Planta Medica

Planta Medica
Volume 77, Issue 08, May 2011
de la Garza, Ana Laura; Milagro, Fermín I.; Boque, Noemí; Campión, Javier;
Martínez, J. Alfredo:
Natural Inhibitors of Pancreatic Lipase as New Players in Obesity Treatment
Wang, Cai-Ping; Wang, Yemin; Wang, Xing; Zhang, Xian; Ye, Jian-Feng; Hu,
Lin-Shui; Kong, Ling-Dong:
Mulberroside A Possesses Potent Uricosuric and Nephroprotective Effects in
Hyperuricemic Mice
Chow, Nicholas K.; Fretz, Michael; Hamburger, Matthias; Butterweck,
Veronika:
Telemetry as a Tool to Measure Sedative Effects of a Valerian Root Extract
and Its Single Constituents in Mice
Ghosh, Tirtha; Maity, Tapan Kumar; Singh, Jagadish:
Antihyperglycemic Activity of Bacosine, a Triterpene from Bacopa monnieri, in
Alloxan-Induced Diabetic Rats
Shao, Meng; Qu, Kai; Liu, Ke; Zhang, Yuqin; Zhang, Ling; Lian, Zeqin; Chen,
Tingting; Liu, Junfeng; Wu, Aili; Tang, Yue; Zhu, Haibo:
Effects of Ligustilide on Lipopolysaccharide-Induced Endotoxic Shock in
Rabbits
Hong, Feng; Xiao, Weilie; Ragupathi, Govind; Lau, Clara B. S.; Leung, Ping
Chung; Yeung, K. Simon; George, Constantine; Cassileth, Barrie; Kennelly,
Edward; Livingston, Philip O.:
The Known Immunologically Active Components of Astragalus Account for
Only a Small Proportion of the Immunological Adjuvant Activity When
Combined with Conjugate Vaccines
Venâncio, Antônio Medeiros; Onofre, Alexandre Sherlley Casimiro; Lira,
Amintas Figueiredo; Alves, Péricles Barreto; Blank, Arie Fitzgerald; Antoniolli,
Ângelo Roberto; Marchioro, Murilo; dos Santos Estevam, Charles; Santos de
Araujo, Brancilene:
Chemical Composition, Acute Toxicity, and Antinociceptive Activity of the
Essential Oil of a Plant Breeding Cultivar of Basil (Ocimum basilicum L.)

Halder, Sumita; Mehta, Ashish Krishan; Kar, Rajarshi; Mustafa, Mohammad;
Mediratta, Pramod Kumari; Sharma, Krishna Kishore:
Clove Oil Reverses Learning and Memory Deficits in Scopolamine-Treated
Mice
Ettefagh, Keivan A.; Burns, Johnna T.; Junio, Hiyas A.; Kaatz, Glenn W.;
Cech, Nadja B.:
Goldenseal (Hydrastis canadensis L.) Extracts Synergistically Enhance the
Antibacterial Activity of Berberine via Efflux Pump Inhibition
Yang, Heejung; Sung, Sang Hyun; Kim, Jinwoong; Kim, Young Choong:
Neuroprotective Diarylheptanoids from the Leaves and Twigs of Juglans
sinensis against Glutamate-Induced Toxicity in HT22 Cells
Liu, Hai; Chou, Gui-Xin; Wang, Jun-Ming; Ji, Li-Li; Wang, Zheng-Tao:
Steroidal Saponins from the Rhizomes of Dioscorea bulbifera and Their
Cytotoxic Activity
Schmidt, Thomas J.; Kaiser, Marcel; Brun, Reto:
Complete Structural Assignment of Serratol, a Cembrane-Type Diterpene
from Boswellia serrata, and Evaluation of Its Antiprotozoal Activity
Zhao, Jianping; Avula, Bharathi; Joshi, Vaishali C.; Techen, Natascha; Wang,
Yan-Hong; Smillie, Troy J.; Khan, Ikhlas A.:
NMR Fingerprinting for Analysis of Hoodia Species and Hoodia Dietary
Products
Turski, Michal P.; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena;
Kocki, Tomasz; Turski, Waldemar A.:
Distribution, Synthesis, and Absorption of Kynurenic Acid in Plants
Yang, Shuting; Chen, Chuan; Zhao, Yunpeng; Xi, Wang; Zhou, Xiaolong;
Chen, Binlong; Fu, Chengxin:
Association between Chemical and Genetic Variation of Wild and Cultivated
Populations of Scrophularia ningpoensis Hemsl.

Natural Inhibitors of Pancreatic Lipase
as New Players in Obesity Treatment
Authors Ana Laura de la Garza, Fermín I. Milagro, Noemí Boque, Javier Campión, J. Alfredo Martínez
Affiliation Department of Nutrition and Food Sciences, Physiology and Toxicology, University of Navarra, Pamplona, Spain
Key words
l " Orlistat
l " high fat diet
l " polyphenols
l " saponins
l " obesity
l " fat digestion
received Dec. 7, 2010
revised February 11, 2011
accepted February 21, 2011
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1270924
Published online March 16,
2011
Planta Med 2011; 77: 773–785
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. J. Alfredo Martinez
Department of Nutrition
and Food Sciences,
Physiology and Toxicology
University of Navarra
c/Irunlarrea 1
31008 Pamplona
Spain
Phone: + 34 94842 56 00
Fax: + 3494842 5649
jalfmtz@unav.es
Abstract
!
Obesity is a multifactorial disease characterized
by an excessive weight for height due to an enlarged
fat deposition such as adipose tissue, which
is attributed to a higher calorie intake than the energy
expenditure. The key strategy to combat obesity
is to prevent chronic positive impairments in
the energy equation. However, it is often difficult
to maintain energy balance, because many available
foods are high-energy yielding, which is usually
accompanied by low levels of physical activity.
The pharmaceutical industry has invested many
efforts in producing antiobesity drugs; but only a
lipid digestion inhibitor obtained from an actino-
Introduction
!
Obesity is becoming one of the greatest threats to
global health in this century, with more than 1.5
billion overweight adults and at least 400 million
of clinically obese subjects [1]. Due to these increasing
obesity rates, the World Health Organization
(WHO) has prompted to consider it as the
epidemic of XXI century and to promote strategies
to prevent and control its progress [2].
The development of obesity is characterized by a
chronic imbalance between energy intake and
energy expenditure [3–5], and it is often ascribed
to changing lifestyles and inadequate dietary habits
[3]. Also, decreased energy expenditure is
often associated with an inherited low basal metabolic
rate, low energy cost of physical activity,
and low capacity for fat oxidation [6]. To reduce
body weight and adiposity, a change in lifestyle
habits is still the crucial cornerstone [7]. Physical
activity might be helpful in the prevention of obesity
by elevating the average daily metabolic rate
and increasing energy expenditure [3]. Unfortunately,
this clinical approach is not long-term lasting,
and weight regain is often seen. Drugs that
Reviews
bacterium is currently approved and authorized
in Europe for obesity treatment. This compound
inhibits the activity of pancreatic lipase, which is
one of the enzymes involved in fat digestion.
In a similar way, hundreds of extracts are currently
being isolated from plants, fungi, algae, or
bacteria and screened for their potential inhibition
of pancreatic lipase activity. Among them,
extracts isolated from common foodstuffs such
as tea, soybean, ginseng, yerba mate, peanut, apple,
or grapevine have been reported. Some of
them are polyphenols and saponins with an inhibitory
effect on pancreatic lipase activity, which
could be applied in the management of the obesity
epidemic.
prevent weight regain appear necessary in obesity
treatment [7]. Thus, the development of natural
products for the treatment of obesity is a
challenging task, which can be launched faster
and cheaper than conventional single-entity
pharmaceuticals [8]. Many medicinal plants may
provide safe, natural, and cost-effective alternatives
to synthetic drugs [9, 10]. Currently, one of
the most important strategies in the treatment of
obesity includes development of inhibitors of nutrient
digestion and absorption. For example,
acarbose is an antidiabetic drug that inhibits glycoside
hydrolases, thus preventing the digestion
of complex carbohydrates and decreasing postprandial
hyperglycemia [11, 12]. Similar compounds
with alpha-amylase inhibiting activity
that can be used for diabetes control are being isolated
from different plants. The list includes valoneaic
acid dilactone [13], obtained from banaba
(Lagerstroemia speciosa), the ethanol extract obtained
from chestnut astringent skin [14], or the
purified pancreatic alpha-amylase inhibitor isolated
from white beans (Phaseolus vulgaris),
which is able to reduce glycemia in both nondiabetic
and diabetic rats [15].
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
773

774
Reviews
In this context, since dietary lipids represent the major source of
unwanted calories, the inhibition of fat digestion is an interesting
approach for reducing fat absorption [16]. Orlistat is the only authorized
antiobesity drug in Europe and has been shown to act
through inhibition of pancreatic lipase (PL), which is a key enzyme
for the digestion of dietary triglycerides [17]. Orlistat is
the saturated derivative of lipstatin, an inhibitor of PL isolated
from the bacterium Streptomyces toxytricini [18]. This molecule
exerts a modest weight lowering effect when accompanying a
suitable dietary advice. Thus, in a recent meta-analysis [19], the
mean BMI change with Orlistat (120 mg three times daily) was a
reduction of 0.83 kg m −2 (95% CI: 0.47–1.19) compared with placebo.
Accompanying this antiobesity action, Orlistat is also able
to modestly reduce blood pressure, improve oral glucose tolerance
and prevent the onset of type 2 diabetes [20, 21].
Now, extracts from hundreds of species of medicinal plants, vegetables,
and fruits [22] as well as products from microorganisms
[9], fungi [23] and marine algae [24] are being screened for potential
lipase inhibitory activity. Ideally, these treatments will be
viewed as adjuncts to behavioral and lifestyle changes aimed at
maintenance of weight loss and improved health [8].
Obesity and High-Fat Diets
!
Epidemiological studies have shown a direct relation between
the incidence of overweight/obesity and dietary fat consumption
[3, 6,25].
Humans are frequently exposed to fat rich foods, which are usually
associated with a high-energy intake [6, 26]. Thus, those
foods with a high-energy and dietary fat content are considered
to promote body fat storage and weight gain in humans [8]. One
explanation is that, in commercially available food items, the percentage
of energy derived from fat is highly correlated with energy
density. Given that fat contains 9 kcal/g compared with
4 kcal/g for carbohydrates and proteins, foods rich in fat are often
high in energy density. Thus, when a similar volume of food is
consumed, energy intake will be higher in high-fat diets compared
with low-fat diets [3].
On the other hand, independently of an increased energy intake,
specific dietary constituents may promote the development of
obesity. This statement means that even consuming an equal
amount of energy, the diet composition is important, especially
the balance between nutrients [27, 28].
Thus, a macronutrient profile (high-protein, high-carbohydrate,
and high-lipid diets) can affect diet-induced thermogenesis, the
oxidation pathway, energy intake, gene expression, or the level
of some hormones [29]. Following a high-fat diet, the diet-induced
thermogenesis is lower than following high-protein and
carbohydrate diets, and also fat is more effectively absorbed from
the gastrointestinal tract than are carbohydrates, which translates
into lower energy expenditure when following a high-fat diet
[26]. So, high-fat diets produce a metabolically more efficient
state, at least in part because of the lower postprandial thermogenic
effect of lipids in comparison with carbohydrates [30].
Furthermore, the consumption of a high-fat diet has the capacity
to modulate the gastrointestinal responses to ingested fat and,
thereby, may lead to impairments in appetite regulation that favour
the development of obesity. Dietary fat usually implies an
increase in energy consumption because it has a lower potential
for inducing satiety than carbohydrates and protein [6,31].
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785
Hence, high-fat diets may play an important role in the increased
prevalence of obesity and can be a triggering factor in the development
of hyperglycemia and hyperinsulinemia [3, 32]. Moreover,
the intake of dietary fats is usually accompanied by a higher
intake of refined sweet carbohydrates (fast food, desserts), where
the high intake of sucrose promotes weight gain, visceral adiposity,
and the development of diseases that are related with obesity,
such as diabetes and cardiovascular diseases [33]. Therefore, lowfat
diets often are prescribed in the prevention and treatment of
overweight and obesity because a reduction in dietary lipids
without restriction of total energy intake could cause weight loss
[26].
Fat digestion
Recent studies indicate that fat digestion is a prerequisite for the
effects of fat on gastric emptying, gastrointestinal hormone secretion,
appetite, and energy intake [6]. An increasing number of
gastrointestinal enzymes involved in nutrient digestion are being
identified and characterized, representing a rich pool of potential
therapeutic targets for obesity and other metabolic disorders [9].
Especially interesting are those enzymes that are related with dietary
fat, which includes pre-duodenal lipases (lingual and gastric
lipases), pancreatic lipase (PL), cholesterol-ester lipase, and
bile-salt stimulated lipase [34].
Most dietary fat is ingested as triglycerides (90–95%), and their
hydrolysis starts in the mouth, then goes on through the stomach
by an acid stable gastric lipase, and continues in the duodenum
through the synergistic actions of gastric and colipase-dependent
pancreatic lipases (PL), leading to the formation of monoglycerides
and free fatty acids (FFA) (l " Fig. 1). FFA are absorbed
by the enterocyte to synthesize new triglyceride molecules,
which are transported to the different organs via lipoproteins, especially
chylomicrons, after a meal [34].
Pancreatic lipase (PL), encoded by the PNLIP gene in humans,
plays a key role in the efficient digestion of triglycerides [35]. It
is secreted into the duodenum through the duct system of the
pancreas and is responsible for the hydrolysis of 50–70% of total
dietary fats [9]. This enzyme has been widely used for the determination
of the potential efficacy of natural products as antiobesity
agents [36].
Orlistat is currently the only clinically approved drug for obesity
management in Europe. This molecule acts by inhibiting PL activity
and the reduction of triglyceride absorption, and its long-term
administration accompanying an energy restricted diet, results in
weight loss [37]. Reduction on intestinal lipid digestion has been
related to a decrease in the intra-abdominal fat content [7]. Thus,
this compound is associated with a small, but statistically significant
weight loss of about 3% more than diet alone in overweight
and obese people [1]. In addition to losing weight, Orlistat within
a prescribed diet has been shown to be safe and more effective
than diet alone in modifying some of the risk of coronary artery
disease and other obesity-related comorbidities. The most commonly
reported adverse effects of Orlistat are a range of gastrointestinal
side effects, including steathorrhea, bloating, oily spotting,
fecal urgency, and fecal incontinence, as well as hepatic adverse
effects [19, 38]. These adverse effects are similar to those
observed for other lipase inhibitors tested in phase II studies,
such as Cetilistat (ATL-962) [39].
On the other hand, the inhibition of fat absorption could be accompanied
by fat-soluble vitamin deficiencies, which could be
prevented by the vitamin supplementation strategy, as other au-

Fig. 1 Fat metabolism in humans. Dietary fats are hydrolyzed in the gastrointestinal
tract, where some lipases are involved.
thors have recommended when vitamin deficiency occurs in patients
undergoing Orlistat therapy [40].
Hence the interest in the search for new natural substances that
show potent inhibitory activity against PL and have fewer side effects
than the current ones.
Natural inhibitors of pancreatic lipase
!
In the continued search for effective antiobesity agents, several
bacterial, fungal, and marine species have been screened to find
new compounds with PL inhibitory activity.
Many metabolic products from microorganisms, such as different
kinds of Streptomyces (toxytricini, sp. NR 0619, albolongus, aburaviensis,
andlavendulae) have a potent inhibitory activity of PL
[9]. Lipstatin was isolated from an actinobacterium, Streptomyces
toxytricini, and the catalytic hydrogenation product of lipstatin is
the approved antiobesity drug tetrahydrolipstatin (Orlistat; marketed
by Roche as Xenical) [18]. Panclicins, analogs of tetrahydrolipstatin
isolated from Streptomyces sp. NR0619, also present
strong anti-lipase activity [41]. Other compounds which also act
as potent inhibitors of PL, at least in vitro, are ebelactones A and B,
isolated from Streptomyces aburaviensis [42], and vibralactone,
isolated from the culture broth of the polypore Boreostereum vibrans
[43]. Finally, other examples of lipase inhibitors have been
obtained from yeasts and fungi such as Candida antarctica, Candida
rugosa, Gestrichum candidum, Humicola lanuginose, and
Pseudomonas glumae, which have received special attention and
are widely used in the pharmaceutical industry [44].
Due to the biodiversity and unexplored resources, the fungal
kingdom has been particularly searched to find new substances
with lipase inhibitory activity. In a thorough screening of lipase
inhibitors of fungal origin in Slovenia [23], extracts obtained from
three species, Laetiporus sulphureus, Tylopilus felleus, andHygrocybe
conica, exhibited very high lipase inhibitory activities (83%
± 5%, 96% ± 3%, and 97% ± 5%, respectively), even higher than Orlistat.
Pleurotus eryngii water extract also shows a significant in-
Reviews
hibitory activity against PL, preventing postprandial hyperlipidemia
through low intestinal absorption of dietary fat [45]. Finally,
the water and ethanol extracts from fruiting bodies of Phellinus
linteus show a potent lipase inhibitory and antiobesity effect
[46]. A special case is that of monascus pigments from Monascus
sp., which have been used for many years as natural colorants and
as a healthy food in East Asia, being employed in the production
of certain fermented foods. Various monascus derivatives with
incorporated unnatural amino acids show inhibitory activities
against lipase [47].
In the same way, marine products are an especially rich source of
bioactive compounds [48]. In a milestone study, Bitou et al. [24]
screened the lipase inhibitory activities of methanol and ethyl
acetate extracts from 54 species of marine algae. These investigations
observed a very high activity (almost 100% inhibition) in
the methanol extracts from Caulerpa taxifolia and Asparagopsis
tociformis, although the methanolic extracts of other Chlorophyta
(i.e., Caulerpa okamurae or Codium latum), Rhodophyta (i.e.,
Gloiopeltis tenax or Hypnea charoides), and Phaeophyta (i.e., Sargassum
muticum, Dictyopteris latiuscula, orCutleria cylindrica),
were also very promising. In this sense, Phaeophyta generally
contains large amounts of polyphenols, such as tannins, with lipase-inhibiting
activity. In fact, most compounds with a porphyrin
structure are able to inhibit lipase activity [49]. Two algae
whose extracts inhibit gastric and pancreatic lipases are Caulerpa
prolifera, which may be a source of a potential antiobesity agent
[50], and Caulerpa taxifolia, which synthesizes the toxin caulerpenyne
[24]. On the other hand, carotenoids from Undaria pinnatifida
and Sargassum fulvellum, specifically fucoxanthin that is
metabolized in vivo to fucoxanthinol, suppress triglyceride absorption
via the inhibition of PL in the intestinal lumen [51].
Medicinal plants have been used as dietary supplements for body
weight management and control in many countries. In this sense,
presence of PL inhibitors has been demonstrated in different
plant species (l " Table 1), although more research is needed for
identifying and characterizing effective lipase inhibitors [52]. Lipase
inhibitors of plant origin include certain proteins, such as
those from soybean [53] and from wheat bran and germ [54].
Other proteins that strongly inhibit hydrolysis of triglycerides
are the basic protein protamine [55] and ε-polylysine [56], which
could act, as several amphiphilic proteins like ovoalbumin and βlactoglobulin
[57], by the desorption of lipase from its substrate
due to a change in interfacial quality [58].
Other lipase inhibitors from plant origin are basic polysaccharides,
especially chitosan oligosaccharides, water-soluble chitosan
(46 kDa) and polydextrose when a basic group is introduced
[59, 60], phytic acid and other myoinositol phosphate esters [61],
phenylboronic acid, a potent inhibitor of lipase from Oryza sativa
[62], and carnosic acid, a diterpene isolated from the methanolic
extract of the leaves of sage (Salvia officinalis) and rosemary [63].
Korean and Chinese researchers have been very active in the
search of new lipase inhibitors of herbal origin. Among the most
promising compounds, there are platycodin D, isolated from the
fresh roots of Platycodon grandiflorum [64, 65], dioscin from Dioscorea
nipponica [66], licochalcone A from the roots of Glycyrrhiza
uralensis [67], phenolic constituents from the leaves of Nelumbo
nucifera [68], the aqueous ethanol extracts of Juniperus communis
or common juniper (bark) and Illicium religiosum (wood)
[69], the ethanol extract from stem bark and leaves from mango
tree (Mangifera indica), which is able to prevent weight gain induced
by feeding a high-fat diet to Wistar rats [70], a pomegranate
leaf extract rich in ellagic acid and tannins [71], Rhei rhizoma
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
775

776
Reviews
Table 1 Plant extracts that showed over 40% inhibitory activity in vitro of pancreatic lipase and part of the plant from which the extract has been isolated.
Family Scientific name Common Part Ref Family Scientific name Common Part Ref
name
of plant
name of plant
Aeraceae Acer pseudosiebol- Korean maple Whole [138] Lamiaceae Spirodela polyrhiza Common Whole [138]
dianum
duckmeat
Anacardiaceae Pistacia vera Pistachio Fruits hull [52] Lamiaceae Thymus pulegoides Lemon thyme Whole [22]
Apiaceae Levisticum officinale Garden lovage Whole [52] Lauraceae Cinnamomum
zeylanicum
Cinnamon Derm [52]
Apiaceae Sanicula chinensis Bian Dou Cai Whole [138] Lauraceae Lindera glauca Grayblue
spicebush
Whole [138]
Araliaceae Eleutherococcus Siberian ginseng Leaves [114] Liliaceae Asparagus
Shiny asparagus Radix [138]
senticosus
cochinchinesis
Aspidiaceaes Cyrtomium falcatum Japanese holly fern Whole [138] Liliaceae Scilla scilloides Chinese scilla Whole [138]
Asteraceae Artemisia scoparia Redstem Whole [138] Linaceae Linum
Oil flax Seed [139]
wormwood
usitatissimum
Asteraceae Helianthus annus Common Seed [139] Lythraceae Lythrum salicaria Purple Whole [138]
sunflower
loosestrife
Brassicaceae Brassica nigra Black mustard Radix [22] Musaeae Musa sapientum French plantain Fructus [22]
Brassicaceae Brassica oleracea
capitata
Cabbage Folium [22] Myricaceae Myrika spp Bayberry Bark [140]
Brassicaceae Raphanus sativus Radish Radix [22] Myrtaceae Myrtus communis True myrtle Leaves [52]
Caprifoliaceae Lonicera japonica Japanese honeysuckle
Whole [138] Myrtaceae Solanum tuberosum Potato Flowers [22]
Celastraceae Euonymus
sachalinensis
Spindletree Whole [138] Oleaceae Olea europeae Olive Folium [22]
Crassulaceae Rhodiola rosea Roseroot Whole [141] Orchida- Gastrodia elata Tien Ma Whole [138]
stonecrop
ceae
Cucurbitaceae Cucurbita pepo Field pumpkin Whole [138] Oxalidaceae Oxalis corniculata Sleeping
beauty
Whole [138]
Cucurbitaceae Momordica
Spiny
Whole [138] Poaceae Eriochloa villosa Hairy cup- Whole [138]
cochinchinensis bittergourd
grass
Cyperaceae Bulbostylis barbata Watergrass Whole [138] Poaceae Hemarthria sibirica Weed Whole [138]
Cyperaceae Carex kobomugi Japanese Whole [138] Poaceae Panicum dichotomi- Fall panic- Whole [138]
sedge
florumgrass
Cyperaceae Cyperus amuricus Asian
Whole [138] Poaceae Setaria italica Foxtail bris- Whole [138]
flatsedge
tlegrass
Eleagnaceae Elaeagnus macro- Oleaster Whole [138] Polygala- Polygala tenuifolia Yuan Zhi Whole [138]
phyllaceae
Ericaceae Arctostaphylos uva-ursi Bear berry Folium [22] Polygona- Reynoutria elliptica Black bind- Whole [138]
ceaeweed
Ericaceae Vaccinium myrtillus Bilberry Fructus [22] Polygona- Rheum ribes Rhubarb Rhi- [52]
ceaezomes
Eriocaulaceae Eriocaulon siebol- Flattened Whole [138] Potamogetona- Potamogeton distinctus Pondweed Whole [138]
dianum
pipewort
ceae
Fabaceae Alhagi camelorum Camelthorn Aerial
parts
[52] Rosaceae Rosa damascene Damask rose Floret [52]
Fabaceae Glycyrrhiza uralensis Gan Cao Whole [138] Rosaceae Rubus idaeus Raspberry Fructus [22]
Fabaceae Lespedeza cuneata Chinese bush
clover
Whole [138] Rosaceae Malus domestica Apple Fructus [22]
Fabaceae Phaseolus vulgaris Common bean Whole [22] Rubiaceae Gardenia jasmi- Cape jas- Whole [138]
noidesmine
Fabaceae Pisum sativum Garden pea Fructus [22] Rubiaceae Rubia akane Asian madder
Whole [138]
Fabaceae Pueraria thunbergiana Kudzu Whole [138] Rutaceae Citrus aurantifolium Lime Whole [138]
Fabaceae Quercus infectoria Aleppo oak Galls [52] Rutaceae Murraya koeninggi Curryleaf
tree
Leaves [142]
Juncaceae Juncus effusus Soft rush Whole [138] Rutaceae Orixa japonica Pearl frost Whole [138]
Lamiaceae Agastache rugosa Purple giant Whole [138] Saxifragaceae Chrysosplenium Golden saxifrage Whole [138]
hyssop
grayanum
Lamiaceae Origanum vulgare Oregano Herba [22] Simaroubaceae Ailanthus altissima Tree of heaven Whole [138]
Lamiaceae Prunella vulgaris Common selfheal Whole [73] Tiliaceae Tilia platyphyllos Largeleaf linden Whole [22]
Lamiaceae Rosmarinus officinalis Rosemary Folium [22] Urticaceae Urtica urens Dwarf nettle Aerial parts [52]
Lamiaceae Salvia officinalis Salvia Folium [22] Zingiberaceae Afromomum
Meleguetta Seed [143]
meleguetta
pepper
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785

Table 2 Some classes of natural compounds that have been reported to inhibit pancreatic lipase activity in vitro and species from which the compound has been
obtained.
Metabolites Scientific name Common name Family References
Flavonoids Alpinia officinarum Lesser galangal Zingiberaceae [144,145]
Flavonoids Taraxacum officinale Dandelion Asteraceae [103]
Flavonoids, triterpenes Actinidia arguta Kiwi Actinidiaceae [146]
Polyphenols Arachis hypogaea Peanut Fabaceae [9]
Polyphenols Mangifera indica Mango Anacardiaceae [9]
Polyphenols Medicago sativa Alfalfa Fabaceae [78]
Polyphenols Nelumbo nucifera Sacred lotus Nelumbonaceae [9]
Polyphenols Salacia reticulate Kotala himbutu Celastraceae [101]
Polyphenols Salix matsudana Corkscrew willow Salicaceae [147]
Polyphenols, proanthocyanidins,
catechins
Camellia sinensis Green, black, oolong tea Theaceae [89]
Polyphenols, saponins Ilex paraguariensis Yerba mate Aquifoliaceae [99]
Proanthocyanidins Cassia mimosoides Nomame herba Fabaceae [148]
Proanthocyanidins Cinnamomum sieboldii Cinnamon Lauraceae [86]
Proanthocyanidins Theobroma cacao Cocoa Malvaceae [86]
Proanthocyanidins, saponins Vitis vinifera Grape vine Vitaceae [79,104]
Saponins Aesculus hippocastanum Horse chestnut Sapindaceae [32]
Saponins Aesculus turbinate Japanese horse chestnut Hippocastanaceae [110]
Saponins Arctostaphylos uva-ursi Bearberry Ericaceae [32]
Saponins Ardisia japonica Marlberry Myrsinaceae [152]
Saponins Avena sativa Oat Poaceae [149]
Saponins Coffea Arabica Coffee Rubiaceae [32]
Saponins Cyclocarya paliurus Wheel wingnut Juglandaceae [9]
Saponins Dioscorea nipponica Yam Dioscoreaceae [9]
Saponins Eleutherococcus senticosus Siberian ginseng Araliaceae [114]
Saponins Eleutherococcus sessiliflorus Sessiloside Araliaceae [9]
Saponins Gardenia jasminoides Cape jasmine Rubiaceae [118]
Saponins Gypsophila oldhamiana Oldhamʼs babyʼs-breath Caryophyllaceae [119]
Saponins Kochia scoparia Burningbush Chenopodiaceae [150]
Saponins Malus domestica Apple Rosaceae [32]
Saponins Momordica charantia Balsampear Cucurbitaceae [151]
Saponins Olea europeae Olive Oleaceae [32]
Saponins Panax ginseng Ginseng Araliaceae [109]
Saponins Panax japonicus Japanese ginseng Araliaceae [120]
Saponins Panax quinquefolium American ginseng Araliaceae [122]
Saponins Platycodi radix Doraji Campanulaceae [64]
Saponins Platycodon grandiflorum Balloon flower Campanulaceae [103]
Saponins Sapindus rarak Soapberry Sapindaceae [127]
Saponins Scabiosa tschiliensis Pincushions Dipsacaceae [9]
Saponins Solanum lycopersicum Tomato Solanaceae [32]
Terpenes Salvia officinalis Salvia Lamiaceae [32]
Triterpenes Aloe vera Aloe vera Asphodelaceae [32]
Triterpenes Betula alba Birch Betulaceae [32]
Triterpenes Calendula officinalis Pot marigold Asteraceae [32]
Triterpenes Melissa officinalis Lemon balm Lamiaceae [32]
Triterpenes Origanum vulgare Oregano Lamiaceae [32]
(rhubarb) and the combinatorial drug Chunghyuldan [72], Prunella
vulgaris, Rheum palmatum, and other herbs [73]. Most of
the common compounds that are found in different plant species
are polyphenols, saponins, and terpenes (l " Table 2).
In the following chapters more information will be given out
about the most thoroughly studied compounds, classified according
to their biochemical structure.
Polyphenols
A number of studies have revealed various health benefits of
plant polyphenols and their importance in foods, beverages, and
natural medicine. In this context, polyphenols have some potential
efficacy for preventing obesity. They inhibit enzymes related
to fat metabolism including PL, lipoprotein lipase, and glycero-
Reviews
phosphate dehydrogenase [74]. Polyphenol extracts are able to
decrease the blood levels of glucose, triglycerides, and LDL cholesterol,
increase energy expenditure and fat oxidation, and reduce
body weight and adiposity [75, 76]. In fact, many polyphenols,
including flavones, flavonols, tannins, and chalcones, have
shown an inhibitory activity of PL [9, 22].
Flavonoids are a type of plant secondary metabolites that are
characterized as containing two or more aromatic rings, each
bearing at least one aromatic hydroxyl and connected with a carbon
bridge [76]. Some of them are polymerized into large molecules,
either by the plants themselves or as a result of food processing.
These polymers are called tannins, and three subclasses
(condensed tannins, derived tannins, and hydrolysable tannins)
exhibit a variety of beneficial effects on health [76]. A flavonoid
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
777

778
Reviews
with PL inhibitory activity is hesperidin, obtained from the peels
of Citrus unshiu [77].
Proanthocyanidins (PA), also known as condensed tannins, are
the most common group of flavonoids in the Western diet. They
consist of monomeric units of flavans linked through carbon-carbon
and ether linkages, which are considered the second most
abundant group of natural phenolics after lignins [78]. PA can be
found in such common foodstuffs as cereals, legumes, fruits, vegetables,
and beverages (red wine and tea in particular) [75, 79].
They have a putative role as antioxidants, showing beneficial effects
on inflammatory processes, cardiovascular diseases, and
other pathological conditions [80, 81]. For example, these compounds
actively reduce plasma triglycerides by inhibiting the absorption
of dietary lipids [79] and possess inhibitory effects on
different digestive enzymes, such as trypsin, amylase, and lipase
[36].
Some examples of polyphenols with inhibitory action on PL are
proanthocyanidins from edible herbs, such as those from Cassia
mimosoides [82], and tea catechins, especially (−)-catechin gallate
and (−)-gallocatechin gallate, [83]. Some of the most thoroughly
studied polyphenol extracts in relation to PL inhibition are the
following:
Arachis hypogaea: Peanut (Arachis hypogaea) shells (hulls, seed
coats), which are by-products of the peanut industry, provide
several compounds showing PL inhibitory activity in a dose dependent
manner (1 mg/mL = 42% inhibitory effect) that are able
to reduce body weight gain in rats fed a high-fat diet [84]. This
plant contains several bioactive molecules, such as luteolin
(l " Fig. 2), certain fatty acids, caffeic, ferulic, and benzoic acids,
all of which are able to inhibit lipases [9]. Coumarin derivates
and phenolic acids were assumed to be the major active constituents.
However the authors have not examined the individual effects
of each compound.
Camellia sinensis: Camellia sinensis or tea plant (green tea, black
tea, or oolong tea) contains over 60 polyphenols, some of them
with a potent PL inhibitory activity. It is likely the plant whose
extracts have been more thoroughly used for searching new PL
inhibitors. The major polyphenols are catechins (l " Fig. 2), which
constitute about one-third of its total dry weight. A serving of tea
is moderate to high in flavonoid and/or tannin content [85–89].
Nakai et al. [90] found that the polyphenols with more potent PL
inhibitory effect were flavan-3-ol digallate esters isolated from
oolong tea, such as (−)-epigallocatechin-3,5-digallate. Oolong
tea-polymerized polyphenols reduced postprandial hypertriglyceridemia
in olive oil-loaded rats and mice [91]. Also (−)-epigallocatechin,
abundant in the green tea extract, is a weak inhibitor of
PL and is able to decrease the postprandial hypertriglyceridemia
in rodents [92].
The administration of black-tea polyphenols suppressed postprandial
hypertriglyceridemia in a dose-dependent manner in
rats, with theaflavin-3,3′-digallate as the most effective PL inhibitor
[93], whereas other authors point out to thearubigins [94].
These extracts are able to prevent increases in body weight and
adiposity in mice fed a high-fat diet [95]. The PL inhibitory and
hypotriglyceridemic effects of tea extracts were corroborated by
Tanaka et al. [96], who orally administered mixed fermented tea
extracts and Loquat tea extracts to rats with a 10% soybean oil
emulsion.
Finally, cocoa tea extract (Camellia sinensis var. ptilophylla) is rich
in polyphenols with PL inhibitory effect. A single oral administration
of this extract produces an inhibition of plasma triglyceride
levels in olive oil-loaded ICR mice and triolein-loaded rats [97].
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785
Fig. 2 Selected polyphenols with PL inhibitory activity: Luteolin (1) from
Arachis hypogaea, catechin (2) from Camellia sinensis, daidzein (3) from Glycine
max, quercetin (4) from Ilex paraguariensis, structure of a procyanidin
(5) from Vitis vinifera.
Glycine max: Daidzein (l " Fig. 2) belongs to the group of isoflavones
and is produced almost exclusively by the members of the
Fabaceae/Leguminosae (bean) family such as soybean. In one
study, Guo et al. [98] investigated the effects of daidzein on body
weight, adipose tissue, blood, and liver lipid levels in obese mice
fed a high-fat diet, finding that daidzein reduced body and white
adipose tissue weights in obese mice and ameliorated the hyperlipidemia
induced by the high-fat diet. The authors attributed
this effect to the inhibition of PL activity and fat digestion.
Ilex paraguariensis: Yerba mate (MT) is a plant from the subtropical
region of South America that is widely consumed in Brazil,
Argentina, Paraguay, and Uruguay. Yerba mate contains polyphenols,
such as flavonoids (quercetin and rutin) (l " Fig. 2) and phenolic
acids (chlorogenic and caffeic acids), and is also rich in caffeine
and saponins [99]. These substances act on the lipid metabolism
by inhibiting PL activity in a concentration value of 1.5 mg/
mL [99]. Several triterpene saponins and monoterpene oligoglycosides
from the leaves of yerba mate were found to exhibit potent
inhibitory activity on porcine PL [100].
Malus domestica: Apples (Malus domestica) belong to the Rosaceae
family whose fruits contain several phenolic substances
(cholorogenic acid, catechin, epicatechin, phloridzin, and procyanins).
Procyanidins in apples are mainly composed of various
polymerized catechins, with some of them showing a PL inhibitory
activity and reducing triglyceride absorption [36]. In corn
oil-loaded mice, a single oral administration of apple polyphenols
reduced plasma triglyceride levels, and a test diet containing
600 mg of apple polyphenols significantly inhibited triglyceride

elevation at 6 h after ingestion, indicating an inhibition of triglyceride
absorption [36].
Salacia reticulata: Salacia reticulata contains a high concentration
of polyphenols, including catechins and condensed tannins.
In hot water-soluble extract from the roots of Salacia reticulata
(SRHW) the concentration is about 24% polyphenols [74]. The
polyphenols from Salacia reticulata inhibit enzymes related to
fat metabolism, including PL, lipoprotein lipase, and glycerophosphate
dehydrogenase, and are effective in preventing obesity
[101]. In fact, Salacia extract markedly improved metabolic syndrome
symptoms (including body weight, adiposity, glucose intolerance,
hypertension, and peripheral neuropathy) in TSOD
mice [102].
Taraxacum officinale: Dandelion (Taraxacum officinale) is a perennial
herbaceous plant of the family Asteraceae that has been
used as a phytomedicine due to its choleretic, antirhemetic, diuretic,
and anti-inflammatory properties [103]. Extracts from
this plant have shown hypolipidemic effects and an inhibitory activity
of PL, decreasing AUC (area under curve) for the postprandial
triglyceride response curve [103].
Vitis vinifera: Grapevine (Vitis vinifera) has become a model plant
for studying proanthocyanidin biosynthesis. Grapevine proanthocyanidins
(l " Fig. 2) consist of two major flavan 3-ol monomers,
catechin and epicatechin, that have inhibitory activity on
PL [79, 104].
Polyphenol-rich extracts from a range of berries, particularly
cloudberry, are able to inhibit PL activity in vitro, which has been
attributed to their content in ellagitannins and proanthocyanidins
[105].
Saponins
Saponins are a major family of secondary metabolites that occur
in a wide range of plants species [106]. These compounds have
been isolated from different parts of the plants, including the
roots, rhizomes, stems, bark, leaves, seeds, and fruits. Occasionally,
the whole plant has been used [107].
Saponins are categorized into two major classes, the triterpenoid
and the steroid saponins, which are both derived from the 30 carbon
atoms containing precursor oxidosqualene [107, 108]. Some
of the triterpene-rich plant materials are common foodstuffs
consumed in large amounts in Mediterranean countries. Therefore,
the correlation of a triterpene-rich diet and the beneficial effects
of consuming a Mediterranean diet should be investigated
in more detail [32]. These types of plant secondary metabolites
are found to inhibit PL and, thus, may represent potential effective
treatments for obesity and related disorders [9, 22].
Aesculus turbinata: The Japanese horse chestnut (Aesculus turbinata)
is a medicinal plant widely used in East Asia. The saponin
mixture extracted from the seeds is called escins and has a strong
inhibitory activity on PL [110]. In mice fed a high-fat diet, total
escins suppressed the increase in body weight, adiposity, and liver
fat and increased triglyceride level in the feces, whereas it decreased
plasma triglycerides after the oral administration of a lipid
emulsion [111, 112].
Dioscorea nipponica: The methanol extract of Dioscorea nipponica
Makino powder has a potent inhibitory activity against porcine
PL, with an IC 50 value of 5–10 µg/mL [66]. In fact, the saponin dioscin
and its aglycone, diosgenin, both suppressed the increase of
blood triacylglycerols when orally injected with corn oil to mice.
Rats fed a high-fat diet containing 5% Dioscorea nipponica Makino
gained significantly less body weight and adipose tissue than
control animals [66], and a similar result has been observed after
Reviews
Fig. 3 Selected isoprenoids with PL inhibitory activity: Eleutheroside (6)
from Eleutherococcus senticosus, geniposide (7) from Gardenia jasminoides,
general structure of dammaran aglycons of ginsenosides (8)inPanax ginseng,
betulin (9) from Betula alba.
administering the aqueous extract of this rhizome to mice fed a
high-fat diet [113].
Eleutherococcus senticosus: Eleutherococcus senticosus is a shrub,
belonging to the family Araliaceae, which is commonly distributed
in north-eastern Asia. It is used as a traditional Chinese
medicine against ischemic heart diseases, neurasthenia, hypertension,
arthritis, and tumors [114]. At least fifteen triterpenoid
saponins with in vitro PL inhibitory activity (l " Fig. 3) have been
isolated from the fruits of Eleutherococcus senticosus [115]. The
total saponin fraction obtained from the fruits of Eleutherococcus
senticosus exhibits inhibitory activity on PL with an IC50 value of
3.63 mg/mL [114].
Eleutherococcus sessiliflorus: Different lupine-type triterpene triglycosides
isolated from a hot water extract of Eleutherococcus
sessiliflorus leaves are able to inhibit PL activity in vitro and to
suppress the body weight gain of mice fed a high-fat diet [116].
Gardenia jasminoides: Crocin is a glycosylated carotenoid extracted
from the fructus of Gardenia jasminoides (l " Fig. 3). Gardeniae
Fructus is used in Asian countries as a natural colorant,
and in Chinese traditional medicine for its antioxidant, cytotoxic,
antitumor, and neuroprotective effects. Crocin and crocetin are
effective hypolipidemic agents that act by reducing the absorption
of fat and cholesterol through inhibition of PL activity [117].
Sheng et al. demonstrated that crocin selectively inhibited the activity
of PL as a competitive inhibitor [118].
Gypsophila oldhamiana: Gypsophila oldhamiana (Caryophyllaceae)
is a plant distributed in the north of China whose roots have
high amounts of saponins, sterols, and fatty acids. The extract
from this plant shows a potent inhibitory activity of PL with an
IC 50 value of 0.54 mg/ml [118,119] and different triterpenoid
saponins, gypsosaponins A–C, as the more efficient compounds
[119].
Panax ginseng: Ginseng is one of the most popular medicinal
herbs and is commonly consumed as powder, a beverage, or a
food supplement. Roots of Panax ginseng contain high levels of
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
779

780
Reviews
ginsenosides (l " Fig. 3), which are steroidal saponins that show
beneficial effects on lipid metabolism. Saponins from ginseng
roots suppressed the expected increase in body weight and plasma
triacylglycerols in mice following a high-fat diet, which was
probably mediated by inhibiting PL with an IC50 value of 500 µg/
mL [109].
Panax japonicus: The rhizomes of Panax japonicus (Japanese ginseng)
are used in folk medicine for the treatment of arteriosclerosis,
hyperlipidemia, hypertension, and diabetes mellitus. Chikusetsusaponins
prevented the increase in body weight and parametrial
adipose tissue weight induced by a high-fat diet and inhibited
the elevation of postprandial plasma triacylglycerols due
to their inhibitory action of PL on dietary fat [120]. The delay in
intestinal fat absorption was also behind the antiobesity effects
observed for Korean white ginseng extract in high-fat diet-induced
obese mice [121].
Panax quinquefolium: American ginseng (Panax quinquefolium) is
a native plant from North America. The saponins isolated from
stems and leaves of Panax quinquefolium may prevent fat storage
in adipose tissue and postprandial elevations of plasma triacylglycerols
by inhibiting the intestinal absorption of dietary fat
through the inhibition of PL activity [122].
Platycodi grandiflorum: Platycodi radix, widely used in traditional
Oriental medicines as a remedy for respiratory disorders, is
rich in saponins, which are responsible for a diversity of effects
including anti-inflammation, antiallergy, antitumor, and immunostimulation
[64]. Given its inhibitory action on PL [123], with
platycodin D as the most efficient compound [124], it ameliorated
high fat-induced obesity in mice [125] and rats [64]. SK1 is
an edible saponin-rich compound from Platycodi Radix that is
able to reduce body weight and fat accumulation by increasing
fecal lipid outputs in high-fat fed mice [126].
Sapindus rarak: The methanolic extract from the pericarps of Sapindus
rarak (Lerak) shows a PL inhibitory activity that is probably
due to diverse saponins and sesquiterpene glycosides [127].
Scabiosa tschiliensis: Different triterpenoid saponins isolated
from the Mongol and Chinese traditional medicinal herb Scabiosa
tschiliensis have shown strong inhibition of PL in vitro [128]. Due
to the difficult task of isolating scabiosaponins and the scarceness
of this type of saponin in nature, some of them have been successfully
synthesized in the laboratory [129].
Tea saponins: At least three kinds of tea (oolong, green, and black)
have been used as healthy drinks. Tea saponins suppress the increases
in body and parametrial adipose tissue weights and adipocyte
diameters induced by a high-fat diet in mice by inhibiting PL
and also reduce the elevation in plasma triacylglycerol levels after
oral administration of a lipid emulsion. The Ki value of tea saponins
was determined to be 0.25 mg/mL [85]. Thus, the crude saponin
fraction from the flower buds of Chinese tea plant exhibits
accelerating effects on gastrointestinal transit in mice and inhibitory
effects against porcine PL, and three floratheasaponins (A–C)
showed inhibitory effects on serum triglyceride elevation [130].
Triterpenes
Terpenes are the primary constituents of the essential oils of
many types of plants and are classified by the number of terpene
units in the molecule (diterpenes, triterpenes, among others).
The pharmacological relevance of triterpenes has increased during
the last two decades demonstrating multitarget properties
such as wound healing, anti-inflammatory, antibacterial, antiviral,
hepatoprotective, and antitumoral effects, combined with
low toxicity [32]. Triterpene extracts are safe and provide a high
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785
potential for further pharmaceutical and pharmacological research
[131], some of them inhibiting PL activity.
Betula alba: Bark of birch (Betula alba) contains pentacyclic triterpenes
(l " Fig. 3). This triterpene extract is safe and provides a
high potential for further pharmaceutical and pharmacological
research [32, 131], displaying an inhibitory activity on PL [22].
Clinical Studies about Pancreatic Lipase Inhibitors
!
A number of plants and natural products have been screened for
their PL inhibitory activity but just some of them have gone up to
clinical studies. In this line, only one product derived from natural
compounds (Orlistat) is currently in clinical use, although
others are under investigation. Some of them are Panax ginseng
[132], Camellia sinensis [133], Eleutherococcus senticosus [134],
Malus domestica [135], and Arachis hypogaea [136].
In one study [132], the administration of an extract of Panax ginseng
in humans for 8 weeks decreased circulating cholesterol, triglyceride,
and low-density lipoprotein levels (LDL). Each subject
ingested 2 g of Panax ginseng extract three times a day.
Lee et al. [134] reported that healthy postmenopausal women
treated for 6 months with Eleutherococcus senticosus supplementation
showed significant decreases in serum LDL levels and LDL/
HDL ratios.
In other study, Sugiyama et al. [135] assessed six healthy male
volunteers that followed a high-fat diet with 40 g of fat with 10
control or 10 apple polyphenol (Malus domestica) capsules (600
or 1500 mg). In this study, they demonstrated that apple polyphenols
may prevent obesity in humans by a PL inhibitory mechanism.
Green tea (Camellia sinensis) has been extensively studied in relation
to obesity and other metabolic disorders. Thus, Chantre
and Lairon [133] showed that green tea consumption may be
useful to treat obesity by both, increasing thermogenesis and inhibiting
PL. Thus, a green tea extract showed a direct in vitro inhibition
of gastric and pancreatic lipases [133]. In moderately
obese patients, green tea lowered body weight by stimulating
thermogenesis and increasing energy expenditure when each
subject received 2 times/d a green tea extract (2 capsules morning,
2 capsules midday). Ingestion of 4 capsules containing AR25
(Exolise) provided a daily total intake of 375 mg catechins, of
which 270 mg was epigallocatechin gallate. Also, He et al. [137]
administered daily 8 g of oolong tea for 6 weeks to 102 obese subjects.
As a result, 70% of the obese subjects decreased more than
1 kg in body weight. In vitro studies suggested that the effect of
oolong tea on body weight could be partially attributed to the inhibition
of PL [68].
According to these data, a number of common herbal products
that are being studied in animal (l " Table 3) and human models
for obesity treatment contain different metabolites that act on
lipid digestion and absorption. However, it is very difficult to establish
in in vivo studies whether these antiobesity effects are only
or mainly due to PL activity inhibition. The clinical implications
of this therapeutic approach have yet to be determined.
Conclusions
!
Orlistat is the only drug authorized and present in Europe for the
treatment of obesity within an adequate energy intake, which
acts by inhibiting the lipolytic activity of PL. With the aim of find-

Table 3 Plant extracts that showed in vivo inhibitory activity of pancreatic lipase, doses and effects. IC 50 is indicated when available.
Scientific name Common name IC50 Doses Model Effects References
Aesculus turbinate Japanese horse chestnut IC50 24 mg/mL 0.1–0.5% of diet DIO mice TG plasma levels and body weight gain [153]
Arachis hypogaea Peanut IC50 0.029 µg/mL 1% of diet DIO rats Body weight gain [136]
Camellia sinensis Green, black, oolong tea IC50 0.091 mg/mL 3% of HFD Rats Body weight gain
and visceral fat
[89]
Cassia mimosoides Nomame herba IC50 0.1–0.71 mg/mL 1–3.5% of diet DIO rats Body weight gain [154]
Coffea arabica Coffee 0.5% of standard
diet
Mice Body weight gain [155]
Cyclocarya paliurus Wheel wingnut IC50 9.1 µg/mL 250 mg/kg; VO Mice TG plasma levels and blood glucose levels [156]
Dioscorea nipponica Yam IC50 5–10 mg/mL 5% of HFD Rats TG plasma levels and body weight gain [157]
Eleutherococcus senti- Siberian ginseng IC50 0.22–0.29 mM 12 mg/kg DIO rats Abdominal fat, TG in liver
[158]
cosus
and serum and LDL in serum
Eleutherococcus Sessiloside IC50 0.36–0.75 mg/mL 100–300 mg/kg; Mice TG plasma levels [159]
sessiliflorus
VO
Gardenia jasminoides Cape jasmine IC50 2.1 mg/mL 50 mg/kg/d Mice Body weight gain [118]
Humulus lupulus Common hop 0.2–1.2% (w/w)
of extract
Mice Body weight gain and blood glucose levels [160]
Ilex paraguariensis Yerba mate 0.24% of HFD Rats Body weight gain [99]
Kochia scoparia Burningbush 3% of HFD Mice Body weight gain [150]
Malus domestica Apple IC50 5.6 µg/mL 200 mg/kg; VO Mice TG plasma levels [161]
Myrica spp Bayberry – – TG plasma levels [140]
Nelumbo nucifera Sacred lotus IC50 0.46 mg/mL 5% of diet Mice TG plasma levels and body weight gain [162]
Panax ginseng Ginseng IC50 500 µg/mL 200 mg/kg with
HFD
Rats Body weight gain [109]
Panax japonicus Japanese ginseng 1–3% of diet DIO mice Body weight gain [120]
Platycodi radix Doraji Ki 0.18 mM 70 mg/kg, Sprague Body weight gain [64]
with HFD Dawley rats
Rhodiola rosea Roseroot stonecrop IC50 0.093 mM 150 mg/kg Mice TG plasma levels [141]
Rosmarinus officinalis Rosemary 200 mg/kg HFD Mice Body weight and fat mass [163]
Salacia reticulata Kotala himbutu IC50 264 mg/L 125 mg/kg;
VO HFD
Rats Body weight gain [101]
Salix matsudana Corkscrew willow 5% of HFD Wistar rats Body weight gain [147]
DIO: Diet-induced obesity; HFD: High-fat diet; VO: Via oral. (Daily food intake is approximately: rats: 20 g/day; mice: 4.5 g/day)
ing new compounds more potent or with less secondary effects
than Orlistat, new natural products are being identified and
screened for their PL inhibitory potential. Some of these extracts
are obtained from plants that are rich in polyphenols and saponins
and show inhibitory effects on fat digestion, whereas other
extracts come from algae, fungi, and microorganisms. Thus, natural
products provide an exciting opportunity and promise for the
development of new therapeutic approaches to the treatment of
obesity by blocking the digestion and absorption of dietary lipids,
and constitute a valuable alternative to other pharmacological
agents. Some of the products reviewed in this article show potentially
promising effects for weight control. In particular apple,
green tea, soybean, and ginseng seem to have great potential as
sources of molecules with PL inhibitory activity. For all of them
more data are needed to define effects, optimal dose required,
and mechanism of action, as well as their possible side or toxic
effects.
Thus, there is an urgent need to update the knowledge on the numerous
natural sources that could act as inhibitors of PL in order
to screen them as new potential therapeutic antiobesity agents
with low secondary effects.
Reviews
Acknowledgements
!
The authors thank Línea Especial (LE/97) from the University of
Navarra (Spain) and the CENIT PRONAOS Program (MICINN,
Spain) for financial support. A. L. de la Garza and N. Boqué hold
pre-doctoral grants from Ibercaja. We also acknowledge Marta
Díaz Hernando for her contribution to the figures design.
References
1 Drew B, Dixon A, Dixon J. Obesity management: update on orlistat. Vasc
Health Risk Manag 2007; 3: 817–821
2 Brug J, Crawford D. The obesity pandemic. Is it bad or worse? Eur
J Public Health 2009; 19: 570–571
3 Schrauwen P, Westerterp KR. The role of high-fat diets and physical activity
in the regulation of body weight. Br J Nutr 2000; 84: 417–427
4 Voshol P, Rensen PCN, van Dijk K, Romijn J, Havekes L. Effect of plasma
triglyceride metabolism on lipid storage in adipose tissue: studies using
genetically engineered mouse models. Biochim Biophys Acta 2009;
1791: 479–485
5 Abete I, Astrup A, Martnez JA, Thorsdottir I, Zulet M. Obesity and the
metabolic syndrome: role of different dietary macronutrient distribution
patterns and specific nutritional components on weight loss and
maintenance. Nutr Rev 2010; 68: 214–231
6 Little T, Horowitz M, Feinle-Bisset C. Modulation by high-fat diets of gastrointestinal
function and hormones associated with the regulation of
energy intake: implications for the pathophysiology of obesity. Am
J Clin Nutr 2007; 86: 531–541
7 Rubio M, Gargallo M, Millán A, Moreno B. Drugs in the treatment of obesity:
sibutramine, orlistat and rimonabant. Public Health Nutr 2007;
10: 1200–1205
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
781

782
Reviews
8 Moreno D, Ilic N, Poulev A, Brasaemle D, Fried S, Raskin I. Inhibitory effects
of grape seed extract on lipases. Nutrition 2003; 19: 876–879
9 Birari R, Bhutani K. Pancreatic lipase inhibitors from natural sources:
unexplored potential. Drug Discov Today 2007; 12: 879–889
10 Sumantran V. Experimental approaches for studying uptake and action
of herbal medicines. Phytother Res 2007; 21: 210–214
11 Yamagishi S, Matsui T, Ueda S, Fukami K, Okuda S. Clinical utility of acarbose,
an alpha-glucosidase inhibitor in cardiometabolic disorders. Curr
Drug Metab 2009; 10: 159–163
12 Raz I, Eldor R, Cernea S, Shafrir E. Diabetes: insulin resistance and derangements
in lipid metabolism. Cure through intervention in fat
transport and storage. Diabetes Metab Res 2005; 21: 3–14
13 Hosoyama H, Sugimoto A, Suzuki Y, Sakane I, Kakuda T. [Isolation and
quantitative analysis of the alpha-amylase inhibitor in Lagerstroemia
speciosa (L.) Pers. (Banaba)]. Yakugaku Zasshi 2003; 123: 599–605
14 Tsujita T, Takaku T, Suzuki T. Chestnut astringent skin extract, an alphaamylase
inhibitor, retards carbohydrate absorption in rats and humans.
J Nutr Sci Vitaminol 2008; 54: 82–88
15 Tormo MA, Gil-Exojo I, de Tejada AR, Campillo JE. White bean amylase
inhibitor administered orally reduces glycaemia in type 2 diabetic rats.
Br J Nutr 2006; 96: 539–544
16 Bray G, Ryan D. Drug treatment of the overweight patient. Gastroenterology
2007; 132: 2239–2252
17 McClendon K, Riche D, Uwaifo G. Orlistat: current status in clinical therapeutics.
Expert Opin Drug Saf 2009; 8: 727–744
18 Weibel EK, Hadvary P, Hochuli E, Kupfer E, Lengsfeld H. Lipstatin, an inhibitor
of pancreatic lipase, produced by Streptomyces toxytricini.
I. Producing organism, fermentation, isolation and biological activity.
J Antibiot 1987; 40: 1081–1085
19 Viner RM, Hsia Y, Tomsic T, Wong ICK. Efficacy and safety of anti-obesity
drugs in children and adolescents: systematic review and meta-analysis.
Obes Rev 2010; 11: 593–602
20 Heymsfield SB, Segal KR, Hauptman J, Lucas CP, Boldrin MN, Rissanen A.
Effects of weight loss with orlistat on glucose tolerance and progression
to type 2 diabetes in obese adults. Arch Intern Med 2000; 160:
1321–1326
21 Torgerson J, Hauptman J, Boldrin M, Sjstrm L. Xenical in the prevention
of diabetes in obese subjects (XENDOS) study: a randomized study of
orlistat as an adjunct to lifestyle changes for the prevention of type 2
diabetes in obese patients. Diabetes Care 2004; 27: 155–161
22 Slanc P, Doljak B, Kreft S, Lunder M, Janes D, Strukelj B. Screening of selected
food and medicinal plant extracts for pancreatic lipase inhibition.
Phytother Res 2009; 23: 874–877
23 Slanc P, Doljak B, Mlinaric A, Strukelj B. Screening of wood damaging
fungi and macrofungi for inhibitors of pancreatic lipase. Phytother Res
2004; 18: 758–762
24 Bitou N, Ninomiya M, Tsujita T, Okuda H. Screening of lipase inhibitors
from marine algae. Lipids 1999; 34: 441–445
25 Abete I, Parra MD, Zulet MA, Martinez JA. Different dietary strategies for
weight loss in obesity: role of energy and macronutrient content. Nutr
Rev 2006; 19: 5–17
26 Astrup A. The role of dietary fat in the prevention and treatment of
obesity. Efficacy and safety of low-fat diets. Int J Obes 2001; 25: 46–50
27 Lomba A, Martinez JA, Garcia-Daz D, Paternain L, Marti A, Campion J,
Milagro FI. Weight gain induced by an isocaloric pair-fed high fat diet:
a nutriepigenetic study on FASN and NDUFB6 gene promoters. Mol
Genet Metab 2010; 101: 273–278
28 Lomba A, Milagro FI, Garcia-Daz DF, Campion J, Marzo F, Martinez JA.
A high-sucrose isocaloric pair-fed model induces obesity and impairs
NDUFB6 gene function in rat adipose tissue. J Nutrigenet Nutrigenomics
2009; 2: 267–272
29 Hermsdorff HHM, Volp ACP, Bressan J. [Macronutrient profile affects
diet-induced thermogenesis and energy intake]. Arch Latinoam Nutr
2007; 57: 33–42
30 Mobbs C, Mastaitis J, Yen K, Schwartz J, Mohan V, Poplawski M. Low-carbohydrate
diets cause obesity, low-carbohydrate diets reverse obesity:
a metabolic mechanism resolving the paradox. Appetite 2007; 48:
135–138
31 Rolls BJ. The role of energy density in the overconsumption of fat. J Nutr
2000; 130: 268–271
32 Jäger S, Trojan H, Kopp T, Laszczyk M, Scheffler A. Pentacyclic triterpene
distribution in various plants – rich sources for a new group of multipotent
plant extracts. Molecules 2009; 14: 2016–2031
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785
33 Stevenson E, Astbury N, Simpson E, Taylor M, Macdonald I. Fat oxidation
during exercise and satiety during recovery are increased following a
low-glycemic index breakfast in sedentary women. J Nutr 2009; 139:
890–897
34 Armand M. Lipases and lipolysis in the human digestive tract: where do
we stand? Curr Opin Clin Nutr Metab Care 2007; 10: 156–164
35 Lowe M. The triglyceride lipases of the pancreas. J Lipid Res 2002; 43:
2007–2016
36 Sugiyama H, Akazome Y, Shoji T, Yamaguchi A, Yasue M, Kanda T. Oligomeric
procyanidins in apple polyphenol are main active components
for inhibition of pancreatic lipase and triglyceride absorption. J Agric
Food Chem 2007; 55: 4604–4609
37 Neovius M, Johansson K, Rssner S. Head-to-head studies evaluating efficacy
of pharmaco-therapy for obesity: a systematic review and metaanalysis.
Obes Rev 2008; 9: 420–427
38 Filippatos T, Derdemezis C, Gazi I, Nakou E, Mikhailidis D, Elisaf M. Orlistat-associated
adverse effects and drug interactions: a critical review.
Drug Saf 2008; 31: 53–65
39 Kopelman P, Bryson A, Hickling R, Rissanen A, Rossner S, Toubro S. Cetilistat
(ATL‑962), a novel lipase inhibitor: a 12-week randomized, placebo-controlled
study of weight reduction in obese patients. Int J Obes
2007; 31: 494–499
40 Melia AT, Koss-Twardy SG, Zhi J. The effect of orlistat, an inhibitor of
dietary fat absorption, on the absorption of vitamins A and E in healthy
volunteers. J Clin Pharmacol 1996; 36: 647–653
41 Mutoh M, Nakada N, Matsukuma S, Ohshima S, Yoshinari K, Watanabe J.
Panclicins, novel pancreatic lipase inhibitors. I. Taxonomy, fermentation,
isolation and biological activity. J Antibiot 1994; 47: 1369–1375
42 Nonaka Y, Ohtaki H, Ohtsuka E, Kocha T, Fukuda T, Takeuchi T. Effects of
ebelactone B, a lipase inhibitor, on intestinal fat absorption in the rat.
J Enzym Inhib 1996; 10: 57–63
43 Liu D, Wang F, Liao T, Tang J, Steglich W, Zhu H. Vibralactone: a lipase
inhibitor with an unusual fused beta-lactone produced by cultures of
the basidiomycete Boreostereum vibrans. Org Lett 2006; 8: 5749–5752
44 Weber HK, Zuegg J, Faber K, Pleiss J. Molecular reasons for lipase-sensitivity
against acetaldehyde. J Mol Catal B 1997: 131–138
45 Mizutani T, Inatomi S, Inazu A, Kawahara E. Hypolipidemic effect of
Pleurotus eryngii extract in fat-loaded mice. J Nutr Sci Vitaminol 2010;
56: 48–53
46 Lee J, Song J, Lee J. Optimal extraction conditions of anti-obesity lipase
inhibitor from Phellinus linteus and nutritional characteristics of the
extracts. Mycobiology 2010; 38: 58–61
47 Kim J, Kim H, Park H, Youn S, Choi D, Shin C. Development of inhibitors
against lipase and alpha-glucosidase from derivatives of monascus pigment.
FEMS Microbiol Lett 2007; 276: 93–98
48 Jones A, Gu L, Sorrels C, Sherman D, Gerwick W. New tricks from ancient
algae: natural products biosynthesis in marine cyanobacteria. Curr
Opin Chem Biol 2009; 13: 216–223
49 Bitou N, Ninomiya M, Tsujita T, Okuda H. Screening of lipase inhibitors
from marine algae. Lipids 1999; 34: 441–445
50 Ben Rebah F, Smaoui S, Frikha F, Gargouri Y, Miled N. Inhibitory effects of
tunisian marine algal extracts on digestive lipases. Appl Biochem Biotechnol
2008; 151: 71–79
51 Matsumoto M, Hosokawa M, Matsukawa N, Hagio M, Shinoki A, Nishimukai
M. Suppressive effects of the marine carotenoids, fucoxanthin
and fucoxanthinol on triglyceride absorption in lymph duct-cannulated
rats. Eur J Nutr 2010; 49: 243–249
52 Gholamhoseinian A, Shahouzehi B, Sharifi-far F. Inhibitory effect of
some plant extracts on pancreatic lipase. Int J Pharmacol 2010; 6: 18–
24
53 Gargouri Y, Julien R, Pieroni G, Verger R, Sarda L. Studies on the inhibition
of pancreatic and microbial lipases by soybean proteins. J Lipid Res
1984; 25: 1214–1221
54 Lairon D, Lafont H, Vigne JL, Nalbone G, Lonardi J, Hauton JC. Effects of
dietary fibers and cholestyramine on the activity of pancreatic lipase
in vitro. Am J Clin Nutr 1985; 42: 629–638
55 Tsujita T, Matsuura Y, Okuda H. Studies on the inhibition of pancreatic
and carboxylester lipases by protamine. J Lipid Res 1996; 37: 1481–
1487
56 Tsujita T, Sumiyoshi M, Takaku T, Momsen W, Lowe M, Brockman H. Inhibition
of lipases by epsilon-polylysine. J Lipid Res 2003; 44: 2278–
2286

