Incidence, Distribution and Characteristics of Major Tomato Leaf ...
Share Embed Flag
Download ePaper

Incidence, Distribution and Characteristics of Major Tomato Leaf ...

Incidence, Distribution and Characteristics of Major Tomato Leaf ... Incidence, Distribution and Characteristics of Major Tomato Leaf ...

tropicallab.ugent.be
from tropicallab.ugent.be More from this publisher
11.06.2013 Views

Incidence, distribution and characteristics of major tomato leaf curl and mosaic virus diseases used were Bean golden mosaic virus (BGMV) DNA as a general probe for geminiviruses (Gilbertson et al., 1991) and TYLCV-EG DNA provided by Professor D.P Maxwell’s laboratory (Nakhla et al., 1993) as specific probe for TYLCV-Is (Padidam et al., 1995). 3.2.2.2.2 Virus Characterization Using Polymerase Chain Reaction (PCR) Samples that tested positive to DNA hybridisation were further analysed using polymerase chain reactions with various general and specific primers to determine presence and identity of geminiviruses (Navot et al., 1992; Briddon and Markham, 1994; Wyatt and Brown, 1996). 3.2.2.2.2.1 Sample Preparation for Polymerase Chain Reaction To extract DNA from samples bearing leaf curl and/or yellow mottling, a minipreparation technique developed by Dellaporta et al. (1983) was used. A dry leaf disc sample, about 1 cm in diameter was used per eppendorf tube per sample for extraction of clean total DNA. The DNA was dried in a vacum centrifuge Speed-Vac® Savant, for 5-7 min to concentrate and dry it. The dry pellet was re-suspended in 100 µl of distilled water. In the case of dirty brown pellets, instead of re-suspending in water, the latter pellets were re-suspended in 500 µl of Dellaporta buffer and the whole extraction procedure was repeated to remove all salts that cause browning and hinder PCR reaction. 3.2.2.2.2.2 DNA Fragment Amplification Extracted DNA, in a 50 µl reaction mixture (28 µl of double-distilled water, 5 µl of 10xdNTPs, 5 µl of 10x buffer, 5 µl of 10x MgC12, 0.2 µl of Taq DNA polymerase, 1µl of each primer, 5 µl of Dellaporta DNA and overlaid with 100 µl of mineral oil was amplified in a Pelkin-Elmer Thermocycler run at 94 ºC for 1 min, 55 ºC for 2 min, and 72 ºC for 2 min, for 30 cycles and 94 ºC for 1 min, 55 ºC for 2 min, and 72 ºC for 4 min, in one cycle. The reaction was then held at 18 ºC (Nakhla et al., 1998). By repeated 64

Incidence, distribution and characteristics of major tomato leaf curl and mosaic virus diseases denaturation (94 ºC), hybridisation or annealing (55 ºC) and extension (72 ºC), target DNA fragments were amplified with their sizes doubling after each cycle. Oligonucleotide primers used for general detection of tomato geminivirus were PAL1V 1978 and PAR1c 715, PAR AV 494 and PAR AC 1048 (Rojas et al., 1993; Nakhla et al., 1993; Wyatt and Brown, 1996) as shown in Table 3.3. Specific primers used to test for TYLCV-Is were PTYCRv 21 and PTYC Rc 287; PTYC2v 1499 and PTYAL1c 2196; PTYV2v 466 and PTYC 2c 1814. Table 3.3: Primers provided by Maxwell Laboratory, University of Wisconsin-Madison and those (PTLCV - UGrep2r, PTLCV - UGrep1f, PTLCV - UGcp 1f) produced during this study, and used in PCR reactions to identify and characterize geminiviruses Primer Code¹ 5'Carbon end (Donor)–Sequence–3'Carbon end (Receptor) / DNA segment size Degenerate PARAv 494 PARAc 1048 PAR1c 715 PAL1v 1978 Specific PTYCRv 21 PTY IRc 287 PTYC 2v 1499 PTYAL1c 2196 PTYV 2v 466 PTYC 2c 1814 PTLCVUGrep2r PTLCVUGrep1f PTLCVUGcp1f GCCCATGTATAGAAAGCCAAC GGATTAGAGGCATGTGTGTACATG CATTTCTGCAGTTDATRTTYTCRTCCATCCA GCATCTGCAGGCCCACATYGTCTTYCCNGT AACTCTGCAGTTGAAATGAATCGGTGTCCC ATATCTGCAGTTGCAAGACAAAAAACTTGGGGACC ATTTGTGGATCCTGATTACCTTCCTGATGTTGTGG AAATCTGCAGATGAACTAGAAGAGTGGG TTAGGGATCCTATATCTGTTGTAAGGGC AAACGGATCCTTGAAAAATTGGGC GAGAATGTCATGAGTTCCGCTGCG GGGGATACCAGGTCGAAGATCGG GTATTACATAGGGTTGGCAAGAGG Nt annealing start-point 494 1048 715 1950 2636 123 1499 2196 466 1814 2078 2437 641 ¹P (Primer); TY (specific to TYLCV); TLCVUG (specific to ToLCV-UG); IR (intergenic region); V1, V2, C1, C2, C3, C4 (different Open Reading Frames, as in figure 3.6 below); V (viral sense primer); C (complementary sense primer); f (forward); r (reverse); 21-2437nt (nucleotide numbers for TYLCV-Is specific primers and for BGMV-GA degenerate primers); rep1 or rep2 (replicates), cp (coat protein). Some of the primers used were designed in the laboratory according to recommended standard guidelines and sent to Life Technologies-GIBCO BRL for synthesis 65

