ExamView - Honors Biology Spring Semester Final Practice Test ...

Name: ________________________ ID: A
____ 54. The cell cycle is divided into interphase and mitosis.
____ 55. Stem cells are only of one type: embryonic.
____ 56. Embryonic stem cells are found in various tissues in the body and might be used to maintain and repair the
same kind of tissue in which they are found.
____ 57. A gamete has one-half the number of chromosomes of a regular body cell.
____ 58. Mendel’s work on garden pea plants resulted in the discovery that genetic traits of parents always blend
together in subsequent generations.
____ 59. In humans, the ability to roll one’s tongue is a dominant trait. Therefore, a tongue roller can only have
children who are also tongue rollers.
____ 60. The separation of genes during crossing over occurs more frequently between genes that are far apart on a
chromosome than for genes that are close together.
____ 61. One map unit between two genes indicates that crossing over occurs between them 100 percent of the time.
____ 62. Gregor Mendel’s research supports the idea each organism carries a pair of alleles.
____ 63. A woman with an X-linked dominant genetic disorder will have children who have a 50% chance to be
affected by the trait also, regardless of their gender.
____ 64. RNA polymerase has to bind to DNA for an enzyme to be synthesized.
____ 65. DNA nucleotides are always added to an existing strand at the 3-prime end. This means that during
replication a leading and lagging strand are created.
____ 66. The human genome is made up of 32 chromosomes.
____ 67. PCR is often used in forensic (crime-related) identification work because the samples found are usually
contaminated.
10

Name: ________________________ ID: A
Practice Short Answer Questions: Spring Semester Final Honors Biology 2011-2012
This practice test will help prepare you for the spring semester final by reminding you of how questions can be
worded. Study the objective questions for the final. This practice test is not meant to be studied for the Final
Using this practice test alone is NOT sufficient studying for the final.
Completion
Complete each statement.
Figure 11-7
68. The abnormality of the karyotype shown in Figure 11-7 is ____________________.
11

Name: ________________________ ID: A
Short Answer: The short answer questions on the final will be very close to these short answer questions. Answer
in 2-3 sentences. To study, begin by answering the questions you are least familiar with.
69. How is breathing related to cellular respiration?
70. A student exposed two plants to only red light and two plants to only green light. Which plants should grow
better? Why?
71. Describe the relationship between the light-dependent and the light-independent reactions.
72. List two factors that affect the rate of photosynthesis.
Figure 10–1
73. The main events of the cell cycle are labeled A, B, C, and D in Figure 10–1. Name these events. Then, briefly
state what happens during each event.
74. Describe how the cell cycle is regulated. The level of cyclins in a cell increases during the M phase of the
cell cycle. What might happen to a cell if no cyclins were present during the M phase?
75. Why are most sex-linked disorders more common in males?
76. A pea plant heterozygous for height and seed color (TtYy) is crossed with a pea plant heterozygous for height
but homozygous recessive for seed color (Ttyy). If 80 offspring are produced, how many are expected to be
tall and have yellow seeds?
77. The gene map of a fruit fly’s chromosome 2 shows the relative locations of the star eye, dumpy wing, and
black body genes to be 1.3, 13.0, and 48.5, respectively. Between which two genes is crossing over likely to
occur most frequently?
78. How does Mendel's law of independent assortment assure genetic diversity?
12

Name: ________________________ ID: A
79. Describe how genetic recombination through segregation and crossing over can lead to variations in the
offspring.
80. Why is there such a difference between the number of individuals who carry the allele of cystic fibrosis and
the number actually born with the disease?
81. Explain how nondisjunction can result in an individual having an extra chromosome.
82. A researcher crossed a brown-eyed flightless fruit fly (bbff) with a heterozygous normal fruit fly (BbFf). Of
the 235 offspring, 220 appeared either brown-eyed flightless or normal. What is the best explanation for this
observation?
83. Two parents with brown eyes have two children with blue eyes. Assume that only one gene for eye type is
involved. How is this possible? Defend your answer by presenting possible genotypes for the individuals in
the scenario.
84. A typical crossing experiment involving three genes in fruit flies might show the percentage of recombinant,
or crossover offspring, between the genes taken in pairs to be the following:
frequency between A and G = 5%
frequency between G and M = 21%
frequency between A and M = 16%
Use these numbers to order the genes on the most reasonable genetic map and indicate the number of map
units between them.
Table 11-1
85. Two couples, the Pages and the Bakers, had baby boys in the same hospital at the same time. There was a
mixup in the hospital nursery. Use the information given in Table 11-1. Which baby belongs to which
family?
13