57 Ivanova M, Panaiotov I, Bois A, GArgouri Y, Verger R. Inhibitiion of pancreatic
lipase by ovalbumin and ‑lactoglobulin A at the air-water interface.
J Colloid Interface Sci 1990; 136: 363–374
58 Gargouri Y, Julien R, Sugihara A, Verger R, Sarda L. Inhibition of pancreatic
and microbial lipases by proteins. Biochim Biophys Acta 1984;
795: 326–331
59 Han LK, Kimura Y, Okuda H. Reduction in fat storage during chitin-chitosan
treatment in mice fed a high-fat diet. Int J Obes 1999; 23: 174–
179
60 Tsujita T, Takaichi H, Takaku T, Sawai T, Yoshida N, Hiraki J. Inhibition of
lipase activities by basic polysaccharide. J Lipid Res 2007; 48: 358–365
61 Knuckles B. Effect of phytate and other myo-inositol phosphate esters
on lipase activity. J Food Sci 1988; 53: 250–252
62 Raghavendra MP, Prakash V. Phenylboronic acid–a potent inhibitor of
lipase from Oryza sativa. J Agric Food Chem 2002; 50: 6037–6041
63 Ninomiya K, Matsuda H, Shimoda H, Nishida N, Kasajima N, Yoshino T.
Carnosic acid, a new class of lipid absorption inhibitor from sage. Bioorg
Med Chem Lett 2004; 14: 1943–1946
64 Zhao HL, Sim J, Shim SH, Ha YW, Kang SS, Kim YS. Antiobese and hypolipidemic
effects of platycodin saponins in diet-induced obese rats:
evidences for lipase inhibition and calorie intake restriction. Int J Obes
2005; 29: 983–990
65 Zhao H, Kim Y. Determination of the kinetic properties of platycodin D
for the inhibition of pancreatic lipase using a 1,2-diglyceride-based
colorimetric assay. Arch Pharm Res 2004; 27: 1048–1052
66 Kwon C, Sohn H, Kim S, Kim J, Son K, Lee J. Anti-obesity effect of Dioscorea
nipponica Makino with lipase-inhibitory activity in rodents. Biosci
Biotechnol Biochem 2003; 67: 1451–1456
67 Won S, Kim S, Kim Y, Lee P, Ryu J, Kim J. Licochalcone A: a lipase inhibitor
from the roots of Glycyrrhiza uralensis. Food Res Int 2007; 40: 1046–
1050
68 Ono Y, Hattori E, Fukaya Y, Imai S, Ohizumi Y. Anti-obesity effect of Nelumbo
nucifera leaves extract in mice and rats. J Ethnopharmacol 2006;
106: 238–244
69 Kim H, Kang M. Screening of Korean medicinal plants for lipase inhibitory
activity. PTR. Phytother Res 2005; 19: 359–361
70 Moreno D, Ripoll C, Ilic N, Poulev A, Aubin C, Raskin I. Inhibition of lipid
metabolic enzymes using Mangifera indica extracts. J Food Agric Environ
2006; 4: 21–26
71 Lei F, Zhang XN, Wang W, Xing DM, Xie WD, Su H. Evidence of anti-obesity
effects of the pomegranate leaf extract in high-fat diet induced
obese mice. Int J Obes 2007; 31: 1023–1029
72 Yang H, Kim Y, Bae H, Cho K, Shin J, Kim N, Kim D. Rhei Rhizoma and
Chunghyuldan inhibit pancreatic lipase. Nat Prod Sci 2003; 9: 38–43
73 Zheng C, Duan Y, Gao J, Ruan Z. Screening for anti-lipase properties of
37 traditional Chinese medicinal herbs. J Chin Med Assoc 2010; 73:
319–324
74 Yoshikawa M, Shimoda H, Nishida N, Takada M, Matsuda H. Salacia reticulata
and its polyphenolic constituents with lipase inhibitory and
lipolytic activities have mild antiobesity effects in rats. J Nutr 2002;
132: 1819–1824
75 Terra X, Montagut G, Bustos M, Llopiz N, Ardvol A, Blad C. Grape-seed
procyanidins prevent low-grade inflammation by modulating cytokine
expression in rats fed a high-fat diet. J Nutr Biochem 2009; 20: 210–
218
76 García-Lafuente A, Guillamón E, Villares A, Rostagno M, Martínez J. Flavonoids
as anti-inflammatory agents: implications in cancer and cardiovascular
disease. Inflamm Res 2009; 58: 537–552
77 Kawaguchi K, Mizuno T, Aida K, Uchino K. Hesperidin as an inhibitor of
lipases from porcine pancreas and Pseudomonas. Biosci Biotechnol Biochem
1997; 61: 102–104
78 He F, Pan Q, Shi Y, Duan C. Biosynthesis and genetic regulation of proanthocyanidins
in plants. Molecules 2008; 13: 2674–2692
79 Quesada H, del Bas JM, Pajuelo D, Daz S, Fernandez-Larrea J, Pinent M.
Grape seed proanthocyanidins correct dyslipidemia associated with a
high-fat diet in rats and repress genes controlling lipogenesis and VLDL
assembling in liver. Int J Obes 2009; 33: 1007–1012
80 Lee Y, Cho E, Tanaka T, Yokozawa T. Inhibitory activities of proanthocyanidins
from persimmon against oxidative stress and digestive enzymes
related to diabetes. J Nutr Sci Vitaminol 2007; 53: 287–292
81 de la Iglesia R, Milagro FI, Campion J, Boque N, Martinez JA. Healthy
properties of proanthocyanidins. Biofactors 2010; 36: 159–168
82 Yamamoto M, Shimura S, Itoh Y, Ohsaka T, Egawa M, Inoue S. Anti-obesity
effects of lipase inhibitor CT‑II, an extract from edible herbs, Nomame
Herba, on rats fed a high-fat diet. Int J Obes 2000; 24: 758–764
Reviews
83 Ikeda I, Tsuda K, Suzuki Y, Kobayashi M, Unno T, Tomoyori H. Tea catechins
with a galloyl moiety suppress postprandial hypertriacylglycerolemia
by delaying lymphatic transport of dietary fat in rats. J Nutr
2005; 135: 155–159
84 Moreno D, Ilic N, Poulev A, Raskin I. Effects of Arachis hypogaea nutshell
extract on lipid metabolic enzymes and obesity parameters. Life
Sci 2006; 78: 2797–2803
85 Han LK, Kimura Y, Kawashima M, Takaku T, Taniyama T, Hayashi T.
Anti-obesity effects in rodents of dietary teasaponin, a lipase inhibitor.
Int J Obes 2001; 25: 1459–1464
86 Tanaka T, Matsuo Y, Kouno I. Chemistry of secondary polyphenols
produced during processing of tea and selected foods. Int J Mol Sci
2009; 11: 14–34
87 Koo S, Noh S. Green tea as inhibitor of the intestinal absorption of lipids:
potential mechanism for its lipid-lowering effect. J Nutr Biochem
2007; 18: 179–183
88 Juhel C, Armand M, Pafumi Y, Rosier C, Vandermander J, Lairon D. Green
tea extract (AR25) inhibits lipolysis of triglycerides in gastric and duodenal
medium in vitro. J Nutr Biochem 2000; 11: 45–51
89 Bose M, Lambert J, Ju J, Reuhl K, Shapses S, Yang C. The major green tea
polyphenol, (−)-epigallocatechin-3-gallate, inhibits obesity, metabolic
syndrome, and fatty liver disease in high-fat-fed mice. J Nutr 2008;
138: 1677–1683
90 Nakai M, Fukui Y, Asami S, Toyoda-Ono Y, Iwashita T, Shibata H. Inhibitory
effects of oolong tea polyphenols on pancreatic lipase in vitro.
J Agric Food Chem 2005; 53: 4593–4598
91 Toyoda-Ono Y, Yoshimura M, Nakai M, Fukui Y, Asami S, Shibata H. Suppression
of postprandial hypertriglyceridemia in rats and mice by
oolong tea polymerized polyphenols. Biosci Biotechnol Biochem
2007; 71: 971–976
92 Ikeda I. Multifunctional effects of green tea catechins on prevention of
the metabolic syndrome. Asia Pac J Clin Nutr 2008; 17: 273–274
93 Kobayashi M, Ichitani M, Suzuki Y, Unno T, Sugawara T, Yamahira T.
Black-tea polyphenols suppress postprandial hypertriacylglycerolemia
by suppressing lymphatic transport of dietary fat in rats. J Agric
Food Chem 2009; 57: 7131–7136
94 Kusano R, Andou H, Fujieda M, Tanaka T, Matsuo Y, Kouno I. Polymerlike
polyphenols of black tea and their lipase and amylase inhibitory
activities. Chem Pharm Bull 2008; 56: 266–272
95 Uchiyama S, Taniguchi Y, Saka A, Yoshida A, Yajima H. Prevention of
diet-induced obesity by dietary black tea polyphenols extract in vitro
and in vivo. Nutrition 2011; 27: 287–292
96 Tanaka K, Tamaru S, Nishizono S, Miyata Y, Tamaya K, Matsui T. Hypotriacylglycerolemic
and antiobesity properties of a new fermented tea
product obtained by tea-rolling processing of third-crop green tea
(Camellia sinensis) leaves and Loquat (Eriobotrya japonica) leaves.
Biosci Biotechnol Biochem 2010; 74: 1606–1612
97 Kurihara H, Shibata H, Fukui Y, Kiso Y, Xu J, Yao X. Evaluation of the hypolipemic
property of Camellia sinensisvar. ptilophylla on postprandial
hypertriglyceridemia. J Agric Food Chem 2006; 54: 4977–4981
98 Guo Y, Wu G, Su X, Yang H, Zhang J. Antiobesity action of a daidzein
derivative on male obese mice induced by a high-fat diet. Nutr Res
2009; 29: 656–663
99 Martins F, Noso T, Porto V, Curiel A, Gambero A, Bastos DHM. Maté tea
inhibits in vitro pancreatic lipase activity and has hypolipidemic effect
on high-fat diet-induced obese mice. Obesity 2010; 18: 42–47
100 Sugimoto S, Nakamura S, Yamamoto S, Yamashita C, Oda Y, Matsuda H.
Brazilian natural medicines. III. structures of triterpene oligoglycosides
and lipase inhibitors from mate, leaves of Ilex paraguariensis.
Chem Pharm Bull 2009; 57: 257–261
101 Yoshikawa M, Shimoda H, Nishida N, Takada M, Matsuda H. Salacia reticulata
and its polyphenolic constituents with lipase inhibitory and
lipolytic activities have mild antiobesity effects in rats. J Nutr 2002;
132: 1819–1824
102 Akase T, Shimada T, Harasawa Y, Akase T, Ikeya Y, Nagai E. Preventive
effects of Salacia reticulata on obesity and metabolic disorders in
TSOD mice. Evid Based Complement Alternat Med, advance online
publication 8 June 2009; doi: 10.1093/ecam/nep052
103 Zhang J, Kang M, Kim M, Kim M, Song J, Lee Y. Pancreatic lipase inhibitory
activity of Taraxacum officinale in vitro and in vivo. Nutr Res Pract
2008; 2: 200–203
104 Zhao J, Pang Y, Dixon R. The mysteries of proanthocyanidin transport
and polymerization. Plant Physiol 2010; 153: 1–18
105 McDougall GJ, Kulkarni NN, Stewart D. Berry polyphenols inhibit pancreatic
lipase activity in vitro. J Food Chem 2009; 115: 193–199
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
783

784
Reviews
106 Sparg SG, Light ME, van Staden J. Biological activities and distribution
of plant saponins. J Ethnopharmacol 2004; 94: 219–243
107 Vincken J, Heng L, de Groot A, Gruppen H. Saponins, classification and
occurrence in the plant kingdom. Phytochemistry 2007; 68: 275–297
108 Haralampidis K, Trojanowska M, Osbourn A. Biosynthesis of triterpenoid
saponins in plants. Adv Biochem Eng Biotechnol 2002; 75: 31
109 Karu N, Reifen R, Kerem Z. Weight gain reduction in mice fed Panax
ginseng saponin, a pancreatic lipase inhibitor. J Agric Food Chem
2007; 55: 2824–2828
110 Kimura H, Ogawa S, Jisaka M, Kimura Y, Katsube T, Yokota K. Identification
of novel saponins from edible seeds of Japanese horse chestnut
(Aesculus turbinata Blume) after treatment with wooden ashes and
their nutraceutical activity. J Pharm Biomed Anal 2006; 41: 1657–
1665
111 Hu J, Zhu X, Han L, Saito M, Sun Y, Yoshikawa M. Anti-obesity effects of
escins extracted from the seeds of Aesculus turbinata BLUME (Hippocastanaceae).
Chem Pharm Bull 2008; 56: 12–16
112 Kimura H, Ogawa S, Katsube T, Jisaka M, Yokota K. Antiobese effects of
novel saponins from edible seeds of Japanese horse chestnut (Aesculus
turbinata BLUME) after treatment with wood ashes. J Agric Food
Chem 2008; 56: 4783–4788
113 Song M, Lv N, Kim E, Kwon K, Yoo Y, Kim J. Antiobesity activity of aqueous
extracts of Rhizoma Dioscoreae tokoronis on high-fat diet-induced
obesity in mice. J Med Food 2009; 12: 304–309
114 Li F, Li W, Fu H, Zhang Q, Koike K. Pancreatic lipase-inhibiting triterpenoid
saponins from fruits of Acanthopanax senticosus. Chem Pharm
Bull 2007; 55: 1087–1089
115 Jiang W, Li W, Han L, Liu L, Zhang Q, Zhang S. Biologically active triterpenoid
saponins from Acanthopanax senticosus. J Nat Prod 2006; 69:
1577–1581
116 Yoshizumi K, Hirano K, Ando H, Hirai Y, Ida Y, Tsuji T. Lupane-type saponins
from leaves of Acanthopanax sessiliflorus and their inhibitory
activity on pancreatic lipase. J Agric Food Chem 2006; 54: 335–341
117 Lee I, Lee J, Baek N, Kim D. Antihyperlipidemic effect of crocin isolated
from the fructus of Gardenia jasminoides and its metabolite Crocetin.
Biol Pharm Bull 2005; 28: 2106–2110
118 Sheng L, Qian Z, Zheng S, Xi L. Mechanism of hypolipidemic effect of
crocin in rats: crocin inhibits pancreatic lipase. Eur J Pharmacol
2006; 543: 116–122
119 Zheng Q, Li W, Han L, Koike K. Pancreatic lipase-inhibiting triterpenoid
saponins from Gypsophila oldhamiana. Chem Pharm Bull 2007; 55:
646–650
120 Han L, Zheng Y, Yoshikawa M, Okuda H, Kimura Y. Anti-obesity effects
of chikusetsusaponins isolated from Panax japonicus rhizomes. BMC
Complement Alternat Med 2005; 5: 9
121 Lee Y, Cha B, Yamaguchi K, Choi S, Yonezawa T, Teruya T. Effects of Korean
white ginseng extracts on obesity in high-fat diet-induced obese
mice. Cytotechnology 2010; 62: 367–376
122 Liu W, Zheng Y, Han L, Wang H, Saito M, Ling M. Saponins (Ginsenosides)
from stems and leaves of Panax quinquefolium prevented
high-fat diet-induced obesity in mice. Phytomedicine 2008; 15:
1140–1145
123 Xu B, Han L, Zheng Y, Lee J, Sung C. In vitro inhibitory effect of triterpenoidal
saponins from Platycodi Radix on pancreatic lipase. Arch
Pharm Res 2005; 28: 180–185
124 Zhao H, Kim Y. Determination of the kinetic properties of platycodin D
for the inhibition of pancreatic lipase using a 1,2-diglyceride-based
colorimetric assay. Arch Pharm Res 2004; 27: 968–972
125 Han L, Zheng Y, Xu B, Okuda H, Kimura Y. Saponins from platycodi radix
ameliorate high fat diet-induced obesity in mice. J Nutr 2002; 132:
2241–2245
126 Kim J, Moon K, Seo K, Park K, Choi M, Do G. Supplementation of SK1
from Platycodi radix ameliorates obesity and glucose intolerance in
mice fed a high-fat diet. J Med Food 2009; 12: 629–636
127 Morikawa T, Xie Y, Asao Y, Okamoto M, Yamashita C, Muraoka O. Oleanane-type
triterpene oligoglycosides with pancreatic lipase inhibitory
activity from the pericarps of Sapindus rarak. Phytochemistry
2009; 70: 1166–1172
128 Zheng Q, Koike K, Han L, Okuda H, Nikaido T. New biologically active
triterpenoid saponins from Scabiosa tschiliensis. J Nat Prod 2004; 67:
604–613
129 Guo T, Liu Q, Wang P, Zhang L, Zhang W, Li Y. Facile synthesis of three
bidesmosidic oleanolic acid saponins with strong inhibitory activity
on pancreatic lipase. Carbohydr Res 2009; 344: 1167–1174
de la Garza AL et al. Natural Inhibitors of… Planta Med 2011; 77: 773–785
130 Yoshikawa M, Morikawa T, Yamamoto K, Kato Y, Nagatomo A, Matsuda
H. Floratheasaponins A–C, acylated oleanane-type triterpene oligoglycosides
with anti-hyperlipidemic activities from flowers of the
tea plant (Camellia sinensis). J Nat Prod 2005; 68: 1360–1365
131 Jäger S, Laszczyk M, Scheffler A. A preliminary pharmacokinetic study
of betulin, the main pentacyclic triterpene from extract of outer bark
of birch (Betulae alba cortex). Molecules 2008; 13: 3224–3235
132 Kim S, Park K. Effects of Panax ginseng extract on lipid metabolism in
humans. Pharmacol Res 2003; 48: 511–513
133 Chantre P, Lairon D. Recent findings of green tea extract AR25 (Exolise)
and its activity for the treatment of obesity. Phytomedicine
2002; 9: 3–8
134 Lee Y, Chung H, Kwak H, Yoon S. The effects of A. senticosus supplementation
on serum lipid profiles, biomarkers of oxidative stress, and
lymphocyte DNA damage in postmenopausal women. Biochem Biophys
Res Commun 2008; 375: 44–48
135 Sugiyama H, Akazome Y, Shoji T, Yamaguchi A, Yasue M, Kanda T. Oligomeric
procyanidins in apple polyphenol are main active components
for inhibition of pancreatic lipase and triglyceride absorption. J Agric
Food Chem 2007; 55: 4604–4609
136 Moreno D, Ilic N, Poulev A, Raskin I. Effects of Arachis hypogaea nutshell
extract on lipid metabolic enzymes and obesity parameters. Life
Sci 2006; 78: 2797–2803
137 He R, Chen L, Lin B, Matsui Y, Yao X, Kurihara H. Beneficial effects of
oolong tea consumption on diet-induced overweight and obese subjects.
Chin J Integr Med 2009; 15: 34–41
138 Sharma N, Sharma V, Seo S. Screening of some medicinal plants for
anti-lipase activity. J Ethnopharmacol 2005; 97: 453–456
139 Möller N, Roos N, Schrezenmeir J. Lipase inhibitory activity in alcohol
extracts of worldwide occurring plants and propolis. Phytother Res
2009; 23: 585–586
140 Kobayashi K, Ihara S, Kobata A, Itoh K, Kusunoki N, Yoshizaki F. Inhibitory
effect of Myrica bark on lipase activity in mouse plasma and gastrointestinal
tract. J Med Food 2008; 11: 289–293
141 Kobayashi K, Yamada K, Murata T, Hasegawa T, Takano F, Koga K. Constituents
of Rhodiola rosea showing inhibitory effect on lipase activity
in mouse plasma and alimentary canal. Planta Med 2008; 74: 1716–
1719
142 Birari R, Roy S, Singh A, Bhutani K. Pancreatic lipase inhibitory alkaloids
of Murraya koenigii leaves. Nat Prod Commun 2009; 4: 1089–
1092
143 Ekanem AP, Wang M, Simon JE, Moreno DA. Antiobesity properties of
two African plants (Afromomum meleguetta and Spilanthes acmella)
by pancreatic lipase inhibition. Phytother Res 2007; 21: 1253–1255
144 Shin J, Han M, Song M, Baek N, Kim D. 5-Hydroxy-7-(4′-hydroxy-3′methoxyphenyl)-1-phenyl-3-heptanone:
a pancreatic lipase inhibitor
isolated from Alpinia officinarum. Biol Pharm Bull 2004; 27: 138–
140
145 Shin J, Han M, Kim D. 3-Methylethergalangin isolated from Alpinia officinarum
inhibits pancreatic lipase. Biol Pharm Bull 2003; 26: 854–
857
146 Jang D, Lee G, Kim J, Lee Y, Kim J, Kim Y. A new pancreatic lipase inhibitor
isolated from the roots of Actinidia arguta. Arch Pharm Res 2008;
31: 666–670
147 Han L, Sumiyoshi M, Zhang J, Liu M, Zhang X, Zheng Y. Anti-obesity action
of Salix matsudana leaves (Part 1). Anti-obesity action by polyphenols
of Salix matsudana in high fat-diet treated rodent animals.
Phytother Res 2003; 17: 1188–1194
148 Tucci SA, Boyland EJ, Halford JC. The role of lipid and carbohydrate digestive
enzyme inhibitors in the management of obesity: a review of
current and emerging therapeutic agents. Diabetes Metab Syndr Obes
2010; 3: 125–143
149 Osbourn A. Saponins in cereals. Phytochemistry 2003; 62: 1–4
150 Han L, Nose R, Li W, Gong X, Zheng Y, Yoshikawa M. Reduction of fat
storage in mice fed a high-fat diet long term by treatment with saponins
prepared from Kochia scoparia fruit. Phytother Res 2006; 20:
877–882
151 Oishi Y, Sakamoto T, Udagawa H, Taniguchi H, Kobayashi-Hattori K,
Ozawa Y. Inhibition of increases in blood glucose and serum neutral
fat by Momordica charantia saponin fraction. Biosci Biotechnol Biochem
2007; 71: 735–740
152 Chang X, Li W, Jia Z, Satou T, Fushiya S, Koike K. Biologically active triterpenoid
saponins from Ardisia japonica. J Nat Prod 2007; 70: 179–
187

153 Kimura H, Ogawa S, Katsube T, Jisaka M, Yokota K. Antiobese effects of
novel saponins from edible seeds of Japanese horse chestnut (Aesculus
turbinata BLUME) after treatment with wood ashes. J Agric Food
Chem 2008; 56: 4783–4788
154 Yamamoto M, Shimura S, Itoh Y, Ohsaka T, Egawa M, Inoue S. Anti-obesity
effects of lipase inhibitor CT‑II, an extract from edible herbs, Nomame
Herba, on rats fed a high-fat diet. Int J Obes 2000; 24: 758–764
155 Shimoda H, Seki E, Aitani M. Inhibitory effect of green coffee bean extract
on fat accumulation and body weight gain in mice. BMC Complement
Alternat Med 2006; 6: 9
156 Kurihara H, Asami S, Shibata H, Fukami H, Tanaka T. Hypolipemic effect
of Cyclocarya paliurus (Batal) Iljinskaja in lipid-loaded mice. Biol
Pharm Bull 2003; 26: 383–385
157 Kwon C, Sohn H, Kim S, Kim J, Son K, Lee J. Anti-obesity effect of Dioscorea
nipponica Makino with lipase-inhibitory activity in rodents.
Biosci Biotechnol Biochem 2003; 67: 1451–1456
158 Cha Y, Rhee S, Heo Y. Acanthopanax senticosus extract prepared from
cultured cells decreases adiposity and obesity indices in C57BL/6J
mice fed a high fat diet. J Med Food 2004; 7: 422–429
Reviews
159 Yoshizumi K, Murota K, Watanabe S, Tomi H, Tsuji T, Terao J. Chiisanoside
is not absorbed but inhibits oil absorption in the small intestine
of rodents. Biosci Biotechnol Biochem 2008; 72: 1126–1129
160 Yajima H, Noguchi T, Ikeshima E, Shiraki M, Kanaya T, Tsuboyama-Kasaoka
N. Prevention of diet-induced obesity by dietary isomerized
hop extract containing isohumulones, in rodents. Int J Obes 2005;
29: 991–997
161 Sugiyama H, Akazome Y, Shoji T, Yamaguchi A, Yasue M, Kanda T. Oligomeric
procyanidins in apple polyphenol are main active components
for inhibition of pancreatic lipase and triglyceride absorption. J Agric
Food Chem 2007; 55: 4604–4609
162 Ono Y, Hattori E, Fukaya Y, Imai S, Ohizumi Y. Anti-obesity effect of
Nelumbo nucifera leaves extract in mice and rats. J Ethnopharmacol
2006; 106: 238–244
163 Harach T, Aprikian O, Monnard I, Moulin J, Membrez M, Bolor J. Rosemary
(Rosmarinus officinalis L.) leaf extract limits weight gain and liver
steatosis in mice fed a high-fat diet. Planta Med 2010; 76: 566–571
de la Garza AL et al. Natural Inhibitors of … Planta Med 2011; 77: 773–785
785

786
Original Papers
Mulberroside A Possesses Potent
Uricosuric and Nephroprotective Effects
in Hyperuricemic Mice
Authors Cai-Ping Wang 1 , Yemin Wang 1,2 , Xing Wang 1 , Xian Zhang 1 , Jian-Feng Ye 3 , Lin-Shui Hu 4 , Ling-Dong Kong 1
Affiliations
Key words
l " mulberroside A
l " hyperuricemia
l " uricosuric
l " nephroprotective
l " organic anion transporters
l " organic cation/carnitine
transporters
l " Morus alba L.
l " Moraceae
received July 23, 2010
revised October 13, 2010
accepted Nov. 9, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250599
Published online December 10,
2010
Planta Med 2011; 77: 786–794
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Ling-Dong Kong
School of Life Sciences
Nanjing University
No. 22, Hankou Road
Nanjing 210093
P. R. China
Phone: + 86 2583 5946 91
Fax: +862583594691
kongld@nju.edu.cn
1 State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, P. R. China
2 Division of Human Biology, Fred Hutchinson Cancer Research Center, Seattle, WA, USA
3 Zhejiang Institute of Traditional Chinese Medicine & Natural Drug, Hangzhou, P.R. China
4 Zhejiang Conba Pharmaceutical Co., Ltd., Lanxi, P. R. China
Abstract
!
Mulberroside A is a major stilbene glycoside of
Morus alba L. (Moraceae), which is effectively
used for the treatment of hyperuricemia and gout
in traditional Chinese medicine. We examined
whether mulberroside A had effects on renal urate
underexcretion and dysfunction in oxonateinduced
hyperuricemic mice and investigated the
potential uricosuric and nephroprotective mechanisms
involved. Mulberroside A at 10, 20, and
40 mg/kg decreased serum uric acid levels and increased
urinary urate excretion and fractional excretion
of uric acid in hyperuricemic mice. Simultaneously,
it reduced serum levels of creatinine
and urea nitrogen (10–40 mg/kg), urinary N-acetyl-β-D-glucosaminidase
activity (10–40 mg/kg),
β2-microglobulin (10–40 mg/kg) and albumin
(20–40 mg/kg), and increased creatinine clearance
(10–40 mg/kg) in hyperuricemic mice. Furthermore,
mulberroside A downregulated mRNA
and protein levels of renal glucose transporter 9
(mGLUT9) and urate transporter 1 (mURAT1),
and upregulated mRNA and protein levels of renal
organic anion transporter 1 (mOAT1) and organic
Introduction
!
The prevalence of gout is rapidly increasing
worldwide [1, 2]. Hyperuricemia is the first clinical
manifestation of gout and contributes to the
development of renal dysfunction [2]. In the majority
of patients with primary gout, hyperuricemia
results from the decreased excretion of renal
uric acid [1]. Recent studies have demonstrated a
pivotal role of organic ion transporters of the
SLC2A and SLC22A gene families in renal urate excretion
and function [3–7]. In renal proximal tubules,
glucose transporter 9 (GLUT9, SLC2A9) and
urate transporter 1 (URAT1, SLC22A12) at the
brush border membranes, and organic anion
Wang C-P et al. Mulberroside A Possesses… Planta Med 2011; 77: 786–794
cation and carnitine transporters (mOCT1,
mOCT2, mOCTN1, and mOCTN2) in hyperuricemic
mice. This is the first study demonstrating
that mulberroside A exhibits uricosuric and nephroprotective
effects mediated in part by cooperative
attenuation of the expression alterations of
renal organic ion transporters in hyperuricemic
mice. These data suggest that mulberroside A
may be a new drug candidate for the treatment
of hyperuricemia with renal dysfunction.
Abbreviations
!
GAPDH: glyceraldehyde-3-phosphate
dehydrogenase
HRP: horseradish peroxidase
IgG: immunoglobulin G
Scr: serum creatinine level
Ucr: urinary creatinine level
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/
plantamedica
transporter 1 (OAT1, SLC22A6) at the basolateral
membranes, are potential molecular components
in effective reabsorptive and secretory mechanisms
of renal urate excretion [5–7]. Organic cation
and carnitine transporters (OCTs and OCTNs)
are responsible for renal uptake and excretion of
organic cations [3]. The altered expressions of
the basolateral membrane OCT1 (SLC22A1) and
OCT2 (SLC22A2), and of the brush border membrane
OCTN1 (SLC22A4) and OCTN2 (SLC22A5)
are suggested to be associated with renal dysfunction
[8–11].
Hypouricemic drugs including uricosurics have
some side effects, which restrict their uses in patients,
such as inapplicability of probenecid in pa-

tients with renal calculi and gastrointestinal problems [12].
Therefore, there is an urgent need for novel hypouricemic agents.
Mulberroside A is a major stilbene glycoside isolated from Morus
genus plants including M. alba L. (Moraceae) [13], which is
widely used in many traditional Chinese medicine prescriptions
to treat gout, arthritis, and rheumatism through purging diuresis
and relieving edema. However, it is not clear whether mulberroside
A plays a causal role in the treatment of hyperuricemia.
In the present study, we evaluated the effects of mulberroside A
on serum uric acid levels and renal urate excretion in oxonate-induced
hyperuricemic mice, a model used to investigate therapies
of hypouricemic agents [14, 15]. We also explored the potential
molecular mechanisms of its uricosuric action by determining
mRNA and protein levels of renal mGLUT9, mURAT1, and mOAT1
in hyperuricemic mice treated with mulberroside A. In addition,
the present study was conducted to assess renal function by measuring
serum levels of creatinine (Cr) and urea nitrogen (BUN),
creatinine clearance (Ccr), and urinary biochemical markers of
renal damage, N-acetyl-β-D-glucosaminidase (NAG) activity, β2microglobulin
(β2-MG), and albumin levels. Expression levels of
renal mOCT1, mOCT2, mOCTN1, and mOCTN2 were simultaneously
detected to investigate the possible mechanisms underlying
kidney function improvement in hyperuricemic mice with
mulberroside A treatment.
Materials and Methods
!
Reagents
Mulberroside A was purified from twigs of Morus alba L., which
were purchased from Medicinal Materials Co. of Jiangsu Province,
R.P. China, and authenticated by Prof. J. W. Cheng, Nanjing University
of Traditional Chinese Medicine. A voucher specimen
(NU-20010) of the herb was deposited in the Herbarium of the
Nanjing University, Nanjing. Uric acid (purity > 99%) and potassium
oxonate (purity > 97%) were purchased from Sigma. Probenecid
(purity > 98.5%) was purchased from SanJiang Pharmaceutical
Chemical Co., Ltd. The purified mulberroside A (purity > 97%,
proved by HPLC) was used. Materials for CC were silica gel (45–
75 µm; Qingdao Haiyang Chemical Co., Ltd.) and Sephadex LH-
20 (40–70 µm; Pharmacia). Assay kits of creatinine, albumin,
BUN, and NAG were purchased from Jiancheng Biotech. ELISA assay
kit of β 2-MG was purchased from R & D. All other reagents
were local analytical grade products.
Extraction and isolation
The air-dried twigs (6500 g) were broken into small pieces and
successively extracted three times with 60% ethanol (45 500 mL)
under reflux, and the solvent was removed under reduced pressure
at 50°C to afford ethanol extract (563.8 g). The extract was
dissolved in deionized water (1500 mL) and re-extracted to obtain
a soluble portion by phase separation using petroleum ether
(5 × 800 mL, 65.9 g), ethyl acetate (3 × 600 mL, 99.8 g), and n-butanol
(3 × 500 mL, 71.6 g). The n-butanol soluble portion (71.6 g)
was subjected to separation on silica gel column (112 × 10.8 cm)
and successively eluted with a solvent system of chloroform/
methanol/H 2O (9 : 1:1, 8 : 2:1, 7:3:1, 6:4:1, v/v/v) with a flow
rate of 8 mL/min to yield one hundred and five fractions. The fractions
so obtained were recombined into fifteen portions on the
basis of bioassay guided TLC fractionation. The fraction 13 was
further purified by gel filtration on a Sephadex LH-20 column
(100 × 2.7 cm) eluted with methanol for isolation of mulberroside
Original Papers
Fig. 1 Structure of
mulberroside A isolated
from the twigs of Morus
alba L.
A (6.7 g), which was identified by comparing experimental data
for MS, 1 H-NMR, and 13 C-NMR spectral data with those of the authentic
mulberroside A. The structure of mulberroside A is
shown in l " Fig. 1.
Animals
Male Kun-Ming mice (20 ± 2 g) were purchased from Henan Experimental
Animal Center. They were housed in plastic cages
with free access to food and tap water at room temperature
(22 ± 2°C) with relative humidity of 55 ± 5%, under a normal 12h/12-h
light/dark schedule with the lights on at 7:00 a.m. They
were allowed at least 1 week to adapt to the environment before
the experiment started. All animal procedures and the experimental
protocols were approved by the Institutional Animal Care
Committee at the Nanjing University and the China Council on
Animal Care at the Nanjing University.
Experimental protocols
In the present study, hyperuricemia was induced by the uricase
inhibitor, potassium oxonate, according to a previous report
[16]. Probenecid was used as a positive control. All doses were
expressed as mg/kg body weight of the respective drugs. Food,
but not water, was withdrawn from the animals 1 h prior to the
administration. Sixty-four mice were divided into a normal group
receiving water (normal-vehicle) and 250 mg/kg oxonate-treated
groups receiving water (hyperuricemia-vehicle), 5, 10, 20, and
40 mg/kg mulberroside A, 50 and 100 mg/kg probenecid, respectively.
Oxonate was administered by oral gavage once daily at
8:00 a. m. for 7 consecutive days. Mulberroside A and probenecid
were orally initiated at 9:00 a. m. on the day after oxonate was
given, respectively. The dose volume 10 mL/kg body weight was
kept constant for all treatment groups.
Blood, urine, and tissue sample collection: During the 6th day of
treatment, normal and hyperuicemic mice were housed in metabolic
cages with free access to standard chow and tap water. The
24-h urine was collected, recorded and centrifuged at 2000 × g for
10 min to remove particulate contaminants. Whole blood samples
were collected 1 h after final administration on the 7th day
by tail vein bleeding, and then centrifuged at 10000 × g for 5 min
to obtain the serum. Serum and urine samples were subjected to
biochemical assays on the day of collection. Simultaneously, animals
were killed to collect kidney cortex tissues that were then
stored at −80°C for assays.
Measurement of urine and blood biospecimens: Uric acid levels in
serum (Sur) and urine (Uur) were determined as described previously
[17]. Excretion of urate in 24 h was calculated using the formula:
volume of urine in 24 h × Uur. Creatinine levels in serum
(Scr) and urine (Ucr) were determined spectrophotometrically
using a standard diagnostic kit. Fractional excretion of uric acid
(FEUA) was calculated using the formula: FEUA = (Uur × Scr)/
(Sur × Ucr) × 100, expressed as a percentage. Creatinine clearance
was calculated using the formula: Ccr = (Uur × Volume of urine in
Wang C-P et al. Mulberroside A Possesses … Planta Med 2011; 77: 786–794
787

788
Original Papers
Table 1 Antibodies used for Western blot analyses.
Company Description Catalog
number
SaiChi Biotech Rabbit mGLUT9 antibody 001052-R
Rabbit mURAT1 antibody 001046-R
Rabbit mOAT1 antibody 001019-R
Rabbit mOCT1 antibody 001017-R
Rabbit mOCT2 antibody 001018-R
Alpha Diagnostic International, Inc. Rabbit mOCTN1 antibody OCTN11-A
Rabbit mOCTN2 antibody OCTN21-A
KangChen BIO-TECH Mouse mGAPDH
monoclonal antibody
KC-5G5
Cell Signaling Technology, Inc. Rabbit mNa + -K + -ATPase
antibody
#3010S
Jingmei Biotech Goat anti-rabbit-IgG-HRP SB-200
24 h)/(Scr × 24 × 60). BUN levels were determined using a standard
diagnostic kit. Urine NAG was measured by the enzymatic
colorimetric method. One unit (U) of NAG enzyme activity was
defined as 1 µmol p-nitrophenol hydrolyzed per minute from 1 L
of reaction sample with substrate at 37°C. Urine β2-MG was measured
using an ELISA kit. Urine albumin was measured by the
bromocresol green colorimetry method. Urinary NAG, β2-MG,
and albumin levels were adjusted with creatinine into NAG/creatinine
(U/g cr), β2-MG/creatinine (ng/g cr), and albumin/creatinine
(g/g cr), respectively.
Histological analysis: Mouse kidneys were removed and immediately
fixed in carnoy fixative (ethanol:chloroform : acetic acid =
6: 3: 1) for 1 day at room temperature, and preserved in 70%
ethanol. Renal biopsies were dehydrated with a graded series of
alcohol and embedded in paraffin. Specimens were cut in 7-µmthick
sections on a rotary microtome and mounted on APEScoated
glass slides. Sections were deparaffinized in xylene, rehydrated
in decreasing concentrations of alcohol in water and
stained with hematoxylin-eosin reagent (Sigma Chemicals Co.).
The slides were mounted with neutral balsam.
Western blot analysis: Mouse kidney tissue samples for Western
blot analyses of mGLUT9, mURAT1, mOAT1, mOCT1, mOCT2,
mOCTN1, and mOCTN2 were prepared as described previously
[18]. The antibodies are listed in l " Table 1.
Semiquantitative reverse transcription-polymerase chain reaction
(RT-PCR): Mouse kidney tissue samples for RT-PCR analyses of
mGLUT9, mURAT1, mOCT1, mOCT2, mOCTN1, and mOCTN2
were prepared as described previously [18]. Sequences of primers,
appropriate annealing temperature, and length of products
are summarized in l " Table 2.
Statistical analysis
All data were expressed as mean ± standard error of the mean
(SEM). Statistical analysis was performed using a one-way analysis
of variance (ANOVA) followed by Dunnettʼs multiple comparison
tests to determine the level of significance. A value of p < 0.05
was considered statistically significant. Figures were obtained by
the Statistical Analysis System (GraphPad Prism 4, GraphPad
Software, Inc.).
Supporting information
1 13 H-NMR, C-NMR, MS, and HPLC spectra of mulberroside A are
available as Supporting Information.
Results
!
Serum uric acid levels of oxonate-induced hyperuricemic mice
were significantly decreased in a dose-dependent manner by a
one-week treatment with mulberroside A compared with the hyperuricemia-vehicle
group (l " Fig. 2A). Twenty or 40 mg/kg mulberroside
A lowered the serum uric acid levels of hyperuricemic
mice to a comparable value obtained from normal-vehicle mice.
Treatment of hyperuricemic mice with 100 mg/kg probenecid, a
widely used uricosuric drug, dramatically reduced serum uric acid
levels compared with vehicle-treated hyperuricemic mice. Simultaneously,
urine volume did not differ among all experimental
groups (l " Fig. 2B). Mulberroside A at 10, 20, and 40 mg/kg significantly
increased urinary urate excretion in 24 h (l " Fig. 2 C),
resulting in a remarkable elevation of FEUA (20–40 mg/kg)
(l " Fig. 2D), and the highest dose completely reversed FEUA alteration
of hyperuricemic mice to normal. Probenecid at 50 and
100 mg/kg also showed uricosuric effects in hyperuricemic mice.
To evaluate renal function in hyperuricemic mice treated with
mulberroside A, we detected serum creatinine and BUN levels,
creatinine clearance, urinary NAG activity, β2-MG and albumin
levels. Oxonate induced NAG hyperactivity as well as β2-MG and
albumin level elevation in mice. Mulberroside A significantly decreased
serum creatinine and BUN levels (10–40 mg/kg) (l " Fig. 3A
and B), urinary NAG activity (10–40 mg/kg) (l " Fig. 3 D), β2-MG
(10–40 mg/kg) and albumin (20–40 mg/kg) levels (l " Fig. 3 E and
F), and increased creatinine clearance (10–40 mg/kg) (l " Fig. 3 C)
in hyperuricemic mice compared with the hyperuricemia-vehicle
group. Moreover, 40 mg/kg mulberroside A completely reversed
abnormalities of these renal function indicators in hyperuricemic
mice to normal. Five mg/kg mulberroside A had no effect on these
changes in this model. Probenecid also decreased serum creatinine
and BUN levels (100 mg/kg) (l " Fig. 3 A and B), urinary NAG ac-
Table 2 Summary of gene-specific PCR primer sequences, length of production, and the appropriate annealing temperature used in the experiments.
Description Genebank Sense primer (5′ → 3′) Antisense primer (5′ → 3′) Product Tm Numbers
size (bp) (°C) of thermal
cycle
mGLUT9 NM_001012363 CTCATTGTGGGACGGTTCA GCTACTTCGTCCTCGGTA 316 56 30
mURAT1 NM_009203 GCTACCAGAATCGGCACGCT CACCGGGAAGTCCACAATCC 342 58 30
mOAT1 NM_008766 ACGGGAAACAAGAAGAGGG AAGAGAGGTATGGAGGGGTAG 580 56 29
mOCT1 NM_009202 ACATCCATGTTGCTCTTTCG TTGCTCCATTATCCTTACCG 315 56 29
mOCT2 NM_013667 ACAGGTTTGGGCGGAAGT CACCAGAAATAGAGCAGGAAG 331 56 29
mOCTN1 NM_019687 TGTTCTTCGTAGGCGTTCT TGGAATAAACCACCACAGG 392 53.3 30
mOCTN2 NM_011396 TCTACGAAGCCTCAGTTGC ATTCCTTTGACCCTTAGCAT 623 53.3 30
mGAPDH NM_008084 TGAGGCCGGTGCTGAGTATGT CAGTCTTCTGGGTGGCAGTGAT 299 58 35
Wang C-P et al. Mulberroside A Possesses… Planta Med 2011; 77: 786–794

Fig. 2 Effects of mulberroside A and probenecid on serum uric acid levels
(A), urine volume (B), urinary urate excretion in 24 h (C), and fractional excretion
of uric acid (FEUA) (D) in oxonate-induced hyperuricemia in mice. Experiments
were performed as described in the Materials and Methods sec-
tivity, and β2-MG levels (50–100 mg/kg) (l " Fig. 3D and E), and increased
creatinine clearance (50–100 mg/kg) (l " Fig. 3C) but
failed to affect urinary albumin levels (l " Fig. 3F) in hyperuricemic
mice compared with the hyperuricemia-vehicle group. On
the other hand, vacuolar and granular degeneration could be
seen in renal tubular epithelial cells of hyperuricemic mice, and
tubular lumen was dilated without visible urate crystals
(l " Fig. 4B). Mulberroside A reduced vacuolar and granular degeneration
in the same parts of hyperuricemic mice (l " Fig. 4C–F).
The degeneration almost disappeared after the highest dose treatment
of mulberroside A (l " Fig. 4 F). Probenecid had similar effects
in this model (l " Fig. 4G, H).
To elucidate whether mulberroside A promotes renal urate excretion
in hyperuricemia mediated by regulating expression of renal
mGLUT9, mURAT1, and mOAT1, we examined their protein and
mRNA levels. Mulberroside A at 10, 20, and 40 mg/kg significantly
suppressed the elevated protein and mRNA levels of renal
mGLUT9 and mURAT1 in hyperuricemic mice compared with the
hyperuricemia-vehicle group (l " Fig. 5 A,B and Fig. 6 A, B). It also
remarkably upregulated the expression levels of renal mOAT1
protein (10, 20, and 40 mg/kg) and mRNA (20 and 40 mg/kg)
(l " Fig. 5C and Fig. 6 C) in this model. One hundred mg/kg probenecid
reduced protein and mRNA levels of mURAT1 and upregulated
mOAT1 expression, which was in agreement with other
reports that the uricosuric activity of probenecid was associated
with its regulatory roles on hURAT1 in Xenopus oocyte [5] and
hURAT1 and hOAT1 in human proximal tubule cells [19]. In line
Original Papers
tion. Data are expressed as the mean ± SEM for 8 mice; ### p < 0.001 vs. normal-vehicle
animals; * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. hyperuricemia-vehicle
animals.
with the previous study in Xenopus laevis oocytes [4], probenecid
treatment did not alter mGLUT9 in hyperuricemic mice
(l " Fig. 5A and Fig. 6 A).
Next, we examined the effects of mulberroside A on expression
profiles of renal mOCT1, mOCT2, mOCTN1, and mOCTN2 to elucidate
the potential mechanisms underlying renal function improvement
in hyperuricemic mice. Downregulation of renal
mOCT1, mOCT2, mOCTN1, and mOCTN2 protein levels in hyperuricemic
mice was attenuated significantly by the treatment with
10, 20, and 40 mg/kg mulberroside A compared with the hyperuricemia-vehicle
group (l " Fig. 5D–G). Mulberroside A also remarkably
increased mRNA levels of renal mOCT1 (5–40 mg/kg),
mOCT2 (10–40 mg/kg), mOCTN1 (20–40 mg/kg), and mOCTN2
(20–40 mg/kg) in this model (l " Fig. 6 D–G). Probenecid treatment
elevated protein and mRNA levels of these renal transporters in
almost all cases with the exception of the 50 mg/kg concentration
of probenecid which failed to alter protein and mRNA levels of renal
mOCT1 and mRNA levels of renal mOCTN1 in hyperuricemic
mice.
Discussion
!
The present study showed that mulberroside A, a major stilbene
glycoside of M. alba, significantly reduced serum uric acid levels,
increased urinary urate excretion, resulting in a significant FEUA
elevation in oxonate-induced hyperuricemic mice. Hyperurice-
Wang C-P et al. Mulberroside A Possesses … Planta Med 2011; 77: 786–794
789

790
Original Papers
Fig. 3 Effects of mulberroside A and probenecid on serum creatinine (A)
and urea nitrogen (BUN) (B) levels, creatinine clearance (Ccr) (C), urinary Nacetyl-β-D-glucosaminidase
(NAG) activity (D), β2-microglobulin (β2-MG) (E)
and albumin (F) levels in oxonate-induced hyperuricemia in mice. Data are
mia is an increased risk for the progression of renal disease [20,
21]. The altered urinary enzyme activity and protein levels are
generally regarded as indicators of renal injury [22,23]. The
present study found that hyperuricemic mice developed an elevation
of urinary NAG activity, β 2-MG, and albumin levels, accompanied
with decreased creatinine clearance and increased
serum creatinine and BUN levels, confirming renal function impairment
in hyperuricemic mice. Mulberroside A was found to attenuate
oxonate-induced renal function impairment in mice. In
line with biochemical markers of renal function, mulberroside A
could reduce kidney histological changes induced by oxonate in
Wang C-P et al. Mulberroside A Possesses… Planta Med 2011; 77: 786–794
expressed as the mean ± SEM for 8 mice; ## p < 0.01, ### p < 0.001 vs. normalvehicle
animals; * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. hyperuricemiavehicle
animals.
mice. This is the first study demonstrating that mulberroside A
has uricosuric and nephroprotective effects. These biochemical
data may provide evidence for the clinical application of M. alba
in the treatment of gout and hyperuricemia in traditional Chinese
medicine.
Uric acid level is a key factor for the prevention and treatment of
hyperuricemia and gout. hGLUT9 has been recently found to reduce
urate reabsorption, resulting in serum uric acid reduction
and FEUA elevation [24, 25]. mGLUT9 at the apical and basolateral
membranes of distal convoluted tubules may be related to renal
urate reabsorption [26]. URAT1, as a mediator of urate reabsorp-

tion, plays a pivotal role in uric acid homeostasis [5]. Mutations in
hURAT1 are associated with the pathogenesis of primary hyperuricemia
and gout [27]. Renal mURAT1 is also involved in renal
urate reabsorption [28]. Renal OAT1 is associated with renal urate
secretion [3, 7]. Suppression of renal rOAT1 was observed in
oxonic acid and uric acid-induced hyperuricemic rats [14].
OAT1-knockout mice exhibit reduced secretion of urate in the
kidney [29]. In addition, patients with renal diseases show low
renal OAT1 expression [30]. Reduction of renal rOCT1 and rOCT2
was observed in streptozotocin-induced diabetes of rats with
kidney dysfunction [8]. Down-expression of rOCT2 was also observed
in rats with chronic renal failure [9] and hyperuricemia
[14]. Defective mutations in hOCTN2 may impair reabsorption
and secretion of organic cations [11]. In the present study, we
demonstrated that oxonate-induced hyperuricemic mice developed
upregulation of renal mGLUT9 and mURAT1, and downregulation
of renal mOAT1, mOCT1, mOCT2, mOCTN1, and
mOCTN2. It has been noted that hOCT2 mediates the basolateral
membrane uptake of creatinine into HEK293 cells [31] and human
tubular cell monolayers [32]. Clearance of both creatinine
and urate in mutant hURAT1 carriers is significantly higher than
that in healthy subjects [33]. Thus, the distorted expression and
function of renal organic ion transporters may cause alterations
in serum and urine creatinine levels in oxonate-treated animals,
resulting in hyperuricemia and renal dysfunction.
Mulberroside A may elicit its uricosuric effect by inhibiting urate
reabsorption via renal mGLUT9 and mURAT1 (l " Fig. 5 A,B and
Fig. 6 A,B) and promoting renal urate secretion via mOAT1
(l " Fig. 5C and Fig. 6 C) in hyperuricemic mice. In addition, mulberroside
A also upregulated expression levels of renal mOCT1,
mOCT2, mOCTN1, and mOCTN2 (l " Fig. 5D–G and Fig. 6 D–G).
These results suggest that regulation of these renal organic ion
transporters by mulberroside A may be responsible for its enhancement
of urate excretion, resulting in the reduction of the
serum uric acid level, and the improvement of renal function in
hyperuricemia. The present study was consistent with other reports
that hypouricemic agents attenuate abnormality of renal
organic ion transporters in oxonic acid-induced hyperuricemic
rats [14] and patients with chronic renal disease [34]. Although
it is unknown how mulberroside A regulates expression of these
renal organic ion transporters, recent studies have provided
some insights. In addition, oxyresveratrol-2-O-beta-D-glucopyranoside,
oxyresveratrol-3′-O-beta-D-glucopyranoside, and oxyresveratrol,
three major metabolites of mulberroside A, have recently
been isolated from the small intestinal contents of rats
Original Papers
Fig. 4 Histological studies of the kidney in oxonate-induced
hyperuricemia in mice. The kidney of
normal-vehicle mice (A), hyperuricemia-vehicle
mice treated with water (B), mulberroside A at 5
(C), 10 (D), 20 (E), and 40 (F) mg/kg, probenecid at
50 (G) and 100 (H) mg/kg; (A–H) 200 ×.
[35]. Oxyresveratrol is transported to tissues much faster than
mulberroside A [36]. Whether these metabolites of mulberroside
A confer the uricosuric activity remains unknown. Further investigation
about the precise molecular mechanism of mulberroside
A regulation on these renal organic ion transporters is necessary.
Of note, mGLUT9 shares 85% homology with hGLUT9 [37]. The
amino acid sequence of mURAT1 has a 74% identity with that of
hURAT1 [28]. hOAT1, hOCT1, and hOCT2 also exhibit a high identity
to mOAT1 (82.9%) [38], mOCT1 (77–95%), and mOCT2 (80%)
[39], and mOCTN1 and mOCTN2 are 84 and 85.5% identical to
hOCTN1 [40] and hOCTN2 [41]. If indeed the present findings in
mice can be extrapolated to humans, mulberroside A may be a
potential candidate for the treatment of hyperuricemia and gout.
In addition, deregulation of these renal organic ion transporters
by certain drugs may cause excessive accumulation of endogenous
and exogenous noxious substances in the kidney, which
may further promote renal dysfunction and elicit nephrotoxicity
[19]. In this regard, it should be noted that disorders of these renal
organic ion transporters may elevate the bodyʼs exposure to
drugs, and induce unexpected side effects of drugs during the
treatment of hyperuricemia and renal dysfunction in the clinic.
In conclusion, the present study showed that mulberroside A
treatment enhanced renal urate excretion, resulting in a reduction
of serum uric acid levels in oxonate-induced hyperuricemic
mice. It also improved renal function characterized by decreasing
serum creatinine and BUN levels, and urinary NAG activity, β2-
MG and albumin levels, and increasing creatinine clearance in
this model. The uricosuric and nephroprotective effects of mulberroside
A were elicited in part by its regulation of renal
mGLUT9, mURAT1, mOAT1, mOCT1, mOCT2, mOCTN1, and
mOCTN2 in hyperuricemic mice. Our findings provide a scientific
basis for the use of mulberroside A as a new drug candidate for
the treatment of hyperuricemia with renal dysfunction.
Acknowledgements
!
This work was co-financed by grants from NCET-06-0442, NSFC
(No. 30873413 and 81025025), JSNSF (BK2010365), and 07-C-
016 to Ling-Dong Kong.
Wang C-P et al. Mulberroside A Possesses … Planta Med 2011; 77: 786–794
791

792
Original Papers
Fig. 5 Effects of mulberroside A and probenecid on protein levels of renal
organic ion transporters in oxonate-induced hyperuricemia in mice. Kidney
cortex tissues were used for Western blot analysis of mGLUT9 (A), mOAT1(C),
mOCT1 (D), and mOCT2 (E). The brush boarder membranes of kidney cortex
Wang C-P et al. Mulberroside A Possesses… Planta Med 2011; 77: 786–794
were prepared for Western blot analysis of mURAT1 (B), mOCTN1 (F) and
mOCTN2 (G). Data are expressed as the mean ± SEM for 4 mice; ### p < 0.001
versus normal-vehicle animals; * p < 0.05, ** p < 0.01, and *** p < 0.001 vs.
hyperuricemia-vehicle animals.

Fig. 6 Effects of mulberroside A and probenecid on mRNA levels of renal
ion transporters in oxonate-induced hyperuricemia in mice. Kidney cortex
RNA was extracted for RT-PCR analysis of mGLUT9 (A), mURAT1 (B), mOAT1
(C), mOCT1 (D), mOCT2 (E), mOCTN1 (F), and mOCTN2 (G). Data are ex-
Original Papers
pressed as the mean ± SEM for 4 mice; ## p < 0.01, ### p < 0.001 vs. normalvehicle
animals; * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. hyperuricemiavehicle
animals.
Wang C-P et al. Mulberroside A Possesses … Planta Med 2011; 77: 786–794
793

794
Original Papers
References
1 Choi HK, Mount DB, Reginato AM. Pathogenesis of gout. Ann Intern Med
2005; 143: 499–516
2 Weiner DE, Tighiouart H, Elsayed EF, Griffith JL, Salem DN, Levey AS. Uric
acid and incident kidney disease in the community. J Am Soc Nephrol
2008; 19: 1204–1211
3 Imaoka T, Kusuhara H, Adachi-Akahane S, Hasegawa M, Morita N, Endou
H, Sugiyama Y. The renal-specific transporter mediates facilitative
transport of organic anions at the brush border membrane of mouse
renal tubules. J Am Soc Nephrol 2004; 15: 2012–2022
4 Caulfield MJ, Munroe PB, OʼNeill D, Witkowska K, Charchar FJ, Doblado M,
Evans S, Eyheramendy S, Onipinla A, Howard P, Shaw-Hawkins S, Dobson
RJ, Wallace C, Newhouse SJ, Brown M, Connell JM, Dominiczak A, Farrall M,
Lathrop GM, Samani NJ, Kumari M, Marmot M, Brunner E, Chambers J, Elliott
P, Kooner J, Laan M, Org E, Veldre G, Viigimaa M, Cappuccio FP, Ji C, Iacone
R, Strazzullo P, Moley KH, Cheeseman C. SLC2A9 is a high-capacity
urate transporter in humans. PLoS Med 2008; 5: 1509–1523
5 Enomoto A, Kimura H, Chairoungdua A, Shigeta Y, Jutabha P, Cha SH, Hosoyamada
M, Takeda M, Sekine T, Igarashi T, Matsuo H, Kikuchi Y, Oda T,
Ichida K, Hosoya T, Shimokata K, Niwa T, Kanai Y, Endou H. Molecular
identification of a renal urate-anion exchanger that regulates blood urate
levels. Nature 2002; 417: 447–452
6 Ichida K, Hosoyamada M, Kimura H, Takeda M, Utsunomiya Y, Hosoya T,
Endou H. Urate transport via human PAH transporter hOAT1 and its
gene structure. Kidney Int 2003; 63: 143–155
7 Eraly SA, Vallon V, Rieg T, Gangoiti JA, Wikoff WR, Siuzdak G, Barshop BA,
Nigam SK. Multiple organic anion transporters contribute to net renal
excretion of uric acid. Physiol Genomics 2008; 33: 180–192
8 Grover B, Buckley D, Buckley AR, Cacini W. Reduced expression of organic
cation transporters rOCT1 and rOCT2 in experimental diabetes.
J Pharmacol Exp Ther 2004; 308: 949–956
9 Ji L, Masuda S, Saito H, Inui K. Down-regulation of rat organic cation
transporter rOCT2 by 5/6 nephrectomy. Kidney Int 2002; 62: 514–524
10 Tokuhiro S, Yamada R, Chang XT, Suzuki A, Kochi Y, Sawada T, Suzuki M,
Nagasaki M, Ohtsuki M, Ono M, Furukawa H, Nagashima M, Yoshino S,
Mabuchi A, Sekine A, Saito S, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto
K. An intronic SNP in a RUNX1 binding site of SLC22A4, encoding
an organic cation transporter, is associated with rheumatoid arthritis.
Nat Genet 2003; 35: 341–348
11 Glube N, Closs E, Langguth P. OCTN2-mediated carnitine uptake in a
newly discovered human proximal tubule cell line (Caki-1). Mol Pharm
2007; 4: 160–168
12 Harris MD, Siegel LB, Alloway JA. Gout and hyperuricemia. Am Fam
Physician 1999; 59: 925–934
13 Nunome S, Kondo K, Terabayashi S, Sasaki H, Xiao C, Hao X, Okada M.
Studies on the quality of mulberry bark (2). Botanical source and
chemical components of mulberry cortex. Nat Med 2000; 54: 33–37
14 Habu Y, Yano I, Okuda M, Fukatsu A, Inui K. Restored expression and activity
of organic ion transporters rOAT1, rOAT3 and rOCT2 after hyperuricemia
in the rat kidney. Biochem Pharmacol 2005; 69: 993–999
15 Kang DH, Nakagawa T, Feng LL, Watanabe S, Han L, Mazzali M, Truong L,
Harris R, Johnson RJ. A role for uric acid in the progression of renal disease.
J Am Soc Nephrol 2002; 13: 2888–2897
16 Hall IH, Scoville JP, Reynolds DJ, Simlot R, Duncan P. Substituted cyclic
imides as potential antigout agents. Life Sci 1990; 46: 1923–1927
17 Hu QH, Wang CA, Li JM, Zhang DM, Kong LD. Allopurinol, rutin, and
quercetin attenuate hyperuricemia and renal dysfunction in rats induced
by fructose intake: renal organic ion transporter involvement.
Am J Physiol Renal Physiol 2009; 297: F1080–F1091
18 Hu QH, Jiao RQ, Wang X, Lv YZ, Kong LD. Simiao pill ameliorates urate
underexcretion and renal dysfunction in hyperuricemic mice.
J Ethnopharmacol 2010; 128: 685–692
19 Rizwan AN, Burckhardt G. Organic anion transporters of the SLC22 family:
biopharmaceutical, physiological, and pathological roles. Pharm
Res 2007; 24: 450–470
20 Iseki K, Oshiro S, Tozawa M, Iseki C, Ikemiya Y, Takishita S. Significance of
hyperuricemia on the early detection of renal failure in a cohort of
screened subjects. Hypertens Res 2001; 24: 691–697
21 Chonchol M, Shlipak MG, Katz R, Sarnak MJ, Newman AB, Siscovick DS,
Kestenbaum B, Carney JK, Fried LF. Relationship of uric acid with progression
of kidney disease. Am J Kidney Dis 2007; 50: 239–247
22 Price RG. Urinalysis to exclude and monitor nephrotoxicity. Clin Chim
Acta 2000; 297: 173–182
Wang C-P et al. Mulberroside A Possesses… Planta Med 2011; 77: 786–794
23 Lauwerys R, Bernard A. Preclinical detection of nephrotoxicity – description
of the tests and appraisal of their health significance. Toxicol
Lett 1989; 46: 13–29
24 Matsuo H, Chiba T, Nagamori S, Nakayama A, Domoto H, Phetdee K, Wiriyasermkul
P, Kikuchi Y, Oda T, Nishiyama J, Nakamura T, Morimoto Y,
Kamakura K, Sakurai Y, Nonoyama S, Kanai Y, Shinomiya N. Mutations
in glucose transporter 9 gene SLC2A9 cause renal hypouricemia. Am
J Hum Genet 2008; 83: 744–751
25 Vitart V, Rudan I, Hayward C, Gray NK, Floyd J, Palmer CN, Knott SA, Kolcic
I, Polasek O, Graessler J, Wilson JF, Marinaki A, Riches PL, Shu X, Janicijevic
B, Smolej-Narancic N, Gorgoni B, Morgan J, Campbell S, Biloglav Z,
Barac-Lauc L, Pericic M, Klaric IM, Zgaga L, Skaric-Juric T, Wild SH, Richardson
WA, Hohenstein P, Kimber CH, Tenesa A, Donnelly LA, Fairbanks
LD, Aringer M, McKeigue PM, Ralston SH, Morris AD, Rudan P, Hastie
ND, Campbell H, Wright AF. SLC2A9 is a newly identified urate transporter
influencing serum urate concentration, urate excretion and
gout. Nat Genet 2008; 40: 437–442
26 Preitner F, Bonny O, Laverriere A, Rotman S, Firsov D, Da Costa A, Metref
S, Thorens B. Glut9 is a major regulator of urate homeostasis and its genetic
inactivation induces hyperuricosuria and urate nephropathy.
Proc Natl Acad Sci USA 2009; 106: 15 501–15 506
27 Vazquez-Mellado J, Jimenez-Vaca AL, Cuevas-Covarrubias S, Alvarado-
Romano V, Pozo-Molina G, Burgos-Vargas R. Molecular analysis of the
SLC22A12 (URAT1) gene in patients with primary gout. Rheumatology
2007; 46: 215–219
28 Hosoyamada M, Ichida K, Enomoto A, Hosoya T, Endou H. Function and
localization of urate transporter 1 in mouse kidney. J Am Soc Nephrol
2004; 15: 261–268
29 Nigam SK, Bush KT, Bhatnagar V. Drug and toxicant handling by the OAT
organic anion transporters in the kidney and other tissues. Nat Clin
Pract Nephrol 2007; 3: 443–448
30 Sakurai Y, Motohashi H, Ueo H, Masuda S, Saito H, Okuda M, Mori N,
Matsuura M, Doi T, Fukatsu A, Ogawa O, Inui K. Expression levels of renal
organic anion transporters (OATs) and their correlation with
anionic drug excretion in patients with renal diseases. Pharm Res
2004; 21: 61–67
31 Urakami Y, Kimura N, Okuda M, Inui K. Creatinine transport by basolateral
organic cation transporter hOCT2 in the human kidney. Pharm Res
2004; 21: 976–981
32 Brown CDA, Sayer R, Windass AS, Haslam IS, De Broe ME, DʼHaese PC,
Verhulst A. Characterisation of human tubular cell monolayers as a
model of proximal tubular xenobiotic handling. Toxicol Appl Pharmacol
2008; 233: 428–438
33 Ichida K, Hosoyamada M, Hisatome I, Enomoto A, Hikita M, Endou H, Hosoya
T. Clinical and molecular analysis of patients with renal hypouricemia
in Japan-influence of URAT1 gene on urinary urate excretion.
J Am Soc Nephrol 2004; 15: 164–173
34 Siu YP, Leung KT, Tong MKH, Kwan TH. Use of allopurinol in slowing the
progression of renal disease through its ability to lower serum uric acid
level. Am J Kidney Dis 2006; 47: 51–59
35 Zhaxi MC, Chen LX, Li XG, Komatsu K, Yao XS, Qiu F. Three major metabolites
of mulberroside A in rat intestinal contents and feces. Planta Med
2010; 76: 362–364
36 Qiu F, Komatsu K, Saito K, Kawasaki K, Yao XS, Kano Y. Pharmacological
properties of traditional medicines. XXII. Pharmacokinetic study of
mulberroside A and its metabolites in rat. Biol Pharm Bull 1996; 19:
1463–1467
37 Keembiyehetty C, Augustin R, Carayannopoulos MO, Steer S, Manolescu
A, Cheeseman CI, Moley KH. Mouse glucose transporter 9 splice variants
are expressed in adult liver and kidney and are up-regulated in diabetes.
Mol Endocrinol 2006; 20: 686–697
38 Hosoyamada M, Sekine T, Kanai Y, Endou H. Molecular cloning and functional
expression of a multispecific organic anion transporter from human
kidney. Am J Physiol Renal Physiol 1999; 276: F122–F128
39 Kakehi M, Koyabu N, Nakamura T, Uchiumi T, Kuwano M, Ohtani H, Sawada
Y. Functional characterization of mouse cation transporter
mOCT2 compared with mOCT1. Biochem Biophys Res Commun 2002;
296: 644–650
40 Tamai I, Yabuuchi H, Nezu J, Sai Y, Oku A, Shimane M, Tsuji A. Cloning
and characterization of a novel human pH-dependent organic cation
transporter, OCTN1. FEBS Lett 1997; 419: 107–111
41 Lu KM, Nishimori H, Nakamura Y, Shima K, Kuwajima M. A missense
mutation of mouse OCTN2, a sodium-dependent carnitine cotransporter,
in the juvenile visceral steatosis mouse. Biochem Biophys Res
Commun 1998; 252: 590–594