<strong>Incidence</strong>, distribution <strong>and</strong> characteristics <strong>of</strong> major tomato leaf curl <strong>and</strong> mosaic virus diseases<br />

denaturation (94 ºC), hybridisation or annealing (55 ºC) <strong>and</strong> extension (72 ºC), target<br />

DNA fragments were amplified with their sizes doubling after each cycle.<br />

Oligonucleotide primers used for general detection <strong>of</strong> tomato geminivirus were PAL1V<br />

1978 <strong>and</strong> PAR1c 715, PAR AV 494 <strong>and</strong> PAR AC 1048 (Rojas et al., 1993; Nakhla et al.,<br />

1993; Wyatt <strong>and</strong> Brown, 1996) as shown in Table 3.3. Specific primers used to test for<br />

TYLCV-Is were PTYCRv 21 <strong>and</strong> PTYC Rc 287; PTYC2v 1499 <strong>and</strong> PTYAL1c 2196;<br />

PTYV2v 466 <strong>and</strong> PTYC 2c 1814.<br />

Table 3.3: Primers provided by Maxwell Laboratory, University <strong>of</strong> Wisconsin-Madison<br />

<strong>and</strong> those (PTLCV - UGrep2r, PTLCV - UGrep1f, PTLCV - UGcp 1f) produced during<br />

this study, <strong>and</strong> used in PCR reactions to identify <strong>and</strong> characterize geminiviruses<br />

Primer Code¹ 5'Carbon end (Donor)–Sequence–3'Carbon end (Receptor)<br />

/ DNA segment size<br />

Degenerate<br />

PARAv 494<br />

PARAc 1048<br />

PAR1c 715<br />

PAL1v 1978<br />

Specific<br />

PTYCRv 21<br />

PTY IRc 287<br />

PTYC 2v 1499<br />

PTYAL1c 2196<br />

PTYV 2v 466<br />

PTYC 2c 1814<br />

PTLCVUGrep2r<br />

PTLCVUGrep1f<br />

PTLCVUGcp1f<br />

GCCCATGTATAGAAAGCCAAC<br />

GGATTAGAGGCATGTGTGTACATG<br />

CATTTCTGCAGTTDATRTTYTCRTCCATCCA<br />

GCATCTGCAGGCCCACATYGTCTTYCCNGT<br />

AACTCTGCAGTTGAAATGAATCGGTGTCCC<br />

ATATCTGCAGTTGCAAGACAAAAAACTTGGGGACC<br />

ATTTGTGGATCCTGATTACCTTCCTGATGTTGTGG<br />

AAATCTGCAGATGAACTAGAAGAGTGGG<br />

TTAGGGATCCTATATCTGTTGTAAGGGC<br />

AAACGGATCCTTGAAAAATTGGGC<br />

GAGAATGTCATGAGTTCCGCTGCG<br />

GGGGATACCAGGTCGAAGATCGG<br />

GTATTACATAGGGTTGGCAAGAGG<br />

Nt annealing<br />

start-point<br />

494<br />

1048<br />

715<br />

1950<br />

2636<br />

123<br />

1499<br />

2196<br />

466<br />

1814<br />

2078<br />

2437<br />

641<br />

¹P (Primer); TY (specific to TYLCV); TLCVUG (specific to ToLCV-UG); IR (intergenic region); V1, V2,<br />

C1, C2, C3, C4 (different Open Reading Frames, as in figure 3.6 below); V (viral sense primer); C<br />

(complementary sense primer); f (forward); r (reverse); 21-2437nt (nucleotide numbers for TYLCV-Is<br />

specific primers <strong>and</strong> for BGMV-GA degenerate primers); rep1 or rep2 (replicates), cp (coat protein).<br />

Some <strong>of</strong> the primers used were designed in the laboratory according to recommended<br />

st<strong>and</strong>ard guidelines <strong>and</strong> sent to Life Technologies-GIBCO BRL for synthesis<br />

65

logo

products

Resources

Company

Terms of service
Privacy policy
Cookie policy
Cookie settings
Imprint
Change language
Made with love in Switzerland
© 2024 Yumpu.com all rights reserved

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!