Name: ________________________ ID: A
The pedigree in Figure 11-6 shows the occurrence of Tay-Sachs disease in a family. Children who were born
with the homozygous recessive genotype are not able to produce the enzyme, hexosaminidase A.
Figure 11-8
86. Which individuals in the F2 generation of Figure 11-8 have at least a 50% chance of being carriers, and which
of these have a 100% chance of being carriers? Explain your answer.
87. Why is this type of marriage (I and J) more likely to produce individuals with the recessive phenotype than
marriages such as those between individuals C and D or between F and G, shown in Figure 11-8?
88. What is a karyotype and how is it produced?
89. Identify the following types of chromosome changes.
a. abcdef → abcedf
b. abcdef → abcef
14

Name: ________________________ ID: A
Figure 12-4
90. Use the genetic code (Figure 12-4) to find the start codon in this mRNA sequence and write the sequence of
amino acids this mRNA would translate into.
CUGACGAUGCUCAACGGCAUAUAACGCGAG
91. In pea plants, round seeds (R) are dominant, and wrinkled seeds (r) are recessive. Why would it be
unnecessary to use a testcross with a wrinkled seed to determine its genotype?
15

Name: ________________________ ID: A
Other
16
Figure 7-2
92. Observing Look at Figure 7-2. Which structure is NOT part of an ADP molecule?
Figure 7-3
93. Predicting Which pathway in Figure 7-3 will only occur if oxygen is present?

Name: ________________________ ID: A
USING SCIENCE SKILLS
17
Figure 9–3
94. Interpreting Graphics Look at Figure 9–3. Where do the electrons moving along the inner membrane come
from?
USING SCIENCE SKILLS
Figure 9-4
95. Observing List the correct order for the diagrams in Figure 9-4.

Name: ________________________ ID: A
USING SCIENCE SKILLS
18
Figure 9-6
96. Observing In Figure 9-6, during which stage might genetic recombination occur? Identify the stage.

Name: ________________________ ID: A
USING SCIENCE SKILLS
Figure 10–6
97. Applying Concepts Explain the role that p53 might have had in the growth and division of the cells shown
in each diagram in Figure 10–6.
USING SCIENCE SKILLS
Heterozygous male guinea pigs with black, rough hair (BbRr) are crossed with heterozygous female guinea
pigs with black, rough hair (BbRr). The incomplete Punnett square in Figure 10-3 shows the expected results
from the cross.
BbRr
BbRr
BR Br bR br
BR BBRR BBRr BbRR BbRr
Br BBRr BBrr BbRr Bbrr
bR BbRR BbRr × bbRr
br BbRr Bbrr bbRr bbrr
Figure 10-3
19
Hair Color
B – black
b – white
Hair Texture
R – rough
r – smooth
98. Inferring In Figure 10-3, what are the possible genotypes of offspring that have black, rough hair?