Telemetry as a Tool to Measure Sedative Effects
of a Valerian Root Extract and Its Single Constituents
in Mice
Authors Nicholas K. Chow 1 , Michael Fretz 2 , Matthias Hamburger 2 , Veronika Butterweck 1
Affiliations
Key words
l " Valeriana officinalis L.
l " Valerianaceae
l " linarin
l " valerenic acid
l " apigenin
l " telemetry
received Sept. 8, 2010
revised Nov. 3, 2010
accepted Nov. 5, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250589
Published online December 10,
2010
Planta Med 2011; 77: 795–803
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Dr. Veronika Butterweck
Department of Pharmaceutics
College of Pharmacy
University of Florida
PO Box 100494
Gainesville FL 32610
USA
Phone: + 13 52273 78 59
Fax: + 1352273 7854
butterwk@cop.ufl.edu
1 Department of Pharmaceutics, College of Pharmacy, University of Florida, Gainesville, FL, USA
2 Institute of Pharmaceutical Biology, Department of Pharmaceutical Sciences, University of Basel, Basel, Switzerland
Abstract
!
Valeriana officinalis L. is a popular herbal treatment
for mild sleep disorders. Clinical and nonclinical
studies found contradictory results for valerian
extracts and single constituents regarding
the influence on sleep parameters. It was the aim
of this study to investigate the sedative effects of a
valerian root extract. Therefore, locomotor activity
and core body temperature were recorded in
male mice using radiotelemetry. A 70% ethanolic
extract prepared from the roots of V. officinalis
(s. l.) and some of its single constituents, valerenic
acid, linarin, and apigenin, were tested for effects
on locomotion and body temperature over 180
minutes after oral administration. The extract
was tested in a dose range of 250–1000 mg/kg,
and only a dose of 1000 mg/kg valerian extract
Introduction
!
An estimated 10 to 15% of the adult population
suffers from chronic insomnia (≥ 1 month) and
an additional 25 to 35% from transient or occasional
insomnia (< 1 month) [1]. These high prevalence
rates connected with pharmacological
treatments cause significant economic and clinical
costs. Traditionally, preparations obtained
from the roots of Valeriana officinalis L. (Valerianaceae)
are used as an herbal remedy because of
their putative sleep promoting effects. In most
countries, valerian preparations are a marketed
over-the-counter product with remarkable success.
One reason for this is that herbal products
and dietary supplements are often considered as
more natural and safer than prescription or other
nonprescription drugs and therefore are very
popular [2].
Not only are extracts from Valeriana officinalis
L. the best known, but also the most studied herbal
treatment for insomnia. Clinical studies of its
Original Papers
showed a mild short-term sedative effect with reduced
locomotor activity between 66–78 min
minutes after administration. Paradoxically, an
increased activity was observed after 150 minutes
after gavage. A dose of 1 mg/kg valerenic acid
produced an intermittent stimulation of activity.
However, a mild short-term sedative effect was
found for linarin at 12 mg/kg and apigenin at
1.5 mg/kg. Considering the cumulative locomotor
activity over the observation period of 180 min, it
is concluded that neither the extract nor one of
the compounds had considerable sedative effects.
More precisely, the observed short-term changes
in activity pattern indicate that valerian extract
as well as the flavonoids linarin and apigenin are
rather effective to reduce sleep latency than to act
as a sleep-maintaining agent.
sleep-inducing and sleep-promoting effects are
contradictory [2–7]. Although sedative and anxiolytic
effects have been observed in nonclinical
studies [8, 9], literature provides insufficient evidence
to imply beneficial effects on sleep.
Several compounds have been isolated and identified
from valerian root preparations, but it is
still unclear which of them are responsible for
the recorded activities. Some of the active compounds
found in commonly used extracts are the
sesquiterpenic acids, especially valerenic acid,
which was recently identified as a GABAA receptor
modulator [8, 10]. Recently, sedative or sleepenhancing
properties were detected for the flavonoids:
linarin (acacetin-7-O-rutinoside) [11],
6-methylapigenin (4′,5,7-trihydroxy-6-methylflavone)
[12,13], and hesperidin (2S(−)-7-rhamnoglucosyl-hesperetin)
[12]. More recently, lignan
derivatives, in particular 4′-O-beta-D-glucosyl-9-O-(6′′-deoxysaccharosyl)olivil
found in V.
officinalis, were shown to bind the adenosine A 1
receptor, which is linked to sleep induction [14].
Chow NK et al. Telemetry as a… Planta Med 2011; 77: 795–803
795

796
Original Papers
In animal studies, sleep parameters are optimally evaluated
under familiar and undisturbed conditions where usual routine
is not interrupted. Therefore, the measurement of sleep-inducing
effects in nonclinical studies is complicated by handling-related
disturbances or unfamiliar measuring instruments. For this reason,
changes in locomotor activity are used as a surrogate parameter
to quantify the effect of valerian root, and experiments are
conducted with methods such as open field [15], rotarod test
[16], and elevated plus maze [8, 9]. But these approaches require
special apparatuses, equipped with a particular measuring system
(e.g., photocells and detectors, infrared beams and sensors,
electromagnetic field, or video cameras). Moreover, long-term
studies in animals are not possible using these methods, and
therefore results are inadequate for the investigation of sleep-inducing
effects (plus handling effects which cause stress). Sleepwake
cycle and body temperature are strongly influenced by
each other [17]. While core temperature in humans is rapidly rising
in the morning and falling in the evening, activity and body
temperature in mice are subject to an inversed circadian rhythm.
It is known that individuals normally fall asleep when core body
temperature is decreasing [18]. Thus, it is indicated to consult
both, activity and core temperature, to evaluate possible effects
on sleep.
The present study represents an innovative, objective approach
to measure sedative effects with minimized handling-related
stress and remote data collection. The animals can be left undisturbed
during the recording period and long-term data acquisition
is possible. Most importantly, effects on locomotion can directly
be quantified. For the first time, radiotelemetry was used
to investigate a 70% ethanolic extract of Valeriana officinalis L. in
mice. Additionally, selected constituents with reported positive
pharmacological activity, namely valerenic acid, linarin, and apigenin
[8, 10, 11,19], were tested. Locomotor activity and body
temperature were recorded and analyzed for possible acute and
medium-term sedative effects.
Material and Methods
!
Extract and single compounds
Valerian extract was manufactured by Finzelberg GmbH & Co.
KG, with 70% ethanol as the solvent and a drug : extract ratio
(DER) of 3–6: 1 (91% native extract, batch #: 08016674). Its content
of sesquiterpenic acids, calculated as valerenic acid, was
0.32% (w/w). Valerenic acid (purity ≥ 98.5%) was purchased from
Phytolab GmbH & Co. Linarin (purity ≥ 98.5%) and apigenin (purity
≥ 99%) were purchased from Indofine Chemical Company,
Inc.
Chemicals and drugs
Midazolam hydrochloride 50 mg/10 mL solution was purchased
from Bedford Laboratories. Zolpidem tablets (5 mg) were purchased
from Henry Schein, Inc. and comminuted by mortar and
pestle for preparation as a suspension for oral administration.
Caffeine (purity ≥ 99%) was purchased from Sigma-Aldrich, Inc.
Drug preparation
All preparations for administration were made on the morning of
the experimental run. Compounds for oral administration were
dissolved, suspended or diluted in a vehicle of deionized water
containing 0.5% propylene glycol (Fisher Scientific, Inc.). Compounds
were administered by feeding needle in a volume of
Chow NK et al. Telemetry as a … Planta Med 2011; 77: 795–803
10 mL/kg in the following concentrations: midazolam 5 mg/kg,
zolpidem 5 mg/kg, caffeine 5 mg/kg, valerian extract 250–
1000 mg/kg, valerenic acid 0.5–5.0 mg/kg, linarin 2.0–12 mg/kg,
and apigenin 1.5–6.0 mg/kg. The concentration of each compound
was chosen based on published literature. Control animals
only received vehicle of the same volume.
Animals
Non-fasted male C57BL/6J mice (supplied by Harlan Sprague
Dawley, Inc.) weighing 22–30 g (between 8–12 weeks old) were
singly caged in a temperature controlled (20 ± 2°C) quiet room
and maintained on a nonreversed 12-h light/dark cycle (lights
on at 6 a. m. and lights off at 6 p.m.). The animals had unlimited
access to food (Harlan Teklad LM-485, standard diet) and water.
From the day of the E-Mitter implantation, all mice were handled
daily before the treatment in order to reduce potential handling
stress. Each mouse was considered available for experimental
runs after a minimum of 7 days post-transmitter implantation.
Animals were randomly assigned to the different treatment
groups (n = 8 per group). Experiments were conducted between
9 a. m. and 1 p. m. All animal experiments were performed according
to the policies and guidelines of the Institutional Animal
Care and Use Committee (IACUC) of the University of Florida,
Gainesville, USA (NIH publication #85-23), study protocol #
200801768 (approved on 09/25/2008).
G2 E-Mitter implantation
The surgical implantation of the G2 E-Mitters was performed
under aseptic conditions according to the University of Florida,
Animal Care Services Guidelines for Telemetry Implants and
Guidelines for Survival Surgery in Mice. Before surgery, meloxicam
(Sigma-Aldrich, Inc.) 1 mg/kg was administered orally for analgesia,
and anesthesia was maintained by 1–3% isoflurane delivered
by nose cone. Twenty-four hours before implantation, the E-Mitters
were sterilized with 2.4% activated glutaraldehyde (Cidex ® ,
Johnson & Johnson, Inc.). The abdomen was opened by making a
2-cm incision along the linea alba. The intestines and colon were
gently reflected to allow insertion of the E-Mitter into the abdominal
cavity along the sagittal plane, placing it in front of the
caudal arteries and veins, but dorsal to the digestive organs. The
positioning is important to acquire accurate temperature data. In
order to prevent migration of the E-Mitter within the peritoneal
cavity, transmitters were anchored to the abdominal cavity wall
by the silastic suture sleeve. The peritoneal incision was closed
using 4/0 caliber monofilament polypropylene nonabsorbable
sutures with reverse cutting needle in a simple interrupted stitch
pattern. The skin incision was closed with a series of 9-mm surgical
staples which were removed 7 days after surgery. Rehydration
at the end of the surgery was assured by subcutaneous administration
of sterile isotonic saline (10 mL/kg body weight). Wound
recovery was checked regularly.
Telemetry system
A data acquisition system, the VitalView ® from Mini Mitter, a
Respironics Company (Series 4000), was used to acquire animal
body temperature and activity data. VitalView ® is a software
and hardware system specially designed for controlling data collection
in laboratory monitoring of physiological parameters
without the need for animal handling and prior habituation to
the test environment or the presence of the experimenter. E-Mitters
capture energy from the field of radio waves emitted by coils
of the ER-4000 Energizer/Receiver, allowing the E-Mitter devices

to be free from battery requirements. The signal returned to the
receiver consists of sequences of pulses whose period is dependent
on temperature. The VitalView ® system records the average
rate and the receiver converts this pulse frequency into a serial
bit stream using calibration values specific to each device. For
the quantification of locomotor activity, movement of the implanted
E-Mitter results in fluctuations in signal strength, which
are detected by the ER-4000 Receiver via telemetry and noted as
activity counts. The total number of these counts during a sampling
period interval is recorded. After a minimum 5-day washout
period following administration of the test substance, each
mouse was administered its matched control vehicle for a comparison
run. At least two corresponding control values were
matched with every test value. On the day of the experiment,
the cages were placed on the receivers at least one hour before
dosing. At 9:29 a. m. EST, dosing was started for the first four mice
and at 9:35 a.m. EST for the second four mice. To assure and control
constant environmental conditions, experiment runs were
always accompanied by control animals.
Original Papers
Fig. 1 Changes in locomotor activity (A,C,E) and
in body temperature (B,D, F) after oral administration
of midazolam (5 mg/kg), zolpidem (5 mg/kg),
caffeine (5 mg/kg), or vehicle. Values are expressed
as mean ± SEM, n = 8 per group. Zero min represents
time of dosing.
Statistical analysis
All statistical procedures were calculated with GraphPad Prism ®
statistical software package, version 5.00 (GraphPad Software,
Inc). Locomotor activity and body temperature data were collected
in 6-minute intervals and are displayed as mean ± SEM.
Comparative cumulative locomotor activity between groups was
analyzed using two-way analysis of variance (ANOVA) followed
by Bonferroniʼs post hoc test. Additionally, temperature and activity
pattern differences between control and each treatment
group were evaluated using the unpaired two-tailed t-test. A
probability level of p < 0.05 was set as statistically significant.
Results
!
l " Fig. 1A shows the depressant effect of midazolam (5 mg/kg,
p.o.) and illustrates the rapid onset of action within the first minutes.
Locomotor activity was significantly lower at 12 minutes
(control: 104.86 ± 16.48, midazolam: 17.36 ± 4.55; p < 0.001,
two-way ANOVA) and 18 minutes (control: 109.45 ± 20.85, midazolam:
24.73 ± 11.33; p < 0.001, two-way ANOVA) after administration.
As shown in l " Fig. 1B, body temperature showed a sig-
Chow NK et al. Telemetry as a… Planta Med 2011; 77: 795–803
797

798
Original Papers
nificant drop of 0.78 °C 12 minutes after dosing (control: 37.19 ±
0.15 °C, midazolam: 36.41 ± 0.18 °C; p < 0.05, two-way ANOVA).
The mean body temperature for the initial 30 minutes was significantly
lower in the midazolam group compared to vehicle (control:
37.13 ± 0.09 °C, midazolam: 36.66 ± 0.12 °C; p < 0.05, unpaired
two-tailed t-test).
Similarly to midazolam, zolpidem (5 mg/kg, p.o.) decreased the
activity in the first 30 minutes (l " Fig. 1C). Mean body temperature
at 12 minutes after administration was significantly lower
in the zolpidem group (35.96 ± 0.13°C) than in the control group
(36.43 ± 0.07 °C; p < 0.01, unpaired two-tailed t-test) (l " Fig. 1 D).
The total activity for 180 minutes after administration of 5 mg/
kg caffeine was increased to 126% compared to the control group
(l " Fig. 1E). More precisely, locomotion was significantly stimulated
only during the initial 30 minutes with a high significance
at 12 minutes (control: 72.40 ± 10.86, caffeine: 176.00 ± 31.76;
p < 0.001), 18 minutes (control: 42.71 ± 10.38, caffeine: 146.43 ±
36.90; p < 0.001) and 24 minutes (control: 30.09 ± 7.23, caffeine:
140.29 ± 32.96; p < 0.001) indicating a rapid onset of action. Body
temperature was not considerably affected (l " Fig. 1F). The cumulative
locomotor activity of midazolam, zolpidem, and caffeine
are shown in l " Table 1.
l " Fig. 2A and C show no major effect on locomotor activity after
oral administration of 250 and 500 mg/kg valerian extract, re-
Chow NK et al. Telemetry as a … Planta Med 2011; 77: 795–803
Treatment Group Cumulative activity
[0–180 min]
Control 1242 ± 73
Caffeine 5 mg/kg 1622 ± 97*
Midazolam 5 mg/kg 829 ± 66**
Zolpidem 5 mg/kg 951 ± 87*
Control 1286 ± 75
Valerian extract 250 mg/kg 1305 ± 112
Valerian extract 500 mg/kg 1398 ± 158
Valerian extract 1000 mg/kg 1367 ± 108
Control 1405 ± 97
Valerenic acid 0.5 mg/kg 1232 ± 175
Valerenic acid 1.0 mg/kg 1221 ± 152
Valerenic acid 2.0 mg/kg 1268 ± 97
Valerenic acid 5.0 mg/kg 1282 ± 171
Control 1303 ± 59
Linarin 2.0 mg/kg 1254 ± 130
Linarin 6.0 mg/kg 1335 ± 134
Linarin 12.0 mg/kg 1197 ± 151
Control 1173 ± 73
Apigenin 1.5 mg/kg 1026 ± 194
Apigenin 3.0 mg/kg 1185 ± 124
Apigenin 6.0 mg/kg 1195 ± 126
Values are expressed as mean ± SEM, two-way analysis of variance
(ANOVA) followed by Bonferroniʼs post hoc test, * p < 0.05;
** p < 0.01
Table 1 Cumulativelocomotor
activity
after oral administration
of
test compounds.
Fig. 2 Changes in locomotor activity (A,C,E)and
in body temperature (B,D, F) after oral administration
of valerian extract (250, 500, and 1000 mg/kg,
respectively) or vehicle. Values are expressed as
mean ± SEM, n = 8 per group. Zero min represents
time of dosing.

spectively, and body temperature remained mostly unaffected in
these concentrations (l " Fig. 2 B, D). In a higher concentration of
1000 mg/kg,valerian extractdid not induceasignificantdifference
in the overall locomotor activity over 180 minutes (l " Table 1), but
altered the pattern of activity with nonsignificant short-term decreases
between 60 and 90 minutes (l " Fig. 2E) and increases in
the extract group between 132 and 150 minutes. Body temperature
remained unchanged during the whole recording period except
with a nonsignificant increase between 132 and 180 minutes
(control: 35.68 ± 0.05 °C, extract: 35.96 ± 0.10 °C) (l " Fig. 2 F).
No major effects were observed for valerenic acid in a low concentration
(0.5 mg/kg) (l " Fig. 3 A, B). One mg/kg of valerenic acid
considerably altered the locomotion pattern (l " Fig. 3C). After a
prominent increase at 78 minutes, a subsequent decrease occurred.
Between 138 and 180 minutes, activity was significantly
lower in the valerenic acid group. Simultaneously, body temperature
was significantly decreased by 0.34°C during the same period
(l " Fig. 3D; control: 35.82 ± 0.09°C, valerenic acid: 35.48 ±
0.10 °C; p < 0.05, unpaired two-tailed t-test). In higher concentra-
Original Papers
Fig. 3 Changes in locomotor activity (A, C,E, G)
and in body temperature (B,D, F, H) after oral administration
of valerenic acid (0.5, 1.0, 2.0, and
5.0 mg/kg, respectively) or vehicle. Values are expressed
as mean ± SEM, n = 8 per group. Zero min
represents time of dosing.
tions (2 mg/kg and 5 mg/kg, respectively), valerenic acid did not
induce any statistically significant changes in locomotion
(l " Fig. 3E, G) or body temperature (l " Fig. 3 F, H). Overall, valerenic
acid had no effects on the cumulative activity from 0–180 min
(l " Table 1).
l " Fig. 4A and 4B illustrate that linarin at a concentration of 2 mg/
kg did not considerably affect locomotion or body temperature.
After oral administration of 6 mg/kg linarin, a significant increase
in locomotor activity during the initial 30 minutes compared to
vehicle was observed. l " Fig. 4C shows the significantly higher activity
values at 12 minutes (control: 72.40 ± 10.86, linarin:
150.20 ± 35.00; p < 0.05), 18 minutes (control: 42.71 ± 10.38, linarin:
152.80 ± 41.04; p < 0.001) and 24 minutes (control: 30.09 ±
7.23, linarin: 110.80 ± 40.42; p < 0.01). Body temperature was not
affected over the whole observation period (l " Fig. 4B). In a dose
of 12 mg/kg, linarin significantly reduced locomotor activity between
60 and 132 minutes (l " Fig. 4 E) whereas no effect on body
temperature was observed (l " Fig. 4 F). Considering the effects on
Chow NK et al. Telemetry as a… Planta Med 2011; 77: 795–803
799

800
Original Papers
the cumulative activity from 0–180 min, linarin had no significant
effect (l " Table 1).
Oral administration of 1.5 mg/kg apigenin induced a significant
reduction in locomotor activity (l " Fig. 5 A). The evaluation indicates
significantly lower activity between 90 and 120 minutes
after gavage. The overall activity during 180 minutes did not significantly
differ between the groups after oral administration of
3 mg/kg apigenin (l " Fig. 5 C). However, locomotion was slightly
lowered between 84 and 114 minutes. Locomotion pattern was
also not considerably altered after administration of 6 mg/kg apigenin
(l " Fig. 5 E). However, the total cumulative activity remained
unaffected (l " Table 1). No considerable effect on body
temperature was observed for all concentrations (l " Fig. 5 B, D,F).
Discussion
!
It is generally acknowledged that the quality of physiological
measurements collected from conscious unstressed animals possesses
the highest validity and best reflects the normal state of
the animal [20–22]. The radiotelemetry system therefore represents
an adequate method and has proven its justification in
modern pharmaceutical research thanks to a minimum of handling-related
or restraint stress to the animal [17, 23,24]. In light
of the above, the present study was interested in possible sedative
effects of a 70% ethanolic valerian extract and some of its sin-
Chow NK et al. Telemetry as a … Planta Med 2011; 77: 795–803
Fig. 4 Changes in locomotor activity (A,C,E)and
in body temperature (B,D, F) after oral administration
of linarin (2.0, 6.0, and 12.0 mg/kg, respectively)
or vehicle. Values are expressed as mean ±
SEM, n = 8 per group. Zero min represents time of
dosing.
gle constituents (valerenic acid, linarin, and apigenin), which are
assumed to be mainly responsible for valerianʼs activity.
The outcomes of the positive (midazolam, zolpidem) and negative
(caffeine) controls are supported by existing literature data
and validate the used method [23, 25–29].
The effects of valerian root on sleep parameters are only sparsely
investigated in animals. Wagner et al. [30] observed a sedative action
of a fresh valerian tincture at 1000 mg/kg p.o. in mice,
whereas an aqueous extract induced a slight decrease in spontaneous
motility at 10 mg/kg p. o. Similar findings are reported by
Leuschner et al. [15] who found pronounced sedative properties
after oral administration of 20 and 200 mg/kg of an aqueous alkaline
extract. While assessing these results, it must be taken into
consideration that statistical specification or significance is absent
in these studies [15, 30]. Additionally, enhancing of barbiturate
sleeping time is demonstrated in several studies [15, 31] and
considered to be evidence for sedation. But its relevance for proving
sedative properties remains unclear since barbiturates have
been shown to interfere with CYP P450 enzymes [32], and therefore
an increased sleeping time due to interactions of valerian
with the barbiturate metabolism in mice cannot be excluded.
Tokunaga et al. [33] reported significant shortening of sleep latency
in rats after oral administration of 1000 mg/kg valerian extract
without affecting total time of wakefulness, non-REM sleep,
and REM sleep. These results are not supported by the present
study, which did not find any significant effect on total cumula-

tive activity over 180 minutes. However, 1000 mg/kg altered the
activity pattern of the mice and induced a nonsignificant intermittent
drop in activity (66–78 min). This short-term depressant
effect is not sufficient to ascribe positive effects on sleep, since a
stimulating activity was observed thereafter. In contrast, 250 mg/
kg and 500 mg/kg did not affect locomotor activity at all. Hattesohl
et al. [9] drew a similar conclusion since they reported no effect
on locomotion for several valerian extract preparations after
acute and subacute (19 days) oral administration.
Temperature data indicate that valerian extract produces a mild
dose-dependent hyperthermic effect in higher doses. This finding
is contradictory to Hendriks et al. [34] who reported a hypothermic
effect for the essential oil of V. officinalis and several constituents,
including valerenic acid. In contrast, Hiller and Zetler
[31] did not observe any influence on body temperature after administration
of 50 and 100 mg/kg ethanolic valerian extract (i. p.),
whereas diazepam produced a significant hypothermic effect. No
marked effects on temperature have been observed in the
present study. In conclusion, considering our results on locomotor
activity and body temperature obtained with telemetry, it
seems unlikely that valerian has any significant sedative actions.
None of the tested concentrations of valerenic acid did significantly
lower the activity over 180 minutes. However, at a concentration
of 1 mg/kg the activity pattern was considerably altered.
A short-lasting increase was observed between 78 and 102 minutes
after administration followed by a reduction in locomotion
Original Papers
Fig. 5 Changes in locomotor activity (A,C,E)and
in body temperature (B,D, F) after oral administration
of apigenin (1.5, 3.0, and 6.0 mg/kg, respectively)
or vehicle. Values are expressed as mean ±
SEM, n = 8 per group. Zero min represents time of
dosing.
between 138 and 180 minutes. These findings are in line with results
from recent studies. Benke et al. [8] reported no indication
for sedative activity for 10 mg/kg p.o. and 30 mg/kg i.p. (elevated
plus-maze). A similar conclusion was drawn by Fernandez et al.
[11]. They observed no in vivo effects in mice at low doses up to
15 mg/kg i.p. (sodium thiopental-induced sleeping time and
holeboard test). In contrast, Hendriks et al. [34] found valerenic
acid to decrease motility of mice at a concentration of 50 mg/kg
i. p. and higher. The same authors reported in a later study a decrease
in rotarod performance in mice (100 mg/kg i. p.) and a
dose-related increase in pentobarbital-induced sleeping time
(50 and 100 mg/kg i. p.) [16]. Furthermore, a significant decrease
of rectal temperature in mice at concentrations of 100, 200, and
400 mg/kg was observed. Paradoxically, after administration of
50 mg/kg, a mild increase in body temperature occurred [16].
Overall, the authors concluded that this compound has central
depressant properties. However, considering the extremely high
and unphysiological doses, the relevance of these results has to
be questioned.
In the present study, linarin induced only at a higher concentration
(12 mg/kg) a significant reduction of locomotor activity between
60 and 132 minutes; however, when considering the cumulative
activity, no significant changes were detected. Therefore,
the findings of Fernandez et al. [11], could partly be confirmed.
The authors observed depressant effects at doses of 4
and 7 mg/kg i. p. in the holeboard test. Furthermore, 7 and
Chow NK et al. Telemetry as a… Planta Med 2011; 77: 795–803
801

802
Original Papers
14 mg/kg i. p. significantly prolonged the thiopental-induced
sleeping time in mice. Hence it was concluded that linarin possesses
sedative and sleep-enhancing activity. In contrast to the
findings of Fernandez et al. [11] we found an initial stimulating
effect after oral administration of 6 mg/kg linarin.
While in the present study all substances were administered orally,
Fernandez et al. [11] used intraperitoneal injection. It is
likely that the different routes of administration caused different
effects on locomotor activity. Consequentially, results obtained
using different routes of administration should not be compared
directly.
In the present study, apigenin showed mild sedative effects at
low concentrations. Locomotor activity was significantly reduced
between 90 and 120 minutes (1.5 mg/kg) after gavage. The observed
effect was indeed short-lasting since after 120 minutes activity
began to rise to control levels. In higher doses, apigenin did
not significantly reduce activity or body temperature. Viola et al.
[35] suggested apigenin to act as a benzodiazepine partial agonist
and to possess anxiolytic activity at low doses (3 mg/kg). In the
same study, sedative effects were only observed after i. p. administration
of high doses (30 and 100 mg/kg) in mice (holeboard
and locomotor activity test), but not for doses up to 10 mg/kg
i. p. Similarly, Avallone et al. [36] reported potent sedative properties
for high doses (25 and 50 mg/kg i. p.) in rats as well. However,
in most of the previously reported studies apigenin was tested for
anxiolytic properties and not particularly for sedation. Therefore,
the presented results reveal for the first time the potential beneficial
effect of apigenin on sleep.
In summary, the present findings indicate that the radiotelemetry
system is suitable for the investigation of sleep-modifying effects.
Considering all aspects, it is concluded that neither the extract
nor one of the compounds had significant sedative activities
over 180 min. However, positive short-term sedative effects were
found for valerian extract 1000 mg/kg, linarin 12 mg/kg, and apigenin
1.5 mg/kg whereas valerenic acid (0.5, 1, 2, and 5 mg/kg)
had no significant effect on locomotor activity or body temperature.
The fact that mild sedative effects of the extract and the single
compounds lasted only for a very short period suggests an interesting
pharmacokinetic profile probably pointing to a short halflife
of all compounds. Since pharmacokinetic data about valerian
compounds are only sparsely available, this assumption presently
is speculative. However, pharmacokinetic data are an important
issue to link data with pharmacological assays. Our findings, obtained
with telemetric recordings of locomotor activity and body
temperature, do not support the use of valerian root for the treatment
of sleep disorders in general. However, the observed shortterm
effects presented for the flavonoids linarin and apigenin indicate
that these compounds could be effective to reduce sleep latency
rather than to act as sleep-maintaining agents. Future studies
therefore should focus on the investigation of other flavonoids
from valerian as sleep-inducing agents.
References
1 Benca RM. Diagnosis and treatment of chronic insomnia: a review. Psychiatr
Serv 2005; 56: 332–343
2 Bent S, Padula A, Moore D, Patterson M, Mehling W. Valerian for sleep: a
systematic review and meta-analysis. Am J Med 2006; 119: 1005–1012
3 Balderer G, Borbely AA. Effect of valerian on human sleep. Psychopharmacology
(Berl) 1985; 87: 406–409
4 Brattstroem A. Scientific evidence for a fixed extract combination (ZE
91019) from valerian and hops traditionally used as a sleep-inducing
aid. Wien Med Wochenschr 2007; 157: 367–370
Chow NK et al. Telemetry as a … Planta Med 2011; 77: 795–803
5 Diaper A, Hindmarch I. A double-blind, placebo-controlled investigation
of the effects of two doses of a valerian preparation on the sleep,
cognitive and psychomotor function of sleep-disturbed older adults.
Phytother Res 2004; 18: 831–836
6 Leathwood PD, Chauffard F. Aqueous extract of valerian reduces latency
to fall asleep in man. Planta Med 1985; 4: 144–148
7 Taibi DM, Vitiello MV, Barsness S, Elmer GW, Anderson GD, Landis CA. A
randomized clinical trial of valerian fails to improve self-reported,
polysomnographic, and actigraphic sleep in older women with insomnia.
Sleep Med 2009; 10: 319–328
8 Benke D, Barberis A, Kopp S, Altmann KH, Schubiger M, Vogt KE, Rudolph
U, Möhler H. GABA A receptors as in vivo substrate for the anxiolytic
action of valerenic acid, a major constituent of valerian root extracts.
Neuropharmacology 2009; 56: 174–181
9 Hattesohl M, Feistel B, Sievers H, Lehnfeld R, Hegger M, Winterhoff H. Extracts
of Valeriana officinalis L. s.l. show anxiolytic and antidepressant
effects but neither sedative nor myorelaxant properties. Phytomedicine
2008; 15: 2–15
10 Trauner G, Khom S, Baburin I, Benedek B, Hering S, Kopp B. Modulation of
GABAA receptors by valerian extracts is related to the content of valerenic
acid. Planta Med 2008; 74: 19–24
11 Fernandez S, Wasowski C, Paladini AC, Marder M. Sedative and sleepenhancing
properties of linarin, a flavonoid-isolated from Valeriana officinalis.
Pharmacol Biochem Behav 2004; 77: 399–404
12 Marder M, Viola H, Wasowski C, Fernandez S, Medina JH, Paladini AC. 6methylapigenin
and hesperidin: new valeriana flavonoids with activity
on the CNS. Pharmacol Biochem Behav 2003; 75: 537–545
13 Wasowski C, Marder M, Viola H, Medina JH, Paladini AC. Isolation and
identification of 6-methylapigenin, a competitive ligand for the brain
GABA(A) receptors, from Valeriana wallichii. Planta Med 2002; 68:
934–936
14 Schumacher B, Scholle S, Holzl J, Khudeir N, Hess S, Muller CE. Lignans
isolated from valerian: identification and characterization of a new olivil
derivative with partial agonistic activity at A(1) adenosine receptors.
J Nat Prod 2002; 65: 1479–1485
15 Leuschner J, Muller J, Rudmann M. Characterisation of the central nervous
depressant activity of a commercially available valerian root extract.
Arzneimittelforschung 1993; 43: 638–641
16 Hendriks H, Bos R, Woerdenbag HJ, Koster AS. Central nervous depressant
activity of valerenic acid in the mouse. Planta Med 1985; 51: 28–
31
17 Mailliet F, Galloux P, Poisson D. Comparative effects of melatonin, zolpidem
and diazepam on sleep, body temperature, blood pressure and
heart rate measured by radiotelemetry in wistar rats. Psychopharmacology
(Berl) 2001; 156: 417–426
18 Weinert D, Waterhouse J. The circadian rhythm of core temperature: effects
of physical activity and aging. Physiol Behav 2007; 90: 246–256
19 Campbell EL, Chebib M, Johnston GA. The dietary flavonoids apigenin
and (−)-epigallocatechin gallate enhance the positive modulation by
diazepam of the activation by GABA of recombinant GABA(A) receptors.
Biochem Pharmacol 2004; 68: 1631–1638
20 Berkey DL, Meeuwsen KW, Barney CC. Measurements of core temperature
in spontaneously hypertensive rats by radiotelemetry. Am
J Physiol 1990; 258: R743–R749
21 Harkin A, Connor TJ, OʼDonnell JM, Kelly JP. Physiological and behavioral
responses to stress: what does a rat find stressful? Lab Anim (NY)
2002; 31: 42–50
22 Taylor SC, Little HJ, Nutt DJ, Sellars N. A benzodiazepine agonist and contragonist
have hypothermic effects in rodents. Neuropharmacology
1985; 24: 69–73
23 Elliot EE, White JM. The acute effects of zolpidem compared to diazepam
and lorazepam using radiotelemetry. Neuropharmacology 2001;
40: 717–721
24 Matthew CB. Telemetry augments the validity of the rat as a model for
heat acclimation. Ann NY Acad Sci 1997; 813: 233–238
25 Davies MF, Onaivi ES, Chen SW, Maguire PA, Tsai NF, Loew GH. Evidence
for central benzodiazepine receptor heterogeneity from behavior tests.
Pharmacol Biochem Behav 1994; 49: 47–56
26 Durcan MJ, Morgan PF. Hypothermic effects of alkylxanthines: evidence
for a calcium-independent phosphodiesterase action. Eur J Pharmacol
1991; 204: 15–20
27 Pieri L. Preclinical pharmacology of midazolam. Br J Clin Pharmacol
1983; 16 (Suppl. 1): 17S–27S

28 Schlosberg AJ. Temperature responses in rats after acute and chronic
administrations of caffeine. Pharmacol Biochem Behav 1983; 18: 935–
942
29 Yang JN, Tiselius C, Dare E, Johansson B, Valen G, Fredholm BB. Sex differences
in mouse heart rate and body temperature and in their regulation
by adenosine A(1) receptors. Acta Physiol (Oxf) 2007; 190: 63–75
30 Wagner H, Jurcic K, Schaette R. Comparative studies on the sedative action
of Valeriana extracts, valepotriates and their degradation product.
Planta Med 1980; 39: 358–365
31 Hiller KO, Zetler G. Neuropharmacological studies on ethanol extracts
of Valeriana officinalis l: behavioural and anticonvulsant properties.
Phytother Res 1996; 10: 145–151
32 Kakinohana M, Taira Y, Kakinohana O, Okuda Y. The inhibition of lidocaine
metabolism by various barbiturates in rat hepatic microsome.
Masui 1998; 47: 1302–1310
Original Papers
33 Tokunaga S, Takeda Y, Niimoto T, Nishida N, Kubo T, Ohno T, Matsuura Y,
Kawahara Y, Shinomiya K, Kamei C. Effect of valerian extract preparation
on the sleep-wake cycle in rats. Biol Pharm Bull 2007; 30: 363–366
34 Hendriks H, Bos R, Allersma DP, Malingre TM, Koster AS. Pharmacological
screening of valerenal and some other components of essential oil of
Valeriana officinalis. Planta Med 1981; 42: 62–68
35 Viola H, Wasowski C, Levi de Stein M, Wolfman C, Silveira R, Dajas F,
Medina JH, Paladini AC. Apigenin, a component of Matricaria recutita
flowers, is a central benzodiazepine receptors-ligand with anxiolytic
effects. Planta Med 1995; 61: 213–216
36 Avallone R, Zanoli P, Puia G, Kleinschnitz M, Schreier P, Baraldi M. Pharmacological
profile of apigenin, a flavonoid isolated from Matricaria
chamomilla. Biochem Pharmacol 2000; 59: 1387–1394
Chow NK et al. Telemetry as a… Planta Med 2011; 77: 795–803
803

804
Original Papers
Antihyperglycemic Activity of Bacosine,
a Triterpene from Bacopa monnieri,
in Alloxan-Induced Diabetic Rats
Authors Tirtha Ghosh 1 , Tapan Kumar Maity 2 , Jagadish Singh 2
Affiliations
Key words
l " Bacopa monnieri
l " Scrophulariaceae
l " bacosine
l " alloxan
l " antidiabetic activity
l " antioxidant activity
received August 15, 2010
revised October 12, 2010
accepted Nov. 11, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250600
Published online December 10,
2010
Planta Med 2011; 77: 804–808
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Tirtha Ghosh
Department of Pharmacy,
Contai Polytechnic
P. O.-Darua,
Dist-Purba Medinipur
721401 West Bengal
India
Phone: + 91 9475 2017 91
Fax: +913220255462
tghosh75@yahoo.co.in
1 Department of Pharmacy, Contai Polytechnic, West Bengal, India
2 Department of Pharmaceutical Technology, Jadavpur University, Kolkata, India
Abstract
!
This article describes the antihyperglycemic activity,
in vivo antioxidant potential, effect on hemoglobin
glycosylation, estimation of liver glycogen
content, and in vitro peripheral glucose utilization
of bacosine, a triterpene isolated from
the ethyl acetate fraction (EAF) of the ethanolic
extract of Bacopa monnieri. Bacosine produced a
significant decrease in the blood glucose level
when compared with the diabetic control rats
both in the single administration as well as in the
multiple administration study. It was observed
that the compound reversed the weight loss of
the diabetic rats, returning the values to near normal.
Bacosine also prevented elevation of glycosylated
hemoglobin in vitro with an IC50 value of
7.44 µg/mL, comparable with the one for the
reference drug α-tocopherol. Administration of
Introduction
!
Diabetes mellitus, a metabolic disorder of carbohydrate,
fat, and protein metabolisms, is affecting
nearly 10% of the population every year [1]. Its
treatment includes the use of oral hypoglycemic
agents and insulin, the former being reported to
have serious side effects [2]. This leads to increasing
demand for herbal products with an antidiabetic
factor and little side effects. A large number
of plants have been recognized to be effective in
the treatment of diabetes mellitus [3].
Bacopa monnieri Linn. (Scrophulariaceae) is a
creeping, glabrous, succulent herb, rooting at
nodes, distributed throughout India in all plain
districts [4]. The plant is reported to contain tetracyclic
triterpenoid saponins, bacosides A and B,
hersaponin, alkaloids viz. herpestine and brahmine,
and flavonoids [5]. In Ayurveda, the plant
has been used in the treatment of insanity, epilepsy,
and hysteria [6]. The other reported activ-
Ghosh T et al. Antihyperglycemic Activity of… Planta Med 2011; 77: 804–808
bacosine and glibenclamide significantly decreased
the levels of malondialdehyde (MDA),
and increased the levels of reduced glutathione
(GSH) and the activities of superoxide dismutase
(SOD) and catalase (CAT) in the liver of diabetic
rats. Bacosine increased glycogen content in the
liver of diabetic rats and peripheral glucose utilization
in the diaphragm of diabetic rats in vitro,
which is comparable with the action of insulin.
Thus, bacosine might have insulin-like activity
and its antihyperglycemic effect might be due to
an increase in peripheral glucose consumption as
well as protection against oxidative damage in alloxanized
diabetes.
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/
plantamedica
ities include sedative, antiepileptic, vasoconstrictor,
and anti-inflammatory properties [4]. Antidiabetic
activity of the ethanolic extract of the
plant has already been reported by the authors
[7]. Hence, further exploitation of the ethanolic
extract was done to find out the active principle
responsible for the antidiabetic activity. We report
herein the fractionation of the ethanol soluble
extract of Bacopa monnieri, which has led to
the isolation of a triterpenoid, bacosine. As triterpenoids
have been shown to possess antidiabetic
property [8], it was thought worthwhile to investigate
the antidiabetic activity of bacosine in a scientific
manner.
In the present paper we report the antihyperglycemic
activity, in vivo antioxidant potential, effect
on hemoglobin glycosylation, liver glycogen content,
and in vitro peripheral glucose utilization of
bacosine, isolated from Bacopa monnieri.

Materials and Methods
!
Plant material
The plant was identified by the taxonomists of the Botanical Survey
of India, Govt. of India, Howrah, bearing reference no. CNH/1-
1(99)/2005/Tech.II/1615 dated 07.12.2005. A voucher specimen
is kept in our department (CP/PH/TG/02/09) for further reference.
Fresh aerial parts of the young and matured plants were collected
in bulk from the rural belt of Salipur, Orissa, India during early
summer, washed, shade dried and then milled in to coarse powder
by a mechanical grinder.
Extraction and isolation
The powdered plant material (2 kg) was defatted with petroleum
ether (60–80°C) and then extracted with 3 L of ethanol (95%) in a
soxhlet apparatus. The solvent was removed under reduced pressure,
which resulted in a greenish-black sticky residue (232 g).
The residue was partitioned successively in an ethyl acetatewater
system and then in an n-butanol-water system (3 × 1 L).
The respective solvents were removed similarly under reduced
pressure, which produced an ethyl acetate fraction (EAF) (112 g)
and an n-butanol fraction (57.4 g). The EAF fraction (40 g × 2
times) was subjected to column chromatography over silica gel
(60–120 mesh, 5 × 60 cm, flow rate 5 mL/min) using CHCl3-MeOH
(gradient) as an eluent [CHCl3-MeOH = 100 : 0 (500 mL) and 95:5
(1 L)]. The fractions 3–6 (500–1500 mL, 4 g) collected at
CHCl3:MeOH 95: 5 were further subjected to preparative thin
layer chromatography (PTLC) using silica gel G as the stationary
phase (thickness of plates 0.5 mm) and C6H6 : MeOH = 8.5 : 1.5 as
the mobile phase. Three spots were obtained. They were
scrapped off. The spot at Rf value 0.30 yielded a product which
was then recrystallized with CHCl3 and MeOH to afford a compound
(120 mg) as shining white crystalline needles, which was
characterized as bacosine (BS; % purity = 95%) (l " Fig. 1) onthe
basis of spectroscopic (IR, 1 H, 13 C NMR, and MS) data [9].
Animals used
Wistar albino rats of either sex, weighing 180–250 g were used.
The selected animals were housed in acrylic cages in standard environmental
conditions (25–30°C). They were allowed free access
to standard dry pellet diet (Hindustan Lever) and water ad
libitum. The recommendations of the Institutional Animal Ethics
Committee (Regn. No. 0367/01/C/CPCSEA) for the care and use of
laboratory animals were strictly followed throughout the study.
Drugs and chemicals used
Thiobarbituric acid, nitro blue tetrazolium chloride (NBT), hemoglobin
(Loba Chemie), and 5,5′-dithio bis-2-nitrobenzoic acid
(DTNB) were used. Glibenclamide (% purity ≥ 99%) and α-tocopherol
(% purity ≥ 96%) were purchased from Sigma-Aldrich Co.
All the solvents were of analytical grade.
Screening for antidiabetic activity [10]
The animals were considered diabetic when the blood glucose
level was raised beyond 300 mg/dL of blood after 72 h of i.p. injection
of 150 mg/kg of alloxan monohydrate in normal saline.
Bacosine was then evaluated for its antidiabetic activity.
Single administration study: Animals were segregated into seven
groups of six rats in each. Group I, II, and III rats were randomly
selected from normal rats which received only distilled water
and bacosine, 10 and 25 mg/kg, p.o. respectively. Group IV to
Group VII animals were selected from the alloxanized rats. Group
Original Papers
Fig. 1 Structure of
bacosine.
IV animals served as diabetic controls. Groups V, VI, and VII animals
were treated with bacosine, 10 and 25 mg/kg, p. o. [11] and
glibenclamide, 600 µg/kg, respectively, in a similar manner. Blood
was collected from the tip of the tail of each rat under mild ether
anesthesia at 0 h, 1 h, 2 h, and 4 h after the administration of test
samples. Estimation of blood glucose was carried out with the
hemoglucostrips (Lifescan, Inc.) with the help of a Johnson &
Johnson One Touch blood glucometer. The hemoglucostrips were
inserted into the glucometer (code matched with that of the
hemoglucostrip vial), and a drop of blood was touched with the
edge of the test strips. The strips automatically draw the blood
and give a reading within 5 sec.
Multi-administration study: Administration of test samples was
continued for 10 days, once daily. Blood samples were collected
and estimated as above on the 1, 3, 7, and 10th day of the drug
administration. Body weights of all the animals were recorded
just prior to and on the 10th day of the study to determine the
change in the body weight if any.
Effect on oral glucose tolerance in rats: Animals were segregated
into different groups as stated in the single administration study.
After overnight fasting, a 0-min blood glucose level was estimated
in different groups and without delay a glucose solution
(2 g/kg) was administered. Four more blood samples were taken
at 30, 60, 90, and 120 min after glucose administration [7] and estimated
for blood glucose level.
Determination of in vivo antioxidant activity: On the 10th day following
study, the animals were deprived of food overnight and
sacrificed by cervical dislocation. The livers were dissected out,
washed in ice-cold saline, patted dry and weighed. A 10% w/v of
homogenate was prepared in 0.15 M Tris-HCl buffer and processed
for the estimation of lipid peroxidation [12], GSH [13],
SOD [14], and CAT [15].
Determination of in vitro glycosylation of hemoglobin: The degree
of glycosylation of hemoglobin in vitro was measured colorimetrically
as suggested by Fluckiger et al., 1978 [16]. Hemoglobin,
5 mg/mL in 0.01 M phosphate buffer (pH 7.4) was incubated for
72 h in the presence of 2 g/100 mL concentration of glucose in order
to find out the best condition for hemoglobin glycosylation.
The assay was performed by adding 1 mL of glucose solution,
1 mL of hemoglobin solution, and 1 mL of gentamycin (20 mg/
100 mL) in 0.01 M phosphate buffer (pH 7.4). The mixture was incubated
in the dark at room temperature. The degree of glycosylation
of hemoglobin in presence of different concentration of bacosine
and its absence was measured colorimetrically at 440 nm.
α-Tocopherol was used as a standard.
Determination of peripheral consumption of glucose in vitro: The
method of Chattopadhyay et al., 1992 [17] was followed. Peripheral
glucose consumption was studied in the rat diaphragm prep-
Ghosh T et al. Antihyperglycemic Activity of … Planta Med 2011; 77: 804–808
805

806
Original Papers
aration from animals fasted for 36 h prior to the experiment. The
animals were sacrificed by cervical dislocation, and the diaphragms
were quickly taken out; followed by dividing each diaphragm
into four pieces. The pieces of diaphragms were incubated
in the nutrient solution with constant oxygenation and
shaking (90 cycles/min) at 37°C for 90 min in accordance with
the procedure. The nutrient solution with the diaphragms was
aerated for 10 min and used immediately. Glucose was added to
a final concentration of 500 mg %. Each piece of diaphragm was
incubated in 2.5 mL of glucose nutrient mixture. The results were
expressed as glucose consumption per 10 mg of dry diaphragm
(by subtracting glucose concentration after incubation from glucose
concentration before incubation). The dry weight was determined
after oven-drying the diaphragm at 105 °C for 2 hours.
Determination of glycogen content of liver: Glycogen estimation of
the liver was carried out by the use of anthrone reagent [18].
2 mL of the liver extract was added to 2 mL of 10 N KOH solution
and boiled for 1 h. After cooling, 1 mL of glacial acetic acid was
added, and the fluid was made up to 20 mL with water. 2 mL of
this solution was added to 4 mL of anthrone reagent (0.5 g of
anthrone was dissolved in 250 mL of 95% (w/v) H2SO4, shaken
and boiled for 10 min for color development. The optical density
was read within 2 h at 650 nm against a blank solution.
Statistical analysis
Statistical significance was determined by one-way analysis of
variance (ANOVA) followed by Dunnetʼs t-test. P < 0.05 indicates
a significant difference between group means.
Supporting information
Original spectra for bacosine are available as Supporting Information.
Results and Discussion
!
The ethyl acetate fraction on further purification led to the isolation
of a triterpene. The compound melted at 284–285 °C, which
is characteristic of bacosine. The physical and spectral data were
in complete agreement to those reported in literature for bacosine
[9] (l " Fig. 1).
l " Table 1 shows the blood glucose level of normal and experimental
animals after oral administration of glucose (2 g/kg). Bacosine
at a dose of 25 mg/kg showed a more significant decrease
in the peak blood glucose level after 1 h and tended to bring the
values near normal values after 2 h.
The results of l " Tables 2 and 3 reveal that bacosine, when applied
to normal rats, did not show any significant change in the blood
glucose levels with respect to the normal control rats but showed
a significant reduction (p < 0.001) of the glucose level in diabetic
rats throughout the experimental period (in both single and multi-administration
studies) in a dose-dependent manner. This
proves that bacosine has antihyperglycemic activity rather than
hypoglycemic activity.
Diabetes mellitus impairs the ability to use glucose for energy
which leads to increased utilization and decreased storage of
protein, and this is responsible for reduction of body weight primarily
by depletion of the body proteins [19]. In the present
study, it was observed that bacosine, in a dose-dependent manner,
reversed the weight loss of the diabetic rats and they returned
to near normal values (l " Table 3).
The excess glucose present in the blood during diabetes reacts
with hemoglobin to form glycosylated hemoglobin, and with its
improvement glycosylated hemoglobin decreases [20]. It is a
well-established fact that the estimation of glycosylation of hemoglobin
is a useful parameter in the management and prog-
Table 1 Effect of bacosine (10 and 25 mg/kg, p.o.) on oral glucose tolerance test (OGTT) in normal and alloxan-induced diabetic rats.
Treatment Blood sugar level (mg/dL)
Fasting 30 min 60 min 90 min 120 min
Normal 76.15 ± 0.83 157.64 ± 3.29 181.58 ± 2.37 120.44 ± 1.96 82.59 ± 1.47
Normal + BS (10 mg/kg) 76.73 ± 0.87a 152.83 ± 2.76a 183.19 ± 2.64a 123.07 ± 2.39a 85.32 ± 1.86a Normal + BS (25 mg/kg) 75.82 ± 0.66a 147.35 ± 3.38a 179.26 ± 2.07a 116.40 ± 2.28a 82.43 ± 1.75a Diabetic control 257.19 ± 2.49c 315.38 ± 5.58c 380.67 ± 4.92c 325.47 ± 3.84c 312.39 ± 3.08c Diabetic + BS (10 mg/kg) 78.54 ± 0.55f 155.63 ± 3.75f 192.69 ± 3.28f 138.56 ± 3.95f 91.74 ± 1.63f Diabetic + BS (25 mg/kg) 78.38 ± 0.62f 149.24 ± 2.75f 183.48 ± 2.98f 125.17 ± 2.36f 86.54 ± 1.23f Diabetic + glibenclamide 77.26 ± 0.48f 145.04 ± 2.73f 181.59 ± 2.40f 121.32 ± 2.87f 84.16 ± 1.94f Values are mean ± SEM for n = 6; a not significant when compared to normal group; c p < 0.001 when compared to normal group; e p < 0.01 and f p < 0.001 when compared to
diabetic control group
Table 2 Effect of single administration treatment of bacosine (10 and 25 mg/kg, p.o.) on blood glucose level in normal and alloxan-induced diabetic rats.
Treatment Blood glucose level(mg/dL)
Basal value 1 h 2 h 4 h
Normal 78.59 ± 0.73 78.76 ± 0.83 78.55 ± 0.73 79.14 ± 0.64
Normal + BS (10 mg/kg) 79.18 ± 0.68a 79.15 ± 0.76a 78.84 ± 0.81a 78.53 ± 0.59a Normal + BS (25 mg/kg) 78.54 ± 0.76a 78.37 ± 0.66a 78.12 ± 0.83a 77.89 ± 0.74a Diabetic control 314.76 ± 3.82c 316.53 ± 3.75c 317.18 ± 4.15c 317.93 ± 3.38c Diabetic + BS (10 mg/kg) 316.13 ± 4.08d 295.48 ± 3.55e 284.53 ± 4.92f 276.83 ± 4.15f Diabetic + BS (25 mg/kg) 312.89 ± 3.57d 286.39 ± 2.88f 268.73 ± 3.15f 257.26 ± 3.18f Diabetic + glibenclamide 317.06 ± 4.19d 283.62 ± 3.17f 257.18 ± 3.84f 242.48 ± 2.86f Values are mean ± SEM for n = 6; a not significant when compared to normal group; c p < 0.001 when compared to normal group; d not significant when compared to diabetic
control group; e p < 0.01 and f p < 0.001 when compared to diabetic control group
Ghosh T et al. Antihyperglycemic Activity of… Planta Med 2011; 77: 804–808

Table 3 Effect of multiple administration treatment of bacosine (10 and 25 mg/kg, p.o.) on blood glucose level and change in body weight after 15 days in
normal and alloxan-induced diabetic rats.
Treatment Blood glucose level (mg/dL) Change in
Basal value Day 1 Day 3 Day 7 Day 10
body weight (g)
Normal 78.59 ± 0.73 78.44 ± 0.87 79.59 ± 0.69 78.55 ± 0.54 79.23 ± 0.62 (+) 9.85 ± 1.29
Normal + BS (10 mg/kg) 79.18 ± 0.68a 78.66 ± 0.65a 78.12 ± 0.91a 79.38 ± 0.88a 78.92 ± 0.59a (+) 10.06 ± 1.57a Normal + BS (25 mg/kg) 78.54 ± 0.76a 78.92 ± 0.80a 79.38 ± 0.71a 80.03 ± 0.92a 79.16 ± 0.68a (+) 10.92 ± 1.22a Diabetic control 314.76 ± 3.82c 319.25 ± 4.16c 325.54 ± 3.83c 316.39 ± 3.66c 307.85 ± 5.03c (−) 8.87 ± 1.15c Diabetic + BS (10 mg/kg) 316.13 ± 4.08d 255.85 ± 2.56f 221.38 ± 2.74f 200.41 ± 2.44f 192.38 ± 1.42f (+) 9.12 ± 1.73f Diabetic + BS (25 mg/kg) 312.89 ± 3.57d 234.19 ± 3.73* 206.13 ± 3.04f 188.57 ± 1.95f 176.65 ± 1.57f (+) 9.92 ± 1.81f Diabetic + glibenclamide 317.06 ± 4.19d 225.37 ± 3.18* 194.48 ± 2.65f 176.37 ± 1.39f 163.52 ± 1.46f (+) 10.25 ± 0.98f Values are mean ± SEM for n = 6; a not significant when compared to normal group; c p < 0.001 when compared to normal group; d not significant when compared to diabetic
control group; f p < 0.001 when compared to diabetic control group
Table 4 Effect of bacosine on percent inhibition of hemoglobin glycosylation
in vitro.
Sample Concentration % inhibition IC50 R
(µg/mL) ±SD
(µg/mL)
Bacosine 1 2.86 ± 0.42 7.44 0.9909
2.5 13.52 ± 2.06
5 34.11 ± 2.69
10 45.76 ± 3.58
15 70.38 ± 5.10
α-Tocopherol 7.74 0.9985
Values are mean ± SD for n = 3; R = regression coefficient
nosis of the disease [21]. The present study showed that bacosine
significantly prevented glycosylation of hemoglobin in vitro, with
an IC50 value of 7.44 µg/mL, which is comparable to the one of the
reference drug α-tocopherol (l " Table 4). Non-enzymatic glycosylation
of hemoglobin is reported to be an oxidative reaction
[22]. As bacosine prevented significantly the increase of hemoglobin
glycosylation, it was thus expected to possess antioxidant
activity, and this fact was further substantiated by our in vivo
studies.
One of the characteristic features of chronic diabetes is lipid peroxidation.
Alloxan gives rise to dialuric acid, which generates O2,
H2O2, and OH [23] and stimulates lipid peroxidation. Administration
of bacosine significantly decreased the levels of MDA in diabetic
rats at a dose of 10 mg/kg (p < 0.05) and 25 mg/kg (p < 0.01)
in a dose-dependent manner (l " Table 5).
GSH, a tripeptide present in all the cells, is an important antioxidant
[24]. Decreased GSH levels in diabetes have been considered
to be an indicator of increased oxidative stress [25]. Our study
showed a decrease in GSH in the liver during diabetes. Administration
of bacosine and glibenclamide increased the level of GSH in
the liver of diabetic rats, though no significant difference was observed
in both MDA and GSH levels when bacosine was administeredtonormal
ratswith respect tonormal control rats(l " Table 5).
The cellular radical scavenging systems include enzymes such as
SOD, which scavenges the superoxide ions by catalyzing its dismutation,
and CAT, a heme enzyme which removes hydrogen
peroxide [26]. Administration of bacosine increased the activity
of SOD and CAT in a dose-dependent manner in diabetic rats. Bacosine
did not show any significant change in SOD and CAT activity
in normal rats when compared to normal control (l " Table 5).
Lupeol, a triterpenoid, has been shown to protect cells from oxidative
stress-induced damage by increasing the transcriptional
activity of NRF 2, which induces the formation of endogenous
Table 5 Effect of bacosine (10 and 25 mg/kg, p.o.) on the levels of MDA,
GSH, glycogen content, and activities of SOD and CAT in the liver of normal
and diabetic rats.
Treatment MDA i GSH j SOD k CAT l Glycogen
Normal 0.31 ± 0.02 9.56 ±
0.53
Normal + BS
(10 mg/kg)
Normal + BS
(25 mg/kg)
Diabetic
control
Diabetic + BS
(10 mg/kg)
Diabetic + BS
(25 mg/kg)
Diabetic +
glibenclamide
0.31 ± 0.01 a 9.88 ±
0.68 a
0.30 ± 0.02 a 10.52 ±
0.74 a
0.72 ± 0.06 d 4.73 ±
0.26 d
0.57 ± 0.05 f 7.94 ±
0.66 g
0.42 ± 0.04 g 9.08 ±
0.56 h
0.37 ± 0.02 h 9.43 ±
0.75 h
5.76 ± 0.43 75.68 ±
6.77
5.85 ± 0.57a 78.23 ±
8.36a 5.91 ± 0.49a 79.42 ±
7.52a 3.55 ± 0.28c 37.51 ±
4.42d 4.83 ± 0.37f 55.41 ±
6.19f 5.18 ± 0.41g 63.72 ±
6.11g 5.52 ± 0.53g 68.81 ±
5.06h Original Papers
content m
43.78 ± 1.52
44.19 ± 1.06 a
45.72 ± 0.98 a
8.08 ± 0.47 d
31.58 ± 1.52 h
39.43 ± 1.65 h
40.65 ± 1.02 h
Values are mean ± SEM for n = 6 animals; a not significant when compared to normal
group; c p < 0.01, and d p < 0.001 when compared to normal group; f p < 0.05,
g h p < 0.01, and p < 0.001 when compared to diabetic control group. MDA: malondialdehyde;
GSH: reduced glutathione; SOD: superoxide dismutase; CAT: catalase;
i j k nmole of MDA/mg of protein; µg/mg of protein; units/mg of protein; one unit of
activity means enzyme reaction responsible for 50% inhibition of NBT per min;
l µ mole of H2O2 consumed/min/mg of protein; m mg/100 g of liver
antioxidant enzymes like CAT, SOD, and others [27]. Bacosine,
being a lupeol-type triterpene, showed an increase in SOD and
CAT activity probably by the same mechanism.
Alloxan causes irreversible destruction of the β-cells of the pancreas
[28]. Thus, the antihyperglycemic activity might be due to
extra pancreatic mechanism. Hence, the effect of bacosine on
peripheral consumption of glucose was investigated. The result
suggests that bacosine produces an antidiabetic effect mediated
by an increase in peripheral glucose consumption in the diaphragm
of diabetic rats, especially at a concentration of 50 µg/
mL (l " Table 6). Insulin increased the peripheral glucose consumption
in normal and diabetic rats. Thus, bacosine might have
insulin-like activity, and the antihyperglycemic effect might be
due to an increase in peripheral glucose consumption.
The above in vitro observation was further substantiated by observing
the effect of bacosine on glycogen content in the liver of
diabetic rats in vivo. It has been reported that insulin is a potent
activator of glycogen synthase and hexokinase, responsible for
the formation of glycogen, and inhibitor of glycogen phosphorylase,
responsible for glycogenolysis in the liver [29]. Insulin defi-
Ghosh T et al. Antihyperglycemic Activity of … Planta Med 2011; 77: 804–808
807

808
Original Papers
Table 6 Effect of bacosine on in vitro peripheral glucose consumption by the
diaphragm of normal and diabetic rats.
Glucose consumption (mg/10 mg
of diaphragm dry weight)
Bacosine (µg/mL) Insulin
Control 25 (µg/mL) 50 (µg/mL) 5 U/mL
Normal rats 0.57 ± 0.05 0.60 ± 0.07a 0.62 ± 0.08a 0.86 ± 0.06c Diabetic rats 0.62 ± 0.06 0.81 ± 0.05e 0.89 ± 0.06f 0.95 ± 0.08f Values are mean ± SEM for n = 6; a not significant when compared to normal rats;
c e f p < 0.01 when compared to normal group; p < 0.05 and p < 0.01 when compared
to diabetic control group
ciency in diabetes results in decreased concentrations of glycogen
in the liver. Bacosine caused a significant increase (p < 0.001) in
glycogen content in the liver of diabetic rats (l " Table 5) and thus
further proved its insulin-like activity leading to an increased uptake
of glucose.
Thus, from the present study it is evident that bacosine, a triterpene
isolated from Bacopa monnieri, possesses significant antihyperglycemic
activity against alloxan-induced diabetic rats,
although it did not show any activity on normal rats. The abovementioned
activity might be attributed to the protective action of
bacosine on lipid peroxidation and at the same time to the enhancing
effects on cellular antioxidant defense contributing to
the protection against oxidative damage in alloxanized diabetes
leading to an improvement of tissues and a subsequent increase
in uptake and utilization of blood glucose.
Acknowledgements
The authors are thankful to the authorities of the Jadavpur University,
Kolkata, India for providing the necessary facilities to
carry out the research work.
References
1 Vetrichelvan T, Jagadeesan M, Uma Devi BA. Antidiabetic activity of alcohol
extract of Celosia argentea Linn. seeds in rats. Biol Pharm Bull
2002; 25: 526–528
2 Pickup J, Williams G. Text book of diabetes. Blackwell: Oxford; 1991:
467–469
3 Nagarajan S, Jain HC, Aulakh GS. Indigenous plants used in the control
of diabetes. New Delhi: CSIR; 1987: 586–590
4 Anonymous. Indian herbal pharmacopoeia, Vol. I. Mumbai: IDMA;
1998: 3037
5 Kiritikar KR, Basu BD. Indian Medicinal plants, Vol. I. Dehradun: Bishen
Singh Mahendrapal Singh; 1994: 1816–1817
6 Chopra RN, Nayar SL, Chopra IC. Glossary of Indian medicinal plants.
New Delhi, India: National Institute of Science and Communication
(CSIR); 1986: 32–34
7 Ghosh T, Maity TK, Sengupta P, Dash DK, Bose A. Antidiabetic and in vivo
antioxidant activity of ethanolic extract of Bacopa monnieri Linn. aerial
parts: a possible mechanism of action. Iranian J Pharm Res 2008; 7:
61–68
Ghosh T et al. Antihyperglycemic Activity of… Planta Med 2011; 77: 804–808
8 Tan MJ, Ye J, Turner N, Hohnen-Behrens C, Ke CQ, Tang CP, Chen T, Weiss
HC, Gesing ER, Rowland A, James DE, Ye Y. Antidiabetic activities of triterpenoids
isolated from bitter melon associated with activation of the
AMPK pathway. Chem Biol 2008; 15: 263–273
9 Ahmed B, Rahman A. Bacosterol, a new 13,14-seco-steroid and Bacosine,
a new triterpene from Bacopa monniera. Indian J Chem 2000;
39B: 620–625
10 Joy KL, Kuttan R. Antidiabetic activity of Picrorrhiza kurroa extract.
J Ethnopharmacol 1999; 67: 143–148
11 Vohra SB, Khanna T, Athar M. Analgesic activity of bacosine a new triterpene
isolated from B. monniera. Fitoterapia 1997; 68: 361–365
12 Fraga CG, Leibovitz BE, Toppel AL. Lipid peroxidation measured as thiobarbituric
acid-reactive substances in tissue slices: characterization
and comparison with homogenates and microsomes. Free Radic Biol
Med 1988; 4: 155–161
13 Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys 1959; 82:
70–77
14 Kakkar P, Das B, Viswanathan PN. A modified spectroscopic assay of
superoxide dismutase. Indian J Biochem Biophys 1984; 21: 130–132
15 Maehly AC, Chance B. The assay of catalases and peroxidases. In: Glick
D, editor. Methods of biochemical analysis, Vol I. New York: Interscience;
1954: 357–358
16 Fluckiger R, Winterhalter KH. Biochemical and clinical aspects of hemoglobin
abnormalities. New York: Academic Press; 1978: 208–209
17 Chattopadhyay RR, Sarkar SK, Ganguly S, Banerjee RN, Basu TK. Effect of
extract of leaves of Vinca rosea Linn. on glucose utilization and glycogen
deposition by isolated rat hemidiaphragm. Indian J Physiol Pharmacol
1992; 36: 137–138
18 Carroll NV, Longley RW, Roe JH. The determination of glycogen in liver
and muscle by use of anthrone reagent. J Biol Chem 1956; 220: 583–
596
19 Guyton AC, Hall JE. Text book of medical physiology, 10th edition. New
Delhi: Elsevier; 2000: 894–897
20 Monnier VK, Cerami A. Non-enzymatic glycosylation and browning in
diabetes and aging. Diabetes 1982; 31: 57–66
21 Chang AT, Nobel J. Estimation of HbA1c like glycosylated proteins in
kidneys of streptozotocin diabetes and controlled rats. Diabetes 1979;
28: 408–415
22 Yadav SB, Tripathi V, Singh RK, Pandey HP. Antioxidant activity of Cusuta
reflexa stem. Indian J Pharm Sci 2000; 62: 477–478
23 Winterbourn CC, Munday R. Glutathion-mediated redox cycling of
alloxan. Biochem Pharmacol 1989; 38: 271–274
24 Lu SC. Regulation of hepatic glutathion synthesis: current concepts and
controversies. FASEB J 1999; 13: 1169–1183
25 Mc Lennan SV, Heffernan S, Wright L, Rae C, Fisher E, Yue DK, Turtle JR.
Changes in hepatic glutathion metabolism in diabetes. Diabetes 1991;
40: 344–349
26 Lee SE, Ju EM, Kim JH. Free radical scavenging and antioxidant enzyme
fortifying activities of extracts from smilax china roots. Exp Mol Med
2001; 34: 263–268
27 Liby KT, Yore MM, Sporn MB. Triterpenoids and rexinoids as multifunctional
agents for the prevention and treatment of cancer. Nat Rev Cancer
2007; 7: 357–369
28 Pari L, Uma Maheswari J. Hypoglycemic activity of Musa sapientum L.
in alloxan-induced diabetic rats. J Ethnopharmacol 1999; 68: 321–325
29 Bollen M, Keppens S, Stalmans W. Specific features of glycogen metabolism
in the liver. Biochem J 1998; 336: 19–31

Effects of Ligustilide on Lipopolysaccharide-Induced
Endotoxic Shock in Rabbits
Authors Meng Shao 1 *, Kai Qu 2 *, Ke Liu 1 , Yuqin Zhang 2 , Ling Zhang 2 , Zeqin Lian 2 , Tingting Chen 2 ,
Junfeng Liu 4 , Aili Wu 3 , Yue Tang 3 , Haibo Zhu 2
Affiliations The affiliations are listed at the end of the article
Key words
l " ligustilide
l " Angelica sinensis (Oliv.) Diels
l " Umbelliferae
l " septic shock
l " tumor necrosis factor‑α
l " interleukin‑1β
received May 23, 2010
revised Sept. 3, 2010
accepted October 28, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250573
Published online November 23,
2010
Planta Med 2011; 77: 809–816
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Professor Haibo Zhu, Ph.D.
Institute of Materia Medica
Chinese Academy of Medicine
Science & Peking Union Medical
College
1 Xian Nong Tan Street
Beijing 100050
P. R. China
Phone: + 86 1063 1881 06
Fax: +861063017757
zhuhaibo@imm.ac.cn
Abstract
!
In this study, we investigated the protective effects
of ligustilide against lipopolysaccharide
(LPS)-induced endotoxic shock in Japanese white
rabbits and attempted to elucidate the possible
mechanism underlying these effects. Forty-two
rabbits were randomized into 6 groups: normal
group, LPS group, dexamethasone group (5 mg/
kg), and 3 ligustilide groups (20, 40, and 80 mg/
kg). After the rabbits had received a LPS infusion
(0.3 mg/kg), dexamethasone and ligustilide were
intravenously injected at the above-mentioned
dosages. Heart rate (HR), mean arterial pressure
(MAP), and rectal temperature (RT) were recorded
throughout the experiment. Tumor necrosis
factor-α (TNF-α), interleukin-1β (IL-1β),
and nitric oxide (NO) levels were measured by radioimmunoassay
every 30 minutes for the first
hour and every 60 minutes thereafter until the
end of the experiment. The serum levels of alanine
transaminase (ALT), aspartate transaminase
(AST), alkaline phosphatase (ALP), γ-glutamyl
transpeptidase (GGT), creatinine kinase (CK), lactate
dehydrogenase (LDH), total protein (TP), creatinine
(Scr), blood urea nitrogen (BUN), total bilirubin
(T. BIL), and counts of formed elements of
Introduction
!
Septic shock is a serious clinical condition associated
with significant morbidity and mortality [1].
It is a systemic inflammatory disorder characterized
by progressive failure of circulation, systemic
hypotension, hyperreactivity to vasoconstrictors,
and subsequent organ dysfunction, which ultimately
leads to multiorgan failure. Septic shock
is mostly caused by gram-negative bacterial infec-
* These authors contributed equally to this work.
blood were measured at 0, 120, and 300 minutes
after the administration of LPS. Hemorheology
was assayed 300 minutes after the LPS injection.
The vital organs were collected and weighed before
histopathologic examination. A comparison
between the LPS group and the ligustilide groups
showed that ligustilide significantly inhibited the
decline in MAP and RT and decreased the levels of
TNF-α, IL-1β, and NO, but had no apparent effect
on HR. Ligustilide also inhibited the increase in
the levels of biochemical markers, such as ALT,
AST, ALP, GGT, LDH, CK, BUN, and Scr, but showed
no apparent effect on T. BIL and TP. Furthermore,
ligustilide partly restored the function of injured
vital organs, including the heart, liver, lungs, and
kidneys. These results suggest that ligustilide protected
the rabbits against LPS-induced endotoxic
shock.
Abbreviation
!
TLC: thin layer chromatography
Original Papers
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/
plantamedica
tion. Lipopolysaccharide (LPS) has been implicated
as the major factor in the pathogenesis of
septic shock caused by gram-negative bacteria
[2–4]. In experimental animals, LPS challenge
causes pathophysiologic changes that are similar
to those observed in human patients with septic
shock [5].
LPS exerts most of its effects via endogenous mediators
such as cytokines. Among these cytokines,
tumor necrosis factor-α (TNF-α) appears to be
particularly important for the endotoxic effects
of LPS; studies have shown that it induces the
most characteristic changes accompanying endo-
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
809
Downloaded by: University of British Columbia. Copyrighted material.

