Identification of fungal endophytes from Orchidaceae members ...

International Research Journal of Biotechnology (ISSN: 2141-5153) Vol. 2(6) pp. 139-144, June, 2011
Available online http://www.interesjournals.org/IRJOB
Copyright © 2011 International Research Journals
Full Length Research Paper
Identification of fungal endophytes from Orchidaceae
members based on nrITS (Internal Transcribed Spacer)
region.
J. Kasmir 1 , S.R.Senthilkumar 2 , S.John Britto 1 , and L. Joelri Michael Raj 2 .
1 The Rapinat Herbarium and Center for Molecular Systematics, St. Joseph’s College(Autonomous), Tiruchirappalli – 620
002, India.
2 Department of Botany, St. Joseph’s College(Autonomous)
Tiruchirappalli – 620 002, India.
Accepted 19 July, 2011
Endophytes, are now considered as an important source of bioactive natural products, because they
occupy unique biological niches as they grow in so many unusual environments. Endophytes colonizing
photosynthetic orchids are recently studied. The present study of fungal identification based on ITS
sequences have precisely identified two important fungi belonging to trichomaceae members
Aspergillus terreus (SJCFBKe01, SJCFBKe02 and RHTFGDe03) and Penicillium aculeatum (RHTFDNe01)
based on occurring as endophytes in orchid roots.
Keywords: Fungal endophytes, Orchidaceae, ITS, NCBI, Blast.
INTRODUCTION
Endophytic fungi are one of the most unexplored and
diverse group of organisms that form symbiotic
associations with higher life forms and may produce
beneficial effects for the host (Weber, 1981; Shiomi et
al., 2006). Fungi have been widely investigated as a
source of bioactive compounds. An excellent example of
this is the anticancer drug, taxol, which had been
previously supposed to occur only in the plants (Strobel
and Daisy, 2003). Endophytic organisms have received
considerable attention after they were found to protect
their host against insect pests, pathogens and even
domestic herbivorous (Weber, 1981). However only a few
plants have been studied for their endophyte biodiversity
and their potential to produce bioactive compounds.
Recently studies have been carried out about the
endophytic biodiversity, taxonomy, reproduction, host
ecology and their effect on host (Petrini, 1986; Arnold et
al., 2001; Clay and Schardl, 2002; Selosse and Schardl,
2007). Endophytes, are now considered as an
outstanding source of bioactive natural products,
because they occupy unique biological niches as they
*Corresponding author Email: senkumar68@gmail.com
grow in so many unusual environments (Strobel and
Daisy, 2003; Strobel et al., 2004). Endophytic fungi from
medicinal plants can therefore be used for the
development of drugs. The endophytic flora, both
numbers and types, differ in their host and depends on
host geographical position (Gange et al., 2007; Arnold
and Herre, 2003). Endophytic fungi that live inside the
tissues of living plants are under-explored group of
microorganisms. Dreyfuss and Chapela (1994) estimated
that there may be at least one million species of
endophytic fungi alone. Recently they have received
considerable attention after they were found to protect
their host against insect pests, pathogens and even
domestic herbivores (Weber, 1981; Shiomi et al., 2006;
Malinowski and Belesky, 2006). Almost all the plant
species harbour one or more endophytic organisms (Tan
and Zou, 2001). To date, only a few plants have been
extensively investigated for their endophytic biodiversity
Endophytic fungi generally live peacefully within their
host, while these fungi under different conditions may act
as facultative pathogen. One of the important roles of
endophytic fungi is to initiate the biological degradation of
dead or dying host-plant, which is necessary for nutrient
recycling (Strobel, 2002). Orchids are plants that are
highly screened for fungal endophytes. The fungi that

140 Int. Res. J. Biotechnol.
colonise the roots of the family Orchidaceae can
essentially be categorised into two main groups. The fully
photosynthetic orchid species appear to rely on fungi for
seed germination and early (and sometimes adult) growth
(e.g. Bougoure et al., 2005; Perkins et al 1995; Warcup
1981; Zelmer et al 1996). The non-photosynthetic orchids
are typically colonised by fungi that supply carbon from
living tree roots to orchids (Taylor and Bruns, 1997;
Bougoure and Dearnaley, 2005; Cha and Igarishi, 1996;
Dearnaley and Le Brocque 2006; Girlanda et al 2006;
Hamada and Nakamura 1963; Taylor and Bruns 1997,
1999). Molecular analysis provides authenticated
information in identification of the colonizing fungi. So the
present study aims with identification of fungi occurring
as endophytes in the roots of some Orchidaceae
members using Internal Transcribed Spacer sequences
(ITS).
