Molecular detection of poisonous mushrooms in ... - Mycologia

Mycologia, 102(3), 2010, pp. 747–754. DOI: 10.3852/09-124 

# 2010 by The Mycological Society of America, Lawrence, KS 66044-8897 

Sara Epis 1 

Molecular detection of poisonous mushrooms in different matrices 

Dipartimento di Patologia Animale, Igiene e Sanità 

Pubblica Veterinaria, Università degli studi di Milano, 

Milano, Italy 

Caterina Matinato 

Responsabile U.O. Preparazione terreni di coltura 

Laboratorio di Sanità Pubblica, ASL di Milano, Italy 

Gabriella Gentili 

Responsabile U.O. Microbiologia Clinica, Sezione 

Specialistica di Micologia, Laboratorio di Sanità 

Pubblica, ASL di Milano, Italy 

Fabio Varotto 

Responsabile Servizio medico, Laboratorio di Sanità 

Pubblica, ASL di Milano, Italy 

Claudio Bandi 

Davide Sassera2 Dipartimento di Patologia Animale, Igiene e Sanità 

Pubblica Veterinaria, Università degli studi di Milano, 

Milano, Italy 

Abstract: Amanita phalloides, Lepiota cristata, Lepiota 

brunneoincarnata and Inocybe asterospora are among 

the most important species responsible of mushroom 

poisoning in northern Italy. A real time PCR method 

for the identification of samples containing DNA 

from each of these species was developed. To test 

specificity all protocols were applied on DNA extracted 

from various mushroom species; sensitivity was 

assessed performing serial dilutions on all samples; 

versatility of the protocols was evaluated performing 

tests on DNA extracted from different matrices. The 

protocols showed high sensitivity (32 ng dried 

mushroom), high specificity and sensitive detection 

of DNA extracted from difficult samples, including 

pasta with mushroom, cooked mushrooms and gastric 

aspirates. 

Key words: Basidiomycetes, poisonous mushrooms, 

real time PCR, species identification 

INTRODUCTION 

Poisonous mushrooms are routinely identified by 

specialized mycologists based on their morphological 

characters, but the samples examined in the context 

Submitted 14 Sep 2009; accepted for publication 27 Oct 2009. 

1 Current address: Dipartimento di Medicina Sperimentale e Sanità 

Pubblica, Università degli Studi di Camerino, Camerino, Italy. 

2 Corresponding author. E-mail: davide.sassera@unimi.it 

747 

of clinical diagnosis are generally not well preserved 

and thus frequently unsuitable for a rapid morphological 

identification. Furthermore morphological 

examination is time consuming and requires the 

professional knowledge of a mycologist. The analysis 

of cooked mushrooms or of gastric aspirates from 

poisoned patients is particularly difficult because the 

spores are often few and their morphology generally 

is altered (Hall et al. 1987, Barbato 1993, McPartland 

et al. 1997). This paper presents novel primer pairs 

and a real time PCR method for the detection of four 

species of poisonous mushrooms that are a common 

cause of human intoxication in Italy, Amanita 

phalloides, Lepiota cristata, Lepiota brunneoincarnata 

and Inocybe asterospora. 

In Italy 1996–2006 about 10 000 cases of mushroom 

poisoning were reported to the Centro Antiveleni of 

Milano. About 2400 of these cases showed a long 

incubation period; 22 cases resulted in the death of 

the patients; and nine required liver transplants due 

to severe hepatic insufficiency (Assisi et al. 2008). In 

northern Italy 2005–2008 15% cases have been caused 

by mushroom genera Lepiota, Amanita and Inocybe 

(data recorded at the Mycology Section, Laboratorio 

di Sanità Pubblica of Milano, ASL Via F. Juvara, 22– 

20129 Milano). 

Toxic mushrooms of genus Lepiota often are 

mistaken for the edible mushrooms of genus Macrolepiota 

and thus are common cause of poisoning. 