810
Original Papers
toxic shock [6, 7]. Interleukin-1β (IL-1β) has also been shown to
contribute to the development of sepsis by inducing the production
of other inflammatory mediators and cytokines involved in
sepsis [8]. The excessive generation of nitric oxide (NO) via the
induction of inducible nitric oxide synthase (iNOS) has been suggested
to cause hypotension, vascular hyporeactivity, and death
induced by LPS; these findings indicate that the overproduction
of NO plays an important role in septic shock [9–11].
Angelica sinensis (Oliv.) Diels, documented in the pharmacopoeia
of China, is known to be an effective medicinal agent for the nourishment
of blood, regulation of menstruation, alleviation of pain,
and sliding of bowels [12]. A very recent publication showed that
an ethyl acetate extract of A. sinensis significantly improved the
survival of LPS-challenged mice with the reduction of TNF-α in
vivo. This protective effect may be associated with the downregulation
of NF-κB by ligustilide [13]. Ligustilide (l " Fig. 1), one of the
major active components of the essential oil extracted from
Angelica sinensis (Oliv.) Diels [14], has been identified as the inhibitor
of LPS-induced TNF-α production in monocytes. This
property of ligustilide is related to its inhibitory effect on the
transcription of TNF-α mRNA. Furthermore, ligustilide exhibits
significant suppressive effects on TNF-α-mediated nuclear factor-κB(NF-κB)
activation in gene assays [15, 16].
Therefore, in this study, we attempted to investigate the protective
effects of ligustilide in a rabbit model of LPS-induced endotoxicity
and to elucidate the mechanism underlying these protective
effects.
Materials and Methods
!
Plant material and preparation
of ligustilide emulsion injection
Roots of Angelica sinensis (Oliv.) Diels were collected from the
northwest of China and identified by Dr. Ke Liu, Jilin University.
A voucher specimen (No. 510073) was deposited at the herbarium
of the College of Life Sciences, Jilin University.
The dried and pulverized roots of Angelica sinensis (Oliv.) Diels
were extracted with supercritical carbon dioxide twice at
25 mPa and 45 °C, for 3 hours each time. Ligustilide (purity > 95%,
Fig. 1S) was isolated and purified from the extract by silica gel
chromatography performed according to a previously described
method [17]. Considering its poor water solubility and stability,
ligustilide was quickly prepared as a water-in-oil (W/O) emulsion
by using a high-pressure homogenizer.
Animals and reagents
Japanese white rabbits (weight, 2.5–3.0 kg; age, 5–6 months; half
male and half female) were purchased from Changchun Gaoxin
Study Center of Medical Animal (certificate number: SCXK-[Ji]-
2003–0004). Ligustilide emulsion injection (ivory-white fluid;
10 mg/mL) was obtained from Shandong Target-drug Research
Co., Ltd. Dexamethasone injection (5 mg/mL) was purchased
from Tianjing Pharmaceutical Group. Just before use, the abovementioned
drugs were dissolved in sodium chloride solution to
achieve the required concentrations. LPS (extracted from Escherichia
coli serotype 0111 : B4) was obtained from Sigma-Aldrich
Biotechnology. Radioimmunoassay kits for IL-1β and TNF-α were
purchased from Scientific and Technological Development Center
of PLA General Hospital. NO detection kit was obtained from
Nanjing Jiancheng Bioengineering Institute. Assay kits for alanine
aminotransferase (ALT), aspartate aminotransferase (AST), alka-
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
Fig. 1 Chemical structure
formula of ligustilide.
line phosphatase (ALP), γ-glutamyltransferase (GGT), creatinine
kinase (CK), lactate dehydrogenase (LDH), blood urea nitrogen
(BUN), serum creatinine (Scr), total protein (TP), and total bilirubin
(T. BIL) were purchased from Zhongsheng Beikong Bioscience
and Technology, Ltd.
Experimentally induced endotoxic shock
All the animals were allowed to acclimatize tothe conditions atour
laboratory facility for at least 7 days before being used for the
study. The rabbits were housed under standard laboratory conditions
(25 ± 2°C, 50–55% relative humidity, and 12-h light-dark
cycle) and were provided ad libitum access to food and water. The
experiments were conducted in accordance with the ethical
guidelines for investigations on laboratory animals and were approved
by the Ethics Committee for Animal Experimentation.
The rabbits were administered intraperitoneal injections of
40 mg/kg (5 mL/kg) pentobarbital and maintained under anesthesia
throughout the experiment. A venous cannula linked to a
3-way joint was inserted into the arteria carotis communis of
the rabbits; this cannula was used for blood sampling and was
connected to an 8-channel physiological recorder to measure
mean arterial blood pressure (MAP) via a pressure capsule. Heparin
(0.3%) was used as an anticoagulant in this closed system.
Heart rate (HR) and rectal temperature (RT) were also recorded
during the experiments. The rabbits in the LPS group were injected
with 300 µg/kg (1 mL/kg) of LPS via the ear vein. Additionally,
within 20 minutes of the LPS injection, the rabbits in the
treatment groups received ligustilide injection at 80, 40, or
20 mg/kg (8 mL/kg), via the ear vein; the dexamethasone group
received dexamethasone (5 mg/kg, 8 mL/kg) after the administration
of LPS. The normal group was not administered LPS and
received only an equal volume of sodium chloride solution at
the same time the other groups were injected with LPS.
Assays for vital parameters
The vital parameters, namely MAP level, HR, and RT, were recorded
before and 30, 60, 120, 180, 240, and 300 minutes after
the injection.
TNF-α, IL-1β, and NO assay
Blood samples (1 mL) were separately collected from the arteria
carotis communis before and at 30, 60, 120, 180, 240, and 300
minutes after the injection. The blood samples were then centrifuged
(2500 rpm) to obtain the serum. TNF-α and IL-1β levels in
the serum were measured using radioimmunoassay kits, and the
NO level was determined by the nitrate reductase (NR) method,
according to the manufacturerʼs instruction.
Downloaded by: University of British Columbia. Copyrighted material.

ALT, AST, ALP, GGT, CK, LDH, TP, Scr, T. BIL, and BUN assays
Blood samples (2 mL) were collected from the arteria carotis
communis before and 120 and 300 minutes after the administration
of LPS. The blood samples were then centrifuged (2500 rpm)
to obtain the serum. The activities of ALT, AST, ALP, GGT, CK, and
LDH in the serum were measured. The levels of TP, Scr, BUN, and
T. BIL were measured using the biuret method, trinitrophenol
method, 2-points dynamics method, and diazo method, respectively,
according to the respective manufacturersʼ instructions.
Assay for formed elements of blood
Blood samples were collected from the arteria carotis communis
before and 120 and 300 minutes after the administration of LPS.
A blood-cell counter was used to measure the hemoglobin level
(HGB), red blood cell (RBC) count, hematocrit (HCT) value, white
blood cell (WBC) count, leukocyte differential count (LDC), and
platelet (PLT) count.
Hemorheology assay
Blood samples (4 mL) from the arteria carotis communis were
collected in heparinized tubes 300 minutes after the administration
of LPS. The samples were used to measure the specific viscosity
of whole blood (VWB), specific viscosity of hematoplasma,
and blood sedimentation rate.
Correlated organs weight and histopathology
Rabbits were killed by bloodletting from the arteria carotis communis
300 minutes after the administration of LPS. Subsequently,
the vital organs, including the heart, liver, lungs, and kidneys, of
the rabbits of all the 6 groups were dissected and weighed. The
ponderal indices were expressed in terms of grams per kilogram
body weight. These organs were fixed with 10% formaldehyde in
phosphate buffer saline for more than 8 hours, dehydrated in
ethanol, and embedded in paraffin. Next, 4-µm-thick sections
were cut, and the sections were deparaffinized in xylene. Subsequently,
the tissue sections were stained with hematoxylin and
eosin (HE) for light microscopy.
Statistical analysis
Data shown represent the mean and standard error of the mean
(SEM). Group comparison was performed using one-way analysis
of variance (ANOVA) with the post hoc Tukeyʼs test. Differences
were considered statistically significant if p < 0.05.
Supporting information
Detailed information on isolation and purification of ligustilide
and microscopic sections of organs are available as Supporting
Information.
Results
!
At all time points after 60 minutes, the MAP level in the LPS group
was markedly less than that in the normal group (p < 0.01;
l " Fig. 2A). Treatment with dexamethasone and ligustilide led to
significant inhibition of the decline in the MAP level (p < 0.01 and
p < 0.05, respectively). There was no change in the HR in any
group at all time points (l " Fig. 2 B). RT in the LPS group was significantly
less (p < 0.01) than that in the normal group and
tended to decrease continuously after the rabbits were administered
LPS (l " Fig. 2 C). For all time points, compared to the LPS
group, the groups treated with dexamethasone (5 mg/kg) and 40
and 80 mg/kg of ligustilide showed a significant decrease in RT
(p < 0.01 and p < 0.05, respectively), while there was no conspicuous
effect in the group treated with 20 mg/kg of ligustilide.
The levels of TNF-α, IL-1β, and NO in the LPS group at each time
point after the LPS injection was significantly (p < 0.01) higher
than the corresponding levels in the normal group (l " Fig. 3). The
levels of TNF-α and IL-1β reached the peak value at 120 minutes,
while that of NO continued to increase even after 120 minutes.
After dexamethasone (5 mg/kg) administration, an obvious decrease
was noted in the level of TNF-α, IL-1β, and NO (p < 0.05
and p < 0.01, respectively). Compared to the LPS group, the group
treated with 80 mg/kg lingustilide showed significant suppression
(p < 0.05 and p < 0.01, respectively) of the levels of TNF-α,
IL-1β, and NO, while 40 mg/kg lingustilide showed a marked decrease
in the level of NO (p < 0.05 or p < 0.01), but no apparent effect
on the levels of TNF-α and IL-1β. Moreover, ligustilide
(20 mg/kg) did not have any apparent effect on the levels of the
above-mentioned cytokines.
After the administration of the LPS injection, the HGB level and
WBC and PLT counts in the LPS group were less than those in the
normal group (l " Table 1). Dexamethasone (5 mg/kg) induced a
remarkable increase in the WBC and PLT counts (p < 0.05), while
ligustilide had no apparent effect on the count of formed elements
of blood.
Compared to the normal group, the LPS group showed markedly
high serum levels of ALT, AST, ALP, GGT, LDH, CK, BUN, and Scr,
but no change in the levels of T. BIL and TP, after the rabbits were
administered LPS. Dexamethasone and ligustilide (20, 40, and
80 mg/kg) treatment had an obvious inhibitory effect on the increase
in the levels of ALT, AST, ALP, GGT, LDH, CK, BUN, and Scr,
which was seen in the LPS group (l " Table 2).
Compared to the normal group, the LPS group showed a markedly
higher value of viscosity of whole blood (VWB), but plasma viscosity
and blood sedimentation rate showed no obvious change
after the rabbits were administered LPS (l " Fig. 4). The value of
VWB after the administration of dexamethasone (5 mg/kg) and
ligustilide (80, 40 mg/kg) was markedly lower than that in the
LPS group.
Compared to the normal group, the LPS group showed significantly
increased (p < 0.05) ponderal indices of the lungs and kidneys,
and slightly increased ponderal indices of the heart and liver.
There was no difference between the 4 drug-treated groups
and the LPS group in terms of the ponderal indices of the abovementioned
tissues (l " Fig. 5).
Compared to the normal group, the LPS group showed a considerably
greater extent of injury to the heart, liver, lungs, and kidneys,
while dexamethasone and ligustilide treatment brought
about a marked reduction in the extent of LPS-induced injury
(Figs. 2S‑5S, Supporting Information).
Discussion
!
Original Papers
Septic shock, which is an acute and severe clinical condition, is a
therapeutic challenge for clinicians. Septic shock leading to multiorgan
failure has remained one of the main reasons for postsurgical
complications and death of patients [18, 19]. LPS is known to
play a central role in the pathogenesis of septic shock. Although it
does not directly cause septic shock, LPS triggers a set of inflammatory
responses that mediate a series of pathophysiologic
changes, such as hypoplasia, fever, tissue necrosis, vascular endothelium
injury, and multiorgan dysfunction, by stimulating some
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
811
Downloaded by: University of British Columbia. Copyrighted material.

812
Original Papers
endogenous mediators of inflammation, and particularly by inducing
excessive secretion of cytokines [8, 20,21].
In the present study, the rabbits injected with LPS showed an
obvious decrease in the MAP level at all time points and a continuous
decrease in RT. These changes are characteristic of severe
shock. According to the published clinical statistical data, in approximately
50% of the fatal cases of infectious shock, the cause
of death is hypotension with hyporesponsiveness to vasoconstrictor
agents and multiple organ dysfunction and failure [18]. We
observed that at all doses, ligustilide could inhibit the decrease
in the MAP level; notably, the effect of high-dose (80 mg/kg)
ligustilide was similar to that of dexamethasone (5 mg/kg). Furthermore,
treatment with ligustilide (80 and 40 mg/kg) restored
the RT of the animals in the 2 therapeutic groups compared with
that in the LPS group.
In LPS-induced endotoxic shock, TNF-α is one of the crucial inflammatory
cytokines that induces rapid production of other in-
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
Fig. 2 Effect of ligustilide on mean arterial pressure,
heart rate, and rectal temperature in the LPSinjected
rabbits. Data were collected at the indicated
time points and analyzed (A, B,andC). Data
are represented as means ± SEM (n = 7 for each
group). # P

mortality in septic shock [9, 30]. Therefore, we also investigated
the effect of ligustilide on the production of NO. Our results
showed that ligustilide can inhibit NO production. Taken together,
these results indicate that the anti-endotoxic shock effect of
ligustilide may be attributed to its inhibitory effect on proinflammatory
mediators.
Ligustilide can also regulate the alterations in serum biochemistry
parameters induced by injury to the vital organs. In the LPS
group, the levels of serum AST, ALT, and GGT, which are clinical
marker enzymes for liver damage, showed a rapid increase, suggesting
acute hepatic tissue damage (l " Table 2). However, the
levels of AST, ALT, and GGT in the ligustilide treatment groups
are markedly lower than those in the LPS group. Similarly, the
levels of serum BUN and Scr, which are clinical marker enzymes
for kidney damage, were markedly lower in the ligustilide treatment
groups than in the LPS group. The serum levels of LDH and
CK are often used as quantitative indices of inflammation and or-
Original Papers
Fig. 3 Effect of ligustilide on TNF-α,IL-1β,andNO
levels in the lipopolysaccharide-injected rabbits.
After the rabbits received a lipopolysaccharide injection,
some of them were administered ligustilide
emulsion. Serum was collected at the indicated
time points, and the levels of TNF-α,IL-1β, and NO
were analyzed separately (A, B,andC). Data are
represented as means ± SEM (n = 7 for each group).
## P < 0.01 compared to the normal group,
* p < 0.05, ** p < 0.01 compared to the LPS group.
gan injury, especially injury to the heart. In the rabbits of the LPS
group, the levels of LDH and CK increased conspicuously. However,
ligustilide treatment (80, 40, or 20 mg/kg) suppressed the
increase in the levels of LDH and CK. These results are consistent
with the histologic findings (Fig. 2S–5S, Supporting Information).
Moreover, a decrease in the specific viscosity of whole blood and
count of formed elements of blood induced by ligustilide also
confirms its protective effect in the rabbit model of LPS-induced
shock.
In summary, the findings of the present study clearly demonstrate
that ligustilide, the main active component of Angelica
sinensis roots, has a potent effect on LPS-induced endotoxic shock
in rabbits. The protective effects of ligustilide could partly be attributed
to its ability to inhibit proinflammatory mediators.
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
813
Downloaded by: University of British Columbia. Copyrighted material.

814
Original Papers
Table 1 Effects of ligustilide on hemoglobin level and complete blood count in rabbit models of endotoxic shock.
Testing Testing Normal LPS Dexamethasone Ligustilide Ligustilide Ligustilide
item time
5 mg/kg
80 mg/kg
40 mg/kg
20 mg/kg
HGB Before 134.9 ± 1.9 130.9 ± 2.0 130.4 ± 1.5 127.0 ± 2.2 131.9 ± 1.9 130.3 ± 1.3
(g/L) 120 min 130.4 ± 2.3 117.3 ± 4.2 # 125.4 ± 3.6 112.3 ± 7.7 124.0 ± 4.6 117.4 ± 4.8
300 min 122.4 ± 5.5 110.9 ± 5.5 114.6 ± 7.9 108.3 ± 8.7 115.0 ± 6.6 107.7 ± 4.8
RBC Before 6.1 ± 0.1 5.9 ± 0.1 6.0 ± 0.2 5.6 ± 0.2 5.8 ± 0.2 5.8 ± 0.1
(× 1012 /L) 120 min 5.8 ± 0.1 5.2 ± 0.2 5.8 ± 0.2 4.9 ± 0.4 5.6 ± 0.2 5.2 ± 0.3
300 min 5.4 ± 0.2 4.9 ± 0.4 5.1 ± 0.4 4.7 ± 0.4 5.2 ± 0.3 4.7 ± 0.3
HCT Before 39.2 ± 0.5 38.8 ± 0.6 39.2 ± 0.5 38.2 ± 0.7 38.5 ± 0.7 38.7 ± 0.7
(%) 120 min 38.2 ± 0.5 34.6 ± 1.7 37.9 ± 1.3 33.1 ± 2.6 37.5 ± 1.4 34.6 ± 1.8
300 min 35.7 ± 0.9 32.2 ± 2.2 34.0 ± 2.5 31.9 ± 2.8 34.6 ± 2.1 31.3 ± 1.5
WBC Before 7.0 ± 1.0 6.3 ± 0.8 6.2 ± 0.5 5.7 ± 0.5 6.0 ± 0.5 7.1 ± 0.8
(× 109 /L) 120 min 5.6 ± 1.2 2.8 ± 0.5 3.4 ± 0.5 2.9 ± 0.5 2.4 ± 0.4 2.3 ± 0.4
300 min 5.2 ± 1.0 2.1 ± 0.6 # 4.2 ± 0.6* 3.0 ± 0.6 3.0 ± 0.4 3.0 ± 0.5
LDC Before 31.3 ± 0.8 30.8 ± 0.7 31.2 ± 0.9 30.1 ± 0.8 30.8 ± 0.8 29.6 ± 0.6
(%) 120 min 31.4 ± 1.2 31.9 ± 1.3 33.0 ± 0.4 32.8 ± 0.6 33.6 ± 1.1 33.8 ± 0.5
300 min 31.5 ± 1.0 33.0 ± 1.3 31.7 ± 0.9 32.6 ± 0.5 33.9 ± 1.2 33.8 ± 1.1
PLT Before 367.3 ± 13.2 374.7 ± 11.0 388.4 ± 11.1 358.0 ± 4.6 372.0 ± 9.1 381.9 ± 11.1
(× 109 /L) 120 min 357.6 ± 11.2 325.0 ± 7.5 # 358.7 ± 13.1* 325.3 ± 17.5 357.1 ± 14.8 332.9 ± 18.8
300 min 322.0 ± 11.0 326.4 ± 15.4 347.0 ± 14.1 316.7 ± 17.8 323.9 ± 15.6 319.1 ± 12.8
Data are represented as means ± SEM (n = 7 for each group). # P < 0.05 compared to the normal group, * p < 0.05 compared to the LPS group
Table 2 Effects of ligustilide on biochemical parameters in the rabbit models of endotoxic shock.
Testing Testing Normal LPS Dexamethasone Ligustilide Ligustilide Ligustilide
item time
5 mg/kg
80 mg/kg
40 mg/kg
20 mg/kg
ALT Before 53.7 ± 6.3 56.5 ± 6.1 57.6 ± 7.4 56.8 ± 3.7 56.6 ± 6.7 60.9 ± 8.9
(U/L) 120 min 55.1 ± 6.0 81.6 ± 7.1 # 61.6 ± 5.1** 62.0 ± 4.2* 58.3 ± 3.9** 64.1 ± 5.4
300 min 57.9 ± 4.6 84.6 ± 6.1 ## 63.5 ± 5.2** 65.5 ± 5.1* 56.4 ± 3.8** 61.7 ± 5.7*
AST Before 41.6 ± 2.5 41.5 ± 2.1 42.0 ± 2.6 41.4 ± 4.3 40.8 ± 3.3 41.0 ± 3.8
(U/L) 120 min 44.8 ± 2.9 106.5 ± 7.2 ## 76.2 ± 7.5* 70.8 ± 7.8** 69.1 ± 6.7** 83.7 ± 6.7*
300 min 42.1 ± 4.1 106.2 ± 8.5 ## 91.2 ± 7.1 76.2 ± 7.5* 76.2 ± 4.5** 86.6 ± 4.0
ALP Before 157.1 ± 7.7 152.5 ± 7.3 155.0 ± 10.1 156.4 ± 9.0 154.2 ± 8.4 154.0 ± 9.4
(U/L) 120 min 150.9 ± 10.0 207.4 ± 10.3 ## 161.0 ± 10.5** 166.7 ± 9.9* 164.3 ± 9.4** 174.5 ± 8.8*
300 min 156.6 ± 6.2 249.8 ± 10.2 ## 172.1 ± 12.8** 170.3 ± 9.4** 173.6 ± 9.7** 187.2 ± 7.7**
GGT Before 14.1 ± 0.4 13.4 ± 0.9 12.6 ± 0.5 12.9 ± 0.7 13.7 ± 0.6 14.0 ± 0.5
(U/L) 120 min 13.6 ± 0.4 16.5 ± 0.9 # 14.2 ± 0.6* 13.9 ± 0.6* 14.9 ± 0.7 15.1 ± 0.5
300 min 13.4 ± 0.5 22.0 ± 1.1 ## 15.8 ± 0.5** 14.2 ± 0.6** 17.5 ± 0.9** 17.2 ± 0.7**
T. BIL Before 7.2 ± 0.3 7.0 ± 0.3 7.2 ± 0.3 7.0 ± 0.3 7.0 ± 0.4 7.2 ± 0.2
(µM) 120 min 6.8 ± 0.5 6.8 ± 0.3 7.3 ± 0.4 7.4 ± 0.3 7.2 ± 0.2 6.8 ± 0.3
300 min 7.4 ± 0.4 7.4 ± 0.2 6.8 ± 0.3 6.7 ± 0.3 7.0 ± 0.4 7.0 ± 0.3
LDH Before 160.3 ± 10.7 165.7 ± 11.0 163.6 ± 8.8 165.6 ± 13.8 158.6 ± 10.0 161.0 ± 7.1
(U/L) 120 min 166.0 ± 10.0 232.1 ± 12.9 ## 187.5 ± 10.2* 176.9 ± 14.2* 177.9 ± 8.7** 189.6 ± 7.7*
300 min 171.2 ± 8.1 256.1 ± 12.8 ## 210.8 ± 12.7* 215.2 ± 11.5* 207.8 ± 13.3* 226.4 ± 13.3
CK Before 2052.0 ± 63.1 2201.6 ± 189.4 1937.0 ± 312.8 2016.6 ± 239.7 2027.8 ± 89.9 1950.6 ± 240.5
(U/L) 120 min 2127.3 ± 70.1 4804.7 ± 302.6 ## 3391.8 ± 395.1* 3212.5 ± 285.8** 3442.3 ± 195.2** 3758.1 ± 248.2*
300 min 2131.7 ± 53.0 6294.8 ± 440.3 ## 4798.4 ± 406.3* 4146.6 ± 254.2** 4271.2 ± 232.0** 5075.5 ± 431.5
TP Before 63.8 ± 3.1 61.8 ± 4.3 63.4 ± 4.2 60.5 ± 3.2 64.6 ± 3.0 62.4 ± 2.8
(g/L) 120 min 61.9 ± 3.4 59.8 ± 3.5 60.8 ± 4.5 60.6 ± 4.2 60.9 ± 1.1 59.4 ± 3.4
300 min 60.2 ± 3.8 57.0 ± 3.4 55.1 ± 2.7 56.1 ± 2.3 56.0 ± 5.2 57.6 ± 2.3
Urea Before 7.0 ± 0.3 6.8 ± 0.4 7.2 ± 0.6 6.9 ± 0.6 7.1 ± 0.5 7.1 ± 0.6
(mM) 120 min 6.9 ± 0.2 9.9 ± 0.6 ## 8.3 ± 0.8 7.3 ± 0.8* 9.0 ± 0.5 9.3 ± 0.9
300 min 7.1 ± 0.2 11.8 ± 1.0 ## 8.3 ± 0.7* 8.1 ± 0.8* 4.5 ± 0.7 11.0 ± 0.8
Scr Before 85.1 ± 2.6 88.4 ± 4.3 84.8 ± 6.4 87.4 ± 2.7 84.2 ± 3.4 84.8 ± 4.6
(µM) 120 min 87.5 ± 2.7 124.0 ± 8.9 ## 101.3 ± 5.9 91.5 ± 3.1** 92.2 ± 5.1** 94.8 ± 3.4**
300 min 86.9 ± 2.2 144.5 ± 11.1 ## 105.0 ± 5.1** 103.1 ± 7.5** 105.0 ± 6.2** 107.9 ± 2.8**
Data are represented as means ± SEM (n = 7 for each group). # P < 0.05, ## p < 0.01 compared to the normal group, * p < 0.05, ** p < 0.01 compared to the LPS group
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
Downloaded by: University of British Columbia. Copyrighted material.

Acknowledgements
!
This study was supported by grants from the National Science &
Technology Major Project (2009ZX 09303-003;2009ZX09103-
034), the National Natural Sciences Foundation of China
(30873063; 30873455), the National 973 Fundamental Project
of China (2009CB523004), the Natural Sciences Foundation of
Beijing (7092068), the Key Project of Youth Foundation of Institute
of Materia Medica, Chinese Academy of Medical Sciences
and Peking Union Medical College (2006QZH01), and the Program
for Changjiang Scholars and Innovative Research Team in
University (PCSIRT, contract grant sponsor: IRT0514).
Affiliations
1 College of Life Sciences, Jilin University, Jilin, P.R. China
2 Key Laboratory of Natural Drugs Biosynthesis, Ministry of Health &
Key Laboratory of Bioactive Substances and Resources Utilization of Chinese
Herbal Medicine, Ministry of Education; Institute of Materia Medica,
Chinese Academy of Medical Science & Peking Union Medical College,
Beijing, P.R. China
3 Chinese Academy of Medical Science & Peking Union Medical College,
Fuwai Hospital & Cardiovascular Institute, Beijing, P.R. China
4 Shandong Target-Drug Research Co., Ltd., Shandong, P.R. China
References
1 Bone RC, Grodzin CJ, Balk RA. Sepsis: a new hypothesis for pathogenesis
of the disease process. Chest 1997; 112: 235–243
2 Friedman G, Silva E, Vincent JL. Has the mortality of septic shock
changed with time. Crit Care Med 1998; 26: 2078–2086
3 Wheeler AP, Bernard GR. Treating patients with severe sepsis. N Engl
J Med 1999; 340: 207–214
Original Papers
Fig. 4 Effect of ligustilide on whole blood viscosity
(mPa/s) at high shear (200/s), middle shear (30/s),
and low shear (3/s); plasma viscosity (mPa/s); and
blood sedimentation rate (Mm/H) in the LPS-injected
rabbits. After the rabbits received a lipopolysaccharide
injection, some of them were administered
ligustilide emulsion. Data are represented as
means ± SEM (n = 7 for each group). # P

816
Original Papers
16 Liu L, Ning ZQ, Shan S, Zhang K, Deng T, Lu XP, Cheng YY. Phthalide lactones
from Ligusticum chuanxiong inhibit lipopolysaccharide-induced
TNF-α production and TNF-α mediated NF-κB activation. Planta Med
2005; 71: 808–813
17 Ma JL, Li HY, Dai RJ, Deng YL. Isolation and purification of ligustilide in
the Radix Angelicae Sinensis. Yaopin Pingjia 2005; 2: 214–215
18 Rackow EC, Astiz ME. Pathophysiology and treatment of septic shock.
JAMA 1991; 266: 548–554
19 Bone RC. Gram-positive organisms and sepsis. Arch Intern Med 1994;
154: 26–34
20 Karima R, Matsumoto S. The molecular pathogenesis of endotoxic
shock and organ failure. Mol Med Today 1999; 5: 123–132
21 Brealey D, Brand M, Hargreaves I, Heales S, Land J, Smolenski R. Association
between mitochondrial dysfunction and severity and outcome of
septic shock. Lancet 2002; 360: 219–223
22 Heinzel FP, Perko RM, Ling P, Hakimi J, Schoenhaut DS. Interleukin-12 is
produced in vivo during endotoxemia and stimulates synthesis of interferon.
Infect Immun 1994; 62: 4244–4249
23 Suzuki K, Tateda K, Matsumoto T, Gondaira F, Tsujimoto S, Yamaguchi K.
Effects of interaction between Escherichia coli verotoxin and lipopolysaccharide
on cytokine induction and lethality in mice. J Med Microbiol
2000; 49: 905–910
Shao M et al. Effects of Ligustilide… Planta Med 2011; 77: 809–816
24 Enomoto N, Takei Y, Hirose M, Kitamura T, Ikejima K, Sato N. Protective
effect of thalidomide on endotoxin-induced liver injury. Alcohol Clin
Exp Res 2003; 27: 2S–6S
25 Shirakawa F, Saito K, Bonagura CA, Galson DL, Fenton MJ, Webb AC,
Auron PE. The human prointerleukin 1 beta genen requires DNA sequences
both proximal and distal to the transcription start site for tissue-specific
induction. Mol Cell Biol 1993; 13: 1332–1344
26 Dinarello CA. Proinflammatory and anti-inflammatory cytokines as
mediators in the pathogenesis of septic shock. Chest 1997; 112:
321S–329S
27 Cobb J, Danner R. Nitric oxide and septic shock. JAMA 1996; 275: 1192–
1196
28 Wolkow PP. Involvement and dual effects of nitric oxide in septic shock.
Inflamm Res 1998; 47: 152–166
29 Llorens S, Nava E. Cardiovascular diseases and the nitric oxide pathway.
Curr Vasc Pharmacol 2003; 1: 335–346
30 Novelli GP. Role of free radicals in septic shock. J Physiol Pharmacol
1997; 48: 517–527
Downloaded by: University of British Columbia. Copyrighted material.

The Known Immunologically Active Components
of Astragalus Account for Only a Small Proportion
of the Immunological Adjuvant Activity When
Combined with Conjugate Vaccines
Authors Feng Hong 1 , Weilie Xiao 2 , Govind Ragupathi 3 , Clara B. S. Lau 4 , Ping Chung Leung 4 , K. Simon Yeung 5 ,
Constantine George 1 , Barrie Cassileth 5 , Edward Kennelly 2 , Philip O. Livingston 3
Affiliations The affiliations are listed at the end of the article
Key words
l " Astragalus membranaceus
l " Leguminosae
l " botanicals
l " conjugate vaccine
l " cancer vaccine
l " astragalosides
l " saponin
received July 2, 2010
revised October 20, 2010
accepted October 28, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250574
Published online December 2,
2010
Planta Med 2011; 77: 817–824
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Philip O. Livingston, MD
Melanoma and Sarcoma Service
Department of Medicine
Memorial Sloan-Kettering
Cancer Center
1275 York Avenue
New York, NY 10065
USA
Phone: + 16 46888 23 76
Fax: + 1646422 0453
livingsp@mskcc.org
Abstract
!
The 95% ethanol extract of Astragalus has been
demonstrated to have potent activity as an immunological
adjuvant when administered with vaccines
of various types. We endeavor here to identify
the components of this extract that are responsible
for this adjuvant activity. Mice were immunized
with KLH conjugated to cancer carbohydrate
antigens globo H and GD3 and cancer peptide
antigen MUC1 combined with different Astragalus
fractions or with commercially available
Astragalus saponins and flavonoids. The antibody
responses against cancer antigens and KLH were
quantitated in ELISA assays, and toxicity was calculated
by weight loss. Astragalosides II and IV
were the most active components, but the toxicity
of these two differed dramatically. Astragaloside
II was the most toxic Astragalus component
with 5–10% weight loss at a dose of 500 µg while
astragaloside IV showed no weight loss at all at
Introduction
!
Many widely used botanicals are claimed to have
immunostimulant effects, but clear evidence that
they are able to augment immunological responses
against defined antigens is lacking.
Screening botanicals for immunomodulatory activity
after oral ingestion is difficult due to unknowns
such as bioavailability (depending in part
on issues such as formulation and concomitant
food intake), the amount of active ingredient in
the botanical selected, optimal dose, and appropriate
assay. As a prelude to testing popular botanical
medicines as immune modulators after
oral ingestion, we have chosen to test their immunological
activity as immunological adjuvants,
mixed with antigens and injected subcutaneously,
using resulting antibody titers as a read-out.
We hypothesized that this would permit us to
Original Papers
this dose, suggesting that astragaloside IV might
be utilized as an immunological adjuvant in future
studies. Several flavonoids also had significant
adjuvant activity. However, when the activities
of these known immunologically active components
of Astragalus (and of endotoxin) are calculated
based on the extent of their presence in
the 95% ethanol extract, they provide only a small
proportion of the immunological activity. This
raises the possibility that additional uniquely active
components of Astragalus may contribute to
adjuvant activity, or that the adjuvant activity of
Astragalus is greater than the activity of the sum
of its parts.
Abbreviations
!
BSA: bovine serum albumin
HSA: human serum albumin
KLH: keyhole limpet hemocyanin
identify active botanicals and botanical fractions
and to identify the active ingredient(s). Once
identified, these ingredients could then be administered
orally in bioavailability and immunogenicity
studies.
When the breast cancer carbohydrate antigen
globo H [1] or glycoprotein antigen MUC1, or neuroectodermal
cancer ganglioside GD3 are conjugated
to KLH, mixed with an immunological adjuvant
and administered subcutaneously (s. c.), the
magnitude of the antibody responses against globo
H, MUC1, and GD3 and against KLH depend
largely on the potency of the adjuvant [2]. This
mix of carbohydrate autoantigens, peptide xenoantigen,
and protein xenoantigen, weak, moderate,
and strong immunogens, reflects the range
of antigens targeted in vaccines against cancer
and infectious diseases, and the range of antigens
encountered in life. We have previously used this
Hong F et al. The Known Immunologically… Planta Med 2011; 77: 817–824
817

818
Original Papers
s. c. immunization model in mice to screen the immunomodulatory
activity of a wide range of immunological adjuvants [2] and
seven widely used botanicals selected based on prevalence of use
and reports describing immunomodulatory activity [3]. The seven
botanicals selected for that initial study were Astragalus [4],
Coriolus [5, 6], Echinacea [6,7], H-48 (a formula consisting of ten
herbs) [8, 9], maitake [7, 10], β-glucan of yeast origin [11], and
turmeric [7, 12]. We found that only the 95% ethanolic extract of
Astragalus (but not the water extract), Coriolus extracts, and yeast
β-glucan had potent adjuvant activity. We focus here on identifying
the active components in the 95% ethanolic extract of Astragalus.
Yang and colleagues have tested saponins extracted from a variety
of botanical sources for hemolytic effect (a surrogate for toxicity)
and have constructed vaccines containing ovalbumin as an
antigen to measure their potency as immunological adjuvants
when mixed with ovalbumin and injected subcutaneously [21].
They have identified the saponins from Astragalus as having a
particularly high activity/toxicity ratio. While these reports are
suggestive (they are the reason we included Astragalus in our initial
screen), they do not guide us in the identification of the
Astragalus components most responsible for the potent adjuvant
activity identified in these or our previous study. Based on the
Yang study, clearly the saponin fraction of Astragalus has adjuvant
activity. Our goal here was to determine whether all of the
Astragalus adjuvant activity resides in the saponin fraction and
if so, which of the multiple saponins in this fraction are most active.
Since activity of most adjuvants is dose related and the dose
that can be administered is determined by local and systemic toxicity,
our study includes toxicity determinations as well.
Materials and Methods
!
Botanicals (see l " Table 1)
The root of Astragalus membranaceus (Fisch.) Bge. (purchased
from an herbal store in Mainland China) was provided by the Institute
of Chinese Medicine (ICM), Chinese University of Hong Kong.
A voucher specimen (no. HK 40399) of the Astragalus membranaceus
studied here was deposited at the Herbarium of Agriculture,
Fisheries and Conservation Department in Hong Kong. For the
preparation of Astragalus extracts, the raw herb was cut into
small pieces and refluxed with 95% ethanol for an hour twice.
The supernatants obtained were combined and dried using a
rotary evaporator to give the 95% ethanolic extract. Three subfractions
of the 95% ethanolic extract of Astragalus were further
prepared by passing through a D101 resin column and successively
eluted with water, 30% ethanol, and 95% ethanol to give
the corresponding water, 30%, and 95% ethanolic subfractions.
Yeast β-glucan (SBG) was provided by Biotec Pharmacon and
was > 95% pure.
Analysis of botanical composition
HPLC PDA and LC‑MS technologies were used for the quantitative
analysis. Standards isoquercitrin, isorhamnetin-3-O-glucoside,
ononin, and calycosin were purchased from ChromaDex. Standards
astragalosides I, II, and IV, and formononetin were obtained
from Zhongxin Innova Laboratories. The purities of the standards
are listed in l " Table 1. Standard calycosin-7-O-β-D-glucoside was
isolated from 95% EtOH Astragalus extract using the following
procedures. Dried Radix Astragali samples (5.0 g) were extracted
with 95% aqueous ethanol at room temperature (3 × 100 mL).
Hong F et al. The Known Immunologically … Planta Med 2011; 77: 817–824
After the EtOH was removed in vacuo, the residue (1.52 g) was
separated over reversed-phase C18 eluting with MeOH−H2O
(1 : 4, 2 :3, 1:1, 3:1, and 0 : 1) to give five fractions (I–V). Fraction
II (250.0 mg) was further separated by Sephadex LH-20 eluting
with methanol to give four subfractions (A–D). Calycosin-7-O-β-
D-glucoside (1) (10.2 mg) was obtained from subfraction B by recrystallization.
Its structure was determined by 1D and 2D NMR
spectra, and the purity was more than 98% determined by
HPLC‑PDA technology.
Standard calycosin-7-O-β-D-glucoside was isolated from 95%
EtOH Astragalus extract using reversed-phase chromatography
as previously described [13]. Its structure was determined by 1D
and 2D NMR spectra, and the purity was more than 98% determined
by HPLC‑PDA technology.
HPLC grade acetonitrile was from J.T. Baker; HPLC grade methanol
was from E. Merck; distilled water was further purified by
Milli-Q system (Millipore). Polyvinylidene difluoride (PVDF) syringe
filters with a pore size of 0.45 µm were procured from National
Scientific Co.
Stock solutions (1 mg/mL) for the nine standards were prepared
by dissolving individual standards in HPLC grade MeOH. Working
standard solutions containing each of the nine compounds were
prepared by diluting the stock solutions with methanol to a series
of proper concentrations. The solutions were brought to
room temperature, and an aliquot of 10 µL was injected into HPLC
or LC‑MS for analysis. Calibration curves were obtained by plotting
the peak area vs. the concentration of the standard.
Analytes including 95% ethanol crude extract, water subfraction
F1, 30% ethanolic subfraction F2, and 95% ethanolic subfraction
F3 were dissolved in HPLC grade MeOH and prepared into
20 mg/mL, which were filtered through a 0.45 µm syringe filters
before injection. 10 µL of each sample was injected to HPLC and
LC‑MS for quantitative analysis of flavonoids and astragalosides,
respectively. The mobile phase, both flavonoids and astragalosides,
consisted of water (A) and MeCN (B) with a flow rate of
1 mL/min. The mobile phase composition began with 0% B, followed
by a linear increase to 10% B in 5 min, 10–55% B in
30 min, 55–100% B in 10 min. The column for separation is Phenomenex
Hydro C 18 column (4.6 × 250 mm, 5 mm) at 25°C. The
peaks for the nine standards were baseline separated. For the six
flavonoids, separations were carried out on a Waters 2695 HPLC
equipped with a PDA dectector. For astragalosides I, II, and IV,
LC‑MS was performed on a Thermo Finnigan LCQ mass spectrometer
in the positive mode with a Waters 2690 separations module.
The instrument was equipped with an atmospheric pressure
chemical ionization (APCI) source and controlled by Xcalibur
software. The discharge current was set to 5 µA. The vaporizer
and capillary temperatures were set to 450 and 200 °C, respectively.
Nitrogen was used as the sheath gas and auxiliary gas at
flow rates of 80 and 10 units, respectively. A mass range of 200–
2000 amu was scanned.
Vaccine production
Globo H hexasaccharide (molecular weight 1055 Da) was synthesized
and conjugated to KLH (8 × 10 6 Da) essentially as previously
described [12]. Globo H/KLH molar ratios in the conjugate ranging
between 500/1 and 800/1 were used in these studies. The globo
H‑KLH used here was purchased from Optimer Pharmaceuticals
who synthesized it under contract. It was provided as globo
H ceramide for use as a target in ELISA assays and as globo H‑KLH
conjugate for vaccine production. GD3 was extracted from bovine
buttermilk, purchased from Matreya, Inc. and conjugated to KLH

Table 1 Botanicals tested with vaccines: source, dose, and active ingredients.
as previously described [14, 15]. The GD3/KLH molar ratio in the
conjugate was 950/1. MUC1 peptide containing 1 ½ tandem repeats
(32 amino acids) was conjugated to KLH using the heterobifunctional
linker MBS as previously described [16]. KLH for vaccine
production and serological target was purchased from Sigma.
OPT-821 (> 95% pure QS-21) at a dose of 20 µg and provided
by Optimer Pharmaceuticals or yeast β-glucan [3] at a dose of
250 µg were used as positive controls. The Astragalus fractions
or purified components were used at doses between 4 µg and
2 mg in individual experiments as indicated.
Vaccine administration
Six-week-old female C57Bl/6 mice were obtained from the Jackson
Laboratory. Groups of 5 mice were immunized s. c. three
times at 1-week intervals with globo H‑KLH containing 3–5µg
of globo H, GD3-KLH containing 5 µg GD3, or MUC1-KLH containing
1 µg MUC1 mixed with either Astragalus fractions or purified
components in 0.1 mL saline, 20 µg OPT-821 as a positive control.
The Memorial Sloan-Kettering Cancer Centerʼs (MSKCC) Animal
Care and Use Program operates in compliance with all applicable
federal, state, and local regulations. Specifically, the program
complies with the Public Health Service Policy on Humane Care
and Use of Laboratory Animals and has an assurance, # A3311-
01, on file with the Office of Laboratory Animal Welfare. MSKCC
is a registered research institution with the United States Department
of Agriculture (registrant # 21-R-0072) and is fully accredited
by the Association for the Accreditation of Laboratory Animal
Care International.
Original Papers
Botanical extract Source Lot # Purity
Dose Probable active
by HPLC
ingredients
Astragalus (A. membranaceus)
water crude extract
ICM 500 µg No activity
Astragalus (A. membranaceus)
50% ethanol crude extract
ICM 500 µg Saponins
Astragalus (A. membranaceus)
95% ethanol crude extract
ICM 0.5–2 mg Saponins
Astragalus 95% ethanol crude extract
– water subfraction F1
ICM 2 mg Saponins
Astragalus 95% ethanol crude extract
– 30% ethanolic subfraction F2
ICM 2 mg Saponins
Astragalus 95% ethanol crude extract
– 95% ethanolic subfraction F3
ICM 100 µg – 2 mg Saponins
Standards Source Lot # Purity Dose Probable active
ingredients
Calycosin-7-O-β-D-glucoside Weilie Xiao 98% 20–100 µg Flavonoid
Astragalosides I Chromadex 111195-(607) 99.0% 20–500 µg Saponin
Astragalosides II Chromadex 11196-(607) 99.5% 4–500 µg Saponin
Astragalosides IV Chromadex 11197-(203) 99.9% 20–500 µg Saponin
Calycosin Chromadex 3 071-(109) 93.1% 20–100 µg Flavonoid
Formononetin Chromadex 6 190-(971) 91.0% 20–500 µg Flavonoid
Isoquercitrin Chromadex 9 505-(311) 91.2% 500 µg Flavonoid
Isorhamnetin-3-b-glucoside Chromadex 9 535-(509) 500 µg Flavonoid
Ononide ononin Chromadex 15371-(206) 99.9% 500 µg Flavonoid
Yeast β-glucan Biotec Pharmacon 100 µg – 2mg β-1,3 backbone
Positive controls
β-glucan
β-1,6 side chains
OPT-821 Quillaja saponaria, fraction 21 Optimer Pharmaceuticals > 99% 20 µg Saponin
Serological assays
Mice were bled from the retro-orbital sinus under general anesthesia
seven days after the third immunization for ELISA, and sera
was frozen for future testing.
ELISA: Enzyme linked immunosorbent assays were performed as
described previously [14, 15]. The target antigens are globo H ceramide,
GD3, MUC1 peptide, or KLH. To determine the titers of
antibodies, ELISA plates were coated with antigen, generally at
0.1 µg/well. Serially diluted sera in 1% HSA in PBS were added to
wells of the coated plate and incubated for 1 hour at room temperature.
Goat anti-mouse IgM or IgG conjugated with alkaline
phosphatase (Southern Biotechnology) serve as second antibodies.
The antibody titer is defined as the highest serum dilution
showing an absorbance of 0.1 or greater over that of normal sera.
A response is considered positive by ELISA if the titer of reactivity
increased from undetectable pretreatment to at least 1 : 40 after
vaccination, or in case of detectable pretreatment, by 8-fold.
Endotoxin assay
Endotoxin levels in the botanical samples were tested at Charles
River Laboratories, using their Endosafe ® PTS system.
Statistical analysis
For each experimental run, results in serological assays for treated
mice were compared to the no-adjuvant controls using the
Mann-Whitney test or Studentʼs t-test.
Hong F et al. The Known Immunologically… Planta Med 2011; 77: 817–824
819

820
Original Papers
Results
!
The adjuvant activity of Astragalus fractions was determined.
After vaccination with globo H‑KLH plus or minus crude Astragalus
extracts, we found that the entire potency of Astragalus as immunological
adjuvant with globo H‑KLH was present in the 95%
ethanol crude extract portion as indicated in l " Table 2. This
strongly suggested that activity was concentrated in the saponin
or possibly flavonoid components. Significant augmentation of
anti-KLH antibody titers using the 95% ethanol crude extract of
Astragalus was confirmed in the 500 µg-2000 µg dose range in 9
of 11 subsequent experiments, though augmentation of antibody
titers against globo H or GD3 was not seen. This 95% ethanol
crude extract of Astragalus was further fractionated into three
subfractions (eluted by water, 30% ethanol, or 95% ethanol), and
the individual fractions tested. Each of these 3 fractions significantly
augmented antibody titers against KLH in 2 of 3 experiments
but in no case were antibody titers higher than with the
same dose of the initial 95% ethanol “crude” Astragalus extract.
The saponin (astragaloside) and flavonoid content of these fractions
was quantified using HPLC and available known astragaloside
and flavonoid positive controls, as summarized in l " Table 3.
While neither could be detected in subfraction F1, subfraction F3
contained the astragalosides and most of the flavonoids, and subfraction
F2 contained a high concentration of the flavonoid calycosin-7-O-β-D-glucoside.
The commercially available purified saponin components of Astragalus
are astragaloside I, astragaloside II, and astragaloside IV.
Seven experiments were conducted with these astragalosides.
l " Table 4 demonstrates that all 3 astragalosides are able to augment
the antibody response against both MUC1 and KLH when
injected with MUC1-KLH. Overall, astragaloside I significantly
augmented KLH antibody titers in 2 of 4 experiments and astragaloside
IV in 3 of 5 experiments. In most cases, significant reactivity
was limited to the 500 µg dose level. Astragaloside II demonstrated
significant elevations in titers against KLH in 6 of 6 experiments,
4 of 6 experiments, and 3 of 6 experiments at the
500 µg, 100 µg, and 20 µg dose levels, respectively. In 2 of 6 experiments,
the anti-KLH titers induced with astragaloside II at
the 500 µg dose level approached the titers of (were not significantly
lower than) those obtained with 20 µg of OPT-821. Despite
the high anti-KLH antibody titers induced and the consistent induction
of anti-GD3 titers between 1/80 and 1/320 when 20 µg of
Table 3 Quantity of astragalosides and flavonoids in dried Astragalus root extracts.
Table 2 ELISA antibody titers after vaccination with globo H‑KLH plus or
minus crude Astragalus extracts.
Globo H‑KLH
vaccine plus
Globo H IgM KLH IgG
No adjuvant 800(3), 1600, 400, 800(2), 1 600,
3200
3200
Water crude extract 400, 800, 1 600(2), 0, 400, 800(2), 3200
500 µg
3200
50% ethanol crude 400(2), 800(2), 1600, 3200(2), 6400,
extract 500 µg
1600
12800
95% ethanol crude 800, 1600(2), 25 600(3), 51 200(2)
extract 500 µg
3200, 6400
Yeast β-glucan 250 µg 800, 1600(2), 102 400, 819 200(2),
3200, 12800 1 638 400(2)
* Reciprocal antibody titer. Number in parentheses is the number of mice with that
titer, if more than 1. ** Groups in bold are significantly (p ≤ 0.05) higher than the
no adjuvant control group
OPT-821 was used as adjuvant with GD3-KLH, in none of the experiments
were astragalosides able to induce detectable antibodies
against GD3.
The commercially available purified flavonoid components of Astragalus
are isoquercitrin, isorhamnetin-3-b-glucoside, ononin,
calycosin, and formononetin. The adjuvant activities of these
were tested in a series of experiments with MUC1-KLH as the
antigen. MUC1 was highly immunogenic, as immunogenic as
KLH, and a more sensitive indicator of adjuvant activity. The results
of one experiment are summarized in l " Table 5. Astragalosides
II and IV at a dose of 100 µg, and Astragalus 95% EtOH extract
at a dose of 500 µg or 2 mg were the most active, though
the flavonoids were also active in this experiment. Overall, ononin
and isorhamnetin-3-O-glucoside were tested in a single experiment
at a dose of 500 µg and failed to significantly elevate
antibody titers against KLH while formononetin and isoquercitrin
were positive at a dose of 500 µg against KLH in 1 of 2 experiments
and at a dose of 100 µg induced antibodies against
MUC1, but not KLH, in 1 experiment.
To address the possibility that endotoxin contamination of the
various extracts was responsible for some or all reactivity, several
of the relevant extracts were sent to Charles River Laboratories
for determination of endotoxin levels. All levels were less than
0.04 EU per dose (see l " Table 5). When the 2 EU dose of endotox-
Qi, 2006 [26] Yu, 2007 [27]
Astragalus 95% Ethanol crude Water subfraction 30% Ethanolic 95% Ethanolic
extract (µg/mg)
F1 (µg/mg)
subfraction F2 subfraction F3
Astragalosides
I 0.61 1.15 1.86 ± 0.06* ND** ND 21.15 ± 0.36*
II 0.24 0.14 0.63 ± 0.06 ND ND 7.27 ± 0.23
IV
Flavonoids
0.14 0.042 0.44 ± 0.03 ND ND 3.76 ± 0.02
Calycosin 0.09 0.03 1.92 ± 0.05 ND ND 23.11 ± 0.14
Calycosin-7-O-β-D-glucoside 0.35 0.43 1.34 ± 0.02 ND 16.41 ± 0.07* 9.03 ± 0.26
Formononetin 0.059 0.022 1.59 ± 0.05 ND ND 12.03 ± 0.05
Isoquercitrin 0.051 ND ND ND ND ND
Isorhamnetin-3-O-β-glucoside 0.13 0.042 ND ND ND ND
Ononin 0.092 0.101 1.14 ± 0.01 ND ND 6.69 ± 0.17
* Standard deviation of triplicates. ** ND: not detectable < 0.005 µg/mg
Hong F et al. The Known Immunologically … Planta Med 2011; 77: 817–824

Table 4 Median ELISA antibody titers after vaccination with MUC1-KLH plus
or minus Astragalus extract and astragalosides.
GD3-KLH vaccine plus: MUC1 IgG KLH IgG
Pretreatment < 40(5) < 100(5)
No adjuvant < 40(3), 40(2), 100(2), 400(6),
80(2), 320, 640,
1280
1600, 6400
95% Ethanol crude extract 2 mg 640(3), 1 280(2) 1600(5)
95% Ethanol crude extract 500 µg 40, 320, 640(2),
1280
400(3), 1600(2)
Astragaloside I 500 µg 160, 1 280, 400, 1 600(2),
2560(2), 5120 6400(2)
Astragaloside I 100 µg 320(4), 5 120 400(2), 1600
(2), 6400
Astragaloside II 100 µg 1280(3), 2560, 6400, 25600(3),
5120
102 400
Astragaloside II 20 µg 320, 640,
1280(2), 5120
400, 1 600(4)
Astragaloside IV 100 µg 1280, 2 560(2),
5120(2)
1600(2), 6400(3)
Astragaloside IV 20 µg 40, 80, 320(2), 400, 1 600(2),
1280
6400(2)
OPT-821 20 µg 640, 1 280(2),
2560, 5 120
102, 400(5)
* Reciprocal antibody titer of each mouse (number of mice at that titer). ** Groups in
bold are significantly (p ≤ 0.05) higher than the 10 no adjuvant control mice
in demonstrated significant adjuvant activity (l " Table 5), we performed
an additional experiment to gage the impact of lower
doses of endotoxin. Doses of 0.5 EU or lower had no significant
adjuvant activity (l " Table 6).
Weight loss after immunizations was used as a way to gauge toxicity.
Significant weight loss (between 5% and 10% of body
weight) was consistently seen with the 500 µg dose of astragaloside
II in the 4 experiments where this was evaluated (see
l " Fig. 1). The same applies to OPT-821 at the 20 µg dose level,
but not to any of the other extracts tested in the experiments described
here. This is an indication that astragaloside II and OPT-
821 doses cannot be further escalated to gain immunogenicity.
Doses of the other preparations could be further escalated safely,
but doses here were limited by expense (all of the commercially
available astragalosides and flavonoids) or volume (Astragalus
extracts).
Compared to the quantities of astragalosides and flavonoids described
by Qi and Yu in whole Astragalus root preparations, the
ethanol extraction procedure that we utilized did purify the astragalosides
by several fold and most of the flavonoids by 4–30
fold [26, 27]. Consistent adjuvant activity was demonstrated in
our experiments with the 500 µg and 2 mg doses of this 95%
EtOH extract of Astragalus. At the 1000 µg dose level, there are
less than 2 µg of any of the major individual astragalosides or
flavonoids known to be in Astragalus (see l " Table 3 under 95%
EtOH extract). A mixture of the 6 astragalosides and flavonoids
most highly expressed in the 95% EtOH extract of astragalus was
tested at the 20 and 100 µg dose levels. Significantly increased
antibody titers resulted against MUC1 at the lower mixture dose
and against MUC1 and KLH at the 100 µg dose level (l " Table 5).
The 100 µg dose level contained 23 µg of calycosin, formononetin,
and astragaloside I, 15 µg of calycosin-7-O-β-D-glucoside, and
8 µg of astragaloside II and astragaloside IV. None of these individual
doses resulted in demonstrable adjuvant activity, so cer-
Original Papers
Table 5 Median ELISA antibody titers after vaccination with MUC1-KLH plus
Astragalus extract, subfractions, astragalosides, flavonoids, or a mixture of
astragalosides and flavonoids.
MUC1-KLH MUC1 Mann- KLH Mann- Endotoxin
vaccine plus IgG Whitney IgG Whitney EU/dose
Calycosin 20 µg 320 0.214 400 0.608
Calycosin 100 µg 640 0.048 1600 0.075 < 0.06 EU
Calycosin-7-O-β-Dglucoside
20 µg
160 0.901 400 0.295
Calycosin-7-O-β-Dglucoside
100 µg
160 0.901 400 0.366
Formononetin 20 µg 320 0.138 400 0.366
Formononetin
100 µg
1 280 0.016 1600 0.179 < 0.06 EU
Astragaloside I
100 µg
320 0.069 1600 0.142
Astragaloside I
500 µg
2 560 0.009 1600 0.058
Astragaloside II 20 µg 1 280 0.016 1600 0.075
Astragaloside II
100 µg
1 280 0.004 25600 0.002 0.018 EU
Astragaloside IV
20 µg
320 0.268 1600 0.143
Astragaloside IV
100 µg
2 560 0.003 6400 0.011 < 0.005 EU
Astragalus 95% EtOH
extract crude
500 µg
640 0.122 400 0.366 < 0.009 EU
Astragalus 95% EtOH
extract crude 2 mg
640 0.026 1600 0.031 0.035 EU
Astragalus 95% EtOH
subfraction F1
100 µg
640 0.048 400 0.366
Astragalus 95% EtOH
subfraction F1
500 µg
320 0.048 400 0.366
Astragalus 95% EtOH
subfraction F2
100 µg
640 0.019 1600 0.075
Astragalus 95% EtOH
subfraction F2
500 µg
2 560 0.012 6400 0.011
Astragalus 95% EtOH
subfraction F3
100 µg
800 0.122 1600 0.432
Astragalus 95% EtOH
subfraction F3
500 µg
640 0.031 1600 0.020
Mixture 20 µg 640 0.036 400 0.661
Mixture 100 µg 1 280 0.026 1600 0.015
OPT-821 20 µg 1 280 0.007 102400 0.002 < 0.005 EU
Endotoxin 2 EU 2 560 0.004 6400 0.007
No adjuvant
(10 mice)
60 400
* Median antibody titer of 5 mice. ** Mixture is Calycosin, Calycosin-7-O-β-D-glucoside,
formononetin, astragaloside I, astragaloside II, and astragaloside IV in weight of
3, 2, 3, 3, 1, and 1
tainly the 20 µg mixture dose and probably the 100 µg dose demonstrated
more than additive reactivity.
Hong F et al. The Known Immunologically… Planta Med 2011; 77: 817–824
821

822
Original Papers
Table 6 Median ELISA antibody titers after vaccination with MUC1-KLH plus
or minus Astragalus extract, astragaloside IV, OPT-821, and endotoxin.
MUC1-KLH vaccine plus: KLH IgG Mann-Whitney
Astragalus 95% EtOH crude extract 2 mg 25600 0.011
Astragaloside IV 100 µg 25600 0.050
OPT-821 20 µg 102400 < 0.001
Endotoxin 0.5 EU 6400 0.259
Endotoxin 0.1 EU 6400 0.125
Endotoxin 0.02 EU 6400 0.178
No adjuvant (10 mice) 6400
* Median antibody titer of 5 mice
Discussion
!
We have identified saponins and in particular the saponin fraction
QS-21 and the semisynthetic saponin mix GPI-0100 as
uniquely potent immunological adjuvants when mixed with conjugate
vaccines containing glycolipids or peptides chemically
conjugated to keyhole limpet hemocyanin (KLH) [2,17]. The maximal
doses of QS-21 used in mice (20 µg) and patients (100 µg)
were selected based on toxicity, acceptable weight loss in mice,
and acceptable local erythema/induration and systemic flu-like
symptoms in patients [18]. The quest continues for immunological
adjuvants with more potent adjuvant activity and more limited
local and systemic toxicities. While most studies have been
focused on Quillaja saponaria saponins, there are many additional
botanicals expressing other saponins. A possible case in point is
Astragalus membranaceus which we have demonstrated previously
[3] and demonstrate here to have significant adjuvant activity
in the 95% ethanolic subfraction.
A. membranaceus is a well-known traditional Chinese medicinal
plant used widely for a variety of indications. The applicable part
of Astragalus is the root. Astragalus root preparations contain a
variety of constituents thought to be immunologically active including
isoflavonoids and triterpene saponins (primarily multiple
astragalosides), as well as a variety of other components including
polysaccharides, multiple trace minerals, amino acids,
and coumarins [19–23]. We have attempted to identify the components
with greatest adjuvant activity in our model by further
fractionating the 95% ethanolic Astragalus fraction into 3 fractions
containing saponins, flavonoids, and the remainder, and
Hong F et al. The Known Immunologically … Planta Med 2011; 77: 817–824
by testing the commercially available components which include
the 3 major saponins and most of the major flavonoids. We demonstrate
here that the 95% ethanolic subfraction of A. membranaceus
(the saponin rich fraction) augments antibody responses
not only against strong xenoantigens such as KLH but also against
moderately immunogenic peptides such as MUC1 and weak glycolipid
autoantigens such as globo H by 4- to 20-fold in different
experiments. At least 15 separate saponins have been identified
among A. membranaceus saponins and their chemical structures
defined [21]. Four of these (astragalosides I–IV), the most heavily
expressed, are commercially available. While purifying the other
11 individual saponins from extracted saponins for use as adjuvants
would be difficult, the recent description of the total
chemical synthesis of QS-21 [24] raises the possibility that these
remaining individual A. membranaceus saponins could be synthesized.
The described low hemolytic activity of these saponins
and their potent adjuvant activity suggest that this might be a
fruitful approach to identification of new adjuvants. It is expected
that even among this family of saponins, some would have greater
or lesser toxicity and that this might be distinct from their adjuvant
activity.
We have now conducted a quantitative analysis of the saponins
and flavonoids present in the 95% ethanol fraction. Most of the
major peaks have been identified and quantitated previously
and are available commercially. Consequently, we were able to
explore the immunological adjuvant potency of these components
in the context of antibody response against our KLH conjugate
vaccines. We confirmed the safety and adjuvant potency of
astragalosides II and IV which are clearly the most immunologically
active of the various components present in the 95% ethanol
extract of Astragalus but also identified a variety of flavonoids
with significant adjuvant activity. Each of these components
were well tolerated at immunologically active doses with only astragaloside
II at a dose of 500 µg inducing significant weight loss
after each immunization.
None of the flavonoids demonstrated detectable immunological
activity in our model at doses of 100 µg or lower, and even astragalosides
II and IV, the most active Astragalus components, demonstrated
only low level activity at a dose of 20 µg and no detectable
activity at a dose of 4 µg. The 500 µg dose of 95% ethanolic
fraction of Astragalus contains less than 1.1 µg of astragalosides
II and IV combined and less than 10 µg of the major flavonoids
combined. When the eight active Astragalus components were
Fig. 1 Toxicity study in C57BL/6J female mice injected
s. c. with different doses of astragaloside
compared to 20 µg OPT 821.

