an antioxidant response element in the thioredoxin 

reductase promoter to be responsible for this regulation. 23 

They also identified the transcriptional factor Nrf2 as a 

mediator of thioredoxin reductase induction in response to 

cadmium incubation. These findings are consistent with 

our current study demonstrating the redox-dependent activation 

of thioredoxin reductase expression by NO. We, 

therefore, concentrated our studies on the regulation of 

Txnip expression because less is known about the underlying 

transcriptional mechanisms controlling Txnip mRNA 

expression. 

Previously, hyperglycemia has been identified as a 

strong inducer of Txnip expression by several 

groups. 21,24,25,28 This induction is mediated by a 

carbohydrate-response element (also called USF-1 binding 

site) 400 bp 5 to the start codon. Promoter deletion 

analysis in the current study revealed that cis-regulatory 

elements -1127 bp upstream of the start codon mediate 

NO’s effects on Txnip expression. Notably, GSNO stimulation 

does not affect the induction of Txnip promoter 

activity by hyperglycemia, whereas hyperglycemia completely 

abolishes NO’s effects on Txnip promoter activity. 

Therefore, the induction of Txnip by glucose and the 

suppression of Txnip by NO are most likely regulated 

through different transcriptional elements, which form a 


molecular balance regulating the expression levels of 

Txnip in RPaSMC. 

The posttranslational modification of proteins by 

S-nitrosylation accounts for various biological effects of 

NO, 29 and proteomic screening for S-nitrosylated proteins 

has revealed numerous protein targets which remain to be 

functionally characterized. 15,30 Direct activation of thioredoxin’s 

antioxidative and antiapoptotic activity by NO has 

been linked to S-nitrosylation of thioredoxin at Cys69 both 

in vitro and in vivo. 14, 15 As demonstrated by Haendeler et 

al, S-nitrosylation of thioredoxin at Cys69 but not Cys32 or 

Cys35 in response to NO increases thioredoxin’s activity 

and anti-apoptotic effects in endothelial cells. 14 Further, 

infusion of S-nitrosylated thioredoxin has been shown to 

reduce myocardial ischemia/reperfusion injury 15 and to 

ameliorate myosin-induced myocarditis. 15 Notably, while 

S-nitrosylation reduces caspase activity and inhibits apoptosis, 

31 S-nitrosylation of Ras increases its activity 32 

indicating both enhancement or inhibition of cellular 

pathways caused by protein S-nitrosylation. The current 

study tested the effect of NO and the resulting 

S-nitrosylation of thioredoxin on the interaction between 

thioredoxin and Txnip. These immunoprecipitation experiments 

were performed in HEK293 cells because of the 

higher efficiency of transfection compared with RPaSMCs. 

Since HEK293 cells do not produce NO endogenously, NO 

was administered exogenously to the cells to study these 

effects. Mutation of the thioredoxin molecule with a 

substitution of Cys69 to Ser had no effect on the ability of 

Txnip to interact with thioredoxin. Therefore, NO-induced 

protein S-nitrosylation of thioredoxin does not inhibit the 

interaction with Txnip. We conclude that our findings 

reveal a novel mechanism by which NO activates the 

thioredoxin system through reduction of Txnip and enhanced 

expression of thioredoxin reductase. 

An important function of thioredoxin is its effects as a 

transcriptional co-activator. On nuclear translocation, thioredoxin 

interacts directly with NF-B and ref1. 5,6 As 

previously reported, this mechanism is redox-dependent 

and can be blocked by antioxidants and overexpression of 

Txnip. 10,12 Additional experiments have revealed a redoxdependent 

translocation of thioredoxin in response to 

incubation with GSNO that accompanies the GSNOinduced 

suppression of Txnip (data not shown). Intriguingly, 

a recent study has demonstrated nuclear localization 

of Txnip suggesting that it may also have a nuclear 

function. 33 This suggests a role for thioredoxin and interaction 

with Txnip in the transcriptional events mediated by 

NO. 

In conclusion, we have demonstrated a novel NOdependent 

mechanism of enhanced thioredoxin activity 

through suppression of Txnip and increased expression of 

thioredoxin reductase. Our findings emphasize pivotal transcriptional 

effects downstream of NO signaling that contribute 

to the anti-apoptotic and antioxidative defense of the cell. 

