2013-4

Review

DOI: 10.4274/Tjh.2013.0054

Strategies in Haploidentical Stem Cell

Transplantation in Adults

Erişkinlerde Haploidentik Kök Hücre Naklinde Stratejiler

Ulaş D. Bayraktar1,2, Stefan O. Ciurea1

1Department of Stem Cell Transplantation and Cellular Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA

2Mercy Cancer Center, Medical Oncology, Hematology, Ardmore, OK, USA

Abstract:

Haploidentical related donors are alternative stem cell sources for patients without human leukocyte antigen (HLA)-matched

related or unrelated donors. Immediate access to the donor, availability for patients with rare haplotypes, ease of stem cell

procurement, and lack of a requirement for a physical cord blood bank or an extensive HLA database render this type of

hematopoietic stem cell transplantation particularly attractive despite the high histoincompatibility barrier between the

recipient and the haploidentical graft. In this review, we answer the following questions: 1) What are the current transplant

strategies used to overcome the histoincompatibility barrier in haploidentical stem cell transplantation and their clinical results?

2) How should we choose the donor when there is more than one available haploidentical donor? 3) How does transplantation

from haploidentical donors compare to that from umbilical cord blood?

Key Words: Haploidentical stem cell transplantation, HLA, GVHD

Özet:

Tam “human leukocyte antigen” (HLA) uyumlu bağışçı bulunamayan hastalar için bir diğer seçenek yarı-eşlenik akraba

bağışçılardan alınacak kök hücrelerdir. Bağışçı ve hasta arasında aşılması gereken yüksek HLA uyumsuzluğuna ragmen, yarıeşlenik

akraba bağışçılarından kan kök hücre nakli (yarı-eşlenik kan kök hücre nakli [YKHN]); bağışçıya anında ulaşılabilirlik,

ender gorülen haplotipler icin uygulanabilirlik, kök hücrelerin elde edilmesindeki kolaylık ve kord kanı bankası/doku

bankasından bağımsızlığı dolayısıyla cazip bir yontemdir. Bu derlemede şu soruları cevaplandıracağız: 1) YKHN’de HLA

uyumsuzluk bariyerini aşmak için kullanılan stratejiler ve sonuçları nelerdir? 2) Birden fazla yarı-eşlenik akraba bağışçısının

olması durumunda bağışçı nasıl seçilmelidir? 3) YKHN’in korddan kök hücre nakline göre avantaj ve dezavantajları nelerdir?

Anahtar Sözcükler: Haploidentik kök hücre nakli, HLA, Graft Versus Host Hastalığı (GVHH)

Address for Correspondence: Ulaş D. BAYRAKTAR, M.D.,

Department of Stem Cell Transplantation and Cellular Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA

Phone: +1 (580) 223-7091

E-mail: darda.bayraktar@gmail.com

Received/Geliş tarihi : February 13, 2013

Accepted/Kabul tarihi : July 25, 2013

342

Bayraktar DU, et al: Haploidentical Transplantation

Turk J Hematol 2013;30:342-350

Introduction

Two-thirds of patients who require allogeneic

hematopoietic stem cell transplantation (SCT) do not have

a human leukocyte antigen (HLA)-matched related donor

available [1]. A matched unrelated donor can be identified in

only 50% to 60% of these cases. The chance of finding such

a donor is particularly poor for patients whose ethnicity is

under-represented in HLA databases. Haploidentical donors

– parents, children, and half of siblings – are alternative stem

cell sources for such patients without matched donors. The

first successful SCT from a haploidentical donor (haploSCT)

was reported in 1981 in a 10-month-old infant using an ex

vivo T cell-depleted bone marrow graft from her father [2].

After 30 years of experience, transplanters are now better

at overcoming the histoincompatibility barrier between the

recipient and the haploidentical donor.

What are the current transplant strategies used to

overcome the histoincompatibility barrier in haploSCT

and their clinical results?

For successful haploSCT, both the patient’s and the

graft’s immunity should be suppressed or modified to

prevent graft failure and graft-versus-host disease (GVHD).

Various strategies have been devised to achieve the required

suppression without substantially increasing treatmentrelated

mortality (TRM) arising from immunosuppression.

These strategies may be studied in 2 groups: those utilizing

ex vivo T cell-depleted grafts and those utilizing T cellreplete

grafts.

With currently available magnetic selection methods, 3

to 5 logs of ex vivo T cell depletion (TCD) of the stem cell

graft is possible [3], and this is the most effective method

to prevent GVHD after SCT. Unfortunately, extensive TCD

of the graft impairs engraftment and increases primary graft

failure rates as more host immune cells survive post-SCT.

In initial trials, T cell-depleted grafts from haploidentical

donors were rejected in up to 50% of cases [4]. The risk

of graft rejection may be reduced by intensification of the

conditioning regimen [5,6], in vivo host TCD with antibodies

[7], and increasing of the bone marrow (BM) inoculum

(number of CD34+ cells infused) [8]. The most notable

haploSCT protocol to date was devised at the University

of Perugia in the 1990s, in which a “mega-dose” of CD34+

cells (while a threshold for the dose has not been defined,

the reported minimum is 5.1x10 6 CD34+ cells/kg) derived

from BM and peripheral blood after TCD was used with

ablative conditioning and anti-thymocyte globulin [3,9].

While GVHD incidence was minimal and the graft rejection

rate was acceptable, TRM due to infections remained an

issue, which is the current focus of transplanters utilizing

TCD grafts. Although ex vivo TCD in haploSCT is most

commonly achieved by positive selection of CD34+ cells,

negative selection of lymphocyte subsets through CD3/

CD19 or TCRαβ retains other donor immune cells, i.e.

natural killer (NK) cells, that may decrease the incidence

of GVHD and exert a graft-versus-leukemia effect [10]. The

strategies used in TCD haploSCT are summarized in Table 1

with their respective clinical results.

Without TCD of the graft, a higher-intensity GVHD

prophylaxis regimen or selective inhibition of graft T cells

becomes necessary to prevent GVHD after haploSCT. While

Chinese researchers chose to intensify immunosuppression

and prime the BM graft with granulocyte colony-stimulating

factor (G-CSF) [11], researchers from Johns Hopkins led the

way by selectively inhibiting graft immunity against donor

cells using post-SCT cyclophosphamide [12,13]. One of

the more established methods to be utilized in haploSCT,

which was studied and reported in a recent Blood and

Marrow Transplant Clinical Trials Network (BMT CTN)

trial [14], post-SCT cyclophosphamide has little impact on

stem cells and engraftment while primarily targeting donor

lymphocytes activated by recipient antigens immediately

after graft infusion. The rationale and clinical results of

haploSCT strategies not utilizing TCD of the graft are

summarized in Table 1.

Overall, while TCD results in lower GVHD incidence

with acceptable engraftment rates when a “mega-dose” of

CD34+ cells is used, a relatively high TRM rate primarily

due to infections remains an issue. Furthermore, TCD

requires an initial investment in facilities employing good

manufacturing practice with cell selection instruments, i.e.

CliniMACS, and expertise to run such facilities. The initial

investment cost may be difficult to attain in developing

and under-developed countries where haploSCT would

be particularly valuable since residents of such countries

are generally under-represented in international HLA

databases. While haploSCT with T cell-replete grafts may

lead to higher GVHD incidence, it allows the intensity of

conditioning regimens to be reduced through host immunity

suppression utilizing engraftment. However, the reduced

intensity conditioning regimen used in most studies of post-

SCT cyclophosphamide may lead to high relapse incidence

in acute leukemic patients. At the MD Anderson Cancer

Center, we compared the outcomes of haploSCT with TCD

peripheral blood grafts to that with unmanipulated BM grafts

after an identical ablative conditioning regimen (fludarabinemelphalan-thiotepa)

[15]. Early results revealed significantly

higher rates of overall and progression-free survival with

unmanipulated BM grafts, primarily because of significantly

lower TRM (16% vs. 42% at 1 year).

How should we choose the donor when there is more

than one available haploidentical donor?

Most patients requiring SCT have more than one

haploidentical donor. The presence of recipient antibodies

against donor-specific HLA, killer immunoglobulin-like

receptor (KIR) mismatch predicting NK cell alloreactivity,

mismatch for non-inherited maternal vs. paternal alleles,

degree of HLA mismatch between donor and recipient,

343



Table 1. Studies utilizing different strategies to overcome histoincompatibility barrier in hematopoietic stem cell transplantation from haploidentical

donors.

Reference Conditioning and GVHD prophylaxis Rationale Patient characteristics Engraftment and

GVHD

Survival

T cell-depleted grafts

Aversa F, 2005 (3) TBI 8 Gy day -8; Thio 5 mg/kg/day days -8,

-7; rATG 5 mg/kg days -5 to -2

No post-SCT GVHD prophylaxis

Graft: Mega-dose of CD34-selected PBSC

Ablative conditioning for better disease control and to

prevent graft rejection

Rigorous T cell depletion to prevent GVHD

ATG to prevent graft rejection and GVHD

Mega-doses of progenitor cells to improve engraftment

n=104

Median age: 33 (9-64)

67 AML (19 in CR1)

37 ALL (14 in CR1)

94 pts (91%) engrafted

Grade II-IV aGVHD in 8

pts (8%)

cGVHD in 5 pts (7%)

TRM: 37% for pts in remission; 44% in

pts with active disease

27 pts (26%) died of infections

RI: 16% for pts in remission; 51% in pts

with active disease

EFS @ 3 yrs: 48% for pts in remission;

4% for pts with active disease

Amrolia PJ, 2006 (39) Ablative: Cy 90 mg/kg, araC 12 g/m 2 , TBI

1400 cGy, Almtz 12-40 mg

RIC: TBI 450 cGy, Flu 120 mg/m 2 , Almtz

40 mg

Graft: Mega-dose CD34-selected PBSC

Allodepleted (through co-culture of donor

T cells with recipient APCs followed by

addition of immunotoxin against CD25 to

eliminate activated T cells) infused on days

30, 60, 90

Rigorous T cell depletion to prevent GVHD

Alemtuzumab to prevent graft rejection

Post-SCT infusion of T cells to hasten immune

reconstitution – allodepleted to prevent GVHD

n=16


7 AML (1 in CR1)

2 ALL

1 HL

1 CML

1 MDS

3 BMF

All engrafted


pts (both after donor T

cell infusion)

cGVHD in 2 pts

5 pts alive @ median follow-up of 33

mos

Federmann B, 2012

(26)

Flu 150 mg/m 2 ; Thio 10 mg/m 2 ; Mel 120

mg/m 2

OKT-3 5 mg/day days -5 to 14

Post-SCT MMF only if graft included

>5x10 4 CD3+ cells/kg

Graft: CD3/CD19 depleted PBSC

RIC to decrease GVHD and TRM

T cell depletion to prevent GVHD

CD3/CD19 depletion used instead of CD34-selection to

retain NK cells in graft

OKT3 to prevent graft rejection – OKT3 preferred over

ATG to spare NK cells

n=61

38 AML

8 ALL

6 NHL

4 MM

3 CML

1 MDS

1 CLL

3 primary graft failures

Grade II-IV GVHD CI

46%

cGVHD CI 18%

NRM @ 2 yrs: 42%


RI @ 2 yrs: 31%

EFS @ 2 yrs: 25%

OS @ 2 yrs: 28%

Di Ianni M, 2011 (40) TBI 8 Gy day -10; Thio 4 mg/kg days -10,

-9; Flu 40 mg/m 2 /day days -10 to -6; Cy 35

mg/kg days -7, -6

Freshly isolated (by CD8 and CD19

depletion followed by CD25-selection)

donor Tregs infused on day -4

Graft: Mega-dose of CD34-selected PBSC

Varying doses of Tcons infused after graft

infusion on day 0

T cell depletion to prevent GVHD

To hasten immune reconstitution post-SCT a fixed dose

of Tcons infused with graft, which was preceded by Treg

infusion to avoid GVHD

Ablative conditioning to prevent graft rejection and for

better disease control

ATG was omitted to preserve infused Tregs and Tcons

n=28

High-risk heme

malignancies

26 pts (93%) engrafted

Grade II-IV aGVHD

in 2 pts

No cGVHD

TRM 13 pts (50%)

8 pts (31%) died of infection

1 pt relapsed

OS @ 1 yr: 46%

Grosso D, 2011(41) TBI 1.5 Gy BID days -9 to -6

2x10 8 CD3+ cells/kg DLI day -6

Cy 60 mg/kg days -3 and -2

MMF and Tacrol after day -1

Graft: CD34-selected PB

2-step transplantation to optimize donor T cell dose by:

a) Infusing a fixed dose of donor T cells (DLI) followed

by Cy to preferentially eliminate activated lymphocytes

b) Infusing T cell-depleted PB graft after DLI to protect

graft from Cy

Ablative conditioning for better disease control and to

prevent graft rejection

n=27


17 AML (5 in CR1)

4 ALL

2 MDS

3 NHL (refractory)

1 AA

No primary graft failures

Grade II-IV aGVHD in

16 pts (60%)

RI: 30%

OS @ 3 yrs: 48%

344



T cell-replete grafts

Luznik L,

2008 (13)

Cy 14.5 mg/kg/day IV days -6, -5; Flu 30 mg/m 2 days

-6 to -2; TBI 200 cGy day -1

Cy 50 mg/kg IV day 3 or days 3, 4; Tacrol from day 5

to 180; MMF day 5 to 35

Graft: RBC-depleted BM

RIC to decrease GVHD incidence

Post-SCT Cy to prevent GVHD by selectively

eliminating donor alloreactive T cells that are

acutely activated after graft infusion by host

antigens

n=68


27 AML (12 in CR1)

4 ALL (2 in CR1)

1 MDS

6 CML/CMML

3 CLL

13 HL (refractory)

10 NHL (refractory)

3 MM (refractory)

1 PNH

Graft rejection in 9 pts

(13%)

