d(GC) - Association of Biotechnology and Pharmacy
d(GC) - Association of Biotechnology and Pharmacy
d(GC) - Association of Biotechnology and Pharmacy
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
Current Trends in <strong>Biotechnology</strong> <strong>and</strong> <strong>Pharmacy</strong><br />
Vol. 6 (2) 173-182 April 2012, ISSN 0973-8916 (Print), 2230-7303 (Online)<br />
Although, we collected the isolates from two<br />
different hosts from each endemic area, we<br />
observed not much variation among the isolates<br />
Table 2. Sequences <strong>of</strong> the primers used in the present study<br />
S.No. Primer Sequence Annealing No. <strong>of</strong> Allele size Observed Expected Polymorphism<br />
temperature observed range heterozy heterozy Information<br />
(T a ) alleles (N a ) (bp) gosity (Ho) gosity(H E ) Content (PIC)<br />
Forward Reverse<br />
1 MGM - 1 tttcgtacaatcccgatg gcgacaatgtcttttttttt 58 8 200-400 0.04 0.35 0.50<br />
2 MGM – 2 gatggggagatattccat actcaccctatcaacacttca 57 7 200-300 0.27 0.49 0.35<br />
3 MGM -3 gtgacattagaggaaataaggt aatcccaaaactcaaaacc 56 7 200-500 0.18 0.48 0.40<br />
4 MGM - 4 tctagaactcaaaactcaaa atcaccattcctgctg 55 7 200-400 0.17 0.43 0.55<br />
178<br />
collected from all the endemic areas <strong>of</strong> the<br />
present study, which indicated the particular race<br />
may be more prevalent <strong>and</strong> virulent in that area.<br />
5 MGM - 5 tctccctatatttctccc aaatgatatgtttgctgc 57 7 200-400 0.32 0.47 0.35<br />
6 MGM - 6 aggcaggaagacatatgc acagctcattaccatgcc 56 6 100-600 0.18 0.92 0.50<br />
Madhan Mohan et al<br />
7 MGM - 9 gactcaaggtggagatgg gcctccactatctctcgt 58 8 100-800 0.18 0.97 0.25<br />
8 MGM - 10 acagccgacaggtcaaga gccagaccttcaaggaca 57 7 100-800 0.16 0.96 0.46<br />
9 MGM - 21 gcaggtgagcaaacagcaaga atatctcgtgcaggccggt 57 7 100-800 0.11 0.97 0.60<br />
10 MGM - 24 gtcttgagtccaccctctttg ccgtcccttgttttcatcc 55 6 100-600 0.43 0.80 0.24<br />
11 Pot2 cggaagccctaaagctgttt ccctcattcgtcacacgttc 55 17 1400 0.20 0.94 0.26