IVRI AR 139.pdf

Vision 

Striving for excellence in 

innovative research, human 

resource development, technology 

generation and transfer for improved 

animal owners and lovers with 

acknowledged leadership 

among the world nations. 

Mission 

Undertaking pioneering research 

in veterinary and animal sciences 

with holistic approach, promoting high 

quality education and training, 

developing systems and technologies for 

better animal health care and production 

and their transfer to end-users, 

functioning as an effective instrument 

for nutritional security, poverty 

alleviation and rural 

construction.

ITWIlliI 

Anllual Report 

2010-11 

PREFACE 

I have the honour to present the IVRI Annual 

Report for the year 2010-11 reflecting the outcome 

of our collective efforts as highly satisfying 

achievements on research, education, extension, 

technology and IP management and other 

developmental activities at this premier national 

institute of global repute in veterinary and animal 

sciences, which has a glorious history of more than 

120 years since its foundation as Imperial 

Bacteriological Laboratory (IBL). 

Serving as a national hub of the major 

interventions for livestock and poultry diseases, 

the institute is accredited for development of more 

than 80 life-saving vaccines, biologicals and 

diagnostics, which helped the nation in successful 

control and eradication of important diseases of 

livestock and poultry. Major recognitions to IVRI 

include approval of the High Security Animal 

Disease Laboratory (HSADL), Bhopal by the 

World Organisation for Animal Health (OlE) as its 

7th Reference Laboratory for highly pathogenic 

avian influenza (HP AI) diagnOSis in the world, 

ISO 9001-2000 certification of CADRAD (2004), 

and establishment of National Referral Laboratory 

for Monitoring of Drug Residues and 

Environmental Pollutants in livestock feed and 

products at Izatnagar. 

Rejuvenating its zeal for excellence in recent 

times, IVRI has won a rich haul of 8 ICAR 

National Awards including the prestigious Sardar 

Patel Outstanding ICAR Institution Award-2009 

and Rajarshi Tandon Rajbhasha Puraskar-2009. 

Presently, the institute is having 236 projects 

including 108 institute-funded research projects, 

02 International and 77 externally-funded national 

projects, 46 service projects and 03 contract 

research/consultancy projects. 

With rapid changes in the climate that are 

palpable across the globe, several diseases of 

livestock and poultry along with zoonotic and 

foodborne diseases are either emerging or reemerging; 

and their epidemiological profiles 

including vector density and behaviour as well as 

clinical presentations are changing in a strange 

manner, thereby making the diagnOSiS and control 

of these infections an increasingly challenging 

task. 

Our OIE-referrallaboratory (HSADL, Bhopal) 

handling the exotic and transboundary diseases 

like Highly Pathogenic Avian Influenza (HP AI) 

and Swine Flu (HINl), has confirmed two HP AI 

(H5Nl) outbreaks in Tripura in 2011, wherein 9 

H5Nl viruses (3 from duck and 6 from chicken) 

were isolated. Sequencing studies of 20 HP AI 

virus isolates revealed that two of the isolates were 

phylogenetically new strain of H5Nl (clade 2.3.2), 

while all other viruses from various outbreaks 

(2007-10) belonged to "Qinghai-like" clade 2.2. 

Moreover, H5Nl viruses from 2008-10 outbreaks 

of West Bengal were very close to Bangladesh and 

Bhutan isolates, indicating persistent circulation of 

these viruses in the region. The cause of concern is 

that 12 of the H5Nl virus isolates showed genetic 

evidence of resistance to the viral drugamantadine. 

It is alarming to note that an isolate of 

swine influenza has found to be a HINI subtype 

with very close homology to the HINI virus that 

caused the human HINI pandemic. Therefore, 

surveillance of avian and swine influenza viruses 

and other exotic viruses in the country need to be 

continued at increased pace. 

Economically important endemic diseases of 

livestock were promptly diagnosed and controlled 

by timely action and concerted efforts of different 

diagnostic centres of IVRI including CADRAD. 

Phylogenetic analysiS of Indian isolates of CSF 

viruses (CSFV) showed that viruses belonging to 

genotypes 1 and 2 are co-circulating in India. 

Another emerging disease Leptospirosis was 

diagnosed in different carnivorous as well as 

herbivorous species of wild animals in different 

zoos of the country. 

Notable headways made by IVRI in the area of 

development of state-of-art and newer generation 

diagnostics for rapid, reliable economical, and 

preferably, on-site detection of important livestock 

diseases include development of a diagnostic kit 

for diagnosis of Haemonchus contortus infection, 

LAMP test for detection of Pasteurella multocida, 

real time PCR (SYBR Green-based) assay for

specific diagnosis of animal rota viruses and Orf, 

TaqMan qPCR for buffalo pox, a synthetic 

pep tides-based I-ELISA for detecting BT virus 

(B1V) antibodies, a combined indirect ELISA for 

simultaneous detection of PPR and B1V 

antibodies, a multiplex RT-PCR for PPR and BT 

viruses in clinical samples as well as 

standardization of a new real time PCR assay for 

quick and confirmatory diagnosis of CSF. PPR c 

ELISA (14) and PPR s-ELISA (14) kits were 

produced and supplied. 

Production, supply and quality control of 

efficacious, safe and innovative vaccines and 

necessary biologicals for diagnosis through strong 

R&D base is the key to the successful control of 

infectious and parasitic diseases in livestock and 

poultry. In this year, a total of 6.82 million 

monovalent doses of FMD vaccine were produced 

and 3.50 million trivalent doses of FMD vaccine 

sold at Bangalore Campus. IVRI has developed 

potency estimation tools in the form of TaqMan 

qPCRs for live attenuated orf and buffalopox 

vaccines; and SYBR Green-based real time PCR for 

attenuated camel pox vaccine besides a PCR-based 

method for detection of extraneous agents in viral 

vaccines. Recent studies have revealed that 

rHaa86-based tick vaccine could be another 

strategic option for the control of both H. a. 

anatolicum and R. (B.) microplus tick infestations. 

In the fast emerging domain of herbal 

veterinary therapeutics, a repository of six 

reference tick lines was developed for testing 

herbal acaricides. Herbal extracts (NBA-13/B/2 and 

IVRI-1/F/l) were found to be effective (60-90%) 

against multi-acaricide resistant ticks novel 

therapeutic approaches developed at IVRI include 

mesenchymal stem cells and bone marrow 

nucleated cells for effective management of 

cartilage defects, full thickness skin wounds, 

fractures and non-unions. The institute is also 

catering to the need of livestock and pet owners by 

providing health coverage to the ailing animals 

through Referral Polyclinic. During the current 

year, more than 6000 cases involving medicinal, 

surgical and reproductive problems were 

successfully treated. 

In nutritional experiments aimed at reducing 

methanogenesis, the supplementation with 

condensed tannins - (1%-2% of diet) showed 

rrwmrr 


2010-11 

improved nutrient utilization with decreased 

methane emission and gastrointestinal parasitic 

load in lambs_ Two essential oils (AjO and CiLO) 

showed 18% and 27% reduction in methane 

production, and feeding of 10% mahua seed cake 

and 2% harad in the ration of buffaloes resulted in 

17.48% reduction in methane production in vivo. 

In order to develop better nutritional regimes for 

normal and diseased animals, karanj cake was 

found to be better than neem seed cake at 5% level 

in concentrate mixture for feeding lambs; 

detoxified jatropha meal could replace 

conventional protein moiety of soyabean meal in 

the concentrate up to the level of 37.5%, and 

supplementation of mahua seed cake (5% of diet) 

reduced the adverse effect of fasciolosis in 

crossbred calves. Dietary regimes were 

standardized for 25 species of wild animals in 

seven zoos after conducting the metabolic trials. 

Value addition of livestock products has resulted 

into restructured chicken meat blocks extended 

with 15% plant-based extruder blend, with 

improved functional value and reduced 

production cost. 

In the area of animal reproduction, freezability 

of Tharparkar bull semen (54%) was found better 

than that of crossbred bull semen (42%). The 

mRNA expression of IL-W and TLR-4 indicated 

their potential application for early diagnosis of 

sub clinical endometritis. Combined treatment 

with curry (Murraya koenigii) and bel (Aegle 

marmelos) leaves restored the cyclicity in 

anoestrus cattle (85.7%) and buffaloes (84.2%). 

Buffalo and caprine fetal stem cells were isolated 

and characterized from very early stage fetus, and 

the latter when differentiated, formed beating 

cardiomyocytes. 

At this reputed Deemed University imparting 

quality education to brilliant students and 

professionals, 240 students (142 MVSc and 98 PhD) 

were selected through All India Entrance 

Examination and admitted to different PG 

programmes along with 15 candidates to national 

diploma courses during 2010-11. An international 

training programme on 'Gene-based techniques 

for research in biotechnology' sponsored by TCS 

Colombo Plan and India Millennium Fund was 

organized, where in fifteen participants from Asia 

Pacific region were trained.

CONTENTS 

nwmrr 

AllIllIai Report 

2010-11 

Chapter Page No. 

1. Executive Summary 

2. Introduction 

3. Research Achievements 

4. Technologies Assessed and Transferred 

5. Education and Training 

6. Awards and Recognition 

7. Linkage and Collaboration in India and Abroad including Funded Projects 

8. List of Publications 

9. List of Research Projects 

10. Consultancy, Patents, Commercialization of Technologies 

11. Meetings of Management Committee, AC, RAC, IRC etc. with Significant Decisions 

12. Participation of Scientists in Conferences, Workshops, Symposia, etc. in India and 

Abroad 

13. Workshops, Seminars, Summer Institutes, Farmer's Day, etc. Convened at the Institute 

14. Distinguished Visitors 

15. IVRI Personnel 

16. Infrastructure Development 

17. Empowerment of Women and the Mainstreaming Gender issues 

1-14 

15-24 

25-156 

157-159 

160-164 

165-167 

168-178 

179-196 

197-212 

213-216 

217-223 

224-228 

229-230 

231-232 

233-244 

245-255 

256-258

ITWIllir 

Annual Report 

__ 2010-11

IlWIlliI 

Allllllal Report 

..... 2010-11 

1. EXECUTIVE SUMMARY 

A. ANIMAL HEALTH 

• LAMP was developed for detection of 

Pasteurella multocida. 

• Standardized PCR using primers targeting 16S 

rRNA for genus specific identification of 

thermophilic Campylobacter and multiplex PCR 

targeting the IpxA gene for species specific 

confirmation. 

• Standardized PCR for amplification of OMP 

31 of Brucella using self designed primers and 

successfully used on field isolates. 

• The IVP index indicated that the H5N1 viruses 

are highly pathogenic and the H9N2 viruses 

arc low pathogenic to chickens. 

• Sequencing of 20 H5N1 viruses was 

compleled, two samples from 2011 outbreak in 

ducks of Tripura were found to be 

phylogenetic ally new strain of H5N1 (clade 

2.3.2). All other viruses from various 

outbreaks (2007-10) belonged to "Qinghailike" 

clade 2.2. 

• H5N1 viruses from 2008-10 outbreaks of West 

Bengal were very close to Bangladesh and 

Bhutan isolates, indicating persistent 

circulation of these viruses in the region. 

• Twelve H5N1 viruses showed genetic 

evidence of amantadine resistance. 

• Nucleotide sequence analysis of 2 H1N1 

isolates revealed close relation with pandemic 

H1Nl 2009 human isolales from India, 

Canada, Argentina, Taiwan and China. 

• SYBR Green based real time PCR for specific 

diagnosis of Orf and TaqMan qPCR based on 

C18L gene for specific diagnosis of buffalo pox 

has been developed. 

• VP6 gene based real-time PCR (SYBR Green) 

assay developed for the detection of animal 

rotaviruses. A total of 120 rotavirus isolates 

from buffaloes, cattle calves and humanbeings 

have been genotyped. 

• Phylogenetic analysis of Indian isolates of 

CSFV showed that viruses belonging to 

genotypes 1 and 2 are co-circulating in India. 

• Molecular characterization of 6 infectious 

bronchitis virus isolates of different 

geographical origin RT-PCR revealed that the 

S1 gene product of IBV genome of all the 

isolates broadly fall into the same genetic 

lineage. Phylogenetic analysis revealed that 

the three Indian isolates had a similar lineage 

and were closely related. The existence of 4/91 

(739B) type was for the first time confirmed by 

isolation and genotyping. 

• Full length VP2 gene of infectious bursal 

disease virus was amplified and expressed 

using yeast expression system to develop a 

recombinant vaccine. 

• Experimental immunogenicity studies on 

chicken infectious anaemia virus DNA vaccine 

(CIA V VPl VP2 genes cloned in pT ARGET 

vector) in SPF chicks revealed moderate 

protective antibody titer for humoral immune 

response and good CMI response. 

• The cytokine expression profile (IFN-y and IL- 

4) and antigen-antibody kinetics in goats after 

PPR virus infection and vaccination have been 

evaluated. 

• Two classical swine fever isolates viz., CSFV 

Agartala and CSFV-Izatnagar have been 

adapted in MOCK and RK-13 cell-lines. 

• Purified epsilon toxin as well as antitoxin of 

Clostridium perfringens type D were prepared 

and standardized for quality testing of 

enterotoxaemia vaccine. 

• Studics revealed that rHaa86 based tick 

vaccine could be used for the control of both 

H.a. anatolicum and R. (B.) microplus 

infestations. 

• The replication-defective adenoviruses 

encoding siRN A targeting rabies virus 

nucleoprotein (RV-N) gene was constructed 

and evaluated for anti-rabies effect in cell 

culture. 

• Porcine Circovirus 2 recombinant capsid 

protein (22.5 kDa) cxpressed in prokaryotic 

system was confirmed by Western blot 

analysis, and it was used in ELISA for 

detection of PCV2 specific antibodies in pig 

serum. 

• A new real time PCR assay using NS5B 

specific primers was standardized for quick 

and confirmatory diagnosis of Classical Swine 

Fever.

• Swine influenza was confirmed by virus 

isolation in chicken embryos, MDCK cell line, 

HA test, electron microscopy, RT-PCR for 

detection of viral genome and cloning and 

sequencing of all eight genes of the virus. The 

phylogenetic analysis revealed that the virus 

was HINI subtype with very close homology 

to the HINI virus that caused the human 

HINI pandemic. 

• The Border disease virus was isolated from 8 

sheep of a farm in J &K and characterized by 

nucleotide sequencing, antigenic analysis and 

electron microscopy. 

• Classical swine fever outbreaks were 

diagnosed in Western and Central Uttar 

Pradesh. 

• A total of IA8,OOO doses of RD 'F' strain 

vaccine; 1,16,000 doses of R2B vaccine; 60,000 

doses of fowl pox vaccine; 3,04,880 doses of 

lapinized swine fever vaccine; 10,54,700 doses 

of tissue culture sheep pox vaccine; 46,40,200 

doses of PPR vaccine; 9,375 ml of Brucella 

abortus strain-19 (live) vaccine; 4,250 ml of 

enterotoxaemia vaccine; 11,520 ml HS 

adjuvant vaccine; 55,000 doses of tuberculin 

PPD; 55,000 doses of Johnin PPD; 18,000 doses 

of mallein PPD; 68,000 ml of Brucella 

agglutination test antigen; 4,620 ml of Brucella 

abortus Bang ring antigen; 18,470 ml of rose 

Bengal plate test antigen; 142 ml of Brucella 

abortus positive serum; 5,520 ml of S. Pullorum 

coloured antigen; 8,750 ml of plain antigen; 41 

ml S. Pullorum positive serum and 6,000 mlof 

S. Abortus equi 'H' antigen were produced, 

quality tested and supplied to various 

organizations viz., Defense Establishments, 

ICAR Institutes, Medical Institutes, Diagnostic 

Laboratories, State Governments and farmers. 

• A total of 6.82 million monovalent doses of 

FMD vaccine were produced at Bangalore 

Campus and 1.44 million trivalent doses of 

FMD vaccine were sold. 

• PPR c-ELISA (14) and PPR s-EUSA (14) kits 

were produced and supplied. 

• Antiviral potential against H5Nl virus has 

been identified in some indigenous herbal 

extracts by in vitro studies. 

• Herbal extracts, NBA-13/B/2 and IVRI-l/F/1, 

were found to be effective (60-90%) against 

multi-acaricide resistant ticks, H.a. anatolicum 

(40-100%), Rhipicephalus sanguineus (60-90%) 

and lice (60-100%). 

• A bio-organic formulation containing 25% 

Ocimum sanctum, 25% Emblica officinalis, and 

50% other bio-organics viz., Syzygium 

aromaticum, Commiphora mukul, Santalbum 

alum, Annona muricata, Centella asiatica, Allium 

sativum, Rubia cordifolia, Tinospora cordifolia, 

was found to have immunomodulatory 

potential. 

• Formulation containing 25% Tinospora 

cordifolia, 25% Commiphora mukul and other 

bio-organics revealed antioxidant potential. 

• Quantitative determination of residue levels of 

tetracycline, oxytetracycline, chlortetracycline 

and ceftiofur was done in pork samples. 

• T-2 toxin was found highly immunotoxic, 

nephrotoxic and hepatotoxic in Wistar rats. T- 

2 toxin and virus interaction caused 

immunosuppression and aggravated the 

pathology and pathogenesis of infectious 

bronchitis virus in broiler chickens. 

• Arsenic exposure in [at caused oxidative stress 

and down regulation of SOD2 gene at 

transcription level. Co-administration of 

mushroom lectin with arsenic improved the 

oxidative stress and cytotoxicity under both in 

vitro and in vivo conditions. 

• It was proved that inorganic arsenic exposure 

causes immunosuppression in birds. Heat 

shock protein 70 was found to be effective as 

biomarker for detection of arsenic toxicity in 

chickens. 

• Autogenous bacterin of Staphylococcus aureus 

in combination with vitamin C, or honey were 

found to be effective against clinical mastitis 

and enhancement of CD3 positive ybTCRs in 

diseased mammary parenchyma. 

• The detection of Cao gene from mastitic milk 

sample was found to be more accurate than 

bacterial culture for screening of Staphylo. 

aureus mastitis in large herd. 

• Mesenchymal stem cells and bone marrow 

nucleated cells were effectively used for the

• 

• 

• 

management of cartilage defects, full thickness 

skin wounds, fractures and non-unions. 

Standardized the technique of intravenous 

infusion of alpha-2 agonists, fentanyl, 

thiopental sodium with halothane/isoflurane 

for maintenance of general anaesthesia in 

buffaloes. 

Standardized the technique of intravenous 

infusion of medetomidine/ dexmedetomidine 

and propofoJ for balanced anaesthesia and 

tramadollfentanyl for postoperative pain 

management in canine orthopaedic patients. 

Identified molecular markers for sex 

determination in Gyps vultures. 

B. ANIMAL GENETIC RESOURCES 

• Amplified fragments of CXCR1 (311 bp), 

CRBRI (316 bp) and CRBR2 (382 bp) genes 

were found to be polymorphic in both the 

mastitis affected as well as tolerant groups of 

crossbred cows. 

• CXCRl, CRBRI and CRBR2 gene fragments 

showed three (AA, AB, BB), three (AA, AB, 

BB) and two (AA, AB) genotypes, respectively. 

However, no significant association was found 

between different genotypes and mastitis, 

whereas, parity was found to be significantly 

associated with mastitis. 

• Higher expression of TLR4 was observed in 

LPS induced condition as compared to uninduced, 

but no significant difference was 

observed among the animals of AA, AB and 

BB genotypes. 

• PCR-RFLP studies of 482 bp amplicon 

encompassing exon 3 and 4 of CatS perl gene 

in Vrindavani and Tharparkar cattle revealed 

monomorphism in both the breeds upon 

digestion with restriction enzyme Pvu II and 

Rsa 1. The amplicon was sequenced and 

aligned with similar sequences of other 

ruminants. A high nucleotide and amino acid 

homology was observed indicating the 

conserved nature of this gene. 

C. LIVESTOCK IMPROVEMENT 

• Study on chemical composition and 

micro mineral profile of locally (Mukteswar) 

available tree leaves revealed that the mineral 

contents were adequate in most of the foliage 

IIWIRill 


2010-11 

except for Cu. It was found that Grewia 

oppositifolia, Ficus nemoloris, Ficus palmate and 

Ficus roxburghii can serve as good source of 

protein in animals' diet. 

• Supplementation of 100 ppm Zn and 100 IU 

vitamin E was effective in amelioration of 

adverse effects of Cd in guinea pigs. 

• Supplementation of copper had no effect on 

serum levels of Ca, P and Zn, T3, T4, TSH and 

testosterone. CMI and humoral immune 

response were significantly (P

IIWrnJI 

Annual Report 

2010-11 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

] 7.48% reduction in methane production in 

vivo. 

Combined treatment with Curry (Murraya 

koenigii) and Bel (Aegle marmelos) leaves 

restored the cyclicity in anoestrus cattle 

(85.7%) and buffaloes (84.2%). 

Developmentally important genes for thermo 

tolerance, compaction and cavitation, 

intercellular adhesion, initiation of translation 

and the regulation of mRN A breakdown, 

energy metabolism, and pleiotropic mitogenic 

activity were evaluated through their 

quantitati ve as well as qualitative expression 

pattern in immature and matured oocytes and 

for different in vivo and in vitro produced 

buffalo embryos. 

Collagen scaffolds supported EBs formation 

and their subsequent colony formation in a 

single three dimensional environment. 

Derivation, culture, characterization of the 

mesenchymal stem cells from different animal 

species was done and is being successfully 

used for the therapeutic purposes. 

Parthenogenetic embryonic stem (ES) cells 

have been generated and could be propagated 

up to 7th passage. Both parthenogenetic and 

IVF embryos derived stem cells expressed 

similar pluripotent markers. Hexokinase may 

be used as a ES cell marker. 

Melatonin supplementation in ES cell medium 

increased multiplication and establishment of 

ES cell colony from parthenogenetic and IVF 

derived embryos in buffalo. 

Buffalo and caprine fetal stem cells were 

isolated and characterized from very early 

stage fetus. Caprine fetal stem cells when 

differentiated formed beating cardiomyocytes. 

The mRNA expression of IL-l(3 and TLR-4 was 

6 and 11 folds higher, respectively in 

subclinical! clinical endometritis as compared 

to normal cows, indicating their application 

for early diagnosis of sub clinical endometritis. 

Freezability of Tharparkar bull semen (54%) 

was found better than crossbred bull semen 

(42%). 

Loss of SOD and leakage of LDH and GOT 

enzyme activity was significantly higher in 

non-freezable than freezable quality semen of 

crossbred bulls indicating their significant role 

in freezing semen. 

• A 51 kDa protein observed in seminal plasma 

of freezable semen can serve as a freezability 

marker. 

• Supplementation of wheat straw with the 

leaves of F. roxburghii and Q. leucotrichophora, 

respectively at 10% and 40% level, showed a 

• 

desirable effect on rumen fermentation. 

The leaves of G. optiva, B. variegata, C. australis 

and R. pseudoacacia had a variable positive 

effect on various ruminal parameters at 

different levels of incorporation. 

• Saponins were isolated from the defatted 

samples of Aesculus indica (Horse Chestnut) 

fruit, Lonicera japonica (Honeysuckle) leaves, 

and Chlorophytum borivilianum (Safed Musli) 

roots and C. borivilianum leaves, and the 

amount was found to be 10, 10.5, 9.9 and 5.5 

g!100 g, respectively. 

• Saponins isolated from Chlorophytum 

borivilianum (Safed Musli) leaves when 

• 

evaluated for rumen fermentation showed 

reduction in ammonia, methane and protozoa. 

Both methanolic and aqueous extracts of sea 

buckthorn lea\'es showed good antioxidant 

activity. 

• Standardized diet for zoo animals and 

conducted metabolic trials on 25 species of 

wild animals in 7 Zoos. 

D. LIVESTOCK PRODUCTS TECHNOLOGY 

• Standardized processing conditions and 

formulations for ready-to-fry shelf stable meat 

based snacks and ready-to-cook! reconstitute 

dehydrated meat cubes. 

• Restructured chicken meat blocks extended 

with 15% plant based extruder blend 

improved the functional value and reduced 

the production cost. 

• Species specific and sex specific primers were 

designed and successfully evaluated for their 

ability to determine the species (cattle, buffalo, 

sheep, goat and pig) and sex origin (cattle) of 

meat. 

E. EXTENSION ACTIVITIES 

• Annual 'Kisan Mela Avam 

Pradarshini' was organized 

November, 2010. 

Pashu Vigyan 

during 1-3

• 

• 

• 

• 

• 

• 

• 

• 

• 

'All India Dog Show' was organized on 26 th 

February, 2011, wherein 162 pet owners, 217 

dogs of 38 breeds participated. 

Forty five technology exhibitions were put up 

at different places, and 12 animal health camps 

were organized. 

Thirty seven demonstrations of technologies 

viz., olinall, crystoscope and area specific 

mineral mixture, external bone fixator, 

UMMB, complete feed block, herbal ointment, 

herbal anti-diarrhoea mixture, herbal 

acaricide, herbal Inedicament, vemi-culture, 

vermi-compost were arranged at different 

Two Farmer-Scientist interaction meets were 

organized, wherein a total of 704 farmers 

participated. 

Nine training programmes were organized on 

different subjects for field veterinarians, 

pharmacists, progressive farmers and 

students. 

A total of 1,176 questions related to various 

aspects of livestock production, health and 

management were replied through 'Kisan Call 

Centre', and 433 calls were attended at the 

Institute Help Line. 

Two issues of half yearly Magazine entitled 

'Pashu Chikitsa Vigyan' were published from 

A TIC for dissemination of scientific 

information to livestock owners, farmers and 

rural youth. 

Developed English software for professionals 

on Livestock and poultry disease intervention 

system and submitted for copy right. 

Developed Hindi Software for farmers on 

Pashudhan avam kukkut rag suchna pranali and 

submitted the copyright. 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

An interface programme between 

leading NGOs was organized 

Izatnagar on 13 th and 14 th July, 2010. 

IVRI and 

at IVRI, 

A book on Vyavsayik Pashupalan was published 

at the occasion of IVRI Kisan Mela- 2010. 

A total of 128 skill oriented on campus and off 

campus trainings were organized at KVK for 

farmers, rural youths, rural women, in-service 

and extension functionaries. Of these, 22 were 

in crop production, 25 in animal science, 20 in 

horticulture, 20 in home science, 16 in 

agricultural extension and 05 in fisheries 

production. 

Eight Scientist-Farmers Interactions were 

conducted by KVK for extension functionaries, 

contact farmers, farm women and paravets. 

Twenty on-campus trainings sponsored by 

line departments, NGOs, National fertilizer 

and private agencies were organized at KVK 

for 695 farmers, master trainers, livestock 

owners, youths of Bareilly and adjoining 

districts. 

Fifty four front line demonstrations were 

organized by KVK on oilseed and pulses; 129 

demonstrations on paddy SRI, Napier grass, 

berseem + oat, nutritional kitchen garden, 

wheat, chilly, fodder sorghum, vegetables, biocontrol 

of fruit fly and floriculture; and 20 

demonstration units were established on 

backyard poultry, four on piggery and one on 

goats in different villages. 

Twenty animal health camps were organized/ 

participated, wherein 2,165 animals were 

treated, 1,941 animals were vaccinated against 

HS and FMD, 478 animals were de-wormed, 

and 1,272 animals were treated against tick 

control. 

Nineteen Kisan Cosh ties were organized 

covering 19 villages of Bareilly district. 

KVK published one issue of Cyan Vigyan news 

letter for farmers and extension personnel. 

One day Kisan Mela was organized in village 

Kesarpur on March 8, 2011 on the occasion of 

International Women Day, wherein women 

goshti, technology exhibition, animal health 

camp and animal competitions were 

organized.

2. INTRODUCTION 

BRIEF HISTORY 

The Indian Veterinary Research Institute, 

Izatnagar is one of the premier national 

institutions in veterinary and animal sciences in 

the world. Founded in 1889, the Institute is the 

oldest among the institu tions governed by Indian 

Council of Agricultural Research. The major 

historical landmarks in the genesis, growth and 

development of this national Institute are detailed 

below: 

1889 

1890 

Foundation of Imperial Bacteriological 

Laboratory (IBL) at Pune, Maharashtra 

Appointment of Dr. Alfred Lingard, a 

noted medical scientist as the founder 

Director 

1893 Shifting of the lBL to Mukteswar, 

Kumaon Hills of Uttar Pradesh (now in 

Uttarakh 

1897 

1899 

1913 

1925 

1930 

1936 

1940 

1947 

Historical visit of renowned 

bacteriologists, Dr. Robert Koch, Dr. R. 

Pfeiffer and Dr. G. Gaffky 

Production of first batch of antirinderpest 

serum 

Birth of Izatnagar campus 

Renaming as Imperial Institute of 

Veterinary Research 

Renaming as Imperial Veterinary Serum 

Institute 

Renaming as Imperial Veterinary 

Research Institute (IVRl) 

Development of vaccine against Ranikhet 

disease of poul try 

Shifting of headquarters of the Institute 

from Mukteswar to Izatnagar and 

lIWIlliI 

AJlllual Rt'port 

2010-11 

1958 

renaming as Indian Veterinary Research 

Institute (IVRI) under Govt. of India 

Establishment of a Postgraduate College 

of Animal Sciences at Mukteswar, 

1966 

affiliated to Agra University 

Transfer of administrative control to 

Indian Council of Agricultural Research 

and recognition as a National Institute 

1967 Establishment of Regional Station at 

Palampur (Himachal Pradesh) 

1970 Establishment of a Regional Station at 

Kolkata (formcrly Calcutta) 

1971 Establishment 

Bangalorc 

of IVRl Campus at 

1973 Development of irradiated lung worm 

vaccine and establishment of Vaccine 

Production Centre at Srinagar 

1982 Establishment of Germplasm Centre at 

Izatnagar 

1983 Conferment of Deemed University status 

by University Grants Commission to 

IVH1, Izatnagar 

1986 

1986 

1998 

2000 

2001 

Establishment of National Biotechnology 

Centre (NBC) at Izatnagar 

Establishment of a Centre for Animal 

Disease Research and Diagnosis 

(CADRAD) at Izatnagar 

Establishment of High Security Animal 

Disease Laboratory at Bhopal 

Dedication of High Security Animal 

Disease Laboratory to the Nation 

Development of competitive-ELISA 

diagnostic kit for Rinderpest, approved 

by OlE and validated by IAH, Pirbright, 

UK.

llWJlill 

Annual Report 

._2010-11 

2001 

2001 

2002 

2004 

2004 

P2 facility for FMD vaccine quality 

control created at Animal Experimental 

Station, Yelahanka, IVRI, Bangalore 

Conferment of Sardar Patel Outstanding 

ICAR Institution Award 

Development of live modified PPR 

vaccine 

Establishment of Kisan Call Centre at 

lzatnagar 

Inauguration of University-cum- 

Administrative Block 

2004 Dedication of Polyclinic to the Nation 

2005 Award of ISO 9001: 2000 Certificate by 

International Certificate Services Asia to 

CADRAD 

2007 Establishment of video conferencing 

facility 

2007 Kisan Help Line at Mukteswar campus 

2009 Recognition of HSADL as OlE approved 

Referal Lab for HP AI diagnosis; the third 

such lab in Asia and seventh in the world 

2009 Establishment of SPF Animal Facility at 

HSADL, Bhopal 

2009 Establishment of Zonal Technology 

Management - Business Planing and 

Development Unit (North Zone) 

2010 Conferment of Sardar Patel Outstanding 

ICAR Institution Award for the 2009 

The Institute with its long heritage and 

glorious scientific achievements has always 

enjoyed a certain prestige and tradition of its 

own. The Institute at its headquarters functions 

through more than 20 research divisions, 400 

acres of livestock and fodder production farms, 

feed technology unit, a modern computerised 

library, engineering section, medical hospital, etc. 

Besides the main campus, three regional stations 

at Kolkata, Palampur and Srinagar and two fullfledged 

campuses at Mukteswar in Uttarakhand 

and Bangalore in Karnataka are the other 

functional units of the Institute dedicated to 

livestock research and development. Further, the 

Institute is the seat of two Centres of Advanced 

Studies in Animal Nutrition, and Veterinary 

Physiology, many a Network, National 

Agricultural Innovation Projects and All India 

Co-ordinated Research Projects. 

MANDATE 

1. To conduct research, provide postgraduate 

education and transfer of the technology in 

all areas of animal sciences w.ith emphasis on 

animal health and production. 

2. To act as national referral centre for 

veterinary type cultures, disease diagnosis, 

biologicals, immunodiagnostics, etc. 

PAST ACHIEVEMENTS 

The Institute, the largest of its kind in whole 

of South-East Asia, is widely known for its 

impressive contributions to all aspects of 

livestock and poultry health, production 

technology and postgraduate education. The 

Institute is a pioneer not only in mission-oriented 

research, but also a foremost centre for 

postgraduate training and education. For many in 

the profession it is their Alma Mater. 

The Institute takes a legitimate pride in its 

contributions and distinguished services pro rata 

in achieving the national goals. With the richest 

animal resource in the world today, India is the 

largest milk producer and ranks fourth in egg 

production and eighth in broiler production in 

the world. These notable achievements became a 

reality due to direct impact on account of control 

of major diseases, particularly rinderpest and 

CBPP in cattle, African horse sickness in horses 

and Newcastle disease in poultry as a result of

, Designing and fabrication of an external 

skeletal fixation device for stable fixation of 

metatarsal and radial fractures in large 

animals (1999) 

y Development of CCPP VaCCil1.e for goats and 

sheep (2000) 

,. Development of Rose Bengal coloured 

antigen for serum agglutination test (1999- 

2000) and kit for diagnosis of caprine 

pleuropneumonia 

,. Occurrence of chicken infectious anaemia 

(CIA) in India by PCR assay and isolation of 

virus (2000) 

,. Development of an inactivated oil emulsified 

vaccine against IBH-HPS (2000) 

}.- Targeted PCR assays for detection of 

haemoprotozoan infections caused by 

Theileria annulata and Babesia bigemina 

infected carrier animals were standardized 

(2001) 

,. PCR based diagnostic technology developed 

for the detection and differentiation of 

important avian diseases viz., infectious 

bursal disease, CIA, Newcastle disease, EDS- 

76 virus syndrome, Avian Reovirus infection 

and duck plague (2001) 

,. Development of an effecti ve indigenous 

treatment for endometritis in buffaloes (2002) 

;;.- Development of DNA vaccines against canine 

parvo virus and IBD virus (2003) 

,. Development of ELISA technology for 

diagnosis of BVD and PPR (2003) 

,. Development of PCR based diagnostic 

technology for fowl adeno virus-4 (2003) 

,. PCR based diagnostic assays standardized for 

BPV, BVD virus, canine parvovirus, 

Campylobacter (2003), Brucella and Haemonchus 

contortus (2006) 

,. Development of area-specific mineral 

mixtures to improve animal health and 

production (2003) 

; Conferment of 100 per cent protection in 

challenged calves by a low volume (2 ml) 

saponified haemorrhagic septicaemia vaccine, 

up to 12 months post immunization (2004) 

,. Conferment of 100 per cent protection in 

mares challenged with a virulent S. Abortus 

equi strain by defined deletion double mutant 

vaccine for Salmonella Abortus equi (2004) 

,. Development of Dot-ELISA for quick 

diagnosis of PPR infection in small ruminants 

(2004) 

, Successful fixation of fractures in dogs with 

osteopenic bones by modified technique of 

interlocking nailing (2004) 

).- Commercialization of area specific mineral 

mixhue with industrial concerns (2005) 

, Commercialization of IVRI crystoscope with 

corporate agencies (2005) 

,. Development of multiplex PCR for listeriosis 

and nested PCR for BOV, BVDV (type 1 & 2) 

and T. evansi (2006) 

r Detection of HsNI subtype of influenza virus 

in poultry for the first time in the country as a 

result of extensive field and laboratory 

investigations. Four H9N2 and one H9Nl 

viruses were isolated (2006) 

),; Development of Real-time PCR based 

diagnostic assays for important exotic 

diseases namely, avian influenza virus and 

pseudorabies (2006) 

, Recombinant diagnostic antigens viz., FMDV 

(PI) polyp rote in, PPR (H protein), RO (HN 

protein), brucellosis (L7/L 12 ribosoma 1 

protein) and IBD (VP2) protein) were 

produced (2006) 

,. A status of freedom from contagious bovine 

pleuropneumonia infection in cattle and 

buffalo was obtained from OIE (2007) 

,. Dot-ELISA was developed for serodignosis of 

Fasciola gigantica infection (2007) 

;... Development of cell culture vaccine for 

classical swine fever (2007). 

)' Development of recombinant antigen based 

ELISA kit for serodiagnosis of IBD and NDV 

(2007) 

, Epoxy-pin external skeletal fixation technique 

has been developed for a variety of 

compound fractures of long bones in small 

animals (2007) 

,. A novel design of bilateral extemal fixator 

has been developed for the management of 

long bone fractures in large animals (2007) 

,. A Taqman based one-step Real-time RT-PCR 

was developed for simultaneous detection 

and genetic typing of ruminant pestiviruses, 

namely, BVDV -1, BVDV -2 and BOV (2008)

synthase, osteopontin, interferon-tau, as-I, 

as-2, !3 & k- casein in buffalo (2006) 

;;.. Development of cross-bred cattle strain 

'Vrindavani' (2006) 

Y Feeding practices were devised for in vivo 

reduction in methane production in buffaloes 

(2010) 

C. LIVESTOCK PRODUCTS TECHNOLOGY 

Development of technologies for value aided 

recipe such as meat pickles (1982), buffalo 

meat sausage (1982), meat patties (1986), meat 

tikkas (1986), meat kofta (1987), rabbit meat 

products (1992), chicken nuggets (1997), milk 

sausages (1986), egg loaf (1997), meat based 

snacks, chicken meat chips, curls (2001) and 

functional mutton nuggets (2007) 

Development of improved techniques to 

extend the shelf-life of chicken meat chunks 

up to one week at ambient temperature (1998) 

y Development of restructured meat rolls from 

buffalo meat (1999) 

,. Development of diet nuggets from broilers 

and culled broiler hens (2002) 

Y Development of technologies for buffalo meat 

based idli and meat samosa (2003) 

Y Development of technique for successful 

incorporation of pork skin! rind in emulsion 

based products (2003) 

Development of a novel device 'tandoor 

hook' hanger for meat specialities (2003) 

Development of low salt, low fat, medium 

fibre pork meat balls (2004) 

Development of meat products of nutritional 

merit incorporating capsicum, carrot, radish, 

red chilli, linseed and soya (2006) 

Development of formulations for ready-to-fry 

shelf stable meat based snacks and ready-tocook! 

reconstitute dehydrated meat cubes 

(2010) 

D. HUMAN RESOURCE DEVELOPMENT 

Y Prior to conferment of Deemed University 

status to IVRI in 1983, a total of 851 scholars 

earned their postgraduate degrees from the 

institute (MVSc-570, PhD-273, DSc-8) 

induding 103 scholars from 22 countries 

;... The Deemed University, IVRI awarded 105 

MSc, 1699 MVSc and 800 PhD degrees to PC 

scholars enrolled at this institute (1984-2011) 

;... A total of 1559 field veterinary officers were 

awarded National Diploma certificates by 

IVRl before conferment of Deemed 

University status 

). The Deemed University IVRl awarded 559 

National Diploma certificates to field 

Veterinary Officers (1984-2011)

3. RESEARCH ACHIEVEMENTS 

Il"WIRill 

Allllual Report 

2010-11 

Sl.No. Theme Page No. 

1. Development and improvement of vaccines 27 

2. Development and improvement of diagnostics 34 

3. Production and standardization of veterinary biological 49 

4. Molecular characterization of pathogens and host pathogen interaction 52 

5. Disease monitoring and surveillance 63 

6. Exotic and emerging diseases 73 

7. Development of altemate systems of therapy 83 

8. Molecular mechanisms of drugs and their monitoring in animal health 89 

9. Environmental pollutants/xenobiotics and their impact on animal health 90 

and production 

10. Clinical and surgical interventions 92 

11. Diagnostic and clinical services 97 

12. Genetic studies related to disease resistance, production and reproduction 102 

in livestock . 

13. Livestock production and management 112 

14. Reproductive management and augmentation 120 

15. Nutrition for health and welfare of livestock, pets and wildlife 124 

16. Expending feed resources and improving nutrient extraction from 131 

biomass 

17. Strategic supplementation of macro and micro-nutrients for improving 133 

livestock production 

18. Feeding practices for optimizing animal productivity and reducing 136 

environmental pollution 

19. Effect of climate change on health and production of livestock 141 

20. Database on livestock related statistics and development of statistical 143 

models 

21. Economic evaluation of livestock diseases and marketing of livestock 145 

products 

22. Extension interventions in livestock production systems 145 

23. Value addition of livestock products 152

IIWIKill 

4111111tll Report 

1IIIi ... 2010-11

Fig. 7: Reduction in fluorescent foci unit (ffu) size of Rabies virus (RV) ill vitro in BHK-21 cells transduced with 

Adenovirus encoding siRNA against RV-N gene. 

(e) Bovine herpes virus-l 

(i) Construction of transfer vector for generation 

of deletion mutants ofBHV-l through homologous 

recombination: For development of deletion 

mutants of bovine herpesvirus-l (BHV-l), the viral 

genes like, glycoprotein C (gC) and glycoprotein E 

(gE) were identified. Two DNA fragments on 

either side of the gene, which acted as left- and 

right-side homologies, respectively, were PCR 

amplified and cloned into pUC19 plasmid along 

with selective marker E. coli guanine 

phosphoribosyl transferase (gpt) gene as fusion 

protein with red fluorescent protein (RFP) gene 

under the control of the CMV immediate-early 

promoter. The transfer vector was transfected into 

MDBK cells and expression of RFP protein was 

detected. 

(f) Swine fever 

The swine fever cell culture vaccine developed 

in the Standardization Division was 

experimentally produced and re-evaluated. 

Initially a batch of 500 doses, and then a batch of 

5000 doses were prepared and freeze dried. The 

challenge virus was revived and PID50 was 

determined in pig. Experimental batches of the cell 

culture vaccine were found satisfactory. 

(g) Chicken infectious anemia 

Experimental evaluation of the induction of 

immune response by the developed CIAV-DNA 

vaccine was carried out in SPF Chicks at the dose 

rate of 150 f.lg each (injected 11M) in specific 

pathogen free (SPF) chicks (n=80), divided into 

four groups (DNA Vaccine, Booster DNA Vaccine, 

Plasmid Control and unvaccinated Control). 

Experimental chicks were assayed for the 

induction of cell mediated immunity (CMI) 

response by FACS by measuring CD4+ and CD8+ 

T cell ratio in peripheral blood mononuclear cells 

(PBMCs) on 4,5,6 and 7 weeks of age. CD4+ and 

CD8+ ratio of groups A (DNA vaccine), B (Booster 

DNA vaccine) and C (Plasmid control) differed 

significantly from the unvaccinated control group 

D on all weekly intervals tested. On 7 weeks age of 

chicks, group B (1.662±O.085) showed significantly 

lower ratio than group A (2.125±0.072), group C 

(2.691±0.012) and group D (3.231±O.042). Group A,

Band C showed a decreasing ratio pattem from 4 

weeks of age. Assessment of humoral immune 

response by CIAV ELISA antibody titres indicated 

significant differences between the DNA 

vaccinated groups and control groups at 3, 4, 5, 6, 

7, 8 and 9 weeks of age. Chicks of the primary 

DNA vaccinated group A showed induction of the 

generation of CIA V antibodies at 1 week post 

vaccination (WPV) with the ELISA titre to be 

2724.29±271.84. Subsequently, the antibody titre in 

group A showed a sharp increase with the highest 

titre being detected at 3 WPV (5746.22±215.89), and 

thereafter showed a decreasing trend, and at 6 

WPV an antibody titre of 5273.33±457.51 was 

observed. Chicks administered with the booster 

dose of CIAV DNA vaccine (group B) showed an 

even sharper rise in antibody titres at 1 week post 

booster (WPB) immunization (7193.58±406.78), 

which was much higher compared with the 

antibody titre with only the primary DNA 

vaccination alone. Thereafter, titre in the booster 

vaccinated group showed a declining trend but the 

decline in antibody titre was much slower as 

compared to single vaccination group, and at 6 

WPV i.e. 4 WPB a comparatively higher titre of 

6526.17±428.81 was maintained as compared to the 

primary vaccination group titre of 5273.33±457.51. 

Chicks of the control groups C and D showed 

negative antibody titres ranging from 241.27±14.70 

to 655.08±122.11 at all the post vaccination 

respective intervals. Pre-vaccination antibody titre 

ranges of 278.35±26.91 to 496.12±50.22 confirmed 

the SPF status of the birds in the present study. 

Overall, the Group B (booster vaccine) showed a 

higher titre than group A (primary DNA vaccine) 

at 6, 7, 8 and 9 weeks age of chicks i.e. at 1-4 WPB 

immunization, and which all were statistically 

significant at P

The three proteins (p15, p24 and p66) of 

Haemonchus contortus were cloned, expressed in E. 

coli and purified. The native form of p66, 

recovered from the paraSite, and its recombinant 

version caused significant proliferation of goat 

peripheral blood mononuclear cells in vitro. The 

effect of p66 on complement activity was also 

assessed. The protein showed no inhibitory effect 

on complement mediated lysis of sensitized sheep 

erythrocytes. 

(4) VACCINE DELIVERY AND AUGMENTING 

IMMUNE RESPONSE 

(a) Development of animal virus derived 

peptidic nanosystems for targeted 

intracellular delivery of bio-molecules 

Peptide domains with putative cell 

penetrating property were identified in different 

proteins of animal viruses and thirty delivery 

peptides were syntheSized by solid phase peptide 

synthesis methodology. The peptides were 

characterized by RP-HPLC and CD Spectroscopy 

and labeled at N-terminal with fluorophore FITC. 

The cell penetrating ability of these delivery 

pep tides in primary chicken (Fig. 11) and mouse 

embryoniC cells and MDBK (Fig. 12) cells was 

determined using fluorescence microscopy and 

flow cytometery. About 50 to 60% intemalization 

was achieved in the primary cells whereas; more 

than 90% internalization was recorded in the 

established cell line MDBK. These delivery 

peptides have potential applications for use as 

transfcction reagent for delivering proteins and 

nucleic acids in the cells. 

Fig. 11: Fluorescence microscopy of Chicken embryo fibroblast (CEF) cells transfected with delivery peptide: [A} 

Cells transfected with unlabeled peptide [B] Cells transfected with FITC labeled delivery peptides. Cells were 

viewed three hours after transfection 

Fig. 12: Fluorescence microscopy of MDBK cells transfected with delivery peptide: [A] Cells transfected with 

unlabeled peptide [8] Cells transfected with FITC labeled delivery peptides. Cells were viewed three hours after 

transfection 

(b) Immunomodulatory role of endotoxin in host compromising its cytokine inducing ability so that 

immune response during health and sepsis the modified LPS may be used as an adjuv ant 

The aim of the project was to reduce the without any risk. The LPS derived from Pasteurella 

toxicity of LPS to a greater extent without multocida was further purified and characterized

(f) Enzootic bovine haematurialbovine 

papillomatoses 

Real time SYBR Green PCR was standardized 

for molecular diagnosis and quantification of BPV- 

2 in cases of EBH as well as for non neoplastic 

affections of bladder. Out of 28 urinary bladder 

samples, 24 samples including UBTs (9), mild 

cystitis (8), chronic cystitis (4), lymphocytic cystitis 

(2), and normal bladder (1) were found to be 

positive by Real-Time PCR. In present study, 15 

cases of non neoplastic lesions were also found to 

be positive for BPV-2 by PCR. All samples tested 

positive by conventional PCR were also found to. 

be positive by Real-time PCR. BPV -2 load was also 

quantified in 18 urinary bladder samples with 

different affections. Quantitative PCR (SYBR 

Green assay) of urinary bladder samples with 

different affections revealed positivity in all 

samples analyzed. A highest copy number 

(9.645e+0.004) was found in a case showing 

undifferentiated transitional cell carcinoma while 

lowest copy number of 1.066e + 0.004 was found in 

a case of chronic cystitis. This indicated that viral 

load in different bladder samples irrespective of its 

affections was almost same. 

(g) Canine parvovirus infection 

Fifty nine stool samples suspected for CPV 

infections collected from the dogs processed for 

virus isolation using MDCK cell lines and 

confirmation with PCR. Two isolates were 

adapted in the MDCK cells, passaged up to 10 

times and confirmed by PCR. Forty-five stool 

samples were found positive with PCR and an 

amplicon of 681 bp was visualized in positive 

cases. Primer sets designed to amplify the part of 

the VP2 gene of CPV yielded a product of 442 bp 

in nested PCR, amplified the N terminal part of 

the VP2 gene to yield a product of 990 bp and C 

terminal part of the VP2 gene of CPV to yield a 

product of 765 bp. 

(h) Classical swine fever 

(i) Real time peR assay targeting the NSSB gene: 

Primers and probes targeting NS5B and E2 

genes were designed based on sequence data 

available for Indian isolates of CSFV which are 

being tested in real-time RT-PCR assay. The real 

time Sybr green assay using CSFV NS5B specific 

primers was standardized. Forty-five field samples 

were tested and the results seem to corroborate 

with results obtained by conventional RT-PCR 

targeting 5'UTR and E2 genes of CSFV. 

Bioinformatic analysis of different structural 

regions of CSFV was carried out to design 

expression primers for constructing various 

recombinant clones. A total of eight different gene 

products, either in full or partial, were PCR 

amplified. Among the gene products, a partial 

fragment of glycoprotein Ems has been amplified 

(-207 bp) from genome of indigenous CSFV strain 

Izatnagar 78, and cloned into prokaryotic 

expression vector-pET32a with Histidine tag. 

Following transformation into E. coli BL21 (DE3) 

pLysS cells and induction with IPTG, an overexpressed 

partial fragment of recombinant Ems 

protein (- MW25 kDa) was observed on SDS 

PAGE. Over-expressed Ems-Ag domain Was 

purified from soluble fraction by affinity 

chromatography using Ni-NTA column (Fig. 18). 

M 1 2 

Fig. 18: Prokaryotic expression of truncated Ems-Ag 

domain. Lane M: Protein ladder; Lane 1: Before 

induction; Lane 2: After induction with IPTG 

(i) Porcine circovirus 

PCV2 infection in a herd was demonstrated by 

correlating clinical signs, gross lesions, 

histopathology and PCR amplification of viral 

nucleic acids from necropsy cases. Full ORF2 gene 

of 705 bp was amplified by PCR from genOmic 

DNA isolated from tissues (PCV2 isolate India 

GN-07) using primers PCV20RF2F and 

PCV20RF2R. The plasmid was isolated from 705 

bp ORF2 gene clone and the region of interest 657 

bp fragment excluding first 16 amino acids Was 

amplified to yield a single band using primers 

PCVl720 and PCVI064 having restriction sites 

BamH I and Sal 1. ORF2 fragment excluding NLS

of N-terminus was also amplified using plasmid as 

template. A set of primer PCV1564 and PCV1064 

with BamH I and Sal I sites, targeting the NLS 

deleted ORF2 gene of PCV2 amplified a product of 

501 bp. pPROEXHP expression vector was used 

for cloning of 657 bp ORF2 fragment and 501 bp 

NLS deleted ORF2 gene which were cloned at 

BamH I and Sal I restriction sites in frame with six 

histidine residues as fusion partner. The ligation 

products were transformed into E. coli, DHsu 

competent cells. The presence of inserts (657 bp 

and 501 bp) in the vector (pPROEXHTb) was 

confirmed by colony PCR for both clones (pPRO 

PCV2-657 and pPRO-PCV2-501). The presence of 

the inserts in both clones was also confirmed by 

BamH I and Sal I RE digestion to release the inserts 

of 657 bp and 501 bp, respectively. 

For the clone NLS deleted ORF2 (pPRO-PCV2- 

501), IPTG induction was done after growing for 5 

h to an OD600 0.6 at 37°C. SDS-PAGE determined 

the molecular size of the recombinant NLS deleted 

ORF2 protein at around 22.5 kDa which is slightly 

higher (+3 kDa) due to the presence of the 

additional polyhistidine tag at the N- terminus of 

the protein. The recombinant Cap protein was 

recovered in the soluble (cytoplasmic) fraction of 

the IPTG induced cell lysate. Recombinant protein 

was purified by affinity chromatography. The 

yield of purified protein estimated by N anodrop 

was 5 mgjl of the bacterial culture. The presence of 

a single band at 22.5 kDa confirmed the purity by 

SDS-PAGE. The immunoreactivity at the unique 

22.5 kDa region specific for the ORF2 subunit on 

the nitrocellulose membrane confirmed the 

presence and purity of the recombinant proteins 

by Western blot. 