Grade II-IV aGVHD 34%

cGVHD CI 5% (2 doses of

post-SCT Cy) and 25% (1

dose of post-SCT Cy)

NRM @ 1 yr: 15%

EFS @ 2 yrs: 26%

OS @ 2 yrs 36%

EFS longer in lymphoid vs. myeloid

malignancies (p=0.02)

Lee KH, 2011

(42)

Bu 3.2 mg/kg/day IV days -7, -6; Flu 30 mg/m 2 days

-7 to -2

rATG 3 mg/kg days -4 to -1; CsA 1.5 mg/kg from

day -1; Mtx 15 mg/m 2 on day 1 then 10 mg/m 2 days

3, 6, 11

Graft: Unmanipulated PB



n=83


52 AML (12 in CR1)

16 ALL (3 in CR1)

15 MDS

No primary graft failures but

early PD in 4 pts


pts (20%)

cGVHD CI 34%

TRM CI 18%

RI: 27%-32% in pts with acute leukemia

in CR; 79% in pts with refractory

leukemia

OS: 41%-60% in pts with leukemia in

CR; 9% in pts with refractory leukemia

Davies JK,

2008 (43)

TBI 175 cGy BID days -6 to -3; Cy 1.8 g/m 2 days -2, -1

Short-course Mtx, CsA

Graft: ex vivo alloanergy induction with incubation of

donor BM graft with recipient APCs and CTLA4-Ig

Induction of allospecific anergy through

blockage of CD80/86 on recipient APC. T cells

require 2 signals for activation: MHC binding

to TCR and co-stimulatory signal through

CD28. Latter binds to CD80/86 on APCs

n=24

Age range: 0.5-50

21 high-risk heme malignancy (none in

CR1, 14 with PD)

3 with bone marrow failure

2 (8%) graft failure

Grade B-D aGVHD in 8 pts

(38%)

cGVHD CI 8%

TRM incidence 50%

EFS and OS: 33% @ 10 yrs

Raiola AM,

2013 (44)

(A) Thio 5 mg/kg days -6 and -5; Flu 50 mg/m 2 days

-4 to -2; Bu 3.2 mg/kg IV daily days -4 to -2

(B) TBI 3.3 Gy days -8 to -6; Flu 30 mg/m 2 days -5

to -2

Cy 50 mg/kg on days 3 and 5; CsA 1 mg/kg/day days

0 to 20; MMF 15 mg/kg q12h days 1 to 28

Graft: Unmanipulated BM




antigens

Ablative conditioning to prevent graft rejection

and for better disease control

n=50


25 AML (9 in CR1)

12 ALL (2 in CR1)

5 lymphoma (chemorefractory)

4 MF (leukemic transformation)

4 MPD (blast crisis)

2 (4%) graft failures

Grade II-IV aGVHD in 6 pts

(12%)

cGVHD CI 26%

6-month TRM: 18%

RI: 22% (33% in pts with active disease

at SCT)

18-month DFS: 51%

18-month OS: 62%

Brunstein CG,

2011 (14)

BMT CTN

0603

Flu 30 mg/m 2 days -6 to -2; Cy 14.5 mg/kg days -6,

-5; TBI 200 cGy day -1

Cy 50 mg/kg days 3, 4; Tacrol day 5 until 180; MMF

day 5 until 35





antigens

n=50


22 AML

9 ALL

12 NHL

7 HL

1 pt had primary graft

failure

Grade II-IV aGVHD CI 32%

cGVHD CI 13%

NRM @ 1 yr: 7%

RI @ 1 yr: 45%

PFS @ 1 yr: 48%

OS @ 1 yr: 62%

Huang XJ,

2009 (11)

araC 4 g/m 2 days -10, -9; Bu 12 mg/kg PO q6h days

-8 to -6; Cy 1.8 g/m 2 days -5, -4; semustine 250 mg/

m 2 day -3

rATG 2.5 mg/kg days -5 to -2; CsA day -9 onward;

MMF 500 mg day -9 to 60; Mtx 15 mg/m 2 on day 1

then 15 mg/m 2 on days 3, 6, 11

Graft: G-CSF–primed unmanipulated BM and PB

Combination of G-CSF–primed BM and PB

grafts may lead to faster engraftment without

increased GVHD


Intensive GVHD prophylaxis

Ablative conditioning to prevent graft rejection

and for better leukemia control

n=250


108 AML (67 in CR1)

142 ALL (82 in CR1)

249 (99%) engrafted


pts (46%)

Limited cGVHD in 61

(28%), extensive cGVHD in

31 (14%) pts

3-year TRM: 29% and 51% in high-risk

AML and ALL

3-year RI: 20% and 49% in high-risk

AML and ALL

3-year LFS: 55% and 25% in high-risk

AML and ALL

Di Bartolomeo

P, 2013 (45)

Various TBI- or non-TBI–based regimens: 64 ablative,

16 RIC

ATG 5 mg/kg days -4 to -1; CsA day -7 to day 180;

Mtx 15 mg/m 2 day 1 then 10 mg/m 2 days 3, 6, 11;

MMF day 7 to 100; basiliximab 10-20 mg days 0

and 4

Graft: G-CSF–primed unmanipulated BM

Intensive GVHD prophylaxis

G-CSF–primed BM graft to hasten engraftment

without increasing GVHD

PBSC were omitted to decrease GVHD

incidence

n=80


45 AML (21 in CR1)

15 ALL (8 in CR1)

5 HL

5 CML

3 MDS

2 NHL

2 MF

3 MM

1 pt had primary graft

failure

Grade II-IV aGVHD CI 24%

cGVHD CI 17%

TRM CI @ 1 yr: 36%


RI @ 3 yrs: 26%-28%

OS @ 3 yrs: 45%

DFS @ 3 yrs: 38%

GVHD: Graft-versus-host disease, TBI: total body irradiation, Thio: thiotepa, rATG: rabbit anti-thymocyte globulin, SCT: hematopoietic stem cell transplantation, PBSC: peripheral blood stem cells, AML: acute myeloid leukemia, ALL: acute lymphoid leukemia, CR: complete

remission, CR1: first CR, aGVHD: acute GVHD, cGVHD: chronic GVHD, TRM: transplant-related mortality, RI: relapse incidence, EFS: event-free survival, Cy: cyclophosphamide, araC: cytarabine, Almtz: alemtuzumab, RIC: reduced-intensity conditioning, Flu: fludarabine, APC:

antigen-presenting cell, HL: Hodgkin lymphoma, CML: chronic myeloid leukemia, MDS: myelodysplastic syndrome, BMF: bone marrow failure syndromes, yr: year, mo: month, pt: patient, MMF: mycophenolate mofetil, NK: natural killer, NHL: non-Hodgkin lymphoma, CLL:

chronic lymphocytic leukemia, MM: multiple myeloma, CI: cumulative incidence, NRM: non-relapse mortality, OS: overall survival, Treg: regulatory T lymphocytes, Tcon: conventional T lymphocytes, DLI: donor lymphocyte infusion, Tacrol: tacrolimus, PB: peripheral blood,

BM: bone marrow, AA: aplastic anemia, RBC: red blood cell, CMML: chronic myelomonocytic leukemia, PNH: paroxysmal nocturnal hemoglobinuria, PFS: progression-free survival, LFS: leukemia-free survival, Bu: busulfan, Mtx: methotrexate, CsA: cyclosporin A, PD: progressive

disease, MHC: major histocompatibility complex, TCR: T cell receptor, MF: primary myelofibrosis, MPD: myeloproliferative disorder.

345



Table 2. Comparison of hematopoietic stem cell transplantation from umbilical cord and haploidentical donors.

Advantages

Issues

Haploidentical donor

- Short search and graft acquisition time

- Availability for patients with rare haplotypes

- Easy rescheduling of infusion

- Does not require an umbilical cord bank or

HLA database

- Relatively high graft failure rates

- Delayed immune reconstitution

- Lack of T cell-mediated graft-versus-leukemia

effect if ex vivo T cell-depleted grafts are used

- Ease of post-transplant cell acquisition for

therapy, i.e. donor NK cell or lymphocyte infusion

Umbilical cord

- Short search and graft acquisition time

- Availability for patients with rare haplotypes

- Easy rescheduling of infusion

- No potential for viral transmission

- Relatively high graft failure rates

- Delayed immune reconstitution

- Delayed engraftment

- Potential for congenital disease transmission

- Inability to use post-transplant cellular therapy, i.e.

donor lymphocyte infusion

vdonor age, and ABO-match should be taken into account

while deciding on the donor among available haploidentical

candidates.

Transplant recipients may have developed anti-HLA

antibodies against donor HLA antigens (donor-specific

antibodies; DSAs) during pregnancy or after blood

product transfusions. The presence of DSAs is associated

with increased risk of primary graft failure after SCT

[16,17,18,19]. Additionally, the level of DSAs in recipient

serum is likely important. If a patient has DSAs against all

haploidentical donors, selecting donors with the lowest

antibody level may be appropriate. Treatment of recipients

with plasma exchange or rituximab may also be reasonable

and has been used in solid organ transplantations.

NK cells primarily attack hematopoietic cells, sparing

solid organs [20]. In recipients lacking HLA class I alleles

specific to the donor KIRs, donor NK cells may prevent GVHD

and disease relapse by eliminating residual recipient antigenpresenting

cells and leukemia cells [21,22]. Accordingly, KIR

mismatch between recipient and donor has been associated

with improved haploSCT outcomes [21,22,23]; however,

this finding has been disputed by other researchers [24,25].

KIR mismatch may play a more pronounced role in SCT for

myeloid malignancies [22,26]. Further studies are needed to

verify the impact of NK alloreactivity and KIR mismatch on

haploSCT outcomes.

Although a progressive increase in TRM with increasing

genetic disparity has been historically reported, contemporary

transplant strategies may negate this correlation by

overcoming larger histoincompatibility barriers. In fact,

Kasamon et al. reported no increased incidence of acute

GVHD (aGVHD) and non-relapse mortality (NRM)

after haploSCT from full-haplotype mismatched donors

compared to those with better-matched donors [27].

Moreover, patients with more than 3 mismatches appeared

to have better outcomes due to a lower relapse incidence.

346

Immunologic tolerance may develop between mother and

fetus during pregnancy [28,29], leading to down-regulated

immune responses if the mismatched haplotype between the

recipient and the haploidentical donor is of maternal origin.

Accordingly, patients with maternal donors were found to

survive longer than those with paternal donors [30], and

TRM was reported to be lower in patients with recipients

mismatched for non-inherited maternal HLA compared to

those with recipients mismatched for paternal antigens [31].

The immune system is subject to senescence with

advancing age. Although no data exist on an association

between donor age and outcomes after haploSCT, the

findings of higher GVHD incidence and shorter survival after

unrelated donor transplants from older donors compared to

younger donors would probably apply for haploSCT, as well.

Older multiparous women may be the least preferred donors

for male recipients [32].

Studies have demonstrated that infusion of larger numbers

of CD34+ cells improved outcomes after SCT [33,34,35].

Stem cell dose is also likely important in haploSCT, as

can be inferred from the improved outcomes with megadoses

of peripheral blood stem cells in TCD haploSCT [9].

Transplants involving a major ABO incompatibility require

mononuclear cell separation to prevent a hemolytic reaction,

which reduces the graft cell dose. If maximizing the infused

stem cell dose is indeed important in haploSCT, then

younger, larger donors without a major ABO incompatibility

with the recipient should be preferred.

An in-depth review of donor selection in haploSCT is

available from Ciurea and Champlin [32] and the proposed

algorithm is shown in Figure 1.

How do transplants from haploidentical donors

compare to those from umbilical cords?

For patients lacking an HLA-matched related or unrelated

donor, umbilical cord blood (UCB) is another alternative

stem cell source. UCB is more immune-plastic than



was similar in both arms at 46% and 48%. Similarly, a

retrospective analysis of the European Group for Blood and

Marrow Transplantation (EBMT) database demonstrated

significantly lower acute GVHD rates after haploSCT

compared to UCB SCT between 1998 and 2002 [38]. A

randomized BMT CTN study is ongoing in the United States,

comparing SCT from haploidentical donors and UCB in

patients with hematological malignancies.

With our current knowledge, it is difficult to recommend

one stem cell source over another for patients without

matched donors. Until a large-scale randomized prospective

study shows one’s superiority, transplant centers will and

should choose an alternative stem cell source based on their

own expertise. However, T cell-replete haploSCT is clearly

advantageous for countries and centers without the financial

backing to invest in and maintain an umbilical cord bank.

Despite these advantages and recent advances, haploSCT is

a risky procedure with additional perils of late-onset chronic

GVHD and infections due to the histoincompatibility

barrier, late immune reconstitution, and intensified GVHD

prophylaxis limiting its use to experienced centers.

Conflict of Interest Statement

Figure 1. Proposed algorithm for donor selection in

haploidentical stem cell transplantation. DSA indicates

donor-specific anti-HLA antibodies; MFI: median

fluorescence intensity, NIMA: non-inherited maternal

antigens, NK: natural killer. Reproduced from Ciurea and

Champlin with permission (32).

peripheral blood and bone marrow grafts; therefore, 2 or 3

out of 6 HLA mismatches are allowed for UCB transplants.

However, use of UCB as a stem cell source has been limited

until recently by the delayed engraftment and relatively high

rate of primary graft failures due to the low volume and low

CD34+ cell content. Use of double, instead of single, UCB

has partially overcome these issues [36,37].

