2012 Promega catalogue
2012 Promega catalogue
2012 Promega catalogue
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
Life<br />
Science<br />
Catalog<br />
<strong>2012</strong><br />
Worldwide Contact List<br />
Section<br />
Contents<br />
Table of<br />
Contents<br />
Cell Signaling<br />
276<br />
Reporter Vector and Luciferase Sequencing<br />
Primers<br />
Product Size Cat.# Price ($)<br />
RVprimer3 (clockwise) 2 µg E4481 126.00<br />
RVprimer4 (counterclockwise) 2 µg E4491 126.00<br />
GLprimer1 (clockwise) 2 µg E1651 126.00<br />
GLprimer2 (counterclockwise) 2 µg E1661 126.00<br />
For Research Use Only. Not for Use in Diagnostic Procedures.<br />
Description: The Reporter Vector (RV) Sequencing Primers are designed<br />
for use with the pGL3 and pGL4 Luciferase Vectors, Chroma-Luc Vectors<br />
and pCAT ® 3 Reporter Vectors. RVprimer3 binds upstream of the luc+, luc2 or<br />
CAT gene, and sequencing runs clockwise across the multiple cloning region.<br />
RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region<br />
in the Promoter and Basic Vectors and downstream of the SV40 enhancer<br />
region of the Enhancer and Control Vectors. Both primers can be used to<br />
sequence double-stranded templates, but only RVprimer4 can be used to<br />
sequence single-stranded templates.<br />
RVprimer3<br />
The GLprimer1 sequences clockwise across the cloning sites upstream of the<br />
luciferase gene in the pGL2 Vectors. GLprimer2 sequences counterclockwise<br />
across the cloning sites upstream of the luciferase gene in pGL2 or pGL3 Vectors.<br />
Both GLprimers can be used to sequence double-stranded DNA, but only<br />
the GLprimer2 can be used to sequence single-stranded DNA.<br />
Primer Sequences<br />
• GLprimer1: 5´-d(TGTATCTTATGGTACTGTAACTG)-3´<br />
• GLprimer2: 5´-d(CTTTATGTTTTTGGCGTCTTCCA)-3´<br />
• RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´<br />
• RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´<br />
Storage Conditions: Store at –20°C. The primers are supplied dried.<br />
Reporter Vector Sequencing Primer Information.<br />
GLprimer2 RVprimer3 RVprimer4<br />
Sequences from luc ORF into Sequences from upstream of Sequences from downstream of<br />
multiple cloning region. Will multiple cloning region into reporter ORF and poly adenylation<br />
sequence through SV40 promoter multiple cloning region. sequences into SalI, BamHI multiple<br />
if present. cloning region, which is intended<br />
for cloning enhancer elements.<br />
pGL3 Vectors<br />
pCAT ® 3 Vectors<br />
Chroma-Luc (Click Beetle)<br />
Vectors (pCBR, pCBG68, pCBG99)<br />
pGL4 Vectors<br />
5′ . . . CTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCTATCGATA<br />
GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGCGATCTAAGTAAGCTTGG . . .<br />
KpnI<br />
Acc65I<br />
SacI MluI<br />
NheI<br />
XmaI<br />
SmaI<br />
CATTCCGGTACTGTTGGTAAAGCCACCATGGAAGACGCCAAAAACATAAAG . . . (1892bp) . . . GGATCCGTCGAC<br />
NcoI<br />
XhoI<br />
luc+ Coding Region<br />
Start<br />
SV40<br />
Promoter<br />
BglII HindIII<br />
RVprimer4<br />
SV40<br />
Enhancer<br />
GLprimer2 BamHI SalI<br />
CGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTC . . . 3′<br />
pGL3 Vector multiple cloning region. The upstream and downstream cloning sites and the locations of the sequencing primers, RVprimer3, GLprimer2 and<br />
RVprimer4, are shown. The arrows above the primers indicate the direction of sequencing. The positions of the promoter (in pGL3-Promoter and pGL3-Control)<br />
and the enhancer (in pGL3-Enhancer and pGL3-Control) are shown as insertions into the sequence of pGL3-Basic (note that the promoter replaces four bases of<br />
pGL3-Basic). The sequence shown is of the ssDNA produced using the f1 origin.<br />
For complete and up-to-date product information visit: www.promega.com/catalog<br />
9490LA<br />
0756MA08_4A