The 22.5 kDa recombinant ORF2 protein was 

evaluated for its utility in the sero-diagnosis of 

PCV2 infection in pigs by indirect ELISA. 

A total of 132 (67%) of 197 sera samples tested 

were judged as PCV2 antibody positive. The 

seroprevalence of PCV2 was 62% in Northem 

region and 78.3% in North-Eastem region of India. 

PCV2 antibodies were detected in 41% (21 out of 

51) of the sera from pre-weaning piglets, 74% (63 

out of 85) of the sera from post-weaning piglets 

and 79% (48 out of 61) of the sera from adult 

animals. Seropositivity among different breeds 

included in the study were 100% in nondescript 

breed of North Eastern region (4 out of 4), 0 in 

Tamworth x Duroc crossbred (0 out of 2) and 67% 

in Landrace x Desi crossbred (128 out of 191). 

(j) Newcastle disease 

(i) Recombinant antigen based rapid seroprofiling 

oj Newcastle disease virus: fuB strain of 

Newcastle disease virus was propagated in 

embryonated chicken eggs, purified and the 

conserved nucleoprotein gene of the virus was 

expressed from the yeast Saccharomyces cerevisiae. 

A recombinant nucleoprotein (NP) antigen-based 

single serum dilution enzyme linked immunosorbent 

assay (ELISA) was developed to measure 

the specific antibody in sera of chickens against 

Newcastle disease virus. Sera samples from a total 

of 1182 chickens collected from various parts of 

the country were analyzed in developing the 

assay. A linear relationship was found between 

the predicted antibody titres at a single working 

dilution of 1:200 and the corresponding observed 

serum titres as determined by the standard serial 

dilution method. Regression analysis was used to 

determine a standard curve from which an 

equation was derived that allowed the 

demonstration of this correlation. The equation 

was then used to convert the corrected absorbance 

readings of the single working dilution directly 

into the predicted ELISA antibody titres. The assay 

proved to be sensitive, specific and accurate as 

compared to the standard haem agglutination 

inhibition (HI) test. 

(ii) Mab based diagnostic kit to differentiate the 

NDV vaccine strain from the virulent strain: Fgene 

(virulent strain-UP/2006) covering the 

cleavage site was amplified, cloned in pET 32a+ 

and expressed in BL-21 (pLysS). The protein was 

checked for its specificity by western blotting with 

anti-sera specific for NDV. The protein was 

purified and immunized into BALB/C Mice. 

(k) Infectious bronchitis 

Molecular characterization of 6 IBV isolates of 

different geographical ongm was done to 

determine the differences at genomic level by 

using RT -PCR and confirmation of IBV was made 

with Nested RT-PCR utilizing the highly 

conserved UTR of IBV. Pathogenicity studies 

indicated that the isolate, India/LKW /56/ IVRI/08 

was pathogenic for young chicks. The 51 gene 

product of IBV genome of all the isolates were 

subjected to RE analysis with different enzymes 

which failed to differentiate from Mass. 41 strain 

- -

and it is concluded that these isolates broadly fall 

into the same genetic lineage. The existence of 4/91 

(739B) type was for the first time confirmed by 

isolation and genotyping. 

(l) Egg drop syndrome-76 

Two immunogenic genes of Egg Drop 

Syndrome-76 virus were selected and primers 

designed. PCR protocol has been standardized 

and both the immunogenic genes have been 

cloned in cloning vector and has been confirmed 

by RE digestion using suitable enzymes. 

(m) Avian leukosis/ sarcoma virus infection 

The diagnostic efficacy of indigenously 

developed novel antigen called, transformed 

fibroblast antigen (TfAg) based indirect enzyme 

linked immunosorbent assay (ELISA) was 

compared with that of highly sensitive molecular 

diagnostic techniques, viz., reverse transcriptase 

polymerase chain reaction CRT - PCR), through 

experimental Rous sarcoma virus (RSV) infection 

model and avian leukosis virus (AL V) positive 

case samples from the field. 

Total 9 CARl synthetic female line (CSFL) 

colored female broiler chicks, 45- days of hatch 

(DOH 45), were used in the study. Bryan standard 

strain of RSV, Rous associated virus-1 [BS RSV 

CRA V-1)], was used for experimental RSV 

infection. Six chicks were infected with RSV @ 

2,000 pkf.u./0.2 ml/ chick, s.c. in the right wingweb; 

and 3 hatchmate chicks were used as RSV 

uninfected controls. Primary tumors were induced 

in the right wing-web on day 1 post- RSV infection 

(DPI 1) in 4 chicks and on DPI 2 in 2 chicks but 3 

RSV uninfected hatchmate control chicks, did not 

induce any tumor. 

Serum samples were collected from 6 chicks 

before RSV infection on DPI 0/ DOH 45, after RSV 

infection on DPI 11/ DOH 56 and 3 RSV uninfected 

hatchmate control chicks on DOH 56. Later, after 

sacrificing all 9 chicks on DOH 56, primary tumor 

tissue samples from 6 RSV infected chicks on DPI 

11 and normal wing-web tissue samples from 3 

RSV uninfected hatchmate control chicks on DOH 

56 were collected. 

Histopathological examination of primary 

wing-web tumor tissue samples revealed them to 

be fibrosarcoma with loose bundles of fibroblasts, 

as compared to normally distributed fibroblasts of 

apparently healthy wing-web tissue samples 

IIWillII 

A1lllual Report 

2010-11 

confirming establishment of experimental RSV 

infection. 

Experimental RSV infection was also detected 

serologically by measuring anti- TfAg antibodies 

in an indirect ELISA. The results revealed that 

serum levels of anti- TfAg antibodies (mean 

OD492±SE) in 6 CSFL colored broiler chicks (DOH 

45) before experimental RSV infection CDPI 0) were 

0.199±0.014, as compared to 0.2023±0.0720 after 

RSV infection CDPI l1/DOH 56), not found 

significantly variable (p> 0.05) by paired t-test. 

Serum levels of anti- TfAg antibodies in 3 RSV 

uninfected hatchmate control chicks were not 

assayed on DOH 45, but the levels on DOH 56 

were found to be 0.1987±0.007, also not 

significantly variable (p> 0.05) as compared to 6 

chicks (DOH 45) before RSV infection (DPI 0) by 

independent t-test. Determination of SIP ratios 

also revealed that all the chicks were positive for 

anti-TfAg antibodies in their serum. 

Experimental RSV infection in serum samples 

was also detected by viral gene amplification 

employing primer specific for H5 and AD1 region 

of ALV genome through RT- PCR assay (Fig.19a, 

b). The results revealed that 'serum viral moieties 

determined as 294- 326 bp amplification products, 

were present in 6 CSFL colored broiler chicks 

(DOH 45) before experimental RSV infection (DPl 

0) and also after experimental RSV infection (DPI 

l1/DOH 56). Serum viral moieties were not 

assayed in 3 RSV uninfected hatchmate control 

chicks on DOH 45, but viral moieties were present 

on DOH 56 as 294-326 bp amplification products. 

RT-PCR assay, thus, confirmed presence of RSV 

infection in serum samples of all experimental 

chickens. 

Experimental RSV infection was also shown in 

primary wing-web tumor tissue samples, 

similarly, by viral gene amplification employing 

same set of primers through RT - PCR assay, as 

done in case of serum samples. The results 

revealed that viral moieties were present in 

primary wing-web tumor tissue samples of 6 RSV 

infected chicks on DPI 11 (DOH 56), but they were 

absent in apparently normal wing-web tissue 

samples of 3 RSV uninfected hatchmate control 

chicks (Fig. 19c). 

Studies were also designed to identify true 

positive cases of AL V infection by postmortem 

examination of dead chicken at the Central

Postmortem and Incineration Facility of IVRl/ 

CARl, Izatnagar. The AL V infection in dead 

chickens was suspected grossly based on grayishwhite 

tumor foci primarily in liver (lymphoid liver 

or LL) and secondarily in other visceral organs 

(Fig. 20A). Prevalence of avian leukosis was 

significantly higher (p

d. Liver e. Spleen f. Bursa of Fabricious 

A. Based on gross lesions (greyish- white tumor foci) primarily in liver and secondarily in visceral organs. 

lIWlEill 

AllIllInI Report 

2010-11 

a. Liver b. Kidney c. Spleen 

B. Based on microscopic lesions (uniform distribution of lymphoblasts) primarily in liver and secondarily in visceral 

organs confirming ALV. HE. X 40. 

Fig. 20: Detection of avian leukosis virus infection in dead chickens arriving at Postmortem and Incineration Facility, 

IVRI/ Central Avian Research Institute (CARl), Izatnagar. 

bp 

500 500 

200 

a. Lanes 1- 9 depict liver lymphoid tumor tissue b. Lanes 10-15 depict liver lymphoid tumor tissue 

samples of dead chicks randomly collected on post- samples of dead chicks randomly collected on postmortem 

examination: Lane M- DNA Molecular weight mortem examination: Lane M - DNA Molecular weight 

marker. marker. 

Fig. 21: Detection of AL V infection in liver lymphoid tumor samples of dead chicks by viral gene amplification of 

294- 326 bp using RT- PCR. 

(2) DIAGNOSTICS FOR BACTERIAL 

DISEASES 

(a) Paratuberculosis 

(i) Development of multigene constructs 

expressing proteins of M. a. paratuberculosis for 

use in a serodiagnosis assay: The nucleotide 

sequence of the constructs pQE 600 and pQE 972 

bp 

200 

expressing the 21.7 kDa and 34.2 kDa fusion 

proteins respectively of M. a. paratuberculosis 

(Map) were carried out. DNA sequence analysis of 

the construct pQE 600 revealed identical sequences 

in-frame having epitopic regions of MAP 862 and 

MAP 1637 with mature protein of 21.7 kDa. 

Similarly, the construct pQE 972 showed expected

tOmpC antiserum and 14 (5.49%) samples were 

positive with Omp antiserum. Salmonella spp. was 

isolated by standard isolation protocol from 17 

(6.66%) blood samples and 9 (3.52%) faecal 

samples. The study revealed higher positivity by 

ELISA in comparison to isolation protocol. 

Screening of 255 sera samples by ELISA 

employing rOMPC antigen revealed 22 (8.62%) 

samples to be positive for the presence of 

Salmonella antibodies. 

(c) Haemorrhagic septicaemia 

(i) LAMP test: LAMP was standardized for 

diagnosis of P. multocida. The primers for LAMP 

were designed and test standardized. Calcein gave 

specific coloured reaction at 61.5°C for 1 hr 20 min 

in thermocycler. The product was further 

subjected to electrophoresis in 2% agarose gel 

which showed typical ladder like pattem of 

amplfiied product observed in LAMP reaction 

(Fig. 25). 

1 2 

Fig. 25: LAMP for detection of P. mliitocida. Tube 1: 

Negative Control, Tube 2: positive coloured reaction 

816bp 

500bp 

ITWJ1ill 

AII/lllnl Report 

2010-11 __ _ 

(ii) OMP Based diagnostics: Outer membrane 

proteins (OMPs) and iron regulated (IROMPs) 

proteins were extracted from P . multocida 

serogroup B:2 grown on iron depleted and 

repleted conditions by Sarkosyl method and 

protein profile was analyzed for identifying 

candidate antigen for the development of a 

diagnostic assay. Different gene sequences 

encoding for various OMPs of P. multocida 

serogoup B: 2 were analyzed bioinformatically and 

primers for gene expression were designed. 

(d) Listeriosis 

Immunodominant epitopes in peptides 

corresponding to InlC protein of Listeria were 

identified using bio-informatics tools and 

predictive algorithms with a view to synthesize 

the synthetic pep tides of InlC and their application 

in ELISA for serodiagnosis of caprine listeriosis. 

The synthetic pep tides (9) were chemic all y 

synthesized by solid phase synthesis. Of the nine 

pep tides synthesized, two were prepared by MAP 

core synthesis (InlC.1M and InlC.2M), and seven 

(Inlc.3L .... InlC.9L) by Linear peptide synthesis on 

Wang resin. 

(e) Campylobacteriosis 

PCR was standardized for specific detection of 

thermophilic Campylobacter. DNA was extracted 

from suspected Campylobacter isolates and 

subjected to the genus specific PCR targeting 

16SrRNA, which gave an 816 bp amplicon (Fig. 

26). Multiplex PCR targeting the IpxA gene was 

employe d for species confirmation for detecting C. 

jejuni, C. coli, C. lari and C. upsaliensis (Fig. 27). 

Fig. 26: Genus PCR for Campylobacter: Lane M: 100 bp ladder; Lane 1-8: Campylobacter positive samples; Lane 9: 

Negative control; Lane 10: Positive control.

wmrr 

Anllllal Report 

2010-11 

rapid and cheap. Nested PCR for amplification of 

830 bp fragment of 18S rRNA gene was 

standardized. 

Fig. 30: Cryptosporidium sp. oocysts (Xl000) 

(d) Heart worm disease 

(i) peR detection of microfilaria: In order to 

detect the presence of the microfilarial DNA of D. 

immitis PCR reaction was performed using the 

specific primers of ITS1 and ITS2 regions of the 

ribosomal gene of D. immitis. Prominent bands of 

504 bp and 465 bp sizes were observed of ITS1 and 

ITS2, respectively (Fig. 31). The PCR detected four 

microfilaria positive dogs out of six positive dogs. 

Fig. 31: Amplification of D. immitis. Lan e 1: 504 b p 

product of ITS1; Lane 2: 465 bp product of ITS2 

(e) Echinococcosis 

(i) Enzyme Linked Immunosorbent Assay 

(ELISA) for diagnosis of cystic echinococcosis in 

animals and man: Relative quantification of two 

subunits of Secretory- Membrane (S/M) bound 

protein in active, transitional and inactive cysts 

discriminate relative expression of two sub units 

of Ag5. Expression was more in active cysts 

compared to transitional and inactive cysts. Out of 

274 cattle sera, 29% samples were seropositive. 

Out of 30 samples collected from sheep, 36% 

samples were found to be seropositive. 

Preliminary evaluation of human samples 

revealed that, six positive sera had OD value of 

0.392 0.0289. On the contrary, eighteen negative 

samples had OD value of 0.187 0.060l. 

(5) MARKERS FOR CANCER DETECTION 

(a) Metalloproteases in canine mammary cancer 

Stromelysin (MMP-ll) was chosen for cloning 

and expression studies to study role in metastasis 

and for developing ELISA to screen the dogs for 

sensitivity to cancer. RNA was collected from dog 

mammary tumor tissue and cDNA was 

synthesized from it. MMP11 gene was amplified 

using this cDNA as template and it was cloned in 

Ptz57Rrr cloning vector and sequenced. Further it 

was cloned and expressed in pProex Htc 

expression vector. The expressed peptide showed 

positive casein hydrolyzing and antiapoptotic 

activity. The expressed protein was found to 

facilitate the cell invasion. Antibodies were raised 

against expressed catalytic domain of MMP-ll in 

rabbits and guinea pigs. Antibodies were used for 

performing sandwich ELISA for detecting MMPll 

protein from serum of canine mammary tumor 

cases, other inflammatory diseases and normal 

dogs. The ROC analysis indicated that the optimal 

cut-off point was 0.168; this resulted in a 

sensitivity of 98% and specificity of 92%. ROC 

analysis indicated that this ELISA was less 

accurate (58.8%) in distinguishing normal sera 

from diseased (inflammatory) ones. The sensitivity 

of this test was found to be 33.93%. The results 

indicate that sandwich ELISA may be used to 

screen the dogs for sensitivity to cancer, for 

diagnosis and prognosis. PCR-SSCP performed on 

MMP11 catalytic domain. gene from normal and 

tumorous mammary tissue showed point 

mutation. There was change in one amino acid i.e. 

tryptophan was replaced with alanine which may 

be responsible for increased activity of MMP-ll in 

canine mammary tumor tissue. 

(6) MARKERS FOR SEX IDENTIFICATION 

(a) Molecular marker for sex identification in 

Gyps vultures 

Females of vultures are homogametic (ZW) 

and males are heterogametic (ZZ). 

Chromohelicase DNA binding protein gene (CHD) 

located on both the chromosomes provide useful 

tool in molecular sex identification of vultures. Wspeci 

fi c primer was used as reverse primer in 

combination with P2 forward primer to detect

l.CW1.ru.[ 

AlIlIllal Report 

2010-11 

9. S. pullorum positive 

serum 

10. S. abortus equi 'H' 

antigen 

It. MalleinPPD 

12. JohninPPD 

13. Bovine tuberculin 

PPD 

TotaI= 38 Batches 

B.P. Div., 

IVRI 

-do- 

-do- 

-do- 

-do- 

1 

2 

l 

l 

l 

(b) Standardization and quality control of 

veterinary vaccines 

As a part of quality assurance programme 

standardization and quality control of veterinary 

vaccines were carried out for a total of 55 batches. 

These included 13 bacterial vaccines and 42 viral 

vaccines, with 18 poultry vaccines from different 

production units as detailed in Table 2. 

T a bI e 2 : D e tail so f b ac t en "al an d· Vir al vaccines t es t e d d unn_g_ 201011 - 

SI.No. Name of Vaccine Bacteriall Viral Production unit No. of batches 

1. HSvaccine Bacterial BPDiv., IVRl 2 

2. Brucella abortus vaccine (Living) Bacterial BP Div., IVRl 3 

3. ET vaccine Bacterial BP Div., IVRl 1 

4. HS BQ combined vaccine Bacterial Brilliant Industries 2 

5. HS BQ combined vaccine Bacterial BioMed 5 

6. SheeE pox vaccine Viral B. P. Division, IVRl 1 

7. Sheep pox vaccine Viral Haryana Veterinary Vaccine 

Institute, Hisar 

1 

8. FMDvaccine Viral Brilliant Bio Pharma 4 

9. PPR cell culture vaccine Viral B. P. Division, IVRI 10 

10. Rabies vaccine Viral B. P. Division, IVRI 1 

It. Lapinized swine fever vaccine Viral B. P. Division, IVRI 5 

12. Swine fever cell culture vaccine 

(Exp) 

Viral Standardization Division, IVRI 2 

13. Ranikhet disease vaccine, live, 

Lentogenic, F strain, 

Viral Globion India Pvt. Ltd 3 

14. Fowl Pox vaccine live, Viral Globion India Pvt. Ltd 3 

15. Ranikhet disease vaccine, 

inactivated, 


16. Inclusion body hepatitis (ffiH) 

vaccine, inactivated, 


17. Newcastle disease vaccine 

inactivated 

Viral Ventri Biologicals 1 

18. Newcastle disease and avian 

infectious bronchitis vaccine 

inactivated 


19. Newcastle disease and infectious 

bursal disease vaccine inactivated 


20. Newcastle disease and avian 

bronchitis and infectious bursal 

disease vaccine inactivated 


21. R2B vaccine Viral BP Division, IVRI 1 

22. RDF vaccine Viral BP Division, IVRI 1 

Total= 55 batches 

(c) Development of standard reagents for 

standardization of enterotoxaemia vaccines 

Clostridium perfringens type 0 was revived and 

cultured to produce f. protoxin. The harvest was 

trypsinized and its toxic activity was detected to 

be 1500 rnld/rnl in mice. Epsilon was precipitated 

with 35% ammonium sulfate and freeze dried. The 

lethal activity of freeze dried epsilon toxin was 

found to be 100 MLD/mg. Minimum lethal activity 

of dried epsilon toxin was found at 10 I--lg leveL 

This freeze dried toxin and crude culture filtrate 

toxin was validated as epsilon toxin by

neutralization test with WHO standard epsilon 

antitoxin. It was found that 300 MLD of epsilon 

toxin is neutralized by 2 ill of epsilon antitoxin. 

Toxoid was prepared and used for repeated 

immunization of goat at 14 days interval to raise E 

antitoxin. After repeated immunization the 

antitoxin titre of the goat sera was found to be 80 

IV. The final freeze drying of epsilon toxin and 

epsilon antitoxin is underway for third party 

validation by June 2011. 

(d) Standardization of PCR for detection of 

extraneous agents in viral vaccines 

The PCR was standardized for detection of 

extraneous agents like pestivirus, chicken 

infectious anemia virus (CIAV) , egg drop 

syndrome virus (EDSV) and Mycoplasma. For 

pestivirus universal pestivirus primers were used 

for amplification of 5@NTR gene correspond to 284 

bp DNA. Another pair of primers were used for 

amplification of Ems-E1gene of 826 bp product (Fig. 

37).The primers based on the VP1 gene of CIAV 

were used for amplification of approximately 419 

bp product (Fig. 38). The primers based on the 

fragment J gene of Egg drop syndrome virus-76 

(EDSV) were used for amplification of 

approximately 230 bp product. This PCR will b e 

used for the detection of EDSV nucleic acid in 

poultry viral vaccines. (Fig. 39).The primers based 

on 16 s RNA gene of mycoplasma was used for 

amplification of approximately 460 bp product. 

Another pair of pnmer was used for amplification 

of approximately 150 bp product (Fig. 40). 

M 1 2 3 4 

( 284bp (5' NTR gene) 

Fig. 37: Amplified SCl>NTR and Ems-E1genc of pcstivirus: 

Lane M: Ladder; Lane 1 & 3: Positive samples, 

Lane 2 & 4: Negative control 

[4!.9bp (VP1 gene) 

IIWIRill 

All/llIal F?cport 

2010-11 

Fig. 38: Amplife d VPI gene of ClAY: Lane M: Ladder; 

Lan e 1: Positive samples, Lane 2: Negative control 

Fig. 39: Amplified Fragment J gene of EDSV: Lane M: 

Ladder; Lane 1: Positive samples, Lane 2: Negative 

control 

M 1 2 3 4 

[ -46Ob;" J 

\ -1S0bP ] 

Fig. 40: Amplified mycoplasmal genes: Lane M: Ladder; 

Lane 1 & 3: Positive samples, Lane 2 & 4: Negative 

control

(2) BACTERIAL PATHOGENS 

(a) Brucella spp. 

For characterization of the field isolates of 

Brucella by sequencing of the 31 kDa outer 

membrane protein (OMP 31) gene, PCR was 

standardized using set of designed primers. A 

total of 8 isolates were used in the study which 

consisted of 6 field isolates of B. melitensis and 2 

field isolates of B. abortus. The PCR product of 788 

bp was observed for B. melitensis (Fig. 48), whereas 

the band for B. abortus was of approx. 1000 bp (Fig. 

49). 

Fig. 48: Standardization of peR for OMP 31: Lane M: 

100 bp ladder, Lan e 1: 50.0°C, 2: 51.3°C, 3: 52.7°C, 4: 

53.8°C, 5: 54 .6°C, 6: 55.4°C, 7: 56.3°C , 8: 57. 3°C, 9: 58.7°C, 

10: 60.0°C, 13 : negative control 

788bp 

Fig . 49: OMP 31 PCR with d ifferent Brucella 

strains: Lane: 1-5. field isolates of Brucella melitensis, 6. 

B. abortus 544, 7. B. suis 1330, 8. B. canis Mex 51, 9. B. ovis 

63/290, 10. B. melitensis 16M, 11. 100bp DNA ladder, 12. 

negative control 

(i) Multilocus variable-number tandem-repeat 

analysis (MLVA) for typing of Brucella isolates: 

ML V A was performed for typing of Brucella 

isolates from India at sub-species level using the 

microsatellite primers. A total of 76 Brucella field 

isolates (14 Brucella abortus and 62 Brucella 

melitensis) along with 11 representative reference 

strains available in the Brucellosis Laboratory, Div. 

of VPH, IVRI were received and were checked for 

their purity, colony characteristics and 

biochemical characterization before analysis. 

Genomic DNA was extracted by Phenol 

Chloroform method. Seven microsatellite variable 

number of tandem repeat (VNTR) loci for ML V A 

were selected (Bruce 04, 07, 09, 16, 18, 21 and 30) 

and were PCR amplified. The products obtained 

from Brucella ML V A PCR were analyzed by 

agarose gel electrophoresis. The sizes of 7 

microsatellite Brucella VNTR PCR products were 

determined by comparing with standard strain's 

amplicon size (Brucella melitensis 16M, ATCC 

23456) and 20 bp ladder (Gene ruler - Fermentas). 

The respective number of repeat at particular loci 

was calculated using published BruceIla-VNTR 

allelic table. The genotyping data obtained was 

used for phylogenetic analysis and calculation of 

allelic profile frequencies' and allele frequencies 

with the help of START software version 1.0.5. The 

Brucella ML V A typing of 87 Brucella strain 

including 11 reference strains resulted in 58 

different profiles. The most common profiles were 

12, 5, 3, 5, 4, 8, 5 shown by 7 different strains with 

8.05% of dataset. Index of Association was 

calculated by formula IA= (Vo/V,,) - 1, where Vo= 

Observed variance and V,,= Expected variance. The 

V o was found to be 1.863 and V e was 1.189. Index 

of Association for present study for different 

Brucella isolates was 0.568. 

(b) Pasteurella multocida 

(i) Multiloeus sequence typing (MLST) analysis 

of Pasteurella multocida: MLST of six house 

keeping genes of Indian isolates of P. multocida 

was done. The PCR for the six house keeping 

genes v iz., adk (Adenylate kinase), est (Esterase), 

pmi (Mannose-6-Phosphate Isomerase, mdh 

(Malate Dehydrogenase), gdh (Glutamate 

dehydrogenase) and pgi (Phospho Glucose 

Isomerase) were standardized, which yielded 

amplicon size of 570 bp, 641 bp, 739 bp, 620 bp, 

702 bp, 784 bp, respectively (Fig. 50).

liWlrul 

Allnual Report 

2010-11 

1 

M 12 3 4 5 6M 

bp 

1000 

500 

Fig. 50: Amplification of housekeeping genes of 

P.multocida by peR for MLST: Lane M: 100 bp ladder, 

Lanel: adk gene (570 bp), Lane 2: mdh gene (620 bp), 

Lane 3: est gene (641 bp), Lane 4: gdh gene (702 bp). 

Lane 5: pmi gene (739 bp), Lane 6: pgi gene (784 bp) 

(ii) Cloning of Recombinant fiagellin protein of 

Clostridium chauvoei and fimbrial protein of 

Pasteurella multocida: To clone and express the 

FliC gene of Clostridium chauvoei and ptfA gene of 

Pasteurella multocida, primers were designed to 

amplify FliC and ptfA genes. Restriction enzyme 

sites were included in the primer sequences to 

facilitate cloning in the expression vectors. Upon 

PCR amplification, 570 bp fragment corresponding 

to FliC gene of C. chauvoei and 435 bp 

corresponding to ptfA gene of P. multocida were 

amplified as expected (Fig. 51 & 52). 

bp 

Fig. 51: Amplification of FliC gene of C. chauvoei 

bp 

Fig. 52: Amplification of ptfA gene of P. multocida 

(c) Salmonella spp. 

(i) Biofilm associated protein A (BapA): Sixty 

seven Salmonella isolates belonging to 34 serotypes 

employing designed primers were examined for 

the presence of BapA gene, which yielded positive 

result with a 667 bp clear band. The eluted 667 bp 

BapA gene was confirmed by internal RE digestion 

of the product using KpnI enzyme. The bapA gene 

was cloned into pGEMT easy cloning vector. The 

presence of the insert of -667 bp was confirmed by 

colony PCR and RE analysis. The cloned product 

of Salmonella Enteritidis (E-2478) BapA gene was 

sequenced, which showed maximum identity with 

S. enteritidis. 

(ii) Cloning of BapB gene of Salmonella: 

Complete sequence of BapB gene was amplified 

employing forward 5' - GCCATGG TGCTGG 

AAGGCCTGGCGGIT -3' and reverse 5 ' 

GGTCGACGGGAAGGG TAAAATGACCITC -3' 

primers. The bapB gene was successfully cloned 

into pTZ57R{T easy cloning vector. The presence 

of the insert of -1607 bp was confirmed by colony 

PCR and RE analysis (Fig. 53). The cloned product 

of Salmonella enteritidis (E-2478) BapB gene was 

sequenced. The S. enteritidis used in this study 

formed a single clad with other zoonotic Salmonella 

serotypes, whereas S. typhi was distinct from 

other strain of different serotypes. 

2886 bp plasmid 

1607 bp insert 

Fig. 53: Release of insert from pTZ57R/T vector after RE 

digestion with XbaI and Pst!: Lane M: 100 bp DNA 

Ladder; Lane B: Digested product (BapB gene) 

(iii) Presence of different virulence gene: A 

representative number of foo d isolates were

compared with human and animal isolates. The 

isolates were subjected to PCR for the detection of 

invA, hilA, fimH and stn genes. All the Salmonella 

isolates harboured in vA and stn genes, whereas 

94.59% of isolates had the presence of jimH and 

hilA genes indicating co Ionising, invasive and 

enterotoxic potential of the pathogen. There was 

no significant difference among isolates of 

different origin. 

(d) Verotoxic E. coli 

Detection of virulence genes among 58 E. coli 

isolates was attempted. stx1 and stx2 genes were 

present in 20.69% and 17.24% of E. coli isolates, 

whereas 8.62% isolates harboured both stx1 and 

stx2 genes. Out of 24 E. coli isolated from carrot,S 

(8.62%) and 4 (6.89%) were positive for stx1 and 

stx2, respectively, while 3 (5.17%) were positive for 

both stx1 and 2. Among turnip isolates, only stx1 

gene was present in 4 (6.89%) isolates. The 

presence of shiga-toxin producing E. coli was 

found be highest in green onion as out of 11 E. coli, 

9 were positive for stx genes. Our findings 

suggested that the occurrence of stxl gene was 

more than stx2 gene. 

PCR assay targeting eae gene revealed an 

overall prevalence of 24.14% among E. coli isolated 

from different vegetables. Higher number of E. coli 

isolates of carrot origin showed the presence of eae 

gene with an incidence of 12.07%, followed by 

turnip (6.89%), tomato (3.45%) and green onion 

(1.72%). 

Randomly amplified polymorphic DNA PCR 

(RAPD-PCR) was performed using genomic DNA 

of E. coli isolates with the random primers URP 6 

(s'-GGC AAG CTG GTG GGA GGT AC-3') and 

NSC II (s'-AGG GCC CGG G-3'). All the isolates 

were typable with primer NSC II with amplified 

fragments ranging in size from 0.25 to 1.5 Kb. The 

RAPD-PCR produced a complex DNA fingerprint 

pattems for all the isolates tested, thus showing a 

good discriminatory power for the typing of E. coli 

isolates. Visual comparison of the banding profiles 

showed that the pattems of isolates 4 and 5 (both 

from mint), 14 and 15 (coriander and chili) were 

closely related. One band each of approx. 1200 bp 

and 450 bp were common for almost all the 

isolates tested (Fig. 54). 

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 M 

IIWJ1ill 

AlIllual Ref''''-' 

2010-11 _ •• 

Fig. 54: RAPD-PCR DNA fingerprints of E. coli with URP6 primer: Lane 1-7: (mint isolates); Lane 8-14: (coriander 

isolates); Lane 15-21: (chilli isolates); Lane 22: Control and Lane M: 1 kb DNA ladder 

Investigations were conducted for molecular 060, 022, 0104, 01, 0114, 028, 028, 069, 091, 

epidemiology of verotoxic Escheriachia coLi isolated 060, 060, 091 and 0102, which were isolated 

from animals of North West Himalayan Region. from pup (rectum swab), pup (rectum swab), wild 

Serotyping of 31 E. coli isolates carried out at cat (caecum piece), guinea pig (lung piece), goat 

National Salmonella and Escherichia Reference kid (rectum swab), calf (rectum swab), calf (rectum 

Laboratory, Central Research Institute, Kasauli 

revealed that the eight isolates were untypable, 

one was rough, 13 verocytotoxigenic E. coli 

(VTEC), 2 enterotoxigenic E. coli (ETEC); one was 

positive for VTEC, ETEC and enteropathogenic E. 

coli (EPEC). Fourteen VTEC isolates included 091, 

swab), calf (rectum swab), goat kid (rectum swab), 

goat (rectum swab), nee] bull (caecum piece), neel 

bull (colon piece), cow (faeces) and rabbit (rectum 

swab), respectively. In vitro antibiotic sensitivity 

test of E. coli isolates against 7 antibiotics indicated 

highest sensitivity to polymyxin-B (82.4%),

JlWJ1Sli 


2010-11 

serovars of Leptospira such as Icterohaemorrhagiae, 

Grippotyphosa, Pomona, Hebdomadis, 

Hardjoprajitno and Australis. All the 40 Caprine 

sera samples tested positive for serovars 

Icterohaemorrhagiae and Grippotyphosa. Canine 

sera samples (16) were found positive for either 

Icterohaemorrhagiae or Grippotyphosa or for both 

the serovars. Out of the 12 human sera tested 

positive, 11 sera samples found positive for 

serovar Icterohaemorrhagiae while one serum 

positive for both Icterohaemorrhagiae and 

Grippotyphosa. 

(d) Q fever 

Out of 24 buffalo milk samples screened by 

trans-PCR assay targeting transposomes-based 

Coxiella burnetii-specific IS 1111 repetitive DNA 

sequence with an amplicon size of 243 bp using 

trans-3 and trans-4 set of primers (Fig. 71) and real 

time PCR, 3 (12.5%) were found positive. All the 

20 meat samples from slaughtered goats turned 

Fig. 71: Trans PCR-Positive Buffalo Milk Samples: Lane 

1: Negative sample, Lanes 2-5: Positive samples, Lane 6: 

Negative control, Lane 7: Positive control, Lane L: 

Ladder 

(f) Campylobacteriosis 

Out of 201 samples comprising of poultry 

caecum (quail 50, chicken 50), poultry meat and 

skin samples (50), human diarrheic samples (15) 

and dog fecal samples (36), 25 samples were found 

to harbour the Campylobacter organisms. The 

highest prevalence was recorded in quail caeam 

samples (18%), followed by samples from chicken 

caecam (16%), chicken meat (13.3), chicken skin 

(10%) and dogs (5.5%). All the human faecal 

samples tuned to be negative. Out of the total 36 

vegetable samples, 2 samples, one each from 

cauliflower and coriander leaves revealed the 

presence of Campylobacter spp. 

(g) Arcobacter infection: 

A total of 383 samples viz. poultry (147) and 

pig faeces (63), chicken meat (94), pork (39) and 

beef samples (40) were processed for the isolation 

and identification of Arcobacter spp. PCR was used 

for the detection of genus Arcobacter using 

published primers (Fig. 72). Highest prevalence of 

Arcobacter was found in chicken meat (17.02%), 

followed by poultry faeces (14.28%), pork 

(10.25%), pig faeces (7.93%) and lowest in beef 

(7.5%). 

1223 b 

500b 

Fig. 72: Confirmation of Arcobacter isolates through 

genus based PCR: Lane M: 100 bp DNA ladder, Lane 1: 

Positive control DNA of Arcobacter butzieri, Lane 2,3,4, 

5 & 6: positive for genus Arcobacter. 

(h) Other bacterial diseases 

A total of 1446 samples including 679 serum 

and other clinical (477), morbid (162) and other 

(128) samples were collected/received for 

bacteriological analyses from the states of AP (12), 

UP (727), UK (361), JK (5), MH (218), Punjab (25), 

MP (184), Orrisa (4) etc. On bacteriological 

analysis, isolates of 14 different bacterial species 

were isolated. Fifty serum samples of 679 were 

tested positive for brucella antibodies. None of the 

90 animals screened for TB and JD were positive. 

Apart from this, 953 slides of rectal pinch, blood 

smear, dung smear, milk smear from different 

military forms of UP, Punjab, J&K, AP and 

Maharashtra etc. were stained and screened for 

acid fast bacterium, of which 30 slides showed 

presence of acid fast bacilli. 

(3) MYCOTIC INFECTIONS 

A total of 120 samples suspected for presence 

of fungal agents. Out of sixty eight samples from 

dog, 7 were found positive for Candida spp., 6 for

Malassezia spp. and 5 for Alternaria spp., 3 for 

Cladosporium spp., 2 each for Aspergillus flavus and 

Aspergillus niger, 1 each for Helmintosporium spp., 

Penicillium spp., Geotrichum spp., Trichosporum 

spp., Chrysosporium spp., Rhodotorulla spp. and one 

for Mucor spp., Pecilomyces spp. Out of 10 samples 

from buffalo, 2 samples were found positive for 

Alternaria spp., 1 for Trichosporum spp. and for 

Fusarium spp. Out of 3 samples of cattle, 1 sample 

was found positive for Dermatophyte spp., 1 for 

Malassezia spp. and 1 for Candida spp. Five samples 

from goat were also collected among them 1 each 

sample was found positive for Malassezia spp., 

Cladosporium spp. and Alternaria spp. Of the 6 

fungal samples from the horses, 1 each sample was 

positive for Cladosporium spp., Aspergillus niger, 

Candida spp., Fusarium spp. and Mucor spp. Two 

samples from pig were positive for Candida spp. 

Twenty six samples from human cases were 

collected having history of chronic fungal 

infection, of which 7 samples were positive for 

Alternaria spp., 5 for Candida spp. and 3 for 

Dermatophyte sp and 1 each for Malassezia spp. and 

Cladosporium spp. 

In addition, out of 12 samples from soil, 3were 

found positive for Chrysosporium spp. and 1 each 

for Penicillium spp. Aspergillus niger and Aspergillus 

flavus. Out of 5 samples from straw 1 was found 

positive for Mucor spp. and 1 each for Rhizopus 

spp. and Aspergillus niger. Out of 68 samples of 

milk, 12 samples were positive for Candida sp, 16 

for Aspergillus niger, 15 for other Aspergillus spp. 

and 5 for Cunnighamella spp. 

(4) PARASITIC DISEASES 

A total of 175 faecal and 114 blood samples 

were collected and screened for parasites. Major 

species of parasites recorded were Ancylostoma 

caninum and Toxocara canis. 

(a) Ilaemonchosis 

Epidemiological studies on G.!. Parasitism 

were conducted in the Rohilkhand region. Out of 

2792 faecal samples of sheep examined for the 

presence of G.!. parasitic infection, 1889 (67.65%) 

were found positive for strongyle infection. 

Coproculture studies revealed 93.96% infection 

with Haemonchus during September, 2010 and 

October, 2010, whereas during January 2011 to 

March, 2011 the infection declined and infection 

rate was 73% during January and 40% during 

March. In goat, out of 4016 faecal samples 

llWllill 


2010-11 ..... 

examined, 2754 (68.01%) were found positive for 

strongyle infection Coprocultures studies revealed 

86-70% infection with H. contortus and higher 

infection rate during July 2010 to December 2010. 

Trichostrongylus infection was prevalent 

throughout the year and higher incidence was 

recorded during February 2011. Oesophagostomum 

infection was prevalent (1-4%) during July to 

December. Infective larvae on the herbage were of 

H. contortus, Oesophagostomum spp. and 

Trichostrongylus spp. H . contortus larvae were 

maximum (761.9 L3/kg DH) during the month of 

October 2010. The environmental temperature was 

found detrimental for infective larvae of H . 

contortus. Epidemiological studies in the 

Rohilkhand region revealed that H. contortus was 

predominant infection in small ruminants with 

other major infections being Trichostrongylus and 

Oesophagostomum (Fig. 73). 

Fig. 73: (a) Larva of Haemonchus (b) Larva of 

Oesophagostomum from herbage

JlWlfill 

Annual Report 

_ .... 2010-11 

(b) Cryptosporidiosis 

A total of 347 faecal samples of domestic 

animals and humans were examined 

microscopically for the presence of Cryptosporidium 

spp. oocysts. Out of 72 buffalo calves, 96 cattle 

calves, 65 goats, 56 sheep, 13 dogs, 28 piglets and 

17 human faecal samples examined, 22 buffalo 

calves, 25 cattle calves, 8 goats and 4 sheep were 

found positive for Cryptosporidium infection. 

Maximum infection was recorded in cattle and 

buffalo calves below 15 days of age and calves 

having diarrhoea. 

Duration and quantity of oocyst output in six 

naturally infected cattle calves were also studied. 

Oocyst shedding continued for 6 to 8 days. Oocyst 

count in heavily infected cattle calves recorded 

was L09xl0 6 oocysts/g of faeces. Fatal infection 

was recorded in calves born prematurely. None of 

the dogs, piglets and humans examined was found 

positive. 

Out of all the staining techniques tried, viz., 

modified Ziehl-Neelsen, Kinouyn's modified, 

negative and Giemsa staining, modified Z-N 

staining was found to give best results for 

identification of oocysts. The method was 

standardized in the laboratory for screening of 

samples in prevalence study. 

Oocyst of Cryptoporidium spp. were purified 

by ether treatment of faecal samples, followed by 

modified Sheather's sugar solution flotation 

technique. Highly purified oocysts (Fig. 74) were 

preserved in antibiotic solution for further use. 

Fig. 74: Purified oocysts (phase contrast X400) 

(c) Toxocariosis 

Out of total 391 faecal samples comprising 238 

from owned and 153 from stray dogs, 104 (26.5%) 

samples were found positive for T. canis eggs. The 

infection rate was higher (37.25%) in stray dogs in 

comparison to owned dogs (19.75%). Young dogs 

of < 6 month age had higher infection rate in both 

stray (62.2%) and in owned (45.16%). 

Twenty eight (9.55%) of 293 soil samples 

collected from playgrounds, public parks, side 

walks and premises of veterinary clinics were 

contaminated with T. canis e 

Fig. 75: Toxocara canis eggs in faecal samples 

(d) Other parasitic diseases 

A total of 827 samples compnsmg of fecal, 

blood/impression smears, skin scrapings, preputial 

washings and parasitic specimens either received 

or collected from different sources were examined 

for parasitic diagnosis. Of the 220 fecal samples 

examined, 94 were positive for gastrointestinal 

parasitism. Strongyle and amphistome infection 

was the most prevalent infection in animals. Of the 

175 blood samples examined, 18 were positive for 

blood protozoans iT\cluding four from horses 

(Babesia equi, 3; Trypanosoma evansi, 1) and 14 from 

cross-bred cattle (Theileria annulata). Two 

specimens recelved for identi fication from tiger 

were Physaloptera praeputialis. Out of 7 skin 

scrapings, 4 from buffaloes of Uttarakhand were 

positive for mixed infection of Sarcoptes scabei var 

bovis and Psoroptes bovis. Preputial washings of 422 

bulls examined for Trichomonas foetus concluded 

negative for the infection. Trypanosoma lewisi was 

diagnosed in the blood sample of a 37-day old 

baby of Distt. Bagpat (UP).

Parasitic diseases of wildlife 

The material/samples collected from wildlife, 

domestic/ pet animals, received from various 

places mainly through the Centre for Wildlife 

T a bi e 5 : P araSl "t es 1 "d en t"£" 1 Ie d" msamp. I es 0 f "ldld 

IIWIRII 

Annual Report 

2010-11 

Conservation (CWL) of the Institute for 

identification/diagnosis were thoroughly 

examined and report is shown in the Table 5. 

WI omes t" Ie anrma I 5 

SI.No" Animal Material/Sample Agency Report 

1. Calves 1. Faecal samples 1. B & MDiv., IVRI, 1. Coccidiosis (6), Strongyle 

(8 + 11 nos) Izatnagar infection (1 +2) 

2. Blood smears 2. -do- 2. Anaplasma marginale (1 +5) 

(10 +11 nos) 

3. Blood smear (1) 

3. -do- 

2. Spotted deer Faecal samples (10 nos) CWL, IVRI, Izatnagar Amphistome eggs in all. 

3. Dog Blood smear with blood 

sample 

SSB, SHQ Gorakhpur Babesia gibsoni 

4. Goat Faecal samples (15 nos) P & C Div., IVRI, Izatnagar Coccidian oocyst in all. 

5. Insects Midges CADRAD, IVRI, Izatnagar Culicoides spp. 

6. Peacock 1. Intestinal parasites CWL, IVRI, Izatnagar 1. Raillietina tetragona 

2. Caeca] parasites 2. Sloughed off mucosa of 

intestine. 

7. Black buck 1. Rumen parasites CWL, IVRI, Izatnagar 1. Amphistomes 

2. Faecal sample (Gastrothylax sp.) 

(3 nos) 2. Strongyle & Amphlstome 

eggs (3) 

8. Royal Blood samples CWL, IVRI, Izatnagar All negative 

Bengal Tiger (4 nos) . 

9. Cattle Blood samples Graphic Era Univ., Theileria annulata (mild) with 

(7 nos) Dehradun Anisocytosis, Leucopenia (1), 

T. mmulata (2) 

10. Cow Slides & blood samples Graphic Era Univ., Anaplasma in all 

(2+4 nos) Dehradun 

11. Cow & Faecal samples LPM (C& B), IVRl, Izatnagar Nematode eggs (4) 

buffalo Fasciola eggs (1) 

Amphlstome eggs (4) 

12. Chi tal Faecal samples (3 nos.) CWL, IVRI, Izatnagar Amphlstome eggs (3) 

13. Hog Deer Faecal sam.l'le CWL, IVRI, Izatnagar Negative 

14. Nilgai Faecal sample CWL, IVRI, Izatnagar Stronhyle, amphistome & 

Fasciola eggs 

15. Jaguar Blood sample CWL, IVRI, Izatnagar Negative 

16. Fishing cat Faecal sample CWL, IVRI, Izatnagar Spirometra sp. & Capillaria sp. 

eggs 

17. Cow Dung sample ADDL, Vizianagaram (AP.) E. zuerni oocysts 

18. Goat Dung sample ADDL, Vizianagaram (AP.) Eimeria spp. oocysts 

19. Elephant Faecal sample CWL, IVRI, Izatnagar N.AD. 

20. Dog Blood sample SSB, SHQ Gorakhpur N.AD. 

21. Equine 1. Faecal sample CMV Lab., Meerut 1. Strongyle eggs 

2. Liver fluke 2. Fasciola spp_. 

22. Bovine Blood smear CMV Lab., Meerut Over staining & faulty smear 

23. Leopard 1. Faecal sample CWL, IVRI, Izatnagar 1. Physaloptera & Cotylode 

2. Stomach worms eggs. 

3. Intestinal content 2. Physaloptera sp. 

3.N.AD.

concentration of nitrite suggesting nitrite toxicity 

in these animals. 

(8) REGISTRY OF PATHOLOGY AND 

ONCOLOGY 

During the period under report, a total of 975 

specimens of important pathological conditions 

were maintained in the registry museum with 

proper fixative. System wise specimens were 

catalogued as urinary system-89, respiratory-159, 

nervous-13, gastrointestinal-237, haemic-25, 

cardiovascular-89, reproductive-184, lymphatic-72, 

muscular and skeletal-23 and miscellaneous-89. 

Twenty-one new specimens were added. 

Photography of museum specimens of different 

systems was carried out for preparation of suitable 

teaching aid for the students. 

(9) ESTABLISHMENT OF NATIONAL 

VETERINARY SCIENCE MUSEUM 

Photography was done at IVRI Campus, 

Bangalore, PDADMAS, Bangalore, UAS Hebbal, 

Bangalore, T ANUV AS, Chennai and ancient 

historical sites at Mahabalipuram, Tamilnadu. 

Centenary Veterinary Science Museum, 

T ANUV AS, Chennai was also visited and 

necessary information for setting up a Veterinary 

Science Museum were collected. Historical 

pictures of IVRI Campus, Bangalore and old and 

modern FMD vaccine manufacturing units were 

taken. Experimental sheds of Yehalanka were also 

visited. PDADMAS, Bangalore was visited and 

photography of this rCAR Institute was also done. 

Similarly, College of Veterinary Sciences, UAS, 

Bangalore was visited and historical interest 

photography of certain departments was done. 

Information and photography of historical 

buildings and certain departments of Madras 

Veterinary College was done. Photography of 

statues of animals like bulls, elephants, monkeys, 

ancient cattle, calves, wild life, birds etc. were 

done at Mahabalipuram. Related information was 

also gathered. Excellent photo album of same was 

prepared. In addition, Museum of Michigan State 

University, East Lansing, MS, USA was visited on 

a private visit. Information for setting a museum 

was collected and will be utilized for establishing 

Museum of Veterinary Science at IVRI. 

(10) OUTBREAK INVESTIGATIONS 

• HCN and phosphene poisoning in free range 

cattle (about 250) under forest area of 

Mandawar and villages- Shakurpur, 

Mohanpur and Bhagwatipur in the basin of 

river Ganga (27th April, 2010). 

• Acute fasciolosis and amphistomosis in cattle 

and buffalo in villages Saidpur and Akat 

under block Faridpur, U.P. (5th June, 2010). 

• Rabies outbreak in Military Dairy Farm, 

Bareilly, UP (18 th June, 2010). 

• GI parasitism in horses at Pashulok, Rishikesh, 

Dehradun, UK (12th and 13th July 2010). 

• Mite infestation and lameness due to nutrional 

deficiency in buffaloes of village Kanda and 

Nawagarh, Tehri Garhwal, UK (13th and , 14th 

July, 2010). 

• Parasitism in cattle of village Dopeheria, 

Baheri, Bareilly, UP. (215t August 2010). 

• Testing of cattle and buffaloes for TB, JD, 

Brucella and IBR at LPM (C&B), rVRI. UP. 

(August/Sept. 2010). 

• Pasteurellosis in buffaloes of Swar, Rampur, 

U.P. (9th September 2010). 

• GI parasitism in goats in village Rahapur, 

Bareilly, UP. (14th October 2010). 

• Surra in horses (5 th October, 2010) at Saidpur 

Majha in Faridpur area of Bareilly. 

• Health status checkup of black Bucks in 

National Zoological Park, Delhi (18th October 

2010). 

• Treatment of elephant having multiple skin 

wounds in Dudhwa Tiger Reserve, Palia, U.P. 

(215t Oct., 10). 

• Glanders in equines in Village Akbarpur 

Jhojha, Rasulpur Nangla of Tehsil Chandpur, 

Distt Bijnor, UP. (30.12.2010). 

• Health status checkup of horses at Police 

Academy, Moradabad (Dec. 2010). 

• Investigation of mortality in animals of 

villages of Aonla, Bareilly (Dec. 2010). 

• Porcine juvenile dermatitis/pox in grower pigs 

at IVRI piggery farm, Bareilly, UP. (12 Jan., 

11). 

• Bird flu in ducks at RK. Nagar Exotic Duck 

Breeding Farm at Tripura (Agartala) (19-21 

Feb., 11). 

• Marek's disease in layer birds (California 

shed) of CARl, Izatnagar, U.P. (4th March, 11). 

• Blackquarter (BQ) in a villages of block 

Chowdwr under Distt Cuttack, Orrisa. (14th to 

17th March 2011). 

• Leptospirosis in wild animals at Jodhpur Zoo, 

Rajasthan (23 and 24th March, 11).

JJ, W il&U, 

Alllllllil [

IlWillII 


_2010-11 

(b) First detection of border disease virus (BDV) 

in Indian sheep 

During surveillance for exotic pestiviruses, 

border disease virus was detected in Indian sheep 

by virus isolation, nucleotide sequencing and 

transmission electron microscopy. The clinical 

signs observed were barren ewes, abortions 

between 2 to 2.5 months, stillbirths, birth of small 

weak lambs, fleece abnormalities (hairy fleece and 

brown/black pigmentation). A total number of 272 

sheep from a farm in the state of Jammu & 

Kashmir were sampled of which 144 (52.9%) sheep 

were found positive for BDV neutralizing 

antibodies and BDV was isolated from eight 

sheep. Antigenic analysis using monoclonal 

antibodies typed the isolates as BDV. The genetic 

analysis in 5' -UTR and Npco region revealed that 

Indian BDV isolates fall into BDV -3 subtype. 

(c) Genetic and antigenic characterization of 

bovine viral diarrhoea-2 isolated from Indian 

cattle: 

Genetic and antigenic analysis of the cattle 

BVDV-2 isolate was carried out. Nucleotide 

sequencing and genetic analysis in 5' -UTR, NpJO, 

entire structural genes (C, Ems, El and E2), nonstructural 

genes NS2-3 besides 3'-UTR 

demonstrated that the nucleotide and amino acid 

sequences showed highest similarity with BVDV- 

2. The entire 5' and 3' -UTR consisted of 387 and 

204 nucleotides, respectively and an eight 

nucleotide repeat motif was found twice within 

the variable part of 3' -UTR that may be considered 

as a characteristic of BVDV-2. The phylogenetic 

analysis revealed that the cattle isolate and earlier 

reported goat BVDV-2 isolate fall into separate 

clades within BVDV-2a subtype. Antigenic typing 

with monoclonal antibodies verified the cattle 

isolate also as BVDV-2. In addition, crossneutralization 

tests using antisera raised against 

Indian BVDV strains circulating in ruminants 

(cattle, sheep, goat and yak) displayed significant 

antigenic differences only between BVDV-l and 

BVDV-2 strains. Identification of BVDV-2 earlier in 

goats and sheep and now in cattle may have 

important implications for immunization 

strategies and molecular epidemiology of BVD. 