MATERIALS AND METHODS
Location and study area
Plant materials were collected from Kolli hills, a part of
Eastern Ghats, S.India is a rich biodiversity hotspot of
representing a great aesthetic treasure as well as a grand
repository of biological wealth. Samples were collected
during February- March 2010 at an altitude of 80 – 869 m
above Mean Sea Level (MSL). The mean temperature
during the study period was 21±2 ° C. The plant species
chosen for the present study were Bulbophyllum
kaitiense Reichebt. Gastrochilus acaulis (Lindley) Kuntze
Dendrobium nanum Hook.f and Geodorum densiflorum
(Lam). Schltr. All the four species are photosynthetic
orchids.
Collection of plant parts
Two plants of each species were selected and 8 root
samples from each plant were randomly cut off with an
ethanol-disinfected sickle and placed separately in sterile
polythene bags to avoid moisture loss. The materials
were transported to laboratory within 12h and stored at
4 0 C until isolation procedures were completed.
Isolation of endophytic fungi
The collected samples were washed thoroughly with
sterile distilled water and air dried before they are
processed. The roots were then surface sterilized by
immersing them sequentially in 70% ethanol for 3min and
0.5% NaCl2 for 1min and rinsed thoroughly with sterile
distilled water. The excess water was dried under laminar
airflow chamber. Then, with a sterile scalpel, outer
tissues were removed and the inner tissues of 0.5cm size
were carefully dissected and placed on petri-plates
containing Potato Dextrose Agar(PDA). The media were
supplemented with streptomycin sulphate (100mg/L) to
suppress bacterial growth. The plates were then
incubated at 25±2 ° C until fungal growth appeared. The
plant segments were observed daily for fungal growth.
Hyphal tips emerging from the plated root segments were
immediately transferred into PDA slant and maintained at
4 ° C. The fungal isolates were identified based on their
morphological and reproductive characters using
standard identification manuals (Barnett and Hunter,
1972; Subramanian, 1971). All the isolates are
maintained on PDA slant in The Department of Rapinat
herbarium and centre for molecular systematics, St.
Joseph’s College, Tiruchirappalli, India. The fungal
mycelia portions were stained with Lactoglycerol cotton
blue and photographed under NIKON E600 Flouroscent
Microscope (Tokyo, Japan). All the microscopic
observations were compared with descriptions provided
in the BioloMICS Software (Robert and Szoke, 2006).
Fungal cultivation
The fungal endophytes were cultivated on Czapex Dox
Broth M076(Himedia) by placing agar blocks of actively
growing pure culture (3mm in diameter) in 250ml
Erlenmeyer flasks containing 100ml of the medium. The
flasks were incubated at 25±1 ° C for 3 weeks with
periodical shaking at 70 rpm. After the incubation period,
only the cultures actively growing in Czapex Dox Broth
were taken out and filtered through sterile cheesecloth to
remove the mycelia mats.
DNA isolation, PCR amplification and sequencing
DNA was extracted from these mycelia mats using Ultra
pure genomic DNA preparation Kit (Genei, Bangalore).
The fungal ITS region of each sample was amplified in 50
µl reaction volumes, each containing 36 µl sterile distilled
H20, 5 µl 10X buffer (50 mM KCl, 10 mM Tris-HC1, 0.1%
Triton X-100), 2.5 µl 50 mM MgC12, 1 µl 10 mM dNTP, 1
µl of each of the fungal specific ITS 1 and ITS4 (White et
al. 1990), 1.5 µl of Taq DNA polymerase (Chromous
Biotech Bangalore) and 2 µl of extracted genomic DNA.
The PCR mixture underwent initial denaturation at 94 º C
for 5 min, 35 cycles of 1 min at 94°C, 1 min at 50°C, and
2 min at 72°C and final extension at 72 º C for 10 min.
Direct DNA sequencing was performed using primers ITS
1 and ITS 4 (White et al., 1990) on an ABI 3100
automated sequencer following the manufacturer’s
instructions (Applied Biosystems, Inc.) at Chromous
Biotech, Bangalore.
DNA sequence assembly and alignment
Sequence similarity searches were performed for each of
the 4 representative fungal sequences against the non-

Table 1. Closest two matches from BLAST searches of fungal ITS sequences amplified from the two different colonies found in the four orchid species.