Sources of Funding 

This work was supported, in part, by grants from the Deutsche 

Akademie der Naturforscher - Leopoldina (BMBF-LPD) (9901/8-41 

to P.C.S.) and from the NIH (PO1 HL64858 to R.T.L.). 




None. 

Disclosures 

References 

1. Holmgren A. Thioredoxin Annu Rev Biochem. 1985;54:237–271. 

2. Matsui M, Oshima M, Oshima H, Takaku K, Maruyama T, Yodoi J, 

Taketo MM. Early embryonic lethality caused by targeted disruption of 

the mouse thioredoxin gene. Dev Biol. 1996;178:179–185. 

3. Saitoh M, Nishitoh H, Fujii M, Takeda K, Tobiume K, Sawada Y, 

Kawabata M, Miyazono K, Ichijo H. Mammalian thioredoxin is a direct 

inhibitor of apoptosis signal-regulating kinase (ASK) 1. EMBO J. 1998; 

17:2596–2606. 

4. Liu Y, Min W. Thioredoxin promotes ASK1 ubiquitination and degradation 

to inhibit ASK1-mediated apoptosis in a redox activityindependent 

manner. Circ Res. 2002;90:1259–1266. 

5. Hirota K, Murata M, Sachi Y, Nakamura H, Takeuchi J, Mori K, Yodoi 

J. Distinct roles of thioredoxin in the cytoplasm and in the nucleus. A 

two-step mechanism of redox regulation of transcription factor 

NF-kappaB. J Biol Chem. 1999;274:27891–27897. 

6. Schenk H, Klein M, Erdbrugger W, Droge W, Schulze-Osthoff K. 

Distinct effects of thioredoxin and antioxidants on the activation of 

transcription factors NF-kappa B and AP-1. Proc Natl Acad Sci U S A. 

1994;91:1672–1676. 

7. Nishiyama A, Matsui M, Iwata S, Hirota K, Masutani H, Nakamura H, 

Takagi Y, Sono H, Gon Y, Yodoi J. Identification of thioredoxin-binding 

protein-2/vitamin D(3) up-regulated protein 1 as a negative regulator of 

thioredoxin function and expression. J Biol Chem. 1999;274: 

21645–21650. 

8. Junn E, Han SH, Im JY, Yang Y, Cho EW, Um HD, Kim DK, Lee KW, 

Han PL, Rhee SG, Choi I. Vitamin D3 up-regulated protein 1 mediates 

oxidative stress via suppressing the thioredoxin function. J Immunol. 

2000;164:6287–6295. 

9. Yamanaka H, Maehira F, Oshiro M, Asato T, Yanagawa Y, Takei H, 

Nakashima Y. A possible interaction of thioredoxin with VDUP1 in HeLa 

cells detected in a yeast two-hybrid system. Biochem Biophys Res 

Commun. 2000;271:796–800. 

10. Schulze PC, De Keulenaer GW, Yoshioka J, Kassik KA, Lee RT. Vitamin 

D3-upregulated protein-1 (VDUP-1) regulates redox-dependent vascular 

smooth muscle cell proliferation through interaction with thioredoxin. 

Circ Res. 2002;91:689–695. 

11. Takahashi Y, Nagata T, Ishii Y, Ikarashi M, Ishikawa K, Asai S. 

Up-regulation of vitamin D3 up-regulated protein 1 gene in response to 

5-fluorouracil in colon carcinoma SW620. Oncol Rep. 2002;9:75–79. 

12. Wang Y, De Keulenaer GW, Lee RT. Vitamin D(3)-up-regulated 

protein-1 is a stress-responsive gene that regulates cardiomyocyte viability 

through interaction with thioredoxin. J Biol Chem. 2002;277: 

26496–26500. 

13. Joguchi A, Otsuka I, Minagawa S, Suzuki T, Fujii M, Ayusawa D. 

Overexpression of VDUP1 mRNA sensitizes HeLa cells to paraquat. 

Biochem Biophys Res Commun. 2002;293:293–297. 

14. Haendeler J, Hoffmann J, Tischler V, Berk BC, Zeiher AM, Dimmeler S. 

Redox regulatory and anti-apoptotic functions of thioredoxin depend on 

S-nitrosylation at cysteine 69. Nat Cell Biol. 2002;4:743–749. 