(4) SCREENING OF QUARANTINE SAMPLES 

FOR RINDERPEST 

Two samples of ox bile solids received from 

AQCS, were tested against rinderpest by RT-PCR 

using primers targeting F gene (RP/F3 F and RP/F4 

R), H gene (RP/24/H3 F and RP/HSR6 R) and L 

gene (rpl_F12 and rpl_R12). Both of these samples 

were found negative for Rinderpest virus and the 

result intimated to AQCS accordingly. 

(5) CRIMEAN CONGO HAEMORRHAGIC 

FEVER 

(a) Screening of samples by RT-PCR 

A team of Scientists from HSADL visited Kolat 

and surrounding villages in Sanand block near 

Ahmadabad on 21.01.2011 regarding screening of 

animals for CCHF. The details of the samples 

received and the results of the lab tests conducted 

at HSADL, Bhopal are as below: 

Bovine sera 576 

Bovine blood samples 47 

Tick pool samples 48 

Flea's pool 01 

Rat sera 19 

Rat tissues 28 

Mice tissues 06 

Total 725 

92 serum samples were tested by sandwich 

ELISA for CCHFV antibody detection. But the test 

results were invalid. The reagents were a kind gift 

from OIE referral lab for CCHF, France, obtained 

in 2009. So it appears that the kit components had 

probably expired. Hence, further antibody testing 

by ELISA was not carried out. 

All the samples were processed for RNA 

extraction, followed by RT-PCR using CCHFV 

genome specific primers. A total of five pairs of 

published primers, namely 188F-645R, F2-R3, F3- 

R2, PS1-PS2 and PS3-PS4 were used. 

PBL were separated from whole blood samples. 

PBL pools, each representing 2 to 5 samples were 

used for isolation in Vero cells and RT-PCR. Four 

serum/pBL samples reported to be positive for 

CCHFV at National Institute of Virology, Pune 

were also tested by RT-PCR. Both one-step as well 

as two-step RT-PCR was carried out. RT-PCR was 

also carried out using RNA extracted from first 

passage Vero cells. 

Reverse transcription was carried out with 

random hexamers as well as specific primer. 

Several variations of the PCR conditions, including 

annealing temperature, MgCh concentrations, etc 

were carried out. One limitation of the PCR assays 

was that HSADL has no known positive control

(10)PICOBIRNA VIRUS 

A picobima virus was isolated during the 

processing of fecal samples (bovine calf) suspected 

for rota virus infection and preliminary 

confirmation was done. This is a dsRNA virus 

belonging to family Picobirnaviridae and is a cause 

of gastroenteritis in animals and humans. 

7. DEVELOPMENT OF ALTERNATE 

SYSTEMS OF THERAPY 

(1) HERBAL REMEDIES 

(a) Herbal acaricides 

(i) Identification of effective herbal extract 

By dose-dependent assay the LC90 value of 

50% hydro-ethanol extract of A. calamus rhizome 

IIWmII 

Annual RCfJ(lrt 

2010-11 

was calculated as 11.3%. The anti-tick activity of 

this extract against IVRJ-I strain of R.(B.) microplus 

was substantiated by a mortality rate ranging from 

40-100%. The in vivo efficacy of the extract was 

42% and repeat in vivo application on cattle was 

recommended in 7 days intervals as aqueous 

solution (Table 1). No adverse reaction of this 

extract was seen in rabbit model when applied 

topically with five times higher dose. The presence 

of a-Asarone in the extract has been identified as 

marker compound (Fig. 82-84). 

I a bl e 1 : I n VIVO e ffi cacyo fA . ca amus r biz omeex tr ac t agams tR (B) mlcrop'us. 

Efficacy of extract Group 

Tick wt. 

(mg) 

Mean:tSE 

Mortality 

% 

Mean:tSE 

Egg mass 

(mg) 

Mean:tSE 

RI 

Mean±SE 

DR 

% 

DO 

% 

E% 

14 days post larval I 136.8±S.4 4.5±4.5 7l.2±2.9 O.456±O.O1 - - - 

challenge II 118.1±3.2b 21 .2±5.2 49.5±2.1c O.389±O.01 c 13.7 31.2 40.6 

7 days post extract I 14B.3±3.7 9.1±O.8 

application II 119.7±4.OC 10.6±5.5 

15 days post I 128.5±3.8 S.2±5.2 

extract application II 124.1±3.2 9.4±3.1 

. . . . . . 

'SIgnificant at P

other isolates collected from the different agroclimatic 

regions was grouped either in level I or II. 

The average RF values were lowest in the transgangetic 

regions (6.1) and the highest (26.65) in the 

middle-gangetic regions. It was observed that 

between resistant levels I to III there was no 

significant effect on production of egg masses in 

dose dependent manner. Due to continuous use of 

the OP compounds the environmental load of 

diazinon has become high in the area. This is the 

first experimental data generated on diazinon 

resistant status in ticks of India. 

(iv) Repository of reference tick lines for testing 

herbal acaricides 

Following five biologically and genetically 

characterized tick lines have been generated and 

maintained in the Entomology Laboratory of 

Par 

IVRI-II 

IVRI-III 

IVRI-IV 

IVRI-V 

Laboratory selected deltamethrin resistant 

(resistant factor= 41.4) R. (B.) microplus with 

mutation at sodium channel 

Multi-acaricide resistant R. (B.) microplus 

with mutation at sodium channel 

(v) Genetical characterization of reference tick 

lines used in testing herbal acaricides 

PCR amplification of mitochondrial 165 rDNA 

of IVRI-I and IVRI-II strain yielded a fragment of 

449 bp and of 454 bp, respectively. The amplified 

product was directly used for sequencing. The 

GenBank accession numbers for these sequences 

are as follows: Hm176656, Hm176658, Hm176657, 

GU222462, GU323287, GU323288. 

A high sequence similarity of 165 rDNA 

(99.8% or more) was observed between the 

different stages of the colony of IVRI-II strain. 

Alignment of sequence data showed that 30 

nucleotides across this hypervariable region of 

mitochondrial 165 rDNA were conserved in 

Hyalomma species (IVRI-II), while corresponding 

nucleotides in Rhipicephalus (IVRI-I) species were 

different but conserved among Rhipicephalus spp. 

The nucleotide substitution between Hyalomma 

IIWillII 


2010-11 

and Rhipicephalus species were found to be 

transversion. The most frequent transversions 

were of A

of infective L3 larvae of H. contortus at 100 f.lg/ml 

concentration within one hour of incubation. 

(e) Bio-prospecting of locally available 

medicinal plants with particular reference to 

Sea buckthorn (Hippophae) species for 

biomolecules with therapeutic potential 

Mature and fresh leaves of sea buckthorn were 

collected from Lahual and Spiti district of 

Himachal Pradesh. Oven dried, air dried and 

freeze dried leaves were subjected to methanol, 

water and methanol: water (1:1) extraction. Total 

phenolics and flavonoid contents were estimated 

in the extracts. Relatively good anti-oxidant 

activity in all these extracts was demonstrated by 

DPPH assay in comparison to standard 

antioxidan ts. 

(f) PharmacodynamiC investigations of Entada 

pllrsaetha and its therapeutic potential 

Alcoholic extract of Entada Pursaetha (PSE) 

stem has been studied for its protective effect on 

inflammatory bowel disease (IBO) in mice and 

monosodium iodoacetate (MIA)-induced 

osteoarthritis in rats. PSE at 30, 100 and 300 mg/kg 

was administered orally to male mice. The 

protective effect of PSE in IBO was tested by 

employing dextran sulphate sodium (DSS) model 

of IBD in male albino mice. PSE significantly 

reduced disease activity index (OAI) score, but did 

not significantly increase colon length. PSE also 

failed to decrease colon wt./length ratio and 

macroscopic scare significantly. PSE treatment 

produced significant decrease in lipid 

peroxidation, nitrate-nitrite content and 

myeloperoxidase activity in colon tissue, which 

were increased by DSS. PSE significantly increased 

catalse and superoxide dismutase activity, but 

failed to increase GSH level significantly in colon 

tissue, which was depleted by OSS. Histological 

score and histopathological changes of colon were 

reduced by PSE treatment. 

MIA was used to induce osteoarthritis in rats 

by single injection of 3 mg of MIA in 50 f.ll of 

normal saline, administered in joint cavity of right 

knee in all the groups of rats on day 0 except naive 

control. PSE and etoricoxib were administered 

orally daily up to 21 days. Pain assessment was 

done on day 0 (before MIA administration) and on 

days 7, 14 and 21, of drug administration. lntraarticular 

injection of MIA caused significant 

hyperalgesia to mechanical, heat and cold stimuli 

IT'WillII 

All/llIal Report 

2010-11 

in rats which was reduced by different doses of E. 

Pursaetha extract and etoricoxib. There was 

significant reduction in horizontal and vertical 

movements due to MIA-induced pain in rats. 

These movements were increased by drug 

administration possibly due to reduction in pain 

suggesting that analgesic effect of Entada Pursaetha 

and also of etoricoxib is not due to depressant 

effect on the central nervous system. 

(g) Herbo-mineral formulation for amelioration 

of lead toxicity 

Four herbs, one sea food and three mineral 

elements were selected for the study. The baseline 

data for the herbs was completed by estimating 

levels of lead, cadmium and micro-elements and 

level of lead in drinking water and IVRI feed 

provided to laboratory animals (albino male rats 

weighing 70-150 gm). Hydro-ethanolic (1:1) extract 

of all the herbs and the extract recovery varied 

from 7-18%.36 male albino rats weighing 70-150 g 

were distributed randomly into 6 groups each 

containing six rats. Zero day level of lead, 

cadmium., copper, zinc, iron were within the 

normal limits. Experimentation for prophylactic 

efficacy of these extracts for amelioration effect 

against lead toxicity revealed that few hydroethanolic 

extract showed potential as ameliorative 

agent for lead in both kidney and blood. 

(h) Ethno veterinary medicine 

A polyherbal formulation for amelioration of 

fluoride toxicity has been developed by the 

Division of Medicine and was tested on clinical 

cases of fluorosis in Chitorgarh district of 

Rajasthan. The study was for 3 months duration. It 

has been recorded that the herbal formulation is 

capable to reduce body fluoride burden by 

enhancing excretion of fluoride in urine. The 

beneficial effect was recorded over general health, 

work performance and alleviation of pain. 

(2) HOMOEOP A THIC THERAPY 

Three homeopathic medicines/their 

combinations were evaluated for in vivo 

immunomodulatory and anti-oxidant potential in 

laboratory animals. The results indicated that 6C 

potency was better with respect to 

immunomodulatory as well as anti-oxidant 

potential. Further, effecbve immunomodulatory 

and anti-oxidant drugs were identified. 

Homeopathy has also been tried with encouraging 

results in the management of diarrhoea and fever.

IIWIlliI 

AlUJIlni Report 

_2010-11 

(3) CLINICAL EVALUATION OF HERBAL 

AND HOMEOPATHIC AGENTS FOR 

AUGMENTATION OF WOUND HEALING 

IN DOMESTIC RUMINANTS 

The study was conducted on different species 

of animals brought for treatment to the Referral 

Veterinary Polyclinics. Various medicaments were 

used on the merit of the case irrespective of age, 

sex and species of the animal. The treatment 

consisted of local application of the herbal extracts 

(CO, TP and AD), oral homeopathic drugs (GR, 

AA, S1 and SU), combinations of the best two 

drugs and was compared with normal saline 

treated animals, which served as control. In all the 

cases, suitable antibiotics were administered. The 

healing effect was assessed based on clinical 

observations, wound morphology (exudate, 

peripheral swelling and colour and type of 

granulation tissue, epithelization and wound 

contraction), haematological and biochemical 

parameters. The mean rectal temperature varied 

from 37.87 to 38.67°C the heart rate varied from 

62.17 to 79.83 per minute and the respiratory rate 

varied from 18 to 22.5 per minute. The mean 

values of haemoglobin varied between 9.8 and 12 

g/dl, which were within the normal physiologic 

limits. The mean values of neutrophil, 

lymphocyte, monocyte and eosinophil ranged 

from 33% to 38%, 53% to 59%, 1.66% to 4.17% and 

2.66% to 5%, respectively. The mean plasma 

glucose, total protein and albumin varied from 

65.88 to 90.37 mg/dl, 5.86 to 9.27 g/dl and 3.09 to 

4.3 g/dl, respectively. Wound contraction was 

observed on 10 th day after treatment and the 

granulation tissue bed below the level of skin 

surface was observed on day 21 post treatment. 

In the animals treated with local application of 

plant extracts, CO was found to be effective 

wound accelerator as compared to TP and AD. In 

the homeopathic drug treated animals, GR was 

found to possess relatively better healing effect as 

compared to other drugs like AA, SI and Su. The 

animals treated with combined drugs of CO and 

GR showed early wound healing as compared to 

single treatment effect of CO, GR and positive 

control animals. In all these animals, no other side 

effect was observed and the animals responded 

well to the treatments. 

(4) EV ALUA nON OF WOUND HEALING 

POTENTIAL OF COELOMIC FLUID AND 

EARTHWORM PASTE 

The study was conducted in two phases. In 

phase 1, 16 rabbits of about one year of age were 

used. The animals were anaesthetized with 10 

mg/kg xylazine and 50 mg/kg ketamine given at 5 

min. interval. Full thickness excisional wounds 

were created in the skin of the dorsum in each 

animal using a sharp knife. A total of 4 wounds 

were created in each animal; two on the left side 

and two on the right of the midline. Each wound 

was created to have a dimension of 2x2 cm and a 

gap of 2 em was maintained between the wounds 

on each side. The wounds were treated by 

application of coelomic fluid in group t cleaning 

with 0.5% povidone-iodine followed by 

application of coelomic fluid in group II, cleaning 

with 0.5% povidone-iodine in group III, and 

cleaning with normal saline in group IV. The 

evaluation of healing in wounds was done by 

histomorphological studies on days 21 and 28. 

Biopsy samples were collected from 4 animals at 

each interval under general' anaesthesia and 

tissues were processed and stained to study 

histomorphological changes to compare the 

wound healing between the groups. In 

comparison to control groups the wounds treated 

by coelomic fluid had more dense and thick 

collagen fibres and .showed more fibroblasts of 

collagen phenotype on day 21. Epithelization was 

better in the treated wounds as compared to the 

control wounds. Collagen fibre density and 

thickness were recorded were more in the wounds 

treated by coelomic fluid alone or in combination 

with beta dine by day 28. 

In phase II of the study, 12 New Zealand 

White rabbits of either sex, and 1.5-2.0 kg b.wt. 

were used for evaluation of coelomic fluid for its 

efficacy in the healing of full thickness skin 

wounds. The animals were divided into two 

groups. All the animals were anaesthetized with 

xylazine 5 mg/kg and ketamine 50 mg/kg given 

intramuscularly 10 min apart. Two full thickness 

square wounds of 2x2 em dimension were created 

in each animal; one on each side of the dorsal 

midline. The wounds in the animals of group I 

were treated with coelomic fluid and the animal of 

group II were treated with normal saline, both 

agents applied topically regularly till the collection

of biopsies. The animals were observed for wound 

contraction and photographed for evaluation of 

gross healing. Two animals from each group were 

used for the collection of biopsies on days 14, 21 

and 28 for histological evaluation of wound 

healing. The faster wound contraction and overall 

wound healing was recorded in the animals 

treated with coelomic fluid as compared to the 

control animals. It was concluded that coelomic 

fluid has the potential to accelerate wound healing 

of full thickness skin wounds in rabbits. Clinical 

trials in a few animals confirmed the results of 

experimental study. 

(5) BACTERIOCIDAL EFFECT OF 2- 

NITROPROP ANOL AGAINST SELECTIVE 

FOODBORNE BACTERIAL PATHOGENS 

Minimum inhibitory concentration (MIC) of 2nitropropanol 

(2-NPOH) for growth inhibition of 

Salmonella Typhimurium, Salmonella Gallinarum, 

E. coli 0157 and E. coli was assessed where 3.5 rnM 

of 2NPOH found to be MIC for growth inhibition 

of Salmonella Typhirnurium. Similarly, 1.5 rnM was 

recorded as MIC for growth inhibition of 

Salmonella Gallinarum, E. coli 0157 and E. coli 

0157:H7. Effect of pH of the media (without 2- 

NPOH) on growth of the above organisms was 

evaluated and found that none of these 4 bacterial 

cultures could grow in the media (Tryptic soy 

broth), where pH was maintained below 7.0. 

Hence, effect of 2-NPOH on these organisms could 

be assessed adopting the media pH above 7.0. 

To know the effect of pH for felicitation of 

growth inhibitory function of 2-NPOH, test was 

conducted using slightly lower levels than the 

MIC of 2-NPOH in tryptic soy broth (TSB) with 

pH 8.0, 9.0 and 9.5, for Salmonella Typhimurium 

(3.0 rnM 2-NPOH); Salmonella Gallinarum (1.0 rnM 

2-NPOH); Shigatoxic E. coli [STEC] (1.0 rnM 2- 

NPOH). It was observed that in growth medium 

with pH 8.0, 9.0 and 9.5 without addition of 2- 

NPOH, the Salmonella Typhimurium grown 

(overnight culture) to 2x10 6 cfu/ml, Salmonella 

Gallinarum 3.5x106 cfu/ml and STEC 6.5x10 6 

cfu/ml, respectively. However, for Salmonella 

Typhimurium with the use of 3.0 mM 2-NPOH in 

medium (MIC is 3.5 mM), 1.7x10 5 cfu/ml, 1.75x10 5 

cfu/ ml and 1.7x105 du/ml growth was observed in 

media with pH 8.0, 9.0 and 9.5, respectively. For 

Salmonella Gallinarurn using 1.0 mM 2-NPOH 

(MIC is 1.5), 1.5x10 5 dul mI, 1.65x10 5 cfu/mI and 

IIWJlill· 

Anllual Repurt 

2010-11 

1.55x105 cfu/mI growth was observed in media 

with pH 8.0, 9.0 and 9.5, respectively. Similarly for 

Shiga toxic E. coli, 2.4x10 5 cfu/ml, 2.6x105 cfu/ml 

and 2.6x105 cfu/ml growth was observed in media 

with pH 8.0, 9.0 and 9.5, respectively. The findings 

suggested the proof of bacteriostatic effect of 2- 

NPOH in sub-MIC dosage even in variable 

alkaline pH of growth medium. For 

understanding the effect of 2-NPOH on growth 

logarithm of these test cultures; sub-MIC dosage of. 

2-NPOH was used and colony count was recorded 

in different span of incubation (6, 12 and 24 h). It 

was observed that Salmonella Typhimurium counts 

were 7x105 cfu/ml, 2x106 cfu/ml and 4.lx106 cfu/ml 

in 6 hrs, 12 hrs and 24 hrs of incubation, 

respectively when 2-NPOH was not added in the 

growth medium. For Salmonella Gallinarum, it was 

1.lx106 cfu/ml, 3.5x106 cfu/ml and 1.50x1Q7 cfu/ml, 

respectively in 6, 12 and 24 h of incubation. 

Similarly, for Shiga toxic E. coli, 2x10 6 cfu/ml, 

6.5x10 6 cfu/ml and 1.7x10 7 cfu/ml was recorded in 

6, 12 and 24 h of incubation. 

With the use of 2-NPOH at 3.0 rnM (MIC is 3.0 

rnM) in growth medium, Salmonella Typhimurium 

grown 0.70x105 cfu/mI, 3.0x105 cfu/ml and 5.5x10 5 

cfu/ml, respectively in 6, 12 and 24 h of incubation. 

For Salmonella Gallinarum, it was 10 5 cfu/ml, 

2.5x10s cfu/ml and 4.5x10S cfu/ml, respectively in 6, 

12 and 24 h of incubation. Likewise, for Shiga toxic 

E. coli, 1.7x10 5 du/m!, 3.5x105 cfu/ml and 5.5x10 5 

du/ml was recorded in 6, 12 and 24 h of 

incubation. It appears that even in sub-MIC 

dosages, 2-NPOH exert its bacteriostatic property. 

8. MOLECULAR MECHANISMS OF 

DRUGS AND THEIR MONITORING 

IN ANIMAL HEALTH 

(1) MOLECULAR MECHANISMS OF 

PULMONARY 

VASCULAR 

DYSFUNCTION IN ENDOTOXIC SHOCK 

The study was carried out to evaluate the 

effects of atorvastatin in mouse model of acute 

lung injury-induced by caecal ligation and 

puncture and canine pneumonia. In mouse model 

of acute lung injury, plasma and lung TNF-a and 

IL-1[3 were increased in septic mice, but pretreatment 

of atorvastatin (0.02 flg/kg b.wt.) 

signifycantly reduced the level of both the 

cytokines. Plasma and lung nitrite was estimated 

in sham operated, sepsis and atorvastatin pre-

treated mice. NO level was significantly (P

carried out on a C18 column by isocratic elution 

using a mobile phase consisted of acetonitrile and 

2 mM ammonium acetate (10:90). Nimesulide was 

detected in a triple-quadrupole mass spectrometer 

operated in negative electrospray ionization mode 

(ES1-). The MRM transition for quantifier and 

qualifier was found to be 307.2/229.0 and 

307.2/198.0, respectively. The method was 

validated at 3.12 to 100 ng/g. For quantification of 

trimethoprim residues, the chromatographic 

separation was performed on a C18 column by 

isocratic elution using a mobile phase consisted of 

acetonitrile and 2 mM ammonium acetate (10:90), 

and then trimethoprim was detected in a triplequadrupole 

mass spectrometer operated in 

positive electrospray ionization mode (ES1+). The 

MRM transition for quantifier and qualifier was 

found to be 291.3/230.2 and 291.3/123.1, 

respectively. The method was validated at 10 to 

100 ng/g. For determination of ampicillin residues 

in buffalo meat, the chromatographic separation 

was carried out on a Cl8 column by isocratic 

elution using a mobile phase consisted of formic 

acid in water (0.1%) and acetonitrile (90:10) and 

the drug was detected in a triple-quadrupole mass 

spectrometer operated in positive electrospray 

ionization mode (ESI+). The MRM transition for 

quantifier and qualifier was found to be 

350.0/106.1 and 350.0/160.2, respectively. The 

method was validated at 05 to 50 ng/g. Highperformance 

liquid chromatographic (HPLC) 

methods for quantification of ciprofloxacin and 

nimesulide residues in buffalo meat were also 

developed and validated. 

10. CLINICAL AND SURGICAL 

INTERVENTIONS 

(1) DEVELOPMENT OF BIOENGINEERED 

COLLAGEN MATRICES FOR 

RECONSTRUCTIVE SURGERY 

Diaphragm and pericardium of bovine 

(buffalo origin) procured from a local abattoir 

were used as raw materials for the development of 

bioengineered collagen matrices. Different 

protocols were standardized for decellularization 

of diaphragm and pericardium of bovine/ buffalo 

origin. These acellular matrixes were used as 

scaffolds for in vitro growth of the fibroblasts. 

Protocols for in vitro culture of primary chicken 

embryo fibroblast (PCEF) and primary mouse 

embryonic fibroblast (PMEF) were optimized in 

the laboratory and growth characteristics of the 

cells were studied in detaiL These primary cells 

were seeded on the biomaterials and growth of 

cells was observed at timely intervals. The cell 

seeded biomaterials were processed for 

histopathology and scanning electron microscopy. 

The native and acellular biomaterials were also 

processed for preparation of soluble antigen and 

laboratory animals (rats) were immunized after 

estimating the protein concentration of processed 

biomaterials. 

(2) STUDIES ON HALOTHANE AND 

ISOFLURANE INHALATION 

ANAESTHESIA IN LARGE RUMINANTS 

The study was conducted on six clinically 

healthy male buffaloes in a Latin square design 

using six anaesthetic treatments in HI, H2, H3, II, 

12 and 13 groups. In groups HI and II sedation 

was accomplished by fentanyl (5f-lg/kg) and 

xylazine (0.05 mg/ kg), in groups H2 and 12 by 

fentanyl (5f-lglkg) and medetomidine (2.5f-lglkg), 

while in groups H3 and 13 by fentanyl (5f-lglkg) 

and dexmedetomidine (5f-lg/kg) administered 

intravenously. Induction of anaesthesia was done 

by 5% thiopental sodium in all groups. 

Maintenance of anaesthesia was done by 2% 

halothane in groups H1, H2 and H3, and by 2% 

isoflurane in groups II, 12 and I3 in 100% oxygen 

through a large animal anaesthesia machine. The 

treatments were compared on the basis of clinicophysiological, 

haemato-biochemical and 

haemodynamic parameters. 

Fentanyl-medetomidine and fentanyldexmedetomidine 

were found to be better 

preanaesthetic agents in comparison to fentanlyxylazine 

for thiopental and isoflurane anaesthesia. 

However, fentanyl-medetomidine and fentanyldexmedetomidine 

combinations produced more 

depression of cardiovascular functions during the 

preanaesthetic period but lesser depression of 

cardio-respiratory dynamics in the post induction 

and during the maintenance period. Quicker 

recovery was observed in fentanyl-medetomidine 

and fentanyl-dexmedetomidine combinations. 

Significantly lesser doses of thiopental sodium for 

induction of anaesthesia was required in the 

animals of groups H3 and 13 (258±0.80mg/kg and 

4.33±0.66 mg/kg) than groups H2 and 12 (6.83±2.79 

mg/kg and 4.41±O.98 mg/kg). The required 

f

maintenance doses of halothane and isoflurane 

were lesser in groups H3 and 13 (26.16±2.61 mL 

and 4S.50±5.45 mL) than groups HI, H2 and 11, 12 

(37.50±7.41 mL, 38.50±7.35 mL, 48.66±5.10 mL and 

48.00±6.38 mL). All the drug combinations 

produced adequate surgical anaesthesia. However, 

better anaesthesia was recorded during the 

maintenance period with fentanyldexmedetomidine- 

thiopental sodium- isoflurane 

combination (group 13), followed by fentanylmedetomidine- 

thiopental sodium- isoflurane 

combination (group 12). None of the drug 

combinations produced any deleterious effect on 

the vital organ functions and were found safe in 

buffaloes. 

(3) ISOLATION, 

CHARACTERIZATION 

EVALUATION OF BONE 

CULTURE, 

AND 

MARROW 

DERIVED MESENCHYMAL STEM CELLS 

FOR THE HEALING OF SKIN AND 

CARTILAGE DEFECTS 

The shldy was conducted in two parts. In part 

I, 30 healthy New Zealand white adult rabbits of 

either sex weighing 1.4 to 2.4 kg were used to 

develop protocols for isolation, culture, 

differentiation and characterization of rabbit 

MSCs. Bone marrow fluid was collected from the 

iliac crest, and bone marrow nucleated cells were 

separated out. Isolated cells were cultured with 

low glucose oulbecco's modified Eagle's medium 

(OM EM) containing 10% fetal bovine serum and 

antibiotics at 37°C in 5% C02 having maximum 

relative humidity. The MSCs were obtained as a 

fibroblast-like population of cells within 14-18 

days time. To characterize MSCs, alkaline 

phosphatase activity and specific gene marker 

osteopontin (OPN) was done. Alkaline 

phosphatase assays were performed in unpassaged 

MSCs, which appeared red after 

staining, hence AP positive. The semi quantitative 

RT-PCR was done for the molecular 

characterization of MSCs through the expression 

of OPN gene. Results from agrose gel 

electrophoresis demonstrated the expression of 

OPN mRNA transcript of 106 bp with uniformly 

expression of house-keeping gene (GAPDH). 

In Part II of the study, 12 New Zealand White 

rabbits of either sex and 1.5 -2.0 kg body weight 

were used for evaluation of culture expanded 

allogenic mesenchymal stem cells for their efficacy 

In the healing of full thickness skin wounds. The 

animals were divided into two groups. All the 

animals were anaesthetized with xylazine 5mg/kg 

and ketarnine 50 mg/kg given i.m. 10 min apart. 

Two full thickness square wounds of 2x2 ern 

dimension were created in each animal, one on 

each side of the dorsal midline. The wounds in the 

animals of group I were treated with allogenic 

mesenchymal stem cells injected into the wound 

margins at four sites in equal quantity 

immediately after the creation of wounds. The 

animals of group II were treated with normal 

saline, applied topically. The animals were 

observed for wound contraction and 

photographed for evaluation of gross healing. Two 

animals from each group were used for the 

collection of biopsies on days 14, 21 and 28 for 

cellular and histological studies. The faster wound 

contraction and overall wound healing was 

recorded in the animals of group I than group II. 

Collectively, a protocol has been successfully 

developed for isolation, culture, differentiation 

and molecular characterization of rabbit MSCs 

from the heterogeneous mixture of bone marrow 

cells. It was also concluded that allogenic 

mesenchymal stem cells can be used for the 

management of full thickness skin wounds in 

rabbits. 

(4) DEVELOPMENT AND EVALUATION OF 

INTERLOCKING NAILS AND LOCKING 

PLATES FOR INTERNAL FIXATION OF 

FRACTURES IN LARGE ANIMALS 

The study included standardization of surgical 

approach for fixation of interlocking nail in bovine 

tibia, redesigning and development of interlocking 

nails and in vitro biomechanical evaluation of 

bovine tibiae and newly developed tibial nails. 

Among different approaches (medial, lateral and 

anterior), the antero-medial approach was found 

most suitable; the site being the dorsal surface of 

medial condyle, medial to the middle patellar 

ligament between the tibial crest and the medial 

tuberosity. A 25 cm long and 12 mm in diameter 

nail was found adequate for an animal weighing 

about 250-300 kg. 

Initially, when developed nails were tested 

biomechanically in a model of unstable tibial 

diaphyseal fracture, it was observed that they 

were not resistant enough against rotational and 

bending loads. Hence, the initial design was

c:..,.:, V c:..,.:,'\..X..!I 

AlIllual Report 

_iIIIIII 2010-11 

modified and redesigned nails were developed, 

which had screw holes along the whole length of 

nail with threaded holes capable of locking with 

the fixation bolts (Fig. 88). The newly developed 

nails were tested in vitro for bending and 

compression strength (n=4 each) by using 

MTESTWindows Material Testing System. Under 

bending load (applied @ 1 KN/sec), an average 

peak load of 3 KN was recorded before the nail 

failed. During compression testing (displacement 

rate of 18 mm/sec), average peak load recorded 

before the nail failed was 5.5 KN. Similarly, 

cadaveric bones (tibiae) collected from adult 

buffaloes were also tested for compression and 

bending strength (n=4 each) using MTEST 

Windows Material Testing System. Under bending 

load @ 1 KN/sec an average peak load of 15 KN 

was required to break the bone. Under 

compression at a displacement rate of 18 mm/sec, 

an average peak load required for failure of the 

bone was 75 KN. The results indicated that the 

newly developed tibial nails have sufficient 

strength to withstand compressive and bending 

loads when used in adult cattle. 

Fig. 88: Fixation of broad locking plate for treatment of radius/ulna fracture in adult cattle. 

(5) PHYSICAL-THERAPY AND 

REHABILITATION PROTOCOL IN 

VETERINARY PATIENTS 

Out of 2,571 surgical cases recorded at Referral 

Veterinary Polyclinic, IVRI, Izatnagar, during one 

year period, 134 cases (5.21%) were of neurological 

disorders which comprised of 81 cases (60.44%) of 

hind quarter weakness (HQW) and 8 cases (8.98%) 

of posterior paresis. The cases of HQW were 

maximum in dogs (67%-82.71%), followed by 

goats and horses (4 each-4.93%), buffaloes, cats 

and rabbits (2 each-2.46%). Different breeds of 

dogs affected were non-descript (20-29.85%), Spitz 

(17-25.37%), Labrador (14%-20.89%), German 

shepherd (8%-11.94%), Boxer (3%-4.47%), Great 

Dane (2%-2.98%) and Rottweiller, Doberman and 

Bhutia (1 each-1.49%). In dogs, males were more 

affected (62.68%) than females (37.32%) and 

maximum number (38%-46.26%) was recorded in 

the age group of > 4 yr, followed by 1-4 yr (22%- 

32.83%) and < 1 yr (14%-20.89%). 

All the animals were subjected to clinical, 

radiological and neurological examination to find 

out the site of affection in the spinal region. In 

most of the cases no abnormality was detected in 

the spinal cord, whereas in few cases spondylosis, 

compression of spinal cord and vertebral fracture 

with and without displacement were noticed. In 19 

dogs only conventional drug therapy (COT) was 

given, whereas 33 dogs were subjected to 

acupuncture therapy along with COT. Other 

physiotherapeutic modalities like ultrasound, 

magnet, interferential, diathermy and 

transcutaneous electrical nerve stimulation were 

used along with COT in 3 dogs each (Fig. 89). The 

improvement was assessed on the basis of clinical 

and neurological signs (locomotor status, wheelbarrowing, 

hemistanding, hemiwalking, hopping

eaction, conscious proprioception, spinal reflex, 

patellar reflex, anal and urinary bladder function) 

and haemato-biochemical changes (haemoglobin, 

TLC, DLC, glucose, lipid peroxidase, reduced 

glutathione, superoxide dismutase and catalase) 

on days 0, 3, 7 and 14. Acupuncture therapy was 

given in 2 cases each in horses, goats, buffaloes, 

cats and rabbits; ultrasound therapy was given in 

2 horses and diathermy · in 2 goats, along with 

COT. Various degrees of improvement were 

noticed in most of the animals subjected to 

different modalities. 

Fig. 89: Interferential therapy in a Spit7- dog with hind 

quarter weakness 

(6) MANAGEMENT OF CHRONIC 

PANCREATIC DISORDERS WITH 

SPECIAL REFERENCE TO DIABETES 

MELLITUS IN DOGS 

(a) Polysystemic effects of Diabetes in dogs 

A total of 27 dogs with diabetes were 

incorporated in this study. The clinical signs like 

polyphagia, polydipsia, polyuria, obesity, 

gangrene, retinopathy were recorded in 88.88% 

(24), 88.88% (24), 74.04% (20), 81.33% (22), 14.8% 

(4),59.25% (16) cases, respectively. Random serum 

glucose level was estimated as 281.81±13.95 mg/dl 

in diabetic dogs compared to lower serum glucose 

value (85.14±7.45) in non-diabetic healthy dogs. 

Out of 27 diabetic dogs screened, signs suggestive 

of renal disorders were recorded in 3 dogs 

(11.11%). Marginal anaemia (TEC 4.19±0.35 

million/dl) and haemoglobin (10.56±0.98 mg/dl) 

was evident in almost all cases. Significantly 

(P

IIWmII 


10-11 

rainfall 31"). CMT of the positive milk samples of 

Bareilly region showed 2.67 point score; somatic 

cell count and total bacterial count were 14.90xl0 5 

cells/ml and 6.33xl03 cells/ml of milk, respectively. 

Samples of Rajnandgaon showed 2.86 point score 

in CMT, 16.70xl0 5 cells/ml of somatic cell count 

and 5.70x103 cells/ml of total bacterial count. 

Nainital samples showed 2.04 point score of CMT, 

somatic cell count of l1.190x10 5 cells/ml milk and 

total bacterial count of 5.19x103 cells/ml of milk. 

Prevalence of S. aureus in three geo-climatic 

regions were 9.3%, 8.09 and 5.2%, respectively. 

Alpha-tocopherol concentration in serum of 

lactating bovines of three geo-climatic regions 

ranged from 1.83 to 3.24 J.lg/ml serum, where 

minimum concentration of Vitamin E was 

recorded in Rajnandgoan and maximum in 

Mukteshwar area. The serum copper 

concentration in mastitic cows in Bareilly was 

minimum followed by zinc; conversely to the 

above the serum zinc concentration was minimum 

in Rajnandgoan and Nainital, followed by copper. 

The milk samples bacteriological positive for 

Staphylococcus aureus were 146, 111 and 44 from 

Bareilly, Rajnandgoan and Nainital, respectively. 

The milk samples positive for pathogenic 

Staphylococcus aureus on the basis of amplification 

of Cao gene were 167, 125 and 48 from Bareilly, 

Rajnandgoan and Nainital, respectively. Out of 

3,934 milk samples, 301 samples were positive for 

pathogenic Staphylococcus au reus, whereas 340 

samples were positive on the basis of PCR 

amplication for eoa gene. The prevalence of bovine 

Staphylococcus aureus mastitis was 23.04% on cow 

basis and 8.92% on quarter-basis in Bareilly; in 

Rajnandgoan, the prevalence was 24.76% on cowbasis 

and 10.36% on quarter-basis, and in Nainital- 

15.84% cow-wise and 5.61% quarter-wise. The 

overall prevalence of mastitis was 19.16% and the 

Staphylococcus aureus mastitis was 8.64% on 

quarter-basis. Pathogenic Staphylococcus aureus 

isolated from clinical cases of bovine mastitis, 

biochemically characterized designated as ' A4' and 

chosen for the intramamrnary challenge. 

The drug trial was conducted in 7 days post 

litter Swiss albino lactating mice using right- 4 (R- 

4) and left (L-4) inguinal mammary glands. Thirty 

five post-litter lactating mice were divided into 5 

equal groups, comprising group I (healthy 

control), group II (infected untreated control), 

group III (Honey), group IV (essential oil), group 

V (Amoxicillin). Except group I animals, all the 

mice were challenged with 5. aureus isolate A4 at 

the dose rate of 0.1 ml containing approximately 

10 8 cfu/ml through R-4 and L-4 inguinal mammary 

glands. The cases of mastitis were screened for 

disease status and graded using clinical 

examination score card. In group II, the TCS 

increased (P

lrWlElli 

AlIllual Report 

__ 2010-11 

(2) CLINICAL AND PREVENTIVE HEALTH 

CARE OF LIVESTOCK OF IVRI 

(a) At LPR (sheep and goats), LPR (Pigs) under 

LPM Division and animals in experimental 

sheds of IVRI 

A total of 3998 morbid cases were treated 

during the period under report. Wound and 

diarrhoea were amongst the most common 

problems. Vaccination was done for FMD (3132 

animals), swine fever (138), PPR (80 animals), HS 

(276 animals), enterotoxemia (110 animals), and 

sheep pox (196). Deworming was carried out in 

3,843 animals and ectoparasiticidal dipping/spray 

in 374 cases. Neonatal care was provided to 111 

animals. 

(b) At LPR (Cattle & Buffalo) farm 

smear and 

Histologically 

tissue triturate methods each. 

different tumours diagnosed 

included squamous cell carcinoma, basal cell 

carcinoma, malignant trichoepithelioma, anal 

gland adenocarcinoma and dermoid cyst in skin; 

granular cell tumour, seminoma, sertoli cell 

tumour, and CTVT in genital organs; 

tubulopapillary adenocarcinoma (1), solid 

carcinoma (4), inflammatory adenocarcinoma (1), 

complex adenocarcinoma (2) and carcinosarcoma 

(mixed carcinoma-I) of mammary gland and 

fibroma, fibrosarcoma, rhabdomyosarcoma and 

osteosarcoma of connective tissue. FNAC smear 

stained with Giemsa stain found to be useful for 

rapid diagnosis of most of the tumours in pet 

animals studied. 

A total 1,594 clinical cases were treated for (4) TREATMENT OF SURGICAL CASES, 

various ailments like enteritis, pneumonia, 

mastitis etc. Out of total 1,594 cases, 1091 cases 

were of Vrindavani cattle, 201 cases of Tharparkar 

and 302 cases of Murrah buffaloes. Other health 

care activities performed included vaccination 

against FMD (2681 animals), HS (833 animals), 

brucellosis (106 calves). Deworming, dry cow 

therapy and acaricide spray were carried out in 

1,218,91 and 2,137 animals, respectively. Similarly, 

liquid vitamin supplementation and coccidiostat 

were given to 289 and 426 animals, respectively. 

(c) At LPR (swine production) farm 

A total 777 clinical cases were effectively 

treated in LPR (SPF) unit, which included wound- 

581 cases, dermatitis/pyoderma-87 cases, 

lameness-48 cases, GI tract disorder-34, respiratory 

problem-2, pyrexia-13, abscess-3, weakness 

and/dull-57, hernia-I, mastitis-l and dystocia-I. 

(3) CYTOLOGICAL TECHNIQUES FOR 

DIAGNOSIS OF PET ANIMAL DISEASES 

A total of 45 clinical cases of dogs were 

evaluated by cytological techniques in rapid 

diagnosis of pet animal diseases. The samples 

examined included 32 cases of neoplasms of 

different organs, 11 urine samples and 2 different 

types of growths. The Neoplasms of mammary 

gland (9), skin (3), connective tissue (7), and 

genital organs (4) were studied using cytological 

and histological techniques. Cytological 

techniques used included fine needle aspiration 

cytology (FNAC), impression smear and tissue 

triturate. A total of 72% of the tumours were 

diagnosed by FNAC and 88% by impression 

PREPARATION OF ANIMAL MODELS, 

COLLECTION OF BIOPSIES AND 

RADIOLOGICAL DIAGNOSIS 

A total of 2,571 surgical cases referred by field 

veterinarians and different sheds of the Divisions 

of this Institute were successfully treated. The 

cases were of different types of wounds (481) and 

multiple trauma (385), followed by 

urolithiasis/urinary obstruction (330), fractures 

(268), lameness (210), ocular affections (141), 

posterior paresis and hind quarter weakness (134), 

dHferent types of tumours (129), otitis (67), 

castration (63), foreign body obstruction (44), 

cesarean sections (42), aural haematoma (36), 

congenital conditions (34), rickets/NBD (28), 

ovariohysterectomy (25) and udder/teat affections 

(21). These were followed by hernias (17), rectal( 

vaginal prolapse (08), docking (05), cardiac 

conditions (01) and miscellaneous surgical 

conditions (102). 

A number of animal models (58) were 

prepared which included testicular biopsy (29) for 

vaccine production in sheep and pigs, vasectomy 

(03) in cow bulls and buffalo bulls, castration (08) 

in pigs, incubator for IVF (08) and uterine flushing 

for collection of embryos (10). 

A total of 743 radiographs were taken for 

diagnosis of clinical cases and for the evaluation of 

research results in experimental animals (research- 

395, clinical- 344). Radiographs were also taken for 

wildlife cases (04). 

A total of 645 ultrasonographic scanning in 

experimental and clinical cases in different species

ITWJIill 

Annual Report 

2010-11 

(7) A NEW THERAPEUTIC APPROACH TO 

CANINE MAMMARY TUMORS 

A total of 82 tumour cases were recorded in 

canines during this period. Canine mammary 

tumour (CMT) was the most predominant 

tumour-52 cases (63.42%) in dogs, followed by 

skin and other tumours-17 (20.73%) and CTVT-13 

(15.85%). The incidence of mammary tumours was 

highest in the age group of 6-12 years (68%); 12-18 

years-18% and below 6 years-14%. The majority of 

the affected breed was German shepherd (38%) 

foHowed by Spitz (30%), Mongrel (13%), 

Doberman (6%), Labrador (4%) and others (9%). 

Incidence of mammary tumours in the male dog 

was 2 out of 52 cases (3.85%). Majority of the 

animals were multiparous and non-pregnant. 

Number of gland involved varied from one to all, 

however, caudal abdominal (4 th gland-40%), 

inguinal (5 th-30%) and others 30% were affected. 

Size of neoplasm varied from 4-22 cm, however, 

majority was recorded with diameter of 5-10 cm 

(60%) followed by below 5 cm (25%) and above 10 

em was 15%. Out of 52 cases of mammary tumour 

recorded, 22 cases (42.30%) had multiple growths 

and 30 cases (57.70%) had solitary growth. 

Pedunculated growths were 25 (48.07%) aI"ld 

remaining 27 (51.93%) growths were sessile. 

Thirty-three mammary tumours were ulcerated 

and inflammed while the remaining was intact 

and subcutaneous. 

Among the 52 cases, in 40 cases mammary 

tumour appeared first time, whereas in 12 cases it 

was recurrence. Diagnosis of tumours was done 

based on clinical history, haemato-biochemical, 

radiological, histopathological examination and 

aspiration biopsy; for special stain was also used 

in confirmation of tumour diagnosis. Among 

them, argyrophilic nuclear organizer region 

(AgNOR) stain was found very useful. In benign 

tumour, AgNOR (black dots) were few in number, 

but larger in size, whereas, in malignant, it was 

numerous but smaller in size. In CMT cases, 

lowered values of TLC with neutropenia, PCV, 

AL T, AST, IgG were recorded. Radiograph studies 

helped to provide information pertaining to the 

extent of organ involved and presence of 

metastasis in the lungs. In this study, in 9 cases, 

metastasis was recorded. 

Histopathological examination of the tumour 

samples revealed different types of tumours like 

cystic mucinous adenocarcinoma, malignant 

mixed mammary tumour, papillary 

adenocarcinoma, solid carcinoma, mixed benign 

mammary tumour, serous cystic adenoma, 

fibroadeno carcinoma, papillary adenoma, 

fibrosarcoma, cutaneous histocytoma, basal cell 

tumour, CTVT and squamous cell carcinoma. 

Different treatment protocols, namely monochemotherapy 

(Doxorubicin, 5-Flurouracil, 

Cyclophosphamide); combination chemotherapy 

(Doxorubicinrramoxifen with COX-2 inhibitor 

Etoricoxib); chemotherapy with immunotherapy 

(Doxorubicinrramoxifen with Levamisole); 

adjuvant chemotherapy (surgery + Doxorubicin) 

and surgical therapy (lumpectomy, simple 

mastectomy, en-bloc mastectomy, unilateral! 

bilateral mastectomy) were performed as per the 

merit of the case, clinical and radiological findings 

and finally owner's request/permission. 

Percentage of apoptotic cells increased at 

succeeding weeks of chemotherapy as compared 

to pre-treatment values. Success rate of different 

chemotherapy varied and Doxorubicin and 

Tamoxifen with Cox-2 inhibitor were found 

comparatively better chemotherapy agents, 

however, surgical eXCISIOn, followed by 

chemotherapy was found to be more effective. 

Canine mammary tumours responded well to the 

combination of Doxorubicinrramoxifen along with 

Immunomodulator + COX-2 inhibitor and they 

proved as promising combinations as an adjunct 

therapy in canine mammary tumour. Levamisole 

along with Etoricoxib and 5-Flurouracil induces 

apoptosis in canine mammary tumours. 

Temporary sign of side effects (vomiting, 

alopecia, anorexia, aIlXicty, anemia etc) were seen 

in mono-chemotherapy cases. No side effects were 

observed in combination chemotherapy 

(Doxorubicin/ Tamoxifen with Cox-2 inhibitors). 

Dot-blot ELISA was used to identify the 

presence of MMP-7 in the clinical serum and tissue 

samples collected from the dogs affected with 

mammary tumour. The cross reactivity was 

observed in tumour tissue homogenate and serum 

of mammary tumour infected dogs. MMP-7 was 

not released in the serum of normal dogs. In 

indirect ELISA of tumour serum MMP-7 was 

found to be 9 times higher as compared to normal 

serum suggesting that there was over expression 

of MMP-7 in tumour serum as compared to 

normal. Moreover, MMP-7 in tumour tissue was 

also found to be 4.7 times higher than that of

parasites, deworming was performed in a total of 

220 animals (134 cases in goats, 78 cases in cattle 

and 8 cases in horses using different groups of 

anthelmintics (fenbendazole, albendazole, 

piperazine, doramectin and closantel). Ticks 

infestation in cattle was controlled (total-348) by 

using flumethrin (bayticol pour on), butox, 

ivermectin (oral preparation) and doramectin 

(injectable preparation). Lice control in goats 

(total-165 cases) and mange control in rabbits was 

performed using doramectin injection. Feed 

supplement viz. livoI, HB, monobolus, ostocalcium 

and agrimin was given to 164 cattle and 187 goats. 

For prevention of foot and mouth disease in 

livestock, a total of 218 cattle, 12 bullocks and 131 

goats were vaccinated. For control of coccidiosis in 

farm and laboratory animal (rabbit), amprolium 

and sulphadimidine were used in 24 cattle calves, 

37 kids and 409 in rabbits. Apart from general 

health care, specific ailments in different livestock 

species (269 cases at ECH, 167 cases at goat farm, 

73 cases at LAPS, 8 cases at equine section, 4 farm 

bullocks and 25 cases in experimental animals of 

Virology Division) were treated accordingly. 

Besides above, specific treatments and health care 

services were also provided to animals (169) in 

nearby villages during field visits for attending 

animal health camps. 

Oestertagia circumcincta Mecistocirrus digitatus Bunostomum trigonocephalum 

Fig. 92: Pa rasites isolated from livestock at Mukteswar 

12. GENETIC STUDIES RELATED TO 

DISEASE RESISTANCE, 

PRODUCTION AND REPRODUCTION 

IN LIVESTOCK 

(1) GENES RELATED TO DISEASE 

RESISTANCE 

(a) CXCR2 gene in crossbred cattle 

Investigation was undertaken to identify 

single nucleotide polymorphisms (SNPs) in 

CXCRI and TLR4 genes and their association with 

mastitis tolerance/susceptibility in crossbred cows. 

Expression profiling of TLR4 in host Peripheral 

Blood Mononuclear Cells (PBMCs) was also 

studied. Lactating crossbred cows (130), which 

had completed at least first lactation, were 

screened by California Mastitis Test (CMT) for 

sub-clinical mastitis. However, screening of health 

register of the cows and physical examination of 

the udder were used for declaring the cows 

suffering from clinical mastitis. The cows which 

had never been affected by clinical mastitis during 

their productive life and tested negative for CMT 

were kept in the mastitis tolerant group. Whereas, 

the cows affected with clinical mastitis at least 

once during their productive life were kept in the 

clinical mastitis group. Blood samples were 

collected from 130 crossbred cows (74-mastitis 

tolerant and 56-clinical mastitis) and DNA was 

isolated. Primers for amplification of CXCR1 gene 

fragment encompassing partial intron 1, exon 2 

and partial intron 2 were designed using 

Integrated DNA Technology (lDT) online 

computer software on the basis of sequences of 

bovine and other related species available at NCBI 

(GenBank). The regions of TLR4 gene were 

amplified using the previously reported primer 

sets, which encompasses partial intron 1, exon 2, 

partial intron 2 (T4CRBRl) and partial cxon 3 

(T4CRBR2). Three fragments i.e. fragment I of 316 

bp (partial intron I, exon 2, partial intron 2) and 

fragment II of 382 bp (parha 1 exon 3) in length of 

TLR4 gene and 311 bp (partial intron 1, exon 2 and

IIWIlliI 

Annllal Report 

__ 2010-11 

These results revealed that the genotype AB 

and allele A are predominant in both the affected 

as well as tolerant groups of cattle. The results also 

suggest that there is not much variation in allelic 

frequencies of both the groups of cattle. 

(i) Cloning of TLR4 and CXCRI gene fragments 

in crossbred cows 

The amplified fragments of TLR4 and CXCR1 

gene fragments were purified using Gel extraction 

kit (Promega, USA) and cloned into pGEMT Easy 

cloning vector (Promega, USA). The ligated 

products were transformed into the DH5a strain 

of E. coli. Screening of blue and white colonies was 

carried out to select the recombinant clones. 

Positive-negative selection was carried out based 

on differential color development by colonies 

grown on the media containing Ampicillin, X -Gal 

and Isopropyl thiogalactoside (IPTG). The positive 

clones having insert appeared as white colonies, 

while the negative ones as blue. The white colonies 

were subjected to colony PCR to check the insert of 

desired gene fragments. 

Plasmid DNA was isolated from the freshly 

grown culture of white colonies and subjected to 

PCR and RE digestion by EcoRI for confirmation of 

the insert. The plasmid peR showed an 

amplification of 316 bp (CRBR1), 382 bp (CRBR2) 

of TLR4 gene and 311 bp of CXCRl gene, which 

confirmed the presence of insert of expected sizes. 

The pGEMT Easy cloning vector has EcoRl 

restriction site (G?AATTC) on either side of 

multiple cloning sites for the release of the insert. 

Consequently, the EcoRI digestion of the plasmid 

DNA from positive clones released the inserts. 