Similarly A. phalloides can be misidentified as an 

edible species of genera Amanita, Lepiota or Russula, 

thus causing 8% of the total fungal poisonings in Italy 

(Assisi et al. 2008). I. asterospora is widespread in 

northern Italy (data recorded by the Associazione 

Micologica Bresadola, Varese; http://digilander.libero. 

it/ambvarese/index.htm) and can be misidentified as 

Armillaria spp. The above poisonous fungi are characterized 

by different toxicity; A. phalloides, L. cristata and 

L. brunneoincarnata cause severe poisoning characterized 

by a lengthy incubation (Karlson-Stiber et al. 2003, 

Roux et al. 2008); I. asterospora causes milder symptoms 

with short latency, from 15 min to 4 h (Lurie et al. 

2009). 

The availability of molecular techniques for the 

identification of poisonous fungi would support and 

integrate the work of the mycologist in cases of 

clinical poisoning. In this study we developed a rapid 

system for identification of four species of poisonous 

mushroom with real time PCR. We show the 

application of this technique on cooked mushrooms 

and gastric aspirates. The described technique allows

748 MYCOLOGIA 

TABLE I. Samples used in this study, accession number of ITS gene sequences from each species, place and year of collection of the samples and identification 

Year of 

isolation Identification 

ITS gene bank 

accession number Source Geography Collector 

Isolate species 

Amanita phalloides EU909444 LSP-MI-68 Parco delle Groane, Milano, 

G. Gentili 2007 molecular & standard 

Lombardia, Italy 

taxonomic keys 

Amanita phalloides EU909444 LSP-MI-CS17 Livigno, Sondrio, Lombardia, Italy Gr. Micologico Agrate 2008 standard taxonomic keys 

Brianza 

Amanita phalloides EU909444 LSP-MI-CS21 Clusone, Bergamo, Lombardia, Italy Gr. Micologico Agrate 2007 standard taxonomic keys 

Brianza 

Amanita virosa FJ755188 LSP-MI-79 Bellamonte, Trento, Trentino, Italy G. Gentili 1993 molecular & standard 


Amanita virosa FJ755188 LSP-MI-CS1 Valbondione, Bergamo, Lombardia, Gr. Micologico Agrate 2008 standard taxonomic keys 

Italy 

Brianza 

Amanita verna EU909448 LSP-MI-78 Dossena, Bergamo, Lombardia, Italy G. Gentili 1994 molecular & standard 


Amanita verna EU909448 LSP-MI-CS11 San Rossore, Pisa, Lombardia, Italy Gr. Micologico Agrate 2006 standard taxonomic keys 

Brianza 

Amanita cesarea AY486237 LSP-MI-50 Parco delle Groane, Milano, 

G. Gentili 2003 standard taxonomic keys 


Amanita muscaria GQ267469 LSP-MI-CS10 Barni, Como, Lombardia, Italy Gr. Micologico Agrate 2000 standard taxonomic keys 

Brianza 

Amanita pantherina GQ401354 LSP-MI-CS15 Triuggio, Monza e Brianza, 

Gr. Micologico Agrate 2000 standard taxonomic keys 


Brianza 

Lepiota lilacea AY176379 LSP-MI-768 Parco delle Groane, Milano, 



Lepiota cristata AJ237628 LSP-MI-757 Rozzano, Milano, Lombardia, Italy G. Gentili 1996 molecular & standard 


Lepiota cristata AJ237628 LSP-MI-CS22 Cologno Monzese, Milano, 



Brianza 

Lepiota 

FJ481017 LSP-MI-750 Rozzano, Milano, Lombardia, Italy G. Gentili 1996 molecular & standard 

brunneoincarnata 


Lepiota 

FJ481017 LSP-MI-CS2 Cologno Monzese, Milano, 


brunneoincarnata 


Brianza 

Lepiota subincarnata AY176491 LSP-MI-CS3 Cologno Monzese, Milano, 



Brianza 

Lepiota josserandii ND LSP-MI-765 Parco delle Groane, Milano, 


Lombardia, Italy

TABLE I. Continued. 