mixed together at the ratios detected in the 95% ethanolic extract
and administered at different doses, activity was seen only at the
100 µg total dose but not at the 20 µg dose. This represents 10fold
the amount of this mixture in 500 µg of the 95% EtOH extract
of Astragalus. These results suggest that the immunologic activity
demonstrated by the 95% ethanolic extract of Astragalus is not
determined by any one or two components but by the entire
mix including components not yet detected or at least not identified
here.
The contribution of even low levels of contaminating endotoxin is
always a concern when studying adjuvant activity. The low levels
of endotoxin (0.035 and 0.018 EU) present in the Astragalus 95%
EtOH and astragaloside II extracts, but not in astragaloside IV,
were sufficient to contribute to adjuvant activity. While these
levels of endotoxin were not high enough to explain all or even
most of the adjuvant activity seen with these extracts, they may
have been responsible for a small amount of the activity. Given
the low levels of the known adjuvant active components in the
95% ethanol Astragalus extract, it may be that there are additional
active components yet to be defined. The recent report from
Liu et al. [25] demonstrating that part of the immunological activity
of Radix Astragali and Radix Hedysari resides in their polysaccharides
is consistent with this possibility. It is also possible
that the components are synergistic and more active than the
sum of the immunologic activities of the component parts (including
endotoxin), although this is less likely since the mixture
of known components was not uniquely active.
The consequences of these findings are that there will be no easy
short cuts to determining batch-to-batch immunologic consistency
for different batches of the same Astragalus preparations
or batches obtained from different sources. It also suggests that
studies aimed at determining the relevant bioavailability from
an immunologic point of view of Astragalus after oral ingestion
will be exceedingly difficult given the many individual components
which contribute to activity. Finally, they suggest that astragaloside
IV has a uniquely favorable adjuvant potency/toxicity
ratio and might be an excellent immunological adjuvant for further
study if it could be obtained more economically.
Acknowledgements
!
This project was supported by Grant Number 1 P50 AT002779-01
from the National Center for Complementary and Alternative
Medicine (NCCAM) and the Office of Dietary Supplements
(ODS). Its contents are solely the responsibility of the authors
and do not necessarily represent the official views of the NCCAM,
ODS, or the National Institute of Health.
The authors would like to thank Professor Cao Hui (National Engineering
Research Centre for Modernization of Traditional Chinese
Medicine, Guangdong, China) for the morphological identification
of the root of Astragalus membranaceus.
Affiliations
1 Department of Medicine, Laboratory of Tumor Vaccinology,
Memorial Sloan-Kettering Cancer Center, New York, New York, United States
2 Department of Biological Sciences, Lehman College and
The Graduate Center, City University of New York, Bronx, New York,
United States
3 Department of Medicine, Melanoma Sarcoma Service,
Memorial Sloan-Kettering Cancer Center, New York, New York, United States
4 Institute of Chinese Medicine, The Chinese University of Hong Kong, Shatin,
Hong Kong
5 Department of Medicine, Integrative Medicine Service,
Memorial Sloan-Kettering Cancer Center, New York, New York,
United States
Original Papers
References
1 Ragupathi G, Park TK, Zhang S, Kim IJ, Graeber K, Adluri S, Lloyd KO, Danishefsky
SJ, Livingston PO. Immunization of mice with the synthetic
hexasaccharide Globo H results in antibodies against human cancer
cells. Angew Chem Int Ed Engl 1997; 36: 125–128
2 Kim SK, Ragupathi G, Cappello S, Kagan E, Livingston PO. Effect of immunological
adjuvant combinations on the antibody and T-cell response
to vaccination with MUC1-KLH and GD3-KLH conjugates. Vaccine
2000; 19: 530–537
3 Ragupathi G, Yeung KS, Leung PC, Lee M, Lau CB, Vickers A, Hood C, Deng
G, Cheung NK, Cassileth B, Livingston P. Evaluation of widely consumed
botanicals as immunological adjuvants. Vaccine 2008; 26: 4860–4865
4 Ross GD, Vetvicka V, Yan J, Xia Y, Vetvickova J. Therapeutic intervention
with complement and beta-glucan in cancer. Immunopharmacology
1999; 42: 61–74
5 [No authors listed]. Astragalus membranaceus. Monograph. Altern Med
Rev 2003; 8: 72–77
6 Chu KK, Ho SS, Chow AH. Coriolus versicolor: a medicinal mushroom
with promising immunotherapeutic values. J Clin Pharmacol 2002;
42: 976–984
7 Spellman K, Burns J, Nichols D, Winters N, Ottersberg S, Tenborg M. Modulation
of cytokine expression by traditional medicines: a review of
herbal immunomodulators. Altern Med Rev 2006; 11: 128–150
8 Kamiyama H, Takano S, Ishikawa E, Tsuboi K, Matsumura A. Anti-angiogenic
and immunomodulatory effect of the herbal medicine “Juzentaiho-to”
on malignant glioma. Biol Pharm Bull 2005; 28: 2111–2116
9 Matsumoto T, Sakurai MH, Kiyohara H, Yamada H. Orally administered
decoction of Kampo (Japanese herbal) medicine, “Juzen-Taiho-To”
modulates cytokine secretion and induces NKT cells in mouse liver. Immunopharmacology
2000; 46: 149–161
10 Kodama N, Komuta K, Nanba H. Can maitake MD-fraction aid cancer
patients? Altern Med Rev 2002; 7: 236–239
11 Smith JESR. Immunomodulatory activities of mushroom glucans and
polysaccharide-protein complexes in animals and humans, Chapter 6.
London: Cancer Res UK 2002; 106
12 Maheshwari RK, Singh AK, Gaddipati J, Srimal RC. Multiple biological activities
of curcumin: a short review. Life Sci 2006; 78: 2081–2087
13 Xiao W, Wang Q, Unachukwu U, Lau CB, Jiang B, Hong F, Leung PC, Motley
T, Livingston P, Cassileth B, Kennelly E. Chemical and genetic assessment
of commercial Radix Astragali (Astragalus spp.) by ion trap LC‑MS
and nuclear ribosomal DNA sequence analyses. J Agric Food Chem, in
press
14 Ragupathi G, Cappello S, Yi SS, Canter D, Spassova M, Bornmann WG,
Danishefsky SJ, Livingston PO. Comparison of antibody titers after immunization
with monovalent or tetravalent KLH conjugate vaccines.
Vaccine 2002; 20: 1030–1038
15 Ragupathi G, Meyers M, Adluri S, Howard L, Musselli C, Livingston PO. Induction
of antibodies against GD3 ganglioside in melanoma patients
by vaccination with GD3-lactone-KLH conjugate plus immunological
adjuvant QS‑21. Int J Cancer 2000; 85: 659–666
16 Gilewski T, Adluri S, Ragupathi G, Zhang S, Yao TJ, Panageas K, Moynahan
M, Houghton A, Norton L, Livingston PO. Vaccination of high-risk breast
cancer patients with mucin-1 (MUC1) keyhole limpet hemocyanin
conjugate plus QS‑21. Clin Cancer Res 2000; 6: 1693–1701
17 Kim SK, Ragupathi G, Musselli C, Choi SJ, Park YS, Livingston PO. Comparison
of the effect of different immunological adjuvants on the antibody
and T-cell response to immunization with MUC1-KLH and GD3-KLH
conjugate cancer vaccines. Vaccine 1999; 18: 597–603
18 Livingston PO, Adluri S, Helling F, Yao TJ, Kensil CR, Newman MJ, Marciani
D. Phase 1 trial of immunological adjuvant QS‑21 with a GM2 ganglioside-keyhole
limpet haemocyanin conjugate vaccine in patients with
malignant melanoma. Vaccine 1994; 12: 1275–1280
19 Chu DT, Wong WL, Mavligit GM. Immunotherapy with Chinese medicinal
herbs. II. Reversal of cyclophosphamide-induced immune suppression
by administration of fractionated Astragalus membranaceus in
vivo. J Clin Lab Immunol 1988; 25: 125–129
20 Sun HX, Qin F, Ye YP. Relationship between haemolytic and adjuvant activity
and structure of protopanaxadiol-type saponins from the roots
of Panax notoginseng. Vaccine 2005; 23: 5533–5542
Hong F et al. The Known Immunologically… Planta Med 2011; 77: 817–824
823

824
Original Papers
21 Yang ZG, Sun HX, Fang WH. Haemolytic activities and adjuvant effect of
Astragalus membranaceus saponins (AMS) on the immune responses to
ovalbumin in mice. Vaccine 2005; 23: 5196–5203
22 Leung AY, Foster S. Encyclopedia of common natural ingredients used in
food, drugs and cosmetics, 2nd edition. New York, NY: John Wiley &
Sons; 1996
23 Upton RSC. Astragalus root: Analytical, quality control, and therapeutic
monograph. Scotts Valley: American Herbal Pharmacopoeia; 1999:
1–25
24 Kim YJ, Wang P, Navarro-Villalobos M, Rohde BD, Derryberry J, Gin DY.
Synthetic studies of complex immunostimulants from Quillaja saponaria:
synthesis of the potent clinical immunoadjuvant QS-21Aapi. J Am
Chem Soc 2006; 128: 11 906–11 915
Hong F et al. The Known Immunologically … Planta Med 2011; 77: 817–824
25 Liu J, Hu X, Yang Q, Yu Z, Zhao Z, Yi T, Chen H. Comparison of the immunoregulatory
function of different constituents in radix astragali and
radix hedysari. J Biomed Biotechnol 2010; 2010: 479426
26 Qi LW, Yu QT, Li P, Li SL, Wang YX, Sheng LH, Yi L. Quality evaluation of
Radix Astragali through a simultaneous determination of six major active
isoflavonoids and four main saponins by high-performance liquid
chromatography coupled with diode array and evaporative light scattering
detectors. J Chromatogr A 2006; 1134: 162–169
27 Yu QT, Qi LW, Li P, Yi L, Zhao J, Bi Z. Determination of seventeen main
flavonoids and saponins in the medicinal plant Huang-qi (Radix astragali)
by HPLC‑DAD-ELSD. J Sep Sci 2007; 30: 1292–1299

Chemical Composition, Acute Toxicity,
and Antinociceptive Activity of the Essential Oil
of a Plant Breeding Cultivar of Basil
(Ocimum basilicum L.)
Authors Antônio Medeiros Venâncio 1,2 , Alexandre Sherlley Casimiro Onofre 2 , Amintas Figueiredo Lira 2 ,
Péricles Barreto Alves 3 , Arie Fitzgerald Blank 4 , Ângelo Roberto Antoniolli 2 , Murilo Marchioro 2 ,
Charles dos Santos Estevam 2 , Brancilene Santos de Araujo 2
Affiliations The affiliations are listed at the end of the article
Key words
l " Ocimum basilicum L.
l " Lamiaceae
l " lethal dose
l " central nervous system
l " central antinociception
l " peripheral antinociception
received June 7, 2010
revised Nov. 7, 2010
accepted Nov. 15, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250607
Published online December 14,
2010
Planta Med 2011; 77: 825–829
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Brancilene Santos de Araujo
Departamento de Fisiologia
Universidade Federal de Sergipe
Laboratório de Bioquímica
de Produtos Naturais
Campus São Cristovão
CEP 49100-000
Aracaju, SE
Brasil
Phone: + 55 7921 0566 47
Fax: +557921056647
bsa@ufs.br
Abstract
!
Ocimum basilicum L. is an aromatic herb used in
Brazil to treat illnesses such as respiratory and
rheumatic problems, vomiting, and pain. In the
present study, the chemical composition, acute
toxicity, and antinociceptive effects of the essential
oil (EO) of the cultivar “Maria Bonita” obtained
from O. basilicum L. PI 197442 genotype
were evaluated in Swiss mice (20–35 g each). Lethal
dose to cause 50% death (LD50) was calculated
from a dose-response curve (100–5000 mg/
kg body wt.; n = 6) as 532 mg/kg body wt. In the
acetic acid-induced writhing test (0.6% i. p.), EO
(50, 100, and 200 mg/kg body wt., n = 8, s. c.) was
Introduction
!
According to the World Health Organization, 80%
of the world population use plants to treat illnesses,
such as microbial and viral diseases, inflammation,
and pain [1]. In this context, culinary
herbs and their essential oils bring benefits to human
health and can be consumed in natura or
added to improve flavor, taste, and the therapeutic
potential of food. Plants can produce several
medicinal effects in the organism, such as antinociception.
They are active against inflammation
and pain by modulating genes, receptors, and enzymes
involved in the inflammatory cascade.
They can be used associated with nonsteroidal
anti-inflammatory drugs (NSAIDs) to attenuate
side effects during the treatment of mucosal erosion
and ulcers in the intestine, perforation and
hemorrhage, kidney damage, and increased blood
pressure [2, 3].
Ocimum (Lamiaceae) is a genus that comprises
more than 150 species, which are distributed
from tropical to subtropical regions [4–6]. The essential
oil of many Ocimum species is used to treat
headaches, diarrhea, helminthes infestation, in-
Original Papers
effective in reducing the abdominal contractions
at all doses (48–78%). In the hot-plate test, EO significantly
increased the latency at 50 mg/kg body
wt. at all times (37–52%, n = 8, s.c.). However, the
effects of morphine and EO at 50 mg/kg were reverted
in the presence of naloxone, an opioid antagonist.
In the formalin test, EO significantly reduced
paw licking time in the first and second
phases of pain at 200 mg/kg body wt. (38 and
75%, respectively, n = 8, s. c.). The results suggested
that the peripheral and central antinociceptive
effects of EO are related to the inhibition
of the biosynthesis of pain mediators, such as
prostaglandins and prostacyclins, and its ability
to interact with opioid receptors.
flammation, and pain [1, 7,8]. It is also used in
the pharmacy, perfume, and cosmetics industries
because of its odorant, bactericide, fungicide, and
insect repellent properties. A chromatographic
analysis of the essential oils showed that plants
from this genus are rich in volatile constituents
such as linalool, geraniol, citral, alcanfor, eugenol,
thymol, 1,8-cineole, and neryl acetate [1, 4–6].
Ocimum basilicum L. is a perennial plant with yellow,
white, and violet flowers, and oval leaves
which have a sharp tip. This plant is cultivated
and sold in Brazil as a culinary herb [9,10]. Extracts
of its aerial parts and essential oil have repellent,
antispasmodic, sedative, antioxidant,
antimicrobial, antiviral, and cardiotonic activities,
which are attributed to the presence of apigenin,
linalool, and ursolic acid. It is active against respiratory
and rheumatic problems, vomiting, and
stomach aches [4, 9–12]. Although it is used to
treat inflammation and pain, little is known about
its antinociceptive mechanisms. In addition, there
is little information about the acute toxicity of the
plant, mainly its essential oil, despite the fact that
its leaves and stems are used in the popular cuisine
as an ingredient in salads and stuffing. A
Medeiros Venâncio A et al. Chemical Composition, Acute … Planta Med 2011; 77: 825–829
825

826
Original Papers
plant breeding study with a genotype of O. basilicum was performed
in the Department of Agronomical Engineering of the
Federal University of Sergipe in Brazil, resulting in one cultivar,
named “Maria Bonita”, which was adapted for use in the northeast
of Brazil [13]. In this study, we investigated the chemical
composition, toxicity, and antinociceptive activity of the essential
oil extracted from the leaves of “Maria Bonita”.
Materials and Methods
!
Drugs and reagents
Morphine sulfate (Dimorf ® , 99%) and naloxone hydrochloride
(Narcan ® , 99%) were purchased from Cristália do Brasil S/A. Propylene
glycol, formaldehyde, and acetic acid were from Vetec. All
other drugs and reagents used were of analytical grade.
Plant material
Voucher specimens of the cultivar used in the present study were
deposited in the Herbarium of the Federal University of Sergipe
under the number 13162. They resulted of a plant breeding study
with the O. basilicum PI 197442 genotype obtained from the
Germplasm Bank at the North Central Regional Plant Introduction
Station, Iowa State University, USA [13]. Briefly, the genotype
was cultivated in the Experimental Field of the Federal University
of Sergipe (EF‑FUS), Brazil, and plants of the first and second generations
were selected based on their essential oil yield and linalool
content to be introduced in cages without pollinating
agents so that they could autopollinate. “Maria Bonita” (PI
197442-S3-bulk 5) was one of the cultivars resulting of the autopollination
and was chosen for the present study due to its highest
essential oil yield and linalool content. Fresh leaves of the cultivar
were obtained from the Medicinal Plant Garden at the
EF‑FUS and were dried (45 °C) for use in the present study.
Essential oil extraction and analysis
The essential oil (EO) of the leaves (600 g) was extracted by hydrodistillation
in a Klavenger apparatus to give 28.5 mL of EO
with a yield of 4.8% (v/w) and density of 0.87 g/mL. The components
of EO were determined by gas chromatography coupled to
mass spectrometry (GC‑MS) using a Shimadzu DC17A instrument.
The GC separation was performed on a column DB-5 ms
(30 m × 0.25 mm i. d., film thickness 0.25 µm) with the following
oven program: (a) 80 °C, (b) increase at a rate of 3°C/min up to
180 °C, and (c) increase at a rate of 10 °C/min up to 300 °C. Sample
injections (2 µL) were performed in the split mode (1 : 100) at
250 °C using helium as the carrier gas (1 mL/min). The mass spectrometer
ionization energy was 70 eV with a scan time of 1 s and
temperatures of 200 °C (ion source) and 280 °C (analyzer).
Animals
Swiss male and female mice (20–35 g) were used in the present
study. The animals were kept in plastic boxes at standard environmental
temperature (25 ± 1 °C) and fed with food and water
ad libitum. Feeding was interrupted 12 h before the antinociceptive
assays. All mice were treated in accordance with the guidelines
approved by the Ethics Committee for Research on Animals
of the Federal University of Sergipe.
Medeiros Venâncio A et al. Chemical Composition, Acute … Planta Med 2011; 77: 825–829
Acute toxicity
The 50% lethal dose (LD50) of EO was determined to find out the
acute toxicity. A prior study was performed by intraperitoneal
administration of aqueous solutions of EO to mice at 1000, 3000,
and 5000 mg/kg body weight (n = 6 each group). Subsequently,
groups of six mice received doses of 100, 250, 500, 1000, and
1500 mg/kg body weight and were surveyed. On the first days,
the animals were observed every 10 min followed by 24, 48, and
72 h observations for any changes in spontaneous motor activity,
gate, respiration, writhing, piloerection, etc., and up to 30 days for
mortality. The LD 50 was determined by logarithmic regression
analysis of the death numbers using the Probit method. Concentrations
used in the pharmacological tests were below the LD50 to
reduce the interferences of EO in the results due to its toxicity
whose signs can be confused with the ones for antinociceptive
behavior.
Acetic acid-induced abdominal writhings in mice
The antinociceptive effect was evaluated according to a method
previously described [14]. Briefly, three experimental groups received
EO at 50, 100, and 200 mg/kg (s. c., diluted in the vehicle
50% propylene glycol in saline), while another group received indomethacin
as the positive control (10 mg/kg body weight, s. c.).
All animals received intraperitoneal injections of 0.6% acetic acid
(0.1 mL/10 g body weight, i. p.) to induce abdominal muscle contractions
and/or stretching of the legs 30 min after the treatment.
The negative control groups received the vehicle (s. c.). After
10 min of the acetic acid injection, the number of writhings was
registered for 20 min for the mice in each group (n = 8).
Hot plate test
The antinociceptive assay was performed according to the classical
hot-plate technique [15]. Briefly, the animals were treated
with vehicle 50% propylene glycol in saline (s. c.), morphine
(10 mg/kg body weight, s. c.), morphine (10 mg/kg body weight,
s. c.) plus naloxone (5 mg/kg body weight, i. p.), EO extract (50,
100, and 200 mg/kg body weight, s. c.), and EO (50 mg/kg, s. c.)
plus naloxone (5 mg/kg, i.p.) 30 min before the beginning of the
experiment. In the groups treated with naloxone, it was administered
15 min before the treatment with morphine or EO. The latency
time for the mice to lick their paws in each group (n = 8)
was registered during the maximum period of 30 s at intervals
of 0, 15, 30, and 60 min.
Formalin test
Animals (n = 8) were preadapted for 10 days to the surrounding
environment before the formalin test took place [16]. They were
treated with vehicle 50% propylene glycol in saline (s. c.), morphine
(10 mg/kg body weight, s. c.), and EO extract (50, 100, and
200 mg/kg body weight, s. c.) 30 min before the injection of 1%
formalin (20 µL/animal, s. c.) in the hind paw. The negative control
group received only vehicle. The pain reaction observations
were registered immediately after the formalin injection utilizing
a stopwatch for registering the time that the animals remained
paw licking or biting during the first phase (0–5 min) and the second
phase (20–25 min) of the test.
Statistical analysis
Results were expressed as mean ± SEM. Data were analyzed by
ANOVA followed by Dunnettʼs test for comparison. Differences
were considered significant when p < 0.05.

Results and Discussion
!
“Maria Bonita”, a cultivar of O. basilicum obtained in a plant
breeding study, was not characterized beyond the increase in EO
yield (from 2.5 to 4.8%) and linalool content (61.6 to 69.5%) [13].
Therefore, the complete chemical composition, acute toxicity,
and antinociceptive potential of EO from its leaves were investigated
in the present study.
Twenty-seven compounds were identified out of thirty-eight
peaks in the EO GC‑MS chromatograms (l " Table 1). The essential
oil consisted mainly of linalool, geraniol, 1,8-cineole, neryl acetate,
and α-trans-bergamotene, representing 94.3%. The components
were separated into aliphatic monoterpenes, cyclic monoterpenes,
bycyclic monoterpenes, oxygenated monoterpenes, cyclic
sesquiterpenes, bycyclic sesquiterpenes, oxygenated sesquiterpenes,
and aliphatic secondary alcohols.
The EO acute toxicity was investigated before the antinociceptive
study. Our results revealed no signs of toxicity or mortality under
250 mg/kg, while animal mortality rates ranged from 16.6 to
100% with this and other concentrations. The LD50 was 532 mg/
kg and may be related to the higher content of linalool because
its reported mice intraperitoneal LD50 is well documented in the
literature ranging from 200 to 1200 mg/kg [17]. Geraniol and 1,8cineole,
also known for their toxicity, may be contributing to the
total toxicity of EO. Therefore, EO in the therapeutic doses used in
our study was not toxic, since the highest dose to produce antinociception
(200 mg/kg) is less than LD50, which indicates its potential
as a therapeutic agent.
EO was significantly active (p < 0.01) in all tested concentrations,
reducing muscle contractions induced by the acetic acid in a
dose-dependent manner (48–78%, l " Fig. 1) when the antinociceptive
effect on the abdominal writhings was evaluated. The intraperitoneal
administration of acetic acid irritates the gastric serous
membrane and produces abdominal writhings due to inflammation,
which is the peripheral component of pain. The inflammatory
response is associated with the release of mediators
such as prostaglandins. The action of anti-inflammatory substances
such as indomethacin results in the inhibition of the enzyme
cyclooxygenase in the arachidonic acid pathway, preventing
the biosynthesis of prostaglandins and prostacyclins and reducing
pain [18, 19].
In the hot-plate test, the antinociceptive potential is characterized
by the behavior of the animal model (biting or licking the
paw) as a response to an external pain stimulus, while the latency
is the time (seconds) before this response emerges [20]. The hotplate
test revealed that EO at 50 mg/kg significantly increased the
time (37–52%, p < 0.05) for mice response to the thermal stimulus
at all analyzed time points (l " Fig. 2 A–D), although it was not
comparable to morphine (up to 151%, l " Fig. 2 B), the positive
control of analgesia. Naloxone was used to determine if EO mimicked
the morphine mechanism of action on opioid receptors.
The effects of morphine and EO at 50 mg/kg were reverted in
the presence of naloxone, which suggests that opioid receptors
are involved in the EO antinociceptive action [19,21, 22].
The EO effect on the first and second phase of pain during the formalin
test was characterized by the reduction of the paw licking
time after the formalin stimulus. The results suggested that its action
on the central and peripheral components of pain might be
dose-dependent because both pain phases were significantly affected
(p < 0.05) only at the highest dose employed, 200 mg/kg,
with 38% (33.97 ± 4.38 s) and 75% (9.13 ± 2.93 s) of paw licking
time reduction, respectively (l " Fig. 3A–B). At 100 mg/kg, EO had
Original Papers
Table 1 Chemical composition of the “Maria Bonita” cultivar essential oil determined
by GC‑MS analysis.
Peak Rt (min) Compound % IRRP exp. IRR lit.
1 4.700 α-pinene 0.19 933 939
2 5.533 sabinene 0.28 972 976
3 5.592 1-octen-3ol 0.07 975 978
4 5.683 β-pinene 0.70 979 980
5 5.850 myrcene 0.14 987 991
6 6.967 limonene 0.20 1029 1031
7 7.050 1,8-cineol 7.47 1035 1033
8 7.375 (Z)-β-ocimene 0.13 1043 1040
9 7.767 γ-terpinene 0.04 1057 1062
10 8.125 – 0.04 1069 –
11 8.583 iso-terpinolene 0.06 1085 1086
12 8.708 – 0.05 1089 –
13 8.992 linalool 69.54 1099 1098
14 10.233 (E)-miroxide 0.13 1137 1142
15 11.292 – 0.12 1169 –
16 11.392 – 0.06 1172 –
17 11.650 terpin-4-ol 0.10 1180 1177
18 12.117 α-terpineol 0.76 1194 1189
19 13.075 – 0.08 1282 –
20 13.542 β-citral 0.11 1236 1240
21 13.933 geraniol 12.55 1249 1255
22 14.542 geraranial 0.18 1265 1270
23 15.158 bornyl acetate 0.29 1283 1285
24 16.458 – 0.10 1321 –
25 16.983 – 0.04 1337 –
26 18.275 neryl acetate 3.58 1375 1365
27 18.725 β-elemene 0.07 1388 1391
28 19.725 β-caryophyllene 0.12 1418 1418
29 20.133 α-trans-bergamotene 1.17 1431 1436
30 20.917 α-humulene 0.04 1455 1454
31 21.100 cis-muurola-4(14)-5-diene 0.06 1460 1460
32 21.717 germacrene-D 0.29 1479 1480
33 21.800 – 0.07 1482 –
34 22.375 – 0.06 1499 –
35 22.567 – 0.06 1506 –
36 22.733 γ-cadinene 0.33 1511 1513
37 25.892 – 0.07 1613 –
38 26.667 epi-α-cadinol 0.65 1639 1640
Fig. 1 Effect of the essential oil of “Maria Bonita” Ocimum basilicum EO
and indomethacin on the abdominal writhings induced by acetic acid
(Dunnettʼs test; ** p < 0.01; n = 8). Abdominal writhing inhibitions for each
treatment are indicated as a percentage.
Medeiros Venâncio A et al. Chemical Composition, Acute … Planta Med 2011; 77: 825–829
827

828
Original Papers
Fig. 2 Antinociceptive effect of “Maria Bonita” Ocimum basilicum EO and
morphine on the pain response induced by heat in mice during the hot-plate
test at 0 (A), 15 (B), 30 (C), and 60 (D) min (Dunnettʼs test; * p < 0.05;
a significant antinociceptive effect only on the second phase of
pain (p < 0.05), causing a reduction of 70% (10.73 ± 3.16 s) in the
paw licking time (l " Fig. 3B). The first phase of pain is neurogenic
and occurs through nociceptive neuronal activation by direct action.
The second phase occurs through ventral horn neuronal activation
at the spinal cord level, which is characterized by inflammation
and sensitivity to NSAIDs [19, 22]. Drugs that present central
action, such as narcotics (morphine), inhibit the two phases
of pain, while peripheral drugs only inhibit the second phase [19,
23]. Morphine and EO at 200 mg/kg revealed an antinociceptive
effect on both phases, which suggests that EO has central and peripheral
action.
It is known that (−)-linalool, the main component of EO, causes
multiple effects on the central nervous system such as removing
nonselectively voltage-gated currents in sensory and nonsensory
neurons [24]. (−)-Linalool affects β waves of the human brain [24,
25] and inhibits the neurons in the cerebral cortex of glutamatergic
mice [24]. (−)-Linalool has local anesthetic, anticonvulsant
activities [26, 27], sedative effect on vertebrates, including humans
[24, 25], and can significantly inhibit the carrageenan-induced
paw edema in mice. The anti-inflammatory, antinociceptive,
and antihyperalgic properties suggest that this compound
can be used to reduce or eliminate pain associated with neuronal
sensitization [28]. The antinociceptive activity seems to be associated
with linalool acting on K + -ATP channels, which has an important
role in pain modulation [28], and the antagonistic com-
Medeiros Venâncio A et al. Chemical Composition, Acute … Planta Med 2011; 77: 825–829
** p < 0.01; n = 8). Percentage indicates the increase in the latency time for
each time and treatment.
petition for the opioid receptor N-methyl-D-aspartate (NMDA)
[26, 29,30]. The NMDA receptor inhibition produces antinociception
[28]. The results of the present study combined with the
ones of the literature suggest that linalool may be the component
of EO responsible for its antinociceptive properties.
The present study demonstrated that “Maria Bonita” EO at
200 mg/kg can be considered of main interest because it showed
a higher inhibition of the peripheral (75–78%) and central (38%)
pain, mainly in the nociception caused by a chemical stimulus
(acetic acid and formalin), while the concentration of 50 mg/kg
was active in the thermal stimulus. The central activity observed
in the thermal stimulus seems to be associated with opioid receptors
due to the inhibition of the EO effect in the presence of
naloxone, a know antagonist of these nociceptive receptors. The
peripheral activity may be associated with the prevention of the
biosynthesis of prostaglandins and prostacyclins, which are inflammatory
mediators. Therefore, the essential oil of this plant
breeding cultivar showed pharmacological potential.
Acknowledgements
!
The authors want to thank specifically Prof. Dr. Arie F. Blank for donating
the botanical material, Prof. Dr. Gileno de Sá Cardoso for
hosting part of the experimental studies in his laboratory, and all
the people who directly and indirectly cooperated with us.

Fig. 3 Antinociceptive effect of “Maria Bonita”Ocimum basilicum EO and
morphine during the first (A) and second (B) phases of the formalin test
(Dunnettʼs test; * p < 0.05; ** p < 0.01; n = 8). The reduction of the paw
licking or biting time is indicated by percentage.
Affiliations
1 Secretaria de Estado da Saúde, Centro de Investigação Toxicológica,
Aracaju, SE, Brazil
2 Departamento de Fisiologia, Universidade Federal de Sergipe,
São Cristovão, SE, Brazil
3 Departamento de Química, Universidade Federal de Sergipe,
São Cristovão, SE, Brazil
4 Departamento de Engenharia Agronômica,
Universidade Federal de Sergipe, São Cristovão, SE, Brazil
References
1 Adigüzel A, Gulluce M, Sengul M, Ogutcu H, Sahin F, Karaman I. Antimicrobial
effects of Ocimum basilicum (Labiatae) extract. Turkish J Biol
2005; 29: 155–160
2 Dog TL. A reason to season: the therapeutic benefits of spices and culinary
herbs. Explore J Sci Healing 2006; 2: 446–449
3 Hajhashemi A, Sajjadi SE, Heshmati M. Anti-inflammatory and analgesic
properties of Heracleum persicum essential oil and hydroalcoholic
extract in animal models. J Ethnopharmacol 2009; 124: 475–480
4 de Paula JP, Carneiro MRG, Paumgartten FJR. Chemical composition,
toxicity and mosquito repellency of Ocimum selloi oil. J Ethnopharmacol
2003; 88: 253–260
5 Makonnen E, Debella A, Zerihun L, Abebe D, Teka F. Antipyretic properties
of the aqueous and ethanol extracts of the leaves of Ocimum suave
and Ocimum lamiifolium in mice. J Ethnopharmacol 2003; 88: 85–91
Original Papers
6 Telci I, Bayram E, Yilmaz G, Avci B. Variability in essential oil composition
of Turkish basils (Ocimum basilicum L.). Biochem Syst Ecol 2006;
34: 489–497
7 Pessoa LM, Morais SM, Bevilaqua CM, Luciano JHS. Anthelmintic activity
of essential oil of Ocimum gratissimum Linn. and eugenol against Haemonchus
contortus. Vet Parasitol 2002; 109: 59–63
8 Franca CS, Menezes FS, Costa LCB, Niculau ES, Alves PB, Pinto JEB, Marçal
RM. Analgesic and antidiarrheal properties of Ocimum selloi essential
oil in mice. Fitoterapia 2008; 79: 569–573
9 Boskabady MH, Kiani S, Haghiri B. Relaxant effects of Ocimum basilicum
on guinea pig tracheal chains and its possible mechanisms. Daru 2005;
13: 28–33
10 Chiang LC, Ng LT, Cheng PW, Chiang W, Lin CC. Antiviral activities of extracts
and selected pure constituents of Ocimum basilicum. Clin Exp
Pharmacol Physiol 2005; 32: 811–816
11 Muralidharan A, Dhananjayan R. Cardiac stimulant activity of Ocimum
basilicum Linn extracts. Indian J Pharmacol 2004; 36: 163–166
12 Carvalho Filho JL, Blank AF, Alves PB, Ehlert PAB, Melo AS, Cavalcanti SCH,
Arrigoni-Blank MF, Silva-Mann R. Influence of the harvesting time,
temperature and drying period on basil (Ocimum basilicum L.) essential
oil. Rev Bras Farmacogn 2006; 16: 24–30
13 Blank AF, Carvalho Filho JLS, Santos Neto AL, Alves PB, Arrigoni-Blank MF,
Silva-Mann R, Mendonça MC. Caracterização morfológica e agronômica
de acessos do manjericão e alfavaca. Hortic Bras 2004; 22: 113–116
14 Koster R, Anderson M, DeBeer MJ. Acetic acid for analgesic screening.
Fed Proc 1959; 18: 412–413
15 Eddy NB, Leimbach D. Synthetic analgesics. II. Dithienylbutenyl and dithienylbutilamines.
J Pharmacol Exp Ther 1953; 107: 385–393
16 Dubuisson D, Dennis SG. The formalin test: a quantitative study of the
analgesic effects of morphine, merepidine and brain stem stimulation
in rats and cats. Pain 1977; 4: 161–174
17 Letizia CS, Cocchiara J, Lalko J, Api AM. Fragrance material review on linalool.
Food Chem Toxicol 2003; 41: 943–964
18 Le Bars D, Gozariu M, Cadden SW. Animal models of nociception. Pharmacol
Rev 2001; 53: 597–652
19 Marchioro M, Arrigoni-Blank MF, Mourão RHV, Antoniolli AR. Anti-nociceptive
activity of the aqueous extract of Erythrina velutina leaves.
Fitoterapia 2005; 76: 637–642
20 Woolfe G, MacDonald AL. The evaluation of the analgesic action of pethidine
hydrochloride (Demerol). J Pharmacol Exp Ther 1994; 80: 300–
307
21 Zakaria ZA, Sulainamn MR, Gopalan HK, Ghani ZDFA, Mohd RNSR, Mat
Jais AM, Abdullah F. Antinociceptive and anti-inflammatory properties
of Corchorus capsularis leaves chloroform extract in experimental animal
model. Yakugaku Zasshi 2007; 127: 359–365
22 Smith HS. Peripherally-acting opioids. Pain Physician 2008; 11: S121–
S132
23 Shibata M, Ohkubo T, Takahashi H, Inoki R. Modified formalin test: characteristic
biphasic pain response. Pain 1989; 38: 347–352
24 Narusuye K, Kawai F, Matsuzaki K, Miyachi E. Linalool suppresses voltage-gated
currents in sensory neurons and cerebellar Purkinje cells.
J Neural Transm 2005; 112: 193–203
25 Sugawara Y, Hara C, Tamura K, Fuji T, Nakamura K, Masujima T, Aoki T.
Sedative effect on humans of inhalation of essential oil of linalool: sensory
evaluation and physiological measurements using optically active
linalool. Anal Chim Acta 1998; 365: 293–299
26 Elisabetsky E, Brum LF, Souza DO. Anticonvulsant properties of linalool
in glutamate-related seizure models. Phytomedicine 1999; 6: 107–113
27 Ghelardini C, Galeotti N, Salvatore G, Mozzanti G. Local anaesthetic activity
of the essential oil of Lavandula angustifolia. Planta Med 1999;
65: 700–703
28 Peana AT, de Montis G, Sechi S, Sircana G, DʼAquila PS, Pippia P. Effects of
(−)-linalool in the acute hyperalgesia induced by carrageenan, L-glutamate
and prostaglandin E2. Eur J Pharmacol 2004; 497: 279–284
29 Silva-Brum LF, Emanuelli T, Souza DO, Elisabetsky E. Effects of linalool
on glutamate release and uptake in mouse cortical synaptosomes.
Neurochem Res 2001; 26: 191–194
30 Peana AT, DʼAquila PS, Chessa ML, Moretti MDL, Serra G, Pippia P.
(−)-Linalool produces antinociception in two experimental models of
pain. Eur J Pharmacol 2003; 460: 37–41
Medeiros Venâncio A et al. Chemical Composition, Acute … Planta Med 2011; 77: 825–829
829

830
Original Papers
Clove Oil Reverses Learning and Memory Deficits
in Scopolamine-Treated Mice
Authors Sumita Halder 1 , Ashish Krishan Mehta 2 , Rajarshi Kar 3 , Mohammad Mustafa 3 ,
Pramod Kumari Mediratta 1 , Krishna Kishore Sharma 1
Affiliations
Key words
l " Eugenia caryophyllata
l " Myrtaceae
l " passive avoidance
l " elevated plus‑maze
l " step‑down latency
l " transfer latency
received June 8, 2010
revised Nov. 10, 2010
accepted Nov. 15, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250605
Published online December 14,
2010
Planta Med 2011; 77: 830–834
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. Pramod
Kumari Mediratta
Department of Pharmacology
University College
of Medical Sciences
(University of Delhi)
Dilshad Garden
Delhi 110095
India
Phone: + 91 9810 5248 79
Fax: +911122590495
drpramod_k@yahoo.com
1 Department of Pharmacology, University College of Medical Sciences, Delhi, India
2 Department of Physiology, University College of Medical Sciences, Delhi, India
3 Department of Biochemistry, University College of Medical Sciences, Delhi, India
Abstract
!
The present study was performed to examine the
effect of Eugenia caryophyllata (Myrtaceae) on
learning and memory, and also evaluate whether
it can modulate oxidative stress in mice. Passive
avoidance step-down task and elevated plusmaze
were used to assess learning and memory
in scopolamine-treated mice. Oxidative stress parameters
were also assessed in brain samples by
estimating the malondialdehyde (MDA) and reduced
glutathione (GSH) levels at the end of the
study. Scopolamine (0.3 mg/kg, i. p.) produced impairment
of acquisition memory as evidenced by
a decrease in step-down latency and an increase
in transfer latency on day 1, and also impairment
of retention of memory on day 2. Pretreatment
Introduction
!
Halder S et al. Clove Oil Reverses… Planta Med 2011; 77: 830–834
Eugenia caryophyllata (Myrtaceae; syn. Syzygium
aromaticum, Caryophyllus aromaticus) commonly
called “clove” is a plant indigenous to Moluca Island
but cultivated in many other parts of the
world including India [1]. In Iran, this plant and
its essential oils have been used as an antiepileptic,
and recent studies have established its anticonvulsant
action [2, 3]. Traditional use of clove
oil includes use in dental care as an antiseptic
and analgesic, the oil being rubbed on the gums
to treat toothaches. Clove oil is widely used in
dentistry to treat dental caries and gingivitis due
to its action against oral bacteria associated with
dental caries and periodontal disease [4,5]. Previous
research has shown antifungal, anticarcinogenic,
antiallergic and antimutagenic activity of
clove oil [6–9]. Its major component is considered
to be eugenol and lesser amounts of beta-caryophyllene
and eugenol acetate [10–12].
Eugenol is reported to activate calcium channels
in dorsal root ganglion cells [13], inhibit calcium
with clove oil (0.05 mL/kg and 0.1 mL/kg) for 3
weeks significantly reversed the increase in acquisition
latency and all the doses (0.025, 0.05,
0.1 mL/kg, i. p.) reversed the increase in retention
latency induced by scopolamine (0.3 mg/kg, i. p.)
in elevated plus-maze. However, 0.05 mL/kg clove
oil attenuated memory deficits in the passive
avoidance step-down task. Brain samples showed
a significant decrease in MDA levels in the group
treated with clove oil (0.05 and 0.025 mL/kg).
GSH levels were also increased in clove oil-treated
mice though the results were not significant.
Thus, it can be concluded that clove oil can reverse
the short-term and long-term memory deficits
induced by scopolamine (0.3 mg/kg, i.p.) and
this effect can, to some extent, be attributed to
decreased oxidative stress.
and potassium channels in guinea pig cardiac
muscles [14] and block the transmission of action
potential in the frog sciatic nerve [15]. Similarly,
beta-caryophyllene, another component of clove
oil has been observed to inhibit calcium and potassium
currents in mammalian cardiac tissues
and abolish conjunctival reflex [14–16]. The role
of clove oil as an antiepileptic suggests its effect
on the central nervous system [3]. It still remains
to be explored whether clove oil has any effect on
learning and memory since many drugs which
are used in the treatment of epilepsy also modulate
cognitive functions [17]. Increased oxidative
stress in the brain has also been suggested to play
a role in memory impairment, and the role of
antioxidants in preventing oxidative stress-induced
memory deficits is well established [18,
19]. Eugenol has been known to demonstrate
neuroprotective action in some studies and to
possess antioxidant properties as well [20–23].
Since eugenol constitutes the major component
of clove oil, it can be possible that clove oil too ex-

hibits such antioxidant potential and modulates memory and
learning processes.
Various animal models have been used to evaluate memory and
learning in animals. The passive avoidance apparatus and the elevated
plus-maze are two such protocols wherein the animal is
trained, and acquisition and retention of task memory are assessed.
Elevated plus-maze (EPM) is a model of anxiety but it
can also be used for the assessment of learning and memory
[24]. In memory assessment, the animal is placed at the end of
the open arm facing outwards (away from the centre), whereas
for the assessment of anxiety, the animal is placed at the centre
of the maze. In both these models, acquisition latency is indicative
of short-term memory, and retention latency denotes longterm
memory in animals [25]. Scopolamine is a known agent
causing memory impairment, and piracetam is a proven nootropic
agent known to improve this scopolamine-induced memory
deficit [26–29].
The present study was undertaken to examine the effect of clove
bud oil on learning and memory and its effects on the parameters
of oxidative stress in mice.
Materials and Methods
!
Animals
Young (6 weeks old) male Swiss albino mice weighing 20–25 g
were used in the study. The animals were procured from the Central
Animal House, University College of Medical Sciences, Delhi.
Animals were housed in groups of 4 per cage with free access to
pellet diet and water in a temperature controlled facility. All the
experiments were performed at daytime between 09:30 and
15:30 h. Care of animals was as per the guidelines of the Committee
for the Purpose of Control and Supervision of Experiments on
Animals (CPCSEA), Ministry of Environment and Forest, Govt. of
India, New Delhi. The study was duly approved by the Institutional
Animal Ethics Committee, University College of Medical Sciences,
Delhi (Approval No. IEC‑AR/10/2008 dated September 26, 2008).
Plant material
Clove bud oil was obtained from M/s. Kancor Ingredients Limited.
As per the literature provided by the manufacturer, the bud oil
was obtained by the steam distillation from the dried flower
buds of Eugenia caryophyllata to obtain a colourless pale yellow
liquid of specific gravity 1.0426 at 25°C and refractive index
1.533 at 20°C (sample code no. 085407, Reference no. 1 of 730/
07-08). The characterisation of a sample of clove bud oil using
GC‑MS revealed a high concentration of eugenol (87.34%), eugenyl
acetate (5.18%), and beta-caryophyllene (2.01%).
For the purpose of the study, the clove bud oil was suspended in
double distilled water along with a few drops of Tween 80 to prepare
solutions of the required doses (0.025, 0.05, 0.1 mL/kg).
Drugs and dosing schedule
Scopolamine (Sigma Aldrich) was dissolved in double distilled
water and administered at a dose of 0.3 mg/kg. Piracetam (Nootropil
– M/s UCB) of 98% purity was administered at 200 mg/kg as
the standard drug.
Animals were divided into six groups (n = 8). Group I was chronically
administered 0.9% saline (i. p. once per day × 3 weeks), and
at the end of 3 weeks, the animals were challenged with saline
only. Group II was also administered 0.9% saline as above and at
the end of 3 weeks was challenged with scopolamine (0.3 mg/kg,
Original Papers
i. p.). Groups III, IV, and V were chronically treated with clove oil
0.025, 0.05, and 0.1 mL/kg/day, i.p., respectively × 3 weeks and at
the end of 3 weeks were challenged with scopolamine (0.3 mg/
kg, i.p.). Group VI was administered piracetam (200 mg/kg,
i. p. × 3 weeks) and at the end of 3 weeks was challenged with
scopolamine (0.3 mg/kg, i. p.). At the end of 3 weeks, the experiments
were performed and the animals were sacrificed to dissect
out the brain for oxidative stress studies.
Assessment of memory and learning
Step-down passive avoidance task: This test was performed by the
method described by Joshi et al. [30] with modifications. The passive
avoidance apparatus consisted of a box (27 × 27 × 27 cm)
having three walls of wood and one wall of Plexiglas, featuring a
grid floor (3 mm stainless steel rods set 8 mm apart) with a
wooden platform (10 × 7 × 1.7 cm) kept at the centre of the grid
floor. Each mouse was placed gently onto the wooden platform
placed in the middle during the training period. When the mouse
stepped down from the platform and placed all its paws on the
grid floor, the unscrambled intermittent electric shock (1 Hz,
0.5 s, 60 V DC) was delivered over a period of 15 s, and the stepdown
latency (SDL) was recorded. SDL was defined as the time
taken by the mouse to step down from the wooden platform to
the grid floor with all its paws on the grid floor. Animals were
then given a second training which was performed 90 min after
the first one. Ninety minutes after the third training on the same
day (day 1), the acquisition test was performed when no electric
shock was given, and SDL was noted. The retention test was performed
24 h after training (on day 2), when each mouse was
again placed on the platform and the SDL was measured. An
upper cut-off time of 600 s was set as per the method described
by Reddy and Kulkarni [31].
Transfer latency (TL) in elevated plus-maze: The test was performed
by the method described by Ukai et al. [32]. On the first
trial (training on day 1), a mouse was placed at the end of one of
the open arms facing away from the central platform, and the
time it took for the mouse to move from the open arm to either
of the enclosed arms (TL) was recorded. If the mouse did not enter
the enclosed arm within 90 s, it was pushed gently to guide its
entrance in the enclosed arm, and in such case the transfer latency
was assigned to 90 s. Then, the mouse was gently taken
out of the plus-maze 10 s after it entered the enclosed arm and
was returned to its home cage. Twenty-four hours later (on day
2), the second trial (retention test) was performed. To accomplish
this, the mouse was again put into the plus-maze, and TL was recorded
up to a maximum of 90 s.
Estimation of oxidative stress: At the end of the study period, i. e.,
after obtaining results of cognitive tests, the animals were sacrificed
by deep ether anaesthesia. The brains were quickly dissected
out, washed with ice-cold sodium phosphate buffer,
weighed and stored over ice. The brains were further processed
within 30 min of dissection, and the estimation of oxidative
stress parameters were conducted on the same working day.
Brain tissue was homogenised with 10 times (w/v) sodium phosphate
buffer (7.4 pH, ice cold, mixture of KH 2PO4 and Na2HPO4).
The homogenate was centrifuged at 3000 rpm for 15 min. The estimated
parameters of oxidative stress were malondialdehyde
(MDA) and reduced glutathione (GSH).
Malondialdehyde (MDA) estimation: Estimation of brain lipid peroxidation
was done by measuring MDA levels, as described by
Ohkawa et al [33]. To 0.5 mL of the supernatant of the homogenate,
acetic acid (20%, pH 3.5) 1.5 mL, thiobarbituric acid (0.8%),
Halder S et al. Clove Oil Reverses… Planta Med 2011; 77: 830–834
831

832
Original Papers
and sodium lauryl sulphate (8.1%) 0.2 mL were added and the
mixture heated at 100 °C for 1 h. After cooling this mixture, 5 mL
of butanol : pyridine (15 : 1 v/v) and 1 mL of distilled water were
added. The mixture was vortexed and then centrifuged at
4000 rpm for 10 min. Thereafter, the organic layer was separated
and the absorbance measured at 532 nm using a spectrophotometer.
Comparing the absorbance with that of a standard of known
concentration, the concentration of MDA was determined by a
linear standard curve and expressed as nmol/g wet brain tissue.
Reduced glutathione (GSH) estimation: GSH was estimated by the
method described by Ellman [34]. To 0.5 mL of the supernatant of
the homogenate obtained above, 1 mL tricarboxylic acid (5%) was
added and centrifuged to remove the proteins. To 0.1 mL of this
homogenate, 4 mL of phosphate buffer (pH 8.4), 0.5 mL of DTNB,
and 0.4 mL double distilled water were added. This mixture was
vortexed and absorbance read at 412 nm within 15 min. Various
concentrations (5–50 µg) of standard glutathione were subjected
to the steps mentioned above and the absorbance plotted against
the known concentrations of GSH to give a standard curve. The
concentration of GSH in the samples were determined by a linear
standard graph and expressed as µg/g wet brain tissue.
Statistical analysis
Results of the above experiments were expressed as mean ± SEM,
and the difference between means was analysed by analysis of
variance (ANOVA) followed by Dunnettʼs multiple comparisons
test.
Results
!
Scopolamine (0.3 mg/kg, i. p.), when administered to the salinetreated
group, was found to significantly increase the acquisition
latency (TL1; p < 0.05) as well as retention latency (TL2; p < 0.01)
compared to the group challenged with saline. Clove oil at doses
of 0.05 mL/kg and 0.1 mL/kg significantly reversed the scopolamine-induced
acquisition deficit (TL1; p < 0.01 and p < 0.05, respectively),
and all the doses reversed retention deficit (TL2) induced
by scopolamine (0.3 mg/kg, i. p.) in elevated plus-maze
(p < 0.001). Piracetam (200 mg/kg, i. p.) pretreatment also reversed
the scopolamine-induced deficit in acquisition (TL1;
p < 0.05) and retention latencies (TL2; p < 0.001) significantly
(l " Fig. 1).
Scopolamine (0.3 mg/kg, i. p.), when administered to the salinetreated
group, was found to significantly decrease (p < 0.05) the
SDL on day 1 (acquisition) as well as on day 2 (retention). At a
dose of 0.05 mL/kg, clove oil significantly attenuated the scopola-
Halder S et al. Clove Oil Reverses… Planta Med 2011; 77: 830–834
mine-induced decrease in SDL on day 1 (acquisition; p < 0.01) as
well as on day 2 (retention; p < 0.05). Treatment with piracetam
(200 mg/kg, i.p.) also reversed the scopolamine-induced acquisition
and retention deficits significantly (p < 0.01) (l " Fig. 2).
Chronic administration of clove oil (0.025 and 0.05 mg/kg, i. p.)
significantly decreased MDA levels as compared to the salinetreated
group (p < 0.01 and p < 0.01, respectively). Piracetam also
showed a significant decrease in MDA levels compared to the saline-treated
group (p < 0.01). GSH levels did not show a significant
increase in any of the treated groups as compared to the saline-treated
group (l " Fig. 3).
Discussion
!
Clove (Eugenia caryophyllata) is an evergreen plant grown in
tropical areas of the world including India. The active medicinal
agent of this botanical is an essential oil which is obtained as a
colourless or light yellowish fluid, extracted from dried flower
buds by steam distillation [1]. Clove oil is mainly constituted of
eugenol, beta-caryophyllene, eugenol acetate, as well as alphahumulen
[35] and has been demonstrated to be effective against
pentylenetetrazole-induced and maximal electroshock seizures,
confirming the claims of its uses in epileptic disorders in Iranian
folk medicine [3]. These findings indicate that clove oil, which has
eugenol as the major constituent, may exert some action on the
nervous system. It could be possible that it also exercises some
effect on the central nervous system influencing learning and
memory processes in the brain as well.
Traditional medicine claims that clove oil is effective in relieving
pain, improves memory, reduces depression and acts as a mind
and body stimulant, thus affecting the central nervous system,
but no conclusive study has been conducted so far to prove such
effects of clove oil. The present study was aimed to explore the
effect of clove oil on learning and memory and evaluate its role
in modulating oxidative stress in mice.
In the present study, we have demonstrated that in the stepdown
latency test, clove bud oil produced significant improvement
in passive avoidance acquisition and retention of memory
in mice. Scopolamine (0.3 mg/kg, i.p.) produced deficits in learning
as well as memory retention since the animals showed a decrease
in step-down latency after prior training. Clove oil was
chronically administered at three doses (0.025, 0.05, 0.1 mL/kg,
i. p.) for three weeks. The treatment with a dose of 0.05 mL/kg
significantly attenuated the scopolamine-induced deficits in acquisition
and retention. However, its administration at doses
higher and lower than 0.05 mL/kg failed to reverse the scopola-
Fig. 1 Effect of chronic Eugenia caryophyllata (EC)
and piracetam (PIR) administration for 3 weeks on
transfer latency (TL) on elevated plus-maze on day 1
and 2 in scopolamine (SAL + SCO)-treated mice.
* P < 0.05 as compared to the saline (SAL + SAL)
group (TL1), ** p < 0.01 as compared to the SAL +
SCO group (TL1), € p < 0.05 as compared to the
SAL + SAL group (TL1), €€ p < 0.05 as compared to
the SAL + SCO group (TL1), a p < 0.01 as compared
to the SAL + SAL group (TL2), b p < 0.001 as compared
to the SAL + SCO group (TL2), c p < 0.05 as
compared to the SAL + SCO group (TL2).

mine-induced memory impairment in mice in the passive avoidance
task.
Additional evidence for the attenuation of scopolamine-induced
memory deficit of clove oil was obtained from studies on the elevated
plus-maze test in which mice showed a natural aversion to
open and high spaces and therefore spent more time in the enclosed
arms. Itoh et al. [36] suggested that TL might be shortened
if the animal had previously experienced entering the arms. This
shortened TL could be related to memory. In the study presented
in this report, shortened TL was obtained on day 2 (retention latency)
as compared to day 1 (acquisition latency) in the salinetreated
group, and the effect was statistically significant. TL on
days 1 and 2 was significantly increased in scopolamine-treated
(0.3 mg/kg) mice compared to the saline-treated group indicating
thereby a memory impairment. Chronic treatment with clove oil
for three weeks prior to scopolamine injection (0.3 mg/kg) significantly
reversed the effects of scopolamine-induced alterations in
the TLs. Chronic administration of clove oil at higher doses (0.05
and 0.1 mL/kg) reversed the scopolamine-induced increase in TL
on day 1 as well as on day 2. This observation suggests that clove
oil at these doses improves acquisition as well as retention of the
learned task. However, a lower dose (0.025 mL/kg) of the agent
showed improvement in retention but not in acquisition latencies.
Piracetam, a known nootropic drug, was shown to improve
acquisition as well as retention in parallel experiments.
Original Papers
Fig. 2 Effect of chronic Eugenia caryophyllata (EC)
and piracetam (PIR) administration for 3 weeks on
step-down latency (SDL) of the passive avoidance
task on day 1 and 2 in scopolamine (SAL + SCO)treated
mice.* P < 0.05 when compared to the saline
(SAL + SAL) group (SDL1), ** p < 0.01 when compared
to the SAL + SCO group (SDL1), *** p < 0.01
when compared to the SAL + SCO group (SDL2),
$ p < 0.05 when compared to the SAL + SCO group
(SDL2), a p < 0.05 when compared to the SAL + SAL
group (SDL2).
Fig. 3 Effect of chronic Eugenia caryophyllata (EC)
and piracetam (PIR) administration for 3 weeks on
malondialdehyde (MDA) and reduced glutathione
(GSH) levels in brain tissue of mice.* P < 0.05 when
compared to the SAL + SAL group, ** p < 0.01 when
compared to the SAL + SAL group.
Recent studies have shown that cognitive disorders characterised
by insidious onset of memory impairment are very often related
to increased oxidative stress [18, 19] which is reflected by an increase
in lipid peroxidation and a decrease in reduced glutathione
[33, 34]. Evaluation of the brain samples after the chronic
treatment revealed the clove oil-treated samples to have lower
MDA levels compared to the saline-treated group. Clove oil at
doses of 0.025 and 0.05 mL/kg demonstrated lower MDA levels
which were statistically significant when compared to the saline-treated
group. Further, the medium dose of 0.05 mL/kg of
clove oil showed the lowest MDA levels similar to the piracetamtreated
group. Brain levels of GSH were found to be relatively increased
in piracetam- and clove oil-treated groups, though this
difference was not statistically significant.
The reduction in MDA levels at a dose of 0.05 mL/kg clove oil correlates
well with our findings of changes in passive avoidance and
elevated plus-maze. However, a higher dose of 0.1 mL/kg of clove
oil has exhibited improvement in elevated plus-maze only, without
a significant reduction in MDA or an increase in GSH levels. A
lower dose of 0.025 mL/kg showed significant improvement in
memory retention in elevated plus-maze only along with a significant
reduction of MDA levels but no significant improvement
in SDL. Thus at a higher dose (0.1 mL/kg), a reversal in effect was
observed. The constituents in clove oil apart from eugenol could
be responsible for this effect. Though eugenol is a known antioxidant
[20–23], other constituents like beta-caryophyllene, euge-
Halder S et al. Clove Oil Reverses… Planta Med 2011; 77: 830–834
833

834
Original Papers
nol acetate, and alpha-humulen could probably exert a modulating
influence at a higher dose. This finding further points to the
fact that plant products have the best therapeutic effect at an optimum
dose and at doses higher or lower to it, the effect can be
suboptimal. The GSH levels in all the groups were not statistically
significant as compared to the saline-treated group, thus suggesting
the involvement of other mechanisms that are associated
with reducing oxidative stress and subsequent improvement in
cognitive function in clove oil-treated mice.
Lesser improvement of scopolamine-induced memory deficit
produced by chronic administration of a higher dose of clove oil
(0.1 mL/kg) could be due to a lesser improvement in oxidative
stress as observed by an insignificant decrease in the brain MDA
levels at this dose. Brain MDA levels in clove oil-treated mice
were found to be increased relatively at a higher dose (0.1 mL/
kg) compared to those at lower doses (0.025 and 0.05 mL/kg).
Treatment with 0.2 mL/kg clove oil was found to increase the
MDA levels even further significantly (data not shown) in subsequent
experiments going on in our laboratory. Hence, the lesser
improvement of scopolamine-induced memory deficit at a relatively
higher dose of clove oil (0.1 mL/kg) as observed in the passive
avoidance task could be probably due to better correlation of
this test to oxidative stress as compared to elevated plus-maze.
Thus, the present study strongly suggests that clove oil could reverse
short-term and long-term memory deficits. Reduction in
lipid peroxides could be one of the mechanisms of reducing oxidative
stress in clove oil-treated mice leading to subsequent improvement
in learning and memory. However, further studies are
needed to figure out the role of other mechanisms as well.
Acknowledgements
!
We would like to thank Kancor Ingredients Limited, Kerala, India,
for generously providing us with clove bud oil for the study.
References
1 Tyler VE, Brady LR, Robbers JE. Pharmacognosy. Philadelphia: Lea and
Febiger; 1998: 103–135
2 Avicenna A. Ghanoon dar teb. Tehran: Soroosh; 1988: 244–251
3 Pourgholami MH, Kamalinejad M, Javadi M, Majzoob S, Sayyah M. Evaluation
of the anticonvulsant activity of the essential oil of Eugenia
caryophyllata in male mice. J Ethnopharmacol 1999; 64: 167–171
4 Cai L, Wu CD. Compounds from Syzygium aromaticum possessing
growth inhibitory activity against oral pathogens. J Nat Prod 1996;
59: 987–990
5 Hiroak N, Ryui U, Nozomik KS, Kenji K. Role of endothelium and adventitia
on eugenol induced relaxation of rabbit ear artery precontracted
by histamine. J Smooth Muscle Res 1998; 34: 123–137
6 Chami F, Chami N, Bennis S, Bouchikhi T, Remmal A. Oregano and clove
essential oils induce surface alteration of Saccharomyces cerevisiae.
Phytother Res 2005; 19: 405–408
7 Kim HM, Lee EH, Hong SH, Song HJ, Shin MK, Kim SH, Shin TY. Effect of
Syzygium aromaticum extract on immediate hypersensitivity in rats.
J Ethnopharmacol 1998; 60: 125–131
8 Miyazawa M, Hisama M. Suppression of chemical mutagen induced
SOS response by alkylphenols from clove (Syzygium aromaticum) in
Salmonella typhymurium TA1535/pSK1002 umu test. J Agric Food
Chem 2001; 49: 4019–4025
9 Zheng GQ, Kenney PM, Lam LKT. Sesquiterpenes from clove (Eugenia
caryophyllata). J Nat Prod 1992; 55: 999–1003
10 Chaieb K, Hajlaoui H, Zmantar T, Kahla-Nakbi AB, Rouabhia M, Mahdouani
K, Bakhrouf A. The chemical composition and biological activity
of clove essential oil, Eugenia caryophyllata (Syzigium aromaticum L.
Myrtaceae): a short review. Phytother Res 2007; 21: 501–506
Halder S et al. Clove Oil Reverses… Planta Med 2011; 77: 830–834
11 Pawar VC, Thakur VS. In vitro efficacy of 75 essential oils against Aspergillus
niger. Mycoses 2006; 49: 316–323
12 Prashar A, Locke IC, Evans CS. Cytotoxicity of clove (Syzygium aromaticum)
oil and its major components to human skin cells. Cell Prolif
1999; 39: 241–248
13 Okhubo T, Kitamura K. Eugenol activates Ca 2+ -permeable currents in rat
dorsal root ganglion cells. J Dent Res 1997; 76: 1737–1744
14 Sensch O, Vierling W, Brandt W, Reiter W. Effects of inhibition of calcium
and potassium currents in guinea-pig cardiac contraction: comparison
of beta-caryophyllene oxide, eugenol, and nifedipine. Br J Pharmacol
2000; 131: 1089–1096
15 Kozam G. The effect of eugenol on nerve transmission. Oral Surg 1977;
44: 799–805
16 Ghelardini C, Galeotti N, Mannelli LDC, Mazzanti G, Bartolini A. Local
anaesthetic activity of beta-caryophyllene. Farmaco 2001; 56: 387–
389
17 Bharal N, Mehta AK, Agarwal NK, Mediratta PK, Sharma KK. Melatonin
protects against maximal electroshock seizures induced cognitive impairment
in mice. Pharm Rev 2009; 7: 132–135
18 Gupta S, Garg GR, Bharal N, Mediratta PK, Banerjee BD, Sharma KK. Reversal
of propoxur-induced impairment of step-down passive avoidance,
transfer latency and oxidative stress by piracetam and ascorbic
acid in rats. Environ Toxicol Pharmacol 2009; 28: 403–408
19 Mehta KD, Garg GR, Mehta AK, Arora T, Sharma AK, Khanna N, Tripathi
AK, Sharma KK. Reversal of propoxur-induced impairment of memory
and oxidative stress by 4′-chlorodiazepam in rats. Naunyn Schmiedebergs
Arch Pharmacol 2010; 381: 1–10
20 Jirovetz L, Buchbauer G, Stoilova I, Stoyanova A, Krastanov A, Schmidt E.
Chemical composition and antioxidant properties of clove leaf essential
oil. J Agric Food Chem 2006; 54: 6303–6307
21 Kim B, Kim J, Kim H, Heo M. Biological screening of 100 plants for cosmetic
use. II. Antioxidative activity and free radical scavenging activity.
Int J Cosmet Sci 1997; 19: 299–307
22 Ogata M, Hoshi M, Urano S, Endo T. Antioxidant activity of eugenol and
related monomeric and dimeric compounds. Chem Pharm Bull 2000;
48: 1467–1469
23 Wie MB, Won MH, Lee KH, Shin JH, Lee JC, Suh HW, Song DK, Kim YH.
Eugenol protects neuronal cells from excitotoxic and oxidative injury
in primary cortical cultures. Neurosci Lett 1997; 225: 93–96
24 Sharma AC, Kulkarni SK. Evaluation of learning and memory mechanisms
employing plus maze in rats and mice. Prog Neuropsychopharmacol
Biol Psychiatry 1992; 16: 117–125
25 Patil RA, Jagdale SC, Kasture SB. Antihyperglycemic, antistress and
nootropic activity of roots of Rubia cordifolia Linn. Indian J Exp Biol
2006; 44: 987–992
26 Li H, Matsumoto K, Tohda M, Yamamoto M, Watanabe H. NMDA antagonists
potentiate scopolamine-induced amnesic effect. Behav Brain Res
1997; 83: 225–228
27 Joshi H, Parle M. Nootropic activity of calyces of Hibiscus sabdariffa
Linn. Iranian J Pharmacol Ther 2006; 5: 15–20
28 Joshi H, Parle M. Evaluation of nootropic potential of Ocimum santum
Linn in mice. Indian J Exp Biol 2006; 44: 133–136
29 De Mello N, Carobrez AP. Elevated T maze as an animal model of memory:
effects of scopolamine. Behav Pharmacol 2002; 13: 139–148
30 Joshi H, Kaur N, Chauhan J. Evaluation of nootropic effect of Argyreia
speciosa in mice. J Health Sci 2007; 53: 382–388
31 Reddy DS, Kulkarni SK. The effects of neurosteroids on acquisition and
retention of a modified passive-avoidance learning task in mice. Brain
Res 1998; 791: 108–116
32 Ukai M, Miura M, Kameyama T. Effects of galanin on passive avoidance
response, elevated plus-maze learning, and spontaneous alternation
performance in mice. Peptides 1995; 16: 1283–1286
33 Okhawa H, Ohishi N, Yagi K. Assay of lipid peroxides in animal tissue by
thiobarbituric acid reaction. Anal Biochem 1979; 95: 351–358
34 Ellman GL. Tissue sulphydryl groups. Arch Biochem Biophys 1959; 82:
70–77
35 Ozturk A, Ozbek H. The anti-inflammatory activity of Eugenia caryophyllata
essential oil: an animal model of anti-inflammatory activity.
Eur J Gen Med 2005; 2: 159–163
36 Itoh J, Nabeshima T, Kameyama T. Utility of elevated plus-maze for dissociation
of amnesic and behavioural effects of drugs in mice. Eur J
Pharmacol 1991; 194: 71–76