(ii) Sequencing of alleles 

Various genotypes containing the fragments of 

TLR4 and CXCR1 genes were selected on the basis 

of their SSCP patterns to perform the sequence 

analysis and to study about the existence of SNPs 

present in the particular allele. Sequencing was 

carried out for all the genotypes observed by the 

automated di-deoxy chain termination cycle 

sequencing method. Sequences obtained for 

different alleles were analyzed by DNAST AR 

software and compared with the sequence of 

different species available at NCB! database. 

(iii) Nucleotide sequencing of 316 bp (CRBR1) 

fragment ofTLR4 

Sequence analysis of 316 bp fragment (partial 

intron 1, exon-2 and partial intron 2) of TLR4 gene 

confirmed the results observed by SSCP. Both the 

alleles of the 316 bp fragment were compared with 

the sequences of Bas indicus (EU816194.3), Bas 

taurus (AY297042.1), buffalo (HM469969.1), goat 

(HM627213.2) and pig (AB232527.1) available at 

NCB! database. The sequence alignment report 

revealed the single nucleotide polymorphisms 

(SNP) in both the alleles. In both the alleles, 

cytosine was present instead of guanine and 

adenine instead of guanine at 10 th and 102 nd 

positions, respectively. Whereas, in addition to 

above SNPs, adenine in place of thymine and 

guanine in place of adenine at 68th and 287th 

positions were found, respectively in allele B. 

Thus, two SNPs in allele A and four SNPs in allele 

B were detected by sequence analysis. The 

sequence pair distance in Clustal V analysis 

showed the allele A of CRBRl of TLR4 gene has 

99.4% similarity with Bos indicus and Bas taurus as 

well as allele B. The phylogenetic tree was 

constructed based on the nucleotide sequences of 

alleles A and B of CRBR1 of TLR4 gene with that 

of other species. The results of the phylogenetic 

study suggested that both the alleles of the 

fragment showed closer lineage with the reported 

alleles of Bas taurus and Bas indicus in comparison 

to other species. Alignment report of amino acid 

sequence of TLR4 (CRBR1) gene showed no 

change in both the alleles, because most of the 

changes are in the intronic region. 

(iv) Nucleotide sequencing of 382 bp (CRBR2) 

fragment ofTLR4 gene 

Two alleles namely A and B observed by SSCP 

analysis were also confirmed by cloning and 

sequencing. The sequences of the alleles were 

compared with the sequences of Bas indicus 

(EU816194.3), Bas taurus (DQ839567.1), goat 

(DQ922635.1), sheep (DQ922636.1), buffalo 

(HM469969.1) and horse (NM001099769.1). The 

alignment report revealed eight single nucleotide 

polymorphisms (SNPs) in allele A and 10 SNPs in 

allele B of CRBR2 of TLR4 gene. In both the alleles, 

T@G, T@A, T@C, T@G, C@A, TwA, TwC, T@G 

changes were present at 34th, 37th, 66th, 67th, 

189 th , 331 st , 338 th and 380 th pOSitions, respectively. 

In allele B, two more SNPs i.e. GwC and T@A were 

found at positions 197 and 116. The sequence pair 

distance in Clustal V analysis showed the allele A 

of the fragment of TLR4 gene has 99.5% similarity 

with allele B, 98.4% with Bas indicus and 98.7%

and AB genotypes' fold changes were obtained in 

both un-induced and induced conditions as shown 

in Table 4. Changes in expression of mRNA were 

found statistically non-significant among the 

genotypes before induction. Similarly, after 

induction, there was no significant change in 

expression of mRNA among the genotypes. The 

fold change values are given in Table 5. 

Table 5: Fold change values of different 

genotypes in induced condition 

Induced ABi AAi BBi 

2 -(MC1) 0.986233 6.453134 1 

2-(MCf) 0.408951 1.021012 1 

2 -(MCf) 1.729074 1.79005 1 

(b) Lysozyme gene in goat 

The investigation was undertaken on serum 

lysozyme gene of indigenous goat breeds with the 

objectives (i) to identify the allelic variants of 

lysozyme gene in Indian goat, if any, (ii) to study 

association of allelic variants with serum lysozyme 

activity, (iii) to characterize cDNA of lysozyme 

gene in goat and (iv) expression profiling of 

lysozyme gene in goat. A total of 100 animals of 

each from 2 breeds of goat viz. Barbari and 

Marwari were used under present investigation. 

Two different fragments of length 275 bp 

(fragment-I) spanning over a part of intron 2 to 

intron 3 including exone 3 and 230 bp (fragment 

II) spanning from intron 3 to partial exon 4 were 

amplified and screened for polymorphism. The 

indigenous goats were found to be polymorphic 

for the SSCP at both the loci. A total of four 

genotypes (AA, BB, CC and AB) and three alleles 

(A, Band C) were delineated in fragment-I, of 

which CC genotype (frequency 0.44) and allele B 

(frequency 0.455) was most abundent in the 

population. In case of fragment II six genotype 

namely AA, BB, AC, AD, AE and AF and six allele 

namely A, B, C, D, E and F were revealed. The 

genotype AD with frequency 0.44 and allele A 

with frequency 0.525 was found to be most 

prevalent in the populations indicating the natural 

selection might be favouring allele A. From the 

However, almost double and statistically 

significant (PsO.05) up-regulation (Table 6) was 

noted after induction when compared to uninduced 

cells in a particular genotype. The mRNA 

of both receptors was up-regulated by all 

concentrations of LPS used (P

earing usual start codon ATG and stop codon G enotype t f requency 

T AA. in both the breeds. A silent mutation was 

observed at position 93 where guanine in Barbari 

goat was replaced by adenine in Black Bengal 

S. 

No. 

t--- - 

1. 

Genotypes 

AA 

Breed wise frequencies 

RIR Naked neck Tellicherry 

0.39 0.35 0.50 

goat. The derived amino acid sequences of 2. AB 0.51 0.60 0.16 

lysozyme gene of goat were precursor for 3. AC 0.10 0.05 0.17 

polypeptide of 147 amino acids with a molecular 

4. AD - - 0.17 

weight of 16.45 kDa. Relative quantification study G ene f requency 

using Real time PCR revealed that nondescript 

animals was found to have 11.31 and 4.92 folds 

S.No. 

1 

BreecIs 

Naked neck 

R .... " , Sallele 

0.39 0.61 

expression level of serum lysozyme gene as 2 T ellicherry 0.48 0.52 

compared to Barbari and Black Bengal breeds. On 

comparing the two well defined breeds it was 

found that Black Bengal has 2.30 fold higher 

expression level of serum lysozyme gene than 

Barbari goats. It can be concluded that the 

G enotype t f requency 

S. 

RR 

Breeds 

No. Resistant 

1. Naked neck 0.28 

2. Tellicherry 0.34 

RS 

Resistant 

0.22 

0.28 

SS 

Sensitive 

0.50 

0.38 

indigenous goats are sufficiently polymorphic 

with respect to serum lysozyme gene. The absence 

of a particular genotype in either breed of goat can 

be considered as a molecular marker for breed 

characterization. The characterization of cDNA 

revealed the differences in coding region which 

may be of evolutionary significance. Inter breed 

difference is present in expression profile of serum 

lysozyme gene. 

(c) Mx1 gene of poultry 

The blood samples (1 ml each) of 100 birds of 

Tellicherry breed of chicken were collected from 

Thrisut Veterinary College, Kerala along with 0.5 

M EDTA as an anticoagulant. DNA isolation of 

poultry DNA was done as per the standard 

protocol. The gene and genotype frequencies were 

estimated by using standard procedures. The 

genotypes were detected by examining the SSCP 

The two alleles of 100 bp fragment of Mx 1 

gene were sequenced. The allele wise nucleotide 

differences are presented in Table 1. From the 

alignment of the allelic variants it was found that 

there is difference in a position (72nd) among the 

alleles. It was reported that when there is adenine 

in place of guanine in 7.2. 

pattern of each sample in the gels. 

The promoter region was found to have four 

alleles viz. A, B, C and D with four genotypes viz., 

AA, AB and AC and AD. 

Digestion of 100 bp PCR product with Rsa I 

restriction enzyme revealed three genotypes 

pa tt erns I VIZ. . RRRS dSS 

I an 

nd position, it causes 

change in amino acid composition of protein by 

substituting asparagine in place of serine and the 

bird possess differential antiviral activity. The R 

allele has adenine but 5 allele has guanine at 720d position. 

Sequence of Mx 1 gene 100 bp (R Allele) 

CCTTCAGCCTGI l 't I ICTCCTTITAGGAAA 

AAAGTCTTCACTCI I I I I I rCCCTCTCCTT 

GTAGGGAGCAAA TATTCGCCTGAGCAAT 

CAGA TTCCTCTG 

Sequence of Mx 1 gene (5 Allele) 

CCTTCAGCCTGTTTTTCTCCTTTTAGGAAA 

AAAGTCTTCACTCI I I I I TTCCCTCTCCTT 

GTAGGGAGCAAGTATTCGCCTGAGCAAT 

CAGA TTCCTCTG 

Table 1. Allele-wise differences for 100 bp 

f ragment 0 fM x 1 gene 

S.No. Alleles Nucleotide at 72nd_])_osition 

1. R A 

2. S G 

Gene frequency 

S. 

No. 

Alleles 

Breed wise frequencies 

RIR Naked neck Tellicherry 

1. A 0.67 0.63 0.60 

2. B 0.23 0.25 0.23 

3. C 0.10 0.13 0.07 

4. D - - 0.10 

(d) Lacto£errin gene 

Open Reading Frame (ORF) of bovine 

lactoferrin gene was isolated from the cow milk. 

Total RNA from milk somatic cells was isolated, 

. . 

converted mto cDNA and amplifIed by usmg

'&+- '6+ B+ B+ )3;-4- )3;+ 

.l,w bp 

HObp 

Fig. 107: Genotypic patems of 140 bp amplicon of FecB 

gene/Ava-II PCR-RFLP from Shahabadi Sheep: Lane M: 

50 bp DNA ladder, Lane B+: Homozygous non-carrier 

13. LIVESTOCK PRODUCTION AND 

MANAGEMENT 

(1) MULTIPLICATION AND EVALUATION 

OF Vrindavani 

The herd strength of Vrindavani cattle as on 

01/04/2010 was 532 heads (74 males and 458 

females). Additions in the herd were due to birth 

of 82 female and 107 male calves (189 heads). 

Deletions from the herd were due to death of 85 

animals (26 males and 59 females), external 

transfer of 41 males and auction/sale of 95 cattle 

heads (19 males and 76 females). In all, 221 

animals were deleted from the herd due to various 

reasons whereas 189 animals were added due to 

new births. The new calvings were well 

distributed over all the year. The male:female ratio 

of new calvings was 1.00:0.77. The dosing balance 

of the Vrindavani cattle herd as on 31/03/2011 was 

500 cattle heads (95 males and 405 females). 

The overall mortality per cent was 6.52%. The 

overall female mortality was 5.94% whereas for 

males it was 8.41%. The overall culling per cent 

was 7.29% with respective values for male and 

female culling % as 6.15 and 7.65%, respectively. 

The external transfer per cent in Vrindavani cattle 

during the period under report was 3.15%. Out of 

them, the value for male transfer was 13.27%. 

The overall conception rate in Vrindavani 

cattle herd was 41.34%. The respective figures in 

heifer and adult groups were 45.38 and 39.60%, 

respectively. The overall calving abnormalities 

were 30.30%, which included 6.56% abortions, 

6.06% unseen abortions, 4.54% dystokia, 6.06% 

retained placenta, 3.53% premature births, 1.01% 

prolapse and 2.52% still births. The least squares' 

means (LSM) for age at first calving, service 

period, dry period and calving interval were 

1041.87±37.15 days, 137.36±7.96 days, 96.23±21.02 

days and 439.30±21.79 days, respectively. 

Vrindavani cattle produced 6,18,684 kg milk 

during the current year. On an average, 71.03% of 

the total adult Vrindavani females were in the 

milk during the current year. Means for overall 

wet and herd averages were 10.82 and 7.75 kg, 

respectively. On the basis of analysis of 4302 milk 

samples, the overall fat, SNF and total solids % 

were 4,42,8.82 and 13.24%, respectively. 

The LSM's for total lactation milk yield, total 

lactation length, milk yield per day of total 

lactation length, 305 days' milk yield, milk yield 

per day of 305 days lactation period, peak yield, 

days to attain peak yield and weight at calving 

were 3,498.28±37.56 kg, 322.96±3.64 days, 

10.52±0.12 kg/d, 3380.50±56,41 kg, 11.67±0.IB kg/d t 

18.02±0.33 kg, 81.41±7,43 days and 402.30±6.28 kg, 

respectively. 

The least squares' means (LSM) for overall live 

body weights at birth, 3, 6, 12, 18 and 24 months of 

age were 23.01±1.44, 57.62±L76, 99.33±2.20, 

187.56±S.10, 240.70±3.90 and 298.36±7.07 kg, 

respectively. The respective values for males and 

females were 23.98±1.90, 56.81±2.54, 94.80±3.87, 

202.50±9.87, 242. 14±7A6, 305.00±13.96 kg and 

22.04±2.1S, 58,43±2,43, 103.S6±2.10, 172.63±2.61, 

239.26±2.28 and 291.73±2.32 kg, respectively. 

(2) THARPARKAR CATTLE 

The opening balance as on 01/04/2010 was 143 

heads (23 males and 120 females). Additions in the 

herd were due to birth of 28 female and 26 male 

calves (54 heads). Deletions from the herd were 

due to death of 15 animals (5 males and 10 

females), external transfer of 10 males, auction/sale 

of 4 males and 14 females (18 heads). In all, 43 


reasons whereas 54 animals were added due to 

new births. The male: female ratio of new calvings 

was 1.00:0.93. The closing balance of the

Tharparkar cattle herd as on 31/03/2011 was 154 

cattle heads (30 males and 124 females). 

The overall mortality per cent in Tharparkar 

herd was 3.89% and was well within the 

permissible limits. The overall female mortality 

was 3.64% whereas for males it was 4.50%. The 

overall culling per cent was 4.66% with respective 

values for male and female culling % as 3.60 and 

5.09%, respectively. The extemal transfer per cent 

of males in Tharparkar herd during the period 

under report was 9.01 %. 

The overall conception rate in Tharparkar herd 

was 41.46%. The respective figures in heifer and 

adult groups were 69.23 and 38.18%, respectively. 

The overall calving abnormalities were 27.27%, 

which included 9.09% abortions, 1.81% unseen 

abortions, 1.81 dystokia, 4.54% premature births, 

4.54% prolapse and 3.64% retained placenta. 

The least squares' means (LSM) for age at first 

calving, service period, dry period and calving 

interval were 1,102.43±4.01 days, 158.59±22.50 

days, 316.98±39.01 days and 444.27±30.88 days, 

respectively. 

Tharparkar produced 38,001 kg milk during 

the current year which was 1,546 kg more than 

that during the previous year (36,455.0 kg). Means 

for overall wet and herd averages were 3.86 and 

1.50 kg, respectively, under suckling system. On 

an average, 28.25% of the total adult females were 

in the milk during the current year. 

On the basis of analysis of 574 milk samples, 

the overall fat, SNF and total solids % were 4.52, 

8.84 and 13.36%, respectively. 

The LSM's for total lactation milk yield, total 

lactation length, milk yield per day of total 

lactation length, 305 days' milk yield, milk yield 

per day of 305 days lactation period, peak yield, 

days to attain peak yield and weight at calving 

were 2042.58±146.18 kg, 290.88±14.01 days, 

6.96±0.48 kg, 2,038.87±158.05 kg, 6.68±0.51 kg, 

1l.70±0.98 kg, 56.06±33.80 days and 387.00±8.86 kg, 

respectively. 



age were 18.91±2.26, 54.16±2.52, 10L01±2.61, 

189.07±4.24, 25S.39±S.1O and 291.56±7.92 kg, 

respectively. The respective values for males were 

19.16±3.26, 53.43±3.39, 103.09±3.55, 206.00±7.29, 

and 276.66±9.41 kg, respectively, however for 

females the respective weights were 18.66±3.13, 

lIWIlliI 

Annual Report 

2010-11 

54.89±3.74, 98.94±3.84, 172.14±4.35, 234.11±3.95 and 

291.56±7.92 kg, respectively 

(3) MURRAH BUFFALO 

The herd strength as on 01/04/2010 was 224 

heads (54 males and 170 females). Additions in the 

herd were due to birth of 34 female and 33 male 

calves (67 heads). Deletions from the herd were 

due to death of 33 animals (11 males and 22 

females), external transfer of 10 males, auction/sale 

of 35 buffaloes (8 males and 27 females). In ali, 78 


reasons whereas 77 animals were 'added due to 

. new births and purchase. The male:female ratio of 

new calvings was 1.00:1.06. The closing balance of 

the buffalo herd as on 31/03/2011 was 223 buffalo 

heads. 

Out of 35 animals culled/sold during the 

current year, 8 males and 27 females were sold/ 

auctioned due to surplus/off-type/low production, 

reproductive ground along with weak and old 

buffaloes. A total of 10 males were transferred to 

various Divisions/Sections for experimental 

purposes. 

The overall mortality per cent was 5.59%. The 

overall female and male mortality per cent were 

5.58 and 5.61 %, respectively. A total of thirty three 

deaths were recorded in IVRI buffalo herd during 

the current year (11 males and 22 females). 

The overall conception rate was 38.09%. The 

respective figures in heifer and adult groups were 

45.00 and 36.79%, respectively. The overall calving 

abnormalities were 23.52%, which included 1.47% 

abortions, 4.41 % unseen abortions, 1.47% dystokia, 

8.82% of retention of placenta, 4.41% prolapse and 

2.94% premature births. The least squares' means 

for age at first calving, service period, dry period 

and calving interval were 39.59±1.16 months, 

169.90±19.93 days, 183.24±21.07 days and 

449.08±15.74 days, respectively. Month-wise 

calving statistics along with sex ratio (Male: 

Female:: 1.00: 1.06). 



age were 30.34±3.79, 78.71±S.04, 123.34±4.77, 

225.55±S.14, 292.16±4.43 and 352.22±7.84 kg, 

respectively. The respective values for females and 

males were 29.52±5.31, 84.43±7.75, 122.81±7.7S, 

230.43±4.46, 292.10±5.03, 344.44±7.31 kg and 

31.15±5.39, 73.00±6.46, 123.87±5.57, 220.66±8.00, 

292.22±7.31 and 360.00±13.87 kg, respectively. The

weight at first calving during the current year was 

483.75.00±16.70 kg. 

Buffaloes produced 1,03,889 kg milk during 

the period. Means for overall wet and herd 

averages were 5.88 and 3.14 kg, respectively. On 

an average, 51.85% of the total adult females were 

in the milk during this period. The LSM's for total 

lactation milk yield, average lactation length, 

average 305 days' yield and peak yield were 

2,157.78±64.94 kg, 286.40±4.89 days, 2,136.48±63.14 

kg and 11.16±0.38 kg, respectively. 

The milk analysis of 1,080 milk sample 

estimated mean values for fat, SNF and total solids 

per cent were 8.01, 9.66 and 17.75%, respectively. 

The analysis for lactational traits data was done for 

animals expressing normal lactation length i.e. 7 

months or more 

(4) DEVELOPMENT OF PACKAGE OF 

PRACTICES FOR WEANING OF MURRAH 

BUFFALO CALVES 

(a) Weaning 

Two groups (Weaned and suckled) of Murrah 

buffalo calves were maintained. Weaned buffalo 

calves were artificially nursed while suckling 

Murrah buffalo calves were allowed to suckle their 

dams. Growth parameters of both groups were 

recorded by measuring body weight of buffalo 

calves. Milk consumed by suckled calf were 

measured by taking pre-suckling and postsuckling 

weight of Murrah buffalo calves and 

deducting latter weight from earlier weight. 

Production of weaned and suckled dam was 

recorded by taking morning and evening milk 

yields. Effect on reproduction was recorded by 

observing induction of first estrous in weaned and 

suckled dam of Murrah buffaloes. 

(b) Body weight 

Overall least squares' means (LSM's±SE) for 

body weight of weaned Murrah buffalo calves for 

bwt (Birth weight), wk1 (weekI), wk2, wk3 to 

wk22 were 27.29±0.48, 35.59±2.83, 35.18±1.97, 

40.57±3.28, 41.21±2.60, 45.28±2.68, 45. 69±2.79, 

47.85±3.13, 50.65±2.82, 54.38±3.12, 57.76±3.41, 

57.24±4.33, 60.20±4.79, 65.02±4.92, n.23±5.73, 

75.97±6.05, 78.70±6.54, 75.37±7.25, 78. 13±8.04, 

80.41±8.61, 83.08±11.90, 93.13±18.80, 95.00±18.62 

and 95.00±18.62 kg respectively. While overall 

least squares' means (LSM's±SE) for body weight 

of suckled Murrah buffalo calves for bwt (birth 

weight), wk1 (week n wk2, wk3 to wk22 were 

27.38±0.45, 31.29±1.18, 34.53±1.84, 43.32±4.63, 

40.21±2.43, 46.08±3.29, 45.27±2.61, 51.08±4.14, 

52.25±2.82, 55. 15±3.37, 58.63±3.41, 61.82±4.33, 

66.43±4.05, 70.91±4.16, 75.54±4.33, 77.95±4.94, 

80.61±5.85, 85.68±6.28, 89.79±6.96, 9S.1l±7.45, 

101.43±8.41, 107.26±9.40 and 112.16±9.31 kg 

respectively. 

(c) Reproduction 

Overall least squares' means (LSM's±SE) for 

weaned and suckled dam for first post partum 

estrous was 54.86±7.25 and 133.33±11.07 days 

respectively. It was observed that induction of first 

post partum estrous was earlier in weaned dam of 

Murrah buffaloes. 

(d) Morbidity and mortality 

Out of 10 weaned Murrah buffalo calves, 20% 

from skin disorders, 50% suffered from GIT 

problems and 20% (two out of 10 weaned Murrah 

buffalo calves) died. While out of 11 in suckled 

group of Murrah buffalo calves 45% suffered from 

CIT problems, 9% locomotor disorders, 27.27% 

from skin disorders and 27.27% and 18.18% (2 

died out of 11 suckled Murrah buffalo calves). 

(5) CHARACTERIZATION AND 

DOCUMENTATION OF ROHILKHANDI 

GOAT 

The morphometrc traits of Rohilkhandi goats 

were documented as per breed descriptor given by 

the NBACR, Kamal during the first year of the 

project. 

(a) Body colour 

Body colour of the Rohilkhandi goat may vary 

from full black to brown and rarely fawn or 

sometimes mixed colour. Black colour was the 

predominant colour (77.62%) in the flock fallowed 

by Brown (19.4%). Rarely fawn and mixed (2.98%) 

are also found in main flock. 

(b) Markings 

The common markings found in the 

Rohilkhandi goat are Star, patch on neck/face, 

body, leg and sometimes on tail. These markings 

are found in 20.15% of the adult population. The 

most common markings are star (5.23%) and patch 

on leg (3.73%). 

(c) Horns 

Majority (90%) of the goat possessed horns. 

However, 4% of the horned goats possessed only 

single horn. Horn was found in both sexes. Hom 

bud starts erupting between 2-4 months. Nearly 

10% of the population was polled. Mostly horns

are either twisted/spiral (90%) or flat (10%). 

Majority of the hom are slightly curved (95.56%) 

and laterally out warded (92.22%). The length of 

the horn ranged from 3.16 to 8.29 cm. 

(d) Ear 

Ears are black in colour and are mostly 

pendulous (92.54%) in nature. However, 7.46% of 

the goat possessed horizontal ears. The average 

length of ear at 15 days, I, 2-3, 3-6, 6-12 and >12 

months is 10.88±0.32, 12.42±0.32, 13.04±0.33, 

14.32±0.43, 15.83±3.74 and 15.41±0.2 cm 

respectively. 

(e) Beard and Wattles 

Both beard and wattles are absent in this goat. 

However, there is possibility of less predominant 

beard may find in less goats (1.5%) in the 

population. 

(f) Head 

Fore head and nose slightly convex and 

muzzle is black colour. 

(g) Neck 

The neck length may range from 12 to 19 cm in 

kids and 20 to 24 cm in adult. 

(h) Mammary system 

The udder is either conical (45.8%) or 

pendulous (52%). Over the udder, hairs are 

sparsely distributed. Rohilkhandi goat also 

possesses supernumerary teats (5.97%) as well as 

bifurcal teats (10.45%) and in few goats both 

(2.24%) are present. 

(i) Body weight 

The body weight (kg) of Rohilkhandi goat at 0 

day, 2nd, 6th, 12th, 18th and> 18 M is 2.12 (Male: 2.21 

and Female 2.02), 7.53 (Male: 7.69 and Female: 7.37 

kg), 9.65, 12.84, 17.43 and 19.62 kg respectively (for 

females only as males are disposed at 2 months of 

age). 

(j) Body measurements 

Chest girth, Body length and height at wither 

(cm) of adult Rohilkhandi goats are 57.13, 50.43 & 

54.34 respectively. 

(6) SWINE PRODUCTION FARM 

(a) Crossbred swine 

During 2010 - 2011, inter se mating was carried 

out to maintain the stock and to study the 

performance of crossbred pigs. A total of 181 

crossbred pigs (86 males and 95 females) were 

present on 01.04.2010, whereas the balance at the 

end of year (i.e. on 31.03.2011) was 146 (52 males 

and 94 females). A total of 282 piglets (131 males 

JIWIfill 


2010-11 

and 151 females) were born, whereas disposal was 

of 317 pigs (165 males and 152 females). Overall 

mortality rate recorded during the period was 

12.74%; out of which 9.07% was within 7 days of 

age. 

Reproductive and litter performance of 

crossbred sows was studied on a total of 31 

farrowings and the breeding involving 12 females 

was also completed during the period. Number of 

services per conception was recorded to be 

1.00±0.01. The litter size was 9.00±0.70 and litter 

weight was 11.00±0.77 kg at birth, whereas, at 

weaning litter size was 7.00±0.80 and litter weight 

was recorded to be 69.00±6.25 kg. Average daily 

gain of pre-weaning piglets was 190.5±2.6 g/d and 

that of post weaning (upto 36 weeks of age) pigs 

was 413.S±14.7 g/d. 

Studies on the feed conversion efficiency in 

crossbred boadings (14 - 24 weeks of age) revealed 

that overall feed consumption was 3.83±0.28 kg for 

1 kg of body weight gain. Carcass studies on the 

crossbred grower pigs fed on supplemented diets 

indicated an overall dressing percentage of 

72.0S±O.70%, 30.0±1.S 'mm thick back fat and 

32.S1±2.11 sq. cm.loin eye area. 

Pure Landrace nucleus herd, established in the 

year 2006-07, is being maintained. Fourteen 

females farrowed in the year 2010-11. Herd 

strength at the beginning of the year i.e. on 

01.04.2010 was 33 (15 males and 18 females) 

whereas at the end of the year (on 31.03.2011), it 

was 109 (52 males and 57 females). Piglets attained 

live weight of 9.58±0.57 kg at weaning (42 days of 

age) and average daily gain during pre-weaning 

period was 196.9 g/d. Overall mortality was 

recorded to be 9.43%; out of which 7.55% was 

within 7 days of age. 

In order to bring down the Landrace 

inheritance to 75%, fourteen indigenous animals 

have been procured and accordingly the technical 

programme will be followed during next year. 

(b) Establishment of pure Landrace nucleus herd 

Breeding of both pure Landrace herd and the 

crossbred pigs was monitored and supervised. All 

the females were bred with 93.3% conception rate 

in pure Landrace pigs with almost similar number 

of services per conception with crossbred pigs 

(1.15 vs. 1.00). Fortification in farrowing 

management schedule and tool to reduce piglet 

mortality was planned and carried out. Ear Pattern

Table 10: Hematological parameters from goat 

blood samples 

Panmeten 

Day 

1 

Day 

t 

Day 

5 

Day 

10 

Day 

20 

Day 

45 

Hemoglobin 6.9 7.0 7.3 7.3 8.2 8.1 

(gldl) ±O.4 ±O.3 ±O.6 ±O.4 ±O.3 ±O.2 

PCV ('Yo) 

22.8 

±1.2 

29.7 

±4.5 

31.7 

±1.5 

33.3 

±2.2 

32.5 

±l.O 

35.2 

±2.5 

TEC (x10 6 / 14.2 14.5 16.0 15.4 15.8 15.2 

cu mm) ±2.3 ±2.S ±1.6 ±2.0 ±O.8 ±O.7 

*Values in the row represent rnean±SD 

Partial CDS of HIF-l (310 bp) was cloned and 

sequenced (accession no. HQ637464). For 

sequencing of full length CDS in goat primers 

were designed, amplified (Fig. 110 & 111) and 

cloned. 

Fig. 110: Amplification of HIF-I CDS-I 

Fig. 111: Amplification of HlF-I COS-2 

(14) SPF UNIT AT HSADL, BHOPAL 

During this year a total 206 SPF chicken were 

hatched in batches of 25-50 chicks/hatch, reared 

upto experimental age of 4-8 weeks at the unit and 

supplied to the containment animal wing for 

various experiments and anti sera production. 

Apart from this, 808 SPF eggs were produced over 

a period of 4 months and utilized for experiment 

and diagnosis work at HSADL. About 300 rnl of 

SPF sera was collected from the spent SPF chicken 

and stored for later usage. 

In order to optimize the management of the 

SPF chicken unit, the problems identified during 

the raising of the first batch of chicken at the unit 

were systematically addressed though discussion 

and consultations with nutritionists and experts in 

the fields of SPF chicken management. The 

nutritional problems were overcome through 

empirical trials combining feeds and nutrient 

supplements of different sources. Presently the 

SPF unit has 22 SPF birds (24 wks) and 63 birds (17 

wks) in two separate super-isolators. 

14. REPRODUCTIVE MANAGEMENT 

AND AUGMENTATION 

(1) PROTEOME ANALYSIS OF BUFFALO 

SPERM FOR PRE-SEXING OF SEMEN 

(a) Expression of buffalo ESX-1gene 

Total RNA was isolated from buffalo blood, 

spermatozoa and testis. The typical (185 and 28S 

rRNA) peaks were absent. Only we could see one 

band (probably 18S) and mRNA smearing profile. 

SpeCifiC primers were designed from the 

conserved regions of ESX-l gene of heterologous 

species for directional cloning. cDNA syntheSis 

from total RNA of blood, spermatozoa and testis 

using specific primers was carried out. peR 

amplification was done to amplify -750bp PCR 

product. The PCR product was then gel extracted 

and cloned in pGEMT Easy vector characterized 

with KpnI and PstI restriction enzymes. One of the 

recombinant clone was then custom sequenced 

and the sequence was submitted to NCBI GenBank 

(Accession no. JF774413). 

The ESX-l gene was sub-cloned in pRSET C 

expression vector, transformed in BL21 (DE3) 

pLysS competent cells and expression was 

attempted. The expressed protein was purified 

with cobalt immuno-affinity column and 

characterized by Western blotting using antihistidine 

antibodies. The protein showed a 

molecular weight of -26kDa on SDS-PAGE and 

Western blotting which was less than the 

predicted 28kDa (Fig. 112 & 113). Further analysis 

of the sequence data using ExP ASy Proteomics 

Server showed a molecular weight of 28.56 kDa 

and rich in negatively charged amino acids (41 

residues out of 251). This could be the probable 

reason for faster migration of the protein.

common experimental protocol in terms of 

monitoring of BW and OM intake, a 4 day 

digestion trial following 30 days of feeding, 

physical, biochemical and microbial assessment of 

faecal quality, periodic assessment of blood 

metabolic profile, and assessment of the humoral 

and cell-mediated immunity. 

Supplementation of prebiotic to sorghumbased 

diet reduced (p0.05) observed in the faecal pH and content of 

lactate, acetate, propionate and consequently total 

SCFAs. Butyrate concentration was found to be 

higher (p0.05) 

among the groups. There was no apparent 

influence of the dietary treatments on plasma lipid 

profile except for a trend (p=0.072) of decreased 

LOL in both prebiotic supplemented groups. 

Plasma uric acid was higher in Wheat-C compared 

to all other groups while that of urea and 

creatinine remained un-altered (p>O.05). Cellmediated 

immune (CMI) response of dogs was 

assessed following seven weeks of feeding as 

delayed-type hypersensitivity (DTH) reaction to 

intra-dermal inoculation of phytohaemagglutinin 

P (PHA-P). Additionally, peripheral lymphocyte 

subpopulations viz. C04 and C08 were measured 

through F ACS technique matching 0 and 24 hours 

of PHA-P inoculation. While the OTH response 

was higher (p

IIWIlliI 

Annual Report 

2010-11 

glucose, total protein, albumin, globulin and their 

ratio did not show any variations attributable to 

dietary. There were no effects of treatments on the 

lipid profile. Plasma urea was lower (p

nutrition as well as nitrogen metabolism remained 

similar (p>0.05) in all the groups, indicating 

possibility of adaptation of ruminal microbes to 

the supplemental herbals in the long-run. 

Consequent to lack of significant effects on 

nutrient metabolism, the body weight changes at 

different fortnights remained similar among the 

groups. The Hb and PCV levels were comparable 

(p>O.05) among the three groups. The mean 

concentration of total protein, globulin and A:G 

ratio remained without apparent variations among 

the control and supplemented groups, whereas, 

mean concentration of glucose (p=0.055) and 

serum albumin was significantly (p

given 10 ppm Cd. Supplementation of zinc, 

selenium and vitamin E had an ameliorative effect 

on adverse effects of Cd on all these blood 

parameters, with best results in the group 

supplemented with 100 ppm Zn and 100 IV 

vitamin E. Growth performance of the guinea pigs 

showed that animals given 10 ppm Cd had lowest 

average daily gain (2.89 g) as compared to 3.45 g in 

the control group. Supplementation of zinc, 

selenium and vitamin E was found to improve the 

growth rate of the animals, with best results in the 

group supplemented with 100 ppm Zn (3.46 g/d) 

and 100 IU vitamin E (3.41 g/d). The 

histopathological findings showed that in group 

given 10 ppm Cd, lung section had mild to 

moderate thickening of inter-alveolar septi; liver 

had swollen hepatocytes with compressed 

sinusoidal spaces; portal veins in the portal areas 

were engorged with RBCs. Renal tubular epithelial 

cells, both in cortex and medulla, were swollen 

and degenerated; and almost occluded the lumen. 

Seminiferous tubules showed comparatively 

diluted lumina. Significant number of tubules 

showed reduced number of spermatozoa. 

However, in the groups supplemented with Zn, 

selenium and vitamin E, there was an 

improvement with best results in 100 ppm Zn and 

100 IV vitamin E groups. In 100 ppm Zn group, 

lungs, liver and kidney were normal in most cases. 

Testes showed normal spermatozoa activity, 

except in some tubules. Similarly in group given 

100 IV vitamin E, lung showed expanded alveoli, 

liver was normal with normal hepatocytes; and 

kidney was also normal. Almost all animals' testes 

showed normal seminiferous tubules, full of 

spermatozoa, and intact epithelial lining. 

Epididymal epithelial lining and lumen were 

completely filled with spermatozoa. This 

experiment indicated that supplementation of 100 

ppm Zn and 100 IV vitamin E were most effective 

ameliorative agents for adverse effects of Cd in 

guinea pigs. 

(b) Efficacy of best ameliorative agents in goats 

Twenty four male kids (about 4 month age) 

were randomly divided into four equal groups 

and experimental feeding was similar in all the 

groups (NRC, 2007), except for the level of Cd and 

ameliorative agent, which were: Gr. I: Basal diet, 

Gr. II: Basal diet + 10 ppm Cd, Gr. III: Basal diet + 

10 ppm Cd + 100 ppm Zn, Gr. IV: Basal diet + 10 

ppm Cd + 100 IU vitamin E. Results for 120 days 

period showed significant depression in the 

growth rate of anim3ls fed diet supplemented with 

10 ppm Cd (27.5 gld vs 37.5 gld in the control 

group). However, average daily gain in groups 

supplemented with 100 ppm Zn and 100 IV 

vitamin E were comparable to control group being 

38.3 and 39.2 gld, respectively. 

(5) EFFECT OF INORGANIC AND ORGANIC 

ZINC, COPPER AND SELENIUM ON 

HEALTH AND PRODUCTIVITY OF THE 

RUMINANTS 

An experiment was conducted on 20 kids of 4- 

5 months of age; divided into 4 groups of 5 kids 

each. All the kids were fed on wheat straw and 

concentrate mixture to meet their nutrient 

requirements; whereas kids in group II were given 

7.0 ppm Cu as copper sulphate and groups III and 

IV were supplemented with 7.0 and 3.5 ppm 

copper as copper methionine, respectively. All the 

kids were weighed at 15 days interval to assess 

their growth rate. Blood samples were collected at 

o day and subsequently at 40 days interval up to 

120 days for the estimation of blood biochemical 

parameters. The CMI response of goat kids was 

assessed by delayed type hypersensitivity (DTH) 

reaction by injecting PHA-P. Animals were 

challenged with Pasteurella multocida antigen to 

study humoral immune response. 

Supplementation of copper had no Significant 

effect on growth, feed intake, digestibility of 

proximate principles and fibre fractions and 

balances of N, Ca and P. Blood biochemicals like 

serum total protein, albumin, globulin, urea and 

crea tinine were not a Heded by copper 

supplementation. However, blood hemoglobin 

was significantly (p

seed cake fed lambs in comparison to infected 

control lambs fed diet containing SBM. The 

reduction of parasitic load (EPG) and egg 

hatchability was evident in karanj and neem seed 

cake fed lambs as compared to infected con trot 

though the reduction was more in karanj cake fed 

lambs. The increased levels of blood biochemical 

parameters viz. Hb, PCV, TEC, total serum protein, 

serum albumin and A:G ratio and the decreased 

levels of TLC, eosinophils, SGPT, SGOT and ALP 

were observed in karanj and neem seed cake fed 

lambs in comparison to infected control group. 

The humoral immune response (against Brucella 

abortus 5-99) was also signjficantly (p

concentration were significantly (p

J.IWmJl 

Annual Report 

2010-11 

nitrogenous supplements formulated to contain 0, 

50, 75 and 100% detoxified jatropha meal as 

protein source in treatment dJM-O (control), dJM- 

50, dJM-75 and dJM-IOO, respectively. The intake 

of DM, OM, DDMl, DOMl (g/d) and MEl (kcalld) 

in dJM-O was significantly (p=0.004) higher than 

dJM-IOO, however, it was comparable in groups 

dJM-50 and dJM-70. The results were similar when 

intake was expressed as g/kgwo.75 and percent BW. 

However, the intake of CP and DCP was similar 

among all the groups. The nutrient digestibility 

(DM, OM and CP) was not affected by the 

treatments. The nutrient density (DCP,%) was 

higher in dJM-O as compared to dJM-IOO, 

however, rest of the groups were comparable. The 

nitrogen intake (g/d) was not affected by feeding 

regime. However, when expressed as g/kgWO.75, it 

was significantly higher in dJM-O as compared to 

dJM-IOO. The nitrogen excretion through faeces 

was similar among all the groups whereas urinary 

loss of nitrogen was higher in dJM-O as compared 

to dJM-IOO and reflected in total nitrogen. The 

nitrogen retention (g/d), per cent of intake and 

absorbed N was similar among all the groups. 

Moreover, the fortnightly body weight changes 

also were not affected by feeding graded levels of 

detoxified jatropha meal. 

(b) Effect of feeding graded levels of detoxified 

karanj cake on the performance of growing 

kids 

In this experiment twenty-four kids of 6 

months of age were randomly divided into four 

groups of six each in a completely randomized 

design and fed four iso-nitrogenous supplements 

formulated to contain 0, 25, 50 and 75% detoxified 

karanj cake (dKC) as protein source in treatments 

dKC-O (control), dKC-2S, dKC-50 and dKC-7S, 

respectively. Feeding of detoxified karanj cake did 

not exert (p

positive shift in rumen fermentation pattem at one 

level of incorporation in the feed. Both the leaves 

have a moderate level of CP (10.2-10.3%) and 

proanthocyanidin tannins (1.3-2.3%). 

In a study to develop suitable processing 

technique for reduction of polyphenols in Ficus 

roxburghii leaves, total phenol, non-tannin phenol, 

condensed tannin, total tannin and hydrolysable 

tannins was significantly (pLJ L>CBR. The 

saponins from the four samples varied in polarity 

and complexity. CBL saponins were evaluated by 

in vitro Hohenheim gas method for effect on 

rumen fermentation and were found to cause a 

decrease in ammonia, methane and protozoa. All 

these changes implied a positive effect on rumen 

fermentation. 

(4) ISOLATION AND UTILIZATION OF 

RUMEN MICROBES FROM THE 

MIGRATORY GOATS CAPABLE OF 

DEGRADING ANTI-NUTRITIONAL 

PLANT SECONDARY METABOLITES 

A total of twenty nine rumen samples were 

randomly collected from migratory Gaddi goats. 

Using in vitro anaerobic microbial enrichment and 

isolation methods various culture media were 

examined for culturing the tannic acid-degrading 

rumen anaerobes. A total of sixty three bacterial 

colonies exhibiting characteristic zones of 

clearance on T -BHI agar (BHI agar supplemented 

with tannic acid, 0.4% w/v) were obtained and 

subjected to further studies. A total of 49 bacterial 

isolates (named, GRT-1 to GRT-49) were finally 

purified. All the isolates were obligatory 

anaerobes with different morphological and 

biochemical features. Besides, five anaerobic 

fungal isolates (GRF-1 and GRF-5) were also 

isolated using growth medium (GSM) agar 

containing tannic acid (0.4% w/v). Among the 

various culture media studied, GSM broth was 

found to be suitable for maintaining the isolates in 

suspension, and studying tannin degradation. 

Thin layer chromatographic (TLC) analysis of in 

vitro degradation of. tannic acid revealed that the 

isolates were able to degrade tannic acid to gallic 

acid and pyrogallol, and that pyogallol was not 

degraded further. Forage tannins were degraded 

to gallic acid, and no pyrogallol or resorcinol were 

detected. The isolate GRT-1 due to its unique 

property to grow in medium containing tannic 

acid (up to 3%, w/v) was studied further. Based on 

16S rDNA sequence analysis the isolate was found 

to be Enterobacter ludwigii GRT1. ] 6S rDNA 

sequence of the strain Enterbacter ludwigii GRT-1 

was submitted in the NCBI GeneBank (Accn. No. 

HM362787). 

17. STRATEGIC SUPPLEMENTATION OF 

MACRO AND MICRO-NUTRIENTS 

FOR IMPROVING LIVESTOCK 

PRODUCTION 

.__-- 

(1) EFFECT OF STRATEGIC 

SUPPLEMENTATION OF PROTEIN AND 

BOOSTERMIN ON THE LACTATION 

PERFORMANCE OF BUFFALOES 

Strategic supplementation of protein and 

Boostermin during 300 days lactation study 

substantia11y increased nutrient intake and 

productivity in terms of total and daily milk yield,

oxburghii was found to be higher (p

IIWmII 

AIl/ILIal Report 

2010-11 

and gaur and amplified using primers (forward 

Arch 364 and reverse Arch 1386) targeting 16S 

rRNA gene of archaea. The amplified product was 

of 1.1 kb in size. The purified PCR product was 

cloned in E. coli using pGEMT easy vector 

(Promega). 

To study the methanogen archaeal diversity of 

neelgai, 86 sequences were used. There were four 

major clusters of known and unknown taxa. Two 

major clusters 1 and 2 were of Methanobrevibacter 

spp. Mbb cluster 1 comprised of 33.72% sequences 

of neelgai along with Mbb. ruminantium, Mbb 

olleyae. The Mehanobrevibacter cluster 2 comprised 

of Mbb. woesei strain GS USS237.1, Mbb gottschalkii 

strain HO USS238, Mbb rnillerae strain ZA-10 

AY196673, Mbb smithii AY196669 with 38.18 per 

cent taxa of neelgai. This group also contained 

three taxa from Bubalus bubalis FJ040811, FJ040813 

and FJ040817. A small sub cluster containing 11 

taxa of neelgai fell with Methanosphaera stadtrnanae 

AY196684.1. Three taxa of neelgai made a small 

cluster with Methanomicrobiurn curvum and also 

contained two taxa from Bubalus bubalis FJ040814 

and FJ040816. A sub cluster of taxa nos. 22, 86, 169, 

38 and 108 of neelgai did not group with any of 

the known methanogen archaea, hence can be 

considered as a novel group. 

To study the methanogen archaea diversity in 

chinkara, 39 taxa were used. The majority of taxa 

(90%) made a cluster with Mbb gottschalkii strain 

HO US5238. One sequence No. 160 was close to 

Methanosphaera stadtrnanae A Y196684. The 

sequences of clone nos. 132, 152 and 161 made a 

cluster with Methanobacterium curvum AF2769S8.1 

with Bubalus bubalis FJ040814, FJ040816. 

To study the methanogen archaeal diversity in 

gaur, 71 sequences were analysed with the known 

one. Out of total clones, 43.66 per cent sequences 

fell in Methanobrevibacter sps. cluster I comprising 

of Mbb gottschalkii strain HO U55238, Mbb millerae 

strain ZA-10 A Y196673, and Mbb smithii A Y196669 

along with Bubalus bubalis FJ040817. Another lS.49 

per cent taxa of gaur belonged to 

Methanobrevibacter cluster II containing Mbb 

ruminantium A Y19666 and Mbb. olleyae strain 

KM1HS-1P AY61S201.1. A cluster of 

Methanobacteriurn forrnicicurn A Y1966S9.1, 

Methanobacteriurn palustre strain 21 DQ649333.1 

contained 2S.3S per cent taxa of gaur. The 

sequence of clone no. 114 showed close association 

with Methanosphaera stadtmanae AY196684.1. Three 

clones nos. 19, 7S and 12S made a small cluster 

with Methanobacterium curvurn AF2769S8.1 with 

Bubalus bubalis FJ040814, FJ040816. The taxa nos. 

23, 9, 119, 16, 26 and 104 did not belong to any 

group and can be considered novel which can be 

explored further. 

The analysis of archaeal methanogenic 

diversity in three wild animals revealed that in all 

the animals the major group of methanogens was 

of Methanobrevibncter sps. followed by 

Methanobacteriurn sps. In all the three animals, 

Methanobacteriurn curvurn AF2769S8.1 along with 

Bubalus bubalis FJ040814, FJ040816 (sequences 

submitted from our laboratory) and a few 

unknown taxa made a most distant group on the 

tree showing a divergence from other known 

methanogens. Community structure of 

methanogen archaea of these wild animals is very 

much similar to the other domesticated animals 

reported earlier. The novel taxa need to be 

explored further to establish their identity. 

Seventy four archaea clone of neelgai were 

submitted to NCBI GenBank with the following 

accession os.: 

JF500561, JFSOOS62, JFSOOS63, JF500S64, JFSOOS6S, 

JFSOOS66, JFSOOS67, JFSOOS68, JFSOOS69, JFSOOS70, 

JF500S71, JFSOOS72, JFSOOS73, JFSOOS74, JFSOOS75, 

JFSOOS76, JFSOOS77, JF500S78, JFSOOS79, JFSOOS80, 

JFSOOS81, JFSOOS82, JF500S83, JFS00584, JFSOOS8S, 

JFSOOS86, JFSOOS87, JF500S88, JFS00589, JFSOOS90, 

JFSOOS91, JFSOOS92, JF500S93, JFS00594, JFSOOS9S, 

JFSOOS96, JFSOOS97, JF500S98, JFS00599, JF500600, 

JFS00601, JFS00602, JF500603, JFS00604, JFS0060S, 

JFS00606, JFS00607, JF500608, JFS00609, JF50061O, 

JFS00611, JFS00612, JFS00613, JFS00614, JF50061S, 

JFS00616, JFS00617, JFS00618, JF500619, JF500620, 

JFS00621, JFS00622, JFS00623, JFS00624, JFS00625, 

JFS00626, JFS00627, JFS00628, JFS00629, JFS00630, 

JFS00631,JF500632,JF500633,JF500634 

(c) Effect of feed additives (nitrate and nitrate + 

NRBB57) on in vivo methane production in 

buffaloes 

To study the effect of feed additives on 

methane emission, nutrient utilization and growth 

performance, IS growing buffaloes with average 

body weight of 241 kg were divided into three 

groups. One group served as control and the other 

two groups served as the treatment groups. The 

two treatment groups were fed on diet

supplemented with nitrate (20% of concentrate 

protein) and nitrate + live culture of NRBB 57 @ 0.5 

mglkg body weight, respectively. For methane 

estimation, the animals were kept one by one in 

the open circuit respiration chamber and after 

three days of acclimatization, methane production 

was estimated for consecutive three days. There 

was no adverse effect of additives feeding on dry 

matter intake and dry matter digestibility as the 

values were similar in all the three groups. 

Methane production was significantly (p

treated groups indicating the improvement of 

rumen environment by the feeding of AO and 

CiLO oils. The concentration of TVF A and acetate 

to propionate ratio were similar in all the three 

groups. The rumen microbial enzymes viz., 

avicelase, carboxymethyl celluase, xylanase, 

protease and acetyl esterase were not affected by 

the feeding of AO and CiLO oils. The holotrichs 

population density significantly increased by 

feeding of AjO and CiLO, however, total protozoa 

population was similar in all the three groups. The 

rumen microbial density as estimated by real time 

PCR, revealed a reduction (p

the isolates and known sequences from GenBank 

were aligned using ClustalW. The trees were 

constructed using the neighbour-joining method. 

Primers for tannin tolerant bacteria (Targeting 

165 rRNA gene, PCR product size 1.5 kb) 

8FPL f 5' -CGG ATC CGC GCC GCT GCA 

GAG TIT GAT CCT GGC TCA G-3' 

1492 r 5' -GGC TCG AGC GGC CGC CCG 

GGT TAC CIT GTT ACG ACT T-3' 

The primer set used was targeted to 165 rRNA 

gene of tannin bacteria and amplification product 

was of 1.5 kb. The phylogenetic analysis of the 

unknown sequences revealed four clusters. The 

major cluster of isolates nos. TOGB 450, 428,20, 19,. 

420, 446, 417, 7, 437, 415 and 406 matched with 

Streptococcus gallolyticus subsps. gallolyticus and 

showed 100% similarity- with S. gallolyticus subsps. 

gallolyticus. Another cluster of TOGB 425 and 430 

made a group with Clostridium bifermentans which 

is a spore forming anaerobic bacteria. TOGB 409 

fromed a group with C. botulinum and C. 

sporogenes. C. sporogenes is widely present in the 

rumen. TOGB though made a group with S. bovis 

but the distance is too large. 

Primers for tannin degrading bacteria 

(Targeting 165 rRNA gene, product size 1.2 kb) 

TOf 5' -GGG TTG CGC TCG TTG CGG GAC 

ITAACCC-3 

TOr 5' -GAG TTT GAT CAT GGC TCA GAT 

TGAACGC-3 

The phylogenetic tree constructed using the 

primer targeting 165 rRNA gene of tannin 

degrading bacteria, showed five clusters. The 

major cluster of S. gallolyticus comprised of TOGB 

406, 450, 20, 446, 417, 19, 7 and 425 with 100 per 

cent similarity. Second cluster was of C. botulinum 

and C. sporogenes which was also with primer set 1. 

TOGB 433 and 430 grouped with C. bifermentans. 

TOGB 430 association with C. bifermentans was 

also there with primer 1, but TOGS 433 was 

grouped with S. bovis. S. carin us and S bovis were 

associated in one group. TOGB 428, 415 and 420 

did not show relationship with any known 

bacteria, but with primer 1 the three taxa were 

grouped with S. gallolyticus. Therefore these three 

isolates need further analysis. 

Primers for sodA gene (Targeting superoxide 

dismutase gene, product size 410 bp) 

5gsodA-F 5'-CAATGACAATTCACCATGA 

5gsodA-R 5' -TTGGTGCTITTCCTTGTG 

JIWTIm 

A mlllal Report 

2010-11 

The database of sodA gene is a valuable 

approach for taxonomic analysis of bacteria. The 

primer is species (S. gallolyticus) specific. Out of 15 

isolate, nos. TOBG 7, 19, 20, 406, 409, 4]5, 417, 420, 

425, 428, 430, 433, 437, 446 and 450, the genomic 

DNA of isolate nos. TOGB nos. 7, 19, 20, 406, 417, 

446, 425, 450, 415 and 420 amplified with the sodA 

gene primer. The isolates nos. TOGB 409, 428, 430, 

433 and 437 which did not amplify with sodA gene 

primer also showed ambiguity with primers 1 and 

2. They were either grouped with Clostridium sps. 

or made a separate group except TOGB 425 which 

with primer 1 grouped with Clostridium sps. and 

with primer 2 grouped with S. gallolyticus. 