EPIS ET AL.: POISONOUS MUSHROOMS 749 

ITS gene bank 


Isolate species accession number Source Geography Collector isolation Identification 

Russula heterophylla DQ422006 LSP-MI-CS6 Arcore, Monza e Brianza, 



Brianza 

Marasmius oreades FJ431267 LSP-MI-CS7 Vimercate, Monza e Brianza, 



Brianza 

Leucoagaricus 

AF482865 LSP-MI-CS8 Rozzano, Milano, Lombardia, Italy Gr. Micologico Agrate 2005 standard taxonomic keys 

leucothites 

Brianza 

Inocybe asterospora AM882897 LSP-MI-613 Trentino, Italy G. Gentili 1996 molecular & standard 


Inocybe asterospora AM882897 LSP-MI-CS24 Barni, Como, Lombardia, Italy Gr. Micologico Agrate 2002 standard taxonomic keys 

Brianza 

Agaricus xanthodermus DQ182534 LSP-MI-36 Parco delle Groane, Milano, 

G. Gentili 1994 molecular & standard 



Agaricus arvensis AF161015 LSP-MI-CS9 Cassina de Pecchi, Milano, 



Brianza 

Agaricus campestris FJ755230 LSP-MI-CS14 Cassina de Pecchi, Milano, 



Brianza 

Cortinarius orellanus AF389164 LSP-MI-CS5 Clusone, Bergamo, Lombardia, Italy Gr. Micologico Agrate 2005 standard taxonomic keys 

Brianza 

Cortinarius 

AF261501 LSP-MI-CS12 Aprica, Sondrio, Lombardia, Italy Gr. Micologico Agrate 2005 standard taxonomic keys 

speciosissimus 

Brianza 

Cortinarius 

AF261501 LSP-MI-CS25 Bossico, Bergamo, Lombardia, Italy Gr. Micologico Agrate 2006 standard taxonomic keys 

speciosissimus 

Brianza 

Chroogomphus AF205650 LSP-MI-CS13 Livigno, Sondrio, Lombardia, Italy Gr. Micologico Agrate 2006 standard taxonomic keys 

helveticus 

Brianza 

Chroogomphus rutilus DQ367894 LSP-MI-CS19 Vimercate, Monza e Brianza, 



Brianza 

Tricholoma equestre EF493263 LSP-MI-CS16 Chiesa Val Malenco, Sondrio, Gr. Micologico Agrate 2007 standard taxonomic keys 


Brianza 

Entoloma lividum AF261294 LSP-MI-CS20 Milano, Lombardia, Italy Gr. Micologico Agrate 2000 standard taxonomic keys 

Brianza 

Armillaria mellea FJ664597 LSP-MI-82 Clusone, Bergamo, Lombardia, Italy G. Gentili 2000 standard taxonomic keys 

Armillaria mellea FJ664597 LSP-MI-CS23 Clusone, Bergamo, Lombardia, Italy Gr. Micologico Agrate 2006 standard taxonomic keys 

Brianza 

Armillaria ostoyae EU257717 LSP-MI-CS4 Clusone, Bergamo, Lombardia, Italy Gr. Micologico Agrate 2008 standard taxonomic keys 

Brianza

750 MYCOLOGIA 

TABLE I. Continued. 


isolation Identification 

ITS gene bank 

accession number Source Geography Collector 

Isolate species 

Macrolepiota procera AM946456 LSP-MI-772 Parco delle Groane, Milano, 



Galerina marginata AY228347 LSP-MI-457 Pergine, Trento, Trentino, Italy G. Gentili 1994 molecular & standard 


Boletus calopus DQ679806 LSP-MI-106 Valtellina, Sondrio, Lombardia, Italy G. Gentili 1996 standard taxonomic keys 

Gyromitra esculenta AJ544209 LSP-MI-CS18 Sommalombardo, Varese, Lombardia, Gr. Micologico Agrate 2006 standard taxonomic keys 

Italy 

Brianza 

Morchella esculenta EU600241 LSP-MI-750 Ballabio, Lecco, Lombardia, Italy G. Gentili 2006 standard taxonomic keys 

ND: Not done. 