Goldenseal (Hydrastis canadensis L.) Extracts
Synergistically Enhance the Antibacterial Activity
of Berberine via Efflux Pump Inhibition
Authors Keivan A. Ettefagh 1 , Johnna T. Burns 1 , Hiyas A. Junio 1 , Glenn W. Kaatz 2 , Nadja B. Cech 1
Affiliations
Key words
l " Hydrastis canadensis
l " Ranunculaceae
l " synergy
l " alkaloid
l " berberine
l " Staphylococcus aureus
received Sept. 2, 2010
revised Nov. 5, 2010
accepted Nov. 17, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250606
Published online December 14,
2010
Planta Med 2011; 77: 835–840
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Nadja B. Cech
Department
of Chemistry/Biochemistry
The University
of North Carolina Greensboro
435 Sullivan Bldg
Greensboro, NC 27402
USA
Phone: + 13 36334 30 17
Fax: + 1336334 5402
nadja_cech@uncg.edu
1 Department of Chemistry/Biochemistry, The University of North Carolina Greensboro, Greensboro, NC, USA
2 Division of Infectious Disease, John Dingell Department of Veteran Affairs Medical Center
and Department of Internal Medicine, Wayne State University School of Medicine, Detroit, MI, USA
Abstract
!
Goldenseal (Hydrastis canadensis L.) is used to
combat inflammation and infection. Its antibacterial
activity in vitro has been attributed to its alkaloids,
the most abundant of which is berberine.
The goal of these studies was to compare the composition,
antibacterial activity, and efflux pump
inhibitory activity of ethanolic extracts prepared
from roots and aerial portions of H. canadensis.
Ethanolic extracts were prepared separately from
roots and aerial portions of six H. canadensis
plants. Extracts were analyzed for alkaloid concentration
using LC‑MS and tested for antimicrobial
activity against Staphylococcus aureus (NCTC
8325-4) and for inhibition of ethidium bromide
efflux. Synergistic antibacterial activity was observed
between the aerial extract (FIC 0.375) and
to a lesser extent the root extract (FIC 0.750) and
berberine. The aerial extract inhibited ethidium
Introduction
!
The rise in infections from multidrug resistant
bacteria is recognized worldwide as a major
health crisis. According to the European Antimicrobial
Resistance Surveillance System, as many
as 52 million of the world population may carry
multidrug resistant bacteria. One such resistant
strain, methicillin-resistant Staphylococcus aureus
(MRSA), is estimated to be responsible for over
18000 annual deaths [1] in the US alone. Better
methods to treat infections from resistant bacteria
are needed. There is a long history of the use
of botanical medicines to treat inflammation and
infection. It is often argued that the inherent complexity
of such preparations, which may lead to
synergistic interactions, may make them more effective
than their pharmaceutical counterparts [2,
3]. Furthermore, if such botanical medicines act
through multiple different pathways, it may make
Original Papers
bromide efflux from wild-type S. aureus but had
no effect on the expulsion of this compound from
an isogenic derivative deleted for norA. Our studies
indicate that the roots of H. canadensis contain
higher levels of alkaloids than the aerial portions,
but the aerial portions synergize with berberine
more significantly than the roots. Furthermore,
extracts from the aerial portions of H. canadensis
contain efflux pump inhibitors, while efflux
pump inhibitory activity was not observed for
the root extract. The three most abundant H. canadensis
alkaloids, berberine, hydrastine, and canadine,
are not responsible for the efflux pump inhibitory
activity of the extracts from H. canadensis
aerial portions.
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/
plantamedica
the development of resistance more difficult. For
these reasons, further research into the use of botanical
medicines to combat bacterial infections is
warranted.
The botanical medicine goldenseal (Hydrastis
canadensis L.) is the subject of this research. Goldenseal
preparations are popular in the international
market [4, 5] and are among the top 20 best
selling botanical dietary supplements in the US
[6]. Crude extracts and isolated compounds from
goldenseal have demonstrated antibacterial activity
in vitro and in clinical trials [7–11]. The
antibacterial activity of goldenseal has typically
been attributed to alkaloids, especially berberine
[11, 12], which has shown activity against various
gram-positive bacteria, including MRSA [13].
However, there has been some suggestion that
other compounds present in complex goldenseal
preparations might enhance the antimicrobial activity
of berberine [7, 14]. We have observed pro-
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
835

836
Original Papers
nounced antimicrobial activity of extracts from the aerial portions
of goldenseal, which could not be attributed to berberine
alone. We hypothesize that these extracts contain efflux pump
inhibitors that synergistically enhance the antimicrobial activity
of berberine. Bacterial efflux pumps are membrane bound proteins
that pump toxins out of bacterial cells [15]. Overexpression
of efflux pumps contributes to the development of resistance in
bacteria, including S. aureus [16]. Inhibition of efflux pumps may
enhance the effectiveness of antimicrobial agents that are substrates
for these pumps and decrease the minimum inhibitory
concentration (MIC) for the antimicrobials [17].
The goals of these studies were (1) to compare alkaloid content in
extracts prepared from below ground (roots and rhizomes) and
above ground (leaves and stems) portions of H. canadensis, (2) to
evaluate the antibacterial activity of H. canadensis extracts in
combination with the antibacterial agent berberine, and (3) to
determine whether H. canadensis extracts act as inhibitors of
NorA, the major chromosomal S. aureus efflux pump. Ultimately,
our objective was to show whether synergists other than the major
known alkaloids are present in H. canadensis, and to determine
which part of the plant would have higher levels of such
synergists. These questions are important in the manufacture
and quality control of dietary supplements from H. canadensis.
More broadly, these studies are relevant because we demonstrate
an analytical approach by which synergistic activity can be investigated
prospectively in crude extracts of botanical medicines.
Materials and Methods
!
Cell lines, chemicals, and biochemicals
Staphyloccus aureus NCTC 8325-4 [18] and its isogenic norA deletion
mutant K1758 [19] were used. Mueller Hinton broth, carbonyl
cyanide m-chloro-phenylhydrazone (CCCP, purity > 98%
by TLC), berberine (purity > 98% by HPLC), (1R,9S)-(-)-β-hydrastine
(purity > 98% by HPLC), and DMSO were purchased from Sigma
Aldrich and canadine (tetrahydroberberine, purity > 98% by
HPLC, stereochemistry unconfirmed) was obtained from Sequoia
Research. Acetic acid was purchased from Fisher Chemical. Ethanol
(95%), HPLC grade acetonitrile, and HPLC grade methanol
were obtained from Pharmaco-AAPER. Nanopure water was prepared
with a nanodiamond water purification system from Barnstead.
Plant material
Hydrastis canadensis L. (Ranunculaceae) was cultivated in its native
habitat (a hardwood forest in Hendersonville, NC, N 35°
24.277′, W 082 °20.993′, 702.4 m elevation) and harvested in September
of 2008. A voucher specimen was deposited at the Herbarium
of the University of North Carolina at Chapel Hill
(NCU583414) and identified by Dr. Alan S. Weakly. Individual H.
canadensis plants were harvested and numbered (l " Table 1).
Extraction and LC‑MS
The extracts (50% ethanol: 50% nanopure water) were prepared
using 1 g of powdered leaves and stems or roots and rhizomes
per 5 mL of solvent (1 : 5 w: v) according to the standard procedures
in the US dietary supplements industry [20]. Henceforth,
the root and rhizome extract will be designated “root” and the
leaf and stem extract will be designated “aerial”. Plant material
was blended with solvent, macerated for 24 hr and filtered under
vacuum. Extracts were stored in amber bottles at room temper-
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
Table 1 Quantity of alkaloids in extracts from the root and rhizome or leaf
and stem (aerial) portions of 6 individual H. canadensis plants and 2 “pooled
samples”. Concentrations were calculated from calibration curves for standards
of each alkaloid analyzed with LC‑MS in the positive ion mode. The
“pooled root” and “pooled leaf” extracts were prepared from larger batches
of plant material (including multiple individual plants) and used for antimicrobial
testing.
Extract Berberine (mM) Hydrastine (mM) Canadine (mM)
Root 1 29.9 ± 0.4 2.30 ± 0.04 0.069 ± 0.011
Root 2 25.3 ± 0.5 2.08 ± 0.04 0.061 ± 0.010
Root 3 39.6 ± 0.5 3.34 ± 0.06 0.078 ± 0.013
Root 4 70.0 ± 0.9 5.23 ± 0.10 0.056 ± 0.009
Root 5 25.0 ± 0.3 3.50 ± 0.07 0.074 ± 0.011
Root 6 28.9 ± 0.4 2.42 ± 0.05 0.074 ± 0.012
Average root 36.5 ± 0.5 3.15 ± 0.06 0.069 ± 0.011
Aerial 1 8.5 ± 0.1 1.23 ± 0.02 0.042 ± 0.007
Aerial 2 8.3 ± 0.1 1.58 ± 0.03 0.046 ± 0.007
Aerial 3 8.8 ± 0.1 1.13 ± 0.02 0.029 ± 0.004
Aerial 4 9.2 ± 0.1 0.77 ± 0.01 0.050 ± 0.008
Aerial 5 6.2 ± 0.8 1.20 ± 0.02 0.059 ± 0.009
Aerial 6 5.7 ± 0.1 0.83 ± 0.02 0.044 ± 0.007
Average aerial 7.8 ± 0.1 1.12 ± 0.02 0.045 ± 0.007
Pooled
Sample root
16.6 ± 0.3 3.79 ± 0.07 0.069 ± 0.011
Pooled
Sample aerial
8.0 ± 0.1 2.61 ± 0.05 0.054 ± 0.008
ature. Biological activity and HPLC profile were retained in these
storage conditions for > 1 year. An entire below ground portion
(roots and rhizome) and its corresponding aerial portions (leaves
and stems) of six individual plants were extracted separately. The
extracts were numbered so that in each case, the number for the
root and aerial extract of a single plant matched. Two larger
“pooled extracts” were also prepared, one using 100 g of root/rhizome
material and one using 100 g of aerial portions. All bioassay
data presented here were collected using these “pooled extracts”.
Analysis of alkaloid content was accomplished with liquid chromatography–mass
spectrometry (LC‑MS) using an ion trap mass
spectrometer with electrospray source (LCQ Advantage; Thermo)
coupled to reversed phase HPLC (HP1100; Agilent). A C-18 column
(50 mm × 2.1 mm, 3 µm particle size, 110 Å pore size, Prevail
packing; Grace and 0.5 µm precolumn filter; MacMod Analytical)
was employed for the analysis of all extracts, using a 0.2 mL/min
flow rate and a 10 µL injection volume. The samples were analyzed
using the following gradient, where A = 1% acetic acid in
nanopure water and B = HPLC grade acetonitrile: 100–68% A from
0 to 5 min; 68% − 0% A from 5 to 20 min; 0% A from 20 to 25 min,
100% B from 25–40 min. Mass spectrometric detection was
conducted in the positive ion mode with a scan range of 50–
2000 m/z. Capillary temperature was 275 °C, sheath gas pressure
was 20 (arbitrary units), and spray, capillary, and tube lens voltages
were 4.5 kV, 3 V, and 60 V, respectively.
Standards of the alkaloids berberine, hydrastine, and canadine
were prepared at stock concentrations of 1 mg/mL in methanol.
Calibration curves over a concentration range of 0.05 to 100 µM
were plotted as peak area of the relevant selected ion trace versus
concentration. Extracts were diluted as necessary in 50 : 50 ethanol
: water to provide alkaloid concentrations within the linear
range of the calibration curve. Alkaloids were identified in the extracts
by matching retention time and fragmentation patterns
with the relevant standards.

Checkerboard assay with Staphyloccus aureus
NCTC 8325-4
Extracts were dried under nitrogen and redissolved in Mueller
Hinton broth containing 10% DMSO and filtered through a
0.45 µm PVDF filter. Broth microdilution MIC assays were performed
according to Clinical and Laboratory Standards Institute
(CLSI) guidelines [21]. Extracts were standardized to berberine
and tested in combination with berberine with a checkerboard
assay [22] over a concentration range of 5 to 300 µg/mL (where
these represent concentration of berberine either in the standard
or the extract). A purified standard of berberine, which has welldocumented
antimicrobial activity [23–25], served as the positive
control. The assay was performed in triplicate in 96-well
plates with 1 × 10 5 CFU/mL S. aureus, 2% final DMSO content,
and a final well volume of 250 µL. The negative (vehicle) control
consisted of 2% DMSO in broth. MIC values were determined at
the point at which there was no significant difference between
OD600 of the vehicle control and the treatment. OD600 for wells
containing only extracts or berberine (without bacteria) was subtracted
from the relevant assay wells to minimize interference.
FIC indices were calculated according to equation 1, where A
and B are the compounds (or extracts) tested in combination, MI-
CA is defined as the minimum inhibitory concentration of A
alone, MICB is defined as the minimum inhibitory concentration
of B alone, and [B] is defined as the MIC of B in the presence of a A,
and [A] is defined as the MIC of A in the presence of B.
FIC Index ¼ FICA þ FICB ¼ A ½ Š
þ
MICA B ½ Š
MICB
(equation 1)
Efflux pump assay
Wild type S. aureus and its isogenic norA deletion mutant (NCTC
8325-4 and K1758, respectively) were grown in Mueller Hinton
broth to OD 600 = 0.740. Ethidium bromide and CCCP were added
to final concentrations of 25 µM and 100 µM, respectively, and
the solution was incubated at 20°C with agitation (300 RPM) for
20 min. This solution was diluted to OD 600 = 0.400 with fresh
Mueller Hinton broth containing 10 µg/mL ethidium bromide
and 100 µM CCCP. The solution was spun down in 1 mL aliquots
at 20°C for 5 min at 13000 × g in a Spectrafuge 24D centrifuge
(Labnet). The supernatant was discarded and the red pellets
placed on ice. At time of measurement, these pellets were thawed
for 5 min and resuspended with 1 mL fresh Mueller Hinton broth
containing 2% DMSO with or without inhibitor. Fluorescence
measurements were made using a Spex FluoroMax-2 spectrofluorometer
(Instruments S. A., Inc.) every second for 300 s, with
λ ex = 530, λ emiss = 600, and slit widths of 5 mm.
Original Papers
Fig. 1 Structures of major alkaloid constituents of
Hydrastis canadensis, berberine (1), (1R,9S)-(-)-β-hydrastine
(2), and canadine (tetrahydroberberine) (3).
Statistics
Statistical significance of means versus control was evaluated using
single factor ANOVA (calculated with Microsoft Excel version
2007) with p < 0.05 considered significant.
Supporting information
Chromatograms and CID fragmentation patterns for berberine,
hydrastine, and canadine as well as data on inhibition of ethidium
bromide efflux by the individual alkaloids are available as
Supporting Information.
Results
!
The alkaloids berberine, hydrastine, and canadine (l " Fig. 1) were
detected in all extracts, as confirmed based on matching retention
times, molecular weights, and CID fragmentation patterns
with standard compounds (Fig. 1S, Supporting Information). The
configuration of hydrastine indicated in l " Fig. 1 is that reported
for the standard, but the configuration of the canadine standard
was not confirmed. The isolation of a ± mixture of canadine from
H. canadensis has been previously reported [26], but it was not
possible with the LC‑MS method employed to distinguish stereoisomers
of hydrastine or canadine.
Alkaloids were found in higher concentrations in root than in leaf
extracts (l " Table 1). This was true for each of the individual root
and leaf samples, and average values among the 6 root and 6 aerial
portion samples. For berberine, the root extracts contained an
average of 5 times more berberine (36.45 ± 0.47 mM in roots versus
7.77 ± 0.10 mM in aerial portions, p = 0.002), 3 times more hydrastine
(3.145 ± 0.058 mM in roots versus 1.123 ± 0.021 mM in
aerial portions, p = 0.002), and 1.5 times more canadine (0.069 ±
0.011 mM in roots versus 0.045 ± 0.007 in aerial portions,
p = 0.001) than did the aerial extracts. Consistent with previous
reports [27], berberine was the most abundant of the alkaloids
(an average of 6.12% in roots, 1.31% in aerial portions), followed
by hydrastine (0.60% in roots, 0.22% in aerial portions) and, finally,
canadine (0.11% in roots, 0.008% in aerial portions).
As indicated by the FIC value of 0.375 (l " Table 2) and by the convex
shape of the isobologram (l " Fig. 2), the extract prepared
from a pooled sample of H. canadensis leaves synergistically enhanced
the antimicrobial activity of berberine. A suggestion of
synergistic enhancement by the root extract was observed as
well (l " Fig. 2), but the results did not comply with the stringent
guidelines of an FIC < 0.5 indicating synergy [28]. For validation
purposes, berberine was tested in combination with itself
(l " Fig. 2), and the effect was additive (FIC of 1.00, linear isobologram).
The berberine standard also served as the positive control
for the antimicrobial assays, and gave an MIC of 150 µg/mL, consistent
with literature values [29–32].
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
837

838
Original Papers
Table 2 MIC and FIC indices of Hydrastis canadensis extracts or isolated alkaloids
in combination with berberine. MIC indicates the minimum inhibitory
concentration of the compound alone, while FIC (calculated with equation 1),
indicates the degree of interaction between the given compound or extract
and berberine.
MIC (µg/mL) FIC Index
Berberine 150 1.00
Hydrastine > 300 0
Canadine > 300 0
Root extract 150 0.750
Aerial extract 75 0.375
Fig. 2 Isobolograms indicating inhibition of bacteria growth by H. canadensis
extracts and added berberine. Berberine alone was also included in
the assay for validation and to serve as a positive control. Extracts were
dissolved in 2% DMSO in Mueller Hinton broth. Assays were performed in
triplicate in a 96-well plate with 5 × 10 5 CFU/mL S. aureus.
Fig. 3 Percent fluorescence over time for S. aureus (NCTC 8325-4) loaded
with ethidium bromide and treated with various extracts and controls.
Treatments included the known efflux pump inhibitor CCCP (positive control)
and extracts from the roots and aerial portions of H. canadensis. All
extracts and CCCP were dissolved in Mueller Hinton broth containing 2%
DMSO. Data points represent the average of three separate experiments
(using 3 different pellets of S. aureus). Error bars are ± standard error.
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
Fig. 4 Percent fluorescence over time for the norA-deleted S. aureus
(K1758). Aside from the use of a different strain of bacteria, conditions
were identical to those employed for l " Fig. 3.
The extract prepared from pooled aerial portions of H. canadensis
was also shown to inhibit efflux of ethidium bromide from wild
type S. aureus (l " Fig. 3), but not its norA-deleted derivative
(l " Fig. 4). For wild-type S. aureus, the percent of ethidum bromide
fluorescence after 3 minutes compared to the initial reading
for bacteria in broth alone was 66.7% ± 5.5% for the root extract
(50 µg/mL), 79.2% ± 1.2% for the aerial extract (50 µg/mL), and
84.73% ± 1.29% for the positive control (CCCP at 20 µg/mL). The
results for the CCCP and the aerial extract were significantly different
from that of the negative control (ethidium bromide
loaded bacteria in Mueller Hinton broth with 2% DMSO), with p
values of 0.002 and 0.02, respectively. There was no significant
difference in % fluorescence between the root extract and the
negative control after 3 minutes. For the norA-deleted S. aureus,
no significant inhibition of ethidium bromide efflux was observed
for any of the treatments (H. canadensis aerial extract, H.
canadensis root extract, or CCCP) after 3 min (l " Fig. 4).
Discussion
!
Goldenseal roots (rather than aerial portions) are more commonly
employed medicinally because of their higher alkaloid
content [27]. Our results do show higher alkaloid content in the
root extracts, but we show that when the extracts are standardized
to berberine content, extracts from the aerial portions of the
plants synergize the antimicrobial activity of berberine (l " Fig. 2).
This finding indicates that some constituent(s) other than berberine
in the extract from H. canadensis aerial portions synergistically
enhance the antimicrobial activity of berberine. This synergistic
enhancement is not due to hydrastine or canadine in the
leaf extracts. Purified standards of these compounds exhibited no
significant antimicrobial activity (MIC values of > 300 µg/mL,
l " Table 2), and did not enhance the antimicrobial activity of berberine
(FIC = 0, l " Table 2).
On the basis of literature reporting the presence of efflux pump
inhibitors in berberine containing plants [33], we hypothesized
that the synergists present in the extracts of H. canadensis aerial
portions might act as inhibitors of the NorA efflux pump, the ma-

jor chromosomal efflux pump expressed by S. aureus. Indeed, our
data (l " Figs. 3 and 4) show that extracts from H. canadensis aerial
portions do contain NorA efflux pump inhibitors. Ethidium bromide
is a known substrate of NorA and fluoresces strongly (due
to intercalation with DNA) when inside bacterial cells [33]. With
the ethidium bromide efflux assay, cells are loaded with ethidium
bromide and fluorescence is monitored over time. A decrease in
fluorescence indicates efflux of ethidium bromide from the cells,
and in the presence of an efflux pump inhibitor, fluorescence
should decrease more slowly. This effect is observed with CCCP,
a known efflux pump inhibitor, and with the extract prepared
from aerial portions of H. canadensis (l " Fig. 3). If inhibition of
NorA is responsible for the altered behavior of wild type
S. aureus in the presence of CCCP and H. canadensis extracts, no
effect should be observed with a norA-deleted strain. This, indeed,
was the case (l " Fig. 4). The efflux pump inhibitory activity
observed was not due to the presence of berberine, hydrastine, or
canadine, as evidenced by the fact that the root extract, which
had higher alkaloid concentration, did not show activity in the
assay (l " Fig. 3). To verify this, the alkaloids were each tested individually
and showed no significant inhibition of ethidium bromide
efflux (Fig. 2S, Supporting Information).
Proponents of the use of botanical dietary supplements often
argue that their complexity leads to enhanced efficacy due to
synergistic interactions among multiple constituents. Here we
demonstrate that extracts from the aerial portions of Hydrastis
canadensis contain both the known antimicrobial agent berberine
and other compounds (hitherto unidentified) that synergistically
increase the antimicrobial activity of berberine. We also
show that this enhancement of antimicrobial activity is likely to
occur through inhibition of the NorA efflux pump. This finding is
particularly interesting given that Hydrastis canadensis is listed
as endangered by CITES in much of its native habitat. Our results
show that the aerial portions of this plant, which can be harvested
sustainably, are a good source of antibacterial compounds.
Furthermore, we demonstrate that berberine is effective in vitro
at lower dosages when used in the complex phytochemical matrix
of the plant aerial portions than in the root portions. Follow-up
studies to evaluate the toxicity of extracts prepared from
roots versus aerial portions of H. canadensis and to test their antibacterial
activity in vivo are warranted.
Acknowledgements
!
This publication was made possible by Grant Number 1 R15
AT005005-01 from the National Center for Complementary and
Alternative Medicine (NCCAM), a component of the National Institutes
of Health (NIH). We thank William Burch for providing
goldenseal plant material for this study, and Dr. Robert Cannon,
Dr. Joseph Falkinham, and Dr. Nicholas Oberlies for helpful advice.
References
1 Klevens RM, Morrison MA, Nadle J, Petit S, Gershman K, Ray S, Harrison
LH, Lynfield R, Dumyati G, Townes JM, Craig AS, Zell ER, Fosheim GE,
McDougal LK, Carey RB, Fridkin SK. Invasive methicillin-resistant Staphylococcus
aureus infections in the United States. JAMA 2007; 298:
1763-1771
2 Spelman K, Duke JA, Bogenschutz-Godwin MJ. The synergy principle at
work with plants, pathogens, insects, herbivores and humans. In:
Cseke L, Kirakosyan A, Kaufman PB, editors. Natural products from
plants, 2nd edition. Boca Raton: CRC Taylor and Francis; 2006: 475–
501
Original Papers
3 Wagner H, Ulrich-Merzenich G. Synergy research: approaching a new
generation of phytopharmaceuticals. Phytomedicine 2009; 16: 97–110
4 Bannerman JE. Goldenseal in world trade: pressures and potentials.
Herbalgram 1997; 2: 51–53
5 Sinclair A, Catling PM. Cultivating the increasingly popular medicinal
plant, goldenseal: Review and update. Am J Altern Agric 2001; 16:
131–140
6 Blumenthal M. Herb market levels after five years of boom. Herbalgram
1999; 47: 64–65
7 Hwang BY, Roberts SK, Chadwick L, Wu CD, Kinghorn DA. Antimicrobial
constitutents from goldenseal (the rhizomes of Hydrastis canadensis)
against selected oral pathogens. Planta Med 2003; 69: 623–627
8 Khosla PK, Neeraj VI, Gupta SK, Satpathy G. Berberine, a potential drug
for trachoma. Rev Int Trach Pathol Ocul Trop Subtrop Sante Publique
1992; 69: 147–165
9 Knight SE. Goldenseal (Hydrastis canadensis) versus penicillin: a comparison
of effects on Staphylococcus aureus, Streptococcus pyogenes,
and Pseudomonas aeruginosa. Bios 1999; 70: 3–10
10 Mahady GB, Pendland SL, Stoia A, Chadwick L. In vitro suceptibility of
Helicobacter pylori to isoquinoline alkaloids from Sanguinaria canadensis
and Hydrastis canadensis. Phytother Res 2003; 17: 217–221
11 Scazzocchino F, Cometa MF, Tomassini L, Palmery M. Antibacterial activity
of Hydrastis canadensis extract and its major isolated alkaloids.
Planta Med 2001; 67: 561–564
12 Chadwick LR, Wu CD, Kinghorn AD. Isolation of alkaloids from goldenseal
(Hydrastis canadensis rhizomes) using pH-zone refining countercurrent
chromatography. J Liq Chromatogr Relat Technol 2001; 24:
2445–2453
13 Villinski JR, Dumas ER, Chai HB, Pezzuto JM, Angerhofer CK, Gafner S.
Antibacterial activity and alkaloid content of Berberis thunbergii, Berberis
vulgaris and Hydrastis canadensis. Pharm Biol 2003; 41: 551–557
14 Gentry EJ, Jampani HB, Keshavarz-Shokri A, Morton MD, Velde DV, Telikepalli
H, Mitscher LA, Shawar R, Humble D, Baker W. Antitubercular
natural products: Berberine from the roots of commercial Hydrastis
canadensis powder. Isolation of inactive 8-oxotetrahydrothalifendine,
canadine, b-hydrastine, and two new quinic acid esters, hycandinic acid
esters-1 and 2. J Nat Prod 1998; 61: 1187–1193
15 Nikaido H. Multiple antibiotic resistance and efflux. Curr Opin Microbiol
1998; 1: 516–523
16 Webber MA, Piddock LJV. The importance of efflux pumps in bacterial
antibiotic resistance. J Antimicrob Chemother 2003; 51: 9–11
17 Lewis K, Ausubel FM. Prospects for plant-derived antibacterials. Nat
Biotechnol 2006; 24: 1504–1507
18 Novick R. Properties of cryptic high-frequency transducing phage of
Staphylococcus aureus. Virology 1967; 33: 155–166
19 Price CT, Kaatz GW, Gustafson JE. The multidrug efflux pump NorA is
not required for salicylate induced reduction in drug accumulation by
Staphylococcus aureus. Int J Antimicrob Agents 2002; 20: 206–213
20 Cech RA. Making plant medicine. Williams: Horizon Herbs; 2000: 276
21 No author. Methods for dilution antimicrobial susceptibility tests for
bacteria that grow aerobically; approved standard, Vol. 26, 7th edition.
Wayne: Clinical and Laboratory Standards Institute; 2006: M7–A7
22 Eliopolous GM, Moellering RC. Antimicrobial combinations. In: Lorian V,
editor. Antibiotics in laboratory medicine. Baltimore, MD: Williams
and Wilkins; 1996: 330–396
23 Amin AH, Subbaiah TV, Abbasi KM. Berberine sulfate: antimicrobial activity,
bioassay, and mode of action. Can J Microbiol 1969; 15: 1067–
1076
24 Yu HH, Kim KJ, Cha JD, Kim HK, Lee YE, Choi NY, You YO. Antimicrobial
activity of berberine alone and in combination with ampicillin or oxacillin
against methicillin-resistant Staphylococcus aureus. J Med Food
2005; 8: 454–461
25 Scazzocchio F, Cometa MF, Tomassini L, Palmery M. Antibacterial activity
of Hydrastis canadensis extract and its major isolated alkaloids. Planta
Med 2001; 67: 561–564
26 Monkovic I, Spenser ID. Biosynthesis of berberine and berverastine. Can
J Chem 1965; 43: 2017–2026
27 Upton R. Goldenseal root Hydrastis canadensis: Standards of analysis,
quality control, and therapeutics. Santa Cruz: American Herbal Pharmacopoeia;
2001
28 Odds FC. Synergy, antagonism, and what the chequerboard puts between
them. J Antimicrob Chemother 2003; 52: 1
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
839

840
Original Papers
29 Stermitz FR, Tawara-Matsuda J, Lorenz P, Mueller P, Zenewicz LA, Lewis K.
5′Methoxyhydnocarpin-D and phenophorbide A: Berberis species
components that potentiate berberine growth inhibition of resistant
Staphylococcus aureus. J Nat Prod 2000; 63: 1146–1149
30 Wang D, Yu L, Xiang H, Fan J, He L, Guo N, Feng H, Deng X. Global transcriptional
profiles of Staphylococcus aureus treated with berberine
chloride. FEMS Microbiol Lett 2008; 279: 217–225
31 Yu H-H, Kim K-J, Cha J-D, Kim H-K, Lee Y-E, Choi N-Y, You Y-O. Antimicrobial
activity of berberine alone and in combination with ampicillin or
oxacillin against methicillin-resistant Staphylococcus aureus. J Med
Food 2005; 8: 454–461
Ettefagh KA et al. Goldenseal (Hydrastis canadensis … Planta Med 2011; 77: 835–840
32 Tegos G, Stermitz FR, Lomovskaya O, Lewis K. Multidrug pump inhibitors
uncover remarkable activity of plant antimicrobials. Antimicrob
Agents Chemother 2002; 46: 3133–3141
33 Stermitz FR, Lorenz P, Tawara JN, Zenewicz LA, Lewis K. Synergy in a medicinal
plant: antimicrobial action of berberine potentiated by 5′-methoxyhydnocarpin,
a multidrug pump inhibitor. Proc Nat Acad Sci
2000; 97: 1433–1437

Neuroprotective Diarylheptanoids
from the Leaves and Twigs
of Juglans sinensis against
Glutamate-Induced Toxicity
in HT22 Cells
Heejung Yang, Sang Hyun Sung, Jinwoong Kim,
Young Choong Kim
College of Pharmacy and Research Institute of Pharmaceutical
Science, Seoul National University, Seoul, Korea
Abstract
!
A new diarylheptanoid, juglanin C (1), was isolated from the 80%
methanolic extract of the leaves and twigs of Juglans sinensis with
three known diarylheptanoids, juglanin A (2), juglanin B (3), and
(5R)-5-hydroxy-7-(4-hydroxy-3-methoxyphenyl)-1(4-hydroxyphenyl)-3-heptanone
(4), using bioactivity-guided fractionation
and chromatographic techniques. Among the isolated diarylheptanoids,
compounds 1 and 2 significantly showed neuroprotective
activities against glutamate-induced toxicity in HT22 cells.
These two diarylheptanoids significantly reduced the overproduction
of cellular peroxide in glutamate-injured HT22 cells.
Moreover, these two diarylheptanoids significantly maintained
antioxidative defense systems, including glutathione, glutathione
reductase, and glutathione peroxidase, under glutamate-induced
oxidative stress in HT22 cells.
Key words
Juglans sinensis · Juglandaceae · diarylheptanoid · HT22 hippocampal
cells · antioxidant activity · neuroprotective
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/plantamedica
Reactive oxygen species are free radicals containing oxygen
atoms which are highly reactive due to the presence of unpaired
valence shell electrons that causes significant damage to cell
structures and platelet functions, protein denaturation, and lipid
peroxidation [1, 2]. It has been reported that natural antioxidants
such as terpenoids, flavonoids, and diarylheptanoids distributed
in many medicinal plants could suppress the oxidative stress implicated
in many neurodegenerative diseases [3–5]. Thus, it has
been attempted to seek antioxidants having neuroprotective activity
from natural resources [6].
Glutamate induces neurotoxicity impairing the glutamate/cystine
antiporter, which results in the decrease at the cellular level
of free cysteine and the depletion of glutathione in HT22 cells,
mouse hippocampal neuronal cells, and subsequently causes cell
death attributable to oxidative stress [7]. Therefore, the glutamate-injured
HT22 cells have been widely used as an in vitro assay
system to elucidate the action mechanism of neuroprotective
compounds [8–11].
As a part of our continuing research seeking neuroprotective
compounds from natural resources, we recently found that the
80% methanolic extract of the leaves and twigs of Juglans sinensis
Dode. (Juglandaceae), Korean walnut tree, significantly protected
HT22 cells from the glutamate insult. J. sinensis is a deciduous native
tree to Korea and China and has been used for the treatment
of airway inflammatory diseases, leucorrhea, scabies, and elephantiasis
in Korean traditional medicine [12]. It was reported
that the phenolic compounds from the walnut tree leaves exerted
antioxidative activities [13]. The genus Juglans contains ellagic acid,
gallic acid, and flavonoids that inhibit the oxidation of human
plasma and low-density lipoproteins (LDL) in vitro, along with
polyphenols, diarylheptanoids, and terpenoids [14–16]. To date,
only a few reports on the biological activities of this tree are
available. Moreover, to the best of our knowledge, there was no
report on its neuroprotective activity. In the present study, we attempted
to isolate neuroprotective compounds from the leaves
and twigs of J. sinensis employing bioactivity–guided fractionation
techniques. We describe the isolation and identification of a
new diarylheptanoid (1), along with three known diarylheptanoids
(2–4), from the EtOAc fraction and their neuroprotective
activities in glutamate-injured HT22 cells. The three known diarylheptanoids
were identified as juglanin A (2) [15], juglanin B
(3) [15], and (5R)-5-hydroxy-7-(4-hydroxy-3-methoxyphenyl)-1
(4-hydroxyphenyl)-3-heptanone (4) [17]. The structures of these
isolated compounds were unequivocally determined by 1D and
2D NMR experiments and MS analysis, as well as in comparison
with the literature (l " Fig. 1).
Fig. 1 Structures of compounds 1–4.
Letters
Yang H et al. Neuroprotective Diarylheptanoids from… Planta Med 2011; 77: 841–845
841

842
Letters
The molecular formula of compound 1 was determined as
C20H22O4 on the basis of 13 C NMR analysis and HREIMS (m/z
326.1518, calcd. for 326.1514 [M + ]). The 1 H NMR (l " Table 1) and
HSQC spectra displayed the presences of two aromatic rings, a
methylenedioxy group, a hydroxyl group, and six methylene
groups. The 13 C NMR and DEPT spectra (l " Table 1) indicated seven
quaternary carbons, six methine carbons, and seven methylene
carbons in consistence with 1 H NMR and HSQC spectra analyses.
The aliphatic chains from C-7 to C-13 were determined by
the correlations in the 1 H- 1 H COSY analysis (l " Fig. 2). The HMBC
correlations of H-7 (δH 2.85 and 2.41) with C-5 (δC 107.6) and C-19
(δC 126.3), H-13 (δH 2.72) with C-15 (δC 129.5) and C-18 (δC 134.2)
indicated that the aliphatic chain was attached at two aromatic
rings (l " Fig. 2). Taken together, the structure of compound 1
was similar to that of juglanin B (3) previously reported from Juglans
spp. [15], except for the correlations of two protons (δH 5.99
and 5.97) with C-3 (δC 142.4) and C-4 (δC 147.6) in HMBC analysis.
These spectral data indicated the substitution of a hydroxyl group
and a methoxy group in the A-ring of compound 3 by a methylenedioxy
group. The absolute configuration of a hydroxyl group
at C-11 was determined to be 11R by comparison of CD spectra
data of compound 3 with those in the literature [18, 19] and the
application of modified Mosherʼs method (l " Fig. 2) [20]. Consequently,
the structure of 1 was determined as (11R)-11,17-dihydroxy-3,4-methylenedioxy-[7,0]-metacyclophane,
and the compound
was named juglanin C.
The isolated diarylheptanoids 1–4 were evaluated for their neuroprotective
activities in vitro. Among these diarylheptanoids,
compounds 1 and 2 exhibited significant neuroprotective activities
at the concentrations ranging from 1 to 10 µM compared to
trolox, the positive control (97.8 ± 1.8% at 10 µM) (l " Table 2; the
MTT assay showed a similar trend to the LDH assay; data not
shown). It was noteworthy that the neuroprotective activity of
compound 1 was superior to that of compound 3 in spite of the
structural similarity between compounds 1 and 3. The difference
in the neuroprotective activity of the two compounds may be explained
by the presence of a methylenedioxy group in compound
1. We attempted to elucidate the underlying mechanism of the
neuroprotective activities of compounds 1 and 2 (93.7 ± 0.7%
and 91.1 ± 1.3% at 10 µM for LDH assay, respectively). Since glutamate-induced
toxicity is mediated by oxidative stress [21], the effects
of the two compounds on the antioxidative defense system
of glutamate-injured HT22 cells were determined. The effects of
compounds 1 and 2 on the cellular peroxide contents were measured
using the specific fluorescent dye, 2, 7-DCF‑DA (l " Table 3).
If HT22 cells were exposed to glutamate, the cellular peroxide
content was rapidly increased within 3 h after glutamate insult
[22]. The increased cellular peroxides induced by the glutamate
insult were effectively decreased by the treatment with compounds
1 or 2. Glutamate-induced oxidative stress has been also
known to deplete intracellular GSH and reduce the activities of
antioxidant enzymes [23, 24]. We further investigated the effects
of compounds 1 and 2 on GSH content and the activities of antioxidant
enzymes in HT22 cells. Under our experimental conditions,
the exposure of HT22 cells to glutamate resulted in a significant
reduction in the activities of superoxide dismutase (SOD),
glutathione reductase (GR), and glutathione peroxidase (GSH‑Px)
(l " Table 4). The reduced activities of GR and GSH‑Px were significantly
restored by the treatment with compounds 1 or 2 in HT22
cells. However, compounds 1 and 2 did not significantly increase
the SOD activity reduced by glutamate. These two compounds also
effectively prevented the glutamate-induced GSH depletion.
Yang H et al. Neuroprotective Diarylheptanoids from… Planta Med 2011; 77: 841–845
Table 1 1 Hand 13 C NMR spectroscopic data for compounds 1 and 3 in
DMSO-d 6.
1 3
No. δH (J in Hz) b a, b δC δH (J in Hz) b a, b δC 1 123.7, s 125.5, s
2 120.5, s 126.2, s
3 142.4, s 140.7, s
4 147.6, s 148.3, s
5 6.65 (1H, s) 107.6, d 6.69 (1H, s) 111.7, d
6 131.6, s 130.3, s
7 2.85 (1H, m), 30.4, t 2.88 (1H, m), 30.0, t
2.41 (1H, m)
2.46 (1H, m)
8 1.87 (1H, m), 26.4, t 1.95 (1H, m), 26.3, t
1.76 (1H, m)
1.81 (1H, m)
9 1.49–1.31 22.4, t 1.65 (1H, m), 22.6, t
(2H, m)
1.44 (1H, m)
10 1.66 (1H, m), 39.4, t 1.81 (1H, m), 39.5, t
1.40 (1H, m)
1.53 (1H, m)
11 3.70 (1H, m) 66.7, d 4 (1H, t,
J = 9.8)
66.7, d
12 2.08 (1H, m), 34.4, t 2.22 (1H, m), 34.4, t
1.49 (1H, m)
1.65 (1H, m)
13 2.72 (2H, m) 26.5, t 2.82 (2H, m) 26.4, t
14 129.4, s 129.2, s
15 6.97 (1H, m) 129.5, d 7.01 (1H,
d, J = 8.2)
129.9, d
16 6.76 (1H, d, 115.7, d 6.78 (1H, 115.9, d
J = 8.0)
d, J = 8.2)
17 152.2, s 151.0, s
18 6.98 (1H, s) 134.2, d 7.16 (1H, s) 133.8, d
19 6.50 (1H, s) 126.3, d 6.73 (1H, s) 125.1, d
OCH3 3.83 (1H, s) 56.0, q
OCH2O 5.99 (1H, s),
5.97 (1H, s)
100.4, t
a 13 Multiplicity of C NMR data was determined by DEPT experiments (s = quaternary,
d = methine, t = methylene, q = methyl). b1H and 13C NMR data were measured at 400
and 100 MHz, respectively
Fig. 2 Key 2D NMR correlations and Δδ (δS-δR) values obtained from MTPA
esters for compound 1.
However, compounds 3 and 4, which did not show significant
neuroprotective activities in LDH assay (57.4 ± 2.0% and 41.6 ±
7.1% at 10 µM, respectively), did not reduce the increased cellular
peroxide content caused by the glutamate insult. The restoration
of reduced intracellular GSH content and antioxidant enzymes
including SOD, GR, and GSH‑Px activities also did not accompany
the treatment with compounds 3 and 4 (data not shown).
Taken together, compounds 1 and 2 isolated from J. sinensis significantly
attenuated glutamate-induced neurotoxicity in HT22

Table 2 Protective effects of compounds 1–4 isolated from J. sinensis on the
glutamate-induced toxicity in HT22 cells.
Groups ED50 (µM)
1 2.29 ± 0.12
2 3.92 ± 0.07
3 7.39 ± 0.10
4 15.61 ± 1.21
Trolox 3.52 ± 0.11
Trolox was used as a positive control. The values are expressed as means ± SD of triplicate
experiments
Table 4 Protective effects of compounds 1 and 2 on the activities of antioxidant
enzymes and glutathione level in the glutamate-injured HT22 cells.
Groups Conc. SOD
(µM) (U/mg
protein)
Control 27.065 ±
0.738
Glutamate- 18.320 ±
injured
1.571
1 10 19.140 ±
1.343
5 18.585 ±
0.388
1 16.686 ±
1.280
2 10 20.641 ±
0.723
5 22.840 ±
1.410**
1 22.940 ±
0.421*
GR
(mU/mg
protein)
6.240 ±
0.315
2.323 ±
0.201
3.960 ±
0.056*
3.816 ±
0.381*
3.298 ±
0.174*
4.243 ±
0.345**
4.461 ±
0.255**
3.239 ±
0.266*
GSH‑Px
(mU/mg
protein)
0.971 ±
0.011
0.466 ±
0.006
0.580 ±
0.006***
0.584 ±
0.005***
0.513 ±
0.009**
0.557 ±
0.012**
0.578 ±
0.006***
0.571 ±
0.010**
GSSG/
total
GSH ratio
2.768 ±
0.082
1.401 ±
0.013
1.766 ±
0.016***
1.612 ±
0.041**
1.656 ±
0.022***
1.722 ±
0.158*
1.628 ±
0.027**
1.595 ±
0.049**
HT22 cells were pretreated with compounds 1–4, respectively, for 1 h before the exposure
to 5 mM glutamate and then maintained for 8–12 h. Each value represents the
mean ± SD of three experiments. Results differ significantly from the glutamate-treated;
* p < 0.05, ** p < 0.01, *** p < 0.001
cells through a mechanism that included the scavenging of reactive
oxygen species. From these results, it could be postulated
that diarylheptanoids of J. sinensis have potential as a natural
antioxidant resource for the treatment of neurodegenerative disorders.
Further studies are ongoing to unravel the specific cellular
and molecular mechanisms of diarylheptanoids from J. sinensis.
Materials and Methods
!
The leaves and twigs of J. sinensis were collected at the Medicinal
Plant Garden, College of Pharmacy, Seoul National University,
Goyang, Korea, in September 2008 and air-dried. J. sinensis was
identified by professor Jong Hee Park, College of Pharmacy, Pusan
National University. A voucher specimen (SNUPH-0329) has been
stored in the Herbarium at the Medicinal Plant Garden, College of
Pharmacy, Seoul National University.
Dried leaves and twigs (20 kg) of J. sinensis were extracted with
80% MeOH (15 L × 3) in an ultrasonic apparatus (3 h × 3). After removal
of the solvent in vacuo, the 80% MeOH extract (2.2 kg) was
suspended in H2O and successively partitioned into n-hexane
fraction, CHCl3 fraction, EtOAc fraction, and n-BuOH fraction, respectively.
The EtOAc fraction (200 g) which showed the most
Table 3 Protective effects of compounds 1 and 2 on cellular peroxidation in
glutamate-induced toxicity in HT22 cells.
Groups Conc. DCF‑DA Fluorescence
(µM) (Arbitrary unit)
Control 176.1 ± 2.7
Glutamate-injured 329.5 ± 27.0
1 10 239.3 ± 11.9***
5 242.9 ± 3.1***
1 267.9 ± 4.5*
2 10 193.1 ± 13.3***
5 229.3 ± 19.9***
1 310.0 ± 6.0
Trolox 10 184.3 ± 9.4***
5 202.0 ± 14.9***
1 238.1 ± 15.6**
Letters
HT22 cells were pretreated with compounds 1–4, respectively, for 1 h before the exposure
to 5 mM glutamate and then maintained for 8–12 h. The content of intracellular
peroxide was determined using the fluorescent dye 2, 7-DCF‑DA. The values are
expressed as means ± SD of triplicate experiments. Results differ significantly from the
glutamate-treated; * p < 0.05, ** p < 0.01, *** p < 0.001
significant neuroprotective activity (63.3 ± 4.8% at 50 µg/mL and
41.1 ± 5.4% at 10 µg/mL) in glutamate-injured HT22 cells was subjected
to repeated open column chromatographies with a gradient
elution of solvents. The EtOAc fraction was subjected to silica
gel column chromatography (2 kg, 20 × 60 cm) and eluted
with a mixture of CHCl 3:MeOH increasing polarity (50 : 1, 30: 1,
10:1, 5:1, 3 : 1, 0:1, v/v, 20 L) to give ten fractions (HoE1-HoE10).
Compound 2 (25 mg) was obtained from HoE2 by ODS silica gel
column chromatography (MeOH : H2O = 7:3, 9:1, v/v, 5 × 20 cm,
4 L) followed by Sephadex LH-20 (MeOH, 2 × 60 cm, 500 mL).
HoE3 was subjected to ODS MPLC (5 × 20 cm) and eluted with
MeOH : H 2O (6 : 4, v/v, 4 L) to yield 3 subfractions (HoE3A‑HoE3C).
HoE3B was refined by Sephadex LH-20 (2 × 60 cm) with MeOH
(500 mL) to give compound 1 (40 mg). Compound 3 (20 mg) was
isolated from HoE3C using Sephadex LH-20 (MeOH, 2 × 60 cm,
300 mL), followed by ODS MPLC (5 × 20 cm) with MeOH : H2O
(7 : 3, v/v, 1 L) as an eluent. The HoE10 fraction was fractionated
into 6 subfractions (HoE10A‑HoE10F) by ODS silica gel column
(MeOH : H2O 8 :2, v/v, 10 × 20 cm, 4 L), and compound 4 (25 mg)
was refined from HoE10F by Sephadex LH-20 (MeOH, 2 × 60 cm)
and eluted with MeOH (300 mL).
Isolates
Juglanin C (1): colorless needle; m.p.; [α] D 25 : − 12.2 (c 1.13, MeOH);
UV (MeOH): λmax (log ε) 297.9 (3.74) nm; IR: νmax 3255 (OH),
1638 (CH=CH), 1509, 1406, 1258, 1222, 1051, 934 cm −1 ;CD(c
0.0005, MeOH): Δε (nm) = + 25.2 (213), ‑18.2 (236), ‑8.4 (255),
‑1.5 (277), ‑6.7 (298); FABMS: m/z = 327 [M + H] + ,326[M] + ;
HREIMS: m/z = 326.1514 [M] + (calcd. m/z = 326.1518); 1 Hand 13 C
NMR spectra data (DMSO-d6): see l " Table 1.
(S)-MTPA ester (1a): 1 H NMR (CDCl3, 500 MHz): 5.69 (1H, m, H-
11α), 2.99 (1H, d, J = 17.0 Hz, H-7a), 2.80 (1H, d, J = 17.6 Hz, H-
13a), 2.47 (1H, m, H-7b), 2.44 (1H, m, H-13b), 2.32 (1H, m, H-
8a), 2.23 (1H, t, J = 13.3 Hz, H-12a), 2.02 (1H, m, H-8b), 1.84 (1H,
m, H-10a), 1.72 (1H, t, J = 11.3 Hz, H-10b), 1.61 (1H, m, H-12b),
1.60 (1H, m, H-9a), 1,50 (1H, m, H-9b).
(R)-MTPA ester (1b): 1 H NMR (CDCl3, 500 MHz): 5.58 (1H, m, H-
11α), 2.94 (2H, m, H-7a and H-13a), 2.73 (1H, t, J = 13.9 Hz, H-
13b), 2.47 (1H, t, J = 12.6 Hz, H-7b), 2.25 (2H, m, H-8a and H-
Yang H et al. Neuroprotective Diarylheptanoids from… Planta Med 2011; 77: 841–845
843

844
Letters
12a), 2.07 (1H, m, H-8b), 1.82 (1H, m, H-10a), 1.77 (1H, m, H-
12b), 1.67 (1H, t, J = 11.3 Hz, H-10b), 1.58 (1H, m, H-9a), 1,48
(1H, m, H-9b).
An immortalized mouse hippocampal cell line, HT22 cells, was a
gift from Dr. Ki-Sun Kwon at the Korea Research Institute of Bioscience
& Biotechnology. HT22 cells were seeded onto 12 or 24well
plates at a density of 2 × 10 5 or 1 × 10 5 cells/mL, respectively,
in DMEM (Dulbeccoʼs modified Eagleʼs medium) containing 10%
heat-inactivated FBS with penicillin (100 IU/mL) and streptomycin
(100 µg/mL) and incubated at 37 °C in a humidified atmosphere
of 95% air and 5% CO2. After 12 to 24 h incubation, cells
were pretreated with each of the four diarylheptanoids at different
concentrations for 1 h and then exposed to 5 mM L-glutamate.
The purity of each one of the diarylheptanoids was higher
than 95.0%. After 8 h, the supernatants of the cultures were assessed
for glutamate-induced toxicity using LDH (lactate dehydrogenase)
assay [25], and the residues of the cultures were evaluated
for the neuroprotective effects using MTT (3-[4,5-dimethylthiozol-2-yl]-2,5-diphenyltetrazolium
bromide) assay [26].
Trolox (Sigma, > 97% purity) was used as a positive control for
the bioassays. For measuring the cellular peroxide contents, the
specific fluorescent dye, 2,7-DCF‑DA, was used [27]. The activities
of SOD, GR, and GSH‑px were measured according to the
previously reported methods [28–30]. Total GSH content in the
supernatant was determined spectrophotometrically using the
enzymatic cycling method [31].
Supporting information
Original spectral data of 1, detailed descriptions of the preparation
of (S)-MTPA and (R)-MTPA ester, and bioassay protocols are
available as Supporting Information.
Acknowledgements
!
This study was supported by a grant (2010K000832) from the
Brain Research Center of the 21st Century Frontier Research Program
funded by the Ministry of Science and Technology, Korea.
We thank Dr. Ki-Sun Kwon (the Korea Research Institute of Bioscience
& Biotechnology, Daejon, South Korea) for his generous
gift of HT22 cells.
References
1 de Diego-Otero Y, Romero-Zerbo Y, el Bekay R, Decara J, Sanchez L, Rodriguez-de
Fonseca F, del Arco-Herrera I. Alpha-tocopherol protects
against oxidative stress in the fragile X knockout mouse: an experimental
therapeutic approach for the Fmr1 deficiency. Neuropsychopharmacology
2009; 34: 1011–1026
2 Kinsella JE, Frankel E, German B, Kanner J. Possible mechanisms for the
protective role of antioxidants in wine and plant foods. Food Technol
1993; 47: 85–89
3 Dinda B, Chowdhury DR, Mohanta BC. Naturally occurring iridoids,
secoiridoids and their bioactivity. An updated review, part 3. Chem
Pharm Bull 2009; 57: 765–796
4 Spencer JP, Vauzour D, Rendeiro C. Flavonoids and cognition: the molecular
mechanisms underlying their behavioural effects. Arch Biochem
Biophys 2009; 492: 1–9
5 Ramassamy C. Emerging role of polyphenolic compounds in the treatment
of neurodegenerative diseases: a review of their intracellular targets.
Eur J Pharmacol 2006; 545: 51–64
6 Zhao B. Natural antioxidants protect neurons in Alzheimerʼs disease
and Parkinsonʼs disease. Neurochem Res 2009; 34: 630–638
Yang H et al. Neuroprotective Diarylheptanoids from… Planta Med 2011; 77: 841–845
7 Fukui M, Song JH, Choi J, Choi HJ, Zhu BT. Mechanism of glutamate-induced
neurotoxicity in HT22 mouse hippocampal cells. Eur
J Pharmacol 2009; 617: 1–11
8 Kang TH, Baek HY, Kim YC. Protective effect of jakyak-gamcho-tang extract
and its constituents against t-BHP-induced oxidative damage in
HT22 cells. Am J Chin Med 2005; 33: 181–189
9 Breyer A, Elstner M, Gillessen T, Weiser D, Elstner E. Glutamate-induced
cell death in neuronal HT22 cells is attenuated by extracts from
St. Johnʼs wort(Hypericum perforatum L.). Phytomedicine 2007; 14:
250–255
10 Satoh T, Izumi M. Neuroprotective effects of phenylenediamine derivatives
independent of an antioxidant pathway in neuronal HT22 cells.
Neurosci Lett 2007; 418: 102–105
11 Jamarkattel-Pandit N, Pandit NR, Kim MY, Park SH, Kim KS, Choi H, Kim
H, Bu Y. Neuroprotective effect of defatted sesame seeds extract against
in vitro and in vivo ischemic neuronal damage. Planta Med 2010; 76:
20–26
12 Bae KH. Medicinal Plants of Korea. Seoul: Kyo-Hak Publishing Co.;
2000: 49
13 Pereira JA, Oliveira I, Sousa A, Valentao P, Andrade PB, Ferreira IC, Ferreres
F, Bento A, Seabra R, Estevinho L. Walnut (Juglans regia L.) leaves:
phenolic compounds, antibacterial activity and antioxidant potential
of different cultivars. Food Chem Toxicol 2007; 45: 2287–2295
14 Anderson KJ, Teuber SS, Gobeille A, Cremin P, Waterhouse AL, Steinberg
FM. Walnut polyphenolics inhibit in vitro human plasma and LDL oxidation.
J Nutr 2001; 131: 2837–2842
15 Liu JX, Di DL, Wei XN, Han Y. Cytotoxic diarylheptanoids from the pericarps
of walnuts (Juglans regia). Planta Med 2008; 74: 754–759
16 Fukuda T, Ito H, Yoshida T. Antioxidative polyphenols from walnuts
(Juglans regia L.). Phytochemistry 2003; 63: 795–801
17 Shin D, Kinoshita K, Koyama K, Takahashi K. Antiemetic principles of
Alpinia officinarum. J Nat Prod 2002; 65: 1315–1318
18 Joshi BS, Pelletier SW, Newton MG, Lee D, McGaughey GB, Puar MS. Extensive
1D, 2D NMR spectra of some [7.0]metacyclophanes and X‑ray
analysis of (±)-myricanol. J Nat Prod 1996; 59: 759–764
19 Takeda Y, Fujita T, Shingu T, Ogimi C. Studies on the bacterial gall of
Myrica rubra – isolation of a new [7,0]-metacyclophan from the gall
and Dl-beta-phenyllactic acid from the culture of gall-forming bacteria.
Chem Pharm Bull 1987; 35: 2569–2573
20 Hoye TR, Jeffrey CS, Shao F. Mosher ester analysis for the determination
of absolute configuration of stereogenic (chiral) carbinol carbons. Nat
Protoc 2007; 2: 2451–2458
21 Fu Y, Koo MW. EGCG protects HT‑22 cells against glutamate-induced
oxidative stress. Neurotox Res 2006; 10: 23–30
22 Lafon-Cazal M, Pietri S, Culcasi M, Bockaert J. NMDA-dependent superoxide
production and neurotoxicity. Nature 1993; 364: 535–537
23 Almeida A, Heales SJ, Bolanos JP, Medina JM. Glutamate neurotoxicity is
associated with nitric oxide-mediated mitochondrial dysfunction and
glutathione depletion. Brain Res 1998; 790: 209–216
24 Coyle JT, Puttfarcken P. Oxidative stress, glutamate, and neurodegenerative
disorders. Science 1993; 262: 689–695
25 Ma CJ, Kim SR, Kim J, Kim YC. Meso-dihydroguaiaretic acid and licarin A
of Machilus thunbergii protect against glutamate-induced toxicity in
primary cultures of a rat cortical cells. Br J Pharmacol 2005; 146: 752–
759
26 Lee KY, Kim SH, Jeong EJ, Park JH, Kim YC, Sung SH. New secoisolariciresinol
derivatives from Lindera obtusiloba stems and their neuroprotective
activities. Planta Med 2010; 76: 294–297
27 Goodman Y, Mattson MP. Secreted forms of beta-amyloid precursor
protein protect hippocampal neurons against amyloid beta-peptideinduced
oxidative injury. Exp Neurol 1994; 128: 1–12
28 McCord JM, Fridovich I. Superoxide dismutase. An enzymic function for
erythrocuprein (hemocuprein). J Biol Chem 1969; 244: 6049–6055
29 Carlberg I, Mannervik B. Purification and characterization of the flavoenzyme
glutathione reductase from rat liver. J Biol Chem 1975; 250:
5475–5480
30 Flohe L, Gunzler WA. Assays of glutathione peroxidase. Methods Enzymol
1984; 105: 114–121
31 Tietze F. Enzymic method for quantitative determination of nanogram
amounts of total and oxidized glutathione: applications to mammalian
blood and other tissues. Anal Biochem 1969; 27: 502–522

eceived October 6, 2010
revised November 16, 2010
accepted November 18, 2010
Bibliography
DOI http://dx.doi.org/10.1055/s-0030-1250609
Published online December 14, 2010
Planta Med 2011; 77: 841–845
© Georg Thieme Verlag KG Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. PhD Young Choong Kim
College of Pharmacy
and Research Institute
of Pharmaceutical Sciences
Seoul National University
San 56-1, Sillim-Dong, Gwanak-Gu
Seoul 151-742
Republic of Korea
Phone: + 82 2880 7842
Fax: +8228882933
youngkim@snu.ac.kr
Steroidal Saponins from
the Rhizomes of Dioscorea bulbifera
and Their Cytotoxic Activity
Hai Liu 1,2 , Gui-Xin Chou 1,2 , Jun-Ming Wang1 , Li-Li Ji1, 2 ,
1, 2
Zheng-Tao Wang
1 The MOE Key Laboratory for Standardization of Chinese Medicines,
Institute of Chinese Materia Medica, Shanghai University
of Traditional Chinese Medicine, Shanghai, P. R. China
2 Shanghai R & D Centre for Standardization of Chinese Medicines,
Shanghai, P. R. China
Letters
Abstract
!
Two new steroidal saponins, diosbulbisides D (1)andE(2), along
with five known saponins (3–7) were isolated from the rhizomes
of Dioscorea bulbifera L. Their structures were elucidated on the
basis of spectral data. Compounds 6 and 7, two3-O-trisaccharides
of diosgenin spirostanes, showed moderate cytotoxic activity
against human hepatocellular carcinoma cells, with IC50 values
of 3.89 µM and 7.47 µM on SMMC7721, and 10.87 µM and
19.10 µM on Bel-7402 cell lines, respectively.
Key words
steroidal saponin · Dioscorea bulbifera L. · Dioscoreaceae · cytotoxicity
Supporting information available online at
http://www.thieme.connect.de/ejournals/toc/plantamedica
The rhizome of Dioscorea bulbifera L. (Dioscoreaceae) has been
commonly used as a medicinal herb in China and Bangladesh for
treatment of goiter, leprosy, and cancers [1,2]. Clerodane diterpenoids
[3–9] and steroidal saponins [10–12] from the Dioscorea
species have been reported to show potent biological activities
such as antitumor, antifungal, and anti-inflammatory activities
[5, 10,13]. In our continuing investigation on the chemistry of
this plant [9,10], two new steroidal saponins, 1 and 2, were isolated,
along with five known saponins, diosgenin-3-O-[α-
L-rhamnopyranosyl-(1 → 4)-β-D-glucopyranoside] (3) [14], pennogenin-3-O-[α-L-rhamnopyranosyl-(1
→ 4)-β-D-glucopyranoside]
(4) [15], diosgenin-3-O-[α-L-rhamnopyranosyl-(1 → 2)-β-
D-glucopyranoside] (5) [14], diosgenin-3-O-[α-L-rhamnopyranosyl-(1
→ 2)-[α-L-rhamnopyranosyl-(1 → 3)]-β-D-glucopyranoside]
(6) [16], and diosgenin-3-O-[α-L-rhamnopyranosyl-(1 → 2)-
[α-L-rhamnopyranosyl-(1 → 4)]-β-D-glucopyranoside] (7) [14]
(l " Fig. 1). Their cytotoxic activities were evaluated using in vitro
assay.
Compound 1 was obtained as a white powder. Its molecular formula
was deduced to be C51H80O22 from the positive-ion
HRFTMS (m/z 1067.5035 [M + Na] + , calcd. 1067.5038). The 1 H
and 13 CNMRspectra(l " Table 1)of1 showed the presence of four
sugar residues, indicated by four anomeric proton and carbon
signals at δH 4.99 (J = 7.6 Hz)/δC 100.1, 5.94 (s)/102.7, 5.82 (s)/
104.0, and 4.91 (J = 7.6 Hz)/104.9. Acid hydrolysis of 1 yielded
glucose and rhamnose by TLC and GC analyses. In addition, three
methyl singlet signals at δ H 2.06, 1.13, and 1.03, one methyl doublet
signal at δH 1.08 (J = 6.7 Hz), an oxymethylene [δH 4.05 and
Liu H et al. Steroidal Saponins from… Planta Med 2011; 77: 845–848
845

eceived October 6, 2010
revised November 16, 2010
accepted November 18, 2010
Bibliography
DOI http://dx.doi.org/10.1055/s-0030-1250609
Published online December 14, 2010
Planta Med 2011; 77: 841–845
© Georg Thieme Verlag KG Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. PhD Young Choong Kim
College of Pharmacy
and Research Institute
of Pharmaceutical Sciences
Seoul National University
San 56-1, Sillim-Dong, Gwanak-Gu
Seoul 151-742
Republic of Korea
Phone: + 82 2880 7842
Fax: +8228882933
youngkim@snu.ac.kr
Steroidal Saponins from
the Rhizomes of Dioscorea bulbifera
and Their Cytotoxic Activity
Hai Liu 1,2 , Gui-Xin Chou 1,2 , Jun-Ming Wang1 , Li-Li Ji1, 2 ,
1, 2
Zheng-Tao Wang
1 The MOE Key Laboratory for Standardization of Chinese Medicines,
Institute of Chinese Materia Medica, Shanghai University
of Traditional Chinese Medicine, Shanghai, P. R. China
2 Shanghai R & D Centre for Standardization of Chinese Medicines,
Shanghai, P. R. China
Letters
Abstract
!
Two new steroidal saponins, diosbulbisides D (1)andE(2), along
with five known saponins (3–7) were isolated from the rhizomes
of Dioscorea bulbifera L. Their structures were elucidated on the
basis of spectral data. Compounds 6 and 7, two3-O-trisaccharides
of diosgenin spirostanes, showed moderate cytotoxic activity
against human hepatocellular carcinoma cells, with IC50 values
of 3.89 µM and 7.47 µM on SMMC7721, and 10.87 µM and
19.10 µM on Bel-7402 cell lines, respectively.
Key words
steroidal saponin · Dioscorea bulbifera L. · Dioscoreaceae · cytotoxicity
Supporting information available online at
http://www.thieme.connect.de/ejournals/toc/plantamedica
The rhizome of Dioscorea bulbifera L. (Dioscoreaceae) has been
commonly used as a medicinal herb in China and Bangladesh for
treatment of goiter, leprosy, and cancers [1,2]. Clerodane diterpenoids
[3–9] and steroidal saponins [10–12] from the Dioscorea
species have been reported to show potent biological activities
such as antitumor, antifungal, and anti-inflammatory activities
[5, 10,13]. In our continuing investigation on the chemistry of
this plant [9,10], two new steroidal saponins, 1 and 2, were isolated,
along with five known saponins, diosgenin-3-O-[α-
L-rhamnopyranosyl-(1 → 4)-β-D-glucopyranoside] (3) [14], pennogenin-3-O-[α-L-rhamnopyranosyl-(1
→ 4)-β-D-glucopyranoside]
(4) [15], diosgenin-3-O-[α-L-rhamnopyranosyl-(1 → 2)-β-
D-glucopyranoside] (5) [14], diosgenin-3-O-[α-L-rhamnopyranosyl-(1
→ 2)-[α-L-rhamnopyranosyl-(1 → 3)]-β-D-glucopyranoside]
(6) [16], and diosgenin-3-O-[α-L-rhamnopyranosyl-(1 → 2)-
[α-L-rhamnopyranosyl-(1 → 4)]-β-D-glucopyranoside] (7) [14]
(l " Fig. 1). Their cytotoxic activities were evaluated using in vitro
assay.
Compound 1 was obtained as a white powder. Its molecular formula
was deduced to be C51H80O22 from the positive-ion
HRFTMS (m/z 1067.5035 [M + Na] + , calcd. 1067.5038). The 1 H
and 13 CNMRspectra(l " Table 1)of1 showed the presence of four
sugar residues, indicated by four anomeric proton and carbon
signals at δH 4.99 (J = 7.6 Hz)/δC 100.1, 5.94 (s)/102.7, 5.82 (s)/
104.0, and 4.91 (J = 7.6 Hz)/104.9. Acid hydrolysis of 1 yielded
glucose and rhamnose by TLC and GC analyses. In addition, three
methyl singlet signals at δ H 2.06, 1.13, and 1.03, one methyl doublet
signal at δH 1.08 (J = 6.7 Hz), an oxymethylene [δH 4.05 and
Liu H et al. Steroidal Saponins from… Planta Med 2011; 77: 845–848
845