Therefore, these isolates need further analysis for 

their molecular identification. The phylogenetic 

tree with primer 3 consists of two groups one 

group was of S. gallolyticus including isolates nos. 

TOGB 7, 19, 20, 406, 417, 425, 437, 446 and 450. The 

isolates nos. TOGS 415 and 420 made a separate 

group. The isolates TOGB 7, 19, 20, 406, 417, 446 

and 450 showed 100 per cent similarity with S. 

gallolyticus with all the three sets of primers. 

HEALTH AND PRODUCTION OF 

LIVESTOCK 

(1) BIOPROSPECTING OF GENES ANO 

ALLELE MINING FOR ABIOTIC STRESS 

TOLERANCE 

Normal physiological, haematological, 

biochemical and hormonal studies during winter 

and summer seasons were conducted on 175 

clinically normal Pashmina goats of Chegu and 

Changthangi and local hill breeds, acclimatized to 

temperate, humid climatic condition of 

Mukteswar. Normal values have been obtained to 

establish physiological trends, species 

characteristics and also to provide a basis for 

interpretation of results of experimental and 

clinical investigations. The experimental goats 

comprised three age groups (birth to 2 years, 2 to 5 

years and > 5 years age) of either sex. Blood was 

collected from each animal fortnightly during one 

peak summer (June) and winter month (January). 

Physiological, haematological, biochemical 

and hormonal parameters were analyzed and 

baseline data for physiological, hematological, 

biochemical and hormonal parameters were

established during heat and cold stress in 

temperate region goats. For the purpose of 

quantification of mRNA profile in lymphocyte for 

genes associated with thermoregulatory 

mechanisms in goats, the following ten genes were 

identified, namely HSP60, HSP70, Ubiquitin, 

HSP90, Il2, IL6, Leptin, RBM3, Metallothionin and 

CIRBP. Primers for all the above genes were 

designed and optimized for real time PCR 

analysis. 

(2) ADAPTATION AND FACILITATION OF 

LIVESTOCK TO IMPENDING CLIMATE 

CHANGE THROUGH SHELTER 

MANAGEMENT 

Thirty SIX animals of Vrindavani (12), 

Tharparkar (12) and Murrah buffalo (12) were 

grouped as adult (n=6) and calves (n=6) of 6-9 

months of age for each animal species/breed. The 

animals were housed in well ventilated animal 

shed and maintained under uniform husbandry 

conditions of feeding and management. 

The physiological observations viz., 

respiration rate, pulse rate, rectal temperature and 

surface temperature were recorded at weekly 

interval in the morning (9 AM) and afternoon (2 

PM) and blood samples were collected at 

fortnightly interval for hematology. The serum 

was separated and samples were analyzed for 

serum electrolytes (Na+, K+, and Chloride), protein, 

phosphorus, calcium, urea, bilirubin, creatinine, 

serum enzymes (ALT, AST, AChE and alkaline 

phosphatase) and hormones T3 (Triiodothyronine), 

T4 (Thyroxine) and cortisol. The data was analysed 

using t-test and analysis of variance in SPSS 11.0 

statistical software. 

Among all three groups, the adult Vrindavani 

cattle had significantly (P

IIWillII 

AllIllial Report 

2010-11 

developed. This monograph mainly consists of 

two parts i.e. introduction to commercialized 

technologies and impact of commercialized 

technologies. The first part provides the birds eye 

view of the vast contribution of the institute in 

technology generation for livestock disease 

prevention and control. 

Second part provides information related to 

the research study conducted to assess the impact 

of the five commercialized technologies of the 

institute viz., Olinall skin ointment, crystoscope, 

area specific mineral mixture, FMD vaccine and 

PPR vaccine. 

(2) DEVELOPMENT OF NEED BASED 

INTERACTIVE INFORMATION SYSTEM 

FOR LIVESTOCK PRODUCTION 

The final process of collection of the detailed 

scientific information on the diseases for the small 

ruminants (goat and sheep), pig, equine and 

poultry and conversion of the material into simple 

language to suit the system were completed. 

Development of the same system in Hindi 

language was also completed for all the 78 disease 

and 9 package of practices. Audio recording of the 

material for small ruminants, pig, equine and 

poultry in hindi and english was completed. 

Storage, classification, and processing, of the 

information for development of the interactive 

information system was completed and two 

information systems entitled 'Livestock and 

poultry Disease Information System' (LPDIS) and 

'Pashudhan avum Kukkut Rog Suchna Pranali' 

(P AKRSP) were developed. These systems are 

comprehensive packages containing information 

about all the infectious, non infectious, metabolic, 

parasitic and fungal diseases of major livestock 

species i.e. cattle, buffalo, sheep, goat, pig, horses 

and poultry. The major feature of this information 

system is its highly appealing presentation along 

with audio backup which helps in inculcating 

greater understanding of the diseases among the 

end users. This system is specifically designed to 

give information on each disease under four major 

heads i.e. epidemiology, symptoms, treatment, 

prevention and control to the livestock owners and 

other people engaged in the treatment and health 

care of livestock as well as to the students engaged 

in degree or diploma courses in animal health 

disciplines. The LPDIS and P AKRSP contains 

original, high quality photographs of majority of 

the diseases. Further, the use of animations for 

depicting that various aspects of the diseases 

makes the system more attractive and clear. The 

system can be run on a computer and is highly 

interactive. 

The system so developed has been 

administered at field level among the various 

groups of livestock owners/ farmers and paravets/ 

veterinary officers coming for educational tours/ 

trainings to the institute from all over the country 

to assess its impact, perceived utility, opinion, and 

its effectiveness in transmitting the information to 

the target audience and also to ask whether they 

would like to purchase it. The screening of the 

system was done at various places such as at the 

institute level to all the visitors and trainees viz., 

farmers, scientist, veterinary officers and paravets. 

Further it was shown at various villages around 

the institute and at the Kisan Mela's at IARI, PUSA, 

New Delhi and Pantnagar and was shown to 

various people visiting these fairs. 

(3) DEVELOPMENT OF PARTICIPATORY 

EDUCA TIONAL AIDS FOR LIVESTOCK 

PRODUCTION SYSTEM AND ITS IMP ACT 

ANALYSIS 

Animal husbandry based films were tested in 

terms of information coverage, audio quality, 

visual quality, pictorial depiction, understandability, 

etc. by showing the films to the 200 

respondents consisting of scientists, experts, 

academicians, veterinary professionals at different 

places in country. Further, the respondents were 

also asked to suggest the total duration of the films 

and the subjects/topic on which the educational 

films as well as audio CDs should be developed. 

The films shown were a) Management for 

better livestock and calf care (Non-lCAR films), 

and b) piggeries and improvement of low quality 

feed and fodder (I CAR films). Data were collected 

through pre-structured interview schedule from 

200 respondents to test the effectiveness of 

educational films. The results revealed that 88% of 

the respondents rated lCAR films "highly 

educational" in terms of information coverage. 

Whereas non-lCAR films were rated as "average 

educational" (32%) and "moderate educational" 

(28%) by majority of the respondents. ICAR films 

were reported very good in terms of audio quality 

by majority of respondents (89%) and the nonleAR 

films were rated "average". Regarding

iodegradable waste to compost within seven 

days. The results of fermentation in process in 

rotary drum composting machine revealed that 

bacteria played very important role as compared 

to actinomycetes and fungi. The quality of 

compost produced by this method is better in 

terms of total nitrogen, phosphorus, potassium 

and other micro nutrients. It is based on aerobic 

fermentation and required very less space. 

Interestingly, maximum population of bacteria 

was recorded in coelomic fluid (1.5x10 8 cfu/g) and 

fungi were absent in this sample. Yeast population 

was more abundant in vermibiomanure while 

fungal population was highest in NADEP . 

compost. Actinomycctes were more prevalent in 

nutriwash sample. Yeast population was more 

abundant in vermibiomanure, while fungal 

population was highest in NADEP compost. 

Actinomycetes were more prevalent in nutriwash 

sample. All the vermibiomanure isolates were 

screened for their hydrolytic enzyme production 

potential by qualitative means. Only three isolates 

(IV7, IV12 and IV26) were found to possess the 

capability to produce carboxymethyl cellulase. The 

three cultures were tested for amylase and 

CMCase by submerged fermentation in minimal 

media with paddy straw as sole carbon source. 

The results suggested that isolate IV25 is 

promising for amylase production. Isolate IV7 and 

IV26 were found to be good CMCase producer. 

Only two isolates namely IV1 and IV2 were having 

ability to enhance seed germination of wheat 

seeds. The results suggested that microflora 

present in vermibiomanure and nutriwash may be 

beneficial for plant growth and decomposition of 

cellulosic wastes. Vermibiomanure addition in 

casing material @ 1:1 (w/w) basis increased the 

yield of white button mushroom in the first flush 

by 11% than control (514 g in comparison to 463 g). 

However, total yield was reduced by 8.6% in 4 

flushes, (1130 g in comparison to 1320 g in control) 

due to white plaster mold disease (Scopulariopsis 

fimicola) late in season. Addition of coelomic fluid 

and nutriwash @ 1% and 5%, respectively in the 

wheat straw for oyster mushroom cultivation was 

found to significantly increase the yield of 

Pleurotus eous (14% and 16%), P. sajor-caju (18% 

and 15%) P. flabellatus (17% and 15%) and P. 

opunitiaZ (15% and 12%), respectively in 4 flushes. 

IIWillII 

AIl11ual Report 

2010-11 

An experiment was conducted with different 

source of nutrients viz., organic and inorganic on 

mango cultivar Amrapali to see effects on growth 

and yield. It is evident from data that maximum 

malformed panicles (38 panicles/plant) were 

observed in plants treated with 70 kg Nadep 

compost. However, minimum was recorded in 

control (5 panicles/plant). Moreover, application of 

either Nadep, or FYM or vermibiomanure had 

higher incidence of malformed panicles. Fruits set 

per plants were found to be the highest with 

application of 200 kg FYM alone (240 fruits/tree) 

followed by 50 kg vermibiomanure (195 

fruits/tree), lh dose of NPK + 100 kg FYM (143 

fruits/tree). Application of organic manure alone 

or in combination with inorganic fertilizers had 

lower peel thickness than controL Total soluble 

solids were found to be the highest in plants 

applied with lh NPK + 25 kg vermibiomanure and 

the lowest T.S.S. was recorded with 200 kg FYM 

alone. This treatment also had lowest acidity 

(0.17%). The maximum acidity (0.24%) was 

recorded in control plants. 

An experiment was conducted to evaluate the 

effect of vermibiomanure, hydrogel and 

hornbiomanure into commercial cultivation of cut 

flowers (chrysanthemum and gerbera). It is 

evident from results that the maximum leaf length 

(27.13 cm), leaf breadth 14.21 cm), leaf area, fresh 

area, fresh weight of plant, fresh weight of roots 

and dry weight of plant was observed in 

treatments (CPV + Vermibiomanure + Hydrogel). 

The number of leaves at appearance of first flower 

was found maximum (29.33) in T5 followed by T4 

(CPV + Hydrogel) (25.67) growing media. The 

minimum days (65 days) taken for appearance of 

first flower bud, first flower opening (76 days) and 

the first flower harvest (95 days) were observed in 

T5 growing media. The maximum stalk length 

(33.2 cm), stalk diameter (0.8 cm), flower head 

diameter (11.5 cm), flower disc diameter (1.93 cm), 

number of ray florets per flower (58.4), number of 

flowers per plant (6.47) and vase life (9.15 days) 

was exhibited in T-5. Another experiment was laid 

out in RBD using two varieties Rosalin (Pink) and 

Goliath (organe) under fully controlled green 

house to study the effect of different concentration 

of nutriwash applied @ 50% and 75% twice in 

week in addition to regular application of 19-19-19 

of NPK Based on the findings of the experiment it

JTIf1lliI 

AII/lllaf Report 

2010-11 

was reported that performance of gerbera CV. 

Rosalin was found significantly better when 

sprayed with 75% nutriwash, growing in soil 

based media amended with vermibiomanure and 

sandy soil. 

Different earthworm derived products viz., 

coelomic fluid, vermiwash and nutriwash were 

evaluated in seed enhancement treatments in 

different seed varieties of maize crop. It was 

revealed by experiment that coelomic fluid was 

most effective for pre-sowing seed enhancement 

treatments followed by vermiwash. Nutriwash 

had no effect on any of growth parameters studied 

in maize. Ceolomic fluids derived from indigenous 

species (Perionyx celenesis designated as uJai 

Gopal") was more effective than coelomic fluid 

derived from exotic species (Eisenea foetida). 

Field experiment was carried out to study the 

effect of three organic manures namely 

vermibiomanure, NADEP compost and FYM and 

mineral fertilizers alone or in combination at MB- 

8B of lARI Farm with maize-wheat crop rotation. 

Three value added organic products alone with 

one control and 100% recommended dose of NPK 

fertilizer (RDF) were evaluated through a field 

experiment. 

Results revealed that yields and nutrients 

uptake by maize and wheat due to integrated use 

of organic and mineral fertilizers increased 

significantly over application of manures alone 

and comparable with the recommended dose of 

NPK fertilizers (100% RDF). Soils amended with 

value added manures as well as 100% RDF 

significantly improved Walkley Black Carbon 

(WBC) over control during the different 

physiological growth stages of both the crops. 

Much more pronounced effect in improving WBC 

was observed under 50% RDF+St ha- 1 of manures 

than control as well as sole application of organic 

manures and 100% RDF. Among the organic 

sources, vermibiomanure performed better, 

followed by FYM and NADEP compost. It was 

also observed that organic C fractions decreased 

with the advancement of crop growth. Similar 

trend also observed in case of labile available 

organic C as well as microbial biomass C with 

treatment receiving 50% RDF+S t ha- 1 of manures. 

Among the different pools, microbial biomass C 

was more influenced by physiological growth 

stages of crops. Carbon mineralization (CO2 

evolution) also followed the same trend as in case 

of microbial biomass C, indicating that soil 

respiration was higher in the active growth stages 

of crops. As compared to maize, the SOC fractions 

improved in greater amount in wheat. It may be 

concluded that 50% RDF could be substituted by 

application of organic manures for crop 

production as well as for maintaining soil organic 

C, thereby 50% cost of chemical fertilizers could be 

saved. 

The results of chemical composition of value 

added organic products revealed that 

vermibiomanure is the best sources of crop 

nutrition. It was evi_FYM > NADEP compost in enhancing nutrient 

availability_ Grain yield of wheat and rice were 

also increased in subsequent years when 

vermibiomanure replaced chemical fertilizer for 

supplying same amount of nitrogen. 

23. VALUE ADDITION OF LIVESTOCK 

PRODUCTS 

(1) STUDIES ON PROCESSING 

QUALITY EVALUATION OF 

SU UM.I PRODUCTS 

AND 

MEAT 

The storage stability of patties, nuggets and 

balls prepared from mixtures of chicken meat and 

fish with 80:20 parts was assessed (Fig. 120). 

Samples packaged in medium density 

polytheylene bags were drawn on 0, 10 and 20 

days of storage at refrigeration temperature of 4°C 

and also on 30 and 60 days of frozen storage at 

-18°C and examined for physico-chemical, sensory 

and microbial quality. 

The results indicated that the pH values of 

chicken meat and fish prior to processing into

products were 6.1 and 6.2, respectively. The 

cooking yields for patties, nuggets and balls 

incorporating meat and fish flesh mixture were 

82.73%, 98.06% and 76.53%, respectively. The 

mean TBA values (mg malonaldehyde/kg wt. of 

sample) for these products were respectively 0.027, 

0.042 and 0.016 on 0 day, 0.095, 0.062 and 0.052 on 

10 days and 0.249, 0.452 and 0.156 on 20 days of 

refrigerated storage, while 0.032, 0.047 and 0.026 

on 30 days and 0.039, 0.052 and 0.027 on 60 days of 

frozen storage. All these values were below the 

level of perceived rancidity. 

Fig. 120: Value added patties and balls prepared from 

chicken meat and fish 

The results of sensory scores of the three 

products for appearace, flavour, juiciness, texture 

and product binding ranged from 4.86 to 6.94 on 7 

point descriptive scale. The overall acceptability 

scores of the three products during refrigerated 

and frozen storage, respectively, ranged between 

5.93 to 6.87 and between 5.14 to 6.31 indicating 

good to very good overall acceptability. The 

microbial count (TPC-Iog cfu/g) of the refrigerated 

products ranged between 1.85 to 3.11 and those of 

frozen products between 2.06 to 2.50. The findings 

indicated that value added products prepared 

with chicken meat and fish flesh (80:20) could be 

safely stored for 20 days at refrigeration 

temperature (4°C) and for 60 days at frozen 

storage (-18°C) without any adverse effect on 

physico-chemical, sensory and microbial qualities. 

The cost of finished product could also be reduced 

by 10%. 

(2) Studies on the development of functional 

restructured meat products 

A series of experimental trials were conducted 

to standardize the particle size, formulation and 

processing conditions to obtain restructured 

chicken meat blocks/slices with very good sensory 

acceptability and around 90% cooked yield. 

Incorporation of plant based extenders viz., raw 

banana pulp, soy chunks (hydrated 1:3), lentil 

flour (hydrated 1:1), boiled and mashed potato, 

water chestnut (hydrated 1:1), sorghum flour 

(hydrated 1:1) was tried individually in 

restructured product and the optimized levels 

were worked out as 8%, 9%, 6%, 6%, 10% and 9%, 

respectively. Incorporation of higher level was 

tried with the help of extender blends and 15% 

incorporation was achieved with an extender 

blend comprising lentil flour, sorghum flour and 

potato. 

Fig. 121: Extended restructured chicken meat 

blocks/slices 

The extended restructured chicken meat 

blocks/slices (Fig. 121) had comparable general 

appearance, binding, texture and overall 

acceptability to control product, but had slightly 

lower flavour and juciness. A comparison of 

physico-chemical properties of the extended 

restructured chicken meat slices revealed that the 

cooking yield per cent of the extended product 

was much higher and protein per cent was much 

lower than control. The most acceptable product 

was packaged in LOPE (200 guage) pouches and 

stored at refrigerated temperature (4±1°C). The 

slices were subjected to microbiological, sensory 

and physico-chemical analysis at 0, 7, 14 and 21 

days of storage. On the basis of results, the shelf 

stability of the product was assessed as 14 days.

(3) Development of novel shelf stable products 

from spent animal's meat 

Series of experiments were conducted to 

standardized formulations and processing 

conditions for preparation of shelf stable ready to 

fry/microwavable chicken meat based snacks, and 

ready -to cook/-to reconstitute dried meat chunks 

(Fig. 122). 

For mutton and chicken based snacks, 

different starchy flours were tried in combination 

with minced meat (40-50%). Optimum level of 

different ingredients, processing, cooking, drying 

and frying conditions were standardized. About 

10 formulations were tried and based on the 

results of sensory evaluation, five formulations 

were selected for detailed study. Moisture 

contents of dried and fried snacks varied between 

9.3 to 10.0 and 2.3 to 3.0%, respectively. Minimum 

protein contents in dried and fried snacks were 

19.5 and 16.04%, respectively. Products from all 

the five selected formulations were liked very 

much by the panelists. Best formulation having 

60% meat and 40% binder mix was selected and 

evaluated during storage. Physico-chemical, 

microbiological and sensory evaluation up to 30 

days of storage at room temperature revealed no 

appreciable changes in the quality of products. 

For preparation of dehydrated meat cubes, 

different binders viz., black gram, green gram, 

Bengal gram, lentil and reconstituted soy granules 

were used. Optimum level of different ingredients, 

processing, cooking, drying and re-hydration 

conditions were standardized. In preliminary 

trials, 10, 20 and 30% binders were tried with 70, 

80 and 90% minced mutton and chicken meat. 

Based on results of sensory evaluation, 4 best 

formulations were selected for detailed evaluation. 

Yield of dried products and dehydration ratio 

varied between 30.61 to 36.86% and 2.71 to 3.27%, 

respectively, and pH and WHC varied between 

6.04 to 6.17 and 20.0 to 21.5, respectively. Moisture 

percentage of products containing Bengal gram 

and green gram as binders was significantly lower 

than products containing black gram and lentil as 

binders. Minimum protein percentage in all the 

products was 36%. Fat percentage in different 

products varied between 4.6 to 5.5%. Although all 

the products were liked very much by the sensory 

panelists, but scores were significantly higher for 

products containing black gram as binder. 

Fig. 122: Shelf stable ready to fry/microwavable chicken 

meat based snacks 

(4) Development and evaluation of nutritious 

food products from dairy by-products 

Consumer evaluation and storage studies 

were conducted to assess the acceptability of the 

products and to determine their shelf life of the 

crisp milk products i.e. 'Milk Chips' and 'Milk 

Nimiki' developed last year. 

Consumer evaluation of milk chips showed 

29.7% of consumers rated the product as excellent 

and 48.51% as very good, whereas 19.31% 

consumers rated it as good. None of the 

consumers rated it as poor. Consumer evaluation 

of milk nirniki revealed very good acceptance for 

the product as about 85% of the respondents rated 

the product from good to excellent. Storage 

studies of the products conducted in terms of TBA 

values and microbial profile and sensory 

evaluation showed the shelf life of both the crisp 

milk products to be three months at ambient 

temperature. 

(5) Decontamination studies for reduction of 

foodbome pathogens 

Effect of lactic acid and polyhexamethylene 

guanidine (PHMG) on survival of different 

foodbome pathogens was studied by employing 

tissue culture plate method and spiking studies. 

The concentrations of different sanitizers used 

were lactic acid (0.5%, 1% and 1.5%) and PHMG 

(50 ppm, 60 ppm and 70 ppm). Reference strains of 

Verotoxic E. coli, L. monocytogens, Salmonella 

Typhimurium and Aeromonas were used in the 

study. All experiments were repeated 3 times to 

confirm reproducibility. The results indicated that 

1.5% lactic acid and 60 ppm PHMG were effective 

in reducing contamination of different foodborne 

pathogens.

(6) Meat authentication: an integrated molecular 

approach 

Five samples of blood from each male and 

female cattle were collected and genomic DNA 

was extracted for peR based sex determination. 

Based on the literature arnelogenin (AMELX/ 

AMEL Y), SRY, TSPY and DEAD box protein 

(DDX3X/ DDX3Y) genes were targeted for primer 

designing of sex specific primers for cattle. For 

each gene at least two sets of primers were 

designed. Polymerase chain reaction (peR) with 

the designed primers revealed that all the four sets 

of primers targeting amelogenin gene sequences 

were suitable for differentiation of sex origin of 

cattle meat (Fig. 123-126). 

III 1 2 3 . 4 5 6 N 

189 bp 

126 bp 

Fig. 123: Electrophoretic analysis of amplification 

fragments from the cattle DNA using LPT/AML-IF&R 

primers: 

Lane M: 100 bp DNA ladder; Lane 1,3&5: Male; 

Lane 2,4&6: Female; Lane N: Negative control 

bp 

bp 


fragments from the cattle DNA using LPT/AML-2F&R 

primers: 



.. 1 

2 3 4 5 

6 N 

IIWIRill 

All/llial Report 

2010-11 


fragments from the cattle DNA using primers 

LPT/ AML-3F&R: 



M 123 • 5 6 N 

241 bp 

178 bp 



primers: 



Two sets of primers targeting the DEAD box 

protein gene, where male exhibited two bands and 

female only one, were also found to be useful in 

differentiating the sex origin of cattle meat (Fig. 

127 and 128). The primers designed were unique 

as the DEAD box gene has been targeted for the 

first time for sex differentiation of cattle meat. 

Two sets of primers targeting SRY gene were 

able to differentiate the sex origin of cattle meat 

(Fig. 129 & 130). Among these, one set of the 

primer was also able to differentiate the sex origin 

of meat in other common species such as buffalo, 

sheep and goat (Fig. 131). The duplex peR of our 

own designed primers for amelogenin and SRY 

showed very clear bands which further support 

our findings (Fig. 132).

lIWlliJJ 


2010-11 

171 bp 

147 bp 


fragments from the cattle DNA using LPT/DDX3-4F&R 

primers 



M 1 23456 IN 


fragments from the cattle DNA using LPT/DDX3-6F&R 

primers: 



M 123456 N 

332 bp 

119 bp 


fragments from the cattle DNA using LPT/SRY-2F&R 

and LPTIGAPDH-2F&R primers: 



M 1 2 3 4 5 6 N 

339 bp 

182 bp 


fragments from the cattle DNA using LPT/SRY-1F&R 

and LPT/GAPDH-lF&R primers: 



M 123456 N 

332 bp 

119 bp 


fragments from the DNA using LPT/SRY-2F&R and 

LPT/GAPDH-2F&R primers 

Lane M: 100 bp DNA ladder; Lane 1: Buffalo male; 

Lane 2: Buffalo Female; Lane 3: Goat Male; Lane 4: 

Goat Female; Lane 5: Sheep Male; Lane 6: Sheep 

Female; Lane N: Negative control 

M 123456 N 

313 bp 

250 bp 

182 bp 

Fig. 132: Electrophoretic analysis of aJ!lplification 


and LPT/SRY-IF&R primers: 

Lane M: 100 bp DNA ladder; Lane 1,3, 5: Male; 

Lane 2,4,6: Female; Lane N: Negative control

4. TECHNOLOGIES ASSESSED AND TRNSFERRED 

The process of technology assessment and 

transfer is a major mandated activity of the 

institute. Technology refinement, up-scaling and 

promoting public private partnerships and startup-companies 

for technology led venture creation 

is an important goal of the institute. Another 

major activity of the institute has been the 

generation of awareness of the farmers and other 

end-users on the livestock health and production, 

and provide suitable package of practices 

including the need based farm-livestock oriented 

technologies. The technologies generated by the 

institute in the areas of animal health, production, 

reproduction, feeding and management, livestock 

products, etc. are field validated and on the basis 

of feedback received, are refined, if required, 

before they are transferred to end-users and/or 

commercialized and licensed to industry 

entrepreneurs. 

Some of the new technologies and the 

technologies already in field use that have been 

assessed during the year as an in-house activity 

are as under: 

Immunoprophylactics and immunodiagnostics 

• Live atte!luated goatpox vaccine 

• Cell culture classical swine fever vaccine 

• A rapid immunoassay for serodiagnosis of 

infectious bursal disease 

Clinical technologies and protocols 

• Polyherbal formulation for amelioration of 

fluoride toxicity has been developed and has 

been tested on clinical cases of fluorosis in 

Chitorgargh district of Rajasthan. Study 

revealed that the herbal formulation is 

capable enough to reduce body fluoride 

burden by enhanancing excretion of fluoride 

in urine. 

• IVRI anti-diarrhoeal herbal formulation in 

animal has been assessed in other 

geographical condition and region and found 

highly effective with laudable future prospect. 

• Therapeutic potential of udder paste prepared 

with bioorganic substances like trace 

minerals, essential oils, fullers earth and herb 

IIWITill 

Annual Report 

2010-11 

extracts, found effective against teat and 

udder lesions and also effective in reducing 

SCC in lactating cows. 

• Repato protective effect of various 

nutraceuticals of plant and animal origin has 

been tested and found highly effective in 

reducing hepatopathy. 

• Rerbo-mineral acaricide formulation against 

Boophilus microplus ticks in cattle is being 

assessed in other geographical condition and . 

region. 

• Ameliorative effect of few hydro-ethanolic 

herb extract against lead toxicity has been 

tested as prophylactic agent for lead in both 

kidney and blood. 

• Tube cystostomy was assessed in goats, 

buffalo calves and bullocks and the 

technology was transferred to the 

veterinarians. 

• For the management of urolithiasis, no scalpel 

surgery for goats and para-anal tube 

cystostomy in bullocks were reassessed in 

clinical cases and the technique was 

transferred to the veterinarians. 

• Earthworm coelomic fluid was evaluated for 

its efficacy in the management of different 

types of wounds in experimental and clinical 

cases and the technology was transferred to 

the veterinary surgeons and field 

veterinarians for further application under 

field conditions. 

• Mesenchymal stem cells and bone marrow 

nucleated cells were assessed for their efficacy 

in the management of cartilage defects, full 

thickness skin wounds, fractures, non-unions 

and spinal cord injury. The technology was 

transferred to field veterinarians through 

lectures and demonstrations during different 

training courses. 

• A technique to augment the healing of below 

carpus and hock wounds of equines with 

Calendula alcoholic extract and glycerin in 1:4 

ratios was assessed and transferred to the 

dressers of National Academy of Taxes, 

Dehradun (U.K).

• Physiotherapy and rehabilitation protocol 

was transferred through demonstration and 

training. 

Livestock products technology 

• Technology of functional chicken nuggets was 

transferred on non-exclusive basis to one 

entrepreneur. 

Farm Machinery 

• Milk feeder for the kids of sheep and goats 

• UMM block making machine (Pashu 

chokolator) 

Vermicomposting technologies 

• Improved three garbage processing 

earthworm species viz., Eisenea foetida, 

Eudrilus eugeniae and Perionyx ceylenensis 

designated as "Jai GopaY' 

• Package of practices for production of 

vermibiomanure and nutriwash. 

• Vermibiomanure sieving machine 

Extension Interventions 

• A total of 12 animal health camps were 

organized in Bareilly district wherein 240 

animals were treated. 

• Twenty kisan gosthies were organized in 

different villages of Bareilly district. 

• Technology demonstrations (37) were 

conducted in different villages of Bareilly 

district. 

• An Interface workshop of leading NGOs (46 

representatives from 42 NGO,s) of country 

and IVRI was organized at IVRI, during 13- 

14 th July, 2010. 

• A new initiative of mobile A TIC van started 

for dissemination and sale of IVRI technology. 

Total visits of mobile van to field were 64, 

Lluough which it covered 42 villages. 

• Technical services provided through Kisan 

Call Centre (1,176 calls) and Institute Help 

• 

• 

• 

• 

• 

• 

Line (433 calls) regarding livestock 

management, extension programmes, 

livestock feeding and nutrition, livestock 

diseases, goat husbandry, dog vare, poultry 

rearing, fisheries, bee keeping, horticulture 

and other allied subjects of agriculture. 

Institute's exhibition stalls at following places: 

Krishi Vigyan Mela IARI, PUSA New Delhi 

3 rd to 5th March 2011 

Kisan Mela at GBPU A& T Pantnagar 8 th to 11th 

October, 2010. 

Kisan Mela organized by Young Farmers 

Association at Patiala in Punjab on 8 th 

September, 2010 

National KVK conference at MPUA&T 

Udaipur, during 22-24th December, 2010 

Kisan Mela at CIRB, Hisar on 1 st February, 

201l. 

• Kisan Mela at CBPUA&T Pantnagar 9 th to 12th 

March, 2011. 

• NBFGR Lucknow during 1O-12th February, 

2011 

• SRM University, Chennai during Indian 

Science Congress held during 3-7th January, 

2011 

• Poultry rearing practices at high altitude was 

assessed and knowledge on the same was 

disseminated to hill farmers through Kisan 

Gosthis. 

• Developed and maintained linkages with 

NCO's and Self Help Groups (Chirag, Aarohi, 

Cirideep, etc.) working in this region and 

provided technical inputs and 

leaflets/pamphlets for onward transmission of 

technical know how to the end users.

• 

• 

• 

Linkage was established with local radio 

station "Kumaun Vani" and about 9 radio talks 

(including live broadcast of phoning 

programme). Through this programme, 

technologies of modem animal husbandry 

practices and solutions for animal health 

problems were provided. 

Technical advice provided through animal 

health and vaccination camps organized at 

farmers' door and 'Kisan Help-Line' of the 

Institute. 

Demonstrated scientific animal husbandry 

practices through 'Farmers' Visit' to different 

Livestock Production Unit of the Division of 

Temperate Animal Husbandry. 

Farm Literature 

• Two issues of half yearly magazine entitled 

"Pashu Chiktsa Vigyan" were published from 

A TIC for dissemination of scientific 

information to livestock owners, farmers and 

rural youth. 

• One issue of Gyan Vigyan Newsletter was 

published for the benefit of the farming 

community and extension personneL

wmn 

Annual Report 

2010-11 

5. EDUCATION AND TRAINING 

Indian Veterinary Research Institute is the 

citadel of learning and scholarship and also of 

creation, preservation and transformation of 

knowledge. Deemed University IVRI established 

in the year 1983 is catering the growing needs of 

the veterinary and animal science sector by 

offering excellent education in most areas of 

veterinary and animal sciences. The specific 

objectives of this Deemed University are to 

develop technologies in proactive manner that 

solve the immediate problems of the livestock 

farmers on priority and to enhance the 

productivity of livestock, reduce the cost of 

production and to increase production in a 

sustainable manner by creating the necessary 

infrastructure for carrying out research in the 

cutting-edge and frontier areas of veterinary 

science and livestock production technology. 

Postgraduate education and training on basic, 

supportive and allied discipline of veterinary and 

animal sciences are the integral functions of this 

university. Deemed University has envisaged a 

few approaches to accomplish the set goals and 

objectives in research by development of rapid 

and sensitive diagnostic tests and kits for 

diagnosis of animal diseases by improvement of 

immuno-prophylactics and use of biotechnological 

tools in evolving vaccines for important diseases 

of livestock and poultry and by human resource 

development. 

Massive infrastructure, adequate modem 

laboratory facilities, trained and experienced 

manpower in the fields of veterinary and animal 

sciences are the major strengths of the IVRI 

Deemed University. The university has performed 

exceedingly well with its glorious scientific and 

academic of its own with its long heritage as a 

school of higher learning, with a number of 

awards and excellent placement opportunities for 

students both within and outside the country. 

The Institute admits students to its 

postgraduate programmes through rigorous 

screening procedure under five categories viz., 

open competition, foreign students, in-service 

candidates of SAUs under faculty up-gradation 

scheme, departmental candidates of IVRI and 

ICAR in-service nominees. For admission to MVSc 

courses in the university, an all India written 

entrance examination was conducted by ICAR and 

142 students were selected after counseling. The 

written entrance examination for PhD courses was 

conducted by the Institute on 04.07.2010, followed 

by an interview on August 3-4, 2010 and 97 

students were selected. For the Master's and 

Doctoral Degree programmes, students admitted 

and degrees awarded during the year were as 

follows: 

Master's Degree Programme: Discipline-wise students admitted and degrees awarded 

were as follows. 

1. 

2. 

3. 

4. 

5. 

6. 

7. 

8. 

9. 

10. 

11. 

12. 

Animal Biochemistry 

Animal Biotechnology 

Animal Genetics and Breeding 

Animal Nutrition 

Veterinary Physiology 

Livestock Production and Management 

Livestock Products Technology 

Poultry Science 

Epidemiology 

Veterinary Bacteriology 

Veterinary Extension Education 

Veterinary Gynaecology and Obstetrics 

12 

14 

15 

16 

13 

8 

10 

19 

7 

11 

9 

13 

7 

7 

8 

8 

7 

4 

6 

10 

3 

6 

5 

7 

4 

6 

3 

5 

5 

3 

2 

5 

2 

6 

6 

5

course. There were two participants each from 

Bangladesh, Myanmar, Sri Lanka and Vietnam 

and one each from Nepal, Philippines, Indonesia 

and Thailand. 

Scholarships 

The students admitted in this premier Institute are 

given financial assistance in the form of different 

SI. Name of Award 

No. 

ICARJRF 

ICARSRF 

Institute 

Scholarship 

MVSc 

PhD 

CSIR]RF 

Inspire Fellowship 

DBT-JRF 

7. Rajiv Gandhi 

National 

Fellowship 

No. of 

Student 

220 

28 

106 

193 

1 

1 

1 

1 

scholarships such as, Institute Scholarship, Indian 

Council of Agricultural Research Fellowship, CSIR 

Fellowship and University Grants Commission's 

Junior Research Fellowship. In addition, students 

are also provided contingency grant for MVSc and 

PhD degree programmes. 

Amount Sanctioned (Rs.) 

Fellowshipl 

Scholarship 

Contingency 

20615607 864000 

4805428 220000 

9616320 

22554000 

144000 

216000 

246129 

288000 

636000 

1860000 

20000 

20000 

43952 

20000 

Amount 

Fellowshipl 

scholarship 

19969511 

2676693 

663435 

16827839 

49497 

108000 

232129 

268714 

IIWIRill 


2010-11 

Funds received under the scheme "Strengthening and Development of Agricultural Education (PG 

Education)" from Education Division of ICAR during the year 2010-2011 is as follows: 

2 

2.1 

3 

Works 

Repair, refurnishing/renovation, modernization of educational structure/ 

infrastructure and other work related to teaching and learning induding 

Model-Class rooms and PG laboratories. 

EquipDlent 

Equipm.ents/ComputerslImplements for education: 

Purchases, repair and maintenance of equipments including those for cuttingedge-technologies, 

e-Iearning and distance education, AMCs; Central 

instrumentation facility and Computers. 

Curriculum developm.ent and delivery 

3.1 Preparation of quality instructional material, practical manuals and eresources; 

Contingency grants for practical for UG/pG; ERN ET"" 

4 Strengthening of UG & PG teaching 

4.1 Faculty development, Facilitating within country participation in symposia, 

seminars, training (other than CAS/CAFT); JRD for technical/paraprofessionals 

and administrative staff; development of facilities for UG practicals, computer 

labs; repair, maintenance and AMC of equipment's; students study/educational 

tours. 

55.00 

45.00 

20.00 

17.00

7. LINKAGES AND COLLABORATION IN INDIA AND ABROAD 

INCLUDING FUNDED PROJECTS 

The development and transfer of knowledge/ 

technologies go hand-in-hand at the institute. For 

effective integration with local and national 

expertise and to have mutual benefit of the 

achievements in research and education, 

appropriate linkage and collaboration with other 

scientific agencies is the need of the day. 

Accordingly, the institute has established linkages 

with various national and international agencies 

AICRP/ COORDINATION UNIT/ NATIONAL CENTRE 

S.No Title of the Project Name of the Project 

Coordinator 

1. AICRP on Pigs A.K Verma 

2. Improvement of feed S.K Mandal 

resources and nutrient N.Dutta 

utilization for raising A.K Pattanaik 

animal production AKGarg 

All India Network Programmes 

S. Title of the Project Name of the PI & 

No. Associates 

1. Haemorrahagic V.P. Singh 

septicemia D.KSinha 

S.K Gupta 

P. Thomas 

2. Bluetongue AB. Pandey 

KP. Singh 

RP. Singh 

B. Mondal (Mukteswar) 

V. Bhanuprakash 

(Mukteswar) 

3. Gastrointestinal A. Prasad 

parasitism RajatGarg 

M. Sankar, TAH, Mukt. 

4. Performance of Murrah AKS. Tomar 

buffalo herd HN.Pandey 

s.c. Joshi 

Dr. Triveni Dutt 

S.Mehmood 

Mukesh Singh 

T.AKhan 

through a large number of funded projects under 

DBT, DST, DAE, ICMR, NPRE, DAH&D, APEDA, 

CZA, DRDO, CCRH, BNHS, UPCAR, Ministry of 

Environment and Forestry, Ministry of 

Agriculture, ICAR (through AICRP, Network 

projects, Niche Area of Excellence and NAIP) at 

national level, and BBSRC and DFID, UK and 

USDA at International level are in operation. The 

lists of the collaborative projects are as under: 

]970 

2003 

Date of 

Start 

Dale of Slart 

2001 

2001 

2001 

2001 

Sanctioned 

funds (Rs. 

in lakhs) 

36.35 

Sanctioned 

funds (Rs. 

in lakhs) 

97.78 

67.00 

7455 

Location 

LPMSection 

AN Division 

Location 

B&M 

Division 

CADRAD 

Parasitology 

Division 

LPMSection

3. 

4. 

5. 

6. 

7. 

8. 

9. 

10. 

nuclear transfer embryos 

reconstructed with 

embryonic stem cells. 

Immunoprophylactic 

evaluation of potential 

vaccine candidates 

against Fasciola gigantica 

in domestic animals 

Identification of novel 

proteins expressed by 

Salmonella spp. in 

biofilm and their utility 

in diagnosis of 

Salmonellosis 

Detoxification and 

utilization of key agroforest 

based nonconventional 

oil cakes in 

the feeding of livestock 

(Network) 

Development of Calcium 

phosphate Nanoparticle 

based DNA vaccine 

againstFMD 

Effect of phytochemicals 

on livestock health, 

production and emission 

of green house gases 

Development of 

embryonic stem cell 

lines from IVF derived 

early stage embryos in 

buffalo 

DBT Network Project on 

Classical Swine Fever 

with special reference to 

Northeastem Region 

Recombinant antigen 

based rapid seroprofiling 

of Newcastle 

disease virus 

O.K. Raina 

Dinesh Chandra 

Dr. S. Samanta 

AK. Tewari 

R.K. Agarwal 

KN. Bhilegaonkar 

A.K. Pattaniak 

S.K Saha 

Naryan Dutta 

(Mrs.) H.J. Dechamma 

V.V.S.Suryanarayana 

G.R. Reddy 

Ms. N. Banumathi 

AK. Pattaniak 

D.N.Kamra 

Naryan Dutta 

P.K. Gupta 

(Ms.) Deepti Rai 

(Ayurvet Res. 

Foundation, Delhi) 

Sadhan Bag 

AC. Mazumdar 

Bharat Bhushan 

Pallab Chaudhary 

S.K. Maiti 

B.c. Das 

G. Sai Kumar (CSF-1 

Component) 

Dr. A Sen 

(CSF-4 Component) 

C. Madan Mohan 

Sohini dey 

J.M. Kataria 

on 31 sf March, 

2011) 

Three years 

(w.e.f 7th Sept., 

2007) 

(Completed in 

Feb. 2010) 

Three years 

(w.e.f. 

13.11.2007) 

(Completed on 

12 November, 

2010) 

Five years 

(w.e.f. Feb., 

2008) 

Three years 

(w.e.f. March 

2008 to March, 

2011) 

(Completed on 

31 st March, 2011) 

Three years 

(w.e.f. June, 

2008) 

Three years 

(w.e.f. 

20.11.08) 

Five years 

(w.e.f. 24th 

Nov., 2008) 

Two years 

(w.e.f. 

3.12.2008) 

(Completed in 

December, 

2010) 

35.03 

21.50 

249.00 

28.30 

70.74 

NRI 

Component: 

52.17 

40.35 

221.20 

131.32 

37.21 

Parasitology 

Division 

B&M Division 

AN Division 

IVRJ, 

Bangalore 

AN Division 

P&C Division 

Pathology 

Division 

IVR1, 

Muktesewar 

Division of 

Animal 

Biotechnology

11. Development of 3-D Naveen Kumar Three years 82.264 Surgery 

biodegradable dermal Satish Kumar (w.e.f. Division 

matrices for Sameer Shrivastava 25.5.2009) 

reconstructive surgery. A. K. Sharma 

S.K. Maiti 

12. Novel intelligent Satish Kumar Three years 86.872 Animal 

peptides for targeting Sameer Shrivastava (w.e.f. Biotechnology 

peptide nuclic acids A.K. Tiwari 25.5.2009) Division 

(PNAs) into cells as 

antiviral therapeutics 

13. Evaluation of anti-rabies P.K. Gupta Three years 56.35 Animal 

effect of small R.P. Singh (w.e.f. Biotechnology 

interfering RNA A.A. Raut 22.6.2009) Division 

(siRNA) delivered 

through viral vector 

14. Development of Sohini Dey Three years 27.71 Animal 

recombinant vaccine for C. Madan Mohan (w.e.f. Biotechnology 

infectious bursal disease J.M. Kataria 29.12.2009) Division 

virus (Indo-US) 

15. Component C3 binding P. Joshi Three years 34.00 Biochemistry 

protein of Haemonchus B.P. Singh (w.e.f. Division 

Contortus and its S.c. Gupta 21.9.2010) 

significance in hostparasite 

interaction 

16. Quest for disease Ashwin Ashok Raut Three years 47.36 (For Animal 

resistant GM poultry (w.e.f. first year) Biotechnology 

Development of RNAi 6.2.2009) Division / 

based anti-Infectious HSADL 

Bursal Disease measures 

for poultry 

17. Expression and Mihir Sarkar Four years 50.063 P&C Division 

localisation of autocrine G. Taru Sharma (w.e.f. 

and paracrine factors Gyanendra Singh 14.3.2011) 

and their receptors RK. Mahapatra 

regulating corpus 

luteum function during 

the estrous cycle of 

buffaloes (Bubalus 

bubalis) 

18. Development of user AjayKumar Three Years 16.58 Animal 

friendly diagnostic kit Vikramaditya (w.e.f. Biotechnology 

for detection of bovine Upmanyu 9.3.2011) Division 

herpes virus - 1 (RGYI) Deepak Kumar

21. RNAi mediated 

comparative functional 

analysis of immune 

response genes in 

ruminants and fish against 

Mycobacterium avium ssp. 

paratuberculosis and M. 

fortuitum (NFBSFARA) 

(Lead Institute) 

Abhijit Mitra (PI) 

Shibnath Mazumdar 

(CCPI), Delhi 

University 

BN. Tripathi (CCPI), 

CSWRI 

OTHER FUNDED PROJECTS 

S.No. Title of the Project Name of the PI &: 

Associates . 

L 

2. 

3. 

4. 

5. 

6. 

Quality assurance of V.K. Chaturvedi 

rinderpest and PPR R.P. Singh 

vaccines maintained as 

vaccine banks in various 

states (NPRE) 

Monitoring 

extraneous 

substances 

residues in animal 

products (APEDA) 

National 

rinderpest 

(DAH&:D) 

of J .K. Malik/S. Kalpana 

chemical 

and their 

project on 

eradication 

A.B. Pandey 

Non-invasive Gyanendra Singh 

monitoring of buffalo 

reproduction: 

application of fecal 

steroid hormones and 

metabolite assay 

(Department of Atomic 

Energy (DAE) (BRNS) 

Establishment of vermi Ranvir Singh 

culture hatcheries for A.K.S. Tomar 

animal and agrowaste 

harbour earthworm 

species (National Centre 

of Organic Farming, 

Ministry of Agriculture) 

Establishment of model Ranvir Singh 

project on recycling of A.K.S. Tomar 

animal and agrowaste 

management (National 

Centre of Organic 

Farming, Ministry of 

Agriculture) 

January 1 st , 

2011 to 31

7. Standardization of AsitDas Three years 31.44 Wildlife 

animal diets in Indian (Mrs.) Mohini Saini (w.e.f. Section 

zoos (CZA) S.Saha Noverrtber, 

C.c. Das 

2007) 

(Completed on 

31 st March, 

2011) 

8. Measurement of A.K. Verma Two years 14.89 AN Division 

methane emission due to PutanSingh (w.e.f. 2008) 

enteric fermentation V.B. Chaturvedi (Completed 

using open circuit in August, 

respiration chamber in 2010) 

cattle and buffaloes 

(NATCOM, Ministry of 

Environment & 

Forestry) 

9. Development of enzyme D. Bhattacharya Three years 17.24 ERS, Kolkata 

linked immunosorbent (w.e.f Feb., 

assay (ELISA) for 2008) 

diagnosis of cystic (Completed 

echinococcosis (CE) in On 28 th Feb., 

animal and man (lCMR) 2011) 

10. Study of Bunya virus G.S. Desai lbreeyears 45.00 HSADL, 

Infections in Animal In P.R. Vanamayya (w.e.f. March, Bhopal 

India. (DRDO), (Life S.c. Dubey 2008) 

Sciences Research Board, S. Ghosh (Completed) 

Min. of Defence). 

11. To evaluate certain UmeshDimri Three years 16.45 Medicine 

homeopathic medicines M.C.Sharma (w.e.f. March, Division 

for their immune- Bhaskar Sharma 2008) 

modulatory and / or (Mrs.) M. Kataria (Extended up 

antioxidant potential S.Dey to June 2011) 

(CCRH, NEW DELHI) 

12. Establishment of model (Mrs.) Hema Tripathi w.e.f.17 th 18.00 KVK 

nursery for fruit crops Ranjit Singh Jan., 2009 

Under the scheme of H.K.Meena 

National Horticulture Rakesh Pandey 

Mission by Horticulture 5.5. Tripathi 

& Food Processing 5.S. Tomer 

Department, UP Govt. 

13. Molecular typing and (Mrs.) Sohini Dey 3 years 5.64 Lakhs Animal 

development of virus w.e.f.31 s t Biotechnology 

like nona-particles March 2009 Division 

towards generation of 

novel vaccine for 

infectious bursal disease 

virus (ffiDV) of chicken 

(DST)

22. Pathogenesis of animal S.K. Srivastava Two years 6.21 B&M 

bacterial diseases (DST) (w.eJ.9th Division 

Aug., 2010) 

23. Diclofenac monitoring in Mohini Saini One Year 13.40,240/- Wildlife 

cattle and buffalo A.K.Sharma (w.eJ. Section 

carcasses surveyed in AsitDas September 

2009-10 and Praveen Gupta 2010 

investigating other to August 

causes of mortality in 2011) 

vultures in India 

(BNHS) 

24. Structural and S.c. Das Three years 12.00 ERS, Kolkata 

functional analysis of T. Ramamurthy (NIC (w.e.f. 

the locus of enterocyte ED) September 

effacement (LEE) - a 2010) 

pathogenicity island in 

Shiga toxigenic 

Escherichia coli (STEq 

strains from human and 

animals with special 

reference to its 

pathogenicity (lCMR) 

25. Conservation of Sahiwal Ranvir Singh (Pij Three Years 14.46940 Animal 

Cattle through farmers Sardar Mahmood (w.e.f. 21st Genetics 

participation in Uttar A.K.S. Tomar December, Division 

Pradesh (UPCAR) S.K.Ghosh 2010) 

INTERNATIONAL COLLABORATIVE RESEARCH PROJECTS (On going) 

S.No. Title of the Project Name of the PI & Date of Start Sanctioned Location 

Associates funds (Rs. 

in lakhs) 

1. Antigenic and genetic R. Venkataramanan Two Years $453,000.00 lVRI, 

characterization of Foot B. Pattanaik, (w.e.f. July (Total Cost) Bangalore 

and Mouth disease PC-FMD, Mukteshwar 2010 to $179402.00 

viruses in India: 29.9.2012) (lVRI 

Application to effective (period of Component) 

molecular vaccines agreement 

(USDA, USA) from 

30.9.2009 to 

29.9.2012) 

2. Anticoccidial vaccine P.S. Banerjee (PI) Three Years Money still ParaSitology 

development: The A.K. Tewari (w.e.f. March not released Division 

importance of genetic M.Sankar 2010 to 

diversity and delivery March 2012) 

strategy (BBSRC and 

DFID, UK)

8. LIST OF PUBLICATIONS 

Division of Bacteriology and Mycology 

1. Abhishek, Rawat, M. and Mishra, A (2010). 

Purification and activity of phage induced 

lysin against mastitogenic strains of 

Staphylococcus aureus. Biotechnol. Int., 3: 18- 

25.* 

2. Chaudhuri, P., Prasad, R., Kumar, V. and 

Basavarajappa, AG. (2010). Recombinant 

OMP28 antigen-based indirect ELISA for 

serodiagnosis of bovine brucellosis. Mol. 

Cell. Probes, 24: 142-145.* 

3. Das, S., Singh, V.P., Ltu, K, Kathiresen, S. 

and Bhilengaonkar, KN. (2010). Cloning 

and sequencing of hly gene of Indian isolate 

of Listeria monocytogenees. /. Vet. Pub. Health, 

8: 23-28. 

4. Dhawale, S.P., Zende, R.J., Paturkar, A.M., 

Agarwal, RK, Dubal, Z.8., Bute, V.S. and 

Chothe, S.V. (2010). Prevalence of Salmonella 

serovars in whole dressed chicken carcasses. 

/. Vet. Pub. Health 8: 37-39. 

5. Gupta, S.K, Singh, S.D., Dhama, K, Kataria, 

].M., Dash, B.B. and Rahul, S. (2009). 

Detection of egg drop syndrome 76 virus by 

polymerase chain reaction (PCR) and 

restriction endonuclease analysis of its 

penton gene. Indian /. Comp. Microbiol. 

Immunol. Inf Dis., 30: 75-78. 

6. Kathiresen, S., Singh, V.P., Cheema, P .S., 

Ltu, K and Das, S. (2010). Characterization 

of surface lipoprotein P48 in Indian isolates 

of Mycoplasma agalactiae. J. Immunol. 

Immunopathol., 12: 64-67.* 

7. Rana, R, Kumar, A., Tiwari, H.A. and 

Vihan, V.S. (2010). Atypical goat pox - A 

case report. Indian J. Vet. Med., 30: 71. 