LSP-MI & LSP-MI-CS: Collection deposited in the herbarium of the ‘‘Laboratorio di Sanità Pubblica’’, of Milano, Italy. 

for rapid, sensitive and specific identification of four 

mushroom species that frequently are recorded as 

being responsible for poisonings in northern Italy. 

MATERIALS AND METHODS 

DNA extraction.—Forty mushroom samples from 31 species 

of Basidiomycetes have been collected in northern Italy 

1993–2008 from 23 locations (TABLE I). All samples were 

identified morphologically with standard taxonomic keys 

(Moser 1993, Mazza 1995, Bon 1988) then subjected to 

rapid drying (in a food dehydrator). Ten milligrams of each 

sample were used for DNA extraction. Samples were put in 

cryotubes and left 10 min in liquid nitrogen, then disrupted 

by rapid vibration in Ribolyser (Hybaid, Middlesex, UK) 

with two sizes of microbeads (1 mm and 100 mm polystyrene 

beads). DNA was extracted with DNeasy Plant Mini Kit 

(QIAGEN, Hilden, Germany) according to manufacturer 

instructions. DNA was stored at 220 C for molecular 

analyses. The above protocol for DNA extraction also was 

used on 30 samples of gastric aspirates and on 10 samples of 

cooked mushrooms collected by the Laboratorio di Sanità 

Pubblica of Milano. Morphological identification on these 

clinical and cooked samples was possible only in a few cases. 

(See TABLE I for a description all examined samples.) 

Primer design and PCR.—DNA quality was tested for each 

sample via spectrophotometer (NanoDrop ND 1000, 

Thermo Fisher Scientific, Wilmington, Delaware) and with 

two PCR protocols that amplify respectively the internal 

transcribed spacer 1 and 2 (ITS1-ITS2) fragments from all 

Basidiomycetes species (Withe et al. 1990, Palapala et al. 

2002). The ITS regions are highly conserved within most 

species but are variable among species and thus are useful 

in taxonomy and for sensitive and selective species 

identification (Turenne et al. 2000). 

Four primer pairs (TABLE II) were manually designed 

based on an alignment of ITS1-5S rDNA-ITS2 gene sequences 

from 40 species of Basidiomycetes (Bao et al. 2005, Schmidt et 

al. 2000), generated with Clustal X 2.0 (Larkin et al. 2007). 

These primer pairs were designed on ITS1 or ITS2 (see 

TABLE II) to be species specific for each of the following: A. 

phalloides, L. cristata, L. brunneoincarnata and I. asterospora. 

Primer specificity then was checked by BLAST analyses. 

Each primer pair was tested for PCR specificity with DNA 

from each of the 40 mushroom species with the same 

amplification conditions: 18 mL buffer (10 mM Tris-HCl 

[pH 8.3], 50 mM KCl, 1.5 mM MgCl 2) with 0.2 mM each 

deoxynucleoside triphosphate, 1 mM each primer, 0.5 U Taq 

Polymerase (Euroclone) and 2 mL DNA extraction obtained 

as above. The thermal profile was 2 min at 90 C; 35 cycles of 

95 C for 40 s, 57 C for 40 s and 72 C for 40 s; the elongation 

was completed with 10 min at 72 C. 

PCR products were gel-purified with the QIAquick TM Gel 

Extraction Kit (QIAGEN) according to manufacturer 

protocols, resuspended in 30 mL deionized water and 

sequenced with PCR primers with the ABI PRISM BigDye 

Terminator Cycle Sequencing Reaction Kit 3.1 (Applera 

Europe, Warrington, UK) and run on an automated 

sequencer (ABI Prism 310 DNA sequencer, Applied

TABLE II. Primers used in this study and PCR product lengths 

Biosystems, Foster City, California). ITS sequences were 

subjected to BLAST analysis (http://www.ncbi.nlm.nih. 

gov/blast) and compared to the sequences available in the 

databases to confirm species identification. 