15. Tao L, Gao E, Bryan NS, Qu Y, Liu HR, Hu A, Christopher TA, Lopez 

BL, Yodoi J, Koch WJ, Feelisch M, Ma XL Cardioprotective effects of 

thioredoxin in myocardial ischemia and the reperfusion role of 

S-nitrosation. Proc Natl Acad Sci U S A. 2004. 

16. Meyer B. Nitric Oxide. Springer, Berlin: 2000. 

17. Humbert M, Morrell NW, Archer SL, Stenmark KR, MacLean MR, Lang 

IM, Christman BW, Weir EK, Eickelberg O, Voelkel NF. Rabinovitch M 

Cellular and molecular pathobiology of pulmonary arterial hypertension. 

J Am Coll Cardiol. 2004;43:13S–24S. 

18. Janssens S, Flaherty D, Nong Z, Varenne O, van Pelt N, Haustermans C, 

Zoldhelyi P, Gerard R, Collen D. Human endothelial nitric oxide synthase 

gene transfer inhibits vascular smooth muscle cell proliferation and neointima 

formation after balloon injury in rats. Circulation. 1998;97: 

1274–1281. 

19. Filippov G, Bloch DB, Bloch KD. Nitric oxide decreases stability of 

mRNAs encoding soluble guanylate cyclase subunits in rat pulmonary 

artery smooth muscle cells. J Clin Invest. 1997;100:942–948. 

20. Fukai T, Siegfried MR, Ushio-Fukai M, Griendling KK, Harrison DG. 

Modulation of extracellular superoxide dismutase expression by angiotensin 

II and hypertension. Circ Res. 1999;85:23–28. 

21. Schulze PC, Yoshioka J, Takahashi T, He Z, King GL, Lee RT. Hyperglycemia 

promotes oxidative stress through inhibition of thioredoxin 

function by thioredoxin-interacting protein. J Biol Chem. 2004;279: 

30369–30374. 

22. Park YS, Fujiwara N, Koh YH, Miyamoto Y, Suzuki K, Honke K, 

Taniguchi N. Induction of thioredoxin reductase gene expression by 

peroxynitrite in human umbilical vein endothelial cells. Biol Chem. 2002; 

383:683–691. 

23. Sakurai A, Nishimoto M, Himeno S, Imura N, Tsujimoto M, Kunimoto 

M, Hara S. Transcriptional regulation of thioredoxin reductase 1 

expression by cadmium in vascular endothelial cells: role of NF-E2related 

factor-2. J Cell Physiol. 2005;203:529–537. 

24. Minn AH, Hafele C, Shalev A. Thioredoxin-interacting protein is stimulated 

by glucose through a carbohydrate response element and induces 

beta-cell apoptosis. Endocrinology. 2005;146:2397–2405. 

25. Kobayashi T, Uehara S, Ikeda T, Itadani H, Kotani H. Vitamin D3 

up-regulated protein-1 regulates collagen expression in mesangial cells. 

Kidney Int. 2003;64:1632–1642. 

26. Ueno M, Masutani H, Arai RJ, Yamauchi A, Hirota K, Sakai T, Inamoto 

T, Yamaoka Y, Yodoi J, Nikaido T. Thioredoxin-dependent redox regulation 

of p53-mediated p21 activation. J Biol Chem. 1999;274: 

35809–35815. 

27. Beavo JA, Brunton LL. Cyclic nucleotide research – still expanding after 

half a century. Nat Rev Mol Cell Biol. 2002;3:710–718. 

28. Shalev A, Pise-Masison CA, Radonovich M, Hoffmann SC, Hirshberg B, 

Brady JN, Harlan DM. Oligonucleotide microarray analysis of intact 

human pancreatic islets: identification of glucose-responsive genes and a 

highly regulated TGFbeta signaling pathway. Endocrinology. 2002;143: 

3695–3698. 

29. Stamler JS, Lamas S, Fang FC. Nitrosylation. the prototypic redox-based 

signaling mechanism. Cell. 2001;106:675–683. 

30. Hoffmann J, Dimmeler S, Haendeler J. Shear stress increases the amount 

of S-nitrosylated molecules in endothelial cells: important role for signal 

transduction. FEBS Lett. 2003;551:153–158. 

31. Mannick JB, Schonhoff C, Papeta N, Ghafourifar P, Szibor M, Fang K, 

Gaston B. S-Nitrosylation of mitochondrial caspases. J Cell Biol. 2001; 

154:1111–1116. 