8. Ranjan, R, Singh, S., Gupta, S.K, Singh, 

V.P., Singh, AP., Bind, RB. and Sharma, B. 

(2010). Detection of Pasteurella multocida in 

blood by Real time PCR. Indian J. Vet. 

Pathol., 34: 15-16. 

9. Singh, A.P., Singh, S., Ranjan, R., Gupta, 

S.K, Singh, V.P. and Sharma, B. (2010). 

Molecular haterogeneity of pIpE gene in 

Indian isolates of Pasteurella multocida and 

expression of recombinant PipE in vaccine 

strain of Pasteurella multocida serotype B: 2. ]. 

Vet. Sci., 11: 227-223. 

Centre for Animal Disease Research and 

Diagnosis 

10. Chandra, D., Sinha, D.K, Singh, KP., 

Chauhan, RS and Pandey, AB. (2009). 

Emergence of demodicosis in breeding bulls 

following FMD vaccination. J. Vet. ParasitoI., 

23: 163-166. 

11. Dharanesha, N.K, Singh, R., Sharma, A.K. 

and Singh, KP. (2010). Spontaneous 

microscopic brain lesions in cattle and 

buffaloes. Indian J. Vet. Pathol., 34: 12-14. 

12. Gangwar, A.K., Harma, A.K., Kumar, N., 

Sangeeta Devi, KH., Maiti, S.K, Gupta, D.P. 

and Singh, R. (2010). Reconstruction of large 

abdominal wall defect with carbon mesh in 

rabbits: gross, histopathological and 

histochemical studies. Indian J. Anim. Sci., 

80: 29-32. 

13. Kumar, M. and Nandi, S. (201O). 

Development of a SYBR Green based real 

time PCR assay for detection and 

quantitation of canine parvovirus in faecal 

samples. J. Viral. Meth. 169: 198-201.* 

14. Kumar, M., Chidri, S. and Nandi, S. (201O). 

Molecular cloning and restriction 

endonuclease analysis of canine parvovirus 

DNA amplified by polymerase chain 

reaction. Global Vet., 4: 125-129.* 

15. Kumar, M., Manohar, M. and Nandi, S. 

(2010). Characterization of canine 

parvovirus in lymphocyte culture. Indian 

Vet. J., 87: 1194-1197. 

16. Kumar, M., Nandi, S. and Manohar, M. 

(2010). Comparison of virus isolation and 

haemagglutination assay with polymerase 

chain reaction for diagnosis of canine 

parvovirus. Indian Vet. ]., 87: 849-852. 

17. Kumar, M., Chidri, S. and Nandi, S. (2010). 

Development of a polyclonal antibodybased 

AC-ELISA and its comparison with 

PCR for diagnosis of canine parvovirus 

infection. Virol. Sinica, 25: 352-360.* 

JIWIlli[ 

AlIIllial Report 

2010-11 .. iIIII

JI\'fIRill 


2010-11 

18. 

19. 

20. 

Nandi, S. (2010). Molecular typing of canine 

parvovirus variants by polymerase chain 

reaction and restriction enzyme analysis. 

Transbound. Emerg. Dis., 57: 458-463.* 

Nandi, S. and Kumar, M. (2010). Serological 

evidence of bovine herpesvirus-l (BoHV-1) 

infection in yaks (Peophagus grunniens) from 

the National Research Centre on Yak, India. 

Trap. Anim. Health Prod. 42: 1041-1042.* 

Nandi, S., Anbazhagan, R and Kumar, M. 

(2010). Molecular characterization and 

nucleotide sequence analysis of canine 29. 

parvovirus strains in vaccines in India. Vet. 

Italiana, 46: 69-81.* 

21. Nandi, S., Manohar, M. and Kumar, M. 

(2010). Sera-surveillance of infectious 30. 

bovine rhinotracheitis in buffalo bulls. 

Indian Vet. J., 87: 544-545. 

22. Paul, S., Chandra, D., Tewari, AX., 

Banerjee, P.S., Ray, D.o., Boral, R and Rao, 

J.R., (2009). Comparative evaluation and 31. 

economic assessment of coprological 

diagnostic methods and PCR for detection 

of Cryptosporidium spp. in bovines. Vet. 

Parasitol., 164: 291-295.* 32. 

23. Sankar P, Telang AG, Manimaran A (2011). 

Effect of piperine on cypermethrin-induced 

oxidative damage in rats. J. Vet. Sci. Tech., 1: 

104 [doi: 10.4172/2157-7579.1000104].* 33. 

24. Singh, KP., AL-Rawahi, Q., AmbuAli 

Aisha, A, AL-Kalbani Sami, A, Body, M., 

AL-Yahamadi Nasir, AL-Maawali, M. and 

AL-Rawahi, A (2010). Malignant 

lymphoma in calves of local Gmani cattle in 

an organized dairy farm. Indian f. Vet. 34. 

Pathol., 34: 110-112. 

25. Singh, KP., Body, M., AL-Lamki, K., AL 

Habsy, S., AL-Rawahi, Q., AL-Rawahi, A 

and AL-Maawali, M. (2010). Detection of 

rabies virus in brain tissue by one-step 35. 

reverse transcription-polymerase chain 

reaction. Indian]. Vet. Pathol., 34: 1-4. 

26. Singh, R, Singh, KP., Sharma, AK. Nandi, 

S. and Chauhan, RS. (2010). Mortality due 

to infectious canine hepatitis in sloth bears 36. 

(Melursus ursinus) in ,captivity. Indian J. 

Anim. Sci., 80: 961-964. 

27. Umeshappa, e.S., Singh, KP., Ahmed, KA, 

Pandey, AB. and Nanjundappa, RH. 

(2011). The measurement of three cytokine 

transcripts in naive and sensitized ovine 

peripheral blood mononuclear cells 

following in vitro stimulation with 

bluetongue virus serotype-23. Res. Vet. Sci., 

90: 212-214. 

Division of Medicine 

28. De, UK. and Dey, S. (2010). Evaluation of 

organ function and oxidant/antioxidant 

status in goats with sarcoptic mange. Trop. 

Anim. Health Prod., 42: 1663.* 

De, UK., Girish, KS., Dey, S. and Swarup, 

D. (2011). Therapeutic manage-ment of 

acuteTrypanosomiasis in Equine. Indian Vet. 

J., 88: 60-61. 

Dey, S., Swarup, D., Saxena, A and Dan, A 

(2010). In VIVO efficacy of tamarind 

(Tamarindus indica) fruit extract on 

experimental fluoride exposure in rat. Res. 

Vet. Sci. [doi: 10. 1016/j. rvsc. 2010. 09.013]* 

Dimri, D., Sharma, M.e, Sharma, B. and 

Kataria, M. (2010). Immuno-modulatory 

and antioxidant potential of a herbal 

formulation. Livestock Int., 14: 12-14. 

Kumar, A, Dey, S., Pawde, AM. and 

Haque, M. (2010). Ultrasonographic 

diagnosis of pancreatitis in 2 dogs. Indian J. 

Vet. Surg., 31: 67-68. 

Mukherjee, R, De, UK and Ram, G.e 

(2010).. Evaluation of mammary gland 

immunity and therapeutic potential of 

Tinospora cordifolia against bovine sub 

clinical mastitis. Trap. Anim. Health Prod., 42: 

645-649.* 

Mukherjee, R., Jadhav, RK. and De, D.K. 

(2010). Expression of L selectin molecules on 

peripheral leukocytes in response to Nisin 

treatment during acute bovine mastitis. 

Veterinarski Arhiv., 30: 355-364.* 

Nabi, S.D., Singh, J., Vala, J.A, Sudan, V., 

Dey, S., Zama, M.M.S. and Haque, M. 

(2010). Pyrithraid poisoning in a hanuman 

langur (Semnopithecus entellus). Indian 

Wildlife Year Book, 8 and 9: 99-100. 

Sharma, N., Mukherjee, R, Ingale, S.L. and 

Jadhav, R (2010). Therapeutic and antioxidant 

activity of vitamin E and selenium 

in bovine Staphylococcal mastitis. Indian J. 

Vet. Res., 19: 25-31.

37. 

38. 

39. 

40. 

41. 

Sharma, N., Mukherjee, R., Ingale, S.L. and 

Jadhav, R. (2010). Effect of Phyllanthus 

emblica on ceruloplasmin in bovine 

Staphylococcal mastitis. Indian J. Vet. Res., 

19: 19-24. 

Singh, S.K and Dirnri, U. (2010). Use of 

Withania somnifera extract in canine 

demodicosis. Indian Vet. J., 87: 1091-1092. 

Singh, S.K, Dirnri, u., Saxena, S.K and 

Jadhav, RK (2010). Therapeutic 

management of canine atopic dermatitis by 

combination of pentoxifylline and PUFAs. J. 

Vet.Philrmacol. Ther., 33: 495-498. * 

Singh, S.K, Dirnri, u., Sharma, M.C., 

Sharma, B. and Saxena, M. (2010). 

Determination of CD4+ and CD8+ T cells in 

the peripheral blood of dogs with 

demodicosis. Parasitol., 137:1921-1924.* 

Vijayakumar, H., Pandey, N.N., Gurav, A., 

Mishra, KK and Mondal, D.B. (2011). 

Diagnostic evaluation of ultrasonography in 

canine hepatobiliary and urinary disorders. 

Indian]. Anim. Sci., 81: 65-00. 

Referral Veterinary Polyclinic 49. 

42. Khurana, S., Khurana KL. and Sethi, RK 

(2010), Retrospective epidemiological 

analysis of mortality trends in neonatal and 

growing Murrah buffalo calves at an 

organised herd. Indian J. Anim. Sci., 80: 976- 

979. 

50. 

Wildlife Section 

43. Das, A, Choubey, M., Gupta, S.P., Saini, M. 

and Swarup, D. (2010). Feed consumption, 

nutrient utilization, faecal pellet 

characteristics and serum metabolite profile 

of captive spotted deer (Axis axis) fed diets 

51. 

containing different roughages. Small 

44. 

Rumin. Res., 94: 185-189*. 

Das, A, De, D. and Katole, S. (2011). Effect 

of partial replacement of concentrates with 

barhar (Artocarpus lakocha) leaves on growth 

performance of kids fed a mixed jungle 

grass-based diet. Asian-Aust.]. Anim. Sci., 24: 

45-55.* 

52. 

45. Ramesh, D., Saini, M., Swarup, D., Singh, V., 

Upreti, S., Das, A and Gupta, P.K (2010). 

Interferon alpha characterization and its 

comparative expression in PBM cells of 

53. 

IIWITill 

AnnulIl Report 

2010-11 

Capra hircus and Antelope cervicapra cultured 

in the presence of TLR9 agonist. Mol. BioI. 

Int., doi: 10.4061/2010/573426.* 

Division of Parasitology 

46. Allaie, I.M., Prasad, A and Nasir, A (2010). 

Identification of imrnunodominant 

polypeptides of infective larva of 

Haemonchus contortus. Indian J. Anim. Sci., 80: 

506-508. 

47. Ghosh, S., Sharma, A.K., Sachin Kumar, 

Tiwari, S.5., Rastogi, S., Srivastava, S., 

Singh, M., Rinesh Kumar, Paul, S., Ray, D.D. 

Chaudhuri, P., Rawat, AKS. (2011). In vitro 

and in vivo efficacy of Acorus calamus extract 

against Rhipicephalus (Boophilus) microplus. 

Parasitol. Res., 108: 361-370.* 

48. Jeyabal, L.P., Azhahianambi, K, Susitha., 

Ray, D.o., Chaudhuri, P., Vanlahrnuaka and 

Ghosh, S. (2010). Efficacy of rHaa86, an 

orthologue of Bm86, against challenge 

infestations of Hyalomma anatolicum 

anatolicum. Transbound. Infcct Dis., 52: 96- 

102.* 

Kundu, K., Rao, J.R., Tewari, A.K., Baidya, 

S., Mishra, A.K (2010). Existence of genetic 

variability among Indian isolates of 

Trypanosoma evansi. Indian J. Anim. Sci., 80: 

3-6. 

Nagar, G., Raina, O.K, Verghese Anju, 

Kumar, N., Samanta, S., Prasad, A., Gupta, 

S.c., Banerjee, P.S., Singh, B.P., Rao, J.R, 

Tewari, AK, Paul, S., Jayrow, AK, 

Chandra, D. and Garg, R (2010). In vitro 

excystment of Fasciola gigantica 

metacecariae. J. Vet. Parasitol., 24: 169-171. 

Ravindran, R, Sreekumar, C., Saravanan, 

B.c., Udaykumar, M., Tewari, A.K, Kumar, 

S., Rao, J.R and Mishra, AK (2010). Genetic 

variation among Indian isolates of Babesia 

bigemina. J. Vet. Parasitol., 24: 159-163. 

Sankar, M., Prasad, A, Zahid, AK, Siju, 

S.J., Singh, c., Kumar, M ., Saravanan, B.C. 

and Raina, O.K (2010). Sequence and 

phylogenetic analysis of Intemal 

Transcriber Spacer (ITS-I) ribosomal DNA 

sequence of Fasciola gigantica isolated from 

Bareilly.]. Vet. Parasitol., 24: 107-110. 

Saravanan, B.C., Pourouchottamane, R., 

Kataktalware, M.A, Rajkowa, J. and

Ramesha, KP. (2010). Occurrence of Ixodes 62. 

cookei on Yak and its hybrids in India. J. Vet. 

Parasitol., 24: 87-89. 

54. Saravanan, B.C., Sankar, M., Bansal, G.c., 

Sreekumar, c., Tewari, AK, Rao, l.R and 63. 

Ray, D.D. (2010). Random amplified 

polymorphic DNA profiles in two Indian 

strains of Theileria annulata. J. Vet. Parasitol., 

24: 39-43. 

55. Tewari, AK, Rao, J.R., KUruPf S.P., Hira 

Ram and Mishra, A.K. (2010). Infection trial 

with Trypanosoma evansi on Clarias jeripenus. 64. 

Indian Vet. J., 87: 230-231. 

56.. Vanlalhmuaka, Bansal, G.c., Saravanan, 

B.C., Rao, J.R and Ray, D.D. (2010). 

Evaluation of pre-erythrocytic stage 

recombinant proteins of Theileria annulata 

for early diagnosis of bovine tropical 

theileriosis in Indian cattle. Indian J. Anim. 

Sci., 80: 822-825. 

Division of Pathology 

57. Bhatt, P., Shukla, S.K, Mahendran, M., 

Dhama, K, Chawak, M.M. and Kataria, J.M. 

(2011). Prevalence of chicken infectious 

anemia virus (CIA V) in commercial poultry 

flocks of Northem India: A serological 

survey. Transbound. Emerg. Dis., doi: 

1O.111l1j.1865-1682. 2011.01215.x. £EpubJ.* 

58. Bhubneswari, T. and Singh, S.D. (2010). 

Pathobiology and molecular 

characterization of avian infectious 

bronchitis virus isolates and 

standardization of suitable diagnostic 

methodology. Indian]. Vet. Pathol., 34: 225. 

59. Dhamesha, N.K, Singh, RK, Sharma, AK 

and Singh, K.P. (2010). Spontaneous 

microscopic brain lesions in cattle and 

buffaloes. Indian J. Vet. Path., 34: 12-14. 

60. Eswari, 5., Rajarajan, K, Saikumar, G. and 

Sharma, G.T. (2011). Supplemen-tation of 

Leukemia inhibitory factor on in vitro 

development of buffalo embryos. Tamilnadu 

]. Anim. Sci., 6: 255-261. 

61. Eswari, S., Saikumar, G and Sharma, G.T. 

(2011). Expression of messenger RNA 

encoding LIF receptor beta in buffalo 

preimplantation embryos produced in vitro. 

Indian]. Anim. Sci., 81: 12-14. 

65. 

66. 

67. 

68. 

69. 

70. 

Hajra, S. and Somvanshi, R (2010). 

Spontaneous case of bile-duct carcinoma in 

a Syrian golden hamster (Mesocricetus 

auratus). Indian J. Vet. Pathol.,34: 87-89. 

Mahendran, M. and Dhama, K (2010) .. 

Development of indirect ELISA for 

detection of chicken infectious anemia virus 

(CIA V) antibodies in poultry and 

evaluation of the immunoreactivity of 

recombinant CIA V proteins. Indian J. Vet. 

Pathol., 34: 100. 

Mishra, A, Saikumar, G. and Sharma, G.T. 

(2010). Expression of Cx43 and PAP genes 

in vitrified in vitro matured buffalo embryos 

produced in vitro. J. Appl. Anim. Res., 38: 29- 

32.* 

Mishra, B., Srivastava, V.K., Chaudhry, R, 

Somvanshi, RK, Singh, AK, Gill, K, 

Somvanshi, R, Patro, LK and Dey, S. 

(2010). SD-8, a novel therapeutic agent 

active against: multidrug-resistant Gram 

positive cocci. Amino Acids, 39: 1493-1505.* 

Nagaraj an, K, Saikumar, G., Arya, RS., 

Gupta, A, Somvanshi, R. and Pattnaik, B. 

(2010). Influenza A H1N1 virus in Indian 

pigs and its genetic relatedness with 

pandemic human influenza A 2009 H1Nl. 

Indian J. Med. Res., 132: 160-167. 

Pangty, K, Dey, S. and Somvanshl, R. 

(2011). Preliminary anti-tumor peptide 

therapy trial in Bovine PapiUoma Virus 

induced experimental hamster tumor 

model: A pathological assessment. Curro 

Sci., 100: 1020-1031. 

Pangty, K, Singh,S., Pandey, AB. and 

Somvanshi, R (2010). Preliminary binary 

ethylenimine (BEl) inactivated bovine 

papillomavirus (BPV) vaccine trial against 

cutaneous warts in bull calves: a 

pathological assessment. Braz. J. Vet. Pathol., 

3: 105-110.* 

Patyal, A, Rathore, RS., Venkatappa, M. H., 

Dhama, K. and Kumar, A (2011). 

Prevalence of Arcobacter spp. in humans, 

animals and foods of animal ongm 

including sea food from India. Transbound. 

Emerg. Dis., doi: 10.11111 j.1865- 

1682.2011.01221.x. [Epub]. * 

Pawaiya, RV.S., Sharma, AK Swarup, D.

IlWIlliI 


..... 2010-11 

Division of Standardization 

90. Goyal, G., Upmanyu, V., Singh, S.K., 

Shukla, S.K., Mehra, S., Kumar, V. and 

Sharma, D. (2010). Differential expression of 

IL-6 and IGF-II in guinea fowl and chicken. 

Int. J. Poultry Sci., 9: 2010.* 

Division of Surgery 

91. Aithal, H.P., Amarpal, Kinjavdekar, P., 

Pawde, A.M., Singh, G.R and Setia, H.C. 

(2010). Management of tibial fractures using 

a circular external fixator in two calves. Vet. 

Surg., 39: 621-626.* 

92. Aithal, H.P., Singh, G.R, Saxena, RK., 

Kinjavdekar, P., Amarpal, Paw de, AM., 

Hoque, M. and Maiti, S.K. (20'10). 

Comparative mechanical, chemical and 

microstructural properties of mild steel and 

aluminum rings used in large animal 

circular external fixators. Indian J. Anim. Sci., 

80: 428-430. 

93. Ajith, P., Maiti, S.K., Kumar, N. and Sharma, 

A.K. (2010). Comparative evaluation of 

laparoscopic vs. ultrasound guided liver 

biopsy techniques in canines. Indian ]. Anim. 

Sc., 80: 405-409. 

94. Amarpal, Kinjavdekar, P., Aithal, H.P., 

Pawde, A.M. and Pratap, K. (2011). 

Evaluation of Gokhru and Pashanbhed for 

management of experimental urolithiasis in 

rabbits. Indian J. Anim. Sci., 81: 251-253. 

95. Amarpal, Kinjavdekar, P., Aithal, H.P., 

Pawde, AM. and Pratap, K. (2010). A 

clinical study on occurrence and efficacy of 

different surgical techniques for 

management of cystic and urethral calculi in 

dogs. Indian J. Canine Pract., 2: 50-60. 

96. Amarpal, Singh, J., Saxena, AC., 

Kinjavdekar, P. and Madhu, D.N. (2010). 

Colopexy for the treatment of recurrent 

complete rectal prolapse in a male pug dog. 

Intas Polivet, 11: 355-357. 

97. Borena, B.M., Paw de, A.M., Amarpal, 

Aithal, H.P., Kinjavdekar, P., Singh, R. and 

Kumar, D. (2010). Evaluation of autologous 

bone marrow-derived nucleated cells for 

healing of fun-thickness skin wounds in 

rabbits. Int. Wound J., 7: 249-260.* 

98. Dutta, A, Maiti, S.K., Ajith, P. and Kumar, 

N. (2010). Evaluation of different 

laparoscopic sterilization techniques in a 

canine birth control Programme. Turkish f. 

Vet. Anim. Sci., 34: 393-402.* 

99. Himani Singh, Naveen Kumar, Sharma, 

AK. and Kataria, M. (2010). Plasma 

proteinase inhibitor activity after repair of 

abdominal wall defects with bovine 

pericardium in rabbit. Indian Vet. J., 87: 457- 

459.Hoque, M. (2010). An appraisal about 

Ganges River Dolphin (Platanista gangetica). 

Indian Wildlife Yearbook 8-9: 31-32. 

101. Maiti, S.K., Khimta, 5., Kumar, N. and 

Kataria, M. (2010). Immunological activity 

of Immuplus and screening of enzymatic 

prognostic marker in the treatment of 

canine mammary tumours. Phytomedica 9: 

37-50. 

102. Malik, V., Kinj1avdekar, P., Amarpal, Aithal, 

HP., Pawde, AM. and Surbhi (2011). 

Continuous intravenous infusion 

anaesthesia with ketamine in 

medetomidine, midazolam, butorphanol 

premedicated and thiopental induced 

buffaloes. Indian J. Anim. Sci., 81: 116-122; 

224-230. 

103. Saxena, V., Hoque, M., Satyanarayana, D., 

Saxena, A. and Kumar, A (2010). 

Anthelmintic activity of substituted 

CinnoHne imidazole derivatives. J. Vet. 

Parasitol., 24: 101-102. 

104. Singh, J., Ahmad, R, Zama, M.M.5., Paw de, 

AM. and Deori, S. (2010). Delivery of 

schistosomus reflexus crossbred calf by 

caesarean section. Indian J. Vet. Surg., 31; 77. 

105. Singh, J., Monsang, S.W., Nabi, S.u., Vala, 

J.A, Pawde, AM., Zama, M.M.S. and 

Hoque, M. (2010). Rescue and rehabilitation 

of an injured Egyptian vulture (Neophron 

percnopterus). Indian Wildlife Yearbook, 8-9: 

95-96. 

106. Singh, L Monsang, S.W., Pawde, A.M and 

Zama, M.M.5. (2010). Surgical management 

of intestinal obstruction by trichobezoar in a 

cat. Intas Polivet, 11: 391-394. 

107. Singh, J., Singh, GD., Zama, M.M.S and 

Pawde, AM. (2010). Management of 

obstructive enterolith in colt. Inias Polivet, 

11: 383-385.

108. Singh, K., Kinjavdekar, P., Aithal, H.P., 

Amarpal, Pawde, A.M. and Gopinathan, A 

(2010). Comparative evaluation of staple 

and cross K-wire fixation to treat carpal 

laxity in growing dogs. Indian J. Vet. Surg., 

31: 130-132. 

109. Singh, M., Pratap, K., Amarpal, Aithal, H.P., 

Kinjavdekar, P., Pawde, AM. and Singh, 

G.R (2010). Evaluation of three techniques 

for dissolution of urethral calculi in goats. 

Indian J. Vet. Surg., 31: 21-24. 

110. Singh, T., Amarpal, Kinjavdekar, P., Aithal, 

H.P. and Pawde, AM. (2010). Comparison 

of four surgical techniques for the 

management of obstructive urolithiasis in 

male goats. Indian J. Vet. Surg., 31: 15-20. 

111. Singh, V., Amarpal, Kinjavdekar, P., Aithal, 

H.P. and Pawde, AM. (2010). Evaluation of 

ketamine and bupivacaine with xylazine for 

epidural analgesia in buffalo calves. Indian]. 

Anim. Sci., 80: 837-841. 

112. Suneja, B.B., Amarpal, Rathore, K, 

Kinjavdekar, P., Aithal, H.P. and Pawde, 

A.M. (2010). Emerging bacterial resistance 

against aminoglycoside antibiotics among 

pathogens of veterinary clinical importance. 

Indian J. Field Vet., 6: 39-41. 

113. Surbhi, Kinjavdekar, P., Amarpal, Aithal, 

H.P., Pawde, A.M. and Malik, V. (2010). 

Comparison of analgesic effects of 

meloxicam and ketoprofen using University 

of Melbourne pain score in clinical canine 

orthopaedic patients. J. Appl. Anim. Res., 38: 

261-264. 

114. Surbhi, Kinjavdekar, P., Amarpal, Aithal, 

H.P., Pawde, A.M., Pathak, M.C., Sorena, 

B.M. and Malik, V. (2010). Physiological and 

biochemical effects of medetomidinebutorphanol- 

propofol anaesthesia in dogs 

undergoing orthopaedic surgery. Indian J. 

Vet. Surg., 31: 101-104. 

Division of Animal Biotechnology 

115. Barman, N.N., Gupta, KS., Bora, D.P., 

Kataria, KS., Tiwari, AK and 

Roychoudhury, P. (2010). Molecular 

characterization of classical swine fever 

virus involved in the outbreak in Mizoram. 

Indian J. Viroi., 21: 76-81. 

lIWffilI 

AllllulIl R.c)1ort 

2010-11 

116. Chaturvedi, 0., Kalim, S., Kumar, K, 

Sawant, P., Tiwari, S., Khurana, S.K., Sahoo, 

AP., Palia, S. and Tiwari, AK. (2010). 

Cloning and expression of chicken 

granulocyte-macrophage colony stimulating 

factor (GMCSF) gene. Indian J. Expt. Biol., 48: 

1175-1180. 

117. Deb, R and Goswami, P.P. (2011). 

Coexpression of PPE 34.9 antigen of 

Mycobacterium avium subsp. paratuberculosis 

with Murine Interferon Gamma in HeLa 

Cell Line and study of their 

immunogenicity in murine model. Biotech. 

Res. Intern., 2011:* 

118. Deb, R, Saxena, V.K. and Goswami, P.P. 

(2011). Conventional vs. recombinant 

antigen based diagnostic tools against 

Mycobacterium avium subspecies 

paratuberculosis infection in animals. J. Appl. 

Biosci., 37: 31-35. 

119. Deb, R and Goswami, P.P. (2010). 

Expression of a gene encoding 34.9 kDa PPE 

antigen of Mycobacterium avium subsp. 

paratuberculosis in ,E. coli. Mol. BioI. Tn tern., 

2010: Article ID 628153* 

120. Gupta, P.K., Saini, M., Dahiya, S.5., Patel, 

c.L., Sonwane, A.A., Rai, D.V. and Pandey, 

KD. (2011). Molecular characterization of 

lapinized classical swine fever vaccine strain 

by full-length genome sequencing and 

analysis. Anim. Biotech., 22: 111-117.* 

121. Ratta, S., Nautiyal, S., Ravindra, P.v., 

Chaturvedi, U., Kumar, S., Subudhi, P.K., 

Kantaraja, c., Tiwari,S., Barman, N.N. and 

Tiwari, A.K. (2010). Characterization and 

expression of E2 glycoprotein of classical 

swine fever virus in a eukaryotic expression 

system. Indian J. Virol., 21: 69-75. 

122. Tupperwar, N., Tiwari, A.K., Kataria, RS., 

Kumar, S. and Rai. A. (2010). Expression of 

ffiD virus VP2 gene In eukaryotic 

expression system for use as DNA vaccine. 

J. Immunol. Immuno-pathol., 12: 52-58.* 

Immunology Section 

123. Heratha, c., Kumar, P., Singh, M., Kumar, 

D ., Saravanan R, Goswami, T.K., Singh, A. 

and Ram, G.c. (2010). Experimental ironinactivated 

Pasteurella multocida A: 1 vaccine

mIDI 

A Illlllni Report 

2010-11 

adjuvanted with bacterial DNA is safe and 

protects chickens from fowl cholera. Vaccine, 

28: 2284-2289.* 

124. Kumar, A, Oandapat, S., Chaudhari, U.K, 

Kumar, B.S.A and Ram, G.C (2009). 

Evaluation of PLG nanoparticles for 

encapsulation of outer membrane proteins 

of Salmonella Gallinarum and oral 

immunization in chicken. Indian J. Camp. 

Microbiol. Immunol. Infect. Dis., 30: 79-84. 

Division of Veterinary Public Health 

125. Biswas, R, Agarwal, RK, Bhilegaonkar, 

KN., Kumar, A, Nambiar, P., Rawat, S. and 

Singh, M. (2010). Cloning and sequencing of 

biofilm-associated protein (bapA) gene and 

its occurrence in different serotypes of 

Salmonella. Lett Appl. Microbial. Published 

online doi:10.1111/j.1472-765X.2010.02975.x.* 

126. Kaushik, P., Singh, O.K and Tiwari, AK 

(2010). Comparison of PCR with 

conventional techniques for the diagnosis of 

brucellosis in cattle. Indian J. Anim. Sci., 80: 

326-328. 

127. Kaushik, P., Singh, O.K., Vinoth Kumar,S., 

Tiwari, AK, Shukla, G., Shanker Dayal and 

Chaudhuri, P. (2010). Protection of mice 

against Brucella abortus 544 challenge by 

vaccination with recombinant OMP28 

adjuvanted with CpG oligonucleotides. Vet 

Res. Comm., 34:119-132.* 

128. Kumar, S., Tuteja, V., Kumari, S., Singh, 

D.K, Kumar, A and Kumar, O. (2010). 

Rapid multiplex PCR assay for the 

simultaneous detection of the Brucella 

Genus, B. abortus, B. melitensis and B. suis. f. 

Microbiol. Biotechnol. 21:89-92. * 

129. Prejit Porteen, K, Agarwal, RK and 

Bhilegaonkar, KN. (2009). PCR based 

detection of the ompC gene in Salmonella 

serovars. Indian J. Compo Microbiol. Immunol. 

Infect. Dis., 30: 91-94. 

130. Rajkumar, RS., Yadav, A.S., Rathore, RS., 

Mohan, H.V. and Singh, B.P. (2010). 

Prevalence of Campylobacter jejuni and 

Campylobacter coli from unorganized and 

organized small scale poultry dressing units 

of Northem India. J. Vet. Pub. Health, 8:1-5. 

13l. Rathore, RS., Kumar, A., Agarwal, RK and 

Bhilegaonkar, KN. (2010), Shiga-like toxin 

producing Escherichia coli serotypes isolated 

from raw and ready to eat meat products. f. 

Vet. Pub. Health, 8: 11-15. 

132. Rizal, A, Kumar, A and Vidyarthi, A.S. 

(2010). Prevalence of pathogenic genes in 

Campylobacter jejuni isolated from poultry 

and human. Int. J. Food Safety, 12: 29-34. 

133. Vaidya, V.M., Malik S.V.S., Bhilegaonkar, 

K.N., Rathore, RS., Kaur, S. and Barbuddhe, 

S. B. (2010). Prevalence of Q fever in 

domestic animals with reproductive 

disorders. Compo Immunol. Microbial. Infect. 

Dis., 33: 307-321.* 

Division of Virology 

134. Balamurugan, V., Sen, A., Venkatesan, G., 

Yadav, V., Bhanot, V., Riyesh, T., 

Bhanuprakash, V. and Singh, RK (2010). 

Sequence and phylogenetic analyses of the 

structural genes of virulent isolates and 

vaccine strains of Peste des petits ruminants 

virus from India. Transbound. Emerg. Dis., 

2010 Jul 19. [Epub ahead of print] PMID: 

20642492.* 

135. Balamurugan, V., Sen, A., Venkatesan, G., 

Yadav, V., Bhanot, V., Bhanuprakash, V. 

and Singh, RK. (2010). Application of semiquantitative 

M gene-based hydrolysis probe 

(TaqMan) real-time RT-PCR assay for the 

detection of Peste des petits ruminants virus 

in the clinical samples for investigation into 

clinical prevalence of disease. Transbound. 

Emerg. Dis., 57: 383-395.* 

136. Balamurugan, V., Venkatesan, G., Sen, A., 

Laxmanan, A, Bhanuprakash, V. and Singh, 

RK. (2010). Recombinant proteins based 

diagnostics in veterinary science with a 

major emphasis on viral diseases: Current 

scenario and future prospectives. Expert 

Rev. Mol. Diagn., 10: 731-753.* 

137. Basera, 5.5., Singh, R, Vaid, N., Sharma, K, 

Chakravarti, S. and Malik, Y.P.S. (2011). 

Detection of Rotavirus infection in bovine 

calves by RNA-PAGE and RT-PCR Indian J. 

Virol. Feb 2011. DOr 10.1007/s13337-010- 

0017-9 [Epub ahead of print]*. 

138. Bhanuprakash, 

Balamurugan, 

V., 

V., 

Hosamani, 

Gandhale, 

M., 

P.N.,

153. Umeshappa, CS., Singh, K.P., Ahmed, KA., 

Pandey, A.B. and Nanjundappa, RH. 

(2011). The measurement of three cytokine 

transcripts in naIve and sensitized ovine 

peripheral blood mononuclear cells 

following in vitro stimulation with 

bluetongue virus serotype-23. Res. Vet. Sci., 

90: 212-214. 

154. Umeshappa, CS., Singh, KP., 

Nanjundappa, RH. and Pandey, A.B. 

(2010). Apoptosis and immuno-suppression 

in sheep infected with bluetongue virus 

serotype-23. Vet. Microbiol. 144: 310-318.* 

155. Venkatesan, G., Balamurugan, V., 

Gandhale, P.N., Singh, RK. and Bhanuprakash, 

V. (2010). Viral zoonosis: A 

comprehensive review. Asian J. Anim. Vet. 

Adv., 5: 77-92, * 

156. Venkatesan, G., Balamurugan, V., Prabhu, 

M., Yogisharadhya, R, Bora, D.P., 

Gandhale, P.N., Siva Sankar, M.S., Kulkarni, 

A.M., Singh, RK. and Bhanu-prakash, V. 

(2010). An emerging and re-emerging 

zoonotic buffalopox infection: A severe 

outbreak in Kolhapur (Maharashtra), India. 

Vet. Italiana, 46: 439-448.* 

Biophysics, Electron Microscopy and 

Instrumentation Section 

157. Singh, P., Onodera, T., Mizuta, Y., 

Matsumoto, K, Miura, N. and Toko, K 

(2009). Dendrimer modified biochip for 

detection of 2, 4, 6 trinitrotoluene on SPR 

immunosesnor: Fabrication and 

Advantages. Sensors and Actuators B: 

Chemical, 137: 403-409.* 

158. Mizuta, Y., Onodera, T., Singh, P., 

Matsumoto, K, Miura, N. and Toko, K 

(2010). Highly sensitive detection of TNT 

using a poly (amidoamine) dendron-based 

SPR immunosensor. Sensors and Materials, 

22: 193-200.* 

High Security Animal Disease Laboratory, 

Bhopal 

159. Bhatia, S., Gangit R, Gupta, D.S., Sood, R, 

Pradhan, HK. and Dubey,S. C (2010). 

Single chain fragment variable antibody 

against the capsid protein of bovine 

immunodeficiency virus and its use in 

ELISA. J. Viral. Methods, 167: 68-73.* 

160. Mathapati, B.S., Mishra, N., Rajukumar, K, 

Nema, R.K., Behera, S.P. and Dubey, S.C 

(2010). Entry of bovine viral diarrhoea virus 

into ovine cells occurs through clathrindependent 

endocytosis and low pHdependent 

fusion. In Vitro Cell Dev. BioI. 

Anim., 46: 403-407.* 

161. Mishra, N., Rajukumar, K, Pitale, S.S., 

Prakash, A., Nema, RK, Behera, S.P. 

and Dubey, S.C (2010). Evidence of a 

humoral immune response against the 

prokaryotic expressed N-terminal 

autoprotease (Npro) protein of bovine viral 

diarrhoea virus. f. Biosci., 35: 79-86.* 

162. Nagarajan, S., Tosh, C, Murugkar, H.V., 

Venkatesh, G., Katare, M., Jain, R., Behera, 

P., Khandia, R, Tripathi, S., Kulkarni, D.o. 

and Dubey, S.C (2010). Isolation and 

molecular characterization of a H5Nl virus 

isolated from a Jungle crow (Corvus 

macrohynchos) in India. Virus Genes. DOl 

10.1007/ s11262-010-0477-4.* 

163. Rai, M., Bhatia, S., Malik, Y.P.S. and Dubey, 

S.C (2010). Production and characterization 

of monoclonal antibodies against NS1 

protein of H5Nl avian influenza virus. 

Hybridoma,29:183-186.* 

164. Tosh, C, Murugkar, H.V., Nagarajan, S., 

Tripathi, S., Katare, M., Jain,R., Khandia, R, 

Syed,Z., Behera,P., Patit S., Kulkarni, D.D. 

and Dubey, S.c. (2010). Emergence of 

amantadine-resistant avian influenza H5N1 

virus in India. Virus Genes, DOL 

10.1007/511262-010-0534-z.* 

165. Tosh, C, Nagarajan, 5., Murugkar, H.V., 

Jain, R, Behera, P., Katare, M., Kulkarni, 

D.D. and Dubey, S.c. (2011). Phylogenetic 

evidence of multiple introduction of H5N1 

virus in MaIda district of West Bengal, India 

in 2008. Vet Microbial, 148: 132-139.* 

IVRI, Bangalore 

166. Jadav, S.K., Siva Reddy, K., Rashmi, B.R., 

Dechamma, H.J., Ganesh, K., 

Suryanarayana, V.v.s and Reddy, G.R. 

(2010). Improved immune response by IDpVAC: 

A secretory DNA vaccine construct 

delivered by PLG micropartic1es against 

FMD in guinea pigs. Res. Vet. Sci. (Available 

online 28 September 2010). *

167. Maddur, M.S., Rao, S., Chockalingam, AK., 

Kishore, S., Gopalakrishna, S., Singh, N., 

Suryanarayana, V.V.S., Sathyanarayana, 

M.L., Gajendragad, M.R. (2011). Absence of 

heat intolerance (panting) syndrome in footand-mouth 

disease-affected Indian cattle 

(Bos indicus) is associated with intact thyroid 

gland function. Transbound. Emerg. Dis., 

(Published online: 19 Jan 2011).* 

168. Maddur, M.S., Kishore, S., Chockalingam, 

AK., Gopalakrishna, S., Singh, N., 

Suryanarayana, V.V.s., Mukund, R. and 

Gajendragad, M.R. (2010). The relationship 

between cellular immune response to footand-mouth 

disease virus, Asia 1 and viral 

persistence in Indian cattle (Bos indicus). Res. 

Vet. Sci., 89: 36-40.* 

169. Saravanan, T., Ashok Kumar, c., Reddy, 

G.R., Dechamma, H.J., Nagarajan, G., 

Ravikumar, P., Srinivas, G. and 

Suryanarayana, V.V.S. (2011). Construction 

of genome-length cDNA for foot and mouth 

disease virus serotype Asia 1 IND 63/72 

vaccine strain. Int. ]. Biotech. Mol. BioI. Res., 

2: 39-45.* 

170. Siva Reddy, K., Muralidhar Rao, 0., 

Badrinaryana, N., Suryanaryana, V.V.S. and 

Reddy, G.R. (2010). Enhancement of 

DNAvaccine (P12A3C-pcDNA) against 

foot-and-mouth disease by coadministration 

of interleukin-18-expressing 

(lL 18 pcDN A) plasmid in guinea-pigs 

FEMS,1-9.* 

171. Siva Reddy, K., Muralidhar Rao, D., 

Dechamma, H.J., Suryanarayana, V.V.S and 

Reddy, G.R. (2010). Expression of bovine 

(Bos indicus) IL18 in E.coli and its biological 

activity. Microbiol. Immunol., 54: 564-567.* 

Eastern Regional Station. Kolkata 

172. Bandyopadhyay, S., Bera, AK, Sikdar, 5., 

De, S., Ghosh, S., Rana, T., Bandyopadhyay, 

5., Dandapat, P. and Bhattacharya, D. (2010). 

Intra-species sequence variability in 28s 

rRNA gene of Oesophagostomum venulosum 

isolated from goats of West Bengal, India. 

Asian Pacific J. Trop. Med., 515-518.* 

173. Bandyopadhyay, S., Manda!, S., Datta, KK., 

Devi, P., De, S., Bera, A.K. and Bhattacharya, 

mlli[ 


2010-11 

D. (2010). Economic analysis of risk of 

gastrointestinal parasite infection in cattle in 

north eastem states of India. Trop. Anim. 

Health Prod., 42: 1481.DOI: 10.1007/s11250- 

010-9582-6.* 

174. Bera, A.K., Bhattacharya, D., Pan, 0., 

Manna, B., Bandyopadhyay, S. and Das, S.K. 

(2010). Effect of heat killed Mycobacterium 

phlei on body weight gain and management 

of caecal coccidiosis in broiler chickens. Res. 

Vet. Sci., doi:10. 1016/j.rvsc.2010.03.008.* 

175. Bera, A.K., Rana, T., Das, S., Bhatta-charya, 

D., Bandyopadhyay, S., Pan, D., De,S., 

Samanta, 5., Chowdhury, AN., Mondal, 

T.K. and Das, S.K. (2010). Ground water 

arsenic contamination in West Bengal, India: 

A risk of sub-clinical toxicity in cattle as 

evident by correlation between arsenic 

exposure, excretion and deposition. ToxicoZ. 

Indust. Health, 001: 

10.1177/0748233710377775.* 

176. Das, 5., Pan, D., Bera, A.K., Rana, T., 

Bhattacharya, D., Bandyapadyay, 5., De, S., 

Sreevatsava, V., Bhattacharya,S., Das, S.K., 

Bandyopadhayay, S. (2010). Sodium arsenite 

mediated immuno-disruption through 

alteration of transcription profile of 

cytokines in chicken splenocytes under in 

vitro system. Mol. BioI. Rep., DOL 

10.1007/511033-010-0091-5 [Epub ahead of 

print] PMID: 20339924.* 

177. De, S., Sanyal, P.K, Pan, D., Bera, A.K., 

Bandyopadhyay, S., Pal, S., MandaI, S.c., 

Sarkar, AK., Patel, N.K., Bhattacharya, D. 

and Das, S.K (2010). Assessment of genetic 

relation of Indian isolates of four predatory 

fungi through RAPD markers. Indian J. 

Anim. Sci., 80: 711-714. 

178. Pan, D., De, S., Bera, AK., Bandyo-padhyay, 

S., Das, S.K. and Bhattacharya, D. (2010). 

Molecular differentiation of cryptic stage of 

Echinococcus granulosus and Taenia species 

from faecal and environmental samples. 

Asian Pacific J. Trap. Med., 253-256.* 

179. Rahman, H., Pal, P. and Bandyopadhyay, S. 

(2010). Occurrence of gastrointestinal 

parasites in domestic yaks in Sikkim. Indian 

]. Anim. Sci., 80: 195-198. 

180. Rana, T., Bera, A.K., Das, S., Battacharya, D.,

uffalo (Bubalus bubalis). J. Mol. Gen., 2: 24- 

31.* 

215. Khan, F.A, Das, G.K., Pande, M., Pathak, 

M.K. and Sarkar, M. (2011). Biochemical and 

hormonal composition of follicular cysts in 

water buffalo (Bubalus bubalis). Anim. 

Reprod. Sci., 124: 61-64.* 

216. Kumar, H., Neeru Bhooshan, Barman, P. 

and Patra, M.K. (2010). Economics of 

hormonal treatments on estrus induction 

and fertility in anestrus buffaloes under 

rural conditions. Indian J. Vet. Res., 19: 8-12. 

217. Kumar, H., Neeru Bhooshan, Patra, M.K. 

and Yadav, M.e. (2010). Treatment with 

progestagen and PMSG to prevent 

prolonged anestrus in buffaloes. Indian J. 

Anim. Sci., 80: 623-625. 

218. MandaI, D.O., Srivastava, S.K. and Kumar, 

P. (2010). Effect of GnRH during various 

stages of estrus cycle on fertility and plasma 

progesterone in buffaloes. Indian J. Anim. 

Reprod. 30: 23-27. 

219. Patra, M.K., Kumar, H., Meur, S.K., 

Mahmood, S. and Yadav, M.e. (2010). 

Comparative thin layer chromatographic 

profiles of bovine urine and cervico-vaginal 

mucus. Indian f. Anim. Sci., 80: 516-518. 

220. Patra, M.K., Kumar, H., Yadav, M.C., 

Varshney, V.P., Mahmood, S. and Tomar, 

AK.S. (2010). Effect of biostimulants on 

estrus itnduction in crossbred heifers. Indian 

Vet. J., 87:100-101. 

221. Rajkumar, R, Singh, S.K., Agarwal, S.K., 

Mahmood, S. and Shankar, V. (2010). Effect 

of selective COX2 inhibitor on conception 

rate, progesterone and PGFM profile in 

buffalo (Bubalus bubalis). J. Appl. Anim. Res., 

38: 209-212.* 

222. Sarath, T., Suguna, K., Mehrotra, S., 

Agarwal, S.K., Sastry, K.V.H. and Vma 

Shankar. (2010). Serum nitric oxide profile 

in cyclic, acyclic and pregnant goats. Indian 

Vet. J., 87: 881-883. 

Division of Animal Nutrition 

223. Dubey, M., Dutta, N., Sharma, K., Pattanaik, 

AK., Banerjee, P.S. and Singh. M. (2011). 

Effect of condensed tannins 

supplementation from tanniferous tree 

leaves on in vitro nitrogen and substrate 

degradation. Anim. Nutr. Feed Technol., 11: 

115-122. 

224. Ingale, S.L., Singh, P., Verma, AK. and 

Mehra, U.R (2010). Effect of Fasciola 

gigantica infection on nutrient utilization 

and cytokine gene expression during 

prepatent period in crossbred calves. Anim. 

Nutr. Feed Technol .. , 10: 177-185. 

225. Kumar, R, Kamra, D.N., Agarwal, N. and 

Chaudhary, L.c. (2011). Effect of tree leaves 

containing plant secondary metabolites on 

in vitro methanogenesis and fermentation of 

feed with buffalo rumen liquor. Anim. Nutr. 

Feed Technol., 11: 103-114. 

226. MandaI, G.P. and Dass, RS. (2010). 

Haemato-biochemical profile of crossbred 

calves supplemented with inorganic and 

organic source of zinc. Indian ]. Anim. Res., 

44: 197-200. 

227. Dutta, N., Sharma, K., Dey, A, Singh, M. 

and Singh, A (2010). Effect of replacing 

wheat bran with rice polishings on the 

lactation performance of crossbred cows. 

Indian J. Anim. Sci., 80: 1559-1562. 

228. Palanivel, M., Sharma, K., Dutta, N. and 

Singh, A. (2010). Effect of feeding raw or 

water soaked rapeseed (Brassica juncea) cake 

on nutrient utilization and growth 

performance of kids. Anim. Nutr. Feed 

Technol., 10: 157-167. 

229. Pawar, M.M., Pattanaik, A.K., Kumar, P., 

Sharma, K and Goswami, T.K. (2011). 

Metabolic and immunological response in 

dogs fed homemade diets with augmented 

nutrient profile. Anim. Nutr. Feed Technol., 

11: 71-80. 

230. Sharma, K, Pattanaik, AK., Anandan, S. 

and Blummel, M. (2010). Food-feed crops 

research: a synthesis. Anim. Nutr. Feed 

Technol., lOS: 1-10. 

231. Katole, S., Saha, S.K., Sastry, V.RB., Nandi, 

S., Lade, M.H. and Sharma, K (2010). 

Assessment of Curcin activity of raw and 

processed Jatropha meal by haemagglutination 

test. Indian Vet. ].,87: 581-583. 

232. Katole, S., Saha, S.K., Sastry, V.RB., 

Zadbuke, S.S., Lade, M.H. and Sharma, K 

(2010). Effect of inclusion of raw and

.u WLllil 

Anl1ual Report 

iiIM 2010-11 

leucotrichophora) foliage toxicity in guinea 

pigs. Indian]. Vet. Pathol., 34: 180-184. 

290. Kurade, N.P., Jaitak, V., Kaul, V.K., Sharma, 

O.P. (2010). Chemical composition and 

antibacterial activity of essential oils of 

Lantana camara, Ageratum houstonianum and 

Eupatorium adenophorum. Pharmaceutical BioI. 

48. 539-544. 

291. Sahoo, A, Singh, B., Bhat, T.K. (2010). Effect 

of tannins on in vitro ruminal protein 

degradability of various tree forages. 

Livestock Res. Rural Develop. 22: 1-8.* 

292. Sahoo, A, Ogra, R.K., Sood, A and Ahuja 

p.s. (2010). Nutritional evaluation of 

bamboo cultivars in sub-Himalayan region 

of India by chemical composition and in 

vitro ruminal fermentation. Grassland Sci., 

56: 116-125.* 

293. Sahoo, A Singh, B. and Sharma, O.P. (2011). 

Evaluation of feeding value of Eupatorium 

adenophorum in combination with mulberry 

leaves. Livestock Sci., 136: 175-183.* 

294. Sharma, O.P. (2010). Nobel science. Curro 

Sci., 98: 1269. 

295. Sharma, O.P. (2010). Roadmap to 

irreverence, argument and critique in 

science education and research. Curro Sci., 

99: 859. 

Division of Livestock Pl"oducts Technology 

296. Chauhan, G., Mahna, R. and Khanna, K. 

(2010). Role of rural women in Indian 

agriculture. J. Eco-friendly Agri., 5: 139-142. 

297. Chauhan, G., Sharma, BD. and Mendiratta, 

S.K. (2010). Development of ghee residue 

sweet cubes. Indian J. Nutr. Dietetics., 47: 

511-514. 

298. Kandeepan. G., Anjaneyulu, A.s.R, 

Kondaiah, N. and Mendiratta, S.K. (2010). 

Quality of buffalo meat keema at different 

storage temperature. Afr. ]. Food Sci., 4: 410- 

417.* 

299. Kandeepan. G., Anjaneyulu, AS.R, 

Gadekar, Y.P., Kondaiah, N. and 

Mendiratta, S.K. (2010). Quality comparison 

of buffalo meat curry stored at refrigerated 

temperature. Fleischwirtschaft Int. 25: 54-59. * 

300. Kandeepan. G., Anjaneyulu, AS.R, 

Kondaiah, N. and Mendiratta, S.K (2010). 

Effect of age and gender on quality 

attributes of buffalo (Bubalus bubalis) meat 

patties. Fleischwirtschaft Int., 25: 71-74.* 

301. Kandeepan, G., Anjaneyulu, AS.R, 

Kondaiah, N. and Mendiratta, S.K. (2011). 

Comparison of quality attributes of buffalo 

meat curry at different storage temperature. 

Acta Scientiarum Polonorum Technologia 

Alimentaria, 10: 83-95.* 

302. Kumar, P., Sharma BD. and Kumar, RR 

(2010). Optimization of the level of 

mushroom in analogue meat nuggets. Indian 

f. Meat Sci., 7: 53-55. 

303. Kumar P., Sharma, B.D. and Kumar, RR 

(2011). Product profile comparison of 

analogues meat nuggets versus chicken 

nuggets. Fleischwirtschatf Int., 26: 72-75.* 

304. Malik, AH. and Sharma, B.D. (2010). 

Comparison of hurdle treatments for 

buffalo meat. Int. J. Food Sci. Technol., 45: 

1552-1563.* 

305. Mendiratta, S.K., Sharma, B.D., Narayan, R. 

and Mane, B.G. (2010). Effect of proteolytic 

enzyme treatments and pressure cooking on 

quality of spent sheep meat curry. ]. Muscle 

Foods, 21: 685-701.* 

306. Rajkumar, R.S., Yadav, AS. Kirupasankar, 

M., Sharma, BD. and Singh R.P. (2010). 

Efficacy of acidified sodium chlorite (ASC) 

and tri-sodium phosphate (TSP) in 

decontaminating chicken carcass against 

Campylobacter coli. Indian J. Anim. Sci., 80: 

864-866. 

307. Sharma, K, Mendiratta, S.K and Sharma, 

BD. (2010). PhYSico-chemical and sensory 

properties of goat meatballs: Fat modulated 

with sunflower oil. J. Vet. Publ. Health. 8: 51- 

55. 