The advantages and disadvantages of haploSCT and

UCB SCT are outlined in Table 2. Although they had not

been systematically compared to each other, a recent

parallel multi-center phase 2 trial by BMT CTN confirmed

the utility of both double UCB and haploidentical donors

as alternative stem cell sources [14]. Fifty patients in

each arm, with advanced hematological malignancies,

received either BM grafts from haploidentical donors or

double UCB after similar conditioning regimens including

fludarabine, cyclophosphamide, and low-dose total body

irradiation (TBI). Grade II-IV acute GVHD and chronic

GVHD incidences were numerically higher in the double

UCB arm (40% vs. 32% and 25% vs. 13%), demonstrating

efficacy of the post-SCT cyclophosphamide in the haploSCT

arm. NRM at 1 year was 24% and 7% in the double UCB

and haploSCT arms, while relapse incidence was 31% and

45%, respectively. One-year progression-free survival (PFS)

The authors of this paper have no conflicts of interest,

including specific financial interests, relationships, and/

or affiliations relevant to the subject matter or materials

included.

References

1. Sasazuki T, Juji T, Morishima Y, Kinukawa N, Kashiwabara

H, Inoko H, Yoshida T, Kimura A, Akaza T, Kamikawaji N,

Kodera Y, Takaku F. Effect of matching of class I HLA alleles

on clinical outcome after transplantation of hematopoietic

stem cells from an unrelated donor. Japan Marrow Donor

Program. N Engl J Med 1998;339:1177-1185.

2. Reisner Y, Kapoor N, Kirkpatrick D, Pollack MS, Dupont B,

Good RA, O’Reilly RJ. Transplantation for acute leukaemia

with HLA-A and B nonidentical parental marrow cells

fractionated with soybean agglutinin and sheep red blood

cells. Lancet 1981;2:327-331.

3. Aversa F, Terenzi A, Tabilio A, Falzetti F, Carotti A, Ballanti

S, Felicini R, Falcinelli F, Velardi A, Ruggeri L, Aloisi T, Saab

JP, Santucci A, Perruccio K, Martelli MP, Mecucci C, Reisner

Y, Martelli MF. Full haplotype-mismatched hematopoietic

stem-cell transplantation: a phase II study in patients

with acute leukemia at high risk of relapse. J Clin Oncol

2005;23:3447-3454.

4. O’Reilly RJ, Kernan NA, Cunningham I, et al. Allogeneic

transplants depleted of T cells by soybean lectin agglutination

and E rosette depletion. Bone Marrow Transplant 1988;3:3-6.

5. Schwartz E, Lapidot T, Gozes D, Singer TS, Reisner Y.

Abrogation of bone marrow allograft resistance in mice by

increased total body irradiation correlates with eradication

of host clonable T cells and alloreactive cytotoxic precursors.

J Immunol 1987;138:460-465.

347



6. Terenzi A, Lubin I, Lapidot T, Salomon O, Faktorowich

Y, Rabi I, Martelli MF, Reisner Y. Enhancement of T celldepleted

bone marrow allografts in mice by thiotepa.

Transplantation 1990;50:717-720.

7. Cobbold SP, Martin G, Qin S, Waldmann H. Monoclonal

antibodies to promote marrow engraftment and tissue graft

tolerance. Nature 1986;323:164-166.

8. Reisner Y, Itzicovitch L, Meshorer A, Sharon N. Hemopoietic

stem cell transplantation using mouse bone marrow and

spleen cells fractionated by lectins. Proc Natl Acad Sci U S A

1978;75:2933-2936.

9. Aversa F, Tabilio A, Terenzi A, Velardi A, Falzetti F, Giannoni

C, Iacucci R, Zei T, Martelli MP, Gambelunghe C, Rossetti M,

Caputo P, Latini P, Aristei C, Raymondi C, Reisner Y, Martelli

MF. Successful engraftment of T-cell-depleted haploidentical

“three-loci” incompatible transplants in leukemia patients

by addition of recombinant human granulocyte colonystimulating

factor-mobilized peripheral blood progenitor

cells to bone marrow inoculum. Blood 1994;84:3948-3955.

10. Bethge WA, Faul C, Bornhäuser M, Stuhler G, Beelen DW,

Lang P, Stelljes M, Vogel W, Hägele M, Handgretinger

R, Kanz L. Haploidentical allogeneic hematopoietic cell

transplantation in adults using CD3/CD19 depletion and

reduced intensity conditioning: an update. Blood Cells Mol

Dis 2008;40:13-19.

11. Huang XJ, Liu DH, Liu KY, Xu LP, Chen H, Han W, Chen

YH, Zhang XH, Lu DP. Treatment of acute leukemia with

unmanipulated HLA-mismatched/haploidentical blood

and bone marrow transplantation. Biol Blood Marrow

Transplant 2009;15:257-265.

12. Luznik L, Jalla S, Engstrom LW, Iannone R, Fuchs EJ.

Durable engraftment of major histocompatibility complexincompatible

cells after nonmyeloablative conditioning

with fludarabine, low-dose total body irradiation,

and posttransplantation cyclophosphamide. Blood

2001;98:3456-3464.

13. Luznik L, O’Donnell PV, Symons HJ, Chen AR, Leffell MS,

Zahurak M, Gooley TA, Piantadosi S, Kaup M, Ambinder

RF, Huff CA, Matsui W, Bolaños-Meade J, Borrello I,

Powell JD, Harrington E, Warnock S, Flowers M, Brodsky

RA, Sandmaier BM, Storb RF, Jones RJ, Fuchs EJ. HLAhaploidentical

bone marrow transplantation for hematologic

malignancies using nonmyeloablative conditioning and

high-dose, posttransplantation cyclophosphamide. Biol

Blood Marrow Transplant 2008;14:641-650.

14. Brunstein CG, Fuchs EJ, Carter SL, Karanes C, Costa LJ, Wu

J, Devine SM, Wingard JR, Aljitawi OS, Cutler CS, Jagasia

MH, Ballen KK, Eapen M, O’Donnell PV; Blood and Marrow

Transplant Clinical Trials Network. Alternative donor

transplantation after reduced intensity conditioning: results

of parallel phase 2 trials using partially HLA-mismatched

related bone marrow or unrelated double umbilical cord

blood grafts. Blood 2011;118:282-288.

15. Ciurea SO, Mulanovich V, Saliba RM, Bayraktar UD, Jiang

Y, Bassett R, Wang SA, Konopleva M, Fernandez-Vina M,

Montes N, Bosque D, Chen J, Rondon G, Alatrash G, Alousi

A, Bashir Q, Korbling M, Qazilbash M, Parmar S, Shpall E,

Nieto Y, Hosing C, Kebriaei P, Khouri I, Popat U, de Lima

M, Champlin RE. Improved early outcomes using a T cell

replete graft compared with T cell depleted haploidentical

hematopoietic stem cell transplantation. Biol Blood Marrow

Transplant 2012;18:1835-1844.

16. Ciurea SO, de Lima M, Cano P, Korbling M, Giralt S, Shpall

EJ, Wang X, Thall PF, Champlin RE, Fernandez-Vina M.

High risk of graft failure in patients with anti-HLA antibodies

undergoing haploidentical stem-cell transplantation.

Transplantation 2009;88:1019-1024.

17. Ciurea SO, Thall PF, Wang X, Wang SA, Hu Y, Cano P,

Aung F, Rondon G, Molldrem JJ, Korbling M, Shpall EJ, de

Lima M, Champlin RE, Fernandez-Vina M. Donor-specific

anti-HLA Abs and graft failure in matched unrelated

donor hematopoietic stem cell transplantation. Blood

2011;118:5957-5964.

18. Takanashi M, Atsuta Y, Fujiwara K, Kodo H, Kai S, Sato H,

Kohsaki M, Azuma H, Tanaka H, Ogawa A, Nakajima K,

Kato S. The impact of anti-HLA antibodies on unrelated

cord blood transplantations. Blood 2010;116:2839-2846.

19. Cutler C, Kim HT, Sun L, Sese D, Glotzbecker B, Armand P,

Koreth J, Ho V, Alyea E, Ballen K, Ritz J, Soiffer RJ, Milford

E, Antin JH. Donor-specific anti-HLA antibodies predict

outcome in double umbilical cord blood transplantation.

Blood 2011;118:6691-6697.

20. Asai O, Longo DL, Tian ZG, Hornung RL, Taub DD,

Ruscetti FW, Murphy WJ. Suppression of graft-versus-host

disease and amplification of graft-versus-tumor effects by

activated natural killer cells after allogeneic bone marrow

transplantation. J Clin Invest 1998;101:1835-1842.

21. Ruggeri L, Capanni M, Casucci M, Volpi I, Tosti A, Perruccio

K, Urbani E, Negrin RS, Martelli MF, Velardi A. Role of natural

killer cell alloreactivity in HLA-mismatched hematopoietic

stem cell transplantation. Blood 1999;94:333-339.

22. Ruggeri L, Capanni M, Urbani E, Perruccio K, Shlomchik

WD, Tosti A, Posati S, Rogaia D, Frassoni F, Aversa F, Martelli

MF, Velardi A. Effectiveness of donor natural killer cell

alloreactivity in mismatched hematopoietic transplants.

Science 2002;295:2097-2100.

23. Symons HJ, Leffell MS, Rossiter ND, Zahurak M, Jones

RJ, Fuchs EJ. Improved survival with inhibitory killer

immunoglobulin receptor (KIR) gene mismatches and

KIR haplotype B donors after nonmyeloablative, HLAhaploidentical

bone marrow transplantation. Biol Blood

Marrow Transplant 2010;16:533-542.

24. Huang XJ, Zhao XY, Liu DH, Liu KY, Xu LP. Deleterious

effects of KIR ligand incompatibility on clinical outcomes

in haploidentical hematopoietic stem cell transplantation

without in vitro T-cell depletion. Leukemia 2007;21:848-

851.

348



25. Gagne K, Brizard G, Gueglio B, Milpied N, Herry P,

Bonneville F, Chéneau ML, Schleinitz N, Cesbron A, Folléa

G, Harrousseau JL, Bignon JD. Relevance of KIR gene

polymorphisms in bone marrow transplantation outcome.

Hum Immunol 2002;63:271-280.

26. Federmann B, Bornhauser M, Meisner C, Kordelas L, Beelen

DW, Stuhler G, Stelljes M, Schwerdtfeger R, Christopeit M,

Behre G, Faul C, Vogel W, Schumm M, Handgretinger R,

Kanz L, Bethge WA. Haploidentical allogeneic hematopoietic

cell transplantation in adults using CD3/CD19 depletion

and reduced intensity conditioning: a phase II study.

Haematologica 2012;97:1523-1531.

27. Kasamon YL, Luznik L, Leffell MS, Kowalski J, Tsai HL,

Bolaños-Meade J, Morris LE, Crilley PA, O’Donnell PV,

Rossiter N, Huff CA, Brodsky RA, Matsui WH, Swinnen

LJ, Borrello I, Powell JD, Ambinder RF, Jones RJ, Fuchs

EJ. Nonmyeloablative HLA-haploidentical bone marrow

transplantation with high-dose posttransplantation

cyclophosphamide: effect of HLA disparity on outcome.

Biol Blood Marrow Transplant 2010;16:482-489.

28. Harris DT, Schumacher MJ, LoCascio J, Booth A, Bard J,

Boyse EA. Immunoreactivity of umbilical cord blood and

post-partum maternal peripheral blood with regard to HLAhaploidentical

transplantation. Bone Marrow Transplant

1994;14:63-68.

29. Claas FH, Gijbels Y, van der Velden-de Munck J, van Rood

JJ. Induction of B cell unresponsiveness to noninherited

maternal HLA antigens during fetal life. Science

1988;241:1815-1817.

30. Tamaki S, Ichinohe T, Matsuo K, Hamajima N, Hirabayashi

N, Dohy H. Superior survival of blood and marrow stem

cell recipients given maternal grafts over recipients given

paternal grafts. Bone Marrow Transplant 2001;28:375-380.

31. van Rood JJ, Loberiza FR Jr, Zhang MJ, Oudshoorn M, Claas

F, Cairo MS, Champlin RE, Gale RP, Ringdén O, Hows JM,

Horowitz MH. Effect of tolerance to noninherited maternal

antigens on the occurrence of graft-versus-host disease after

bone marrow transplantation from a parent or an HLAhaploidentical

sibling. Blood 2002;99:1572-1577.

32. Ciurea SO, Champlin RE. Donor selection in T cell-replete

haploidentical hematopoietic stem cell transplantation:

knowns, unknowns, and controversies. Biol Blood Marrow

Transplant 2013;19:180-184.

33. Díez-Campelo M, Pérez-Simón JA, Ocio EM, Castilla

C, González-Porras JR, Sánchez-Guijo FM, Vázquez L,

Caballero MD, Cañizo MC, San Miguel JF. CD34 + cell

dose and outcome of patients undergoing reducedintensity-conditioning

allogeneic peripheral blood stem cell

transplantation. Leuk Lymphoma 2005;46:177-183.

34. Singhal S, Powles R, Treleaven J, Kulkarni S, Sirohi B,

Horton C, Millar B, Shepherd V, Tait D, Saso R, Rowland A,

Long S, Mehta J. A low CD34+ cell dose results in higher

mortality and poorer survival after blood or marrow stem

cell transplantation from HLA-identical siblings: should 2 x

106 CD34+ cells/kg be considered the minimum threshold?

Bone Marrow Transplant 2000;26:489-496.

35. Bittencourt H, Rocha V, Chevret S, Socié G, Espérou

H, Devergie A, Dal Cortivo L, Marolleau JP, Garnier F,

Ribaud P, Gluckman E. Association of CD34 cell dose with

hematopoietic recovery, infections, and other outcomes after

HLA-identical sibling bone marrow transplantation. Blood

2002;99:2726-2733.