846
Letters
3.69/δC 75.2 (CH2)], two carbonyl groups (δC 210.6 and 205.8), a
tetrasubstituted olefinic group (δC 145.8 and 142.7), and a trisubstituted
olefinic group [δH 5.38/δC 141.0, 121.5] suggested
that 1 had a C27 cholestane steroidal skeleton [10]. In HMBC experiments,
the correlations from H2-15 to C-16 (δC 205.8), and
from Me-21, H2-23, and H2-24 to C-22 (δC 210.6) indicated the
locations of the two carbonyl groups (l " Fig. 2). The double bond
between C-17 (δC 142.7) and C-20 (δC 145.8) was determined by
the HMBC correlations from Me-18 to C-17 and from Me-21 to δC
142.7 and 145.8 (l " Fig. 2). The correlation between H-3 (δH 3.99)
and H-9 (δH 1.05) in the NOESY spectrum indicated H-3 in α-orientation.
The 25 R configuration was deduced based on the coupling
difference between H-26a and H-26b, which showed a Δa b
(δHa–δHb) of 0.36 [17]. The double bond at C-17(20) of 1 in cisconfiguration
(Z-configuration) was revealed by the NOESY correlation
between Me-18 and Me-21. Thus, the aglycone of 1 was
identified as (25R)-3,26-dihydroxycholesta-5,17-diene-16,22-dione
[10, 18]. The glycosidic and the monosaccharide residues
linkages were also deduced from HMBC analyses, in which C-3
(δC 77.9) correlated with H-1′, C-2′ (δC 78.5) with H-1′′, C-3′ (δC
87.5) with H-1′′′, and C-26 (δC 75.2) correlated with H-1′′′′. The
β-configuration of D-glucopyranosyl was determined by 1H NMR coupling constants ( 3J1, 2 > 7 Hz) for anomeric protons,
while L-rhamnopyranosyl had its α-configuration deduced by
comparing the 13C NMR data for the C-3 and C-5 of rhamnose
[19]. Thus, the structure of 1 was established as (25R)-26-[(β-Dglucopyranosyl)oxy]-3β-[(O-α-L-rhamnopyranosyl-(1
→ 3)-[α-Lrhamnopyranosyl-(1
→ 2)]-β-D-glucopyranosyl)oxy]-cholesta-
5,17-diene-16,22-dione and named diosbulbiside D.
Compound 2 was obtained as a white powder. Its molecular formula
was deduced to be C45H72O18 from the HRFTMS data (m/z
923.4640 [M + Na] + , calcd. 923.4616). The 1Hand13C NMR spectra
of 2 (l " Table 1) exhibited a C27 furospirostenol skeleton with
one glucosyl and two rhamnopyranosyls (l " Table 1). The aglycone
part of 2 was similar to that of nuatigenin [14], with the exception
of an extra hydroxyl in 2. The 17-OH substitution was de-
Liu H et al. Steroidal Saponins from … Planta Med 2011; 77: 845–848
Fig. 1 Structures of compounds 1–7.
Fig. 2 Key HMBC correlations (arrow) of compound 1.
duced from the HMBC correlation of the quaternary carbon at δC
88.3 to the proton signals at δH 4.64 (H-16), 1.03 (H-18), and 1.29
(H-21). The HMBC correlations of H-1′ (δH 4.97) with C-3 (δC
76.6), H-1′′ (δH 5.94) with C-2′ (δC 76.9), and H-1′′′ (δH 5.83) with
C-3′ (δC 85.9) indicated the glycosidic and sugar sequencing linkages.
Accordingly, the structure of 2 was elucidated as (22S,25S)-
17α,26-dihydroxy-22,25-epoxyfurost-5-ene-3β-yl-O-α-L-rhamnopyranosyl-(1
→ 3)-[α-L-rhamnopyranosyl-(1 → 2)]-β-D-glucopyranoside
and was assigned to the trivial name diosbulbisin E.
The cytotoxic activities of compounds 1–7 were evaluated against
proliferation of the human hepatocellular carcinoma Bel-7402
and SMMC7721 cell lines, following an MTT assay [20]. Among
the tested compounds, 6 and 7 exhibited moderate cytotoxic activities,
with IC50 values of 10.87 µM (6) and 19.10 µM (7) against
the Bel-7402 cell line while for the SMMC7721 cell line, the IC50

Table 1 1 H (500 MHz) and 13 C NMR (125 MHz) data of diosbulbisides D (1)
and E (2) with J values (in Hz) in parentheses.
No. Diosbulbiside D Diosbulbiside E
δ H δ C δ H δ C
1a
1b
1.78 m
0.99 m
37.3
1.80 m
1.01 m
36.0
2a
2b
2.20 m
1.93 m
30.1
2.17 m
1.92 m
28.5
3 3.99 m 77.9 3.86 m 76.6
4a
4b
2.82 m
2.82 m
38.7
2.79 m
2.79 m
37.2
5 141.0 139.2
6 5.38 d (5.3) 121.5 5.35 d (5.2) 120.4
7a
7b
1.88 m
1.57 m
31.8
1.97 m
1.68 m
31.0
8 1.57 m 30.9 1.53 m 30.9
9 1.05 m 50.0 0.99 m 48.7
10 37.2 35.6
11a
11b
1.59 m
1.59 m
21.0
1.65 m
1.63 m
19.5
12a
12b
2.23 m
1.59 m
36.2
2.40 m
1.67 m
30.3
13 43.5 43.8
14 1.48 m 50.6 2.13 m 51.4
15a
15b
2.28 m
2.10 m
38.1
2.22 m
1.70 m
30.7
16 205.8 4.64 m 88.5
17 142.7 88.3
18 1.03 s 16.9 1.03 s 15.5
19 1.13 s 19.4 1.15 s 18.0
20 145.8 2.61 m 40.0
21 2.06 s 15.9 1.29 d (7.2) 8.6
22 210.6 119.0
23a
23b
2.88 m
2.88 m
38.9
2.21 m
2.21 m
32.8
24a
24b
2.21 m
1.94 m
28.1
2.45 m
2.20 m
30.9
25 2.09 m 33.5 84.6
26a
26b
4.05 m
3.69 dd (9.6, 6.1)
75.2
3.96 m
3.96 m
68.6
27
3-Glc
1.08 d (6.7) 17.6 1.41 s 22.6
1′ 4.99 d (7.6) 100.1 4.97 d (7.8) 98.4
2′ 4.14 m 78.5 4.14 m 76.9
3′ 4.23 m 87.5 4.24 m 85.9
4′ 4.13 m 70.1 4.12 m 68.4
5′ 3.89 m 78.2 3.96 m 76.3
6′a
6′b
2′-Rha
4.55 m
4.43 m
62.4
4.50 m
4.40 m
60.8
1′′ 5.94 s 102.7 5.94 s 101.2
2′′ 4.83 m 72.5 4.83 m 71.0
3′′ 4.61 m 72.9 4.57 m 71.3
4′ 4.40 m 73.9 4.37 m 72.4
5′′ 4.94 m 70.0 4.93 m 68.4
6′′
3′-Rha
1.84 d (6.2) 18.8 1.83 d (6.2) 17.2
1′′′ 5.82 s 104.0 5.83 s 102.4
2′′′ 4.58 m 72.6 4.55 m 71.0
3′′′ 4.92 m 72.7 4.94 m 71.2
4′′′ 4.40 m 73.7 4.36 m 72.1
5′′′ 4.84 m 70.7 4.85 m 69.1
6′′′ 1.73 d (6.3) 18.5 1.53 d (6.1) 17.0
Table 1 1 H (500 MHz) and 13 C NMR (125 MHz) data of diosbulbisides D (1)
and E (2) with J values (in Hz) in parentheses. (continued)
No. Diosbulbiside D Diosbulbiside E
δH δC δH δC 26-Glc
1′′′′ 4.91 d (7.6) 104.9
2′′′′ 4.10 m 75.3
3′′′′ 4.02 m 78.6
4′′′′ 4.31 m 71.8
5′′′′ 4.32 m 78.7
6′′′′a
6′′′′b
4.63 m
4.47 m
63.0
values were 3.89 (6) and 7.47 µM (7), respectively. Structurally,
both 6 and 7 are diosgenin saponins bearing a trisaccharide moiety
at C-3, differently from other tested saponins.
Materials and Methods
!
Letters
Optical rotations were measured on a KRÜSS P8000-T polarimeter.
Melting points were taken on a BÜCHI Melting Point B-540
(uncorrected). The 1D and 2D NMR spectra were recorded on a
Bruker AV500 spectrometer in pyridine-d5. The HRFTMS were
determined on an Ionspec 4.7 T HisRes MALDI-FTMS. Column
chromatography (CC) was performed using silica gel (200–300
and 300–400 mesh; Qingdao Marine Chemical Co.), D101 macroporous
resin (Tianjin Pesticide Co.), ODS‑A (50 µm; YMC), and
Sephadex LH-20 (GE Healthcare) as the stationary phases. Thinlayer
chromatography was performed on HSGF254 (0.2 mm;
Qingdao Marine Chemical Co.) and RP-18 F254 (0.25 mm: Merck)
plates. GC analysis was recorded on a Thermo Finnigan Trace DSQ
gas chromatograph equipped with a mass spectrometry detector.
The rhizomes of D. bulbifera L. were collected in September 2006
from Qingyang, Anhui Province, China, and authenticated by Professor
Shou-Jin Liu (Anhui College of Traditional Chinese Medicine,
Anhui Province, China). A voucher specimen (LH0609-1)
was deposited in the herbarium of the Institute of Chinese Materia
Medica, Shanghai University of Traditional Chinese Medicine.
The aqueous ethanol extract of the dried and pulverized rhizomes
of D. bulbifera (30 kg) was partitioned with petroleum
ether and ethyl acetate successively, and the residual aqueous solution
was applied to D101 macroporous resin column chromatography
(CC) to yield a saponin-rich fraction, which was further
separated by silica gel CC, Sephadex LH-20, and reversed phase
silica gel (RP-18) columns to afford seven compounds, 1–7. (Detailed
information is shown in Supporting Information.)
Isolates
Diosbulbiside D (25R)-26-[(β-D-glucopyranosyl)oxy]-3β-[(O-α-Lrhamnopyranosyl-(1
→ 3)-[α-L-rhamnopyranosyl-(1 → 2)]-β-Dglucopyranosyl)oxy]-cholesta-5,17-diene-16,22-dione
(1): white
powder, m.p. 182–183 °C, [α] D 25 − 74.4° (c 0.048, MeOH), 1 H‑NMR
and 13 C NMR data: see l " Table 1, HRFTMS m/z: 1067.5035 [M +
Na] + (calcd. for C51H80O22Na, 1067.5038).
Diosbulbiside E (22S,25S)-17α,26-dihydroxy-22,25-epoxyfurost-
5-en-3β-yl-O-α-L-rhamnopyranosyl-(1 → 3)-[α-L-rhamnopyranosyl-(1
→ 2)]-β-D-glucopyranoside (2): white powder, m. p.
Liu H et al. Steroidal Saponins from… Planta Med 2011; 77: 845–848
847

848
Letters
290–291 °C, [α] D 25 − 94.0° (c 0.051, MeOH), 1 H‑NMR and 13 C NMR
data: see l " Table 1, HRFTMSm/z: 923.4640 [M + Na] + (calcd. for
C45H72O18Na, 923.4616).
Acid hydrolysis and sugar analysis
The hydrolysis and GC‑MS analysis of the chiral derivatives of the
sugars of compounds 1 and 2 (1.5 mg, each) were achieved as
previous described [10].
MTT colorimetric assay
The cell growth inhibition was measured by a microculture tetrazolium
(MTT) assay, using two human hepatocellular carcinoma
cells (Bel-7402 and SMMC7721; Cell Bank, Type Culture Collection
of the Chinese Academy of Sciences) [10, 20], and 10hydroxycamptothecine
(HCP; Shanghai R & D Center for Standardization
of Chinese Medicines) as a positive control.
Supporting information
Details on extraction and isolation and copies of the spectra for
compounds 1 and 2 are available as Supporting Information.
Acknowledgements
!
Financial support from the National Natural Science Foundation
of China (NSFC) to Dr. Hai Liu (No. 30701082) and National Basic
Research Program of China (2006CB504704) are acknowledged.
We are also grateful to Prof. Shou-Jin Liu for collecting material
to this study. The authors thank Miss Jie Li and Prof. Kan Ding for
the cytotoxicity assay.
References
1 Gao HY, Kuroyanagi M, Wu L, Kawahara N, Yasuno T, Nakamura Y. Antitumor-promoting
constituents from Dioscorea bulbifera L. in JB6
mouse epidermal cells. Biol Pharm Bull 2002; 25: 1241–1243
2 Murray RDH, Jorge ZD, Khan NH, Shahjahan M, Quaisuddin M. Diosbulbin
D and 8-epidiosbulbin-E acetate, norclerodane diterpenoid
from Dioscorea bulbifera tubers. Phytochemistry 1984; 23: 623–625
3 Komori T. Glycosides from Dioscorea bulbifera. Toxicon 1997; 35:
1531–1535
4 Teponno RB, Tapondjou AL, Abou-Mansour E, Stoeckli-Evans H, Tane P,
Barboni L. Bafoudiosbulbins F and G, further clerodane diterpenoids
from Dioscorea bulbifera L. var sativa and revised structure of bafoudiosbulbin
B. Phytochemistry 2008; 69: 2374–2379
5 Teponno RB, Tapondjou AL, Gatsing D, Djoukeng JD, Abou-Mansour E,
Tabacchi R, Tane P, Stoekli-Evans H, Lontsi D. Bafoudiosbulbins A, and
B, two anti-salmonellal clerodane diterpenoids from Dioscorea bulbifera
L. var sativa. Phytochemistry 2006; 67: 1957–1963
6 Zheng SZ, Guo Z, Shen T, Zhen XD, Shen XW. Three new apianen lactones
from Dioscorea bulbifera L. Indian J Chem Sect B 2003; 42: 946–949
7 Teponno RB, Tapondjou AL, Ju-Jung H, Nam JH, Tane P, Park HJ. Three
new clerodane diterpenoids from the bulbils of Dioscorea bulbifera L.
var sativa. Helv Chim Acta 2007; 90: 1599–1605
Liu H et al. Steroidal Saponins from … Planta Med 2011; 77: 845–848
8 Wang G, Liu JS, Lin BB, Wang GK, Liu JK. Two new furanoid norditerpenes
from Dioscorea bulbifera. Chem Pharm Bull 2009; 57: 625–627
9 Liu H, Chou GX, Guo YL, Ji LL, Wang JM, Wang ZT. Norclerodane diterpenoids
from the rhizomes of Dioscorea bulbifera. Phytochemistry 2010;
71: 1174–1180
10 Liu H, Chou GX, Wu T, Guo YL, Wang SC, Wang CH, Wang ZT. Steroidal
sapogenins and glycosides from the rhizomes of Dioscorea bulbifera.
J Nat Prod 2009; 72: 1964–1968
11 Teponno RB, Tapondjou AL, Djoukeng JD, Abou-Mansour E, Tabacchi R,
Tane P, Lontsi D, Park HJ. Isolation and NMR assignment of a pennogenin
glycoside from Dioscorea bulbifera L. var sativa. Nat Prod Sci
2006; 12: 62–66
12 Li SS, Deng JZ, Zhao SX. Steroids from tuber of Dioscorea bulbifera L.
J Plant Resour Environ 1999; 8: 61–62
13 Sautour M, Mitaine-Offer AC, Lacaille-Dubois MA. The Dioscorea genus:
a review of bioactive steroid saponins. J Nat Med 2007; 61: 91–101
14 Agrawal PK, Jain DC, Gupta RK, Thakur RS. Carbon-13 NMR spectroscopy
of steroidal sapogenins and steroidal saponins. Phytochemistry
1985; 24: 2479–2496
15 Mahato SB, Sahu NP, Ganguly AN. Steroidal saponins from Dioscorea floribunda:
Structures of floribundasaponins A and B. Phytochemistry
1981; 20: 1943–1946
16 Han XW, Yu H, Liu XM, Bao X, Yu B, Li C, Hui YZ. Complete 1 Hand 13 C
NMR assignments of diosgenyl saponins. Magn Reson Chem 1999; 37:
140–144
17 Agrawal PK. Assigning stereodiversity of the 27-Me group of furostanetype
steroidal saponins via NMR chemical shifts. Steroids 2005; 70:
715–724
18 Mimaki Y, Watanabe K, Sakagami H, Sashida Y. Steroidal glycosides
form the leaves of Cestrum nocturnum. J Nat Prod 2002; 65: 1863–1868
19 Kasai R, Okihara M, Asakawa J, Mizutani K, Tanaka O. 13 C nmr study of
α-anomeric and β-anomeric pairs of d-mannopyranosides and l-rhamnopyranosides.
Tetrahedron 1979; 35: 1427–1432
20 Carmichael J, Degraff WG, Gazdar AF, Minna JD, Mitchell JB. Evaluation of
a tetrazolium based semiautomated colorimetric assay assessment of
chemosensitivity testing. Cancer Res 1987; 47: 936–942
received July 4, 2010
revised November 21, 2010
accepted November 24, 2010
Bibliography
DOI http://dx.doi.org/10.1055/s-0030-1250633
Published online December 16, 2010
Planta Med 2011; 77: 845–848
© Georg Thieme Verlag KG Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. Dr. Zheng-Tao Wang
The MOE Key Laboratory
for Standardization of Chinese Medicines
Institute of Traditional Chinese Medicine
Shanghai University
of Traditional Chinese Medicine
1200 Cailun Road
201210 Shanghai
P. R. China
Phone: + 86 2151 3225 07
Fax: +862151322519
wangzht@hotmail.com

Complete Structural Assignment
of Serratol, a Cembrane-Type
Diterpene from Boswellia serrata,
and Evaluation of Its
Antiprotozoal Activity
Thomas J. Schmidt 1 , Marcel Kaiser2,3 , Reto Brun 2,3
1 Institut für Pharmazeutische Biologie und Phytochemie (IPBP),
Westfälische Wilhelms-Universität Münster, Münster, Germany
2 Swiss Tropical and Public Health Institute, Basel, Switzerland
3 University of Basel, Basel, Switzerland
Abstract
!
From the dichloromethane extract obtained from the gum resin
of Boswellia serrata Roxb. (Burseraceae), a well-known medicinal
plant resin (“Indian Olibanum”), the cembrane-type diterpene
serratol was isolated in high yield. Its structure, previously reported
without clear specification of double-bond geometry and
without specification of stereochemistry, was reanalysed by
means of spectroscopic measurements and unambiguously assigned
as S(−)-cembra-3E,7E,11E‑triene-1-ol. Full assignment of
all NMR data is reported for the first time. The compound was
found to be identical with a cembrenol previously isolated from
B. carteri. Serratol was tested for in vitro activity against four protozoan
human pathogens, namely, Trypanosoma brucei rhodesiense
(East African Human Trypanosomiasis, sleeping sickness),
T. cruzi (Chagasʼ disease), Leishmania donovani (Kala-Azar), and
Plasmodium falciparum (Tropical Malaria). It was found active
against T. brucei and P. falciparum. These activities were 10- to
15-fold higher than its cytotoxicity against rat skeletal myoblasts.
While some reports exist on potential anti-inflammatory activity
of Boswellia diterpenes, this is the first report on antiprotozoal
activity of such a compound.
Key words
Boswellia serrata Roxb. · Burseraceae · cembrane diterpene ·
serratol · antiprotozoal activity
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/plantamedica
Pardhy and Bhattacharyya, in 1978, first reported on the isolation
and structure elucidation of serratol, a cembrane diterpene, from
the gum resin of Boswellia serrata Roxb. (“Indian Olibanum”; Burseraceae)
and assigned its structure as cembra-4,8,12-triene-1-ol
[1]. Although not explicitly stating a double-bond geometry, they
depicted the structure of serratol with two Z-configured double
bonds. The absolute stereochemistry at C-1 was left unassigned
[1]. Klein and Obermann [2], in the same year, reported on a
new cembrenol of the same constitution which they isolated
from the essential oil of Olibanum, the resin of Boswellia carteri
Burdw. (Syn. B. sacra Flueck.). These authors assigned the double-bond
geometry of their compound as all-E on grounds of the
NMR data, and the configuration at C-1 as S.
We have now reisolated serratol from B. serrata and found its
NMR data (see l " Table 1) identical with those of sarcophytol M,
Letters
Table 1 13 Cand 1 H‑NMR data (125/500 MHz, CDCl 3) of serratol. All assignments
were confirmed by HSQC and HMBC spectra.
Position δC (ppm) mult. δH (ppm) a mult. J (Hz)
1 76.94 s
2 34.86 t 2.19 m
2.15 m
3 121.03 d 5.234 br dd (t) 6.5, 7.5
4 136.64 s
5 39.59 t 2.19 m (2H)
6 24.93 t 2.277 dddd (ddt)
2.09 m
7 126.04 d 4.879 br dd (t) 5.5, 6.5
8 133.37 s
9 40.02 t 2.10 m
1.92 m
10 23.87 t 2.06 m (2H)
11 123.28 d 4.986 br dd (t) 7.0, 7.0
12 135.62 s
13 33.59 t 1.91 m
1.73 m
14 35.05 t 1.618 m (2H)
15 34.66 d 1.682 m
16 16.92b q 0.924 d (3H) 7.0
17 16.75b q 0.931 d (3H) 7.0
18 15.17 q 1.536 s (3H)
19 15.28 q 1.555 s (3H)
20 16.33 q 1.537 s (3H)
a 1H‑NMR shift values reported with two digits were taken from HSQC cross signals.
b Assignment interchangeable
a cembratrienol of the soft coral Sarcophyton glaucum Quoy &
Gaimard [3]. Sarcophytol M possesses the same constitution and
double-bond configuration as reported for the B. carteri cembrenol
[2] but opposite configuration at C-1, i.e., it is the enantiomer
of the former. Based on HSQC and HMBC spectra, all proton and
carbon resonances of serratol were resolved and unambiguously
assigned for the first time. The specific optical rotation of our isolate
([α] D 20 − 97, CHCl3) was essentially identical with the published
value for serratol (− 93 [1]) and showed the same sign as
reported for the cembrenol from B. carteri (− 152 [2]), while values
of + 57 (CHCl3) and + 160 (EtOH) were reported for sarcophytol
M [3]. Serratol from B. serrata is thus identical with the cembrenol
from B. carteri (l " Fig. 1).
It is noteworthy that serratol is present in the oleoresin in quite
high concentrations. Calculated from our preparative yield, the
content of serratol in the resin would amount to approximately
1.2%.
A number of reports exist on pharmacological activity of cembrane
diterpenes from the Boswellia species, such as an interesting
anti-inflammatory potential of incensol [4, 5]. The anti-infective
potential of such compounds has not been studied so far.
In the course of our search for natural compounds with antiprotozoal
activity (e.g. [6, 7]), serratol was therefore tested for activity
against Trypanosoma brucei rhodesiense, T. cruzi, Leishmania
donovani,andPlasmodium falciparum. It was found active against
T. brucei rhodesiense and P. falciparum (IC 50 1.1 µg/mL = 3.8 µM
and 0.72 µg/mL = 2.5 µM, respectively). Its activity was much
weaker than the positive control drugs, melarsoprol and chloroquine
(0.004 and 0.07 µg/mL against T. brucei and P. falciparum,
respectively) but, interestingly enough, it displayed cytotoxicity
against the L6 rat skeletal myoblast cell line only at a much higher
concentration (IC50 11.4 µg/mL = 39 µM) and thus showed a cer-
Schmidt TJ et al. Complete Structural Assignment… Planta Med 2011; 77: 849–850
849

850
Letters
Fig. 1 Structure of
S-(−)-cembra-3E,7E,11Etriene-1-ol
(serratol).
tain degree of selectivity. It was essentially inactive against T.
cruzi and L. donovani (IC50 = 44 and 12 µM). In spite of its relatively
moderate activity, serratol might be an interesting starting
point for further studies on antiprotozoal effects of cembranoid
diterpenes.
Material and Methods
!
Oleoresin of B. serrata was obtained from Pharmasan GmbH,
batch No. PS0208030. A voucher sample (number PB226) was retained
at the documentation file of the Institut für Pharmazeutische
Biologie und Phytochemie, Münster. The material was powdered
and 998 g were extracted exhaustively (Soxhlet) with dichloromethane
to yield 665 g of crude extract. 100 g of the extract
were separated in three portions of 33 g each by VLC on
300 g silica 60 with n-hexane/EtOAc 95: 5 (1500 mL) and EtOAc
(500 mL). The hexane-rich lipophilic fractions were combined
(14.8 g) and further separated by CC on silica 60 (column dimensions;
126 × 8 cm; 1500 g silica) using n-hexane/EtOAc 98:2
(5000 mL), 95: 5 (12 000 mL), 90: 10 (5000 mL), 50: 50 (1000
mL), and 0: 100 (2000 mL). Serratol was eluted in pure form (TLC
control) between 12 300 and 13600 mL. The total yield was
1831 mg of TLC and GC pure serratol in the form of a colourless
resin.
GC/EIMS analyses were carried out with an Agilent 6890N/5973
system; optical rotation was measured with a Perkin Elmer Polarimeter
341; CD and UV spectra were obtained with a JASCO J-815
spectropolarimeter, and NMR spectra were recorded on a Varian
INOVA spectrometer.
Antiprotozoal tests were performed according to well-established
protocols as reported previously [6].
S-(−)-cembra-3E,7E,11E-triene-1-ol (serratol): GC/EIMS: m/z (rel.
int. %): 290 [M] + (100); 275 [M‑CH3] + (2); 261 [M‑CHO] + (1); 247
[M‑CH3CO] + (67); UV (n-hexane): λ,(logε): 190 nm (end absorb-
20
ance, 4.4); CD (n-hexane): λ, (Δε): 202 (−12.7); 190 (−7.6); [α] D
−97° (n-hexane c 1.0); −79° (CHCl3 c 1.0). 1Hand 13C‑NMR see
l " Table 1.
Schmidt TJ et al. Complete Structural Assignment… Planta Med 2011; 77: 849–850
Supporting information
Copies of all spectra are available as Supporting Information.
Acknowledgements
!
The authors cordially thank Mairin Lenz for excellent technical
assistance.
References
1 Pardhy RS, Bhattacharyya S. Structure of serratol, a new diterpene
cembranoid alcohol from Boswellia serrata Roxb. Indian J Chem 1977;
16 B: 171–173
2 Klein E, Obermann H. (S)-1-Isopropyl-4,8,12-trimethyl-cyclotetradeca-
3E,7E,11E-trien-1-ol, ein neues Cembrenol aus dem ätherischen Öl von
Olibanum. Tetrahedron Lett 1978; 4: 349–352
3 Kobayashi M, Osabe K. Marine terpenes and terpenoids. VII. Minor
cembranoid derivatives, structurally related to the potent anti-tumorpromoter
sarcophytol A, from the soft coral Sarcophyton glaucum.
Chem Pharm Bull 1989; 37: 631–636
4 Moussaieff A, Shohami E, Kashman Y, Fride E, Schmitz ML, Renner F, Fiebich
BL, Munoz E, Ben-Neriah Y, Mechoulam R. Incensole acetate, a novel
anti-inflammatory compound isolated from Boswellia resin, inhibits
nuclear factor-kB activation. Mol Pharmacol 2007; 72: 1657–1664
5 Moussaieff A, Shein NA, Tsenter J, Grigoriadis S, Simeonidou C, Alexandrovich
AG, Trembovler V, Ben-Neriah Y, Schmitz ML, Fiebich BL, Munoz
E, Mechoulam R, Shohami E. Incensole acetate: a novel neuroprotective
agent isolated from Boswellia carterii. J Cereb Blood Flow Metab 2008;
28: 1341–1352
6 Nour AMM, Khalid SA, Brun R, Kaiser M, Schmidt TJ. The antiprotozoal
activity of sixteen Asteraceae species native to Sudan and bioactivityguided
isolation of xanthanolides from Xanthium brasilicum. Planta
Med 2009; 75: 1363–1368
7 Nour AMM, Khalid SA, Brun R, Kaiser M, Schmidt TJ. The antiprotozoal
activity of methylated flavonoids from Ageratum conyzoides L.
J Ethnopharmacol 2010; 129: 127–130
received September 27, 2010
revised November 17, 2010
accepted November 19, 2010
Bibliography
DOI http://dx.doi.org/10.1055/s-0030-1250612
Published online December 14, 2010
Planta Med 2011; 77: 849–850
© Georg Thieme Verlag KG Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. Dr. Thomas J. Schmidt
Institut für Pharmazeutische Biologie
und Phytochemie (IPBP)
Westfälische Wilhelms-Universität Münster
Hittorfstraße 56
D-48149 Münster
Germany
Phone: + 49 2518 3333 78
Fax: +492518338341
thomschm@uni-muenster.de

NMR Fingerprinting for Analysis
of Hoodia Species and Hoodia Dietary Products
Authors Jianping Zhao 1 , Bharathi Avula 1 , Vaishali C. Joshi 1 , Natascha Techen 1 , Yan-Hong Wang 1 ,
Troy J. Smillie 1 , Ikhlas A. Khan 1,2
Affiliations
Key words
l " NMR
l " fingerprinting
l " multivariate analysis
l " Hoodia species
l " Asclepiadaceae
l " botanical
l " dietary supplement
received July 30, 2010
revised October 28, 2010
accepted Nov. 2, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250583
Published online December 2,
2010
Planta Med 2011; 77: 851–857
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Prof. Dr. Ikhlas A. Khan
National Center
for Natural Products Research
Research Institute
of Pharmaceutical Sciences
University of Mississippi
P. O. Box 1848
University, MS 38677
USA
Phone: + 166 2915 78 21
Fax: + 166 2915 7989
ikhan@olemiss.edu
Correspondence
Dr. Jianping Zhao
National Center
for Natural Products Research
Thad Cochran Research Center
University of Mississippi
P. O. Box 1848
University, MS 38677
USA
Phone: + 166 2915 71 51
Fax: + 166 2915 7989
jianping@olemiss.edu
1 National Center for Natural Products Research, Research Institute of Pharmaceutical Sciences, University of Mississippi,
University, MS, USA
2 Department of Pharmacognosy, School of Pharmacy, University of Mississippi, University, MS, USA
Abstract
!
Hoodia gordonii, a succulent plant growing in
African arid regions, is used as a botanical dietary
supplement for weight loss. The increasing concerns
on the quality and safety of Hoodia products
call for the needs of more science-based information,
as well as objective and efficient tools for inspection.
In the present study, NMR fingerprinting
and multivariate analysis techniques were applied
for the identification, discrimination, and
quality analysis of Hoodia plant materials and
commercial products. Four Hoodia species,
namely H. gordonii (five authenticated samples),
H. currorii (one authenticated sample), H. parvi-
Introduction
!
Hoodia gordonii (Masson) Sweet ex Decne (Asclepiadaceae),
a succulent plant, grows primarily in
the semi-deserts of South Africa, Botswana, Namibia,
and Angola. There are about 13 species in
the genus Hoodia [1]. Being fleshy succulents and
growing in arid regions, H. gordonii is traditionally
used as food by the indigenous people in the
Kalahari Desert [2]. H. gordonii has gained popularity
in recent years because of its anorectic activity.
Varieties of Hoodia products prepared in
powder, capsule, liquid, or tea form are sold in
health food stores and on the internet as herbal
weight-loss supplements. The demand for
weight-loss products containing H. gordonii is increasing,
especially after the Ephedra product was
banned because of its side effects.
H. gordonii grows slowly [3]. It takes several years
to mature and grows in a limited area with extreme
soil and weather conditions, making the
plant vulnerable to overexploitation and short of
supply. The gap between supply and demand of
H. gordonii plant materials might be reflected to
some extent by the existence of adulteration
Original Papers
flora (three authenticated samples), and H. rushii
(one authenticated sample), were investigated;
the chemicals and characteristic spectral signals
that made most contributions for their differentiations
were revealed. With the aid of NMR fingerprint
analysis, ten Hoodia products sold on
the dietary supplement market were assessed for
their chemical composition and quality. The study
demonstrated that the NMR fingerprinting approach
could be a promising and efficient tool for
the authentication of botanicals.
Supporting information available online at
http://www.thieme‑connect.de/ejournals/toc/
plantamedica
problems for Hoodia commercial products. Many
Hoodia products on the market were found to be
counterfeits, causing more concerns about their
safety and quality [4, 5]. There is a crucial need to
develop effective methods for authentication and
quality analysis of H. gordonii plant material and
commercial products.
So far, H. gordonii is the only sought-after species
for trade and the only source material for manufacturing
Hoodia dietary supplement products.
Previously, our group developed UPLC‑UV‑MS
and HPTLC methods for identifying and quantifying
P57, an oxypregnane glycoside purported as
the active principle in H. gordonii, and several
other pregnane glycosides in different species of
Hoodia genus and related genera [4, 6]. Interestingly,
it was found that besides H. gordonii, other
species of Hoodia genus, namely H. currorii (synonym
H. macranth), H. parviflora, and H. ruschii, also
contained P57 and other pregnane glycosides.
The finding provided the information that it
might be possible to use these other Hoodia species
as substitutes for H. gordonii. However, there
is no sufficient knowledge about the safety and
efficacy of using these related species as supple-
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
851

852
Original Papers
ments, and even the information about their chemical compositions
is rare. In our previous studies, the chemical fingerprint
analyses of the Hoodia species by using HPLC and HPTLC were reported
[6, 7]. The chromatographic methods can provide information
about the content levels of different pregnane glycosides
in different Hoodia species. However, it is difficult to discriminate
H. gordonii from the other three Hoodia species even though at
least 11 pregnane glycosides reference compounds were used as
markers.
Nuclear magnetic resonance (NMR) spectroscopy is one of the
most powerful chemical analytical tools and widely used for
characterization and structure determination of natural products.
NMR spectra can provide qualitative and quantitative information
regarding the components of a mixture. In principle, any
components containing hydrogen can be detected by 1 H NMR.
Hence, it provides unbiased detections for compounds over all organic
chemical classes and allows direct quantitative comparisons
[8]. NMR has therefore become one of the most useful techniques
contributing to the emerging field of metabolomics [9,
10]. NMR spectroscopy combined with multivariate analysis
techniques have been successfully used to solve problems such
as plant species and cultivar discrimination, metabolite profiling,
and quality assessment of food or herbal medicines [11, 12].
The aim of the present work was to study the variability of metabolite
fingerprints of the Hoodia species and to develop an efficient
method for identification, differentiation, and quality analysis
of H. gordonii plant materials and its products by using the
NMR fingerprinting approach.
Materials and Methods
!
Chemicals
Methanol, acetonitrile, water, and formic acid were of HPLC grade,
purchased from Fisher Scientific. Deuterated methanol (CD3OD,
99.8% D), chloroform (CDCl3, 99.9% D), and D2O (99.9% D) were obtained
from Cambridge Isotope Laboratories, and sodium 3-trimethylsilyl
[2,2,3,3- 2 H(4)] propanoate (TSP) was purchased from
Sigma-Aldrich, Inc.
The standard compounds (P57, 93.6% purity and hoodigoside L,
87.0% purity) were isolated at the National Center for Natural
Products Research (NCNPR). The identity and purity were confirmed
by chromatographic (TLC, HPLC) methods, by the analysis
of the spectroscopic data (IR, 1D- and 2D‑NMR, HR–ESI–MS), and
by comparison with published spectroscopic data [13, 14].
Plant materials
Authenticated samples of H. gordonii were obtained from the
Universiteit Van Die Vrystaat, South Africa (code numbers: 2925,
2926, and 2927), the Missouri Botanical Garden (code number:
2821), and the American Herbal Pharmacopoeia (AHP) (code
number: 3164). The samples of H. parviflora were obtained from
the AHP (code numbers: 3162 and 3163) and a domestic supplier
(code number: 3230). H. ruschii (code number: 2822) and H. currorii
(code number: 2823) samples were obtained from the Missouri
Botanical Garden. The plant material was authenticated by
Dr. Vaishali Joshi. Hoodia commercial products (sample codes:
HCP-1 to HCP-10) claiming to consist solely of 100% pure H. gordonii
were obtained from the market in the USA. Voucher specimens
of all samples were deposited at the National Center for
Natural Products Research (NCNPR), University of Mississippi,
Mississippi, USA.
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
Sample preparation
The dried plant materials were ground with an electric blender
(IKA Works Inc.) into powder and sieved through a 2-mm sieve.
The commercial Hoodia products investigated in this study were
mixed and triturated with a mortar and pestle prior to further
preparation. The homogenized sample (200 mg) was weighed
and ultrasonicated in 3 mL of methanol for 20 min followed by
centrifugation for 15 min at 4500 rpm. The supernatant was transferred
to a 15-mL vial. The extraction procedure was repeated
thrice, and the respective supernatants combined. The extract
was dried by removing the solvent under vacuum with a Thermo
Savant SpeedVac system (Thermo Scientific, MA). Parallel triplicate
experiments were conducted for each sample. The dried extract
was dissolved in 0.4 mL of CD3OD containing 0.05% (w/v)
TSP, then transferred into a NMR tube for NMR measurement.
NMR measurements
1 H NMR spectra were measured on a Bruker AVANCE DRX400
NMR spectrometer operating at a proton NMR frequency of
400.13 MHz under a temperature of 298 K with Bruker Topspin
software (v. 1.3). A pulse program with 60 dB power level of selective
irradiation for water presaturation during relaxation delay
was used to suppress the residual water signal. For each sample,
16 transients were collected into 64 k data points. The spectra
were recorded with the following parameters: spectral width =
4845 Hz, relaxation delay = 5 s, pulse width = 11.00 µs (90 °). FIDs
were Fourier transformed with LB = 0.3 Hz. The spectra were
manually phased and baseline corrected using Mnova (v. 5.2,
Mestrelab Research S. L.), and calibrated to the signal of TSP at
chemical shift δ = 0.00 ppm. 2D NMR spectra (COSY, TOCSY, HSQC,
and HMBC) were recorded with the standard acquisition programs
for spectral interpretation and component identification.
Multivariate data analysis
1 H NMR spectra were bucketed with equal bin width of 0.02 ppm
over a region of δ 0.5 to 8.5 ppm after phase and baseline corrections.
The spectral regions from δ 4.75 to 5.05 ppm and 3.27 to
3.37 ppm were excluded to eliminate the effects of water suppression
and the residual methanol signal. Binned data were normalized
to the total sum and converted to ASCII format. The data
sets were then imported and subjected to orthogonal partial least
squares project to latent structures-discriminant analysis
(OPLS‑DA), using software SIMCA‑P + (v. 12.0; Umetrics). The data
sets were Pareto-scaled. The OPLS‑DA model was cross-validated
through the exclusion of every 7th spectra in each cross validation
round. Model quality was assessed by means of the goodness
of fit parameter (R 2 ) and cross validation predictive ability [Q 2 (Y)].
To identify and select the significant and reliable variables that
make most contributions to the classification from the OPLS‑DA
model, the VIP (variable importance in the projection) plot, S-plot
[Cov(t,X) vector vs. Corr(t,X) vector], and loading plot with a jackknifed
confidence interval (CIJKjk) were computed using SIMCA‑P
software. Multi-criteria assessment (MCA), i.e., VIP > 1, | Corr(t,X)|
> 0.58, and the span of CIJKjk excluding zero, was used selecting
the most significant and reliable variables [15, 16].
Supporting information
Statistical validation result of the OPLS‑DA model for the samples
of H. gordonii and H. parviflora, as well as VIP plot, S-plot, and
loading plot with CIJKjk from the model are available as Supporting
Information. The PCA scores and loadings plots for the samples
of H. gordonii and H. parviflora were also provided.

Results and Discussion
!
The genus Hoodia belongs to the Asclepiadaceae family. It has
been found that many plants in this family commonly contain
steroidal glycosides as major secondary metabolites [17]. Previous
phytochemical investigations conducted by our group on
H. gordonii led to the isolation and identification of more than
twenty pregnane glycosides, including the purported active component
P57 [13, 14,18]. These pregnane glycosides are characterized
by an aglycone (either hoodigogenin A or calogenin) and
sugar side chains structured by different 6-deoxy- and/or 2,6-dideoxy
hexopyranose moieties (l " Fig. 1). Hoodigoside L was identified
as a major pregnane glycoside present in the organic extract
of H. gordonii [4]. l " Fig. 2 shows a representative 1 H NMR
spectrum of H. gordonii extract, as well as the spectra of pure
compound P57 and hoodigoside L. The assignment of signals in
the 1 H NMR spectrum of H. gordonii extract was achieved (see
l " Table 1) with the aid of 13 C NMR, 2D NMR (COSY, TOCSY, HSQC,
and HMBC), and spiking experiments. The broad signals with a
chemical shift in the range of δ 6.88 to 7.08 ppm were assigned
to the olefinic protons from the tigloyl moieties of hoodigogenin
and calogenin glycosides by using COSY and HSQC analyses. The
assignment was further confirmed by the HMBC experiment,
which showed the correlation to the carbonyl carbon (δC 168.1)
of the tiglic acid moiety. The HSQC and HMBC experiments revealed
that the two methyl groups on the tigloyl moiety corresponded
to the two strong signals, one singlet and one doublet,
with chemical shifts at δ 1.88 and 1.83 ppm, respectively. The
tigloyl moiety is a characteristic structure segment of the unique
pregnane glycosides present in H. gordonii. Its NMR signals can be
used as spectral markers when using the NMR fingerprinting approach
for authenticating Hoodia products. The term “spectralfeature-signatures”
was used for such spectral markers in this
study. Another significant singlet signal with strong intensity at
δ 2.19 ppm was ascribed to the methyl group (C-21) of the unique
ketone moiety of hoodigogenin glycosides. The olefinic proton
(H-6) on the pregnane aglycone also presented a characteristic
feature in the NMR fingerprint of H. gordonii. The signals of the
H-6 protons from different pregnane glycosides in the extract
were observed around 5.41 ppm. The pregnane glycosides have
different sugar side chains consisting of various hexopyranoses
(see l " Fig. 1), and the anomeric protons of these sugar moieties
gave the characteristic signals in the region from δ 4.30 to δ
4.77 ppm. Their assignments were confirmed by using 2D NMR
analyses including COSY, HMBC, and HSQC. In addition, the methoxyl
and methyl groups on the hexopyranose side-chain-moieties
of the pregnane glycosides were ascribed to the characteristic
strong singlet signals in the regions of δ 3.34 to 3.72 ppm
and the doublet signals in the region of δ 1.12 to 1.37 ppm, respectively.
Furthermore, the characteristic singlet signals with
relatively strong intensity in the region of δ 0.98 to 1.06 ppm
were attributed to the C-18 and C-19 methyl groups of pregnane
aglycone. All the signals mentioned above can be served as “spectral-feature-signatures”
for identifying or authenticating the
presence of hoodigogenin, calogenin, and their glycosides. Further
spectral analyses revealed that the olefinic protons from unsaturated
long chains of lipids in the extracts gave signals with
chemical shifts at about δ 5.35 ppm. Sucrose, α-glucose, and βglucose
were identified on the basis of 13 C, 2D NMR (COSY,
TOCSY, and HMBC), and spiking experiments. Their anomeric
protons showed characteristic signals at δ 5.40 (d, J = 3.8 Hz), δ
5.12 (d, J = 3.7 Hz), and δ 4.48 (d, J = 8.0 Hz) ppm, respectively.
Original Papers
Fig. 1 Structures of pregnane glycosides and hexopyranoses previously
identified in H. gordonii.
l " Fig. 3 shows the 1 H NMR spectra of four different Hoodia species,
H. gordonii, H. parviflora, H. currorii, andH. ruschii. Some
common features in their spectra were observed for these four
species. For example, all of these Hoodia species demonstrate
the presence of the “spectral-feature-signatures” of pregnane
glycosides in their spectra, although the intensities vary. All extracts
of these species contained lipids, giving the characteristic
broad signals with chemical shifts at around 1.3 and 1.6 ppm.
However, the NMR spectra of H. gordonii and H. ruschii showed
distinct differences from each other at a range of 2.5 to 2.8 ppm.
The spectrum of H. ruschii shows significant strong multiplet signals
at δ 2.57 (dd, J = 16.0, 8.0 Hz), 2.77 (dd, J = 16.0, 4.0 Hz), and
4.30 (dd, J = 4.0, 8.0 Hz), but the intensity of these signals was
very low in the spectrum of H. gordonii. The investigation conducted
by using 2D NMR analyses attributed these resonances to
malic acid. The assignment and presence of malic acid were further
confirmed by a spiking experiment. Another significant difference
between H. gordonii and H. ruschii revealed from their
NMR fingerprints was the difference of the signal intensities for
α-glucose, β-glucose, and sucrose. With calculations from the integrals
of the signals relative to the internal reference TSP (0.05%,
w/v), it was found that the concentrations of α-glucose, β-glu-
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
853

854
Original Papers
Table 1 Characteristics of 1 H NMR signals observed in H. gordonii extract.
Compound Groupa Chemical shift
δ (ppm)
Pregnane glycosides Tigloyl
=CH (br, d)
6.88–7.08
-CH3 (s)
1.88
-CH3 (d)
Pregnane aglycone
1.83
=CH (H-6) (m)
5.41
-CH3 (H-18) (s)
0.98–1.01
-CH3 (H-19) (s)
Hoodigogin
1.04–1.06
-CH3 (H-21) (s)
Sugar moiety
2.19
-CH (anomeric) (d) 4.30–4.77
-CH3 (d)
1.12–1.37
-OCH3 (s)
3.34–3.72
Sucrose -CH (anomeric) (d) 5.40
α-Glucose -CH (anomeric) (d) 5.12
β-Glucose -CH (anomeric) (d) 4.48
Lipids Fatty acid chain
-CH3 (chain terminal) (t) 0.89
-CH2 (m)
1.28
-CH2 (m)
1.59
=CH (br)
5.35
a Letters in parentheses indicate the peak multiplicity property of proton NMR signal:
s, singlet; d, doublet; t, triplet; m, multiplet; br, broad
cose, and sucrose in H. gordonii were approximately 3.8, 2.3, and
4.7 times, respectively, higher than in H. ruschii.
Significant differences between H. gordonii and H. currorii in
their NMR spectra were observed in the region of δ 2.20 to
2.70 ppm and at 4.30 ppm. Malic acid was identified in H. currorii
also, corresponding to the signals at δ 2.57, 2.77, and 4.30 ppm.
The strong multiplet signals at around 2.33 and 2.45 ppm could
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
Fig. 2 1 HNMR spectra of H. gordonii extract, P57,
and hoodigoside L. Characteristic resonances assigned
to: 1, olefinic proton on tigloyl moiety;
2, olefinic proton (H-6) on pregnane aglycone;
3, sucrose; 4, α-glucose; 5, β-glucose; 6, methoxyl
on hexopyranose of pregnane glycoside; 7, methyl
(C-21) on hoodigogenin; 8, methyl on tigloyl moiety;
9, methyl on hexopyranose and methylene on
fatty chains; 10, methyl (C-18/C-19) on pregnane
aglycon.
not be assigned to a known compound (or compounds) because
of the complexity of the resonances. Another significant difference
between H. gordonii and H. currorii in their NMR fingerprints
that could be clearly observed was the difference of sucrose
signals. The signal of sucrose at δ 5.40 ppm (J =3.8Hz) in
H. currorii was undetectable. Furthermore, the quantitative analyses
through the integrals of the anomeric signals revealed that
the concentrations of α-glucose and β-glucose in H. gordonii were
approximately 2.2 and 1.4 times, respectively, higher than in H.
currorii.
The 1 H NMR spectra of H. gordonii and H. parviflora illustrated
close similarity regarding the “spectral-feature-signatures” of
pregnane glycosides, although a different feature pattern in the
range of δ 3.3 to 4.2 ppm (sugar range) was observed. The discrimination
of H. gordonii from H. parviflora was further conducted
by analysis of spectra using chemometric methods. Chemometrics
is an effective tool for visualizing and deciphering
the useful information hidden within NMR spectra [19]. Mutlivariate
analysis is used to describe sample clustering and to detect
the chemical compounds responsible for the separation of
samples. To understand the significance of variables ( 1 H NMR signals)
contributing to the differentiation between H. gordonii and
H. parviflora, the data sets derived from the NMR spectra of samples
of these two species were subjected to OPLS‑DA. OPLS‑DA is
a supervised multivariate analysis tool that focuses on analyzing
variance between the sample groups (interclass variation), making
the interpretation straightforward [16].
l " Fig. 4 shows the scores scatter plot from the OPLS‑DA model for
H. gordonii and H. parviflora samples collected from different
sources. The model presented a clear separation between the
two species along the predictive component (tP) dimension. Besides,
discernible subgroupings were observed for the samples
within the same species group along the orthogonal component
(t o) dimension. Such sub-separations would be explained as the
variations of metabolites in individual samples collected from

different sources. Many factors such as the growing site, age of
plant, and harvest season could cause the variation of metabolites
in plant materials. The model had an overall goodness of fit,
R 2 (Y), of 98.4% and an overall cross-validation coefficient, Q 2 (Y),
of 98.0%. To test the possibility of correlation by chance, a “yscrambling”
validation was carried out to assess the risk that the
model was overfitted or spurious [20]. A substantial decrease in
both values of parameters R 2 (Y) and Q 2 (Y) was observed after
performing 200 rounds of random permutations, and the extrapolated
value of the Q 2 regression line was − 0.298 (Fig. 1S in
Supporting Information). Generally, the criteria for validity are
Original Papers
Fig. 3 1 H NMR spectra of Hoodia species. 1, H. gordonii;
2. H. parviflora; 3, H. currorii; 4, H. ruschii.
Fig. 4 OPLS‑DA scores scatter plot for H. gordonii
samples (Δ, 2925; ○, 2926; ◊, 2927; ∇, 2821; ▫,
3164) and H. parviflora samples (▲, 3162; ♦, 3163;
▪, 3230).
that all Q 2 values to the left are lower than the original points to
the right or the regression line of the Q 2 points intersects the vertical
axis below zero. The validation results demonstrated that
the constructed model was statistically valid and that the value
of predictability did not arise from overfitting.
By using a combination analysis of VIP statistics, S-plot, and loading
plot with a jack-knifed confidence interval as a tool [15, 16],
the significant and reliable variables (SRVs) that made the greatest
contribution to the discrimination of H. gordonii and H. parviflora
in the constructed OPLS‑DA model were further investigated.
The results revealed that the NMR spectral signals corre-
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
855

856
Original Papers
sponding to these SRVs were ascribed to saccharides including
sucrose (δ 5.40), α-glucose (δ 5.12), and β-glucose (δ 4.48), and
lipids (with characteristic broad peaks at around δ 0.89, 1.28,
1.59, and 2.01 ppm for fatty chain) (Fig. 2S in the Supporting Information).
The concentrations of sucrose, α-glucose, and β-glucose
in extracts of H. gordonii and H. parviflora were calculated
from the integrals of their signals relative to that of the internal
reference TSP (0.05% w/v), and the results showed that the concentrations
of sucrose, α-glucose, and β-glucose in H. gordonii
were approximately 2.1, 2.3, and 2.2 times, respectively, higher
than in H. parviflora.
H. gordonii is the only sought-after species for trade and the only
source material for manufacturing Hoodia dietary supplement
products so far. The adulteration problem related to Hoodia products
has raised concerns about their quality and safety [4, 5]. NMR
fingerprint analysis can be used as an efficient tool to provide information
on the identity and quality of Hoodia products. In the
present study, we investigated ten commercial Hoodia products,
which were sold on the market and claimed to consist solely of
100% pure H. gordonii.
l " Fig. 5 shows the 1 H NMR spectra of H. gordonii and ten commercial
Hoodia products. A close examination of the spectra for
the tested products revealed that the products HCP-2, HCP-3,
HCP-5, HCP-6, HCP-9, and HCP-10 had significant different spectral
features in comparison with that of the H. gordonii reference.
There was no presence of the “spectral-feature-signatures”,characteristic
signals of the NMR spectrum of H. gordonii, in the spec-
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
Fig. 5 1 H NMR spectra of H. gordonii and Hoodia
products (HCP-1 to HCP-10).
tra of these products. Therefore, these samples can be easily
sorted as counterfeits according to their NMR fingerprints. The
“spectral-feature-signatures” of H. gordonii could be detected in
the NMR fingerprints of products HCP-1, HCP-4, HCP-7, and HCP-
8. The spectrum of product HCP-1 matched very well with that of
the H. gordonii reference, indicating it was a true product of
H. gordonii. Product HCP-7 showed a spectral pattern that agreed
with the reference spectrum of H. gordonii, but the signals at δ
5.40, 5.12, 4.48 ppm, arising from sucrose, α-glucose, and β-glucose,
respectively, showed relatively lower intensities compared
to those of the H. gordonii standard. A much better match was observed
when comparing the spectrum with that of H. parviflora.
Therefore, product HCP-7 might have H. parviflora as its source
material. Products HCP-4 and HCP-8 show clear “spectral-feature-signatures”
of H. gordonii in their NMR fingerprints. However,
the additional signals, showing at δ 2.26 (broad triplet),
1.65 (broad), and 0.88 (broad triplet) ppm, as well as a stronger
broad peak at around δ 1.29, suggested that these two products
contained additional components. All ten products were analyzed
using UPLC‑UV‑MS to determine the presence of P57 [4],
and the results showed that the products HCP-1, HCP-4, HCP-7,
and HCP-8 did contain P57 but products HCP-2, HCP-3, HCP-5,
HCP-6, HCP-9, and HCP-10 did not, which was in agreement with
the result of the NMR fingerprint analysis. Yet, the NMR approach
enabled us to get a holistic view about the chemical composition
of the products. In addition, the method was simple, rapid, and
easy to conduct.

In summary, NMR fingerprint analysis can be applied as an efficient
tool for identifying and discriminating Hoodia species and
commercial products. The approach offered holistic views for
the chemical composition of Hoodia plant materials and commercial
products without bias. Since the composition is directly
associated with the source of plant material and quality of product,
the method can be used as an efficient tool for the assessment
of the authenticity of Hoodia plant materials and quality of
commercial products. In this study, the identification and differentiation
of H. gordonii from H. currorii and H. ruschii were analyzed
by comparing the characteristic features of the NMR fingerprints.
The application of multivariate data analysis allowed for
the visualization of the separation between H. gordonii and
H. parviflora and deciphering of the information on signals and
metabolites that made the greatest contribution to their differentiation.
The chemical markers and spectral signals that most contributed
to the discrimination of H. gordonii from the other three
Hoodia species were revealed. The study demonstrated that the
NMR fingerprinting approach could be a promising and efficient
tool for the identification, differentiation, and quality assessment
of botanicals.
Acknowledgements
!
This research is supported in part by “Science Based Authentication
of Dietary Supplements” and “Botanical Dietary Supplement
Research” funded by the Food and Drug Administration grant
numbers 5U01FD002071-09 and 1U01FD003871-01, and the
United States Department of Agriculture, Agricultural Research
Service, Specific Cooperative Agreement No. 58-6408-2-0009.
The authors would like to thank the Missouri Botanical Garden,
Missouri, USA, and AHP, USA for providing plant samples. The authors
also would like to thank Prof. Jan (JH) Van der Westhuizen
and Dr. PC Zietsman for providing the H. gordonii samples.
References
1 Mabberly DJ. The plant-book. A portable dictionary of the vascular
plants. Cambridge: Cambridge University Press; 1997: 354
2 van Heerden FR, Marthinus HR, Maharaj VJ, Vleggaar R, Senabe JV, Gunning
PJ. An appetite suppressant from Hoodia species. Phytochemistry
2007; 68: 2545–2553
3 Tibe O, Modise DM, Mogotsi KK. Potential for domestication and commercialization
of Hoodia and Opuntia species in Botswana. Afr J Biotechnol
2008; 7: 1199–1203
Original Papers
4 Avula B, Wang YH, Pawar RS, Shukla YJ, Smillie TJ, Khan IA. A rapid
method for chemical fingerprint analysis of Hoodia species, related
genera, and dietary supplements using UPLC‑UV‑MS. J Pharm Biomed
Anal 2008; 48: 722–731
5 Robb-Nicholson C. By the way, doctor. Iʼve seen a lot of Internet ads for
Hoodia, a natural supplement that suppresses your appetite. What do
you know about it? Does it work, is it safe? Harv Womens Health
Watch 2008; 15: 8
6 Rumalla CS, Avula B, Shukla YJ, Wang YH, Pawar RS, Smillie TJ, Khan IA.
Chemical fingerprint of Hoodia species, dietary supplements, and related
genera by using HPTLC. J Sep Sci 2008; 31: 3959–3964
7 Avula B, Wang YH, Pawar RS, Shukla YJ, Khan IA. Chemical fingerprinting
of Hoodia species and related genera: chemical analysis of oxypregnane
glycosides using high-performance liquid chromatography with
UV detection in Hoodia gordonii. J AOAC Int 2007; 90: 1526–1531
8 Teng R, Junankar PR, Bubb WA, Rae C, Mercier P, Kirk K. Metabolite
profiling of the intraerythrocytic malaria parasite Plasmodium falciparum
by 1H NMR spectroscopy. NMR Biomed 2009; 22: 292–302
9 Powers R. NMR metabolomics and drug discovery. Magn Reson Chem
2009; 47: S2–S11
10 Verpoorte R, Choi Y, Kim H. NMR-based metabolomics at work in phytochemistry.
Phytochem Rev 2007; 6: 3–14
11 van der Kooy F, Maltese F, Choi YH, Kim HK, Verpoorte R. Quality control
of herbal material and phytopharmaceuticals with MS and NMR based
metabolic fingerprinting. Planta Med 2009; 75: 763–775
12 Ward JL, Baker JM, Beale MH. Recent applications of NMR spectroscopy
in plant metabolomics. FEBS J 2007; 274: 1126–1131
13 Pawar RS, Shukla YJ, Khan IA. New calogenin glycosides from Hoodia
gordonii. Steroids 2007; 72: 881–891
14 Pawar RS, Shukla YJ, Khan SI, Avula B, Khan IA. New oxypregnane glycosides
from appetite suppressant herbal supplement Hoodia gordonii.
Steroids 2007; 72: 524–534
15 Son HS, Hwang GS, Kim KM, Kim EY, van den Berg F, Park WM, Lee CH,
Hong YS. 1 H NMR-based metabolomic approach for understanding the
fermentation behaviors of wine yeast strains. Anal Chem 2009; 81:
1137–1145
16 Wiklund S, Johansson E, Sjostrom L, Mellerowicz EJ, Edlund U, Shockcor
JP, Gottfries J, Moritz T, Trygg J. Visualization of GC/TOF‑MS-based metabolomics
data for identification of biochemically interesting compounds
using OPLS class models. Anal Chem 2008; 80: 115–122
17 van Heerden FR. Hoodia gordonii: a natural appetite suppressant.
J Ethnopharmacol 2008; 119: 434–437
18 Shukla YJ, Pawar RS, Ding Y, Li XC, Ferreira D, Khan IA. Pregnane glycosides
from Hoodia gordonii. Phytochemistry 2009; 70: 675–683
19 Lindon JC, Nicholson JK. Analytical technologies for metabonomics and
metabolomics, and multi-omic information recovery. Trends Analyt
Chem 2008; 27: 194–204
20 Kang J, Choi MY, Kang S, Kwon HN, Wen H, Lee CH, Park M, Wiklund S,
Kim HJ, Kwon SW, Park S. Application of a 1 H nuclear magnetic resonance
(NMR) metabolomics approach combined with orthogonal projections
to latent structure-discriminant analysis as an efficient tool for
discriminating between Korean and Chinese herbal medicines. J Agric
Food Chem 2008; 56: 11 589–11 595
Zhao J et al. NMR Fingerprinting for… Planta Med 2011; 77: 851–857
857

858
Original Papers
Distribution, Synthesis, and Absorption
of Kynurenic Acid in Plants
Authors Michal P. Turski 1 , Monika Turska 1 , Wojciech Zgrajka 1 , Magdalena Bartnik 2 , Tomasz Kocki 3 , Waldemar A. Turski 1,3
Affiliations
Key words
l " kynurenic acid
l " medicinal plants
l " synthesis
l " absorption
received May 15, 2009
revised Nov. 8, 2010
accepted Nov. 15, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250604
Published online December 14,
2010
Planta Med 2011; 77: 858–864
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Waldemar A. Turski
Department of Toxicology
Institute
of Agricultural Medicine
Jaczewskiego 2
20-950 Lublin
Poland
Phone: + 48 81718 45 43
Fax: + 4881747 8646
turskiwa@op.pl
1 Department of Toxicology, Institute of Agricultural Medicine, Lublin, Poland
2 Department of Pharmacognosy with Medicinal Plant Laboratory, Medical University, Lublin, Poland
3 Department of Experimental and Clinical Pharmacology, Medical University, Lublin, Poland
Abstract
!
Kynurenic acid (KYNA) is an endogenous antagonist
of the ionotropic glutamate receptors and the
α7 nicotinic acetylcholine receptor as well as an
agonist of the G-protein-coupled receptor
GPR35. In this study, KYNA distribution and synthesis
in plants as well as its absorption was researched.
KYNA level was determined by means
of the high-performance liquid chromatography
with fluorescence detection. KYNA was found in
leaves, flowers, and roots of tested medicinal
herbs: dandelion (Taraxacum officinale), common
nettle (Urtica dioica), and greater celandine (Chelidonium
majus). The highest concentration of this
compound was detected in leaves of dandelion – a
Introduction
!
Kynurenic acid (KYNA) is an oxidative pathway
metabolite of tryptophan formed along the kynurenine
pathway. Its presence was first demonstrated
in urine by Liebig in 1853 [1]. KYNA is an
endogenous antagonist of the ionotropic glutamate
receptors and the α7 nicotinic acetylcholine
receptor. Moreover, it exerts an anticonvulsant
and neuroprotective activity [2–6]. KYNA is an agonist
of the G-protein-coupled receptor GPR35,
which is predominantly expressed in the gastrointestinal
tissues [7]. Based on electrophysiological
studies, KYNA exerts a modulatory effect on
the neurotransmission in the brain [3,8]. The possible
role of KYNA in the central nervous system
was recently reviewed by Wonodi and Schwarcz,
2010 [9], Vamos et al., 2009 [10], and Erhardt et
al., 2009 [11].
In recent years, the identification of KYNA and its
potential role outside the brain became popular.
KYNA was found in urine, serum, amniotic and
synovial fluid, where its concentration varied
from 0.02–0.8 µM [12–15].
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
mean value of 0.49 µg/g wet weight. It was shown
that KYNA can be synthesized enzymatically in
plants from its precursor, L-kynurenine, or absorbed
by plants from the soil. Finally, the content
of KYNA was investigated in 21 herbal tablets,
herbal tea, herbs in sachets, and single herbs in
bags. The highest content of KYNA in a maximum
daily dose of herbal medicines appeared in
St. Johnʼswort– 33.75 µg (tablets) or 32.60 µg (sachets).
The pharmacological properties of KYNA
and its presence in high concentrations in medicinal
herbs may suggest that it possesses therapeutic
potential, especially in the digestive system
and should be considered a new valuable dietary
supplement.
More recently, it was demonstrated that KYNA is
a constituent of the rat intestinal fluid and that its
content increases along the small intestine,
reaching a concentration of 16 µM in its distal
part [13, 16]. Interestingly, KYNA in a concentration
found in the digestive system may interact
with the glycine site of the N-methyl-D-aspartate
(NMDA) glutamate receptors, the α7 nicotinic receptor,
and the GPR35 receptor [16]. Furthermore,
it was shown that KYNA protects against
the experimentally induced gastric ulcer [17, 18],
attenuates the intestinal motility in experimental
colonic obstruction in dogs [19] and decreases the
motility and the inflammatory activation in the
early phase of acute experimental colitis in rats
[20]. Taken together, these findings suggest a potential
role of KYNA in the regulation of the gastrointestinal
tract.
In our previous study, it was proved that KYNA is
present in food and honeybee products, being
found in all 37 tested samples. The highest concentration
of KYNA was obtained from the samples
of honeybee products: propolis, multiflorous
honey, and bee pollen. A high concentration of