The four novel primer pairs were used for Sybr green real 

time PCR. Serial dilutions corresponding to the DNA 

extracted from 0.1 mg to 32 ng dried mushrooms were 

prepared for each of the four target species, A. phalloides, L. 

cristata, L. brunneoincarnata and I. asterospora. These 

dilutions were used to test the sensitivity and the efficiency 

of the four protocols in triplicate. The four thermal profiles 

were identical: 95 C for 2 min, 35 cycles at 95 C for 15 s and 

at 57 C for 30 s, and melt curve 55–95 C with increments of 

0.5 C per cycle. All reactions were performed in 25 mL, with 

600 nM of each primer, 12.5 mL iQ-SybrGreen Supermix 

and 1 mL DNA extraction. All dilutions also were tested in 

conventional PCR for a sensitivity comparison. 

Subsequently all extracted DNA (TABLE III) were analyzed 

on real time PCR with the primers targeted to the 

species present in the sample. Reconstruction of possible 

poisoning conditions was attempted by mixing gastric 

aspirates without mushroom spores with known quantities 

of dried mushrooms and incubating them for two different 

time spans (i.e. 12 h and 24 h) at 36 C. PCR protocols also 

were tested on different samples of food containing 

poisonous mushrooms obtained from the Laboratorio di 

Sanità Pubblica of Milano (Italy). 

RESULTS 

A total of 70 DNA samples were obtained, 40 from 31 

species of both poisonous and edible fungi (TABLE I) 

and 30 from clinical samples. All samples were 

analyzed for DNA quantity and quality with a 

spectrophotometer. All samples exhibited a DNA 

concentration above 20 ng/mL and 260/280 ratio 

1.7–2.1 and thus were considered suitable for 

subsequent analyses. All samples were positive in 

PCR for Basidiomycetes ITS, with the exception of the 

DNA samples obtained from gastric aspirates without 

mushrooms, used as negative controls. 


Primers Sequence (59–39) PCR product Amplified gene Reference 

ITS-Aph-F CTGTCTGCTTTTTTGATAGGTA 158 bp ITS2 This study 

ITS-Aph-R CAGAGAGAAGTGATATTGCTC This study 

ITS-Lcr-F TGACTCCTCGAACGGCTT 106 bp ITS1 This study 

ITS-Lcr-R TGGAAAAGACATAGACCTAG This study 

ITS-Lbr-F CATGCTGGCTTTGTAAGG 125 bp ITS2 This study 

ITS-Lbr-R ATTATCACACCGGCAACTGA This study 

ITS-Ias-F ATATGATGTGGCTTTTGGATGATG 94 bp ITS2 This study 

ITS-Ias-R AGTAGCCCCTCAGATACCA This study 

ITS1 TCCGTAGGTGAACCTGCGG Variable ITS1 Withe et al. 1990 

ITS2 GCTGCGTTCTTCATCGATGC Withe et al. 1990 

ITS3 GCATCGATGAAGAACGCAGC Variable ITS2 Withe et al. 1990 

ITS4 TCCTCCGCTTATTGATATGC Withe et al. 1990 

All these samples were used to test the specificity 

and sensitivity of each of the primers pairs designed 

for real time PCR. All protocols were specific (i.e. the 

amplification was obtained only when DNA from the 

target species was present), with no aspecific amplification 

observed on agarose gel or in real time PCR. 

The amplified fragments were sequenced, and the 

sequences matched those deposited in databanks for 

each of the four species. 

The maximum sensitivity and the efficiency for the 

four real time PCR protocols are indicated (respectively 

in TABLE III and FIG. 1). Conventional PCR 

amplification of mushroom DNA in serial dilution 

also was performed on all samples with the same 

primers pairs and thermal profile as for the real time 

PCR. Conventional PCR exhibited sensitivity 10–100 

times lower than real time PCR (data not shown). 