36. Ballen KK, Spitzer TR, Yeap BY, McAfee S, Dey BR, Attar

E, Haspel R, Kao G, Liney D, Alyea E, Lee S, Cutler C, Ho

V, Soiffer R, Antin JH. Double unrelated reduced-intensity

umbilical cord blood transplantation in adults. Biol Blood


37. Brunstein CG, Barker JN, Weisdorf DJ, DeFor TE, Miller

JS, Blazar BR, McGlave PB, Wagner JE. Umbilical cord

blood transplantation after nonmyeloablative conditioning:

impact on transplantation outcomes in 110 adults with

hematologic disease. Blood 2007;110:3064-3070.

38. Rocha V, Gluckman E. Clinical use of umbilical cord blood

hematopoietic stem cells. Biol Blood Marrow Transplant

2006;12:34-41.

39. Amrolia PJ, Muccioli-Casadei G, Huls H, Adams S, Durett A,

Gee A, Yvon E, Weiss H, Cobbold M, Gaspar HB, Rooney C,

Kuehnle I, Ghetie V, Schindler J, Krance R, Heslop HE, Veys

P, Vitetta E, Brenner MK. Adoptive immunotherapy with

allodepleted donor T-cells improves immune reconstitution

after haploidentical stem cell transplantation. Blood

2006;108:1797-1808.

40. Di Ianni M, Falzetti F, Carotti A, Terenzi A, Castellino

F, Bonifacio E, Del Papa B, Zei T, Ostini RI, Cecchini D,

Aloisi T, Perruccio K, Ruggeri L, Balucani C, Pierini A,

Sportoletti P, Aristei C, Falini B, Reisner Y, Velardi A, Aversa

F, Martelli MF. Tregs prevent GVHD and promote immune

reconstitution in HLA-haploidentical transplantation. Blood

2011;117:3921-3928.

41. Grosso D, Carabasi M, Filicko-O’Hara J, Kasner M, Wagner

JL, Colombe B, Cornett Farley P, O’Hara W, Flomenberg P,

Werner-Wasik M, Brunner J, Mookerjee B, Hyslop T, Weiss

M, Flomenberg N. A 2-step approach to myeloablative

haploidentical stem cell transplantation: a phase 1/2

trial performed with optimized T-cell dosing. Blood

2011;118:4732-4739.

42. Lee KH, Lee JH, Lee JH, Kim DY, Seol M, Lee YS, Kang

YA, Jeon M, Hwang HJ, Jung AR, Kim SH, Yun SC,

Shin HJ. Reduced-intensity conditioning therapy with

busulfan, fludarabine, and antithymocyte globulin for

HLA-haploidentical hematopoietic cell transplantation

in acute leukemia and myelodysplastic syndrome. Blood

2011;118:2609-2617.

43. Davies JK, Gribben JG, Brennan LL, Yuk D, Nadler LM,

Guinan EC. Outcome of alloanergized haploidentical bone

marrow transplantation after ex vivo costimulatory blockade:

results of 2 phase 1 studies. Blood 2008;112:2232-2241.

349



44. Raiola AM, Dominietto A, Ghiso A, Di Grazia C, Lamparelli

T, Gualandi F, Bregante S, Van Lint MT, Geroldi S, Luchetti

S, Ballerini F, Miglino M, Varaldo R, Bacigalupo A.

Unmanipulated haploidentical bone marrow transplantation

and posttransplantation cyclophosphamide for hematologic

malignancies after myeloablative conditioning. Biol Blood


45. Di Bartolomeo P, Santarone S, De Angelis G, Picardi A,

Cudillo L, Cerretti R, Adorno G, Angelini S, Andreani M,

De Felice L, Rapanotti MC, Sarmati L, Bavaro P, Papalinetti

G, Di Nicola M, Papola F, Montanari M, Nagler A, Arcese

W. Haploidentical, unmanipulated, G-CSF-primed

bone marrow transplantation for patients with high-risk

hematological malignancies. Blood 2013;121:849-857.

350

Research Article

DOI: 10.4274/tjh.2013.0151

Turkish Chronic Myeloid Leukemia Study:

Retrospective Sectional Analysis of CML Patients

Türk Kronik Myeloid Lösemi Çalışması: KML Hastalarının

Geriye Dönük Kesitsel İncelenmesi

Fahri Şahin 1 , Güray Saydam 1 , Melda Cömert 1 , Burak Uz 2 , Akif Selim Yavuz 3 , Esra Turan 3 , İpek Yönal 3 ,

Hilmi Atay 4 , Engin Keltikli 4 , Mehmet Turgut 4 , Mustafa Pehlivan 5 , Meltem Olga Akay 6 , Emel Gürkan 7 ,

Semra Paydaş 7 , Selda Kahraman 8 , Fatih Demirkan 8 , Onur Kırkızlar 9 , Seval Akpınar 9 , Gülsüm Emel Pamuk 9 ,

Muzaffer Demir 9 , Hasan Mücahit Özbaş 10 , Mehmet Sönmez 10 , Mine Gültürk 11 Ayşe Salihoğlu 11 , Ahmet

Emre Eşkazan 11 , Cem Ar 11 , Handan Haydaroğlu Şahin 5 , Şeniz Öngören 11 , Zafer Başlar 11 , Yıldız Aydın 11 ,

Mustafa Nuri Yenere 13 , Nükhet Tüzüner 11 , Burhan Ferhanoğlu 11 , İbrahim C. Haznedaroglu 2 , Osman İlhan 12 ,

Teoman Soysal 11

1Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey

2Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey

3İstanbul University Faculty of Medicine, Department of Hematology, İstanbul, Turkey

4Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey

5Gaziantep University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey

6Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey

7Çukurova University Faculty of Medicine Department of Hematology and Oncology, Adana, Turkey

8Dokuz Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey

9Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey

10Karadeniz Technical University Faculty of Medicine, Department of Hematology, Trabzon, Turkey

11İstanbul University Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey

12Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract:

Objective: here have been tremendous changes in treatment and follow-up of patients with chronic myeloid leukemia

(CML) in the last decade. Especially, regular publication and updating of NCCN and ELN guidelines have provided enermous

rationale and base for close monitorization of patients with CML. But, it is stil needed to have registry results retrospectively

to evaluate daily CML practices.

Address for Correspondence: Güray SAYDAM, M.D.,

Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey

E-mail: saydamguray@yahoo.com

Received/Geliş tarihi : April 29, 2013

Accepted/Kabul tarihi : June 10, 2013

351


Şahin F, et al: CML in Turkey

Materials and Methods: In this article, we have evaluated 1133 patients’ results with CML in terms of demographical

features, disease status, response, resistance and use of second-generation TKIs.

Results: The response rate has been found relatively high in comparison with previously published articles, and we detected

that there was a lack of appropriate and adequate molecular response assessment.

Conclusion: We concluded that we need to improve registry systems and increase the availability of molecular response

assessment to provide high-quality patient care.

Key Words: Chronic myeloid leukemia, Registry, Response

Özet:

Amaç: Kronik myeloid lösemi (KML) tanısı olan hastalarda tedavi ve takip kriterleri son 10 yılda çok ciddi değişimlere

uğramıştır. Özellikle NCCN ve ELN kılavuzlarının yayınlanması ve düzenli olarak güncellenmesiyle hastaların daha yakın

takibi mümkün olmuştur. Ancak güncel uygulamaları değerlendirebilmek için kayıt ve retrospektif analizlere ihtiyaç vardır.

Gereç ve Yöntemler: Bu çalışmada, ülkemizde 12 merkezin katılımıyla KML tanısıyla izlenen 1133 hastanın demografik

özellikleri, hastalık durumları, yanıt, direnç ve ikinci kuşak tirozin kinaz inhibitör kullanımları analiz edilmiştir.

Bulgular: Hasta grubumuzda, yanıt oranlarının litaretüre göre daha yüksek olduğu, moleküler yanıt değerlendirmenin tüm

merkezlerde mümkün olmadığı saptanmıştır.

Sonuç: KML hastalarının bakım kalitesinin arttırılması için moleküler teknik kullanımının arttırılması ve daha yaygın kayıt

sistemine ihtiyaç vardır.

Anahtar Sözcükler: Kronik myeloid lösemi, Kayıt, Yanıt

Introduction

Chronic myeloid leukemia (CML) is a clonal

myeloproliferative disease characterized by t(9:22)

translocation, which produces the BCR-ABL fusion gene [1].

It is very well documented that the expression of constitutively

activated tyrosine kinase, which is a product of BCR-ABL, is the

underlying reason for the CML phenotype [2,3]. The reciprocal

translocation between chromosomes 9 and 22 produces the

shortened 22q known as the Philadelphia chromosome (Ph),

and the new fusion gene is called the BCR-ABL fusion gene

[4]. The clinical presentation of CML in most cases is seen

in 3 different clinical phases: the chronic phase, accelerated

phase, and blastic phase [5]. If left untreated, newly diagnosed

chronic-phase CML patients finally progress to the accelerated

and blastic phases. The blastic phase is of mainly the myeloid

phenotype in almost two-third of patients and of the lymphoid

phenotype in most of the remaining patients [6]. The blastic

phase of the disease in all forms has a poor prognosis, with

overall survival of 3 to 6 months. Most of the patients have

been diagnosed in chronic phase [7].

CML has been treated with hydroxyurea, interferon,

chemotherapy, and, most effectively, allogeneic stem cell

transplantation. After 2000, the treatment strategy and

results were completely changed by the introduction of

targeted treatment with tyrosine kinase inhibitor (TKI)

imatinib. The tyrosine kinase activity of BCR-ABL is the

main therapeutic target of imatinib, the first TKI to be used

in the treatment of CML. A large phase III randomized

trial, known as IRIS, provided the clinical and scientific

background for the use of imatinib in the treatment of Ph (+)

leukemias [8]. At a median follow-up of 19 months, the rate

of complete cytogenetic response (CCyR) in the imatinibtreated

patients was 94%, compared with a CCyR of 8.5%

achieved by patients in the IFN-alpha and cytarabine arm.

According to the 5-year results of the IRIS study, only 68%

of the patients in CCyR still remained on imatinib therapy

[9]. The previously reported prospective IRIS trial, which

retrospectively compared patient groups treated with imatinib

and interferon, and single-center studies and comparison of

allogeneic stem cell transplantation with data reported from

stem cell transplant registries have confirmed the superiority

of imatinib treatment to previously used strategies [9,10,11].

However, there are only a few reports describing imatinib

therapy in patients with CML treated outside prospective

trials or even from CML patient registries [12,13].

Although there have been tremendous increases in

knowledge regarding clinical and molecular features of CML,

epidemiology and treatment of CML in daily practice have

not been studied in detail [14]. Sources of epidemiological

data are mainly mortality statistics, European cancer

registries such as the Swedish Cancer Registry or the Saarland

Registry in Germany, or the database of the Surveillance,

Epidemiology, and End Results Program of the United States

National Cancer Institute [15].

The European LeukemiaNet (ELN) has developed

recommendations for the medical management of patients

352



with CML in daily clinical practice [15]. A careful and close

monitoring of treatment response and of prognostic factors

is required first to identify development of first-line therapy

(imatinib) resistance, intolerance, and noncompliance

or progression to advanced-phase disease. Subsequently,

the treatment benefits of second-line therapies have to be

considered. For success of treatment strategies, all required

data and monitoring schedules of patients should be

recorded appropriately.

There have not been many studies of treatment, followup,

and monitoring strategies of patients with CML treated

with TKIs in Turkey. Recently, Saydam et al. published the

results of patients with CML treated with dasatinib under

a compassionate use program [7]. However, that article

covered only a small segment of patients with CML, was not

nationwide in scope, and did not focus on the general CML

population.

The aim of this report was to determine the demographic

features, disease characteristics, treatment and monitoring

strategies, response status, and survival rates of patients with

CML treated with TKIs in Turkey.

Data Collection

Materials and Methods

This study was designed as a retrospective sectional

study. The primary objective of this study was to evaluate

the patients with the diagnosis of CML in Turkey. To

collect the essential and maximum available data on

patients with CML, a steering committee was organized

and met to define the required information and to create a

standardized questionnaire. The questionnaire consisted of

separate sections such as demographical data and patient

characteristics, disease characteristics, therapy and side

effects, and, finally, last status of the patients. Across all of

Turkey, 11 centers were enrolled in the study and 2 physicians

from each center were chosen to fill out the forms. Ethics

committee approval was obtained from the Ege University

Ethics Committee with the date of 22 November 2011 and

number of B.30.2.EGE.0.20.05.00/BOY/1401/575. The first

patient was recorded on 13 August 2012. The data collection

process was finished by October 2012 and statistical analyses

were completed by the end of January 2013.

Patients’ Inclusion

Patients of ≥18 years old with the diagnosis of CML

irrespective of the diagnosis date and treatment strategies

were enrolled in the study if the required data could be

provided by the primary physicians.

Patients’ Exclusion

Patients were excluded if they did not have cytogenetically

and/or molecularly confirmed diagnosis of CML at any time

point in their follow-up. Patients who could not have regular

follow-up or had interruption in their follow-up of longer

than 1 year, those who were referred for allogeneic stem cell

transplantation, and those who stopped CML treatments

were also excluded.

Treatment and Monitoring

All patients with the diagnosis of CML were included

irrespective of their current treatment, with the exception

of allogeneic stem cell transplantation. The duration of

the current treatment, dosage, dose and therapy changes,

and side effects were recorded. If there was more than one

treatment in the patient’s history, the same information

regarding these other therapies was also obtained.

Information on monitoring was classified as the duration,

time points, and results based on the ELN recommendations

for hematological, cytogenetic, and molecular responses. The

results for each time point were not evaluated independently

and separately; instead, certain definitions such as complete

hematological response (CHR), minor/minimal/partial/

major cytogenetic response (CyR), and major molecular

response (MMR) or complete molecular response (CMR;

undetectable BCR-ABL transcripts with currently available

techniques) were used as recommended by and indicated in

the National Comprehensive Cancer Network (NCCN) and

ELN guidelines.