308. Sharma, K, Mendiratta, S.K. and Sharma, 

B.D. (2011) Physico-chemical, sensory and 

lipid profile of low fat chicken nuggets 

incorporated with carrageenan fat replacer. 

Int. J. Meat Sci. 1: 1-7.* 

"Published in foreign journals

lIWJ1Sli 

Annual Report 

2010-11 

13. Development of biodynamic therapeutic regime Reena Mukherjee June July 

against bovine sub-clinical mastitis (PI) 

KN.Bhilegaonkar 

U.s. Thakur 

2009 2011 

14. Development of diagnostic markers and catalytic D. B. Mondal (PI) June June 

therapy for management of hepatobiliary N. N. Pandey (up to 2009 2012 

dysfunctions 

31.7.10) 

K. Mahendran 

Meena Kataria 

Monalisa Sahoo 

15. Development of herbo-mineral formulation for Pankaj Kumar (PI) June June 

amelioration of lead toxicity S. Dey 

(Mrs.) Mohini Saini 

Dhirendra Kumar 

2009 2012 

16. Comparative evaluation of imaging techniques, K. Mahendran (PI) July June 2013 

electrocardiographic changes and blood S.Dey 2010 

biochemical findings to evolve diagnostic D.B. Mondal 

markers for cardiopulmonary and urogenital Abhishek C. Saxena 

disorders in canines. KKMishra 

WILDLIFE SECTION 

17. Influence of duration and level of feeding on Asit Das (PI) April March 

feed consumption nutrient utilization, serum 

metabolite and mineral status in semi-captive 

Asiatic elephant (Elaphus maximus) 

(Mrs.) Mohini Saini 2009 2012 

18. Development of molecular marker for sex Mohini Saini (PI) Sept., August 

identification in Gyps vultures Praveen Kumar 

Gupta 

Asit Das 

Vibhu Prakash, 

(BNHS, Mumbai) 

2009 2011 

PARASITOLOGY DIVISION 

19. Identification and evaluation of Trypanosoma A.K. Tewari (PI) June May 

evansi specific molecules relevant to sensitive p.s. Banerjee 2007 2011 

detection and prophylaxis O.K. Raina 

20. Molecular based diagnosis of heart worm S. Samanta (PI) June March 

disease of dogs caused by Dirofilaria immitis O.K. Raina 

P.S. Banerjee 

AK. Tewari 

2008 2011 

21. Development of molecular tool/kit for M. Sankar (PI) Oct, March,2012 

detection and monitoring of benzimidazole B.C. Saravanan 2008 

resistance in common gastrointestinal B.P. Singh 

nematodes of small ruminants. A Prasad 

S.c. Gupta 

PATHOLOGY DIVISION 

22. Studies on the etiopathology of hepatitis and G. Sai Kumar (PI) April March 

nephritis syndrome in piglets R. Somvanshi 

Rinku Sharma 

2005 2011 

23. Viro-immunopathological studies on calf R.B. Rai (PI) June June 

enteritis AK. Sharma 

K Dhama 

2008 2011 

@) 

, 

/"

24. Diagnosis of infectious bronchitis virus (mV) S.D. Singh (PI) June March 

infection in poultry using molecular biological K Dhama 2008 2011 

techniques A.K Tewari 

25. T-2 mycotoxicosis in animals: pathology, A K. Sharma (PI) June May 

pathogenesis, diagnosis and ameliorative AG.Telang 2009 2012 

measures S. Dandapat 

PHARMACOLOGY & TOXICOLOGY DIVISION 

26. Molecular mechanisms of pulmonary vascular S.K. Mishra (PI) June May 

dysfunction in endotoxic shock T.U.Singh 2007 2011 

(Mrs.) S. Parida 

KP. Singh 

27. Efficacy studies of some promising essential oil Dinesh Kumar (PI) June May 

preparations in experimental and clinical J.K Malik 2008 2011 

haemonchosis and fasciolosis S.K Tandan 

A. Prasad 

S.c. Gupta 

U. Dimri 


28. Pharmacodynamic investigations of Entada S.K Tandan (PI) June May 

pursaetha and its therapeutic potential Dinesh Kumar 2009 2012 


29. Pharmacokinetic studies of gatifloxacin in AG. Telang (PI) June May 

sheep S. Kalpana 2009 2011 

J.K. Malik 

30. Evaluation of toxic influence of arsenic on the S.N. Sarkar (PI) Dec Sept 2012 

pharmacodynamics of nonsteroidal anti- S. K. Tandan 2009 

inflammatory drugs A K. Tiwari 

M. Sankar 

STANDARDIZATION DIVISION 

31. Purification and standardization of epsilon Lata Jain (PI) June May 

toxin and epsilon antitoxin for potency testing Mayank Rawat 2009 2011 

of enterotoxaemia vaccine 

32. Detection of extraneous agents in viral V. Upamanyu (PI) July June 2012 

vaccines by nucleic acid amplification Rishendra Verma 2010 

techniques Sameer Shrivastava 

SURGERY DIVISION 

33. Studies on halothane and isoflurane inhalation P. Kinjavdekar (PI) June May 

anaesthesia in large ruminants Amarpal 2009 2012 

H.P. Aithal 

A.M. Paw de 

M.M.S.Zama 

34. Clinical evaluation of herbal and homeopathic A.M. Pawde (PI) July May 

agents for augmentation of wound healing in Amarpal 2009 2012 

domestic animals P. Kinjavdekar 

H.P. Aithal 

Dinesh Kumar

.!J. \1 .LillJ. 

Annual Report 

... 2010-11 

35. 

36. 

37. 

38. 

39. 

40. 

A new therapeutic approach to canine 

mammary tumours 

Studies on cardiac structural and functional 

assessment in dogs with special reference to 

cardiac imaging 

Development and evaluation of interlocking 

nails and locking plates for intemal fixation of 

fractures in large animals 

Development of bioengineered collagen 

matrices for reconstructive surgery 

S.K. Maiti (PI) 

M.M.S.Zama 

AK. Tiwari 

(Mrs) Meena Kataria 

Naveen Kumar 

AK. Sharma 

M. Hoque (PI) 

M.M.S.Zama 

P. Kinjavdekar 

AM.Pawde 

S.Dey 

M.CSharma 

HoC Setia 

HoP. Aithal (PI) 

Amarpal 


AM.Pawde 

AK. Sharma (PI) 

RB. Rai 

M.M.S.Zama 

Naveen Kumar 

S.K. Maiti 

Sameer Srivastava 

Development of physical therapy and M.M.S Zama (PI) 

rehabilitation protocol in veterinary patients M. Hoque 

A.M.Pawde 

H.P.Aithal 

S.K. Maiti 

Isolation, culture, characterization and 

evaluation of bone marrow derived mesenchymal 

stem cells for the healing of skin and 

cartilage defects. 

VETERINARY POLYCLINIC 

41. Evaluation of cytological techniques for rapid 

diagnosis of pet animal diseases. 

42. 

Studies on incidence of helminthic infection in 

canines brought for treatment to referral 

veterinary polyclinic and development of 

immunodiagnostics to identify sub-clinical 

parasitic infections in field cases. 

U. Dimri 

Amarpal (PI) 

M.M.S.Zama 


H.P. Aithal 

A.M.Pawde 

Rekha Pathak 

G. Tam Sharma 

G.SaiKumar 

N.P. Kurade (PI) 

S.Dey 

AK. Sharma 

AM.Pawde 

S.K. Maiti 

KL. Khurana (PI) 

S. Dey 

N.P.Kurade 

V.K. Gupta 

Rajat Garg 

KMahendran 

June 

2009 

June 

2009 

June 

2009 

July 

2009 

June 

2009 

July 

2010 

July 

2009 

July 

2010 

May 

2012 

May 

2012 

May 

2012 

June 

2012 

May 

2012 

June 

2012 

June 

2011 

June 

2013

VETERINARY PUBLIC HEALTH DIVISION 

43. Occurrence, molecular characterization and RK. Agarwal (PI) June May 

decontamination of food-borne pathogens KN. Bhilegaonkar 2008 2011 

from foods of plant origin D.K. Singh 

S. Sarnanta 

A.Kumar 

44 •• Detection of Coxiella burnetii in foods of animal S.V.5. Malik (PI) July June 

origin and high risk groups of man and A Kumar 2010 2013 

animals by different diagnostic tests. RS. Rathore 

R Singh 

S. Shrivastava 

BEMI SECTION 

45. Bioconjugation and biolabeling of gold, Praveen Singh (PI) July June 

magnetic and quantum dots nanoparticles for Satish Kumar 2008 2012 

biosensing applications in veterinary and RP. Singh 

biomedical sciences 

VIROLOGY DIVISION (MUKTESWAR CAMPUS) 

46. Production of monoclonal antibody against AB. Pandey (PI) June May 

bovine herpes virus-1 and development of P.N. Gandhale 2007 2011 

ELISA 

47. Development of cell culture adapted live V. Bhanuprakash (PI) July March 

attenuated camel pox vaccine 2008 2011 

48. Studies on atypical and mixed infections of A Sen (PI) Nov. October 

PPR infected small ruminants. KK Rajak 2009 2012 

S.B. Sudhakar 

S.K. Biswas 

B. Mondal 

V. Bhanuprakash 

49. Prevalence, characterization and development 

of indigenous diagnostics for animal 

rota viruses 

Sub project: 

(1) Detection and molecular characterization Y.p.s. Malik (PI) Oct. Sept. 

of animal rota viruses and development of S. Chakarvati 2009 2012 

diagnostic kit/reagents AmabSen 

P.N. Gandhale 

G. Venkatesan 

(2) Prevalence and characterization of animal KN. Bhilegaonkar Oct. Sept. 

rotaviruses (PI) 2009 2012 

RK Agarwal 

50. Development of diagnostic assays based on S.B. Shivachandra (PI) Oct. Sept. 

recombinant antigens for classical swine fever V.P. Singh 2010 2013 

and pasteurellosis A Sen 

KN. Viswas 

M.A Ramakrishnan 

KK. Rajak 

S.B. Sudhakar --- 

mlliI 

A mill al Report 

2010-11

ITWIRill 


.... 2010-11 

LIVESTOCK PRODUCTION MANAGEMENT SECTION 

73. Multiplication and evaluation of synthetic Triveni Dutt (PI) 

crossbred cattle strain - Vrindavani H.C. Joshi 


AK.S. Tomar 

Mukesh Singh 

T.A. Khan 

B.H.M. Patel 

H.O. Pandey 

S. Mehrotra 

H . Kumar 

S.K Singh 

74. Establishment of pure Landrace nucleus herd S.K Mondal (PI) 

in Swine Production Farm 

B.C. Das 

S.K Ghosh 

75. Development of appropriate milk production T. A Khan (PI) 

models for selection of Vrindavani cattle and A.KS. Tomar 

Murrah buffaloes Triveni Dutt 

Bharat Bhushan (wef 

Sept 2010) 

76. Genetic improvement, conservation and A.K.S. Tomar (PI) 

multiplication of Tharparkar native cattle V.B. Chaturvedi 

T.A.Khan 

H.O. Pandey 

Triveni Dutt 

Mukesh Singh 

B.H.M. Patel 

S.K. Singh 

S.K. Mendiratta 

U.K. De 

V.K Gupta 

S.K Ghosh 

Om Singh 

UmaShankar 


77. Development of package of practices for H.O. Pandey (PI) 

weaning of Murrah buffalo calves 

AK.S. Tomar 

Triveni Dutt 

T.A. Khan 


V.B. Chaturvedi 

Mukesh Singh 

S. Mehrotra 

B.H.M. Patel 

S.K Singh 

U.K. De 

Vma Shankar 

78. Characterization and documentation of B.H.M. Patel (PI) 

Rohilkhandi goats 

Triveni Dutt 

AK.S. Tomar 

April 

2006 

July 

2006 

June 

2009 

August, 

2010 

July 

2010 

August, 

2010 

Long-term 

project 

June 

2011 

May 

2011 

July 

2015 

June 

2013 

July 

2013

79. Development of mixed farming system 

modules involving crop and livestock for 

enhancing farm production 

ANIMAL REPRODUCTION DIVISION 

80. Effect of Aegle marmelos (Bel) and Ficus religiosa 

(Pipal) on reproductive performance in farm 

animals 

81. 

82. 

Studies on the semen quality and preservative 

of indigenous and crossbred bulls 

Studies on innate immunity markers in cattle 

and buffaloes in relation to uterine infections 

C. LIVESTOCK IMPROVEMENT 

ANIMAL NUTRITION DIVISION 

83. Effect of dietary cadmium and arsenic on 

health and productivity of the animals 

84. 

85. 

86. 

87. 

Utilization of inorganic and organic zinc, 

copper and selenium in ruminants and their 

effect on their health and production 

Effect of unconventional 

testinal parasitism for 

efficiency of ruminants 

Exploration and validation 

synbiotics as functional foods 

feeds on gastroinbetter 

nutrional 

of potential 

for nutritional 

health of dogs 

Development of supplements and complete 

rations containing leaves based condensed 

tannins for improving performance of ruminants 

T.A Khan 

Mukesh Singh 

S.K. Mondal 

H.G.Pandey 


Om Singh (PI) 

A.K.S. Tomar 

V. B Chaturvedi 

H.O.Pandey 

T.A Khan 

S. Mehrotra 

Uma Shanker (PI) 

S.K. Agarwal 

S. Mehrotra 

S.K. Singh 

G.K. Das 

M.Hoque 

Dinesh Kumar 

S.K. Ghosh (PI) 

J.K. Prasad 

S.K. Srivastava 

Pushpendra Kumar 

RP. Tripathi 

Harendra Kumar (PI) 

S. Nandi 

S.Mahrnood 

S. Dandapat 

M.C.Yadav 

A K. Garg (PI) 

RS. Dass 

V.K. Chaturvedi 

A.K. Sharma 

RS. Dass (PI) 

AK. Garg 

V.K. Chaturvedi 


S.K. Saha (PI) 

Narayan Dutta 

V.B. Chaturvedi 

P .S. Banerjee 

AG. Telang 

AK. Pattanaik (PI) 

Narayan Dutta 

A vneesh Kumar 

Narayan Dutta (PI) 

AK. Pattanaik 

P.S. Banerjee 

August 

2010 

October 

2006 

Nov. 

2007 

June 

2009 

Sept., 

2007 

July 

2008 

June 

2008 

July 

2008 

June 

2009 

July 

2011 

March 

2011 

October 

2011 

May 

2012 

August 

2011 

June 

2011 

March 

2011 

June 

2011 

May 

2011 

rrwmrr 


2010-11

LIVESTOCK ECONOMICS, STATISTICS AND INFORMATION TECHNOLOGY DIVISION 

9S. Study of marketing intelligence of livestock, Rajendra Singh (PI) June May 

livestock products and byproducts (up to Dec. 2010) 2009 2012 

Med Ram Verma (PI) 

(w.e.f. Jan. 2011) 

Shiv Prasad 

Sanjay Kumar 

REGIONAL STATION, P ALAMPUR 

99. Isolation and identification of potential O.P. Sharma (PI) October March 

modulators of rumen fermentation in the T.K. Bhat 2006 2012 

extracts of locally available plants Birbal Singh 

N.P. Kurade 

100. Utilization of regionally available T.K. Bhat (PI) June May 

proenthocyanadin rich tree forages as O.P. Sharma 2008 2011 

supplementary feed for enhanced animal Birbal Singh 

production N.P. Kurade 

101. Molecular epidemiology of verotoxic U.S. Pati (PI) June May 

Escherichia coli infection of animals from North N.P. Kurade 2009 2011 

West Himalayan Region. Birbal Singh 

102. Isolation and utilization of rumen microbes Birbal Singh (PI) June Dec. 

from the migratory goats capable of degrading T. K. Bhat 2009 2010 

antinutritional plant secondary metabolites 

103 Bio-prospecting of locally available medicinal V. Umapathi (PI) August July 

plants with particular reference to Sea O.P. Sharma 2010 2013 

buckthorn (Hippophae) species for biomolecules T.K. Bhat 

with therapeutic potential Birbal Singh 

D. LIVESTOCK PRODUers TEalNOLOGY 

LIVESTOCK PRODUCTS TECHNOLOGY DIVISION 

104. Studies on processing and quality evaluation R C. Keshri (PI) Oct March 

of rr..eat Surimi products S.K. Mendiratta 2008 2011 

105. Development and evaluation of nutritious (Mrs.) Geeta Chauhan June April 

food products from dairy by-products (PI) 2008 2011 

BD. Sharma 


106. Meat authentication: An integrated molecular RR Kumar (PI) April April 

approach. A.K.Tewari 2009 2012 

BD. Sharma 

S.K. Mendiretta 

D. Sharma, CARl 

107. Development of novel shelf stable products S. K. Mendiretta (PI) July June 

from spent animal's meat. BD. Sharma 2010 2013 

(Mrs.) Geeta Chauhan 

RR Kumar 

S. Talukder 

lOS. Studies on the development of functional B.D. Sharma (PI) July June 

restructured meat products. S.K. Mendiratta 2010 2013 

RR Kumar 

S. Talukder 

rrwmrr 

Allllllal Report 

2010-11

mrul 


2010-11 

LIST OF SERVICE PROJECTS 

S.No. 

1. 

2. 

3. 

4. 

5. 

6. 

8. 

9. 

9.1 

10. 

Project Title 

Investigation and diagnosis of diseases of poultry and other 

captive birds 

Diagnosis of bacterial and mycotic diseases of animals and birds 

and maintenance of bacterial and mycotic agents 

Investigation and diagnosis of viral diseases of livestock 

Investigation, identification and characterization of bacterial 

agents from clinical/morbid materials of animals 

Investigation and control of parasitic diseases of livestock 

Pathomorphological diagnosis of animal diseases 

Field investigation and diagnOSiS of toxicosis in animals 

Clinical diagnosis, treatment and prophylaxis of livestock diseases 

Clinical and preventive health care of livestock of IVRI 

• At LPR (S&G), LPR (Pig) and animals in divisional 

experimental sheds of IVRI 

• At LPR (C&B) farm 

Diagnosis of parasitic diseases and consultancy services 

Name of PI/Associate (s) 

S.D. Singh (PI) 

K Dhama 

Vijendra Pal Singh (PI) 

R Verma 

RK Agarwal 

Pallab Chaudhuri 

Rajneesh Rana 

KN. Viswas 

S.K Gupta 

T. Sabarinath 

Prasad Thomas 

Abhishek 

S. Nandi 

Vishal Chander 

R Rathore 

Chandan Prakash 

Dinesh Chandra 

Rajendra Singh 

KP. Singh 

A.G. Telang 

S. Dey (PI) 

U. Dimri 

Reena Mukerjee 

D.B. Mondal 

KL. Khurana 

V.K Gupta 

Pankaj Kumar 

Rinku Sharma 

U.K De 

K Mahendran 

Umesh Dimri (PI) 

V.K Gupta (PI) 

U.K De 

J.R Rao (PI) 

(up to July 2010) 

B.P. Singh (PI) 

(w.e.f. August 2010) 

G.c. Bansal 

D.D. Ray 

s.c.Gupta 

S. Ghosh 

O.K Raina 

A.K. Tewari 

P.S. Banerjee 

S. Samanta

11. 

11.1 

11.2 

11.3 

11.4 

11.5 

11.6 

11.7 

11.8 

11.9 

12. 

13. 

Studies on mortality pattem and causes of mortality among 

livestock and wild animals 

Studies on mortality pattem and causes of mortality among cattle 

Studies on mortality pattem and causes of mortality of buffaloes 

Studies on mortality pattem and causes of mortality in sheep 

Studies on mortality pattern and causes of mortality in goats 

Studies on mortality pattem and causes of mortality among pigs 

Disease investigation and diagnosis of canines and equines 

Disease investigation and diagnosis (_)f diseases of wild animals 

Organization and development of Registry of Veterinary 

Pathology and Oncology 

Eastblishment of National Veterinary Science Museum 

Treatment of surgical cases, preparation of animal models, 

collection of biopsies and radiological diagnosis 

Maintenance and supply of stock strains, disease diagnosis and 

investigation of food- and water-borne diseases 

RajatGarg 

B.e. Saravanan 

M.Sankar 

R Somvanshi (PI) 

A.K. Sharma 

RB. Rai 

M.Sahoo 

M.Sahoo 

G. Sai Kumar 

A.K.Sharma 

A.K. Sharma 

M.Sahoo 

R Somvanshi 

R. Somvanshi 

Kundan Singh 

M.M.S.Zama 

A.K. Sharma 

M.Hoque 


Naveen Kumar 

A.M. Pawde 

• AmarPal 

H.P. Aithal 

S.K. Maiti 

Rekha Pathak 

A.e. Saxena 

A. Gopinathan 

H.e. Setia 

A. Kumar (PI) 

S.V.S. Malik 

R.K. Agarwal 

D.K. Singh 

R.S. Rathore 

K.N. Bhilegaonkar 

14. Technological improvement/production and standardization of diagnostic antigens and sera 

14.1 Production and standardization of purified protein derivatives 

(PPD) of bovine tuberculin, johnin and mallein 

P. Das (PI) 

14.2 

14.3 

14.4 

14.5 

14.6 

Production and standardization of Brucella diagnostic antigen 

Production and standardization of Rose Bengal plate test antigen 

Production and standardization of Brucella abortus positive serum 

Production and standardization of Salmonella antigens 

Production and standardization of Salmonella antisera 

15. Development/production of viral vaccines 

15.1 

15.2 

Production of tissue culture sheep pox vaccine 

Production of lapinised swine fever vaccine 

V.K. Chaturvedi (PI) 

R. Saravanan 


R. Saravanan 

v.K. Chaturvedi (PI) 



P.e. Verma (PI) 

P.e. Verma I c.L. Patel (PI)

wmrr 

Annual Report 

2010-11 

15.3 

15.4 

15.5 

16 

16.1 

16.2 

16.3 

16.4 

17. 

18. 

19. 

20. 

21. 

22. 

23. 

24. 

25. 

26. 

27. 

28. 

29. 

30. 

Production of vaccine against poultry diseases viz., Ranikhet 

disease (Mukt. Strain), Ranikhet disease (F strain) and fowl pox 

Production of PPR vaccine 

Production and standardization of anti-rabies vaccine for large 

animals 

Technological improvement/production of bacterial vaccines 

Production of Brucella abortus strain (19) and Salmonella Abortus 

equi vaccines 

Production of enterotoxaemia vaccine 

Production of H.S.OiI adjuvant vaccine 

Bacterial biomass production using fermenter 

Diagnostic service and supply of soluble antigen and serum 

against capripox viruses: Production and supply of live attenuated 

goat pox vaccine 

Supply and field evaluation of PPR vaccine, diagnostic kits, 

diagnostic service and maintenance of virus/serum repository 

Disease diagnosis, treatment and maintenance of health of animal 

Maintenance and enhancement of productivity of experimental 

livestock 

Standardization and quality control of bacterial vaccines & antigens 

Quality control of viral vaccines of animals (other than poultry) 

Veterinary type cultures for production and testing of veterinary 

biologicals, research and training 

Quality control of poultry vaccines 

Standardization and quality control of veterinary 

immunodiagnostics antigens and antisera 

Production of FMD vaccine using BHK-21 cell culture system 

Foot and mouth disease vaccine quality control & assurance 

Production of laboratory animals 

Animal and farm waste management through vermibiotechnology 

Studies on reproductive problems in livestock 

P.e. Verma / e.L. Patel (PI) 

R Sarvanan (PI) 

Bina Mishra (PI) 

RP. Singh 





V. Bhanuprakash (PI) 

V. Gnanavel 

AB. Pandey (PI) 

D. Muthuchelvan 

A Sen 

K.K. Rajak 

S.B. Sudhakar 


P. Thirumurugan 

B.Sahoo 

Hira Ram 

Vikas Chandra 


P. Thirumurugan 

B.Sahoo 

Vikas Chandra 

HiraRam 

Mayank Rawat (PI) 

P. Dhar (PI) 

V. Upamanyu 

Mayank Rawat (PI) 

(Mrs) Lata Jain (PI) 

Rishendra Verma 

H.D. Karmakar (PI) 

Mayank Rawat 

R Venkatramanan (PI) 

B.P. Srinivasa 

M.Hosamani 

Subodh Kishore (PI) 

K. Ganesh 

Amit Kumar (PI) 

Ran Vir Singh (PI) 

S.K. Agarwal (PI) 

UmaShanker 

S.K. Srivastava

10. CONSULTANCY, PATENTS, COMMERCIALIZATION OF 

TECHNOLOGY 

Research, education and training, and their 

integration with technology transfer activities are 

the core activities of the institute. Besides these, 

the institute also provides consultancy and 

advisory services in various areas of animal health, 

production and product technology to the farmers, 

entrepreneurs, industries, central and state 

government agencies SAUs/SVU's CAUs, etc. The 

institute disseminates the technologies generated 

to the end - users through field extension 

programmes and Krishi Vigayan Kendra. The 

issues like !PR, patenting and commercialization 

of technologies are managed through the Institute 

Technology Management Unit (ITMU) and the 

Institute has been identified as one of the five 

Zonal Technology Management Centres (ZTMC) 

of lCAR for promoting the IPR portfolio and 

commercialization of technologies of the 20 

institutes of North Zone - II. In addition to these 

activities, the Business Planning and Development 

component of NAIP is designed to supplement the 

efforts at the zonal level to enhance capacity 

building for intellectual property and technology 

management and improve efficiency for effective 

execution of technology transfer / 

commercialization through the technology 

business incubators set up at the institute. 

A. Consultancy Services Provided 

Consultancy services are provided by 

CADRAD to the state animal husbandry 

departments for the diagnosis of diseases and their 

management, including prevention and control 

measures. Besides, attending and investigating 

outbreaks of diseases in animals and testing of 

samples, CADRAD and various Divisions also 

provided solutions to the disease problems. 

1. Animal Husbandry Department, Lucknow 

(UP) 

2. Animal Husbandry Department, Dehradun 

(UK) 

3. SSB Shrinagar, Garhwal (UK) 

4. BRAUP Police Academy, Moradabad (UP) 

5. Military Dairy Farm, Bareilly 

6. Pashulok, Rishikesh, Dehradun, UK. 

rrwmn 

Allllual Rt.>porl 

2010-11 

7. Central Avian Research Institute, Izatnagar, 

u.P. 

8. R.K. Nagar Exotic Duck Breeding Farm at 

Agartala (Tripura). 

9. Animal Husbandry Department, 

Bhubaneswar (Orissa) for BQ outbreak 

investigation in Chowder under Distt. 

Cuttack, 

10. Pet animal owners and livestock owners on 

prophylactic and therapeutic health-care. 

11. Field veterinarians on latest approaches in 

treatment of animal diseases and advanced 

diagnostic facilities like ultrasound, ECG, etc 

Consultancy services were provided to following 

Zoos and National Parks: 

1. Kanpur Zoological Park for treatment of a 

lioness 

2. MC Zoological Park Chhatbir, Panjab for 

treatment and control of leptospirosis in zoo 

animals 

3. Jodhpur Zoo, Rajasthan, for treatment and 

control of leptospirosis in zoo animals 

4. National Zoological Park, Delhi for health 

status checkup of black Bucks 

5. Chandipur Forest range, Haridwar for 

treatment of a lame wild elephant 

6. Dudhwa National Park, Palia, Khiri for 

treatment of an ailing elephant 

7. Van Vihar National Park, Bhopal for health 

checkup of ailing tigress 

8. Social forestry Department, Bareilly for 

surgery and treatment of a Sambhar 

9. Deer Park IFF CO, Aonla, Bareilly for animal 

health evaluation 

10. Gandhi Prani Udhyan, Gwalior for health 

evaluation of zoo animals 

11. GB Pant High Altitude Zoo, Nainital for health 

evaluation of zoo animals 

MoU for consultancy services 

• MOU between IVRI, Izatnagar and CARD, 

New Delhi was signed on November 27,2010 

for the establishment of Frozen Semen Bank at 

Lakhimpur Khiri, U.P. where IVRI, Izatnagar

IMKill 


2010-11 

I. Technologies ready for commercial 

transfer 

Vaccines 

.:. Live attenuated homologous Peste des petits 

ruminants (PPR) vaccine for small ruminants 

.:. A low-volume saponified haemorrhagic 

septicaemia (HS) vaccine 

.:. A Vero cell based live attenuated vaccine for 

control of goat pox in goats 

.:. Vero cell based sheep pox vaccine 

.:. Swine fever virus cell culture vaccine 

.:. Aluminum hydrOXide gel-concentrated, oil 

adjuvanted vaccine for FMD 

Diagnostics and Diagnostic kits 

.:. Monoclonal antibody based sandwich ELISA 

kit for detection of Peste des petits ruminants 

virus antigen 

.:. Monoclonal antibody based competitive 

ELISA kit for detection of Peste des petits 

ruminants virus antibodies 

.:. Recombinant antigen based ELISA for 

diagnosis of animal leptospirosis 

.:. Recombinant yeast expressed VP2 antigen 

based latex agglutination test for the serodiagnosis 

of Infectious Bursal Disease Virus 

infection 

.:. Diagnostic kit for caprine pleuropneumonia 

for field use 

Herbal Drugs Formulations for livestock 

.:. Development of post milking teat dip based 

on a novel herbal formulation for the 

prevention of bovine sub clinical mastitis 

• :. Herbo-mineral acaricide formulations against 

Boophilus ticks in cattle 

.:. A process of preparing a bio-organo-mineral 

formulation for the therapy of skin ailments in 

animals 

Biotechnology Products 

.:. A novel peptide as transfection reagent for 

protein and nucleic acids 

.:. A noval transfer vector for transferring genes 

into sheep pox virus; useful for developing 

vectored vaccines. 

• :. 3 AB protein of foot and mouth disease virus 

expressed in Pichia pastoris as a diagnostic tool 

to differentiate infected animals from the 

vaccinated 

.:. A process for expression of variable surface 

glycoprotein of Trypanosoma evansi in Pichia 

pastoris 

.:. Hybridoma clones for Monoclonal antibodies 

against PPR virus (H and N Proteins). 

Surgical Devices for livestock and other 

tools 

.:. A novel bilateral external skeletal fixation 

device for the management of long bone 

fractures in large animals 

.:. Circular and hybrid external skeletal fixators 

for large animals 

.:. Epoxy-pin external skeletal fixator for 

management of compound fractures in small 

animals and bird 

An indigenous methodology IVRI 

Crystoscope as field tool for determining 

optimum time for fertile insemination in 

animals 

Technologies for Value Addition in Meat 

Products 

.:. Emulsion based chicken products 

.:. Emulsion based mutton & chevon products 

.:. Chicken chips from spent hen meat 

.:. Incorporation of vegetables in meat products 

.:. Hurdle tech meat pickle 

.:. Functional mutton nuggets with low salt, low 

fat and high dietary fibre 

.:. A chitosan based biopreservative mix for 

buffalo meat mince at S±l °c" . 

.1. Intellectual fee distribution among the 

stakeholders 

The Institute Technology Management 

Committee approved the distribution of 

intellectual fee (lump-sum and royalty) generated 

upon licensing of the two technologies viz., 'Area 

Specific mineral Mixture' and 'PPR Vaccine' 

among the eligible scientists and other 

stakeholders as per the lCAR Guidelines for LP 

Management and Technology transfer/ 

Commercialization .

Composition of the Research Advisory Committee (,RAC) 

Position Status Names and Designation 

An eminent scientist from outside the Chairman 

ICAR system nominated by DG, ICAR 

4-5 External Members 

(including retired scientists of ICAR) 

representing the major areas of research 

& development programme of the 

institut'e nominated by DG, ICAR 

Director of the Institute 

DDG, concerned with the institute 

Two persons representing Agriculture I 

Rural interest of the IMC to the Institute 

in terms of Rule 66(a)5 for a period of 

their membership of the IMe. 

One Sr. level Scientist of the concerned 

Institute nominated by the Director of 

the Institute. 

Members 

Member 

Member 

Member 

Member 

Secretary 

COMPOSITION OF INSTITUTE RESEARCH COMMITTEE 

S1. 

No. 

Composition Name & Designation 

1. Dr. M.e. Sharma 

Director, IVRI 

2. Dr. J.K Malik 

Joint Director (Res.) 

3. lCAR Nominee 

D.D.G. (lCAR) 

4. Heads of Divisions, IVRI 

5. Principal Scientists, IVRl 

6. Prof. A. Ahmad Former VC and Former DDG (Edn.) 

7. Prof. P.K. Uppal Former Director, NRCE , Hisar 

Dr. A. T. Sherikar, Ex-Vice Chancellor 

IIWmll 


2010-11 

1. Dr. R.N. Sreenivas Gowda, 

Ex-Vice Chancellor, Karnataka 

Veterinary, Animal and Fisheries 

Sciences 

Bangalor,e 

University, Mandinagar, 

2. Dr. G. Butchaiah, 

Ex-Dean, Rajiv Gandhi College of 

Veterinary 

Hyderabad 

and Animal Science, 

3. Dr. J.M. Nigam, Jabalpur 

4. Dr. J.S. Dhillon, 

Ex-Dean, College of Veterinary 

5. 

Science, PAU, Ludhiana 

Dr. M.V. Subba Rao, FAO Expert, 

Ex-Dean of Vety. Sciences, ANGRAU, 

Hyderabad 

Dr. M.e. Sharma 

DDG (AS), ICAR, Krishi Bhavan, New 

Delhi 

By virtue of their membership of the BOM 

of IVRI, 

1. Dr. T.A. Kadarbhai, Krishi Vigyan 

Kendra, Baramati, DisH. Pune. 

2. Shri P.G. Bhatol, Chairman, Gujarat 

State Milk Marketing Federation, P.O. 

Box No. 10, Amul Dairy Road, Anand- 

388001 

Joint Director (Research) 

Status 

Chairman 

Member Secretary 

Member 

Members 

Members 

Expert Member 

Expert Member

IrWillII 

Annual Report 

2010-11 

8. Dr. M.P. Yadav Former VC, SVPUAT, Meerut Expert Member 

9. Dr. S.K. Carg Former VC, UPPDDUPCVV & GAS, Mathura Expert Member 

10. Dr. Nem Singh Former Joint Director (Res), IVRI 

11. Dr. Harpal Singh Former Dean, COVS, Pantnagar Expert Member 

12. Dr. Gaya Prasad A.D.G. (AH), ICAR Expert Member 

13. Dr. O.P. Dhanda Former A.D.G. (AP&B), rCAR Expert Member 

14. Dr. S.P. Singh Former Dean, COVS, GBPUAT, Pantnagar Expert Member 

15. Dr. N.N. Pathak Former Director, CIRB, Hisar 

16. Dr. K. Prabhudas Director, PDADMAS, Hebbal Expert Member 

17. Dr. V.K. Singh Former Director, CSWRI, Avikanagar 

18. Dr. J.P. Sharma Head, IARI, New Delhi Expert Member 

19. Dr. Arnresh Kumar Former Dean, COVS, Pantnagar Expert Member 

20. Dr. V.D. Sharma Former Head, Vet. Microbiol., GBPUA&T, Expert Member 

Pantnagar 

21. Dr. P.N. Kaul Former HD/EE, IVRI Expert Member 

22. Dr. D.C. Shukla Former Head, P & C, IVRI Expert Member 

23. Dr. RP. Mishra Former FAO Expert Expert Member 

24. Dr. V.P. Singh Former HD/B&M, IVRI Expert Member 

25. Dr. RS. Khatri Former PS, IASRI, New Delhi Expert Member 

Significant Decisions of Various 

Committees 

Board of Management 

The 44th meeting of Board of Management of 

IVRI was held on 3 rd June 2010 at lzatnagar 

Campus. The BOM approved holding of the VII 

Convocation of the Deemed University on 4th June, 

2010. The award of degrees to 243 MVSc and 146 

PhD students approved by the 50 th meeting of the 

Academic Council was placed before the BOM for 

information and it was agreed. The proceedings of 

50 th meeting of Academic Council were submitted 

for perusal and information of the BOM, and it 

was approved. 

50 th Meeting of the Academic Council 

The 50 th meeting of the Academic Council was 

held on 2nd June 2010 at Izatnagar. The changes 

made In the information bulletin for PC 

admissions during the academic session 2010-11 

were put before the Council for perusal and the 

same has been approved by the AC The AC also 

approved the proceedings of the meeting of 

Standing Committee on P.G. Faculty held on 19 th 

April 2010 and 29 th May 2010, and approved the 

names of 14 scientists for induction in faculty. 

The AC approved the names of 243 MVSc and 

146 PhD students who have completed the 

formalities for the award of degrees. The AC also 

approved holding of the VII Convocation of the 

Deemed University on 4th June 2010. The AC duly 

approved the recommendations of the committees 

and names of the awardees for Best Student 

Award and Best Teacher Award for the year 2007- 

08 and 2008-09. The AC also duly approved the 

recommendations of the committee and names for 

Dr. CM. Singh Award for the year 2006, 2007,2008 

and 2009. The AC considered the proposal of one 

of the members to make some rules to publish the 

research papers out of PC thesis research before 

issuing of PDC; and suggested that thesis should 

be accepted when at least one research paper has 

been submitted for publication by MVSc students, 

and one research paper should have been accepted 

and second submitted or one patent filed out of 

thesis work by PhD students. 

51 st meeting of the Academic Council 

The 51 st meeting of the Academic Council was 

held on 10 Ul January 2011 at Izatnagar. The 

proceedings of 49 th and 50 th meetings of Academic

Council were submitted for confirmation and 

review of action taken, which were approved by 

the Ae. Regarding the proceedings of Standing 

Committee Meeting on students problems and 

discipline held on 16 th April 2010, the AC 

suggested that online monitoring system for 

attendance, evaluation of student, etc. should be 

developed, and the fellowship of those students 

who indulge in any kind of indiscipline should be 

stopped. Regarding the request of the Student 

Council on the PhD guide allotment procedure, 

the AC recommended that the existing rules are 

foolproof, but guide allotment should be done 

immediately in the month of September itself 

when the new academic session starts; if Heads of 

the divisions are not allotting guides in time, Joint 

Director (Acad.) may allot the guides by 

constituting a committee with the approval of 

Director. The AC also approved the names of new 

scientists for induction in faculty. Regarding 

induction of more faculty members in 

Epidemiology Discipline, being the peculiar 

pOSition of Epidemiology Section, as a special case 

the AC agreed that faculty can be taken from B&M 

and Medicine Divisions to guide the students. 

Regarding the inclusion of foreign language 

optional course, the AC was of the view that 

foreign language may be started as a non-credit 

optional course for PhD students only for which 

interest of student may first be explored. Further, 

the AC suggested that English language course 

should also include scientific writing and thesis 

writing, etc. Regarding the consideration of seat 

position for the academic session 2011-12, the AC 

recommended to send a letter to the Education 

Division, rCAR, explaining the accommodation 

facilities and asking to reduce the seats for both 

MVSc and PhD courses to the original number 

(2008-09 seat position) till basic infrastructure 

facilities are developed at IVRI Deemed 

University. Regarding the proposal for starting 

MBA (Veterinary) programme, the AC was of the 

view that it may be started from the next academic 

session commencing from 1 s t September. The AC 

also suggested combining the Extension Course on 

Entrepreneurship, 1+1 (T+P), to a 2 credit inbuilt 

course of theory and practical, from next academic 

session, to ease out the problems of funds/vehicles 

and taking practical classes. 

XII RAG MEETING 

The meeting of XII Research Advisory 

Committee was held on April 5-6, 2010 at 

Mukteswar Campus. The Director Prof. M.e. 

Sharma in his welcome address highlighted the 

importance of the RAC and briefed RAC members 

about some of the important achievements of the 

Institute. Dr. J.K. Malik, Joint Director (Res.) and 

Member Secretary RAC presented the agenda 

. items for consideration and approval. The RAC 

confirmed the proceedings of XI RAC held on 5 th 

and 6 th July 2008, discussed the Action Taken 

Report on XI RAC recommendations and made 

appropriate suggestions. 

After detailed deliberations on various issues, 

the RAC made several recommendations, which 

included: filling the vacant posts of scientists at the 

earliest; establishing institute-university linkages 

and exchange of students; establishing the 

linkages with international institutes/universities; 

having one institute wprking on pet animals; 

having Post-Doctoral positions at IVRl; widening 

the scope of research work to address the needs of 

the entire nation; assessing and preparing a 

document on the impact analysis and economic 

losses of non-infectious diseases; strengthening 

research on stem cells; prioritizing research 

keeping in view the climate change and its impact; 

undertaking national surveillance and satellite 

mapping of status of diseases/health, management 

and nutrition; developing software, databanks and 

package of practices on livestock/herd health 

management, production and livestock marketing; 

organizing short course on animal behaviour; and 

scientists visiting well established co-operatives of 

Gujarat and Western Maharashtra to explore the 

possibilities of collaborationsllinkages, etc. In the 

concluding remarks the Chairman urged the 

scientists to reach out to the needy and poor 

farmers of the country and disseminate the 

advanced technolOgies through information 

technology gateways so that animal husbandry 

can provide the sustainable support to them.

IlW1Iill 


2010-11 

12. Participation of Scientists in Conferences, Workshops, 

Symposia, Trainings, etc. in India and Abroad 

S1. Name of the Symposium/Seminar/Workshop Number of 

No. Scientists 

Attended 

International 

1. Endeavour Research Fellowship, University of Adelaide, Australia, Feb. 22 to Aug. 

21.2010. 

1 

2. 

3. 

4. 

5. 

6. 

7. 

8. 

9. 

10. 

11. 

12. 

13. 

14. 

1. 

2. 

3. 

4. 

5. 

6. 

7. 

8. 

9. 

10. 

NAIP/ICAR Training in IOWA State University, USA, March 25 to June 24, 2010. 

Training on Nanotechnology/Microsphere based PLG Vaccine Delivery System to 

Control Viral Infections, USA, March 1O-June 10, 2010. 

Asia and Pacific Initiative on Reproduction (ASPIRE), Bangkok, April 9-11, 2010. 

35 th World Small Animal Veterinary Association Congress, Geneva, June 2-5,2010. 

Workshop on Progressing Tertiary Animal Welfare Education, Bangkok, June 21- 

22,2010. 

XIII European Poultry Conference, France, August 23-27, 2010. 

Scientific Meeting on International Consortium on Ticks and Tick Borne Diseases, 

Istanbul, Turkey, Aug. 26-30, 2010. 

Royan International Congress, Teheran, Iran, Sept. 14-17,2010. 

Scientific Meeting of International Standards Committee of SAN/Rainforest 

Alliance, Frankfurt, Germany, Nov. 8-10, 2010. 

Workshop at Massey University, New Zealand, Dec. 3-23, 2010. 

International Meeting on Influenza Interspecies Transmission, Treviso, Italy, Feb. 1- 

3,2011. 

IX Asia Pacific Poultry Conference, Taipei, Taiwan, March 20-23, 2011. 

5 th International qPCR Symposium, Freising, Germany, March 2011. 

National 

XIX National Conference on Recent Trends in Viral Disease Problems and 

Management, Tirupati, March 18-20, 2010. 

5 th Convention of UP Chapter of ISVS and Seminar on Role of Physiotherapy in 

Rehabilitation of Veterinary Surgical Patients, Izatnagar, April 3, 2010. 

XVI Annual Convention of ISVIB and National Symposium on Novel 

Biotechnological and Immunological Interventions in Mitigation of Climate 

Changes on Production and Protection of Livestock and Poultry, Namakkal, April 

8-10,2010. 

Training on Open Source GIS, New Delhi, April 12-16, 2010. 

National Conference on Knowledge Management in the Globalized Era, New 

Delhi, April 21-23, 2010. 

Web of Science' of Thomson Reuter on-line Training, Izatnagar, May 5-6,2010. 

Mid Term Workshop of KVK, Kanpur, May 6-7,2010. 

First Seminar of Indian JSPS Alumni Association, lIT Delhi, New Delhi May 10-12, 

2010. 

Training Programme on Creative Writing on Agriculture, Dhenkanal, Orissa, May 

10-15, 2010. 

WHO Workshop on National Consultation for Strengthening Laboratory Capacity 

for Diagnosis of Infectious Diseases, New Delhi, May 12-13, 2010. 

1 

1 

1 

1 

1 

1 

1 

2 

1 

1 

1 

1 

1 

1 

11 

1 

1 

2 

1 

2 

1 

1 

1

IIWffill 

Annual Report 

2010-11 

39. 

40. 

41. 

42. 

43. 

44. 

45. 

46. 

47. 

48. 

49. 

50. 

51. 

52. 

53. 

54. 

55. 

56. 

57. 

58. 

59. 

60. 

61. 

62. 

63. 

Training on Data Analysis using SAS, Izatnagar, Sept. 20-25, 2010. 

Regional Training Course under the Technical Cooperation Regional Project 

RER/5/015: Supporting Early Warning and Surveillance of Avian Influenza 

Infection in Wild and Domestic Birds and Assessing Genetic Markers for Bird 

Resistance at IAEA laboratories in Seibersdorf, Austria, Sept. 20 to Oct. 1, 2010. 

ICAR Summer School on Recent Advances in Molecular Diagnosis and Control of 

Important Zoonotic Diseases, Izatnagar, Sept. 21-30,2010. 

Winter School Training on Basic Techniques in Solid Phase Synthesis and 

Application of Synthetic Peptides in Animal Disease Diagnosis and Research, 

Izatnagar, Sept. 22-0ct.12, 2010. 

ICAR-Winter School on Newer Concepts and Techniques in Molecular and Pathoanatomical 

Diagnosis of Farm Animals, Poultry, Wildlife and Laboratory Animal 

Diseases, Izatnagar, Oct. 1-21,2010. 

Third GLP Inspectors Training Course, Gurgaon, October 3-10, 2010. 

Training Programme on SAS Genetics and JMP Genomics, New Delhi, Oct. 4-8, 

2010. 

Short Course on Application of Molecular Pharmacology Techniques in Drug 

Development, lzatnagar, Oct. 4-13, 2010. 

ICAR Regional Committee Meeting No. N, Ranchi, Oct. 7-9, 2010. 

Training Programme on Data Analysis using SAS, New Delhi, Oct. 9-15, 2010. 

International Symposium on Recent Advances in Ecology and Management of 

Vectors and Vector Borne Diseases, Gwalior, Oct. 10-15,2010. 

Management Development Programme on Leadership for Innovation in 

Agriculture, Lucknow, Oct. 18-22,2010. 

National Symposium on Conventional and Modern Breeding Technologies for 

Genetic Improvement of Livestock and Poultry in India, Pantnagar, Oct. 22-23, 

2010. 

Interactive Meet on Enhancing the Role of IASRl in R&D Efficacy of leAR 

Institutes under Animal Sciences Division, New Delhi, Oct. 27, 2010. 

National Seminar on Gaushalas, Kamal, Oct. 28, 2010. 

Veterinary Biological Manufacturers, Drugs, and Indian Pharmacopoeia 

Commission Meet, Izatnagar, Nov. 9-10, 2010. 

International Symposium on Biotechnologies for Optimization of Reproductive 

Efficiency of Farm and Companion Animals to Improve Global Food Security and 

Human Health and XXVI Annual Convention of ISSAR, Pantnagar, Nov. 10-12, 

2010. 

V Uttarakhand State Science and Technology Congress, Dehradun, Nov. 10-12, 

2010. 

International Conference on Physiological Capacity Building under Changing 

Climatic Scenario, and Annual Convention of Society of Animal Physiologists of 

India, Izatnagar, November 11-13, 2010. 

PIMS-ICAR Workshop at IASRl, New Delhi, Nov. 15,2010. 

Laboratory Biorisk Management Awareness Training and Transport of Infectious 

Substance Shipping Training, New Delhi, Nov.16-19, 2010. 

National Symposium on Strategies for Sustainable Meat Production for Nutritional 

Security and Employment Generation, Izatnagar, Nov. 19-20,2010. 

All India State Animal Husbandry Meet, Izatnagar, Nov. 24,2010. 

Winter School on Advances in Dairy Production Management for Precision Output 

in Relation to Environment and Trade, Bangalore, Nov. 22-Dec.14, 2010. 

XXVII Annual Conference of Indian Association of Veterinary Pathologists on 

5 

2 

1 

6 

1 

1 

2 

1 

4 

2 

1 

1 

1 

1 

1 

6 

3 

1 

37 

1 

1 

17 

1 

1 

4

64. 

65. 

66. 

67. 

68. 

69. 

70. 

71. 

72. 

73. 

74. 

75. 

76. 

77. 

78. 

79. 

80. 

81. 

82. 

83. 

84. 

85. 

86. 

87. 

Recent Trend in Diagnosis and Pathology of Emerging and Re-emerging Diseases 

of Livestock and Poultry, Guwahati, Nov. 25-27, 2010. 

National Seminar on Sustainable Agriculture and Food Security - Challenges and 

Opportunities, Bhubaneswar, Nov. 29-30, 2010. 

Workshop on Multi-country Research Initiative on Eco-health Research on Japanese 

Encephalitis in South Asia, Kathmandu, Nov. 29-Dec. 2, 2010. 

Brainstorming Meet on Research Priorities of HSADL for the Next Decade, Bhopal, 

Dec. 1, 2010. 

X Annual Conference of Indian Society of Veterinary Pharmacology and 

Toxicology, Jabalpur, Dec. 2-4,2010. 

V International Nitrogen Conference, Dec. 3-7, 2010, New Delhi 

Workshop on Monographs of Indian Pharmacopoeia-2010, Ghaziabad, Dec. 7-8, 

2010. 

XXXIV Congress of the ISVS and National Symposium, Puducherry, Dec. 8-10, 

2010. 

Zonal Workshop ofKVK, Varanasi, Dec. 9-10, 2010. 

VII Biennial Conference of ANA on Animal Nutrition Strategies for Environment 

Protection and Poverty Alleviation, Bhubaneswar, Dec.17-19, 2010. 

V Convention of Society of Immunology and Immunopathology and National 

Symposium, Nainital, Dec. 17-19,2010. 

National Conference on KVK, Udaipur, Dec. 22-24, 2010. 

International Symposium on Role of Biotechnology in Conserving Biodiversity and 

Livestock Development for Food Security and Poverty Alleviation and XVII 

Annual Convention of Indian Society of Veterinary Immun,?logy and 

Biotechnology, Bikaner, Dec. 29-31, 2010. 

XXI National Congress of Veterinary ParaSitology, Mumbai, Jan. 5-7, 2011. 

Training on Data Analysis using SAS of the National Agricultural Innovation 

Project on Strengthening Statistical Computing for NARS, Izatnagar, Jan. 15-20, 

2011. 

XI Annual Convention of Indian Society of Animal Genetics and Breeding & 

National Conference, Izatnagar, Jan. 20-21, 2011. 

International Conference on Managing Sustainable Development of Rural Economy 

and Agri. Business (ICONBHU11), Varanasi, Jan. 21-23, 2011. 

Workshop on Development of Technology Commercialization and Transfer 

Specialists, Bangalore, Jan. 27-29, 2011. 

National Symposium on New Paradigms in Laboratory Animal Science in an Era of 

Advance Biomedical Research, Izatnagar, Jan. 28-29, 2011. 

IX Annual Conference of IAVPHS and National Symposium on Veterinary Public 

Health: New Horizon for Integrating the Animal Production, Food Safety and 

Human Health, Mumbai, Jan. 28-29, 2011. 

National Workshop on Biosecurity and Mitigation of Biological Disaster, New 

Delhi, Feb. 2, 2011. 

ICAR-NAIP National Workshop on Gene Expression and SNP Analysis, Chennai, 

Feb. 2-4, 2011. 

International Sugarcane Rice and Maize India Expo, Kamal, Feb. 3-5, 2011. 

National Workshop cum CAC Meeting of NAIP Component-4 projects, Kamal, 

Feb. 7-8,2011. 

International Conference on Frontiers in Reproductive Biotechnology and XXI 

Annual Meeting of the ISSRF, Kamal, Feb. 9-11, 2011. 

rrwmrr 

AllIllIal Report 

2010-11 

1 

1 

18 

2 

2 

1 

5 

2 

10 

3 

1 

5 

7 

8 

19 

1 

1 

20 

3 

1 

2 

1 

2 

3

14. DISTINGUISED VISITORS 

• Dr. A.K Srivastava, Director & VC, NDRI, 

Kamal. 

• Dr. A.K Mishra, Project Director, PO Cattle, 

Meerut. 

• Dr. A.T. Sherikar, Ex-Vice Chancellor, 

MAFSU, Nagpur. 

• Dr. Amresh Kumar, Ex.-Dean, College of Vety. 