Fragmented dried mushrooms were added to 

aliquots of gastric juice to simulate the samples that 

typically are obtained from poisoned patients. These 

samples were subjected to DNA extraction and real 

time PCR to evaluate the sensitivity of the protocols 

under conditions similar to those encountered in 

diagnoses. Real time PCR amplification of the 

samples treated with gastric juice showed Ct (cycle 

threshold) values that were actually slightly higher 

than those obtained from samples not treated with 

gastric juice (a portion of the results are shown in 

TABLE III). For example the DNA sample extracted 

from 10 mL aspirate with addition of 1 mg dried A. 

phalloides kept 24 h at 36 C presents a mean Ct value 

of 20.45, which is close to the 19.53 Ct obtained from 

4 mg dried mushroom. 

DISCUSSION 

Mushrooms from species A. phalloides, L. cristata, L. 

brunneoincarnata and I. asterospora can be identified 

mistakenly as edible by the collector, thus possibly

752 MYCOLOGIA 

TABLE III. Samples examined by real time PCR and main results of the study 

Target species Samples Starting material Mean cycle-threshold Standard deviation 

A. phalloides A. phalloides dried mushroom 0.1 mg 12.72 0.07 

A. phalloides A. phalloides dried mushroom 32 ng 31.00 0.15 

A. phalloides 10 mL Aspirate with addition of 5 mg dried mushroom 0.05 mg 17.58 0.51 

A. phalloides Aspirate without addition of mushrooms 0 mg N/A N/A 

A. phalloides 10 mL Aspirate with addition 10 mg dried mushroom Sample 1 0.1 mg 12.87 0.18 





A. phalloides 10 mL Aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 17.89 0.11 

A. phalloides 10 mL Aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 20.45 0.20 

A. phalloides 10 mL aspirate at 36 C 12 h without mushroom 0 mg N/A N/A 

A. phalloides Mixed cooked mushrooms sample 1 0.2 mg 18.50 0.11 



A. phalloides Pasta with mushrooms 0.2 mg 17.04 0.11 

L. cristata L. cristata dried mushrooms 0.1 mg 17.96 0.062 

L. cristata L. cristata dried mushrooms 32 ng 29.80 0.158 

L. cristata 10 mL aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 24.57 0.09 

L. cristata 10 mL aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 25.79 0.41 

L. cristata 10 mL aspirate at 36 C 12 h without mushroom 0 mg N/A N/A 

L. cristata Mixed cooked mushrooms 0.2 mg 26.71 0.19 

L. cristata Pasta with mushrooms 0.2 mg 27.06 0.50 

L. brunneoincarnata L. brunneoincarnata dried mushroom 0.1 mg 14.73 0.03 

L. brunneoincarnata L. brunneoincarnata dried mushroom 32 ng 27.57 0.08 

L. brunneoincarnata 10 mL aspirate with addition 5 mg dried mushroom Sample 1 0.05 mg 24.91 0.12 

L. brunneoincarnata 10 mL aspirate with addition 5 mg dried mushroom Sample 2 0.05 mg 25.24 0.05 

L. brunneoincarnata 10 mL aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 25.17 0.11 

L. brunneoincarnata 10 mL aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 26.72 0.12 

L. brunneoincarnata 10 mL aspirate at 36 C 12 h without mushroom 0 mg N/A N/A 

L. brunneoincarnata Mixed cooked mushrooms 0.2 mg 26.05 0.35 

I. asterospora I. asterospora dried mushroom 0.1 mg 12.39 0.095 

I. asterospora I. asterospora dried mushroom 32 ng 25.03 0.03 

I. asterospora 10 mL aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 19.02 0.26 

I. asterospora 10 mL aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 22.06 0.02 

I. asterospora 10 mL aspirate at 36 C 12 h without mushroom 0 mg N/A N/A 

I. asterospora 10 mL aspirate with 5 mg dried mushroom 0.05 mg 24.98 0.07 

I. asterospora Pasta with mushrooms 0.2 mg 15.20 0.01

causing poisonings. In cases of suspected mushroom 

poisoning species identification based on morphologic 

characters is often difficult; the morphology of 

the mushrooms, particularly of the spores, may be 

distorted by handling and cooking, and a mycologist 

might be unable to identify the species. Examination 

of fungal spores in the gastric contents also may be 

inconclusive. If poisoning by A. phalloides-type mushrooms 

is suspected, gastric contents, mushroom 

samples and residuals of food if available must be 

assayed to verify the presence of mushrooms or 

spores. The development of methods for the identification 

of poisonous mushrooms thus is important. 