Endpoints

The primary endpoint of this program was to provide

information regarding clinical, demographic, laboratory, and

treatment status of patients with the diagnosis of CML, and

also to determine the response rates, number of treatmentrelated

adverse events, and use of second-generation TKIs.

Dose modifications, disease status under TKI treatment, and

cytogenetic and molecular responses were also analyzed and

evaluated according to the available patient data.

Statistical Analysis

All the statistical analyses were performed by using the

data obtained from the patients’ files as recorded by primary

physicians. A special form was designed to summarize the

required data; it was completed by primary physicians and

analyzed by an independent contract research organization.

Any patient who received the diagnosis of CML at any time

point was included in the evaluation. Demographics, disease

status at baseline, time from diagnosis, duration of treatment,

the reasons for switching therapy to dasatinib and/or

nilotinib, and the median dose of imatinib were summarized

for all patients. Additionally, the last disease status, mortality

rates, discontinuation rates, use of second-generation TKIs,

and reported adverse events and dose modifications were

also presented.

Statistical analyses were performed by using SPSS

20 and Excel 2007. The variables were first assessed by

Kolmogorov–Smirnov/Shapiro–Wilk testing in terms of

normal distribution. The results were provided as mean±SD

for normally distributed variables and as median (min-max)

353



for abnormally distributed parameters. Time to progression

(TTP) was defined as the time between starting the drug and

either discontinuation/switching of the drug for any reason

or death. Overall survival (OS) was defined as the time

period between the time of diagnosis to death because of

any reason as well as any death reported after the drug was

stopped. TTP and OS evaluations were performed by using

the Kaplan–Meier method.

354

Results

The demographic features of patients at the time of

diagnosis are illustrated in Table 1. Based on these data,

median age was calculated as 46.1±14.8 years for all

patients, and this was similar for both sexes in terms of time

of diagnosis. There was no difference between the rates of

male and female patients, as 50.7% of patients were female

and 49.3% were male. It was noticed that all patients had

splenomegaly within the range of a median of 5 cm up to 40

cm. Hepatomegaly was detected in 46.5% of patients.

Disease status of patients at the time of diagnosis is

illustrated in Table 2. The median white blood cell (WBC)

count was calculated as 101x10 3 /mm 3 (range: 29x10 2 to

14x10 6 ). The median eosinophil percentage was 2.5%

(range: 0%-9%), while the basophil level was 3±5%. Median

hemoglobin level at the time of diagnosis was 11.5 g/dL,

while platelet count was 275.10 3 /mm 3 (range: 22.10 4 to

24.10 5 /mm 3 ). At the time of diagnosis, 77.5% of patients

had bone marrow fibrosis of any degree, and 83.2% of

patients had hypercellular bone marrow histology. During

first evaluation of patients during diagnostic work-up, 94.9%

of patients were in the chronic phase, 4.1% were in the

accelerated phase, and 1.1% were in the blastic phase. Sokal

risk scores at diagnosis were calculated as low in 575/831

(69.2%), intermediate in 201/ 831 (24.2%), and high in

55/831 (6.6%) among patients with available data. Most of

the patients (76.4%) had been treated with hydroxyurea

after diagnosis in terms of decreasing WBC count before

starting imatinib. The median dose of imatinib was reported

as 400 mg/day (range: 100-800 mg) and median duration of

imatinib therapy was 35.6 (range: 0.7-275.5) months. Since

this evaluation does not have limitations in terms of therapy

and diagnosis duration and it includes all patients with the

diagnosis of CML, treatment duration with imatinib has a

large range at 0.7 months to 275.5 months.

All patients had imatinib as the first line of therapy

regardless of the phase of the disease. The most prominent

reported side effects of imatinib were as follows: cytopenias

in more than one lineage (10.75%), edema (6.41%),

thrombocytopenia (4.67%), nausea (3.91%), rashes in grades

1-2 (3.04%), musculoskeletal pain (2.61%), neutropenia

(2.39%), leukopenia (1.85%), vomiting (1.52%), malaise

(1.41%), and “others”, which covers mainly local edema,

increase in biochemical parameters, and gastrointestinal

disturbance (13.24%). Most of these side effects were

managed successfully.

Response to treatment with imatinib was evaluated in

terms of hematological, cytogenetic, and molecular response

based on current and previously published NCCN and ELN

guidelines. This evaluation was performed by patients’

primary physicians and the available data collected from

screening forms were statistically analyzed. Based on this

analysis, 95.7% of patients treated with imatinib had CHR

and 63.8% of patients had CCyR at certain time points.

Molecular response evaluation could not be performed due

to lack of available data in most of the patients. Response to

imatinib therapy and results are provided in Table 4. When

we checked the progression to accelerated and blastic phases

under imatinib treatment, it was noted that 114 of 1133

patients (10.1%) had progressed. The rates of progression

in all Sokal risk score groups were similar at 10.1% in all

groups. Median time to progression was 58.5±30.1 months.

Table 5 summarizes the use of second-generation TKIs

(dasatinib, nilotinib, or both) after imatinib failure or

intolerance. Imatinib had to be replaced by dasatinib or

nilotinib, or sequentially by both, in 332 patients (29.3% of

total) and, of those, 307 (90.8%) had to have their imatinib

therapy changed due to resistance/inadequate response and

25 (9.2%) had to have it changed because of dug intolerance.

The first choice for switching TKI therapy in 194 patients

(58.8%) was dasatinib, in 138 patients (41.2%) it was

nilotinib, and 114 patients had to use both drugs in the

course of CML due to either failure or intolerance. When the

response to second-generation TKIs was evaluated, CCyR

was calculated as 31.3% in patients treated with nilotinib

and/or dasatinib. Due to lack of available data, molecular

response could not be assessed.

At the end of study and data collection period, 86 (7.6%)

patients were deceased and 1047 (92.4%) patients were alive

(Figure 1). The median survival time for all patients was 218

(0.7-245.6) months.

Table 1. Demographic characteristics.

Age (years; median ± SD) 46.1±14.8

Age, females (years; median ± SD) 45.9±14.6

Age, males (years; median ± SD) 46.4±15

Sex (n (%))

Female 575/1133 (50.7)

Male 558/1133 (49.3)

Spleen size at the time of diagnosis,

median (cm; min-max) 5 (1-40)

Hepatomegaly at the time of diagnosis

(n (%))

Yes 452/971 (46.5)

No 519/971 (53.5)



Table 2. Laboratory characteristics and disease phases.

WBC count at the time of diagnosis (10 9 /L; median (min-max)) 101 (2.9-140)

Eosinophils at the time of diagnosis (median % (min-max)) 2.5 (0-9)

Basophils at the time of diagnosis (median±SD, %) 3±5

Blasts at the time of diagnosis (median % (min-max)) 1 (0-30)

Hb at the time of diagnosis (g/L; median (min-max)) 115 (42-173)

Platelets at the time of diagnosis (10 9 /L; median (min-max))

275 (22-2400)

Bone marrow fibrosis at the time of diagnosis (n (%))

Yes 711/917 (77.5)

No 206/917 (22.5)

Cellularity of bone marrow (n (%))

Hypercellular 721/867 (83.2)

Normocellular 141/867 (16.3)

Hypocellular 5/867 (0.6)

Disease phase at the time of diagnosis (n (%))

Chronic phase 885/933 (94.9)

Accelerated phase 38/933 (4.1)

Blastic phase 10/933 (1.1)

The use of hydroxyurea before TKI treatment (n (%))

Yes 820/1074 (76.4)

No 254/1074 (23.6)

Imatinib dose (mg/day; median (min-max)) 400 (100-800)

Duration of imatinib treatment (months; median (min-max)) 35.6 (0.7-275.5)

The OS time was recalculated after switching imatinib

therapy to nilotinib or dasatinib and Kaplan–Meier survival

estimation resulted in 189.7 (0-275.9) months of OS for

those patients (Figure 2).

Discussion

In this study, we have evaluated 1133 Turkish patients

with the diagnosis of CML in terms of demographic

characteristics and disease status, treatment strategies and

switching rates, and side effects. We have found that, during

the first evaluation of patients during diagnostic work-up,

94.9% of patients were in the chronic phase, 4.1% were in

the accelerated phase, and 1.1% were in the blastic phase.

All patients had imatinib as a first-line therapy regardless of

the phase of the disease. It was found that 95.7% of patients

treated with imatinib had CHR and 63.8% of patients had

CCyR at certain time points. Molecular response evaluation

could not be performed due to lack of available data in

Figure 1: Overall survival analyses for all patients with the

diagnosis of CML irrespective of treatment.

355



Table 3. The frequency of adverse events during imatinib

treatment.

Adverse events n %

Multiple cytopenias 99 10.75

Edema 59 6.41

Thrombocytopenia 43 4.67

Nausea 36 3.91

Rash 28 3.04

Musculoskeletal pain 24 2.61

Neutropenia 22 2.39

Leukopenia 17 1.85

Vomit 14 1.52

Malaise 13 1.41

Arthralgia 8 0.87

Itching 5 0.54

Myalgia 4 0.43

Others 122 13.24

Total 494 53.64

Figure 2: Overall survival plot after switching therapy to

second-generation TKIs.

most of the cases. When we checked the progression to

accelerated and blastic phases under imatinib treatment, it

was noted that 114 of 1133 patients (10.1%) had progressed.

Median time to progression was 58.5±30.1 months. Imatinib

has to be replaced by dasatinib or nilotinib, or sequentially

by both, in 332 patients (29.3% of total) and, of those,

307 (90.8%) had to change their imatinib therapy due to

resistance/inadequate response and 25 (9.2%) had to change

imatinib therapy because of drug intolerance. The first

choice for switching TKI therapy in 194 patients (58.8%)

was dasatinib, in 138 patients (41.2%) it was nilotinib, and

114 patients had to use both drugs in the course of CML due

to either failure or intolerance.

Table 4. Response evaluation in CML patients treated

with imatinib.

Response n (%)

Complete hematologic response

Yes 1020/1066 (95.7)

No 46/1066 (4.3)

Complete cytogenetic response

Yes 660/1033 (63.8)

No 373/1033 (36.2)

Table 5. The general characteristics of second-line

treatment after imatinib failure/intolerance.

Parameters n (%)

Number of patients 332/1133 (29.3)

Reason for discontinuation of

imatinib treatment

Resistance 307/332 (90.8)

Intolerance 25/332 (9.2)

New TKI

Dasatinib 194/332 (58.8)

Nilotinib 138/332 (41.2)

Dasatinib + nilotinib 114/332

Complete cytogenetic response

Yes 102/332 (31.3)

No 230/332 (68.7)

Our study has been the first nationwide CML registration

study with the largest enrolled patient population. Since

it is not a prospective trial and does not have any time

limitations, it may be accepted as a reflection of current

CML practice in Turkey outside of clinical trials. Patients

participating in clinical trials are usually selected according

to strict eligibility criteria. However, in practical situations,

the clinical features of patients are much more heterogeneous

than those defined by the selection criteria in clinical trials.

Because of that, sometimes, the results of clinical trials might

not be applicable to real medical practice. However, it is very

obvious that the results of treatment with TKIs outside of

clinical trials are mandatory in order to evaluate and prove

the efficacy of TKIs and for confirmation of clinical trials.

The comparison of results obtained from clinical trials

with results of patients in routine practice has always been

controversial. To do this successfully, dedicated registry

programs are required with well-defined parameters.

TARGET (Timely and Appropriate Registration System for

GLIVEC Therapy) is a Japanese organization to improve

356

Şahin F, et al: CML in Turkey Turk J Hematol 2013;30:351-358

the quality of medical care for CML patients in Japan [16].

The TARGET system is an online database that can be easily

accessed by physicians. Results of patients registered in the

TARGET system from 2003 to 2010 were recently published

[17]. In that study, Tauchi et al. evaluated 639 CML patients

followed for 90 months and treated with imatinib as a firstline

therapy. They reported high survival rates with eventfree

survival (EFS), progression-free survival (PFS), and OS

at 79.1%, 94.8%, and 95.1%, respectively. Of course, it is not

possible to compare these results with ours, as their patient

population was highly homogeneous and was followed more

strictly compared to ours.

There are other registry studies reporting the results of

CML patients in terms of changing trends and survival plots.

Björkholm et al. published the Swedish registry results of 3173

diagnosed patients who were followed for the last 36 years

[18]. They reported that the survival rates of patients changed

dramatically after introduction of imatinib into clinical

practice and that the estimated survival of patients with CML

could be prolonged by up to 79 years by appropriate use of

imatinib. These data, however, were sorted from the Swedish

Cancer Registry and are not specific for only CML; they

also lack available data on PFS and EFS [18]. All the same,

the study was very important because of its large number

of patients and because it provided relative survival rates in

terms of changing paradigms of CML treatments.

CAMELIA is an international population-based, noninterventional,

observational multicenter clinical registry

system established by the Czech and Slovak Society of

Hematology in 2004 [19]. Recently, they published 661

consecutive CML patients registered to this system in terms

of the use of imatinib in first- or second-line treatment and

the role of stem cell transplantation in this patient cohort.

However, these patients were entered into the system between

the years of 2000 and 2008, and some of them could have

begun imatinib therapy relatively late. They proposed that,

for success of not only imatinib therapy but also of stem

cell transplantation, timing and appropriate dosing have

been important factors influencing the results. Some of our

patients, as in the case of CAMELIA, were diagnosed before

the introduction of imatinib, but they began being treated

with imatinib immediately after its approval. We also did not

aim to investigate the role of stem cell transplantation in our

patient cohort.

