Genomics – A New Era for Cattle Breeding. Session - ICBF

More documents

Recommendations

Info

Microsatellites • Short repeats of DNA sequence A C A C A C A C A • Caused by mutations and subsequently passed to progeny • Used for parentage verification …GTCCGTACACACACTTATCAA…
What is a SNP? • 99.9% of human DNA is identical – most of the differences are in the form of SNPs … ACGTACGTCAATGACTTTTACGTAT… … ACGTACGACAATGACTTTTACGTAT… • Single Nucleotide Polymorphism Change
Page 1 and 2: Genomics - A New Era for Cattle Bre
Page 3 and 4: Session 1. Genomics & parentage ide
Page 5 and 6: Introduction to Animal Breeding & G
Page 7 and 8: Traditional Animal Breeding • Cal
Page 9 and 10: Using technology of today • At bi
Page 11: How do we use this DNA information?
Page 15 and 16: SNP effect on performance SNP Var M
Page 17 and 18: Indentifying Mendelian sampling ter
Page 19 and 20: Cost of sequencing has decreased Bu
Page 21 and 22: Sire …..TCACCGCTGAG….. …..CAG
Page 27 and 28: Parentage Sire 1 Sire 2 Sire 3 Sire
Page 29 and 30: Recessive genetic disorders AB AB A
Page 31 and 32: To Conclude • Differences seen be
Page 33 and 34: Genomic Advances in Parentage Verif
Page 35 and 36: U.S. Department of Agriculture, Agr
Page 37 and 38: Blood Typing >1990’s Used to dete
Page 39 and 40: Used to detect bi-allelic polymorph
Page 41 and 42: Technology Transfer via Imputation
Page 43 and 44: Impute ISAG cattle MS alleles from
Page 45 and 46: SNP haplotype to MS allele BM1824 I
Page 47 and 48: Validate Cattle with SNP and MS on
Page 49 and 50: Validate Phase, impute, check 316 S
Page 51 and 52: Validate Phase, impute, check 316 S
Page 53 and 54: Validation with DAIRY table Order:
Page 55 and 56: Microsatellite Imputation 2 nd Stud
Page 57 and 58: Initial Results 642 456 312 233 220
Page 59 and 60: Acknowledgements • BFGL (USDA-ARS
Page 61 and 62: Parentage verification Genomic sele
Page 63 and 64:
LD+ content (V1-19K) • Genomic se
Page 65 and 66:
Proportion allele concordance 1.00
Page 67 and 68:
• CVM • BLAD Lethal Recessives
Page 69 and 70:
Major genes • 14 major genes incl
Page 71 and 72:
From just 1 hair sample! Calf ID CV
Page 73 and 74:
Conclusions • Custom chip - value
Page 75 and 76:
Implementation of Genomic Services
Page 77 and 78:
What is Genotyping? • Identifying
Page 79 and 80:
Typical example of processing a Bov
Page 81 and 82:
ICBF & Teagasc Genomics Conference
Page 83 and 84:
Page 85 and 86:
Page 87 and 88:
Page 89 and 90:
Page 91 and 92:
Page 93 and 94:
Work Flow Summary • Sample assign
Page 95 and 96:
IRISH CATTLE BREEDING FEDERATION Ge
Page 97 and 98:
© Irish Cattle Breeding Federation
Page 99 and 100:
User friendly, fully integrated, tr
Page 101 and 102:
AI Company/Breed Society Order Scre
Page 103 and 104:
HerdPlus® User genotype request sc
Page 105 and 106:
Page 107 and 108:
Page 109 and 110:
Page 111 and 112:
VIEW YOUR RESULTS Genomic Evaluatio
Page 113 and 114:
Page 115 and 116:
Chip Type Number of animals genotyp
Page 117 and 118:
LIST OF BEEF BULLS WANTED Contact I
Page 119 and 120:
Page 121 and 122:
Genomics & Breeding Programs • Ge
Page 123 and 124:
Pedigree dairy registrations (2011)
Page 125 and 126:
Moving Beef to SNP’s for parentag
Page 127 and 128:
Moving beef industry to SNP’s for
Page 129 and 130:
Quantifying the Benefits. A quick s
show all

Genomics – A New Era for Cattle Breeding. Session - ICBF

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?