Name: ________________________ ID: A
USING SCIENCE SKILLS
Figure 10-4
99. Inferring Explain whether the alleles in Figure 10-4 show dominance, intermediate inheritance, or
codominance.
100. Predicting According to Figure 10-4, if red-flowered snapdragons and ivory-flowered snapdragons are
crossed, what percentage of their offspring would be expected to be pink-flowered?
20

Name: ________________________ ID: A
USING SCIENCE SKILLS
Figure 11-1
101. Predicting What would happen to structure F in Figure 11-1 if structure C were deleted?
USING SCIENCE SKILLS
Figure 12–5
102. Inferring What is the relationship between the codons and anticodons in Figure 12–5? How is this
relationship important?
21

Name: ________________________ ID: A
USING SCIENCE SKILLS
Figure 12–6
103. Interpreting Graphics In Figure 12–6, which process is a translocation?
USING SCIENCE SKILLS
Figure 13–2
104. Interpreting Graphics Which group of bands in Figure 13–2 moved faster, C or D? Why?
105. Drawing Conclusions In Figure 13–2, were the three DNA samples shown in A identical? Explain your
answer.
22

Name: ________________________ ID: A
Essay
USING SCIENCE SKILLS
Figure 13–4
106. Inferring In Figure 13–4, why was the nucleus removed from the egg cell?
107. Explain how “falling” electrons are a source of energy.
108. List the main events of glycolysis. How many ATP molecules are produced and consumed by glycolysis?
What effect does the presence of oxygen have on the events that follow glycolysis?
109. Discuss the relationship between autotrophs and heterotrophs. Do heterotrophs depend on autotrophs for
their survival? Explain your answer.
110. Compare lactic acid fermentation with alcoholic fermentation. Where does each process occur? What are the
products of each process?
111. Describe the kinds of light that chlorophyll and carotene pigments absorb. What is the advantage for a plant
to have more than one kind of pigment?
112. Trace the events that occur in the thylakoid membrane during the light-dependent reactions.
113. Explain why the daughter cells produced by meiosis are genetically different from each other, whereas the
daughter cells produced by mitosis are not.
23

Name: ________________________ ID: A
114. Assume that prophase begins with eight chromatids in the nucleus of a cell. When telophase ends, how many
chromosomes will be present in each new nucleus? Explain your answer.
115. The stages of meiosis are classified into two divisions: meiosis I and meiosis II. Compare and contrast these
two divisions.
116. Suppose the homologous chromosomes that make up a tetrad fail to separate during anaphase I of meiosis.
Predict the results of this event.
117. Explain the roles of environment and genetics in causing cancer.
118. Relate ratio of surface area to volume to cell growth and cell division.
119. How can environmental conditions affect phenotype expression?
120. In humans, albinism is recessive to normal coloration. Assume that an albino woman and a man who is
homozygous for normal coloration are planning to have children. What is the likelihood that their children
will be albino? Defend your answer by including specific genotypes of the individuals involved.
121. Describe the process in which an RNA transcript is converted into a final mRNA.
122. Contrast the functions of the three main types of RNA.
123. Why do some kinds of mutations cause greater changes in proteins than others?
124. How does transcription differ from DNA replication? Describe at least four differences.
125. If you unraveled a eukaryotic chromosome, what would you observe as it became unraveled?
126. Compare and contrast DNA replication in prokaryotes and eukaryotes.
127. Why does Huntington’s disease remain in the human population, even though it is fatal and is caused by a
dominant allele?
128. What are stem cells? What are the unique features of stem cells?
24

Name: ________________________ ID: A
Problem
129. In guinea pigs, the allele for rough coat (R) is dominant to the allele for smooth coat (r), and the allele for
black fur (B) is dominant to the allele for white fur (b). If two guinea pigs that are heterozygous for rough,
black fur (RrBb) are mated, what are the possible phenotypes and what is the frequency of each? Show your
work in a Punnett square, Figure 10-4.
Figure 10-4
130. In fruit flies, the allele for normal body (H) is dominant to the allele for hairy body (h), and the allele for red
eye color (B) is dominant to the allele for brown (b). Use a Punnett square to determine the possible
phenotypes and frequencies of the offspring from the cross Hhbb × hhBb.
131. In Figure 12-5, use the letter P to label all of the phosphate groups. Use an S to label all the sugar molecules.
For labeling the nitrogen bases, use a T for thymine and a C for cytosine. Guanine and adenine have been
filled in for you. Circle and label a codon. Circle and label a nucleotide.
Figure 12-5
25