Our study, unfortunately, could not rely on any registry

system, and the parameters for analyses were designed by

other investigators before data were collected. Since this was

not a prospective study, but rather was performed based on

retrospective patients’ files, the lack of some data was seen

due to inadequate records. However, one must not forget that

this study includes the largest patient cohort ever assembled

in Turkey to date, and it is a good reflection of the current

status of CML therapy and results currently available. We

have the hematological and cytogenetic results of almost all

patients, but unfortunately we do not have much information

about molecular responses. Molecular response to TKI

therapy in patients with CML could not be assessed in our

retrospective study due to lack of available and standardized

real-time RT-PCR results, the universally accepted technique

for detection of BCR-ABL transcripts. Although a small

part of the participating centers in this sectional study have

been involved in ELN standardization projects, also known

as the EUTOS Project, most of the centers do not have

laboratory facilities for obtaining standardized PCR results

[20]. Recently, major hematology clinics have started to use

commercially available kits with international scale values.

Our study has clarified that appropriate and adequate

recording systems and, furthermore, dedicated and specific,

non-interventional, and prospective recording systems are

mandatory for not only future projects and research but

also for patient care and effective follow-up. Our study

also confirmed that all Turkish CML patients have similar

hematological and cytogenetic response results as those

reported by clinical trials and national registry programs.

However, it is obvious that, for molecular evaluation, much

more effort is required in terms of establishment of adequate

PCR facilities, which should be standardized eventually.

Acknowledgments

We would like to thank all colleagues who provided the

data of their patients for this analysis.





included.

References

1. Corm S, Roche L, Micol JB, Coiteux V, Bossard N, Nicolini

FE, Iwaz J, Preudhomme C, Roche-Lestienne C, Facon T,

Remontet L. Changes in the dynamic of the excess mortality

rate in chronic phase-chronic myeloid leukemia over 1990-

2007: a population study. Blood 2011;118:4331-4337.

2. Daley GQ, Van Etten RA, Baltimore D. Induction of chronic

myelogenous leukemia in mice by the P210bcr/abl gene of

the Philadelphia chromosome. Science 1990;247:824-830.

3. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine

kinase activity and transformation potency of bcr-abl

oncogene products. Science 1990;247:1079-1082.

4. Rowley JD. Letter: A new consistent chromosomal

abnormality in chronic myelogenous leukemia identified

by quinacrine fluorescence and Giemsa staining. Nature

1973;243:290-293.

357



5. Sokal JE, Baccarani M, Russo D, Tura S. Staging and

prognosis in chronic myelogenous leukemia. Semin

Hematol 1988;25:49-61.

6. Kurzrock G, Gutterman J, Talpaz M. The molecular genetics

of Philadelphia chromosome-positive leukemias. N Engl J

Med 1988;319:990-998.

7. Saydam G, Haznedaroglu IC, Temiz Y, Soysal T, Sucak G,

Tombuloglu M, Ozdogu H, Yavuz S, Altintas A, Ozet G,

Gulbas Z, Ferhanoglu B, Ilhan O. Retrospective evaluation

of patients treated with dasatinib for Philadelphia positive

leukemias: Turkish experience of 16 months. UHOD

2009;19:195-204.

8. O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M,

Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes

T, Lechner K, Nielsen JL, Rousselot P, Reiffers J, Saglio

G, Shepherd J, Simonsson B, Gratwohl A, Goldman JM,

Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville

R, Druker BJ; IRIS Investigators. Imatinib compared with

interferon and low-dose cytarabine for newly diagnosed

chronic-phase chronic myeloid leukemia. N Engl J Med

2003;348:994-1004.

9. Druker BJ, Guilhot F, O’Brien SG, Gathmann I, Kantarjian

H, Gattermann N, Deininger MW, Silver RT, Goldman JM,

Stone RM, Cervantes F, Hochhaus A, Powell BL, Gabrilove

JL, Rousselot P, Reiffers J, Cornelissen JJ, Hughes T, Agis

H, Fischer T, Verhoef G, Shepherd J, Saglio G, Gratwohl

A, Nielsen JL, Radich JP, Simonsson B, Taylor K, Baccarani

M, So C, Letvak L, Larson RA; IRIS Investigators. Five-year

follow-up of patients receiving imatinib for chronic myeloid

leukemia. N Engl J Med 2006;355:2408-2417.

10. Roy L, Guilhot J, Krahnke T, Guerci-Bresler A, Druker BJ,

Larson RA, O’Brien S, So C, Massimini G, Guilhot F. Survival

advantage from imatinib compared with combination

interferon-alpha plus cytarabine in chronic-phase chronic

myelogenous leukemia: historical comparison between two

phase 3 trials. Blood 2006;108:1478-1484.

11. Bittencourt H, Funke V, Fogliatto L, Magalhães S, Setubal D,

Paz A, Macedo AV, Ruiz J, Azambuja AP, Silla L, Clementino

N, Pasquini R. Imatinib mesylate versus allogeneic BMT

for patients with chronic myeloid leukemia in first chronic

phase. Bone Marrow Transplant 2008;42:597-600.

12. de Lavallade H, Apperley JF, Khorashad JS, Milojkovic D, Reid

AG, Bua M, Szydlo R, Olavarria E, Kaeda J, Goldman JM,

Marin D. Imatinib for newly diagnosed patients with chronic

myeloid leukemia: incidence of sustained responses in an

intention-to-treat analysis. J Clin Oncol 2008;26:3358-3363.

13. Lucas CM, Wang L, Austin GM, Knight K, Watmough SJ,

Shwe KH, Dasgupta R, Butt NM, Galvani D, Hoyle CF, Seale

JR, Clark RE. A population study of imatinib in chronic

myeloid leukemia demonstrates lower efficacy than in

clinical trials. Leukemia 2008;22:1963-1966.

14. Hehlmann R, Hocchaus A, Baccarani M. Chronic myeloid

leukemia. Lancet 2007;370:342-350.

15. Rohrbacher M, Hasford J. Epidemiology of chronic myeloid

leukemia. Best Pract Res Clin Haematol 2009;22:295-302.

16. Kizaki M, Okamoto S, Tauchi T, Tanaka H, Tanimoto M,

Inokuchi K, Murayama T, Saburi Y, Hino M, Tsudo M,

Shimomura T, Isobe Y; TARGET Investigators. Current and

future perspectives on the TARGET system: the registration

system for Glivec established by JSH. Int J Hematol

2008;88:409-417.

17. Tauchi T, Kizaki M, Okamoto S, Tanaka H, Tanimoto M,

Inokuchi K, Murayama T, Saburi Y, Hino M, Tsudo M,

Shimomura T, Isobe Y, Oshimi K, Dan K, Ohyashiki K, Ikeda

Y; TARGET Investigators. Seven-year follow-up of patients

receiving imatinib for the treatment of newly diagnosed

chronic myelogenous leukemia by the TARGET system.

Leuk Res 2011;35:585-590.

18. Björkholm M, Ohm L, Eloranta S, Derolf A, Hultcrantz M,

Sjöberg J, Andersson T, Höglund M, Richter J, Landgren

O, Kristinsson SY, Dickman PW. Success story of targeted

therapy in chronic myeloid leukemia: a population-based

study of patients diagnosed in Sweden from 1973 to 2008.

J Clin Oncol 2011;29:2514-2520.

19. Faber E, Mužík J, Koza V, Demeková E, Voglová J, Demitrovi

ová L, Chrudej J, Markuljak I, Cmunt E, Kozák T, Tóthová

E, Jarošová M, Dušek L, Indrák K. Treatment of consecutive

patients with chronic myeloid leukemia in the cooperating

centres from the Czech Republic and the whole of Slovakia

after 2000--a report from the population-based CAMELIA

Registry. Eur J Haematol 2011;87:157-168.

20. Hasford J, Baccarani M, Hoffmann V, Guilhot J, Saussele S,

Rosti G, Guilhot F, Porkka K, Ossenkoppele G, Lindoerfer

D, Simonsson B, Pfirrmann M, Hehlmann R. Predicting

complete cytogenetic response and subsequent progressionfree

survival in 2060 patients with CML on imatinib

treatment: the EUTOS score. Blood 2011;118:686-692.

358

Research Article

DOI: 10.4274/Tjh.2012.0083

Does HOXA9 Gene Expression in Egyptian Chronic

Myelogenous Leukemia Patients Affect Disease

Progression? A Retrospective Cohort Study

Mısırlı Kronik Miyeloid Lösemi Hastalarında HOXA-9 Gen

Sunumu Hastalık Progresyonu Üzerine Etkili midir?

Geriye Dönük Kohort Çalışması

Manar Mohamd Mohamad Ismail1, Moneer M. Manar2

1Laboratory Medicine Department, Faculty of Applied Medical Science, Um Al Qura University, Saudi Arabia

2Epidemiology and Biostatistics Department, National Cancer Institute, Cairo University, Egypt

Abstract:

Objective: Chronic myelogenous leukemia (CML) is a clonal stem cell disease and is consistently associated with the BCR-ABL

fusion gene. The chronic phase of the disease tends to pass into an accelerated phase and eventually leads to acute leukemia if

left untreated. Oncoproteins necessary for leukemic transformation are both fundamentally and clinically relevant to identify as

they might be new molecular targets for the development of specific anti-leukemic drugs. This study is an initial step to define

the proportion of HOXA9 gene expression in some Egyptians with chronic-phase CML at diagnosis and to evaluate its relation

with BCR-ABL expression and its clinical significance.

Materials and Methods: Sixty-two newly diagnosed CML patients (56 in chronic phase, 1 in accelerated phase, and 5

in blastic crises) were enrolled in the study. HOXA9 and BCR-ABL gene expressions were detected by one-step RT-PCR. ABL

was chosen as a control gene to calculate HOXA9/ABL and BCR-ABL/ABL ratios from densitometric values of PCR product

intensities.

Results: HOXA9 expression was encountered in 25/56 (44.6%) of newly diagnosed CML patients in the chronic phase. The

median expression was 0.31 (range: 0.08-1.37) in relation to the ABL gene, with a higher frequency of expression in CML

patients presenting with splenomegaly (p<0.001), high Sokal score (p<0.001), and BCR-ABL expression from the first round

(p=0.004). No association could be detected with other clinical parameters, overall survival, or disease-free survival.

Conclusion: HOXA9 expression is closely related to poor prognostic factors, but we could not demonstrate its relationship

to patient survival.

Key Words: Chronic myeloid leukemia, CML, Accelerated phase HOXA9 gene, BCR-ABL expression, BCR-ABL/ABL ratio

Address for Correspondence: Manar Mohamd Mohamad Ismail, M.D.,

4 Fum Al-Khalig Square, National Cancer Institute, Egypt, Cairo

Phone: 00966-505524982 E-mail: manarismail4@yahoo.com

Received/Geliş tarihi : July 3, 2012

Accepted/Kabul tarihi : March 25, 2013

359


Ismail MMM, et al: HOXA9 Gene Expression in CML

Özet:

Amaç: Kronik Miyeloid Lösemi (KML) klonal bir kök hücre hastalığıdır ve BCR-ABL füzyon geni ile ilişkilidir. Hastalık tedavi

edilmediği zaman, kronik evreden hızlanmış evreye ilerler ve sonunda akut lösemi ile sonuçlanır. Lösemik transformasyonda

temel olarak gerekli olan ve klinik olarak ilişkili onkoproteinlerin belirlenmesi spesifik anti-lösemik ilaçlar için yeni moleküler

hedef olabilecekleri için önemlidir. Bu çalışma bazı Mısırlı kronik evre KML hastalarında HOXA9 gen sunum oranını

belirlemede ve bunun BCR-ABL sunumu ile ilişkisinin ve klinik öneminin değerlendirilmesinde başlangıç adımıdır.

Gereç ve Yöntemler: Çalışmaya altmış iki yeni tanı KML olgusu (56 kronik evre, 1 hızlanmış evre ve 5 blastik kriz) alındı.

HOXA9 ve BCR-ABL genlerinin sunumu tek basamaklı RT-PCR ile tespit edildi. HOXA9/ABL ve BCR-ABL/ABL oranlarının

PCR ürün yoğunluklarının dansitometrik değerleri üzerinden hesaplanması için kontrol geni olarak ABL seçildi.

Bulgular: HOXA9 sunumu yeni tanı kronik evre KML olgularının %44.6’sında (25/56) tespit edildi. ABL geni ile ilişkili olarak

ortanca sunum 0.32 idi (aralık: 0.08-1.37) ve splenomegali ile başvuran (p<0.001), yüksek Sokal skoru (p<0.001) ve birinci

raundda BCR-ABL sunumu olan (p =0.004) KML olgularında daha yüksek sunum sıklığı vardı. Diğer klinik parametreler, genel

sağkalım ve hastalıksız sağkalım ile ilişki tespit edilemedi.

Sonuç: HOXA9 sunumu kötü prognostik faktörler ile yakından ilişkilidir ancak çalışmamızda bunun hasta sağkalımı ile

ilişkisini gösteremedik.

Anahtar Sözcükler: Kronik Miyeloid Lösemi, KML, akselere faz HOXA9 geni, BCR-ABL ekspresyonu, BCR-ABL/ABL oranı

360

Introduction

Chronic myelogenous leukemia (CML) has a worldwide

annual incidence of 1-2 cases per 100,000. It can occur at any

age, but the median age at diagnosis is 40-59 years [1]. CML

is a clonal stem cell disease and is consistently associated

with the BCR-ABL fusion gene located on the Philadelphia

chromosome [2]. The translocation fuses the BCR and ABL

genes, which results in the production of oncoprotein with

an aberrant tyrosine kinase, which confers proliferative and

survival properties to hematopoietic cells [3].This kinase

plays a critical role in the pathogenesis of CML by activating

multiple signaling pathways such as Ras, PI3K, MAPK,

JAK/STAT, and Myc [4]. In the early phases of the disease

there is excessive accumulation of mature myeloid cells

that pass into the accelerated phase and eventually develop

to acute leukemia if left untreated [1]. Additional genetic

changes may reflect genetic instability. Therefore, intrinsic

aggressiveness of the disease has been reported to ensue

at varying frequencies during disease progression to the

accelerated and blast crisis phases [5,6].