Maeta et al. (2008) present such a methodology for 

four poisonous species common in Japan. 

As for the four mushroom species for which we 

developed the real time PCR, a molecular method for 

detection so far has been published only for A. 

phalloides (Kotlowski et al. 2000). This method was 

based on a conventional PCR. It must be emphasized 


FIG. 1. Serial dilution of each dried mushroom species. Amanita phalloides. A. Efficiency of the reaction: 101.1%.B.Inocybe 

asterospora. Efficiency of the reaction: 93.3%.C.Lepiota cristata. Efficiency of the reaction: 98.7%.D.Lepiota brunneoincarnata. 

Efficiency of the reaction: 98.6%. 

that the detection of a specific fungus requires a few 

hours with conventional PCR, while real time PCR 

requires only 1 h or less depending on the apparatus. 

In addition Kotlowski et al. did not present an 

application to clinical samples. 

Here we present a real time PCR protocol for the 

detection of four medically important poisonous 

mushroom species. All protocols were highly specific 

for the target species and sufficiently sensitive to 

detect up to 32 ng dried mushroom. Furthermore, as 

demonstrated by Maeta et al. (2008), fungal DNA is 

detectable in various cooked preparations. We focused 

on samples that are particularly difficult for 

morphological identification, such as pasta with 

mushrooms (TABLE III), where the action of starch 

on the spores makes morphological details indistinguishable 

while the DNA is expected to remain in 

sufficiently good condition. 

The real time PCR amplification of the samples of 

the four species of mushrooms treated with gastric

754 MYCOLOGIA 

juice showed higher Ct values than untreated ones. 

For example the DNA sample extracted from 10 mL 

aspirate with addition of 1 mg dried A. phalloides kept 

24 h at 36 C (starting material 10 mg) presents a mean 

Ct value of 20.45 while the sample not treated with 

the gastric aspirate containing a similar starting 

quantity of mushroom (4 mg) had a Ct of 19.53 (data 

not shown). In any case the protocols also exhibited 

high specificity and sensitivity on the samples treated 

with gastric juice. The fact that the Ct values from 

these samples were not too divergent from the ones 

generated from dried specimens suggests that treatment 

with gastric juice lead only to a moderate 

degradation of the mushroom DNA. 

It must be emphasized however that some treatments 

can influence different samples in different 

ways and the result might not always be predictable. 

For example for I. asterospora the DNA sample 

obtained from 10 mL aspirate with addition of 1 mg 

dried mushroom for 24 h at 36 C shows a lower Ct 

value than the sample obtained from 10 mL aspirate 

with 5 mg dried mushroom while in the case of A. 

phalloides the DNA sample obtained from 10 mL 

aspirate with 5 mg dried mushroom shows a lower Ct. 

A possible explanation is a difference between the 

starting samples, which could contain DNA-degrading 

substances or PCR inhibitors, as well as a difference in 

the gastric aspirates collected from different patients 

and thus likely varying in pH, enzyme content, etc. 

In conclusion the real time PCR protocol presented 

here exhibits a number of features that make it a 

useful diagnostic tool. It is specific, sensitive, quick, 

relatively cheap and can function with samples that 

are difficult to identify morphologically. Future 

developments of this technique could include novel 

primers for other poisonous mushroom species and 

the implementation of a multiplex real time PCR 

protocol to test in a single analysis a clinical sample 

for the presence of different fungal DNA. 

ACKNOWLEDGMENTS 

The authors thank Dr Massimo Pajoro for help in DNA 

extraction procedures and Gruppo Micologico ‘‘Ercole 

Cantù’’ Agrate Brianza for mushroom samples. The authors 

also thank the two anonymous reviewers for useful 

comments and suggestions. 

