d(GC) - Association of Biotechnology and Pharmacy

More documents

Recommendations

Info

Current Trends in Biotechnology and Pharmacy Vol. 6 (2) 173-182 April 2012, ISSN 0973-8916 (Print), 2230-7303 (Online) Although, we collected the isolates from two different hosts from each endemic area, we observed not much variation among the isolates Table 2. Sequences of the primers used in the present study S.No. Primer Sequence Annealing No. of Allele size Observed Expected Polymorphism temperature observed range heterozy heterozy Information (T a ) alleles (N a ) (bp) gosity (Ho) gosity(H E ) Content (PIC) Forward Reverse 1 MGM - 1 tttcgtacaatcccgatg gcgacaatgtcttttttttt 58 8 200-400 0.04 0.35 0.50 2 MGM – 2 gatggggagatattccat actcaccctatcaacacttca 57 7 200-300 0.27 0.49 0.35 3 MGM -3 gtgacattagaggaaataaggt aatcccaaaactcaaaacc 56 7 200-500 0.18 0.48 0.40 4 MGM - 4 tctagaactcaaaactcaaa atcaccattcctgctg 55 7 200-400 0.17 0.43 0.55 178 collected from all the endemic areas of the present study, which indicated the particular race may be more prevalent and virulent in that area. 5 MGM - 5 tctccctatatttctccc aaatgatatgtttgctgc 57 7 200-400 0.32 0.47 0.35 6 MGM - 6 aggcaggaagacatatgc acagctcattaccatgcc 56 6 100-600 0.18 0.92 0.50 Madhan Mohan et al 7 MGM - 9 gactcaaggtggagatgg gcctccactatctctcgt 58 8 100-800 0.18 0.97 0.25 8 MGM - 10 acagccgacaggtcaaga gccagaccttcaaggaca 57 7 100-800 0.16 0.96 0.46 9 MGM - 21 gcaggtgagcaaacagcaaga atatctcgtgcaggccggt 57 7 100-800 0.11 0.97 0.60 10 MGM - 24 gtcttgagtccaccctctttg ccgtcccttgttttcatcc 55 6 100-600 0.43 0.80 0.24 11 Pot2 cggaagccctaaagctgttt ccctcattcgtcacacgttc 55 17 1400 0.20 0.94 0.26
Current Trends in Biotechnology and Pharmacy Vol. 6 (2) 173-182 April 2012, ISSN 0973-8916 (Print), 2230-7303 (Online) Genetic frequency for heterozygsity in the population was analyzed using Hardy-Weinberg equilibrium it was revealed that few heterozygote’s was observed indicating inbreeding pattern in the population this may be due to the most of the isolates collected from same region while MGM - 2, MGM - 5 and MGM – 24 primers showed significant observed heterozygosity (Table 2) indicating that MGM primers are the right choice to analyze the Magnaporthe grisea genetic diversity compared to other conventional primers, Similarly using Hardy–Weinberg equilibrium Li et al., (29) was observed no deviations between any pair of loci, suggesting that null alleles at all the loci are rare in M. grisea. However, we observed great extent of variation among the isolates collected from different endemic areas. For instance, the isolates collected from Mareturu (SP 25 and SP 26), Assam (SP 3 and SP 4), Almora (SP 1 and SP 2) and Nellore grouped in the same cluster but they share only 35 % similarity. Another 9 isolates two each from Ranchi (SP 33 and SP 34), Jagityal (SP 20 and SP 21), Karjat (SP 22 and SP 23) and 3 isolates from DRR (SP 12, SP 10 and SP 19) also grouped in the first major cluster they were out grouped with two sub clusters by showing 75 % dissimilarity to the isolates in the first major cluster. We also observed some exceptions like isolates collected from coastal Andhra Pradesh (Mareturu and Nellore) shares the high similarity of 64 % with Assam isolates (SP 3 and SP 4). High similarities between isolates collected from various endemic areas of India like Uttaranchal, Himachal Pradesh those of Madhya Pradesh and Karnataka was reported earlier by Chadha et al., (30) with RAPD markers contributing to the possibility of seedborne transmission of the pathogen. Therefore it is expected that, the migration of the pathogen to a newer location operates. Due to extensive gene flow among the isolates genetic variability may arise that was evident from the presence of high variation among the isolates collected from different endemic areas. Kumar et al., (23) also 179 concluded the migration of the pathogen that results in to the wide distribution of lineages in the Indo-Gangetic Plains of India. Nguyen et al., (31) also observed the significant gene flow between P. oryzae isolates of indica populations collected from North Vietnam. The clustering analysis revealed the grouping of the isolates collected over differentials with the isolates collected from the susceptible cultivars of blast endemic areas. Based on these clustering and similarity values, a prediction of AVR/avr genes was done. The isolate (SP 14) which was virulent on differential variety i.e., Kanto51 (which has Pi-k gene) shares 43 % similarity with the isolates (SP 29 and SP 30) collected from Nellore. Hence, we presumed that in Nellore region the fungal population may have avr Pi-k gene, hence deployment of varieties having Pi-k gene may not offer resistance to this prevalent race in that region. Interestingly, many present day ruling varieties (NLR 145) in this region have developed using Tetep (which has Pi-Kh ) as a resistance source (32, 33). It is also predicted that there will be many alleles exist in avr Pi-k cluster in Magnaporthe grisea as like Pik cluster in rice It has also been reported that the Pi-k locus is actually a cluster of genes including Pik-p, Pik-m, Pik-s and Pik-h present on rice chromosome 11 (34). Similarly, the isolate (SP 24) collected from endemic area of South India (Mandya- Karnataka) showed 70 % similarity with the isolate (SP 17) which is collected on IR50 variety as well as 40 % with the isolate (SP 9) which is collected on BL-245 variety which is known to contain a combination of Pi-2 and Pi-4 genes. Hence the fungal population of Mandya region might be having both or either of avr Pi-2 and avr Pi-4 genes. Assam fungal population might be having avr Pi-ks gene since these isolates collected from these regions showed 64 % of similarity to the isolate collected from a differential variety (Calaro) which contains Pi-ks gene. On the other hand, tightly linked blast resistance genes at the Pik locus were presumed to have evolved from Analysis of Population Structure of Magnaporthe grisea
Page 3 and 4:
Current Trends in Biotechnology and
Page 5 and 6:
Page 7 and 8:
Page 9 and 10:
Page 11 and 12:
Page 13 and 14:
Page 15 and 16: Current Trends in Biotechnology and
Page 65: Current Trends in Biotechnology and
Page 117 and 118:
Page 119 and 120:
Page 121 and 122:
Page 123 and 124:
Page 125 and 126:
Page 127 and 128:
Page 129 and 130:
Page 131 and 132:
Page 133 and 134:
Page 135 and 136:
Page 137 and 138:
Page 139 and 140:
Page 141 and 142:
Page 143 and 144:
Page 145 and 146:
Page 147 and 148:
6th Annual Convention of Associatio
show all

d(GC) - Association of Biotechnology and Pharmacy

Create successful ePaper yourself

Delete template?

Save as template?