KYNA was also found in fresh broccoli and potatoes [18]. Therefore,
the aim of this study was to investigate the content and distribution
of KYNA in medicinal herbs, soil, surface water, and natural
fertilizer, as well as to discover whether KYNA is synthesized
in plants or absorbed by them.
Materials and Methods
!
Standard and reagents
Kynurenic acid (KYNA), the standard (98.5% purity, determined
by HPLC) used for the quantitative analysis of KYNA presence in
the plant extracts, was purchased from Sigma. All high-performance
liquid chromatography (HPLC) reagents were purchased
from J.T. Baker and were of the highest available purity: zinc acetate
(analytical purity 100%), sodium acetate (analytical purity
100%, assay by non-aqueous titration), water (HPLC gradient
grade), acetonitrile (HPLC ultra gradient grade, purity determined
by GC), and isopropyl alcohol (99.5%). L-kynurenine used
as a sulfate salt (purity 99%, assay by titration), triethylammonium
phosphate (HPLC grade), and aminooxyacetic acid (AOAA)
were obtained from Sigma. Hydrochloric acid (J.T. Baker) and trichloroacetic
acid (POCH) were of an analytical grade. For purification
of the extracts obtained from the plant material and the
environmental sources and for extraction of KYNA, cation exchange
resin Dowex 50 WX4–400, purchased from Sigma, was
used.
Herbal medicines
The following herbal tablets were used: camomile (Matricaria
chamomilla; batch 01072007), flax (Linum usitatissimum; batch
803), midland hawthorn (Crataegus oxyacantha; batch 803),
heartsease (Viola tricolor; batch 804), lemon balm (Melissa officinalis;
batch 804), small-leaved-lime (Tilia cordata; batch
01012007), common nettle (Urtica dioica; batch 803), and
St. Johnʼs wort(Hypericum perforatum; batch 02042007). All of
those tablets were purchased from Zakłady Farmaceutyczne Colfarm
S.A. Broccoli (Brassica oleracea var. botrytis; batch AL003)
purchased from Unipharm sp. z o. o. and capsules with lupulin
(Lupulinum; batch 010408) purchased from Herbapol Kraków
S. A. were used. The only herbal tea used, nettle root (Urticae radix),
was purchased from Dary Natury Mirosław Angielczyk. The
following herbs in sachets were used: lime flower (Tiliae flos)
and nettle leaf (Urticae folium), both purchased from Herbapol
Białystok S. A. The following single herbs in bags were used: matricaria
flower (Matricariae flos), elderberry flower (Sambuci
flos), common mallow flower (Malvae flos), peppermint leaf
(Menthae piperitae folium), mullein flower (Verbasci flos),
St. Johnʼs wort (Hyperici herba) (all supplied by “Kawon-Hurt”
Nowak Sp. J.), strawflower (Helichrysi inflorescentia; Zakład
Konfekcjonowania Ziół FLOS Elżbieta i Jan Głąb), and meadowsweet
herb (Ulmariae herba; Herbapol Białystok S.A.).
Medicinal herbs: dandelion (Taraxacum officinale), greater celandine
(Chelidonium majus), common nettle (Urtica dioica), and
horse-chestnut (Aesculus hippocastanum) were collected from
the natural state, divided into organs: leaves, flowers, and roots
and analyzed when fresh. Herbs were identified by Dr. M. Bartnik,
a pharmacognosist.
Original Papers
Water, soil, and natural fertilizer
Water samples were collected from four lakes and one river in Lublin,
Opole Lubelskie and Poniatowa, Poland. Forest soil was collected
in Ludwin, Poland. Peat was collected in Piaseczno, Poland.
Fresh natural fertilizer – dung – was obtained from a farm in Jakubowice,
Poland.
Cultivation of garden cress
Garden cress (Lepidium sativum) seeds (Plantico) were seeded in
the artificial soil formed from cellulose pads on petri dishes
(50 mm diameter) or in the natural soil (Agroplanta – universal
natural soil for plants, PPHU “Atlas-Planta”) in flowerpots
(62 × 62 × 62 mm) – 100 seeds in each flowerpot or on each petri
dish.
Adding KYNA to the artificial soil
The artificial soil formed from cellulose pads was divided into 3
groups and placed on petri dishes. The first group was watered
with 4 mL of tap water, the second group with 4 mL of KYNA solution
(pH = 7.0) in the concentration of 1 mM, and the third
group with 4 mL of KYNA solution (pH = 7.0) in the concentration
of 10 mM on the first day. On the following days, the artificial soil
was watered with tap water only.
Adding KYNA to the natural soil
The natural soil was divided into 3 groups. The first group was
watered with 200 mL of tap water per 1 kg of soil (control group),
the second group with 200 mL of KYNA solution (pH = 7.0) in the
concentration of 1 mM per 1 kg of soil, and the third group with
200 mL of KYNA solution (pH = 7.0) in the concentration of
10 mM per 1 kg of soil on the first day. The natural soil was then
thoroughly mixed. On the following days, the natural soil was
watered with tap water only.
KYNA synthesis in plants
Dandelion (Taraxacum officinale) was collected and cleaned from
the remaining soil. Fresh plants were divided into roots, leaves,
and flowers. Samples were weighed and Tris solution was added
to all of them (1 : 4 w/v). Samples were then homogenized (Sonopuls
2070; Bandelin Electronic GMBH & Co. KG) and centrifuged
(4000 rpm, 5 min). Samples from each part of a plant – roots,
leaves, and flowers separately – were placed in culture wells in
the volume of 0.9 mL each and incubated in the presence of Lkynurenine
in the volume of 0.1 mL for 2 hours at room temperature.
The final volume of a solution was 1 mL. To stop the reaction,
the plates were placed on ice. 1 mL of supernatant was collected
for KYNA determination. Other samples of the homogenate
of dandelion leaves were placed in culture wells in the volume
of 0.9 mL and divided into 2 groups: the first group was incubated
in the presence of AOAA in the concentration of 50 µM
and in the volume of 0.1 mL, while the second group was incubated
in the presence of both L-kynurenine and AOAA in the concentration
of 50 µM and in the volume of 0.1 mL for 2 hours at
room temperature. The final volume of a solution was 1 mL. To
stop the reaction, the plates were placed on ice. 1 mL of supernatant
was collected for KYNA determination.
Preparation of samples for KYNA determination
Distilled water was added to herbal tablets (1 : 5 w/v) and they
were left for 30 minutes. Then they were homogenized and centrifuged
(4000 rpm, 5 min) and 1 mL of supernatant was collected
for further experiments. Herbal tea, herbs in sachets, and
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
859

860
Original Papers
single herbs in bags were prepared according to producersʼ
guidelines. All the extracts were made using methods common
in pharmacy: decoction, maceration, and infusion. Subsequently,
they were centrifuged (4000 rpm, 5 min), and 1 mL of supernatant
was collected for further experiments. Fresh medicinal herbs
were cleaned from the remaining soil and were divided into
parts. Samples were weighed, and distilled water was added to
them (1 : 5 w/v). They were then homogenized and centrifuged
(4000 rpm, 5 min), and 1 mL of supernatant was collected for further
experiments.
15 mL of water samples obtained from the lakes and the river
were centrifuged (4000 rpm, 5 min), and 10 mL of supernatant
was collected for further experiments.
Samples of soil and dung were weighed, and distilled water was
added to them (1 : 5 w/v). They were then homogenized and centrifuged
(4000 rpm, 5 min), and 1 mL of supernatant was collected
for further experiments.
Samples of garden cress (Lepidium sativum) growing in the natural
soil with or without added KYNA solution and in the artificial
soil with or without added KYNA solution were cut 5 mm
above the ground after 4 days. Plants were then counted,
weighed and thoroughly washed. Distilled water was added to
them (1 : 5 w/v). They were then homogenized and centrifuged
(4000 rpm, 5 min), and 1 mL of supernatant was collected for further
experiments.
Measurement of KYNA
KYNA was isolated and determined according to the methods described
previously [5, 22]. Samples were acidified with 50% trichloroacetic
acid. Denaturated proteins were removed by centrifugation
(4000 rpm, 5 min) and supernatant acidified with 0.1 N
HCl was applied to the columns containing cation exchange resin
Dowex 50 prewashed with 0.1 N HCl. Subsequently, the columns
were washed with 1 mL of 0.1 N HCl and 1 mL of water. The fraction
containing KYNA was eluted with 4 mL of water. The eluate
was subjected to HPLC, and KYNA was detected fluorometrically
(system I – Hewlett Packard 1050 HPLC system: ESA catecholamine
HR-80, 3 µm, C18 reverse-phase column, mobile phase:
250 mM zinc acetate, 25 mM sodium acetate, 5% acetonitrile,
pH 6.2, flow rate of 1.0 mL/min; fluorescence detector: excitation
244 nm, emission 398 nm). Mobile phase was filtered through a
0.2-µm membrane filter (Alltech Associates) and degassed by
ultrasonic equipment for 30 min. The injection volume was
100 µL. Separation was achieved at an ambient temperature. The
Chromeleon software was employed to control HPLC system I
and process chromatographic data.
At least 10% of randomly assigned samples were subjected to another
HPLC system (system II) which consisted of a Varian Pro
Star pump, ESA catecholamine HR-80, 3 µm, C18 reverse-phase
column, mobile phase: 250 mM zinc acetate, 25 mM sodium acetate,
5% acetonitrile, pH 6.2, flow rate of 1.0 mL/min; Dionex
RF2000 fluorescence detector set at excitation 350 nm and emission
404 nm. Mobile phase was filtered through a 0.2-µm membrane
filter (Alltech Associates) and degassed by ultrasonic
equipment for 30 min. The injection volume was 100 µL. Separation
was achieved at an ambient temperature. The Chromeleon
software was employed to control HPLC system II and process
chromatographic data.
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
Identification and purity determination
The Dionex HPLC system (DionexA) consisted of a gradient pump
P580 LPG, manual injector (7725i Rheodyne) with a 20 µL loop,
ODS-2 Hypersil, 5 µm, C18 column (Thermo-Fisher Scientific),
elution solvent (A) acetonitrile, elution solvent (B) 30 mM triethylammonium
phosphate; elution profile: 0–3min 100–90%
B; 4–15 min 90–20% B; 16–22 min 0% B; 23–25 min 0–100% B,
flow rate of 1 mL/min; UVD340S diode array UV detector set at
334 nm. Separation was achieved at an ambient temperature.
The Dionex Chromeleon software was employed to control HPLC
system and process chromatographic data. For identification purposes,
the eluate corresponding to the KYNA fraction obtained
from HPLC system I was used.
Validation of the method of KYNA determination
Linearity: KYNA standard was prepared by dissolving the authentic
substance (obtained from Sigma) in water for HPLC at
the following concentration levels: 0.0000945, 0.000189,
0.000378, 0.0004725, 0.000945, and 0.00189 µg/100 µL in HPLC
system I and 0.0000189, 0.0000378, 0.0000756, 0.0001134,
0.0001512, and 0.000189 µg/100 µL in HPLC system II. The sixpoint
linearity curve was prepared in three replicates. The calibration
curve was obtained by plotting the quotient of the peak
areas against KYNA content. The linearity of the calibration curve
was evaluated by the linear regression analysis. The following r 2
values were obtained: 0.9989 and 0.9939 in HPLC system I and
II, respectively. The precision expressed as a relative standard deviation
(RSD%) was 4.8 and 6.3 in HPLC system I and II, respectively.
Limit of detection: Limit of detection (LOD) was determined on
the basis of the calibration curve. LOD of KYNA was
0.0000201 µg/100 µL in HPLC system I and 0.0000149 µg/100 µL
in HPLC system II. LOQ was 0.0000603 µg/100 µL and
0.0000447 µg/100 µL in HPLC system I and II, respectively.
Recovery: The accuracy of the Dowex extraction method was
evaluated from the recovery studies. Standard KYNA solutions at
6 different concentrations: 0.00378, 0.00756, 0.01512, 0.0189,
0.0378, and 0.0756 µg/4 mL were subjected to the Dowex procedure
and determined by HPLC (as described above). The recovery
for the KYNA standard was 94.77% ± 1.62.
Selectivity: The selectivity of the method was determined by a
comparison of the chromatograms obtained from the different
parts of plants with chromatograms obtained from standards, using
two different mobile phases in HPLC system I: standard mobile
phase as described above and second mobile phase consisting
of: 250 mM zinc acetate, 25 mM sodium acetate, 2.25% acetonitrile,
isopropyl alcohol 2%, pH 6.2, flow rate of 1.0 mL/min.
Moreover, randomly assigned samples (at least 10%) were subjected
to HPLC system II and determined fluorimetrically at an
excitation wavelength of 350 nm instead of 244 nm in HPLC system
I and at an emission wavelength of 398 nm in both systems.
Matrix effect and internal standard: KYNA standard prepared by
dissolving the authentic substance (obtained from Sigma) in
water for HPLC was added to the samples of dandelion leaves before
homogenization at 6 concentration levels: 0.00378, 0.00756,
0.01512, 0.01890, 0.03780, 0.07560 µg/4 mL (n = 5). Then, samples
were processed in HPLC system I as described above. The calibration
curve was obtained by plotting the quotient of the peak
areas (after subtraction of an endogenous KYNA content) against
added KYNA content. The linearity of the calibration curve was
evaluated by the linear regression analysis. Calculated r 2 value
was 0.9971. LOD and LOQ determined on the basis of the calibra-

tion curve were 0.0001124 µg/100 µL and 0.0003372 µg/100 µL,
respectively.
The calculated recovery for the KYNA standard in samples of dandelion
leaves was 70.24% ± 1.22. In order to compensate the matrix
effect in all further experiments, a known amount of the
standard solution of an authentic KYNA was added to samples
before homogenization as an internal standard. Then, samples
were processed as described above. At least 3 original samples
with added KYNA solution as an internal standard were analyzed
for each plant material. The mean value was calculated and used
to determine the content of KYNA.
Statistical analysis
Data were presented as a mean value and a standard error of the
mean (SEM). The statistical analysis was accomplished using oneway
ANOVA followed by the post hoc Tukey test. A p value of less
than 0.05 was considered significant.
Results
!
The substance extracted from herbal tablets, herbal tea, herbs in
sachets, single herbs in bags, fresh medicinal herbs, soil, dung,
and garden cress was compared to the authentic KYNA in two
chromatographic systems. A solution of the authentic KYNA was
added to the samples of herbs which were then processed as described
in the Materials and Methods section. Retention times
and shapes of obtained peaks were compared. In all cases, both
shapes and retention times to peaks of isolated and authentic KY-
NA were identical. Moreover, the substance extracted from dandelion
leaves and eluted at the retention time of authentic KYNA
in HPLC system I was identified by comparing retention times
and diode-array spectra (wavelength range 200–595 nm) with
those of the authentic reference substance. Variation between retention
times which was less than 1% and spectra analysis which
showed accuracy exceeding 99% confirmed the identity and purity
of the peak extracted from dandelion leaves.
Distribution of KYNA in plants was measured in dandelion, common
nettle, greater celandine, and horse-chestnut. KYNA was
found in leaves, flowers, and roots of all three medicinal herbs,
as well as in leaves and flowers of horse-chestnut. A high concentration
of KYNA was found in leaves: horse-chestnut leaves –
0.636 µg/g, dandelion leaves – 0.489 µg/g, nettle leaves – 0.445
µg/g, and greater celandine leaves – 0.283 µg/g. A lower amount
of KYNA was found in flowers: horse-chestnut flowers – 0.043
µg/g, dandelion flowers – 0.041 µg/g, greater celandine flowers –
0.069 µg/g, and common nettle flowers – 0.243 µg/g. The content
of KYNA in roots was as follows: common nettle roots – 0.063 µg/
g, greater celandine roots – 0.022 µg/g, and dandelion roots –
0.011 µg/g (l " Table 1).
KYNA synthesis in plants was investigated in the homogenates of
dandelion leaves, flowers, and roots. KYNA was synthesized in all
investigated parts of dandelion. The most efficient synthesis of
KYNA occurred in the presence of L-kynurenine (compared to
the control group without added L-kynurenine) in the homogenate
of dandelion leaves (1.208 ± 0.020 µg/g/1 h). A less effective
synthesis was observed in the homogenate of dandelion flowers
(0.343 ± 0.003 µg/g/1 h), and the least effective synthesis was
measured in the homogenate of dandelion roots (0.141 ±
0.001 µg/g/1 h) (l " Fig. 1).
Influence of AOAA on KYNA synthesis in plants was measured in
the homogenate of dandelion leaves. AOAA in the concentration
Table 1 Content of kynurenic acid in the different parts of fresh collected
plant material.
Medicinal
plant
KYNA content [µg/g wet weight]
Original Papers
Leaves Flowers Roots
Greater celandine 0.283 ± 0.018 0.069 ± 0.008 0.022 ± 0.001
Common nettle 0.445 ± 0.025 0.243 ± 0.024 0.063 ± 0.007
Dandelion 0.489 ± 0.040 0.041 ± 0.004 0.011 ± 0.001
Horse-chestnut 0.636 ± 0.051 0.043 ± 0.005 not determined
Data are presented as a mean value of 6 determinations and a standard error of the
mean (SEM). KYNA – kynurenic acid
Fig. 1 Kynurenic acid production in the different parts of dandelion. Data
are presented as mean ± SEM, n = 6; one-way ANOVA followed by the post
hoc Tukey test, p < 0.05 versus appropriate group.
Fig. 2 Influence of aminooxyacetic acid (AOAA) upon kynurenic acid production
in the homogenate of dandelion leaves. Data are presented as
mean ± SEM, n = 6; one-way ANOVA followed by the post hoc Tukey test,
p < 0.05 versus L-kynurenine.
of 50 µM lowered KYNA synthesis from its precursor – L-kynurenine
by about 60% (l " Fig. 2).
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
861

862
Original Papers
Table 2 Content of kynurenic acid in surface water, forest soil, peat, and natural
fertilizer.
Environmental source KYNA content
Surface water 0.000024 ± 0.000002 µg/mL
Forest soil 0.002365 ± 0.000213 µg/g
Peat 0.005670 ± 0.000395 µg/g
Natural fertilizer (dung) 0.466070 ± 0.046223 µg/g
Data are presented as a mean value of 3 determinations and a standard error of the
mean (SEM); KYNA: kynurenic acid
Table 3 Content of kynurenic acid in a maximum daily dose of herbal tablets.
Medicinal Content
Maximum KYNA content
plant
of medicinal daily dose in a maximum
plant extract [tablets/day] daily dose
[g/tablet]*
[µg/day]
Camomile 0.15 6 0.41
Flax 0.25 6 0.53
Midland
hawthorn
0.10 6 1.19
Lupulin 0.25 8 4.42
Heartsease 0.15 6 5.95
Broccoli 0.50 2 9.51
Common
nettle
0.15 6 12.15
Small-leavedlime
0.15 6 13.55
Lemon balm 0.15 6 15.98
St. Johnʼs wort 0.15 6 30.38
Data are presented as means. Samples were determined in duplicates. * Content of
medicinal plant extract was specified by the supplier
KYNA content was measured in water, forest soil, peat, and dung.
KYNA was found in water obtained from the lakes and a river in a
mean concentration of 0.000 024 µg/mL. KYNA was also found in
the samples of forest soil (0.0024 µg/g), peat (0.0057 µg/g), and
natural fertilizer (dung; 0.47 µg/g) (l " Table 2).
Absorption of KYNA by plants was investigated on the basis of the
cultivation of garden cress. It was found that garden cress growing
in the natural soil with added KYNA solution in the concentration
of 10 mM contained 0.203 µg KYNA/g, which is about 6.5
times more than garden cress growing in the natural soil without
added KYNA solution (which contained 0.031 µg KYNA/g). The
addition of KYNA solution in the concentration of 1 mM into the
natural soil had no influence on the presence of KYNA in garden
cress (0.031 µg/g) (l " Fig. 3).
It was found that garden cress growing in the artificial soil with
added KYNA solution in concentrations of 1 mM or 10 mM contained
2.750 or 20.639 µg KYNA/g, respectively, which is 254
and 1910 times more than garden cress growing in the artificial
soil without added KYNA solution (0.011 µg KYNA/g) (l " Fig. 4).
KYNA was found in all ten tested herbal tablets available on the
market (the amount of KYNA is expressed in µg KYNA in a maximum
recommended daily dose): in camomile – 0.41, flax – 0.53,
midland hawthorn – 1.19, lupulin – 4.42, heartsease – 5.95, broccoli
– 9.51, common nettle – 12.15, small-leaved-lime – 13.55,
lemon balm – 15.98, and St. Johnʼswort– 30.38 (l " Table 3).
The amount of KYNA in herbal tea, herbs in sachets, and single
herbs in bags was expressed in µg KYNA per a maximum daily
dose of the medicinal plant extract recommended by producers.
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
Fig. 3 Kynurenic acid absorption by roots of garden cress from the natural
soil enriched with kynurenic acid. Data are presented as mean ± SEM, n = 6;
one-way ANOVA followed by the post hoc Tukey test, p < 0.05 versus appropriate
group.
Fig. 4 Kynurenic acid absorption by roots of garden cress from the artificial
soil containing kynurenic acid. Data are presented as mean ± SEM,
n = 6; one-way ANOVA followed by the post hoc Tukey test, p < 0.05 versus
appropriate group.
KYNA was found in a herbal tea (common nettle root – 1.08 µg),
in two types of herbs in sachets (lime flower – 4.24 µg and common
nettle leaf – 32.50 µg), as well as in the following single
herbs in bags: mullein flower – 2.44 µg, common mallow flower
– 5.98 µg, matricaria flower – 10.17 µg, strawflower – 10.74 µg,
meadowsweet herb – 13.27 µg, peppermint leaf – 19.50 µg, elderberry
flower – 20.74 µg, and St. Johnʼswort– 32.60 µg (l " Table 4).
Discussion
!
To the best of our knowledge, this is the first scientific approach
towards the detailed analysis of KYNA content in medicinal
herbs. Previously, KYNA was mentioned as a constituent of the
plants Gingko biloba [23] and Ephedra transitoria [24]. However,
it was neither unequivocally identified nor had its content been
measured. In our recent research, it was proved that KYNA is
present in food and honeybee products [21], being found in all

Table 4 Content of kynurenic acid in a maximum daily dose of herbal medicines.
Herbal
Method of preparation/ KYNA content
medicine
temperature/time* in a maximum
daily dose* [µg/day]
Nettle root Infusion/90 °C/15 min 1.08
Mullein flower Infusion/90 °C/15 min 2.44
Lime flower Infusion/90 °C/15 min 4.24
Common mallow
flower
Infusion/90 °C/10 min 5.98
Matricaria flower Infusion/90 °C/10 min 10.17
Strawflower Decoction/100 °C/5 min 10.74
Meadowsweet herb Infusion/90 °C/5 min 13.27
Peppermint leaf Infusion/90 °C/10 min 19.50
Elderberry flower Decoction/100 °C/3 min 20.74
Nettle leaf Infusion/90 °C/5 min 32.50
St. Johnʼs wort Infusion/90 °C/60 min 32.60
Data are presented as means. Samples were determined in duplicates.
* Method of preparation and a maximum daily dose were specified by the supplier
37 tested samples. The highest concentration of KYNA was obtained
from the samples of honeybee products, propolis
(1.63 µg/g), multiflorous honey (0.87 µg/g), and bee pollen (0.64
µg/g). A high concentration of KYNA was also found in fresh broccoli
(0.42 µg/g) and potatoes (0.51 µg/g) [21]. An extremely high
level of KYNA in honey (23–2,114 µg/g) was recently reported by
Beretta et al., 2009 [25]. Since propolis, honey, and bee pollen are
commonly used in folk medicine and apitherapy, and they contain
a lot of KYNA as previous studies have indicated [21, 25], it
was decided to investigate the content and distribution of KYNA
in herbal medicines.
Experiments were carried out on four medicinal plants – dandelion,
common nettle, greater celandine, and horse-chestnut. It
was found that KYNA is present in all examined parts of these
plants; nevertheless, its concentration expressed in µg/g wet
weight varies significantly between parts. A high concentration
of KYNA was found in leaves of all chosen plants. A lower concentration
of KYNA was found in flowers, and the lowest concentration
of KYNA was found in roots.
Since achieved results proved our hypothesis that KYNA is
present in medicinal herbs to be correct, it was decided to check
whether KYNA might be synthesized in plants and/or absorbed
by plants. KYNA is formed along the tryptophan–kynurenine
pathway. Conversion from tryptophan to kynurenine is achieved
by tryptophan-2,3-dioxygenase and indole-2,3-dioxygenase, and
KYNA is produced irreversibly from kynurenine by kynurenine
aminotransferases [26]. In order to investigate whether KYNA
might be produced in plants, its precursor – L-kynurenine – was
added to the homogenates of dandelion leaves, flowers, and
roots, and after 2 hours of incubation at room temperature, KYNA
content in all parts mentioned above was measured. It was found
that KYNA is formed in such conditions, and that the rate of KY-
NA synthesis is highest in leaves, followed by flowers and roots.
Comparison between the amount of KYNA and the rate of KYNA
synthesis in dandelion parts suggests that there is a positive correlation
between both values.
Due to the fact that KYNA is formed from kynurenine by the activity
of kynurenine aminotransferases which are blocked by
AOAA, it was decided to check whether KYNA is synthesized
along this pathway in plants. In order to do this, AOAA and kyn-
Original Papers
urenine were added to the homogenate of dandelion leaves. AOAA
significantly reduced KYNA production in such conditions, which
firmly proves that KYNA is enzymatically synthesized in plants.
Further experiments were aimed at checking whether KYNA
might be absorbed by plants from the soil. Firstly, KYNA presence
in the soil was investigated. It was proved that the highest concentration
of KYNA is found in peat, and a considerably lower
concentration in forest soil. Those results suggest that KYNA is
present in soils of an organic origin. An additional argument for
such a thesis is the huge amount of KYNA found in the natural fertilizer
– dung. Moreover, a low concentration of KYNA was found
in surface water. Those results interchangeably suggest that KY-
NA is present in the soil, and that such soil might be a source of
KYNA for plants if they are able to absorb it from the ground. Further
experiments carried out on garden cress supported the assumptions
that KYNA might be absorbed by plants either from a
liquid basis or from the natural soil. Thus, our experiments demonstrate
that KYNA found in plants might be synthesized in a
plant and/or absorbed by a plant. To the best of our knowledge,
this is the first report on the fate of KYNA in plants. The physiological
role of KYNA in plants remains to be elucidated.
Medicinal herbs are marketed in different forms. Single herbs in
bags and herbal sachets are the most popular among the global
society. However, herbal tablets are growing in popularity because
they do not require prior time-consuming self preparation,
they are handy, easy to take, and virtually tasteless. A high concentration
of KYNA in honeybee products [21] and the presence
of KYNA in all tested medicinal herbs prompted us to investigate
the content of KYNA in herbal preparations and herbal tablets
which are available in almost all pharmacies and herbal shops.
Herbal teas and single herbs in bags were prepared in accordance
with the producersʼ guidelines, and KYNA content was measured
in µg KYNA/maximum recommended daily dose. Although KYNA
was found in all tested herbal preparations and herbal tablets, its
concentration varied distinctly between different products; the
highest concentration was measured in St. Johnʼs wort and nettle
leaf. When considering only herbal tablets, the highest concentration
of KYNA was found in St. Johnʼs wort, lemon balm, smallleaved-lime,
and common nettle. The majority of herbal preparations
and herbal tablets containing significant amounts of KYNA,
such as peppermint leaf, lemon balm, small-leaved-lime, common
nettle, and St. Johnʼs wort are used to reduce the symptoms
and cure the diseases of the digestive system. They stimulate secretion
of gastric juices and bile and reduce smooth musclesʼ
spasm. The most recent scientific reports suggest that KYNA is
found in high concentrations in the intestine, bile, and pancreatic
juice [27]. It was proved that this compound protects against
stomach mucous membrane ulceration [17]. Moreover, it was also
demonstrated that KYNA counteracts pathological reactions
caused by ileus in dogs [19] and colitis in rats [20] and suggested
that it plays an important role in regulating the functions of the
digestive system [19,27]. Bearing in mind all those scientific reports,
our results showing a high KYNA concentration in herbal
preparations and herbal tablets used mainly in the diseases of
the digestive system suggest that this compound might be partly
responsible for their healing properties.
The obtained results and recently published scientific reports enable
us to make a hypothesis of an existing KYNA circulation in
the biosphere. KYNA might be synthesized along the enzymatic
pathway in plants and animals, absorbed from food of both vegetable
and animal origin and transported to the soil in animal excrements
and plant debris. Plants might absorb it from the soil.
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
863

864
Original Papers
Much less is known about KYNA metabolism. In mammals, KYNA
seems to be an end-product formed along the kynurenine pathway
[28]. However, microbiotics such as Pseudomonas were
found to metabolize this compound to glutamic acid, alanine,
and acetic acid [29]. Thus, the catabolism of KYNA protects
against its accumulation in the biosphere.
Summing up, pharmacological properties of KYNA and its presence
in high concentrations in medicinal herbs may suggest that
it possesses therapeutic potential and should be considered a
new valuable dietary supplement.
Acknowledgements
!
M. P. Turski and M. Turska are students, and volunteers in the Department
of Toxicology. This study was supported in part by the
Foundation for Polish Science.
References
1 Liebig J. Über Kynurensäure. Justus Liebigs Ann Chem 1853; 86: 125–
126
2 Ganong AH, Cotman CW. Kynurenic acid and quinolinic acid act at Nmethyl-D-aspartate
receptors in the rat hippocampus. J Pharmacol
Exp Ther 1986; 236: 293–299
3 Hilmas C, Pereira EF, Alkondon M, Rassoulpour A, Schwarcz R, Albuquerque
EX. The brain metabolite kynurenic acid inhibits alpha7 nicotinic
receptor activity and increases non-alpha7 nicotinic receptor expression:
physiopathological implications. J Neurosci 2001; 21: 7463–7473
4 Perkins MN, Stone TW. An iontophoretic investigation of the actions of
convulsant kynurenines and their interaction with the endogenous excitant
quinolinic acid. Brain Res 1982; 247: 184–187
5 Turski WA, Nakamura M, Todd WP, Carpenter BK, Whetsell Jr WO,
Schwarcz R. Identification and quantification of kynurenic acid in human
brain tissue. Brain Res 1988; 454: 164–169
6 Schwarcz R, Pellicciari R. Manipulation of brain kynurenines: glial targets,
neuronal effects, and clinical opportunities. J Pharmacol Exp Ther
2002; 303: 1–10
7 Wang J, Simonavicius N, Wu X, Swaminath G, Reagan J, Tian H, Ling L.
Kynurenic acid as a ligand for orphan G protein-coupled receptor
GPR35. J Biol Chem 2006; 281: 22 021–22 028
8 Scharfman HE, Goodman JH, Schwarcz R. Electrophysiological effects of
exogenous and endogenous kynurenic acid in the rat brain: studies in
vivo and in vitro. Amino Acids 2000; 19: 283–297
9 Wonodi I, Schwarcz R. Cortical kynurenine pathway metabolism: a novel
target for cognitive enhancement in schizophrenia. Schizophr Bull
2010; 36: 211–218
10 Vamos E, Pardutz A, Klivenyi P, Toldi J, Vecsei L. The role of kynurenines
in disorders of the central nervous system: possibilities for neuroprotection.
J Neurol Sci 2009; 283: 21–27
11 Erhardt S, Olsson SK, Engberg G. Pharmacological manipulation of kynurenic
acid: potential in the treatment of psychiatric disorders. CNS
Drugs 2009; 23: 91–101
Turski MP et al. Distribution, Synthesis, and … Planta Med 2011; 77: 858–864
12 Kazda H, Taylor N, Healy D, Walker D. Maternal, umbilical, and amniotic
fluid concentrations of tryptophan and kynurenine after labor or cesarean
section. Pediatr Res 1998; 44: 368–373
13 Milart P, Sikorski R. Kynurenic acid concentration in blood and urine
during normal pregnancy. Ginekol Pol 1998; 69: 968–973
14 Milart P, Urbanska EM, Turski WA, Paszkowski T, Sikorski R. Intrapartum
levels of endogenous glutamate antagonist – kynurenic acid in amniotic
fluid, umbilical and maternal blood. Neurosci Res Commun 1999;
24: 173–178
15 Parada-Turska J, Rzeski W, Zgrajka W, Majdan M, Kandefer-Szerszen M,
Turski W. Kynurenic acid, an endogenous constituent of rheumatoid arthritis
synovial fluid, inhibits proliferation of synoviocytes in vitro.
Rheumatol Int 2006; 26: 422–426
16 Kuc D, Zgrajka W, Parada-Turska J, Urbanik-Sypniewska T, Turski WA.
Micromolar concentration of kynurenic acid in rat small intestine.
Amino Acids 2008; 35: 503–505
17 Glavin GB, Pinsky C. Kynurenic acid attenuates experimental ulcer formation
and basal gastric acid secretion in rats. Res Commun Chem
Pathol Pharmacol 1989; 64: 111–119
18 Glavin GB, Pinsky C, Bose R. Gastrointestinal effects of contaminated
mussels and putative antidotes thereof. Can Dis Wkly Rep 1990; 16
(Suppl. 1E): 111–115
19 Kaszaki J, Palasthy Z, Erczes D, Racz A, Torday C, Varga G, Vecsei L, Boros
M. Kynurenic acid inhibits intestinal hypermotility and xanthine oxidase
activity during experimental colon obstruction in dogs. Neurogastroenterol
Motil 2008; 21: 53–62
20 Varga G, Erces D, Fazekas B, Fulop M, Kovacs T, Kaszaki J, Fulop F, Vecsei L,
Boros M. N-Methyl-D-aspartate receptor antagonism decreases motility
and inflammatory activation in the early phase of acute experimental
colitis in the rat. Neurogastroenterol Motil 2010; 22: 217–225
21 Turski MP, Turska M, Zgrajka W, Kuc D, Turski WA. Presence of kynurenic
acid in food and honeybee products. Amino Acids 2009; 36:
75–80
22 Shibata K. Fluorimetric micro-determination of kynurenic acid, an endogenous
blocker of neurotoxicity, by high-performance liquid chromatography.
J Chromatogr 1988; 430: 376–380
23 Drieu K. Preparation and definition of Ginkgo biloba extract. Presse
Med 1986; 15: 1455–1457
24 al-Khalil S, Alkofahi A, al-Eisawi D, al-Shibib A. Transtorine, a new quinoline
alkaloid from Ephedra transitoria. J Nat Prod 1998; 61: 262–263
25 Beretta G, Artali R, Caneva E, Orlandini S, Centini M, Facino RM. Quinoline
alkaloids in honey: further analytical (HPLC‑DAD‑ESI‑MS, multidimensional
diffusion-ordered NMR spectroscopy), theoretical and
chemometric studies. J Pharm Biomed Anal 2009; 50: 432–439
26 Nemeth H, Toldi J, Vecsei L. Role of kynurenines in the central and peripheral
nervous systems. Curr Neurovasc Res 2005; 2: 249–260
27 Paluszkiewicz P, Zgrajka W, Saran T, Schabowski J, Valverde Piedra JL,
Fedkiv O, Rengman S, Pierzynowski SG, Turski WA. High concentration
of kynurenic acid in bile and pancreatic juice. Amino Acids 2009; 37:
637–641
28 Turski WA, Schwarcz R. On the disposition of intrahippocampally injected
kynurenic acid in the rat. Exp Brain Res 1988; 71: 563–567
29 Horibata K, Taniuchi H, Tashiro M, Kuno S, Hayaishi O. The metabolism
of kynurenic acid. II. Tracer experiments on the mechanism of kynurenic
acid degradation and glutamic acid synthesis by Pseudomonas
extracts. J Biol Chem 1961; 236: 2991–2995

Association between Chemical and Genetic
Variation of Wild and Cultivated Populations
of Scrophularia ningpoensis Hemsl.
Authors Shuting Yang 1,2 *, Chuan Chen 1 *, Yunpeng Zhao 1 ,WangXi 1 , Xiaolong Zhou 3 , Binlong Chen 3 , Chengxin Fu 2
Affiliations
Key words
l " Scrophularia ningpoensis
l " Scrophulariaceae
l " Radix Scrophulariae
l " chemical diversity
l " genetic diversity
l " ISSR fingerprinting
l " HPLC fingerprinting
received April 30, 2010
revised October 4, 2010
accepted Nov. 11, 2010
Bibliography
DOI http://dx.doi.org/
10.1055/s-0030-1250601
Published online December 14,
2010
Planta Med 2011; 77: 865–871
© Georg Thieme Verlag KG
Stuttgart · New York ·
ISSN 0032‑0943
Correspondence
Dr. Yunpeng Zhao
Department of Biology
College of Life Sciences,
Zhejiang University
388 Yukangtang Road
Hangzhou 310058
P. R. China
Phone: + 86 57188 20 6463
Fax: + 8657186 4322 73
ypzhao@zju.edu.cn
Correspondence
Prof. Chengxin Fu
Laboratory of Systematic
and Evolutionary Botany
Institute of Plant Sciences,
Zhejiang University
388 Yukangtang Road
Hangzhou 310058
P. R. China
Phone: + 86 57188 20 6607
Fax: + 8657186 4322 73
cxfu@zju.edu.cn
1 The Key Laboratory of Conservation Biology for Endangered Wildlife of the Ministry of Education,
College of Life Sciences, Zhejiang University, Hangzhou, P.R. China
2 Laboratory of Systematic & Evolutionary Botany and Biodiversity, Institute of Plant Sciences
and Conservation Center for Gene Resources of Endangered Wildlife, Zhejiang University, Hangzhou, P. R. China
3 Panʼan Institute of Chinese Materia Medica, Panʼan, P.R. China
Abstract
!
Scrophularia ningpoensis Hemsl. is an important
Chinese medicinal herb with a domestication history
of more than one thousand years. Although a
number of studies have focused on either chemical
or genetic variation, none have dealt with
their association to discuss the formation of
chemical diversity. We applied HPLC fingerprinting
with identification of four predominant bioactive
compounds using LC‑ESI‑MS to assess chemical
variation among 6 cultivated and 5 wild populations
of S. ningpoensis. Significant chemical differences
were revealed between wild and cultivated
populations in terms of chromatographic
profiles, principal component analysis (PCA)
plots, and bioactive compounds contents. Compared
to cultivated populations, the chemical profiles
varied considerably among wild populations,
of which some were remarkably similar to cultivated
populations. Inter simple sequence repeats
(ISSR) fingerprinting indicated a genetic differentiation
pattern parallel to chemical variation. Evidence
strongly supported the association be-
Introduction
!
Phytochemical diversity, on which the pharmaceutical
quality of medicinal plants relies, results
from plasticity of plant secondary metabolism
which has evolved to respond to stresses and interactions
with continuously changing environments
[1]. Genetic diversity underlies the plasticity
of secondary metabolism [2]. However, domestication
has led to an overall reduction of genetic
diversity of crop plants, including medicinal
plants, despite increased productivity [3]. The
narrowing genetic variability may weaken crop
* These two authors contributed to this work equally.
tween chemical and genetic variation of S. ningpoensis.
Based on both sets of data, suggestions
are proposed for the conservation of genetic diversity,
crop improvement, and good agricultural
practice. The present results will also facilitate
our theoretical understanding of the selective
and adaptive evolutionary processes of medicinal
plant species impacted by domestication and a
changing environment.
Abbreviations
!
Original Papers
FST: genetic differentiation estimated by
ANOVA
ΦST: inter-population genetic differentiation
estimated by AMOVA
ΦCT: among-group genetic differentiation
estimated by AMOVA
Supporting information available online at
http://www.thieme-connect.de/ejournals/toc/
plantamedica
plasticity with respect to compositional quality
as well as responses to biotic and abiotic stresses
[1, 4]. Therefore, wild ancestors and landraces,
which are likely to bear higher genetic diversity,
attract an increasing interest for their potential
role in improving chemical composition and other
traits in crop plants [4].
Radix Scrophulariae, the root of Scrophularia
ningpoensis Hemsl. (Scrophulariaceae), is a famous
Chinese traditional medicinal herb with a
domestication history of over 1000 years. Iridoids,
like harpagoside, phenylpropanoid glycosides,
like angroside C and acteoside, and cinnamic acid
were revealed to be its main bioactive components
with anti-inflammatory, antimicrobial, and
antitumor activities [5–9]. Several methods based
Yang S et al. Association between Chemical… Planta Med 2011; 77: 865–871
865

866
Original Papers
Table 1 Sample information of 16 populations of S. ningpoensis surveyed for ISSR variation and HPLC fingerprinting.
Population
Locality Sample
Sample
Vouchers
Code
Cultivated populations
size for ISSR size for HPLC
DP Dapan, Panan County, Zhejiang Province 15 3 C. Chen, 060601-060603
YC Yaochuan, Panan County, Zhejiang Province 15 3 C. Chen, 060604-060606
RC Renchuan, Panan County, Zhejiang Province 15 3 C. Chen, 060607-060609
HB Enshi City, Hubei Province 10 3 C. Chen, 060614-060616
SX Zhenping County, Shaanxi Province 10 3 C. Chen, 060617-060619
CQ
Wild populations
Jinfo, Chongqing Municipality 19 3 C. Chen, 060620-060622
TM Tianmu Mountain, Zhejiang Province 10 3 C. Chen, 060623-060625
TW Dapan Mountain, Zhejiang Province
(introduced to SH)
10 3 C. Chen, 060626-060628
AH Tiantangzhai, Anhui Province – 4 P. Li, 091120-091122
HN Pingjiang County, Hunan Province – 3 P. Li, 091131-091133
JX Jiujiang County, Jiangxi Province – 3 P. Li, 091134-091136
on HPLC or combined with LC‑ESI‑MS were developed to qualify
and quantify all or part of the foregoing four bioactive compounds
for the purposes of quality assessment on Radix Scrophulariae
[10–14]. HPLC fingerprinting with no or few identified
chromatographic peaks combined with multivariate analysis
was also applied for quality evaluation [15, 16]. The chemical differences
of Radix Scrophulariae among various production regions
were demonstrated to different extents. Compared to
chemical assessment, there are relatively fewer studies on the genetic
variation of S. ningpoensis. Zhao et al. developed ISSR fingerprinting
for this species [17] and analyzed the genetic relationships
among one wild and five cultivated populations [18]. Chen
et al. analyzed the genetic differentiation among three cultivars
using sequence-related amplified polymorphism (SRAP) [19].
Although studies have focused on either chemical or genetic
analyses, no previous work has combined both sets of data to deal
with the association between the chemical and genetic variation
of S. ningpoensis. Therefore, in the present paper we aim (i) to estimate
the chemical variation pattern of wild and cultivated Radix
Scrophulariae from different regions in China using HPLC‑DAD
fingerprinting and LC‑ESI‑MS, (ii) to determine genetic diversity
and differentiation of these S. ningpoensis populations using ISSR
Yang S et al. Association between Chemical … Planta Med 2011; 77: 865–871
Fig. 1 Distribution of studied populations of
S. ningpoensis.
markers, and (iii) to probe the possible relationship between
chemical and genetic variation of S. ningpoensis. The results will
facilitate an exploration of the genetic basis of chemical variation
and the development of strategies for utilization and conservation
of S. ningpoensis, as well as understanding evolution of plant
secondary metabolism.
Materials and Methods
!
Sampling
Young leaves of S. ningpoensis were collected from May to June of
2006 and dried in silica gel (l " Table 1; l " Fig. 1). Only two wild
populations (TM and TW) were subjected to ISSR analyses due
to the material availability. All the materials were authenticated
by Professor Chengxin Fu, and voucher specimens were deposited
at the Herbarium of Zhejiang University (HZU). Samples of
Radix Scrophulariae were collected in December of 2006 from
the same populations from which leaf materials were sampled
(l " Table 1). The remaining wild materials were collected in November
of 2009. All the sampled roots were gently washed and
dried at 50°C followed by pulverization and 40-mesh sieving.

HPLC fingerprinting
An accurately weighed root powder (1.0 g) was ultrasonically extracted
with 50 mL 70% methanol for 30 min, and the extract was
diluted to a volume of 50 mL following paper-filtration. The solutions
were filtered through a 0.45 µm membrane prior to HPLC
analysis. Chromatograms were generated on an Agilent 1100 series
HPLC system equipped with a 5 µm HC‑C18 column
(250 mm × 4.6 mm) using a gradient of acetonitrile (A) and 1%
aqueous acetic acid (B). The gradient program was performed as
follows: 0–5min, 15% A; 5–30 min, 15–50% A; 30–50 min, 50–
65% A; 50–60 min, 65% A, with a flow rate of 0.8 mL ·min −1 , column
temperature 35°C, and a detection wavelength of 280 nm.
One analyte was randomly selected for 5 consecutive analyses to
validate precision. Stability examination was accomplished with
the same analyte in 48 h (n = 5). Peak area variation was estimated
in terms of relative standard deviation (RSD).
Identification of four main compounds
in chromatograms
The four main bioactive compounds of Radix Scrophulariae, including
harpagoside, angroside C, acetoeside, and cinnamic acid,
were identified in terms of retention time and mass spectrum by
comparison with reference compounds. The ESI MS n spectra were
acquired in both positive and negative ion modes in Thermo Finnigan
LCQ DECA XP system equipped with an electrospray ionization
source (Thermo LC/MS Division). The mass spectrometry detector
(MSD) parameters were as follows: nebulizer sheath gas,
N 2 (80 uit); nebulizer auxiliary gas, N2 (20 uit); capillary temperature,
350 °C; spray voltage, 4500 V in negative ion ESI mode,
5000 V in positive ion ESI mode; capillary voltage, − 13 V in (−)
ESI, 25 V in (+) ESI; lens voltage, 18 V in (−) ESI, − 16 V in (+) ESI;
isolation width for the MS n experiments, 1.0 m/z; collision gas,
He; and collision energy, 35%.
HPLC fingerprinting data analyses
Characteristic peaks extracted from chromatogram data in Agilent
Chemstation software were used as variables for principal
component analysis (PCA). Difference significance of bioactive
compound contents was tested using one-way ANOVA or independent
t-test. The program SPSS 13.0 was employed for both
analyses.
DNA extraction and ISSR amplification
Total genomic DNA was extracted using the modified CTAB
method [20]. ISSR‑PCR amplifications were performed in a PTC-
200 thermal cycler (MJ Research) programmed for an initial 5min
denaturation at 94°C, followed by 45 cycles of 1 min denaturation
at 94°C, 45 s annealing at 49.4–65°C (depending on different
primers), and 1.5 min elongation at 72°C, as well as a final
elongation step of 10 min at 72°C. Twelve primers (UBC primer
set no. 9, Biotechnology Laboratory, University of British Columbia)
were screened for fingerprinting all 100 individuals. The following
primers were used (annealing temperature in parentheses):
UBC809 (60.5 °C), UBC810 (53 °C), UBC811 (52.7 °C),
UBC812 (50.8 °C), UBC827 (60.5 °C), UBC834 (49.4 °C), UBC855
(62 °C), UBC859 (57 °C), UBC874 (65 °C), UBC881 (60.5 °C),
UBC887 (50.8 °C), and UBC889 (50.8 °C).
ISSR data analyses
The following parameters of genetic diversity were calculated using
POPGENE version 1.31 [21]: (i) the percentage of polymorphic
fragments (PPF); (ii) Neiʼs expected heterozygosity (HPOP); and
Original Papers
(iii) Neiʼs coefficient of population differentiation (GST). Considering
a possible bias of HPOP resulting from the assumption of the
Hardy-Weinberg equilibrium, Bayesian gene diversity (HB) was
also computed using HICKORY version 1.0 [22]. A dendrogram of
the unweighted pair-group method with arithmetic means
(UPGMA) was generated by TFPGA version 1.3 [23], and bootstrap
values were computed by resampling with replacement over loci
(1000 replicates). Hierarchical structuring of genetic variation
and pairwise Φ ST distances among populations were also determined
by an analysis of molecular variance (AMOVA) with
WINAMOVA version 1.55 [24]. Significance levels of the variance
components were based on 1000 permutations. Furthermore, an
estimator of F ST under a free model of population sampling, θB,
and GST‑B, a Bayesian analogue of Neiʼs GST, was produced using
HICKORY version 1.0. Principal coordinates analysis (PCoA) was
executed using MVSP version 1.3 [25].
Supporting information
Information on the peak areas of all analyzed samples, the chromatogram
of wild and cultivated Radix Scrophulariae, the PCA
analysis of Radix Scrophulariae and the PCoA analysis of ISSR
phenotypes are available as Supporting Information.
Results
!
HPLC validation presented satisfactory precision, reproducibility,
stability, and recovery with RSD of peak areas less than 5%. In total,
29 characteristic peaks were extracted as fingerprint markers
from all 34 analyzed samples of Radix Scrophulariae (refer to
Fig. 1S for representative chromatograms in Supporting Information).
Harpagoside, angroside C, acteoside, and cinnamic acid
were characterized as the four predominant common peaks.
Eight peaks including the four compounds mentioned above
were shared by all samples (monomorphic) with varying intensities,
while the other 21 compounds were polymorphic
(72.41%). Most wild samples exhibited two- to three-fold greater
intensities of chromatographic peaks than cultivated samples
(see Table 1S in Supporting Information). Compared to wild Radix
Scrophulariae, slighter differences of peak amount and peak
area existed to different extents among cultivated ones.
In the PCA scatter plot of all samples generated by 29 peak areas,
cultivated populations approximately fell into a big cluster, while
the wild populations appeared more scattered, especially the distant
TW population. However, wild populations of JX, TM (except
one sample), and HN distributed considerably close to the cluster
of cultivated populations (l " Fig. 2 a). Further PCA excluding wild
samples produced four clustered groups in coincidence with cultivated
populations (l " Fig. 2 b). We ran additional PCAs using the
four main bioactive compounds as variables, and the projections
showed similar trends (see Fig. 2S in Supporting Information), indicating
their potency as markers for quality assessment of Radix
Scrophulariae. The mean contents of the two compounds, angroside
C and harpagoside, of wild populations were significantly
higher than those of cultivated ones (l " Table 2). Generally, one
of the wild populations, TW, produced the highest contents of
bioactive compounds. There were also significant differences of
angroside C and cinnamic acid contents among cultivated populations.
Besides these two compounds, the wild populations
showed further difference of acetoside content, implying more
chemical variation among wild populations.
Yang S et al. Association between Chemical… Planta Med 2011; 77: 865–871
867

868
Original Papers
Yang S et al. Association between Chemical … Planta Med 2011; 77: 865–871
Fig. 2 a Scatter plot of principal component analysis
(PCA) for all samples of Radix Scrophulariae.
PC1 and PC2 are the first principal components using
29 chromatographic peak areas as variables.
Fig. 2 b Scatter plot of principal component analysis
(PCA) for the cultivated samples of Radix
Scrophulariae. PC1 and PC2 are the first principal
components using 29 chromatographic peak areas
as variables.

Table 2 Content comparison of the four bioactive compounds among different populations of S. ningpoensis (µg/mg).
Population
Cultivated populations
Acteoside Angroside C Harpagoside Cinammic acid
DP 0.104 ± 0.002c 0.152 ± 0.017cd 1.823 ± 0.613cde 0.596 ± 0.127bc YC 0.122 ± 0.033bc 0.138 ± 0.020cd 1.557 ± 0.495de 0.702 ± 0.097b RC 0.086 ± 0.029c 0.138 ± 0.019cd 1.465 ± 0.440de 0.445 ± 0.109bcd HB 0.064 ± 0.017c 0.127 ± 0.022d 0.685 ± 0.389e 0.310 ± 0.073cd SX 0.063 ± 0.008c 0.251 ± 0.055b 2.236 ± 0.822cde 0.289 ± 0.040d CQ 0.059 ± 0.008c 0.159 ± 0.025bcd 1.521 ± 0.280de 0.287 ± 0.016d Mean
Wild populations
0.083 ± 0.029 0.161 ± 0.049 1.548 ± 0.657 0.438 ± 0.181
TM 0.178 ± 0.081ab 0.369 ± 0.128a 5.732 ± 3.739b 0.475 ± 0.104bcd TW 0.226 ± 0.061a 0.418 ± 0.049a 3.506 ± 1.119bcd 1.918 ± 0.417a JX 0.077 ± 0.020c 0.227 ± 0.062bc 4.077 ± 0.632bc 0.272 ± 0.036d HN 0.071 ± 0.004c 0.195 ± 0.030bcd 5.369 ± 1.253b 0.361 ± 0.145cd AH 0.069 ± 0.028c 0.233 ± 0.027bc 11.434 ± 0.959a 0.204 ± 0.141d Mean 0.121 ± 0.078 0.285 ± 0.106 6.362 ± 3.506 0.618 ± 0.676
Lowercases represent significant differences at the level of 95% revealed by post hoc multiple comparison
The survey of 100 individuals from 8 populations of S. ningpoensis
with 12 ISSR primers produced a total of 124 reproducible
fragments, of which 108 were polymorphic (87.10%). The highest
genetic diversity was observed in the wild population TM, with
PPF, HPOP, and HB up to 48.39%, 0.166, and 0.208, respectively. In
contrast, the level of genetic diversity was lowest in the cultivated
population DP (PPF = 12.90%, HPOP = 0.052, HB = 0.073).
Considering groups of populations, those from the wild populations
(TM and TW) possessed on average higher levels of diversity
(PPF = 41.94%, H POP = 0.150, HB = 0.186) than those from cultivated
populations (PPF = 16.80%, HPOP = 0.064, HB = 0.80) (l " Table 3).
Neiʼs estimator of population substructure (GST) indicated a
strong differentiation among cultivated populations (GST =
0.706) while a greatly lower value among wild ones (GST =
0.289). The analysis of molecular variance (AMOVA) produced a
parallel result of population differentiation within both groups
(Φ ST = 0.801 vs. ΦST = 0.399) (l " Table 4). As the hierarchical estimates
of variance components displayed, the variance component
was large and significant among groups (48.04%, p < 0.001;
l " Table 4). The Bayesian estimate of FST (θB) and Neiʼs GST (GST‑B)
indicated a similar result: cultivated populations harbored higher
levels of variance distributed among populations compared to
wild populations (l " Table 4).
UPGMA clustering based on the genetic distance matrix resulted
in two clades in the studied populations of S. ningpoensis, cultivated
and wild clades (l " Fig. 3). In the cultivated clade, population
CQ was clearly separated from the other cultivated populations,
while all populations from Zhejiang (DP, RC, and YC) composed
a close clade parallel to HB and SX populations. PCoA indicated
four main plots approximately consistent with UPGMA
clustering (see Fig. 3S in Supporting Information).
Discussion
!
In many cases, chemical diversity has been largely attributed to a
variable environment. However, recent work demonstrated that
chemical diversity was correlated with genetic variation in Anemopsis
californica [26, 27], Pinus ponderosa [28], and Vitex rotundifolia
[29]. In our present research, PCA (l " Fig. 2) and UPGMA
(l " Fig. 3) showed that chemical and genetic differentiation
among S. ningpoensis populations demonstrated nearly identical
Original Papers
Table 3 Genetic diversity indices of the ten populations of S. ningpoensis.
Population
Cultivated populations
PPF (%) HPOP HB DP 12.90 0.052 0.073
YC 20.97 0.086 0.094
RC 13.71 0.042 0.058
HB 22.58 0.085 0.103
SX 16.94 0.068 0.092
CQ 13.71 0.048 0.060
Mean
Wild populations
16.80 ± 4.13 0.064 ± 0.019 0.080 ± 0.019
TM 48.39 0.166 0.208
TW 35.48 0.134 0.164
Mean 41.94 ± 9.13 0.150 ± 0.023 0.186 ± 0.031
PPF, percentage of polymorphic fragments; HPOP, Neiʼsexpected heterozygosity; HB, expected Bayesian heterozygosity
patterns. Both chemical and genetic diversity of wild populations
were significantly higher than that of cultivated ones (l " Table 2;
l " Table 3; Table 1S in Supporting Information). Regarding the
currently unanalyzed wild populations of S. ningpoensis, our further
ITS-based maximum parsimony (MP) tree revealed a substantial
differentiation within population TM with one clade parallel
to clade AH and another relatively remote clade close to cultivated
populations. Populations JX and HN considerably resembled
all the cultivated populations in the ITS tree (C. Chen et
al., unpublished manuscript). All the above genetic relationships
indicated by the ITS tree unexpectedly coincided with the chemical
differentiation represented in l " Fig. 2. The correlation between
chemical and genetic variation was further supported by
the detection of a specific chloroplast DNA haplotype in population
TW, which is phytochemically distinct, and by the existence
of a shared haplotype between most cultivated populations and a
wild population, JX, which is chemically the closest to the cultivated
ones (C. Chen et al., unpublished manuscript). Therefore,
chemical variation was strongly indicated to be associated with
genetic variation in S. ningpoensis.
Compared to cultivated populations, wild populations of S. ningpoensis
produced a couple of unique chromatographic peaks as
well as much higher contents of most metabolites, especially in
Yang S et al. Association between Chemical… Planta Med 2011; 77: 865–871
869

870
Original Papers
Table 4 Analysis of molecular variance (AMOVA) and Bayesian F ST estimators for ISSR data of wild and cultivated S. ningpoensis.
AMOVA Bayesian estimators
Source of variation
Wild populations
d.f. Variance percent Φ-statistic P value θB ±SD GST‑B ±SD
Variation among populations 1 39.92% ΦST = 0.399 < 0.001 0.397 ± 0.041 0.236 ± 0.021
Variation within populations
Cultivated populations
18 60.08%
Variation among populations 5 80.13% ΦST = 0.801 < 0.001 0.720 ± 0.018 0.691 ± 0.016
Variation within populations
Hierarchical analysis for all studied populations
70 19.87%
Among groups of populations 1 48.04% ΦCT = 0.480 < 0.001
Among populations within the groups 6 36.80%
Within populations 88 15.16%
ΦST: inter-population genetic differentiation; ΦCT: genetic differentiation among groups; θB: FST analogues under a free model of population sampling; GST‑B: Bayesian analogue of
Neiʼs GST; d. f.: degree of freedom
terms of angroside C and harpagoside (l " Table 2; Fig. 1S and
Table 1S in Supporting Information). Secondary metabolites
function in response to stresses and changing environments
[1]. High genetic diversity was proposed to benefit the longterm
persistence of plant species through increasing their
adaptivity to ever changing environments [30]. The wild populations
of S. ningpoensis (like population TW), harboring a much
higher level of genetic and chemical variation, would be highly
valuable for breeding programs promoting metabolite production
and stress resistance. Considering that variation was largely apportioned
within populations (60.08%, see l " Table 4), a sampling
strategy using more individuals from one population was suggested
for both breeding program and germplasm conservation.
In contrast, the six cultivated populations of S. ningpoensis exhibited
a remarkably low level of average ISSR diversity within populations
(l " Table 3) and high differentiation (l " Table 4; l " Fig. 3).
These results were consistent with the previous report of S. ningpoensis
[18] as well as many other crop plants [31, 32]. This could
be explained by the long-term artificial selection, the mode of
clonal propagation, and limited among-population exchange of
genetic materials in cultivated populations of S. ningpoensis. The
cultivated populations with remarkable genetic differentiation
(landraces) displaying a high among-population portion of genetic
variation (80.13%, see l " Table 4) should be included for ex situ
Yang S et al. Association between Chemical … Planta Med 2011; 77: 865–871
Fig. 3 UPGMA dendrogram illustrating the genetic
relationships among eight populations of S. ningpoensis.
Numbers on branches indicate bootstrap
values from 1000 replicates.
conservation. Although clonally propagated in cultivated populations,
S. ningpoensis reproduces sexually in wild populations.
Therefore, to maintain and improve genetic diversity, sexual
propagation should be encouraged to a certain extent within
and among cultivated populations, even between cultivated and
wild populations of S. ningpoensis.
The following conclusions can be drawn from the present results.
(i) There is a strong association between chemical and genetic
variation of wild and cultivated populations of S. ningpoensis. (ii)
The wild and genetically differentiated cultivated populations
call for priority to in situ or ex situ conservation and utilization.
(iii) Sexual propagation should be partly carried out in practice
to maintain and improve genetic diversity. The present research
considerably promotes our theoretical understanding of medicinal
plant species regarding the selective and adaptive evolutionary
processes under the influence of both domestication and
their habitats. Our findings are also beneficial to genetic conservation,
crop improvement, and quality control of S. ningpoensis.

Acknowledgements
!
This work was financially supported by the National Basic Research
Program of China (Grant No. 2007CB411600), the National
Science & Technology Pillar Program during the Eleventh Five-
Year Plan Period (Grant No. 2006BAI21B07), Zhejiang Provincial
Natural Science Foundation of China (Grant No. Y3080087), and
the Fundamental Research Funds for the Central Universities.
The authors are grateful to Pan Li for collecting part of wild populations,
the local producers for their kindness of facilitating
sampling, and Xinhang Jiang and Dr. Zhican Wang for LC‑MS
analysis. We also thank Dr. Yingxiong Qiu for his assistance in genetic
data analyses and crucial suggestions and Dr. Jimmy Triplette
for manuscript improvement.
References
1 Fernie AR. The future of metabolic phytochemistry: larger numbers of
metabolites, higher resolution, greater understanding. Phytochemistry
2007; 68: 2861–2880
2 Hartmann T. From waste products to ecochemicals: fifty years research
of plant secondary metabolism. Phytochemistry 2007; 68: 2831–2846
3 Hoisington D, Khairallah M, Reeves T, Ribaut JM, Skovmand B, Taba S,
Warburton M. Plant genetic resources: what can they contribute toward
increased crop productivity? Proc Natl Acad Sci USA 1999; 96:
5937–5943
4 Fernie AR, Tadmor Y, Zamir D. Natural genetic variation for improving
crop quality. Curr Opin Plant Biol 2006; 9: 196–202
5 Diaz AM, Abad MJ, Fernandez L, Silvan AM, De Santos J, Bermejo P. Phenylpropanoid
glycosides from Scrophularia scorodonia: in vitro anti-inflammatory
activity. Life Sci 2004; 74: 2515–2526
6 Galindez JD, Lanza AMD, Matellano LF. Biologically active substances
from the genus Scrophularia. Pharm Biol 2002; 40: 45–59
7 Garcia D, Fernandez A, Saenz T, Ahumada C. Antiinflammatory effects of
different extracts and harpagoside isolated from Scrophularia frutescens
L. Farmaco 1996; 51: 443–446
8 Liu L, Hudgins WR, Shack S, Yin MQ, Samid D. Cinnamic acid: a natural
product with potential use in cancer intervention. Int J Cancer 1995;
65: 345–350
9 Miyazawa M, Okuno Y, Nakamura S, Kameoka H. Suppression of SOSinducing
activity of chemical mutagens by cinnamic acid derivatives
from Scrophulia ningpoensis in the Salmonella typhimurium TA1535/
pSK1002 umu Test. J Agric Food Chem 1998; 46: 904–910
10 Zhang HX, Song JY, Zhao SR, Zhao HQ, Gong KM. Simultaneous determination
of the contents of the cinnamic acid and harpagoside in Radix
Scrophulariae by RP-HPLC. J Shenyang Pharm Univ 2006; 23: 507–510
11 Liu CW, Bi ZM, Zhu YF, Li P. Simultaneous determination of four kinds of
bioactive components in Radix Scrophulariae by HPLC. China Pharm
J 2007; 42: 1614–1616
12 Li P, Zhang Y, Xiao L, Jin X, Yang K. Simultaneous determination of harpagoside
and cinnamic acid in rat plasma by high-performance liquid
chromatography: application to a pharmacokinetic study. Anal Bioanal
Chem 2007; 389: 2259–2264
13 Wang SJ, Ruan JX, Zhao YH. Simultaneous determination of harpagoside
and cinnamic acid in rat plasma by liquid chromatography electrospray
ionization mass spectrometry and its application to pharmacokinetic
studies. Biomed Chromatogr 2008; 22: 50–57
Original Papers
14 Zhu YF, Bi ZM, Liu CW, Ren MT, Wu FH, Li P. Endothelial cell extraction
and HPLC‑ESI/TOF MS analysis for predicting potential bioactive components
of Radix Scrophulariae. J China Pharm Univ 2008; 39: 228–
231
15 Bai ZC. Fingerprints of Radix Scrophulariae by HPLC. Chin Mater Med
2006; 29: 1295–1299
16 Ma DF, Zhou N, Bai ZC, Fang LJ, Sun CJ. Identification of the habitat of
Radix Scrophulariae with chromatographic fingerprinting. Lishizhen
Med Mater Med Res 2009; 20: 789–793
17 Zhao ZX, Liang ZS, Jiang ZM, Xue YF, Yang YZ. Establishment and optimization
of ISSR reaction system for Scrophularia ningpoensis Hemsl.
Pharm Biotechnol 2007; 14: 318–323
18 Zhao ZX. The study on germplast resources diversity of Scrophularian
ningpoensis Hemsl. [dissertation]. Yangling: Northwest Agricultural
Forestry University; 2008
19 Chen DX, Li LY, Peng R, Wu Y, Cai Y. Analysis of genetic difference among
Scrophularia ningpoensis cultivars by SRAP. China J Chin Mater Med
2009; 34: 138–142
20 Doyle JJ. DNA protocols for plants – CTAB total DNA isolation. In: Hewitt
GM, Johnston A, editors. Molecular techniques in taxonomy. Heidelberg:
Springer-Verlag; 1991: 283–293
21 Yeh FC, Yang RC, Boyle TB, Ye ZH, Mao JX. POPGENE, the user-friendly
shareware for population genetic analysis. Available at http://www.
ualberta.ca/~fyeh. Accessed October 3, 2009
22 Holsinger KE, Lewis PO. Hickory: a package for analysis of population
genetic data V1.0. Available at http://www.eeb.uconn.edu. Accessed
October 3, 2009
23 Miller MP. AMOVA-PREP 1.01: A program for the preparation of AMO-
VA input files from dominant-markers raw data. Flagstaff: Department
of Biological Sciences, Northern Arizona University; 1998
24 Excoffier L, Smouse PE, Quattro JM. Analysis of molecular variance inferred
from metric distances among DNA haplotypes: applications to
human mitochondrial DNA restriction data. Genetics 1992; 131: 479–
491
25 Kovach WL. MVSP – A multivariate statistical package for windows,
version 3.1. Wales: Kovach Computing Services; 1999
26 Medina-Holguin AL, Holguin FO, Micheletto S, Goehle S, Simon JA, OʼConnell
MA. Chemotypic variation of essential oils in the medicinal plant,
Anemopsis californica. Phytochemistry 2008; 69: 919–927
27 Medina-Holguin AL, Martin C, Micheletto S, Holguín FO, Rodriguez J,
OʼConnel MA. Environmental influences on essential oils in roots of
Anemopsis californica. Hortscience 2007; 42: 1578–1583
28 Gerson EA, Kelsy RG, Clair JB. Genetic variation of piperidine alkaloids in
Pinus ponderosa: a common garden study. Ann Bot 2009; 103: 447–
457
29 Hu Y, Zhang QY, Xin HL, Qin LP, Lu BR, Rahman K, Zheng H. Association
between chemical and genetic variation of Vitex rotundifolia populations
from different locations in China: its implication for quality control
of medicinal plants. Biomed Chromatogr 2007; 21: 967–975
30 Vrijenhoek RC. Animal population genetics and disturbance: the effects
of local extinctions and recolonizations on heterozygosity and fitness.
In: Pickett STA, White PS, editors. The ecology of natural disturbance
and path dynamics. London, MA: Academic Press; 1985: 265–285
31 Abbo S, Berger J, Turner NC. Evolution of cultivated chickpea: four bottlenecks
limit diversity and constrain adaptation. Funct Plant Biol
2003; 30: 1081–1087
32 Doebley J. Isozymic evidence and the evolution of crop plants. In: Soltis
DE, Soltis PS, editors. Isozymes in plant biology. Portland: Dioscorides
Press; 1989: 165–191
Yang S et al. Association between Chemical… Planta Med 2011; 77: 865–871
871