Orchid
name
Bulbophyllu
m kaitiense
Gastrochilus
acaulis
Dendrobium
nanum
Geodorum
densiflorum
Colonising fungal
species as
identified under
microscope
Aspergillus sp
Trichomaceae
Aspergillus sp
Trichomaceae
Penicillium sp
Trichomaceae
Aspergillus sp
Trichomaceae
redundant database maintained by the National
Center for Biotechnology Information using the
BLAST algorithm (http://www.ncbi.nlm.nih.gov).
GenBank accession numbers of the
representative endophytic fungal sequences from
this study and their top two BLAST match
sequences are given in Table 1. The ITS1-5.8S-
ITS2 sequences of endophytic fungal isolates
were aligned with the sequences of selected
reference taxa in the Database(s) UNITE + INSD
(= GenBank, EMBL, DDBJ) + Envir and
consensus tree was obtained for identifying
closely related accessions (i, j, k, l figure -1). After
precise identification, the sequences were
submitted at NCBI database and genbank
accession numbers were obtained ( Table - 1).
The closely related species were aligned using
CLUSTAL W (1.83) to identify the variations in the
sequences ( Figure - 2).
Isolate GenBank
accession
code
Closest species match and Accession
code
Query
length (%)
SJCFBKe01 GU564260 Aspergillus terreus GU564261 96 99
Aspergillus tubingensis HM753602 96 99
SJCFGAe02 GU564261 Aspergillus terreus strain 6 HM016906 97 99
Aspergillus terreus FR837967 97 99
RHTFDNe01 GU564262 Penicillium aculeatum AY303608 97 99
Penicillium sp. EN13 HQ343437 97 97
RHTFGDe03 GU564263 Aspergillus terreus HQ449678 97 99
Aspergillus terreus GU564261 97 99
RESULTS AND DISCUSSION
Microscopic identification
Only brown and white colonies that were able to
grow rapidly in Czapex Dox Broth were taken for
further microscopic analysis. In this way the fungal
colonies were initially screened from other fungal
members. On Czapek dox broth, colonies were
typically suede-like and cinnamon-buff, white to
sand brown in color. The spore character
indicated them as motosporic trichomaceae
members. Conidial heads were compact,
columnar and biseriate. Conidiophores were
hyaline and smooth-walled. Conidia were globose
to ellipsoidal hyaline and smooth-walled. (figure -1
e,f,g,h). Isolates SJCFBKe01, SJCFBKe02 and
RHTFGDe03 were assumed to be Aspergillus sp.
but not Aspergillus niger since it had dirty brown
powdery colonies whereas A.niger is
characterized by black colonies (Pitt, 1979).
These three isolates were discriminated from
Kasmir et al. 141
Sequence
Identity
(%)
isolate RHTFDNe01 by having flask shaped
(ampulliform with constriction) phialides (figure -1
e,f,g,h). Isolate RHTFDNe01 was suspected to be
Penicillium sp. due to presence of white creamy
colonies (figure - 1, c) acerose (lanceolate,
without constriction) phialides (figure -1 g) ( Raper
and Fenell, 1965). However they could not be
precisely identified at species level.
Sequence based identification
Though microscopic identification clearly
segregated these fungal isolates at family level as
Trichomaceae members, the sequence based
identification was precise in identifying them as
Aspergillus terreus and Penicillium aculeatum.
The BLAST searches showing 99% similarity level
shows the closest match with these two fungal
species (Table -1). The phylogenetic tree on
Fungal ITS database UNITE paired them with
specific species (Figure -1 i,j,k,l). The common
fungus colonizing Bulbophyllum kaitiense,

142 Int. Res. J. Biotechnol.
Figure - 1 a,b,c,d - Fungal endophytes cultured on PDA. e,f,g,h - fungal cultures observed after Lactophenol cotton
Blue staining under Flouroscent Microscope Nikon 100x; i,j.k.l - CONSENSUS TREE for identifying closely related
accessions Database(s) used: UNITE + INSD ( = GenBank, EMBL, DDBJ) + Envir. The numbers on the branches
indicate the number of times the partition of the species into the two sets which are separated by that branch occurred
among the trees, out of 5.00 trees
query GATAAGACGCAGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTC
GU564260-1 ----------AGTCTTTATGGCCCA-CCTCCCACCCGTGACTATTGTACCTTGTTGCTTC
GU564261-1 GATAAGACGCAGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTC
GU564263-1 ------------TCTTTATGGCC-AACCTCCCACCCGTGACTATTGTACCTTGTTGCTTC
*********** * **********************************
query GGCGGGCCCGCCAGCGTT-GCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCG
GU564260-1 GGCGGGCCCGCCAGCGTTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCG
GU564261-1 GGCGGGCCCGCCAGCGTT-GCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCG
GU564263-1 GGCGGGCCCGCCAGCGTT-GCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCG
****************** *****************************************
Figure 2. Multiple Sequence Alignment using CLUSTAL W (1.83) showing variations between the three closely related
Aspergillus sp.