32. Yun HY, Gonzalez-Zulueta M, Dawson VL, Dawson TM. Nitric oxide 

mediates N-methyl-D-aspartate receptor-induced activation of p21ras. 

Proc Natl Acad Sci U S A. 1998;95:5773–5778. 

33. Nishinaka Y, Masutani H, Oka SI, Matsuo Y, Yamaguchi Y, Nishio K, 

Ishii Y, Yodoi J Importin alpha 1 (Rch1) mediates nuclear translocation 

of thioredoxin-binding protein-2 (TBP-2/VDUP1). J Biol Chem. 2004; 

279:37559–37565. 



Supplemental Material 

METHODS 

Schulze et al. NO regulates thioredoxin through Txnip-Supplemental Material – R2; page 1 

Cell Culture. Primary cultures of RPaSMC were prepared from adult Sprague-Dawley rats 

as previously described, and passages between 4 and 9 were used for experimentation. RPaSMC 

were maintained in the RPMI 1640 medium supplemented with 10% NuSerum (Collaborative 

Biomedical Products, Bedford, MA), penicillin, and streptomycin. RPaSMC were exposed to the 

NO-donor compounds S-nitroso-glutathione (GSNO, 100 µM), PAPA NONOate (NOC-15, 500 

µM) and S-nitroso-N-acetylpenicillamine (SNAP, 100 µM); 1H-[1,2,4]oxadiazolo-[4,3- 

a]quinoxalin-1-one (ODQ, 10 µM), an inhibitor of guanylate cyclase, 1 for different time intervals. 

293 cells were plated in DMEM containing 10% FCS, penicillin and streptomycin. Transfection of 

cells was performed at 70% confluence followed by further incubation for 48 h to allow stable 

protein expression. 

Northern Analysis. RNA was extracted from RPaSMC using the Trizol Reagent (Invitrogen 

Life Technologies, Carlsbad, CA). 15 µg of cellular RNA was fractionated in 1.5% agarose- 

formaldehyde gels containing ethidium bromide. RNA was transferred to MAGNA CHARGE 

membranes (Micron Separations INC., Westboro, MA) and crosslinked by ultraviolet light. 

Membranes were hybridized overnight at 42ºC with 32 P-radiolabeled specific cDNA probes. cDNAs 

were synthesized using the following oligonucleotides: thioredoxin, 5’– AGC AGC CAA GAT 

GGT GAA GCA GA -3’ and 5’ – CTC CAG AAA ATT CAC CCA CC -3’; Txnip, 5’ –TCT GCC 

AAA AAG GAG AAG AAA G - 3’ and 5’ –GGC GTA CAT AAA GAT AGG- 3’; and thioredoxin 

reductase, 5’– GGC CTC GAC GTC ACT GTA AT -3’ and 5’ – TTC CAA TGG CCA GAA GAA 

AC -3’. cDNA identity was confirmed by sequence analysis. Membranes were washed in a solution 

containing 3 mM sodium citrate, 30 mM sodium chloride, and 0.1% sodium dodecyl sulfate (SDS) 



Schulze et al. NO regulates thioredoxin through Txnip-Supplemental Material - R1; page 2 

at 65 ºC and exposed to X-ray film. By staining 28S and 18S ribosomal RNA with ethidium 

bromide, equal loading of RNA on gels was confirmed. 

Quantitative real-time PCR. Txnip gene expression was analyzed by real time PCR 

(LightCycler, Roche Applied Science) using specific oligonucleotides: rat Txnip, 5'- 

CAAGTTCGGCTTTGAGCTTC-3' (sense) and 5'-GCCATTGGCAAGGTAAGTGT-3' (antisense); 

rat β-tubulin, 5'-CATCCAGGAGCTCTTCAAGC-3' (sense) and 5'- 

CGCCTTAGGCCTCTTCTTCT-3' (antisense). 

Western Analysis. RPaSMC were washed twice with 10 ml of ice-cold phosphate-buffered 

saline (PBS) and harvested by scraping with a rubber policeman into buffer that contained 50 mM 

Tris-HCl (pH 7.6), 1 mM EDTA, 1 mM dithiothreitol, and 2 mM phenyl-methlsulfonyl fluoride. 