LITERATURE CITED 

Assisi F, Balestreri S, Galli R. 2008. Funghi velenosi. Italy: 

Dalla Natura. 368 p. 

Bao DP, Aimi T, Kitamoto Y. 2005. Cladistic relationships 

among the Pleurotus ostreatus complex, the Pleurotus 

pulmonarius complex, and Pleurotus eryngii based on 

the mitochondrial small subunit ribosomal DNA 

sequence analysis. J Wood Sci 51:77–82. 

Barbato MP. 1993. Poisoning from accidental ingestion of 

mushrooms. Med J Aust. 158:842–847. 

Bon M. 1988. Champignons d’Europe occidentale. France: 

Arthaud. 184 p. 

Hall AH, Spoerke DG, Rumack BH. 1987. Mushroom 

poisoning: identification, diagnosis and treatment. 

Pediatr Rev 8:291–298. 

Karlson-Stiber C, Persson H. 2003. Cytotoxic fungi—an 

overview. Toxicon 15:339–349. 

Kotlowski R, Myjak P, Kur J. 2000. Specific detection of 

Amanita phalloides mycelium and spores by PCR 

amplification of the gpd (glyceraldehyde-3-phosphate 

dehydrogenase) gene fragment. J Food Biochem 24: 

201–212. 

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan 

PA, McWilliam H, Valentin F, Wallace IM, Wilm A, 

Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. 

Nov Clustal W and Clustal X version 2.0. Bioinformatics 

1:2947–2948. 

Lurie Y, Wasser SP, Taha M, Shehade H, Nijim J, Hoffmann 

Y, Basis F, Vardi M, Lavon O, Suaed S, Bisharat B, 

Bentur Y. 2009. Mushroom poisoning from species of 

genus Inocybe (fiber head mushroom): a case series 

with exact species identification. Clin Toxicol 47:562– 

565. 

Maeta K, Ochi T, Tokimoto K, Shimomura N, Maekawa N, 

Kawaguchi N, Nakaya M, Kitamoto Y, Aimi T. 2008. 

Rapid species identification of cooked poisonous 

mushrooms by using real time PCR. Appl Environ 

Microbiol 74:3306–3309. 

McPartland JM, Vilgalys RJ, Cubeta MA. 1997. Mushroom 

poisoning. Am Fam Physician 55:1797–1800, 1805– 

1809, 1811–1812. 

Mazza R. 1995. I funghi—Guida al riconoscimento. Italy: 

Manuali Sonzogno. 164 p. 

Moser M. 1993. Guida alla determinazione dei funghi. 

Vol. 1. Polyporales, Boletales, Agaricales, Russulales 

Italy: Saturnia. 565 p. 

Palapala VA, Aimi T, Inatomi S, Morinaga T. 2002. ITS-PCR- 

RFLP method for the distinguishing commercial 

cultivars of edible mushroom, Flammulina velutipes. J 

Food Sci 67:2486–2490. 

Roux X, Labadie P, Morand C, Fontaine B, Coutant G. 

2008. Mushroom poisoning by brunneoincarnata: 

about two cases. Ann Fr Anesth Reanim 27:450–452. 

Schmidt O, Moreth U. 2000. Species-specific PCR primers 

in the rDNA-ITS region as a diagnostic tool for Serpula 

lacrymans. Mycol Res 104:69–72. 

Turenne CY, Sanche SE, Hoban DJ, Karlowsky JA, Kabani 

AM. 2000. Rapid identification of fungi by using the 

ITS2 genetic region and an automated fluorescent 

capillary electrophoresis system. J Clin Microbiol 38: 

944. 

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and 

direct sequencing of fungal ribosomal RNA genes for 

phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, 

White TJ, eds. PCR protocols: a guide to methods and 

applications. New York: Academic Press. p 315–322.

Molecular detection of poisonous mushrooms in ... - Mycologia

Create successful ePaper yourself

Delete template?

Save as template?