Gastrochilus acaulis, Geodorum densiflorum was A.
terreus and one peculiar isolate identified to colonise
Dendrobium nanum was P. aculeatum. The Multiple
Sequence Alignment (MSA) using CLUSTAL W was
possible for three isolates SJCFBKe01, SJCFBKe02 and
RHTFGDe03 that were identified to be A.terreus. MSA
also showed few variations (insertions and deletions) in
the first 150 bp of the ITS sequences. But these were not
enough to segregate these three isolates SJCFBKe01,
SJCFBKe02 and RHTFGDe03 as three different species.
Thus the variations occurring between the same species
isolated from three different orchid species were
screened. Whereas P. aculeatum (RHTFDNe01) stood
far away from these three isolates in the NCBI BLAST
tree obtained using fast minimum evolution method
(figure -3). This shows the discriminatory power of ITS
sequences in identifying endophytic fungus. The
photosynthetic orchids depending on some

Kasmir et al. 143
Figure 3. NCBI BLAST tree based on Fast Minimum Evolution method clearly segregating Penicillium aculeatum
(RHTFDNe01) from other three isolates shaded in yellow color.
heterobasidiomycete fungi for seed germination has been
previously studied (Bougoure et al., 2005; Perkins et al
1995; Warcup 1981; Zelmer et al 1996). The present
study has reported new instance of occurrence of some
ascomycete fungi in orchid roots. Though A. terreus is a
cosmopolitan fungus P. aculeatum is an organism much
exploited for a new class of antibiotic called Penitricin
(Okuda, 1984). The Isolate RHTFDNe01 identified as P.
aculeatum was identified to be an economically important
species. The further close identity with P. aculeatum
could be confirmed based on 28S rDNA sequences. Thus
molecular identification had been useful in precisely
screening fungal endophytes than relying on
microscopical featutes alone.
CONCLUSION
The research on endophytic association is rapidly
changing and serves as plant defensive mechanism
against plant diseases including stress tolerant
conditions. Need more strategies for endophytic
fungi is to be evaluated to utilize these fungus as
potential group of organisms for the production of such
novel secondary metabolites which could be used in the
field of agriculture and medicinal use. The result obtained
in this work will help to identify the other endophytic fungi
associated with the same species at different season
could prove the thrust in the areas of pharmaceutical and
biotechnological research.
REFERENCES
Arnold AE, Herre EA (2003). Canopy cover and leaf age affect
colonization by tropical fungal endophytes: Ecological pattern and
process in Theobroma cacao (Malvaceae). Mycologia, 95(3): 388-
398.
Arnold AE, Z Maynard, Gilbert GS (2001). Fungal endophytes in
dicotyledonous neotropical trees: patterns of abundance and
diversity. Mycol. Res. 105: 1502-1507.
Barnett HL, Hunter B (1972). Illustrated genera of Imperfect fungi.
Burgers Company, Minneapolis.
Bougoure JJ, Bougoure DS, Cairney JWG, Dearnaley JDW (2005).
ITS-RFLP and sequence analysis of endophytes from Acianthus,
Caladenia and Pterostylis (Orchidaceae) in south eastern Queensland,
Australia. Mycol. Res. 109: 452-460.

144 Int. Res. J. Biotechnol.
Bougoure JJ, Dearnaley JDW (2005). The fungal endophytes of
Dipodium variegatum (Orchidaceae). Aus. Mycol. 24: 15-19.
Cha JY, Igarashi T (1996). Armillari jezoensis, a new symbiont of
Galeola septentrionalis (Orchidaceae) in Hokkaido. Mycoscience 37:
21-24.
Clay KC, Schardl (2002). Evolution origins and ecological
consequences of endophyte symbiosis with grasses. American
Naturalist, 160: 99-127.
Dearnaley JDW , Le Brocque AB (2006). Molecular identification of the
primary root fungal endophyte of Dipodium hamiltonianum (Yellow
hyacinth orchid). Aus. J. of Bot. 54: 487-491.
Dreyfuss M, Chapela IH (1994). Potential of fungi in the discovery of
novel, low-molecular weight pharmaceuticals. In: The discovery of
natural products with therapeutic potential. (Ed.): V. P. Gullo. Butter-
worth-Heinemann, London, United Kingdom. p. 49-80.