Cell membranes were disrupted by passing through a 22-gauge needle 10 times. Cell extracts were 

centrifuged at 10,000 x g for 30 min at 4 ºC. Cell supernatants containing 50 µg of protein were 

subjected to 8% sodium dodecyl sulfate - polyacrylamide gel electrophoresis and transferred 

electrophoretically to nitrocellulose membranes (Micron Separations Inc., Westboro, MA). The 

membranes were blocked in phosphate-buffered saline containing 5% non-fat milk at room 

temperature for 1h and then incubated with antibodies directed against Txnip, thioredoxin reductase 

or thioredoxin. After incubation with horseradish peroxidase-conjugated secondary antibodies, 

positive immunoreactivity was visualized using enhanced chemiluminescence. 

Nuclear run-off experiments. Nuclear run-off assays were performed as previously 

described. 2 cDNA probes were created using specific oligonucleotides: rat Txnip, 5'-CAA GTT 

CGG CTT TGA GCT TC-3' (sense) and 5'-GCC ATT GGC AAG GTA AGT GT-3' (antisense); rat 

β-tubulin, 5'-CAT CCA GGA GCT CTT CAA GC-3' (sense) and 5'-CGC CTT AGG CCT CTT 

CTT CT-3' (antisense); rat thioredoxin sense 5´-GCT GAT CGA GAG CAA GGA AG-3 and 

antisense 5´-TCA AGG AAC ACC ACA TTG GA-3´. Equal amounts of cDNA (5ug) were blotted 




onto nitrocellulose membranes. Identical numbers of control and GSNO-treated cells were used for 

the isolation of nuclei and preparation of [ 32 P]UTP-radiolabeled transcripts. Signals were visualized 

by autoradiography. Specific radioactive signal intensity (as counts per minute) was determined for 

each probe individually using a scintillation counter and normalized over signal intensity of the 

housekeeping gene β-tubulin. 

mRNA stability. Cells were pretreated with actinomycin D (5 µg/mL for 30 min) before 

incubation with and without GSNO stimulation (100 µM) for varying durations. RNA was extracted, 

and Txnip gene expression was measured by quantitative PCR and normalized for expression of β- 

tubulin as described before. 3 

Plasmid construction and transient transfection experiments. The human Txnip promoter 

region including -1777 bp upstream of the ATG start codon was cloned from human genomic DNA 

using primers 1-6 (Table 1). To generate the Txnip promoter constructs, PCR products were 

extracted and cloned into a firefly luciferase reporter vector pGL3-Basic Vector (Promega). The 

transcriptional activity of the promoter constructs was assessed under stimulation with GSNO at 5.6 

mM and 22.4 mM glucose. Luciferase activity was determined using the Dual Light assay kit 

(Tropix). All experiments were repeated five times. Further, full-length human Txnip was cloned 

into a mammalian expression vector (pcDNA3.1, Invitrogen). Expression plasmids for human 

wildtype thioredoxin or mutant thioredoxin with a serine replacing cysteine 69 (C69S) were kindly 

provided by Dr. Judith Haendeler (Molecular Cardiology, University of Frankfurt, Germany). These 

vectors express a thioredoxin-Xpress-tag fusion protein. Complete sequence identity was confirmed 

by sequencing analysis. Cells were transfected using FUGENE transfection reagent (Roche Applied 

Biosystems) and were studied 48 hours later. Equal amounts of empty expression plasmids served 

as control vectors. 




Immunoprecipitation. Protein G sepharose beads (30 µl) were incubated with 1 µg anti- 

Txnip antibody. Equal amounts of total protein lysates were incubated with antibody-bead 

complexes for 2h rotating at 4°C. Beads were centrifuged and washed three times with 0.5 ml lysis 

buffer and once with 0.5 ml ice-cold PBS. The beads were resuspended in SDS sample buffer, 

incubated at 95°C for five minutes, and centrifuged. The supernatant was electrophoresed through a 

SDS-PAGE system and signals visualized by enhanced chemiluminescence. 