The genetic events involved in CML’s transformation into

the acute phase are poorly understood [7]. However, there is

increasing evidence that abnormal HOXA protein expression

is functionally significant in myeloid transformation [8]. The

homeodomain protein of the HOX family plays an important

role in regulating definitive hematopoiesis [9]. One of

them, HOXA9, part of the A cluster on chromosome 7p15,

is expressed under physiological conditions in primitive

hematopoietic cells of human and murine origin. The

expression pattern of the homeobox genes in hematopoietic

cells is specific to both lineage and differentiation stage. This

expression is down-regulated as blood cells differentiate,

suggesting a function in early hematopoiesis [10].

A growing body of evidence supports the notion that

misexpression of the HOXA9 homeobox gene is a common

and critical event in human acute myelogenous leukemia

(AML) and is critical to the induction and maintenance of

the malignant phenotype [9,11]. It was also proven that

enforced expression of HOXA9 in murine marrow cells can

immortalize the cells in culture and thus contributes largely

with other events in leukemogenesis [12].

The strong association between HOXA9 overexpression

and development of AML has encouraged us to determine its

expression in CML at diagnosis to determine its proportion

among Egyptian patients and to evaluate its relation with

BCR-ABL expression and the clinical significance of such

expression in disease aggression and patient survival.

Study Design


Patients and Clinical Samples

Peripheral EDTA blood samples (5 mL) were obtained

from 62 new patients presenting to the outpatient clinic

of the National Cancer Institute, Cairo University, during

a 6-month period starting in March 2004 with suspected

CML based on morphological examination of peripheral

blood (PB) and bone marrow (BM) films and leukocyte

alkaline phosphatase score. Diagnosis was confirmed by

the presence of the BCR-ABL fusion gene either from the

first round or by nested polymerase chain reaction (PCR).

Fifty-six patients were in the chronic phase, 1 was in the

accelerated phase, and 5 had acute blastic crises (ABCs)

on top of CML (2 with B-cell acute lymphocytic leukemia

[B-ALL] and 3 with AML) according to World Health

Organization classifications [13].



The Sokal score, a prognostic score that depends

on age, spleen size, PB blasts, and platelets [14], was

calculated. Overall survival and disease-free survival

(DFS) were calculated for all patients and in relation to the

studied genes. The study was approved by the local ethics

committee of the university. All patients presenting in the

chronic phase were treated with hydroxyurea at 1 to 6 g/day

orally, depending on the level of the white blood cell (WBC)

count [15]. When the total leukocyte count (TLC) reached

20x10 9 /L, the dosage was decreased to 1 to 2 g/day and given

continuously with the goal of reaching normal WBC counts

(5 to 15x10 9 /L).The drug was temporarily discontinued if

the WBC count dropped below 5x10 9 /L [16].

RNA Purification

Total RNA was extracted from 10 6 cells from PB EDTA

samples using the QIAamp RNA Blood Mini Kit (QIAGEN,

Cat. No. 52304) and stored at -80 °C.

RT-PCR

The OneStep RT-PCR kit (QIAGEN, Cat. No. 210212),

which combines cDNA synthesis from RNA with PCR

amplification to provide a rapid, sensitive method for

analyzing gene expression, was used. The following primer

sets were used:

TGTGGTTCTCCTCCAGTTGATAGA/

TCGGTGAGGTTGAGCAGTCGAG, which amplifies a

fragment of 267 bp for human HOXA9 [9];

TGTTGACTGGCGTGATGTAGTTGCTTGG/

TCAGCGGCCAGTAGCATCTGACTT for ABL, which was

used as an internal control;

ACAGCATTCCGCTGACCATCAATAAG/

TGTTGACTGGCGTGATGTAGTTGCTTGG (BCR-

ABL, first round); and CTGACCATCAATAAGGAAG/

GACCCGGAGCTTTTCACCTTTAGTT (BCR-ABL; second

round) [17].

The total reaction volume was 25 µL, containing 2.5

µL of RNA, 100 µM of each dNTP, 0.4 mM of each primer

(forward and reverse primer for each gene), and the enzyme

mix included in the kit (reverse transcriptase and hot-start

Taq DNA polymerase) in a 1X RT reaction buffer. All RT-

PCR reactions included NTC control (reaction mix without

RNA). The confirmation of BCR-ABL amplification was

carried out by nested PCR if the sample did not reveal it

from the first round.

Cycling Parameters

The thermal cycle program included a step for reverse

transcription (30 min, 50 °C); an initial PCR activation step

(15 min, 95 °C); 30 cycles consisting of denaturation (1 min,

94 °C), annealing (1 min, 58 °C), and extension (1 min, 72

°C); and a final extension step (10 min, 72 °C).

Electrophoresis

Ten microliters of the PCR products were subjected

to electrophoresis on 2% agarose gel containing ethidium

bromide. A molecular weight marker (100-1000 bp) was

used to assess the positions of the defined DNA band. The

gels were visualized under UV light (Figure 1).The image

obtained was analyzed using complete gel documentations

and an analysis system (Biometra, Germany). In order to

obtain a semi-quantitative value, the intensity of the gene

of interest (HOXA9 or BCR-ABL) was compared to a control

gene in the same sample [18]. ABL was chosen as a control

gene [19]. The HOXA9/ABL and BCR-ABL/ABL ratios

were calculated from densitometric values of PCR product

intensities.

Statistical Methods

Data were analyzed using SPSS 12. The chi-square

test (Fisher’s exact test) was used to examine the relation

between qualitative variables. Spearman’s rho method was

used to test correlations between numerical variables. The

Kaplan–Meier method was used for survival analysis with

the log-rank test to compare survival curves. All tests were

2-tailed and p<0.05 was considered significant.

Results

The clinical characteristics of chronic-phase CML

patients are shown in Table 1. HOXA9 expression was

encountered in 25/56 (44.6%) of newly diagnosed CML

cases. The median expression was 0.31 (range: 0.08-1.37)

in relation to the ABL gene in each sample. The expression

of HOXA9/ABL ratio in the accelerated case was 0.31, and in

the 3 myeloid blastic crisis cases it was 0.83, 0.59, and 0.51,

while it was not expressed in cases of lymphoid crisis.

HOXA9 was not related to age, sex, percentage of blasts

in PB or BM, hemoglobin levels, or platelet count (p>0.05).

HOXA9-positive CML was significantly associated with

larger spleen size (15.9±2.5 cm vs. 5.4±3.2 cm, p<0.001),

higher Sokal score (p<0.001), and BCR-ABL expression from

the first round (p=0.004) (Table 2). The HOXA9/ABL ratio

was positively correlated with the BCR/ABL ratio (r=0.538,

p=0.008), but not correlated to Sokal score (r=0.001,

p=0.995).

Survival Analysis

The median follow-up for the chronic-phase CML

patients was 3 years (range: 0.2-6.8). The cumulative overall

survival was 77.5%. There was no significant relation

between overall survival and expression of the HOXA9 gene

(p=0.073) or BCR-ABL fusion gene expression whether

from the first round or the second round (p=0.523). Within

the HOXA9-positive cases, there was no significant relation

between HOXA9/ABL ratio and overall survival (p=0.794).

Patients with a Sokal score of <0.8 had significantly higher

overall survival (95%) compared to the other 2 groups with

higher scores (p=0.017 and p=0.022) (Table 3; Figure 2).

Ten out of 56 patients progressed to either the accelerated

phase or acute blastic crisis (5 progressed to acute leukemia

and the other 5 to the accelerated phase), and 5 cases could

not be followed. Regarding the patients that progressed to

361



Table 1. Clinical characteristics of chronic-phase CML

patients (n=56).

Characteristic

Age (years) # 37 (18-71)

Sex (male/female) 32/24 (1.3/1.0)

Spleen size (cm) 11 (2-19)

TLC (x10 9 /L) # 147.4 (10.7-566)

Hb (g/dL) # 9.6 (5.7-13.9)

Platelets (x10 9 /L) # 365.5 (59-1054)

Peripheral blood blasts # 1 (0-5)

BM blasts # 2 (0-5)

Sokal score ^

Low risk (<0.8) 24 (42.8%)

Intermediate risk (0.8-1.2) 21 (37.5%)

High risk (>1.2) 11 (19.6%)

BCR-ABL1 expression (first

round) ^

Positive 41 (73.2%)

Negative = positive for BCR-ABL

(second round)

15 (26.8%)

BCR/ABL ratio in first round 0.72 (0.13-2.35)

positive cases #

HOXA9 expression

Positive ^ 25 (44.6%)

Negative ^ 31 (55.4%)

HOXA9/ABL ratio in

0.31 (0.08-1.37)

HOXA9-positive cases #

Disease progression *

Chronic 46 (82.2%)

Accelerated 5 (8.9%)

Acute blastic crisis 5 (8.9%)

Survival status *

Alive 44 (78.5%)

Dead 12 (21.4%)

Figure 1. Agarose gel electrophoresis for PCR product. Case

1: A case of CML that failed to express the HOXA9 gene at

276 bp. Case 2: Another case of CML that did express the

HOXA9 gene. Molecular size marker: 100-1000 bp. Band

density is presented between brackets.

#

: Data presented as median (range).

^: Data presented as frequency (%).

*: Five cases could not be followed.

acute leukemia, the 3 that developed AML had HOXA9/ABL

ratios of 0.31, 0.47, and 1.37 at diagnosis, while the other 2

who developed ALL did not express HOXA9. Regarding the

accelerated cases, only 1 patient had an HOXA9/ABL ratio

of 0.25 at presentation. Considering Sokal scores, 3 patients

passed to the accelerated phase and 1 developed ABC in the

group with low scores (<0.8), 2 patients progressed to the

accelerated phase and 3 developed ABC in the group with

intermediate scores (0.8-1.2), and only 1 developed ABC in

the high score group (>1.2).

Figure 2. Overall survival in 56 chronic-phase CML patients.

A) HOXA9/ABL ratio in relation to overall survival (OS). B)

BCR/ABL ratio in relation to OS. C) Sokal score in relation

to OS.

362



The cumulative DFS for those who did not express

HOXA9 was 71.7% versus 73.4% among HOXA9-positive

cases (p=0.759). Within the HOXA9-positive cases, there was

no significant relation between DFS and HOXA9/ABL ratio

(p=0.337). DFS was 68.4% for cases in which BCR-ABL was

expressed from the first round versus 85.7% for cases in which

it was expressed from the second round (p=0.297). DFS was

Figure 3. Disease-free survival (DFS) in 56 chronic-phase

CML patients. A) HOXA9/ABL ratio in relation to DFS.

B) BCR/ABL ratio in relation to DFS. C) Sokal score in

relation to DFS.

75.2% in cases with a Sokal score of <0.8, 61.4% for score

of 0.8-1.2, and 88.9% for score of >1.2, with no significant

difference among the 3 levels (p>0.05) (Figure 3).

Discussion

This study demonstrated an HOXA9 expression rate

of 44.6% in patients with chronic-phase CML. A previous

study found HOXA9 expressed at detectable levels in every

sample [20]. Our results could be explained by the fact that

the expression of HOXA9 is down-regulated during myeloid

differentiation [21], and all of the cells in chronic-phase

CML show myeloid differentiation.

In accordance with other studies, we found lower

expression of the HOXA9/ABL ratio in the accelerated cases

than in cases of myeloid blastic crisis [22,24], raising the

possibility that HOXA9 may interact with BCR-ABL to

transform BM cells.

In the current series, patients presenting with lymphoid

crises failed to express HOXA9. This could be explained

by the fact that over-expression of HOXA9 in more

mature cells enhances granulopoiesis and partially blocks

B lymphopoiesis [12]; thus, it would not be expressed in

B-ALL. In addition, in a previous gene expression study

of human leukemia, HOXA9 emerged as one of the top 20

genes that distinguished AML from ALL [25].

In the current study, patients with poor prognosis (i.e.

intermediate or high Sokal score) demonstrated higher

HOXA9 expression (p<0.001), which concurs with the

results of previous studies [20,26]. Splenomegaly was

associated with HOXA9 expression (p<0.001), which is

one of the factors included in Sokal scores denoting poor

prognosis. Splenomegaly was also a criterion found in an

experimental animal study done by Mayotte et al., in which

they induced leukemia by HOXA9 over-expression [24].

In this work, 92% of HOXA9-positive cases had BCR-

ABL expressed from the first round (p=0.004), i.e. patients

with more copies of the BCR-ABL fusion gene showed

higher proportions of HOXA9 expression. A previous study

reported that patients with poor prognosis had increased

expression of BCR-ABL as well as the HOXA9 gene [20].

Table 2. Relation between HOXA9 expression and both Sokal score and BCR-ABL expression in chronic-phase CML.

HOXA9 expression

Negative

(n=31)

Positive

(n=25)

Sokal score Low risk (<0.8) 23 (74.2%) 1 (4%)

Intermediate risk (0.8-1.2) 8 (25.8%) 13 (52%)

High risk (>1.2) 0 (0%) 11 (44%)

BCR-ABL expression BCR-ABL (1 st ) positive 18 (58.1%) 23 (92%)

BCR-ABL (1 st ) negative = BCR-ABL (2 nd ) positive 13 (41.9%) 2 (8%)

*Fisher’s exact test was used to examine the relation between qualitative variables

p-value

<0.001

0.004

363



Table 3. Impact of the studied factors on overall survival at 3 years among CML patients.