Gange ACS, Dey AF, Currie, BVC Sutton (2007). Site- and speciesspecies
differences in endophyte occurrence in two herbaceous
plants. J. of Ecol. 95(4): 614-622.
Girlanda M, Selosse MA, Cafasso D, Brilli F, Delfine, Fabbian, R
Ghignone, Pinelli, P Segreto, R Loreto, F Cozzolino S, Perotto S
(2006). Inefficient photosynthesis in the Mediterranean orchid
Limodorum abortivum is mirrored by specific association to
ectomycorrhizal Russulaceae. Molecular Ecology 15: 491-504.
Hamada M, Nakamura S (1963). Wurzelsymbiose von Galeola altissima
Reichb. f., Einer chlorophyllfreien Orchidee, mit dem
holzzerstorenden Pilz Hymenochaete crocicreas Berk. et Br.
Scientific Reports of Tohuku University Series IV 29: 227-238.
Malinowski DP, DP Belesky (2006). Ecological importance of
Neotyphodium sp. Grass endophytes in agroecosystems. Grassland
Science, 52(1): 23-28.
Okuda T, Yoneyama Y, Fujiwara A , Furumai T (1984). Penitricin, a new
class of antibiotic produced by Penicillium aculeatum. I. Taxonomy of
the producer strain and fermentation. J Antibiot (Tokyo). 37(7):712-
717.
Perkins AJ, Masuhara G, McGee PA (1995). Specificity of the
associations between Microtis parvifora (Orchidaceae) and its
mycorrhizal fungi. Aus. J. of Bot. 43:85-91.
Petrini O (1986). Taxonomy of endophytic fungi of aerial plant tissues.
In: Microbiology of the
phylosphere. (Ed.): N.J. Fokkema and J. Van-den Heuvel. Cambridge
University Press, Cambridge. p. 175-187.
Pitt JI (1979). The genus Penicillium and its teleomorphic states
Eupenicillium and Talaromyces.London, New York, Academic Press.
Raper KB ,Fennell DI (1965). The genus Aspergillus. Baltimore,
Williams and Wilkins.
Rep, 18: 448-459.
Robert V, Szoke S (2006). BioloMICS Software.
Selosse MA, CL Schardl (2007). Fungal endophytes of grass: hybrids
rescued by vertical specialization in the 'cheating' orchids
Corallorhiza maculata and C mertensiana. Mol. Ecol. 8:1719-1732.
Shiomi, HF, HSA Silva, IS De Melo, FV Nunes ,W Bettiol (2006).
Bioprospecting endophytic bacteria for biological control of coffee leaf
rust. Sci. Agric., 63(1): 32-39.
Strobel G, B Daisy (2003). Bioprospecting for microbial endophytes and
their natural products. Microbiol. and Molecular Biol. Review, 67: 491-
502.
Strobel G B Daisy U Castillo ,J Harper (2004). Natural Product from
endophytic microorganisms. Journal of Natural Products, 67: 257-
268.
Strobel GA (2002). Microbial gifts from rain forests. Can. J. Plant
Pathol., 24: 14-20.
Subramanian CV (1971). Hypomycetes an account of Indian species
except Cercospora. Indian Council of Agricultural Research
Publication, New Delhi.
Tan RX ,WX Zou (2001). Endophytes: a rich source of functional
metabolites. Nat. Prod. Rep 18: 448-459.
Taylor DL, Bruns TD (1997). Independent, specialized invasions of
ectomycorrhizal mutualism by two nonphotosynthetic orchids.
Proceedings of the National Academy of Sciences. 94: 4510 - 4515.
Taylor DL, Bruns,TD (1999). Population, habitat and genetic correlates
of mycorrhizal transmission? An evolutionary perspective. New
Phytol. 173(3): 452-458.
Warcup JH (1981). The mycorrhizal relationships of Australian orchids.
New Phytol. 87 : 371- 381.
Weber J (1981). A natural control of Dutch elm disease. Nature, 292:
449-451.
White TJ, Bruns T, Lee S,Taylor J (1990). Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics, in M.A.
Innis, D.H. Gelfand, JJ. Sninsky and TJ. White (eds), PCR Protocols:
a Guide to Methods and Applications, pp. 315-322, Academic
Press,San Diego, USA.
Zelmer CD, Cuthbertson L, Currah RS (1996). Fungi associated with
terrestrial orchid mycorrhizas, seeds and protocorms. Mycoscience
37: 439-448.