Thioredoxin Activity Assay. Thioredoxin activity was measured using the insulin disulfide 

reduction assay as previously described. 4 Total cellular protein was extracted using lysis buffer, and 

50 µg of cellular protein extracts were incubated at 37ºC for 15 min with 1 µL of activation buffer 

(HEPES 50 mM, EDTA 1 mM, BSA 2 mg/mL, DTT 2 mM in water) in a total volume of 35 µL to 

reduce thioredoxin. Reaction buffer (20 µL of HEPES 200 mM, EDTA 8 mM, NADPH 1.6 mg/mL, 

insulin 5 mg/mL) was then added to the samples. The reaction was started by the addition of 5 µL 

bovine thioredoxin reductase (American Diagnostica Inc., Greenwich, CT) or 5 µL water to control 

cells, and the samples were incubated for 20 min at 37 ºC. The reaction was terminated by adding 

250 µL of stop mix (guanidine chloride 6M, DTNB 400 µg/mL, Tris-HCl 200mM). Finally, the 

absorption at 412 nm was measured spectroscopically. Thioredoxin activity was expressed per 

milligram total protein. 

Measurement of oxidative stress. Cells were incubated with 2’,7’-dichlorodihydrofluorecein 

diacetate (DCFDA) for 45 min, washed in PBS and fluorescence intensity measured using a 

fluorometer (Perkin Elmer) at 595 nm. 

Statistical analysis. All experiments were performed at least three times and data are 

expressed as mean ± s.d. The data were analyzed by Student’s t-test. One-way ANOVA with post- 

hoc analysis was used for the analysis of data sets of more than two groups. P < 0.05 was 

considered statistically significant. 



Supplemental Figure 


Hyperglycemia induces Txnip promoter activity through activation of a carbohydrate-response 

element (ChRE). (E) RPaSMC’s were transfected with promoter constructs (-400 bp upstream of the 

ATG codon) containing a functional (-400) or mutated (-400 ∆ChRE ) ChRE site. Hyperglycemia 

induced a 2-fold increase of Txnip promoter activity in cells transfected with control constructs 

which was completely abolished in cells transfected with constructs containing a mutated ChRE site. 

Stimulation of the cells with GSNO (100 µM) had no effect on these Txnip promoter constructs 

both in normoglycemia (5.6 mM) and hyperglycemia (22.4 mM) (* p

Glucose 

GSNO 

- 400 5.6 mM - 

- 400 5.6 mM + 

- 400 22.4 mM - 

- 400 22.4 mM + 

- 400 ΔChRE 5.6 mM - 

- 400 ΔChRE 5.6 mM + 

- 400 ΔChRE 22.4 mM - 

- 400 ΔChRE 22.4 mM + 

* 

* 

0 50 100 150 

Relative luciferase expression 

[% maximum] 

Supplemental Figure 1


TABLE I. Oligonucleotides used for the promoter construction 

To be published on-line only. 

Sequence (5’-3’) Use 

1. GCACAGATATAGGAAGGGTC -1777 5’ cloning primer 

2. ATGTAAACACGCCCCTCCTA -1127 5’ cloning primer 

3. GGCTAAGACTAGGCATGAAA -747 5’ cloning primer 

4. CGCCGCTCCAGAGCGCAACA -527 5’ cloning primer 

5. CCCACGCGTCACGAGGGCAGCACGAGCC -400 5’ cloning primer 

6. CCCACGCGTTGGTCACGCAGCACGAGCC -400 ΔChRE 5’ cloning primer 

5. GCCAGCGCTCGCGTGGCTCT -377 5’ cloning primer 

6. GCCTCGAGCTCCAAATCGAGGAAAACCC 3’ cloning primer 



REFERENCES 


1. Filippov G, Bloch DB, Bloch KD. Nitric oxide decreases stability of mRNAs encoding 

soluble guanylate cyclase subunits in rat pulmonary artery smooth muscle cells. J Clin 

Invest. 1997;100:942-948. 

2. Fukai T, Siegfried MR, Ushio-Fukai M, Griendling KK, Harrison DG. Modulation of 

extracellular superoxide dismutase expression by angiotensin II and hypertension. Circ Res. 

1999;85:23-28. 

3. Schulze PC, Yoshioka J, Takahashi T, He Z, King GL, Lee RT. Hyperglycemia promotes 

oxidative stress through inhibition of thioredoxin function by thioredoxin-interacting protein. 

J Biol Chem. 2004;279:30369-30374. 

4. Wang Y, De Keulenaer GW, Lee RT. Vitamin D(3)-up-regulated protein-1 is a stress- 

responsive gene that regulates cardiomyocyte viability through interaction with thioredoxin. 

J Biol Chem. 2002;277:26496-26500.

Bloch and Richard T. Lee P. Christian Schulze, Heling Liu, Elizabeth ...

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?