Science, GBPUA&T, Pantnagar & DG, KCMT, 

Bareilly. 

• Dr. Anii. P. Joshi, Executive Director, HE'SCO, 

Uttarakhand. 

• Dr. Arun Varma, Ex- ADG (AN&P), ICAR, 

New Delhi. 

• Dr. Arvind Kumar, DOG (Edn.), ICAR, New 

Delhi. 

• Dr. B. Pattnaik, Project Director, PO FMD, 

Mukteswar. 

• Dr. B.K Joshi, Director, NBAGR, Kamal. 

• Dr. B.N. Saikia, BOM Member and MP, AAU, 

Khanapara. 

• Dr. B.s. Bisht, Vc, GBPUA&T, Pantnagar. 

• Dr. C. Rajkhowa, Director, NRC on Mithun, 

Nagaland. 

• Dr. C.S. Prasad, ADG (AN&P), ICAR, New 

Delhi. 

• Dr. Chanda Nimbkar, Director, AH Div. ARI, 

Pha]tan, Maharashtra (ICAR, GB). 

• Dr. Chandrika Prasad, Ex-DOG (Extn.), ICAR, 

New Delhi. 

• Dr. D. Swarup, Director, CIRG, Makhdoom, 

Mathura. 

• Dr. D.N. Tewari, IFS, Secretary Gol and DG 

ICFRE; Ex. Member Planning Commission, 

Gol., New Delhi. 

• Dr. David Castellan, Regional Vety. 

Epidemiologist, FAO, Bangkok. 

• Dr. G.N. Singh, Secretary-cum-Scientific 

Director, Indian Pharmacopeia Commission, 

Gol, Ministry of H&FW, Ghaziabad. 

• Dr. Gaj Raj Singh, Dean, College of Vety. 

Science, Aizawl. 

• Dr. Gaya Prasad, ADG (AH), ICAR, New 

Delhi. 

• Dr. Guru Bachan Lal, IPS, IGP, Bareilly. 

• Dr. J.M. Nigam, Ex-Dean, College of Vety. 

Science, Palampur. 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

ITW1Iill 


2010-11 

Dr. KK Singh, Chief Veterinary Officer, 

Deptt. of Animal Husbandry, Uttar Pradesh. 

Dr. KM.L. Pathak, DOG (AS), ICAR, New 

Delhi. 

Dr. Kamel Taori, International Institute for 

Holistic Res. & Voluntary Action, Rural 

Business Hub Foundation India. 

Dr. Lal Krishna, ADG (AH) ICAR, New Delhi 

& AHC, GoI, New Delhi. 

Dr. Leo Loth, Chief Tech. Advisor, ECTAD, 

FAO of UN, New Delhi. 

Dr. M.L. Madan, Ex-DOG (AS), ICAR and Ex 

Vc, UPPDDUPCVV Evam GAS, Mathura. 

Dr. M.P. Yadav, Ex-Director, IVRI and Ex-VC, 

SVPUA&T, Meerut. 

Dr. M.V. Subba Rao, National Project 

Consultant, FAO, New Delhi, India. 

Dr. Madan Mohan, ADG (Inland Fisheries), 

ICAR, New Delhi. 

Dr. Mark Taggart, Instituto de Investigaci6n 

en Recursos Cinegeticos, UCLM, Spain. 

Dr. N.N. Pathak, Ex-Director, CIRB, Hisar. 

Dr. Nadhim Sulaiman Abdul Aziz Jakhi, 

Cultural Councellor, Embassy of the Republic 

of Iraq. 

Dr. O.P. Mishra, Dept. of Ext. Edu., Ag. 

Sciences, BHU, Varanasi. 

Dr. O.P. Singh, Director (Extension) 

SVPUA&T, Meerut. 

Dr. P.K Shukla, Joint Commissioner of 

Poultry, Gal, New Delhi. 

Dr. P.K Uppal, Ex-Director, NRCE, Hisar. 

Dr. P.N. Bhat, Ex-DDG(AS), ICAR, New Delhi. 

Dr. p.s. Ahuja, Director, Institute of 

Himalayan Bioresource Technology (CSIR), 

Palampur. 

Dr. RM. Acharya, Ex-DDG(AS), ICAR, New 

Delhi. 

Dr. R.K Singh, Director, NRC on Equine, 

Hisar. 

Dr. R.N. Sreenivas Gowda, Ex-Vice 

Chancellor, Kamataka Veterinary, Animal and 

Fisheries Sciences University, Mandinagar, 

Bangalore. 

Dr. Rajiv Mehrishi, Additional Secretary, 

DARE, ICAR, New Delhi.

IIWIlliI 

Annual Report 

2010-11 

• Dr. S. Ayyappan, DG, ICAR and Secretary, 

DARE, New Delhi. 

• Dr. S.c. Gupta, AOG (AP&B), ICAR, New 

Delhi. 

• Dr. S.K. Garg, Ex-VC, UPPODUPCVV Evam 

GAS, Mathura & Director CAE&HS, Meerut. 

• Dr. S.L. Mehta, Ex-DDG (Edu.)" leAR, New 

Delhi. 

• Dr. Subhash Morzaria, Regional Manager, 

ECTAD FAO, Bangkok, Thailand. 

• Dr. Takeshi Onodera, Assistant Professor, 

Ultra Biology Lab, Department of Electronics, 

Kyushu University, Fukuoka, Japan. 

• Dr. V. Prabhakar Rao, VC, SVVU, Tirupati. 

• Justice Barin Ghosh, Hon'ble Chief Justice, 

High court Nainital, Uttarakhand. 

• Mr Masato Yasuura, Ultra Biology Lab, 

Department of Electronics, Kyushu University, 

Fukuoka, Japan. 

• Mr. Thorn Wright, Attache for Agricultural 

Specialist, USDA. 

• Ms. Athena, Oy. Manager, Old Home Care, 

UK. 

• Ms. Deepa Krishnan, Chief Commissioner, 

Income Tax, Uttarakhand. 

• Ms. Ixmel V. Marla, Chairperson, International 

Institute for Holistic Res. & Voluntary Action, 

Rural Business Hub Foundation India. 

• Prof. A. Ahmad, Ex-DOG (Edn.), ICAR, New 

Delhi. 

• Prof. Harpal Singh, Ex-Dean, College of Vety. 

Science, GBPUA&T, Pantnagar. 

• Prof. M.J. Modayil, Member, ASRB, New 

Delhi. 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

• 

Prof. Nadhim S. Jakhia, Cultural Counsellor, 

Iraqui Embassy, India. 

Prof. Peter PC Mertens, Institute for AH, UK. 

Prof. S.A.H. Abidi, Ex-Member, ASRB, New 

Delhi. 

Prof. V.N. Vakharia, University of Maryland 

Biotechnology Institute, USA. 

Shri Aditya Murthy, Chairman, SRMS, 

Bareilly. 

Shri Anil Garg, lAS, District Magistrate, 

Bareilly. 

Shri Badri Prasad Singh, IPS, IGP, Bareilly. 

Shri Chandra Kant Tripathi, CGM & Resident 

Editor for Oainik Jagaran, Bareilly. 

Shri K.K. Bajpai, Ex-ADG (Adm.), ICAR, New 

Delhi. 

Shri M. V .S. Rami Reddy, Commissioner, 

Bareilly. 

Shri P.G. Bhatol, Chairman, Gujarat State Milk 

Marketing Federation, Anand. 

Shri Prabhat Singh, Chief Editor, Amar Ujala, 

Bareilly. 

Shri Prakash. 0, DIG of Police, Bareilly. 

Shri S.K. Mitra, Deputy Secretary, ICAR, New 

Delhi. 

Shri S.P. Singh, Civil Judge, Bareilly. 

Shri Sunil Chawdhary, IFS, Conservator of 

Forest, Bareilly. 

Shri Urnesh Gautharn, Chairman, Invertis 

Educational Institutes, Bareilly. 

Shri V.P. Kothiyal, Director (Works), ICAR, 

New Delhi. 

Smt. Supriya Aron, Mayor, Bareilly.

15. IVRI PERSONNEL (2010-11) 

ADMINISTRATION - IZATNAGAR CAMPUS 

1. Prof. M.e. Sharma Director & 

Vice-Chancellor 

JD (Academic) 

2. Dr. Dharmeswar Das 

(up to 19.2.2011) 

3. Dr. J.K Malik 

(up to 31.7.2010) 

4. Dr. J.M. Kataria 

(w.e.f.18.1.2011) 

4. Dr. Triveni Dutt 

6. Dr. Rishendra Verma 

7. Dr. J.R Rao 

8. Dr. S.V.S. Malik 

8. Dr. Rupasi Twari 

9. Dr. G.e. Ram 

10. Dr. Uma Shankar 

13. Shri D.O. Verma 

14. Shri Sanjay Bokolia 

(up to 8.9.2010) 

15. Shri KL. Meena 

17. Shri Pankaj Kumar 

18. Shri Vampad Sharma 

19. Shri G.e. Pant 

JD (Research) 

JD(Research ) 

JD (Extension Edn.) 

JD(CADRAD) 

Scientific Secretary 

to Director 

(up to 31.7.2010) 


to Director 

(w.e.I. 1.8.2010) 


to Director 

Scientific 

Coordinator, 

Deemed University 

(up to 31.10.2010) 

Scientific 

Coordinator, 

Deemed University 

(w.e.f.1.11.2010) 

10. Dr. KN. Bhilegaonkar Principal Scientist 

Joint Directorate of 

Research 

11. Shri Rakesh Kumar CAO 

(w.e.f.7.4.2010) 

12. Shri G.R Deshbandhu JD (Admn.) & 

Registrar 

(w.e.f. 5.8.2010) 

Comptroller 

SAO 

SAO 

SAO 

AO 

F&AO 

20. Shri Prashant Kumar F&AO 

(up to 26.3.2011) 

21. Shri G.D. Amola AF&AO 

(up to 21.3.2011) 

22. Shri G.e. Joshi AF&AO 

(up to 8.3.2011) 

23. Shri U.K Saxena AF&AO 

(up to 26.3.2011) 

27. Shri RB. Saxena AAO 

30. Shri S.P. Pandey AAO 

33. Smt. Usha Pandey AAO 

34. Shri B.D.V.BhiwapurkarAAO 

(up to 5.2.2011) 

35. Shri S.K Saxena AAO 

36. Shri P.e. Kamatak 

37. Shri Z.A. Khan 

38. Shri H.e. Pandey 

39. Smt. Sujatha Jethi 

40. Dr. (Smt.) Shashi Rani 

Saxena 

AAO 

AAO 

AAO 

Asstt. Director 

(Official Language) 

Asstt. Professor 

(English) 

MUKTESWAR CAMPUS 

1. Dr. A.B. Pandey Head, Virology & 

Station In-charge 

2. Shri B.M. Lal AAO 

(up to 31.10.2010) 

3. Shri J.D. Suntha AAO 

(w.e.f. 27.10.2010) 

4. Shri Arnar N ath AAO 

(w.e.f. 13.12.2010) 

5. Shri D.K Arya AF&AO 

BANGALORE CAMPUS 

1. Dr. R Venkataramanan Joint Director 

2. Shri B. Riyaz Ahmed AAO 

3. Smt. G.S. Rajalaxmi Private Secretary 

4. Dr. S. Srinivas Medical Officer 

5. Mrs. B. Dakshyani AAO 

REGIONAL STATION, PALAMPUR 

1. Dr. O.P. Sharma Principal Scientist & 

In-charge 

REGIONAL STATION, KOLKATA 

1. Dr. S.e. Das Principal Scientist & 

Station In-chargre 

ITWIlliI 

AJlI1l1al Rcport 

2010-11

llWllil1 

Alllluai Report 

2010-11 

HSADL, BHOPAL CENTRE FOR ANIMAL DISEASE RESEARCH 

L Dr. S.C Dubey Joint Director AND DIAGNOSIS 

2. Shri S. K Gupta AO 1. Dr. Rishendra Verma MVSc,PhD 

3. Shri MKM. Nair AAO Joint Director 

4. Shri B.K Kanchan AF&AO 2. Dr. Rajendra Singh MVSc,PhO 

Principal Scientist 

DIVISION OF BACTERIOLOGY & 3. Dr. KP. Singh MVSc,PhD 

MYCOLOGY Principal Scientist 

1. Dr. Vijendra Pal Singh MVSc,PhD 4. Dr. A.B. Pandey MVSc,PhD 

Principal Scientist & Principal Scientist 

Head (up to 11.4.2010) 

2. Dr. RK Agarwal MVSc,PhD 5. Dr. Dinesh Chandra MVSc,PhD 

Principal Scientist Principal Scientist 

3. Dr. P. Chaudhuri MVSc,PhD 6. Dr. S. Nandi MVSc,PhD 

Senior Scientist Senior Scientist 

4. Dr. Rajneesh Rana MVSc,PhD 7. Dr. A.G. Telang MVSc,PhD 


5. Dr. KN. Viswas MVSc,PhO 8. Dr. Rajesh Rathore MVSc,PhO 

Senior Scientist Scientist (Sr. Scale) 

6. Dr. S. K Gupta MVSc, PhD 9. Dr. Vishal Chandra MVSc 

Scientist Scientist 

7. Dr. Sabrinath T. MVSc 10. DT. Chandan Prakash MVSc 


8. 

9. 

Dr. Prasad Thomas 

Dr. Abhishek 

MVSc 

Scientist 

MVSc 

Scientist 

EPIDEMIOLOGY SECTION 

1. Dr. Hari Shankar MVSc,PhD 


& In-charge 

DIVISION OF BIOLOGICAL PRODUCTS 

1. Dr. V.K Chaturvedi MVSc,PhO 

Principal Scientist & 

2. Dr. D.K Sinha 

(up to 30.11.2010) 

MVSc,PhD 

Senior Scientist 

Head 

DIVISION OF MEDICINE 

2. Dr. P.C Verma MVSc, PhD 1. Dr. N.N. Pandey MVSc,PhO 



3. Dr. P. Das MVSc,PhD Head 


(up to 31.7.2010) 

4. Dr. R P. Singh MVSc,PhO 2. Dr. S. Dey MVSc,PhD 



5. Dr. Bina Mishra MVSc,PhO Actg. Head 


(w.e.f. 1.8.2010) 

6. Dr. R Saravanan MVSc,PhO 3. Dr. U. Dimri MVSc, PhD, MBA 

Scientist 

PrinCipal Scientist 

7. Dr. CL. Patel MVSc, PhD 4. Dr. Reena Mukherjee MVSc,PhO 

Scientist 


Technical Staff: 

L Er. Gopal Tandon M.Tech. 

T-9 

5. 

6. 

Dr. O.E. MondaI 

Dr. Vinod Kr. Gupta 

MVSc,PhO 


MVSc,PhO 


7. Dr. Pankaj Kumar MVSc,PhD 

Scientist

8. Dr. Ujjwal Kumar De MVSc 

Scientist 

9. Dr. K. Mahendran MVSc 

Scientist 

VETERINARY POLYCLINIC 

1. Dr. N.N. Pandey MVSc, PhD 


In-charge 

(up to 31.7.2010) 

2. Dr. S. Dey 

MVSc,PhD 


In-charge 

(w.e.£. 1.8.2010) 

3. Dr. KL. Khurana MVSc,PhD 

Sr. Scientist 

4. Dr. N.P. Kurade MVSc, PhD 

Sr. Scientist 

WILDLIFE SECTION 

1. Dr. A.K Sharma 

2. Dr. Mohini Saini 

3. Dr. Asit Das 

MVSc, PhD 


In-Charge 

MSc,PhD 


MVSc, PhD 


DIVISION OF PARASITOLOGY 

1. Dr. J.R Rao 

MVSc,PhD 


Head 

(up to 31.7.2010) 

2. Dr. B.P. Singh MVSc,PhD 


Acting Head 

(w.e.f. 1.8.2010) 

3. Shri S.c. Gupta MScMPhil 


4. Dr. G.c. Bansal MVSc,PhD 


5. Dr. A. Prasad 

MSc, DPhil 


6. Dr. D.O. Ray 

MVSc,PhD 


7. Dr. S. Ghosh 

MSc,PhD 


8. Dr. P.S. Banerjee MVSc, PhD 


9. Dr. S. Samanta MVSc,PhD 


10. Dr. O.K Raina 

11. Dr. A.K Tewari 

12. Dr. B.C. Saravanan 

13. Dr. Rajat Garg 

14. Dr. M. Sankar 

15. Dr. Hira Ram 

MSc, PhD 


MVSc,PhD 


MVSc,PhD 


MVSc,PhD 


MVSc,PhD 

Scientist 

(Up to 15.2.2011) 

MVSc,PhD 

Scientist 

(w.e.£. 4.12.2010) 

DIVISION OF PATHOLOGY 

1. Dr. R Somvanshi MVSc, PhD,FRVCS 

(Sweden) 


Head 

2. Dr. Ram Kumar MVSc,PhD 


(up to 31.7.2010) 

3. Dr. RB. Rai 

MVSc,PhD 

• Principal Scientist 

4. Dr. S.D. Singh MVSc,PhD 


IIC A.D. Section 

5. Dr. A.K Sharma MVSc,PhD 


6. Dr. G. Sai Kumar MVSc,PhD 


7. Dr. K Dhama MVSc,PhD 


8. Dr. Monalisa Sahoo MVSc 

Scientist 

Technical Staff 

1. 5hri B.K. Das 

(Dip. Photography) 

T-6 

DIVISION OF PHARMACOLOGY & 

TOXICOLOGY 

1. Dr. S.K Mishra 

2. Dr. S.K Tandan 

3. Dr. S.N. Sarkar 

BVSc&AH 

MSc,PhD 


Head 

MVSc,PhD 


MVSc,PhD 


ITW'illI( 

AllIllllll ({eport 

2010-11

IIWImI 

Annual Report 

2010-11 

4. Dr. Dinesh Kumar MVSc,PhD 


5. Dr. Thakur Uttam SinghMVSc, PhD 

Scientist 

6. Dr. Dhirendra Kumar MVSc 

Scientist 

7. Dr. S. Kalpana MVSc,PhD 

Scientist 

8. Dr. Subhashree Parida MVSc 

Scientist 

(w.e.f.19.4.2010) 

9. Dr. P. Sankar 

MVSc 

Scientist 

(w.e.f. 24.4.2010) 

DIVISION OF STANDARDISATION 

1. Dr. Rishendra Verma MVSc, MSc, 

(Immunol, u.K.), 

PhD 

2. Dr. P. Dhar 

3. Dr. Mayank Rawat 

4. Dr. Haridas Karmakar 

5. Dr. Lata Jain 

6. Dr. Vikramaditya 

Upmanyu 

DIVISION OF SURGERY 

1. Dr. M.M.S. Zama 

2. Dr. AK. Sharma 

3. Dr. M. Hoque 

4. Dr. P. Kinjavdekar 

S. Dr. Naveen Kumar 

6. Dr. AM. Pawde 

7. Dr. Amarpal 

8. Dr. H.P. Aithal 


Head 

MVSc,PhD 


MVSc,PhD 


MVSc,PhD 


MVSc 

Scientist 

MVSc,PhD 

Scientist 

MVSc,PhD 

Head 

MVSc,PhD 


MVSc,PhD 


MVSc, PhD 


MVSc,PhD 


MVSc,PhD 


MVSc, PhD 


MVSc,PhD 


9. Dr. S.K. Maiti 

10. Dr. Rekha Pathak 

11. Dr. AC. Saxena 

12. Dr.(Mrs.) Aswathi 

Gopinathan 

Technical Officer 

1. Shri H.C. Setia 

MVSc,PhD 


MVSc,PhD 


MVSc 

Scientist 

(w.e.f 23.4.2010) 

MVSc, PhD 

Scientist 

(w.e.f.1O.1.2011) 

MSc (Radiol.) 

T-9 (up to 31.12.2010) 

DIVISION OF VETERINARY PUBLIC HEALTH 

1. Dr. Ashok Kumar MVSc, PhD 


Head 

2. Dr. S.V.S. Malik MVSc,PhD 


3. Dr. D.K. Singh MVSc,PhD 


4. Dr. KN. Bhilegaonkar MVSc, PhD 


5. Dr. R.S. Rathore MVPH,PhD 


DIVISION OF VIROLOGY, MUKTESWAR 

1. Dr. AB. Pandey MVSc, PhD Head & 

Station Incharge 

2. Dr. V. Bhanuprakash MVSc, PhD 


3. Dr. B. Mondal MVSc,PhD 


4. Dr. Y.P.S. Malik MVSc, PhD 


5. Dr. D. Muthuchelvan MVSc, PhD 


(w.e.f. 16.9.2010) 

6. Dr. S.B. Shivachandran MVSc, PhD 


(w.e.f. 17.2.2010) 

7. Dr. M.A Ramakrishnan MVSc, PhD 

Senior Scientist, 

(w.e.f.7.04.2010) 

8. Dr. Amab Sen MVSc,PhD 

Scientist (SG) 

(up to 22.2.2011) 

9. Dr. S.K Biswas MVSc 

Scientist

10. Dr. S. Chakravarti 

11. Dr. Gnanavel V. 

12. Dr. KK Rajak 

13. Dr. S.B. Sudhakar 

14. Dr. P.N. Gandhale 


1. Shri D.C. Joshi 

2. Dr. Manu Malviya 

MVSc 

Scientist 

MVSc 

Scientist 

MVSc,PhD 

Scientist 

MVSc 

Scientist 

MVSc 

Scientist 

Diploma (Elect. 

Engg.) T-9 (TO) 

MBBS,DCH 

T-9 (MO) (On leave) 

3. Shri Hari Om Gangawar MSc (Agro.) 

T-6 (TO) 

4. Shri T.L. Banker MLib Sci 

BEd & Diploma 

(Agri.) T-6 (TO) 

DIVISION OF TEMPERATE ANIMAL 

HUSBANDRY, MUKTESWAR 

1. Dr. A.K Sharma MVSc, PhD 

Senior Scientist & 

Incharge 

2. Dr.P.11Urumurugan MVSc,PhD 


3. Dr. B. Sahoo MVSc,PhD 


4. Dr. HiraRi'l.m MVSc,PhD 

Scientist (Sr. Scale) 

(up to 3.12.2010) 

5. Dr. Vikas Chandra MVSc,PhD 

Scientist 

6. Dr. M. Sankar MVSc,PhD 

Scientist 

(w.e.f. 18.2.2011) 

EXTENSION EDUCATION SECTION, 

MUKTESWAR 

1. Dr. Vikas Chandra MVSc,PhD 

Acting In-charge 

DIVISION OF ANIMAL BIOTECHNOLOGY 

1. Dr. G.c. Ram MVSc, PhD 


Acting Head 

(up to 31.8.2010) 

2. Dr. B.P. Mishra MVSc,PhD 


Head 

(w.e.f.25.2.2011) 

3. Dr. Satish Kumar MSc,PhD 


4. Dr. P.P. Goswami MSc,PhD 


5. Dr. A.K Tiwari MVSc,PhD 


6. Dr. P.K Gupta MVSc, PhD 


7. Dr. GVPPS Ravi Kumar MVSc, PhD 


8. Dr. C. Madhan Mohan MVSc,PhD 


9. Dr. Sohini Dey MVSc, PhD 


10. Dr. Sameer Srivastava MVSc,PhD 

Scientist 

11. Dr. Sonal 

MVSc,PhO 

Scientist 

12. Dr. Ajay Kumar 

13. Dr. Oeepak Kumar 

MVSc,PhD 

Scientist . MVSc,PhD 

Scientist 

14. Dr. Aditya P. Sahoo MVSc 

Scientist 

15. Dr. S.K Ohara MVSc, PhD 

Sr. Scientist 

(w.e.f.26.7.2010) 

16. Dr. Jowar Ooley MVSc 

Scientist 


1. Dr. P.K. Bhatnagar 

2. Shri Surendra Nath 

3. Shri Sudesh Palia 

MSc,PhD 

T-9 

MSc 

T-9 

MSc 

T-9 

4. Shri N arsingh Prasad MSc 

T (7-8) 

IMMUNOLOGY SECTION 

1. Dr. G.C. Ram MVSc,PhD 


In-charge 

(up to 31.8.2010) 

IIWIRill 

Anllual R.eport 

2010-11

2. Dr. T.K. Goswami 

3. Dr. Alka Tomar 

4. Dr. S. Oandapat 

5. Dr. Mithilesh Singh 

MVSc,PhO 


In-charge 

(w.e.£. 1.9.2010) 

MVSc,PhO 


MVSc, PhD 


MVSc,PhO 

Scientist 

I.V.R.I. CAMPUS, BAN GALORE 

1. Dr. R. Venkataramanan MVSc, PhD 

Joint Director 

2. Dr. V.V.S. MSc, PhD 

Suryanarayana Principal Scientist 

3. Dr. G.R. Reddy MSc, PhD 


4. Dr. Subodh Kishore MVSc,PhD 


5. Dr.S.H. MVSc,PhO 

Basagoudanavar Sr. Scientist 

6. Dr. B.P. Sreenivasa MVSc,PhD 


7. Dr. K. Ganesh MVSc,PhO 


8. Dr. N . Bhanumathi MSc 


9. Dr. H.J. Dechamma MVSc,PhD 

Sr. Scientist 

10. Dr. P. Saravanan MVSc,PhD 


11. Dr. Madhusudan MVSc,PhD 

Hosamani Scientist (Sr. Scale) 

12. Dr. N. Lalitha MVSc 

Scientist 

13. Dr. S. Chandra Sekar MVSc,PhD 

Scientist 


1. Mr. A.M. Mathur Diploma (Ref.) 

T-9 

(Ref. Engg.) 

2. Shri A. Sadashivam BE, (Instmn.) 

T-9 

3. Dr. Sakey Srinivas Medical Officer 

T (7-8) 

4. Shri B. BE (Electrical) 

Somasundaram T (7-8) 

5. Shri A. Rajendran MSc 

T (7-8) 

6. Shri S. Krisnamurthy BE (Instrurnen.) 

T-6 

7. Shri H .R. Narayana BSc 

T-6 (Lab.) 

I.V.R.I. REGIONAL STATION, KOLKATA 

1. Dr. U.K. MVSc, PhD 

Bandyopadhyay Principal Scientist & 


(up to 28.6.2010) 

2. Dr. S.c. Das 

MVSc,PhD 



(w.e.f. 29.6.2010) 

3. Dr.S.Bandyopadhaya MVScPhD 


4. Dr. S. Naskar MVSc,PhD 


5. Dr. R.N. Roy 

MVSc,PhD 


6. Dr. D. Bhattacharya MVSc,PhD 


7. Dr. P . Dandapat MVSc,PhD 


8. Dr. P.K. Nanda MFSc 

Scientist (SG) 

9. Dr. A.K. Bera MVSc,PhD 


DIVISION OF ANIMAL GENETICS 

1. Dr. Arjava Sharma MSc,PhD 


Head 

2. Dr. Bharat Bhushan MSc,PhD 


3. Dr. Pushpendra MSc,PhO 

Kumar Principal Scientist 

4. Dr. Ran Vir Singh MSc,PhD 


5. Dr. Ahhijit Mitra BVSc&AH 

MSc,PhO 


6. Dr. Subodh Kumar MSc,PhO 


7. Dr. AmitKumar MVSc,PhD 

Scientist 

8. Dr. Sivamani B. MVSc 

Scientist 

9. Dr. Anuj Chauhan MVSc 

Scientist

10. Dr. Arvind Sonwane MVSc 2. Dr. Uma Shanker MVSc, PhD 

Scientist 


CENTRAL DATA CELL 

Actg. Head 

l. Shri c.L. Suman MSc 


In-charge 3. Dr. S.K. Agarwal 

(from 1.7.2010 

to 7.10.2010) 

MVSc, PhD 


LIVESTOCK PRODUCTION & 

Head 

MANAGEMENT SECTION 

(w.e.f. 8.10.20101) 

1. 

2. 

3. 

4. 

5. 

6. 

Dr. Uma Shankar 

Dr. Bharat Bhushan 

Dr. G.K. Gaur 

Dr. A.K. Verma 

Dr. T.A Khan 

Dr. AKS. Tomar 

MVSc, PhD 


Incharge 

MSc,PhD 


MSc, PhD 


MSc(Ag), PhD 


MSc, PhD 


MSc,PhD 

4. 

5. 

6. 

7. 

8. 

9. 

Dr.H. Kumar 

Dr. S.K. Srivastava 

Dr. S. Mahmood 

Dr. S.K. Ghosh 

Dr. G.K. Das 

Dr. J.K Prasad 

MVSc,PhD 


MVSc, PhD 


MVSc, PhD 


MVSc, PhD 


MVSc, PhD 


MVSc,PhD 


7. Dr. Sanjeev Mehrotra 


MVSc, PhD 


1. Dr. RP. Tripathi . MSc(Ag), PhD 


T(7-8) 

8. Dr. Mukesh Singh M. Tech,PhD 

Senior Scientist DIVISION OF ANIMAL NUTRITION 

9. Dr. S.K Singh MVSc, PhD l. Dr. D.N. Kamra MSc,PhD 

Senior Scientist Principal Scientist & 

10. Dr. S.K Mondal MSc (Dairy), PhD Head 

Senior Scientist 2. Dr. R S. Dass MSc,PhD 

11. Dr. Om Singh MSc (Agro.) PhD Principal Scientist 

Senior Scientist 3. Dr. AK. Garg MSc(AH), PhD 

12. Dr. B.H.M. Patel MVSc, PhD Principal Scientist 

Senior Scientist 4. Dr. L.c. Chaudhary MSc(Ag), PhD 

13. Dr. H.o. Pandey MVSc Principal Scientist 

Scientist 5. Dr. Putan Singh MSc(AN), PhD 


1. Shri RP. Verma 

2. Shri Alok Mathur 

3. Shri S.B. Singh 

MSc(Ag) 

T-9 

MSc,PGDCA 

T-7/8 

MSc 

T-7/8 

6. 

7. 

8. 

9. 

Dr. AK Pattanaik 

Dr. N. Dutta 

Dr. V.B. Chaturvedi 

Dr. S.KSaha 


MVSc,PhD 


MSc(Ag), PhD 


MSc(Ag), PhD 


MVSc,PhD 

DIVISION OF ANIMAL REPRODUCTION 


1. Dr. M.e. Yadav MVSc,PhD Technical Staff: 

Principal Scientist & 1. Dr. Neeta Agarwal MSc,PhD 

Head 

(up to 30.6.2010) 

T-9 

IIWillII 

Anlllw/ Report 

2010-11

2. Dr. Avneesh Kumar MSc, PhD 

T-9 

3. Shri RK Mishra BSc(Ag &AH) 

T-6 

4. Shri Ram Singh BSc (Ag), MA 

T-6 

5. Shri Rajendra Singh MSc 

T-6 

DIVISION OF PHYSIOLOGY & 

CLIMATOLOGY 

1. Dr. G. Taru Sharma 

2. Dr. A.e. Majumdar 

3. Dr. Puneet Kumar 

4. Dr. Sadhan Bag 

5. Dr. Gyanendra Singh 

6. Dr. MiNT Sarkar 

7. Dr. B.e. Oas 

8. Dr. R K Mahapatra 

9. Dr. Mohan. N.H. 


1. Shri M.e. Pathak 

MSc,PhO 


Head 

MSc, PhD 


(up to 30.11.2010) 

MSc,PhO 


MVSc,PhO 


MVSc,PhO 


MSc,PhO 


MSc,PhD 


MSc,PhO 


PhD 


MSc 

T (7-8) 

BIOCHEMISTRY SECTION 

1. Dr. Bhaskar Sharma MSc,PhO 

National Professor 

2. Dr. P.Joshi MSc, PhD 


In-charge 

3. Dr. M. Kataria MSc,PhO 


4. Dr. Sanjeev Bhure MVSc,PhO 


5. Dr. Sujata Sahoo MVSc,PhO 

Scientist 

JOINT DIRECTORATE OF EXTENSION 

EDUCATION 

1. Dr. Triveni Outt MSc,PhO 

Joint Director 

2. Dr. B.P. Singh MSc,PhO 


3. Dr. Rupasi Tiwari MSc,PhO 



1. Dr. M.S. Rathore MSc,PhD 

T-9 

2. Dr. Neeraj Srivastava MVSc; T-6 

3. Dr. KK Mishra MVSc; T-6 

4. Shri Atul Sa chan MSc(Ag.); T-6 

DIVISION OF EXTENSION EDUCATION 

1. Dr. Mahesh Chander MSc, PhD 

Senior Scientist & 

In-charge 

2. Dr. HR Meena MSc, PhD 


KRISHI VIGYAN KENDRA (KVK) 

1. Dr. Hema Tripathi MSc,PhD 


In-charge 


1. Mrs. M. Gupta MSc (Ext. Edn.) 

T-9 

2. Dr. S.s. Tomar MSc (Agril.), PhD 

T-9 

3. Dr. V.5. Solanki MVSc, PhD 

T (7-8) 

4. Shri Ranjeet Singh MSc (Hort) 

T (7-8) 

5. Shri KL. Meena MSc (Anim. Sci.) 

T (7-8) 

6. Dr. Ranjana Gupta MSc, PhD; T-6 

7. Shri M. Tomar MSc (Ag.); T-6 

DIVISION OF LIVESTOCK ECONOMICS, 

STATISTICS & INFORMATION 

TECHNOLOGY 

1. Dr. Rajendra Singh 

2. Dr. B. Singh 

3. Dr. Shiv Prasad 

MA (Stat), PhD 


Head (up to 31.12.10) 

M. Stat., PhD 


Head (w.e.f. 1.1.2011) 

MSc,PhD 

Principal Scientist

4. Dr. Med Ram Verma PhD (Statistics) Scientist 

Sr. Scientist 18. Dr. Senthil Kumar D. MVSc 

5. Shri Dinesh Kumar MSc Scientist 

Scientist (Sr. Scale) Technical Staff: 

(On study leave) 1. Shri KK Gupta AMIE, M.Tech 

Technical Staff: T-9 (Sr. Engineer) 

1. Shri Ajay Shukla MSc; T(7-8) 2. Shri RK Kaushik AMlE (Electronics) 

2. Shri am Prakash MA; T(7-8) T-9 (lnstrumn. & 

Control) 

BIOPHYSICS, ELECTRON MICROSCOPY & 3. Mr. T.K. Ghosh MTech, BE(Elect), 

INSTRUMENTATION SECTION MBA, T-9 

l. Dr. Praveen Singh MSc,PhD 4. Shri R.B. Srivastava BE (Civil), 

Senior Scientist & ME (Civil), T (7-8) 

In-charge I.V.R.1. REGIONAL STATION, PALAMPUR 

1. Dr. O.P. Sharma MSc, PhD 

HIGH SECURITY ANIMAL DISEASE LAB Principal Scientist & 

(HSADL), BHOPAL In-charge 

1. Dr. S.C Dubey MVSc, PhD 2. Dr. T.K. Bhat MSc,PhD 

Joint Director Principal Scientist 

2. Dr. D.o. Kulkarni MVSc, PhD 3. Dr. R Bhar MVSc, PhD 

Principal Scientist Principal Scientist 

3. Dr. H.V. Murugkar MVSc,PhO 4. Dr. U.S. Pati MVSc, PhD 


4. Dr. C Tosh MVSc, PhD 


5. Dr. Birbal Singh MSc,PhD 

. Senior Scientist 

5. Dr. N. Mishra MVSc, PhD 6. Dr. V. Umapathi MVSc,PhD 


6. Dr. Sandeep Bhatia M.V.Sc, PhD 7. Dr. A. Kannan MVSc, PhD 



7. Dr. A.A. Raut MVSc,PhD 8. Dr. Rinku Sharma MVSc, PhD 


Scientist 

8. Dr. K RaJukumar MVSc,PhD 

Scientist (Sr. Scale) DIVISION OF LIVESTOCK PRODUCTS 

9. Dr. G.S. Desai MVSc, PhD TECHNOLOGY 

Scientist (Sr. Scale) 1. Dr. B.D. Sharma MVSc, PhD 

10. Dr. Richa Sood MVSc Principal Scientist & 


Head 

11. Dr. S. Nagarajan MVSc 2. Dr. RC Keshri MVSc, PhD 

Scientist (Sr. Scale) Principal Scientist 

12. Dr. C. Venkatesh MVSc,PhD 3. Dr. S.K. Mendiratta MVSc,PhD 

Scientist (Sr. Scale) Senior Scientist 

13. Shri Atul K. Pateriya MSc 4. Dr. Geeta Chauhan MSc,PhD 

Scientist Senior Scientist 

14. Dr (Mrs.) A. Mishra MVSc, PhD 5. Dr. Rajiv R Kumar MVSc 


15. Dr. Manoj Kumar MVSc,PhD 6. Dr. G. Kandeepan MVSc,PhD 


16. Dr. Kalaiyarasu S. MVSc 7. Dr. Suman Talukder MVSc 


17. Dr. Sridevi R MVSc, PhD 

Il'WmlI 

All/llIlll Report 

2010-11

ITWJ1?1I 

All Il lIal Report 

2010-11 

SCIENTISTSI OFFICERS SUPERANNUATED 

l. Dr. M.e. Yadav, Head 30.06.2010 

2. Dr. S.P.S. Ahlawant, Ex. Director 30.06.2010 

3. Dr. Ram Kumar, PS 30.06.2010 

4. Dr. J.K. Malik, Joint Director (Res.) 31.07.2010 

5. Dr. J.R. Rao, Head 31.07.2010 

6. Dr. N.N. Pandey, PS 31.07.2010 

7. Sri Hari Shanker, T-5 31.07.2010 

8. Sri Mohan Lal, T-5 31.07.2010 

9. Sri Lakhan Ram, T-O 31.08.2010 

10. Dr. G.c. Ram, Prin. Sc. 31.08.2010 

11. Sri Nasir Husain, T-5 30.09.2010 

12. Sri Shibban Lal, T-5 30.11.2010 

13. Dr. A.c. Majumdar, PS 30.11.2010 

14. Dr. Hari Shanker Atre, PS 30.11.2010 

15. Sri H.C. Setia, T-9 31.12.2010 

16. Dr. Rajendra Singh, Head 31.12.2010 

17. Sri N.K. Gangwar, T-5 31.01.2011 

18. Sri Ram Nath, T-5 31.01.2011 

19. Sri Noni Ram, T-5 31.01.2011 

20. Sri Mahendra Singh, AAO 31.03.2011 

21. Sanjeet Kumar, Scientist Resigned 

(w.e.f. 

10.12.2009) 

PERSONS PROMOTED 

Scientific Staff 

S.No. Name P08theld 

1. Dr. (Ms.) Alka Tomer Senior Scientist 

2. Dr. U.K. Bandyopadhyay Senior Scientist 

3. Dr. S. Ghosh Senior Scientist 

4. Dr. Oinesh Chandra Senior Scientist 

5. Dr. P.S. Banerjee Senior Scientist 

6. Dr. A.M. Pawde Senior Scientist 

Administrative staff 

S.No. Name Post held 

1. Shri J.D. Suntha Assistant 

2. Shri Amar Nath Assistant 

3. Mrs. B. Dakshyani Assistant 

4. Shri B.N. Pal PA 

5. Shri K.c. Chauhan PA 

6. Shri A.K. Saxena PA 

7. Shri G.S. Danu PA 

8. Shri Sushil Kumar Shukla PA 

SCIENTIFIC I TECHNICAL OFFICERS 

DEPUTED ABROAD 

1. Dr. Pallab Chaudhury Senior Scientist 

2. Dr. M.e. Sharma Director, IVRI 

3. Dr. G. Taru Sharma Head, P&C Division 

4. Dr. S.e. Dubey Joint Director HSADL 

5. Dr. S.K. Maiti Senior Scientist 

6. Dr. (Mrs.) Sohini Dey Scientist (SS) 

7. Dr. S. Ghosh Senior Scientist 

8. Dr. Mohan N.H. Senior Scientist 

9. Dr. Deepak Kumar Scientist 

10. Dr. S.Nagarajan Scientist (SS) 

11. Dr. K.N.Bhilegaonkar Principal Scientist 

12. Dr. Praveen Singh Senior Scientist 

13. Dr. R.P. Singh Senior Scientist 

14. Dr. Mahesh Chander Principal Scientist 

15. Dr. B.C. Oas Senior Scientist 

16. Dr. Ashok Kumar HD, VPH 

17. Dr. P.Dandapat Senior Scientist 

18. Dr. Rishendra Verma JD(CAORAD) 

19. Dr. C. Tosh Senior Scientist 

20. Dr. Deepak Kumar Scientist 

21. Dr. Mihir Sarkar Senior Scientist 

______ PmInoted to the post o_f ___ -J 







Promoted to the post of 

AAO 

AAO 

AAO 

Private Secretary 




Private Secretary

16. INFRASTRUCTURE DEVELOPMENT 

Human Hospital, IVRI 

Human Hospital, IVRI extended medical 

facilities to the staff of IVRI and CARl with focus 

on health and preventive care, treatment, 

awareness and education, which was well 

supported by radiology, pathology, nursing care, 

pharmacy, dressing room assistance, indoor 

facility and emergency care. The hospital is well 

equipped with nebuliser, biochemistry autoanalyzer, 

short-wave diathermy, urine chemistry 

analyzer, electrocardiogram, ambulance, etc. 

The hospital has attended 40,176 cases, 

besides 186 emergency and 277 indoor cases, and 

2049 cases were referred to outside specialized 

hospitals. Vaccination coverage to 1269 subjects 

was extended, which included tetanus (760), 

measles (17), DPT (54), oral polio (58) and antirabies 

(380). A total of 16,617 clinical investigations 

including 321 ECG, 1,246 X-rays, 1,284 diathermy 

and 13,766 clinical pathological investigations 

were done. A total of 7,334 dressing cases 

including 238 plaster cases were attended. The 

hospital organized camps for pulse polio (6 

camps), bone mineral density (705 patients), 

osteoporosis (560 patients), thyrOid check for T3, 

T4 and TSH (163 patients) and pulmonary 

function test camp (360 patients). Medical hospital 

also extended checkup facility in Pashu Mela - 

2010, wherein 1925 people / farmers were 

benefited, besides 200 diabetic cases were tested, 

and 370 blood group and 6360 blood sugar tests 

were done. 

Medical Section, Bangalore 

Comprehensive health care of the employees 

of I.V.R.I. staff, ADMAS staff, NBAII staff, TOT 

staff and retired ICAR staff and their dependent 

family members through primary health care 

approach (Preventive, primitive, curative and 

rehabilitative care) were undertaken. 

Engineering Section, Izatnagar 

This section (Unit - II) provides basic services 

like water supply, air conditioning, carpentry 

work and repair of laboratory equipment. This 

section also undertakes minor civil works. The 

section attended mechanical jobs, mechanical 

JIWmII 

AllIllIal Report 

2010-11 

fabrications, carpentry jobs and masonry repairs 

and plumbing work. This section has also taken up 

civil repairs/ renovation works. The refrigeration 

unit repaired refrigerators and deep freezers, 

water coolers and BOD incubators, some imported 

refrigeration machines, air conditioners serviced 

and minor complaints of refrigerators have been 

attended. The section maintained the AC plant at 

NRL, BP Division LAR and Pathology and looked 

after the cold room and deep freezer room at BP 

Division, LPT Division and chilling plant at Dairy 

Technology Section. Made all the arrangements 

pertaining to this section for the successful 

completion of 'Kisan Mela' and 'Convocation 

Ceremony. Special assignment of preparing 

online examination hall for managing an online 

examination system for NET/ARS-Prelim 

examination for ASRB, rCAR was completed 

successfully. 

Unit-l of the Engin,eering section is responsible 

for providing basic services like electriCity, 

generator supply and EP ABX etc. to whole 

campus including residential buildings. The 

following major works were undertaken and 

services were provided to whole campus through 

out the year: 

Ii> Running maintenance and operation of (2500+ 

1000) KV A, 33/11 KV Sub-station 01 NO, 11/ 

0.433 KV Sub station -07 NO 

Ii> Maintenance of external services, overhead 

lines, street lights and compound light of the 

campus. 

fl) Maintenance of internal electrical installations 

and fans in residential and non-residential 

buildings. 

ell Maintenance of electrical and electronic 

appliances I equipments including P.A system 

of all laboratories and offices. 

fl) Running Maintenance and operation of DIG 

sets (1250 KVA 11 KV-01 No. , 320 KVA 440 

Volt -01 No., 250 KVA 440 Volt -01 No., 180 

KV A-01 No, 125 KV A-02 Nos.) 

@ Running, maintenance and operation of 600 

lines EP ABX of the campus 

fl) Running, maintenance and operation of 

sewage pump behind fish pond (KVK farm).

JIWmI[ 

Annual Report 

2010-11 

ARIS Cell, Izatnagar 

Institute website is being maintained and 

updated regularly. Internet and E-mail facility was 

provided to the scientists and students of the 

campus through 1 Mbps VSAT along with newly 

acquired 1 Gbps leased line connectivity. This year 

the institute has been connected with the National 

Knowledge Network (NKN) with all the 

institutions and universities of higher learning. 

Human recourse management software was 

acquired and will be implemented in the next 

financial year. Personal information related to the 

staff of the whole institute is being updated on 

PERMISNet of ICAR. Video conferencing facility 

in the institute is being maintained. Consultancy 

services were provided to the central store and 

purchase section in purchase related to computer 

and its accessories. Four courses with theory and 

practical in computer was offered to PhD and 

MVSc students. Statistical analysis of the research 

data of scientist and students was carried out. 

Bioinformatics Centre, Izatnagar 

Bioinformatics Centre has all modem 

computer and communication facilities viz., Intel 

Xeon server with RAID capability, latest high 

speed Pentium workstation, 2 Mbps broadband 

connectivity, Wi-Fi system, laser and DMP 

printers, photocopier and fax machine. The 

scientific software packages available with the 

centre are Lasergene (DNA STAR), Genocluster 

(IGffi Jalaja), ClustalW, Rasmol, Gene designer, 

Emboss, Geneious, SEQtools, Oligos, etc. 

G) Online/Off-line information was collected to 

help the scientists/students for references. 

G) Analysis of micro-array data using different 

softwares like CaGEDA, SPSS, MATLAB etc. 

ell Students and Scientists of NRI and other 

organizations were trained in handling 

bioinformatics databases and tools for 

sequence analysis, primer designing, probe 

searching, micro-array analysis and 

phylogenetic analysis, etc. 

• Microarray data of hereditary breast cancer 

were analyzed using CaGEDA and ten genes 

were identified and probable candidates of 

breast cancer BRCAI and BRCA2 mutation. 

@ Twenty seven mRNA UTR sequences were 

analyzed for predicting miRNA target which 

gave 143 possible targets with 81.14% accuracy 

uSingSVM. 

@) Identification and analysis of signals 

responsible for the binding of microRNA at 

target sites in the rice was done. 

@) AnalysiS of HINI viral genome revealed five 

chains (H,K,A,1 and G), which were selected as 

probable candidates for the production of 

vaccine free from existing side effects. 

@) Phylogenetic and mutation rate analysis of 

PPR genome of 10 different countries using 

bioinformatics approaches such as multiple 

sequence alignment and analysis of conserved 

sequences, was done using different 

programmes like Mega5 and MegAlign 

programme. 

Cil A livestock disease database has been 

developed in which data of 35 bacterial, 

parasitic, fungal and viral diseases have been 

entered. 

fl) Two students carried out their research work 

at the centre for partial fulfillment for the 

award of MSc in Bioinformatics during the 

session 2010-11. 

@ Bioinformatic facilities were extended to post 

graduate students (both MVSc and PhD) of 

NRI. Facilities were also extended for 

conducting practical of the course 

'Bioinformatics in Biotechnology' in which 

more than 40 students of Biotechnology and 

other disciplines registered. 

Trainings/Workshop organized 

a. The center has organized a national workshop 

cum training programme on "Bioinformatics 

Tools for Genome Analysis" from March 14- 

16, 2011. The workshop was attended by 26 

participants who were given hands on training 

in the bioinformatics tools used for genome 

analysis, sequence retrieval, sequence editing, 

BLAST, primer designing, sequence alignment 

and phylogenetic analysis. 

b. Two trainees for six months and one trainee 

for one month were trained in bioinformatics 

at the centre. 

c. A total of 151 scientists, students and other 

research workers have been trained to handle 

different bioinformatics tools.

ITWmlI 

AlilllIa! Report 

2010-11 

17. EMPOWERMENT OF WOMEN AND THE MAIN· 

STREAMING THE GENDER ISSUES 

"Gender inequality, which remains pervasive 

worldwide, tends to lower the productivity of 

labour and the efficiency of labour allocation in 

households and the economy, intensifying the 

unequal distribution of resources. It also 

contributes to the non-monetary aspects of 

poverty - lack of security, opportunity and 

empowerment - that lower the quality of life for 

both men and women. While women and girls 

bear the largest and most direct costs of these 

inequalities, the costs cut broadly across society, 

ultimately hindering development and poverty 

reduction," 

(Gender and Development Group - World Bank, 

from the report 'Gender Equality and the 

Millennium Development Goals', 2003) 

Mainstreaming is the process of assessing the 

implications for women and men of any planned 

action, including legislation, policies or 

programmes, in all areas and at all levels. The 

ultimate goal of this strategy is to achieve gender 

equality. Gender equality is not only a basic 

human right, but its achievement has enormous 

socio-economic ramifications. Empowering 

women fuels thriving economies, spurring 

productivity and growth. Yet gender inequalities 

remain deeply entrenched in every society. 

Women lack access to decent work and face 

occupational segregation and gender wage gaps. 

They are too often denied access to basic education 

and health care. Women in all parts of the world 

suffer violence and discrimination. They are 

under-represented in political and economic 

decision-making processes. 'The voice of the 

working woman' a document of U.N.O. 1982 

made a Significant statistical statement. "Women 

make up 50% of the world's population, comprise 

33.3% of the official labor force, perform nearly 

66.6% of all working hours, receive 10% of the 

world's income but own less than 1% of world 

property". This statement alone justifies, serious, 

positive, down to earth policy on empowerment of 

women. For many years, the UN has faced serious 

challenges in its efforts to promote gender equality 

globally, including inadequate funding and no 

single recognized driver to direct UN activities on 

gender equality issues and therefore on 2 July 

2010, the United Nations General Assembly 

created the United Nations Entity for Gender 

Equality and the Empowerment of Women, also 

known as UN Women. In doing so, UN Member 

States took a historic step towards accelerating the 

Organization's goals on gender equality and the 

empowerment of women. 

Role of Women in Agriculture and 

Livestock rearing 

Women have been working along with men in 

all agricultural operations since the first furrow of 

plough was drawn on soil. It is evident from 

historical, anthropological and archaeological 

findings that women folk has been a major force in 

the advancement of human civilization. The 

importance of working women in the Indian 

context has been appreciated since prehistoric ages 

in view of the specific roles attributed to them at 

home and outside. The development of a 

community, society or the nation in any field be it 

social, economic, political or spiritual depends as 

much on women as on men. Agriculture and 

animal husbandry growth is bound to be 

ineffective without skill upgradation and 

participation of women. The contribution of 

women in the field of animal husbandry has been 

substantial. Farm women as farmers have been a 

well accepted proposition these days. Their intensity 

of participation however varies according 

to the nature of the work. The soft, easy and 

feminine character activities like animal husbandry 

operations have been dominated by farm 

women for long. Animal husbandry and 

agriculture are an integral part of a farmer's life 

and it is the women folk who look after these 

activities. 

The women in India, like in many developing 

countries are silent workers. Although, there are a 

growing number of available technologies which 

can enhance women's productivity and income in 

animal husbandry sector, these technolOgies have 

not reached them. A number of research studies 

have been conducted in the past to identify the

IIWmll 

11l11l11l1 Report 

2010-11 

and programmes in livestock production, 

identification and refinement of appropriate 

technologies to address the gender needs and 

facilitation of appropriate institutional mechanism 

and capacity building for up scaling of appropriate 

technologies. Location specific women friendly 

livestock technologies have been identified in the 

field of livestock development in view of their 

roles and responsibilities. Appropriate livestock 

and poultry technolOgies were identified and 

related interventions were made by establishing 

pig, goat and backyard poultry units in the 

selected villages and area specific mineral mixture, 

urea molasses mineral block, crystoscope have 

been distributed among farm women. Specific 

capacity building programs for selected rural 

women were delineated by organizing training 

programs, gosthies and discussions. Interventions 

were also made on dairy farming, post harvest 

technologies on milk and milk products. 

Thus, the institute is continuously striving 

towards women empowerment and is moving 

ahead to create gender equity and equality 

through educational interventions especially in the 

livestock sector.

IVRI AR 139.pdf

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?