HOXA9 expression

Positive (n=23)

Negative (n=28)

BCR-ABL expression

First round (n=39)

Second round (n=12)

Sokal score

First group, <0.8 (n=20)

Second group, 0.8-1.2 (n=20)

Third group, >1.2 (n=11)

68.4

84.8

76.0

82.5

95.0

65.5

63.6

Cumulative overall

survival

Chronic-phase CML

0.073

0.523

p-value

0.017 (between 1 st & 2 nd groups)

0.022 (between 1 st & 3 rd groups)

0.808 (between 2 nd & 3 rd groups)

In the current study, overall survival was 77.5% without

significant relation to expression of the HOXA9 gene

(p=0.073) or BCR-ABL (p=0.523). Overall survival was 95%

for cases with a Sokal score of <0.8, which is significantly

higher as compared to the other 2 groups (p=0.017 and

p=0.022).

DFS was not significantly related to HOXA9 or BCR-ABL

expression or to Sokal score (p>0.05). Contrary to these

findings, a previous study reported a patient with poorer

prognosis (high Sokal score) showing the highest HOXA9/

ABL ratio, who quickly entered blast crisis and died 5

months later [26].

In this cohort study, 5 patients progressed to acute

leukemia; of those, 3/5 expressed HOXA9 at diagnosis and

developed AML, while the other 2, who developed ALL,

did not express HOXA9. These data support previously

recorded results of an earlier experimental study in which

all mice that received BM cells infected with BCR-ABL plus

HOXA9 retroviruses died within 9 days of acute leukemia

and, in all cases, the leukemia was myeloid [24]. The fact

that the patients presenting with AML on top of CML in

this study were expressing higher levels of HOXA9/ABL ratio

may indicate that the combination of these oncogenes was

sufficient for the full transformation into AML.

Conclusion

The rate of HOXA9 expression in the studied chronicphase

CML cases was 44.6%. It was higher in cases of poor

prognosis with high or intermediate Sokal scores and in

patients that expressed the BCR-ABL fusion gene from the

first round. We could not draw a firm conclusion about

whether HOXA9 expression has a bad effect on overall

or disease-free survival. However, for data regarding the

proportion of HOXA9 expression in CML and its effect on

blastic transformation, HOXA9 should be evaluated in a larger

number of patients both at presentation and during blastic

crisis, and it will be important to evaluate misexpression

of HOXA9 oncogenes when seeking genes involved in the

progression of CML to acute myeloid leukemia.

Authors’ Contributions

Manar Ismail was responsible for study design, all lab

work, collection of clinical data, analysis and interpretation of

findings, and writing of the paper.

Manar Moneer was responsible for statistical analysis,

interpretation of the data, and revising of the paper.

Acknowledgments

The authors acknowledge Dr. Heba Shaker for her

scientific support, expert technical assistance, and permission

to perform the practical work under her supervision in the

BMT lab at the NCI, Cairo University.





included.

References

1. Redaelli A, Bell C, Casagrande J, Stephens J, Botteman M,

Laskin B, Pashos C. Clinical and epidemiological burden

of chronic myeloid leukemia. Expert Rev Anticancer Ther

2004;4:85-96.

2. Melo JV, Barnes DJ. Chronic myeloid leukemia as model

of disease evolution in human cancer. Nat Rev Cancer

2007;7:441-453.

3. Dash AB, Williams IR, Kutok JL, Kutok JL, Tomasson MH,

Anastasiadou E, Lindahl K, Li S, Van Etten RA, Borrow J,

Housman D, Druker B, Gilliland DG. A murine model of CML

blast crisis induced by cooperation between BCR/ABL and

NUP98/HOXA. Proc Nat Acad Sci USA 2002;99:7622-7627.

364



4. Merkerova M, Bruchova H, Brdicka R. Expression analysis

of PCNA gene in chronic myeloid leukemia- combined

application of siRNA silencing and expression arrays. Leuk

Res 2006;31:661-672.

5. Ahuja HG, Popplewell L, Tcheurekdjian L, Slovak ML.

NUP98 gene rearrangements and the clonal evolution of

chronic myelogenous leukemia. Genes Chromosomes

Cancer 2001;30:410-415.

6. Kim TD, Türkmen S, Schwarz M, Koca G, Nogai H, Bommer

C, Dörken B, Daniel P, Coutre P. Impact of additional

chromosomal aberrations and BCR-ABL kinase domain

mutations on the response to nilotinib in Philadelphia

chromosome-positive chronic myeloid leukemia.

Haematologica 2010;95:582-588.

7. Calabretta B, Perrotti D. The biology of CML blastic crisis.

Blood 2004;103:4010-4020.

8. Eklund EA. The role of HOX gene in myeloid leukemogenesis.

Curr Opin Hematol 2006;13:67-73.

9. Eklund EA. The role of HOX gene in malignant myeloid

diseases. Curr Opin Hematol 2007;14:85-89.

10. Lawrence HJ, Christensen J, Fong S, Hu YL, Weissman I,

Sauvageau G, Humphries RK, Largman C. Loss of expression

of the Hoxa-9 homeobox gene impairs the proliferation

and repopulating ability of hematopoietic stem cells. Blood

2005;106:3988-3994.

11. Shah N, Sukumar S. The Hox genes and their roles in

oncogenesis. Nat Rev Cancer 2010;10:361-371.

12. Thorsteinsdottir U, Mamo A, Kroon E, Jerome L, Bijl J,

Lawrence HJ, Humphries K, Sauvageau G. Over expression

of the myeloid leukemia associated HOXA9 gene in

bone marrow cells induces stem cell expansion. Blood

2002;99:121-129.

13. Wadleigh M, Tefferi A. Classification and diagnosis of

myeloproliferative neoplasms according to the 2008 World

Health Organization criteria. Int J Hematol 2010;91:174-

179.

14. Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson

JE, Tso CY, Braun TJ, Clarkson BD, Cervantes F, Rozman

C; Italian Cooperative CML Study Group. Prognostic

discrimination in ‘good risk’ chronic granulocytic leukemia.

Blood 1984;63:789-799.

15. Kennedy BJ. The evolution of hydroxyurea therapy

in chronic myelogenous leukemia. Semin Oncol

1992;19:21-26.

16. Abhyankar D, Shende C, Saikia T, Advani SH. Hydroxyurea

induced leg ulcers. J Assoc Physicians India 2000;48:926-

927.

17. Cross NCP, Melo JV, Feng L, Goldman JM. An optimized

multiplex PCR for detection of BCR-ABL fusion mRNA in

hematological disorders. Leukemia 1994;58:186-189.

18. Dorsam ST, Ferrell CM, Dorsam GP, Derynck MK, Vijapurkar

U, Khodabakhsh D, Pau B, Bernstein H, Haqq CM, Largman

C, Lawrence HJ. The transcriptome of the leukomogenic

homeoprotein HOXA9 in human hematopoietic cells. Blood

2004;103:1676-1684.

19. Beillard E, Pallisgaard N, van der Velden VH, Bi W, Dee R,

van der Schoot E, Delabesse E, Macintyre E, Gottardi E,

Saglio G, Watzinger F, Lion T, van Dongen JJ, Hokland P,

Gabert J. Evaluation of candidate control genes for diagnosis

and residual disease detection in leukemic patients using

‘real-time’ quantitative reverse transcriptase polymerase

chain reaction (RQ-PCR) Europe against cancer program.

Leukemia 2003;17:2474-2786.

20. Tedeschi FA, Cardozo MA, Valentini R, Zalazar FE. Coexpression

of HoxA9 and bcr-abl genes in chronic myeloid

leukemia. Leuk Lymphoma 2010;51:892-896.

21. Fujino T, Yamazaki Y, Largaespada DA, Jenkins NA,

Copeland NG, Hirokawa K, Nakamura T. Inhibition

of myeloid differentiation by Hoxa9, Hoxb8, and Meis

homeobox genes. Exp Hematol 2001;29:856-863.

22. Celetti A, Barba P, Cillo C, Rotoli B, Boncinelli E, Magli MC.

Characteristic patterns of HOX gene expression in different

types of human leukemia. Int J Cancer 1993;53:237-244.

23. Kroon E, Thorsteinsdottir U, Mayotte N, Nakamura T,

Sauvageau G. NUP98-HOXA9 expression in hemopoietic

stem cells induces chronic and acute myeloid leukemias in

mice. EMBO J 2001;20:350-361.

24. Mayotte N, Roy DC, Yao J, Kroon E, Sauvageau G.

Oncogenic interaction between BCR-ABL and NUP98-

HOXA9 demonstrated by the use of an in vitro purging

culture system. Blood 2002;100:4177-4184.

25. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek

M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri

MA, Bloomfield CD, Lander ES. Molecular classification

of cancer: class discovery and class prediction by gene

expression monitoring. Science 1999;286:531-537.

26. Tedeschi FA, Zalazar FE. HOXA9 gene expression in

the chronic myeloid leukemia progression. Leuk Res

2006;30:1453-1456.

365

Research Article

DOI: 10.4274/Tjh.2012.0199

Evaluation of Danazol, Cyclosporine, and Prednisolone as

Single Agent or in Combination for Paroxysmal Nocturnal

Hemoglobinuria

Paroksismal Nokturnal Hemoglobinüri Tedavisinde Tek

Başına veya Birlikte Kullanılan Danazol, Siklosporin ve

Prednizolonun Değerlendirilmesi

Kanjaksha Ghosh, Manisha Madkaikar, Maya Gupta, Farah Jijina

National Institute of Immunohaematology, 13 th Floor, NMS Building, KEM Hospital Campus, Parel, Mumbai, India and

Department of Haematology, 10 th Floor, NMS Building, KEM Hospital Campus, Parel, Mumbai, India

Abstract:

Objective: The responses of 32 patients with paroxysmal nocturnal hemoglobinuria (PNH) were assessed after the patients

were put on various combinations of danazol, prednisolone, and cyclosporine.

Materials and Methods: Nineteen males and 13 females aged between 14 and 60 years with confirmed diagnosis of PNH

were treated with danazol (4), danazol + cyclosporine (7), cyclosporine (1), and prednisolone + danazol (20). Response to

these interventions was assessed regularly. Danazol was added to cyclosporine in patients with aplastic bone marrow after 3

months of cyclocporine use only unless the former therapy was successful. Four patients with aplastic marrow received only

danazol because they had renal insufficiency at presentation. Patients were evaluated with regular complete blood count and

routine liver and renal function tests.

Results: One patient responded to cyclosporine only. Thirteen of 32 patients (40%) had complete response, 12/32 patients

(37%) had partial response leading to freedom from red cell transfusion, and 2/32 (7%) had no response. Five patients (16%)

died due to thrombosis or hemorrhage within 3 months of therapy before their response to therapy could be assessed. The

median period of review of the cases was 4 years and 6 months.

Conclusion: Danazol is a useful addition to PNH therapy both in combination with cyclosporine for hypoplastic PNH and

with prednisolone for other forms of PNH, and this therapy could be a good alternative where eculizumab and anti-lymphocyte

globulin cannot be used for various reasons.

Key Words: Cyclosporine, Danazol, Hemoglobinuria, Paroxysmal, Immunosuppression, Prednisolone

Address for Correspondence: Kanjaksha GHOSH M.D.,

MRCPI, MRCP, FRCPath FACP, FRCP (Glasg) Director, National Institute of Immunohaematology

E-mail: kanjakshaghosh@hotmail.com

Received/Geliş tarihi : December 18, 2012


366


Ghosh K, et al: Evaluation of Danazol, Cyclosporine, and Prednisolone as

Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria

Özet:

Amaç: Tek başına veya birlikte kullanılan danazol, siklosporin ve prednizolonun tedavideki yeri 32 paroksismal nokturnal

hemoglobinürili (PNH) hasta üzerinde değerlendirildi.

Gereç ve Yöntemler: Yaşları 14 ile 60 arasında değişen 19 erkek ve 13 kadın PNH tanılı hasta danazol (4), danazol

+ siklosporin (7), siklosporin (1), ve danazol + prednizolon (20) ile tedavi edildi. Aplastik kemik iliği olup en az 3 aylık

siklosporin tedavisine yanıt alınamayan hastalarda tedaviye danazol eklendi. Aplastik kemik iliği olan 4 hastada tanı anında

böbrek yetersizliği bulunması nedeniyle sadece danazol kullanıldı. Hastalar düzenli kan sayımı, karaciğer ve böbrek testleri

ile değerlendirildi.

Bulgular: Bir hastada tek başına siklosporin kullanımına yanıt alındı. Otuz iki hastanın 13’ünde (%40) tam remisyon elde

edildi. On iki hastada (%37) kısmi yanıt görüldü ve bu hastalarda eritrosit replasman gereksinimi ortadan kalktı. İki hastada

ise (7) tedaviye yanıt alınamadı. Beş hasta (%16) tedavinin ilk 3 ayı içinde yanıt değerlendirmesi yapılamadan tromboz veya

kanamadan kaybedildi. Ortanca takip süresi 4,5 yıldı.

Sonuç: Danazol hipoplastik PNH’da siklosporine, diğer PNH türlerinde ise prednizolonun yanına eklenebilecek yararlı

bir tedavi tamamlayıcı ajan olarak görünmektedir. Özellikle eculizumab ve antilenfosit globulinlere erişimin kısıtlı olduğu

yerlerde uygulanabilecek bir tedavi seçeneği oluşturmaktadır.

Anahtar Sözcükler: Siklosporin, Danazol, Hemoglobinüri, Paroksismal, İmmunosupresyon, Prednizolon

Introduction

Paroxysmal nocturnal hemoglobinuria (PNH) has been

variously managed with immunosuppressive therapies

such as corticosteroids and cyclosporine [1,2]. Unusual

medicines like metronidazole [3] have also been used

for this condition. Recently the humanized monoclonal

antibody against the C5a component of the complement

system (eculizumab) has been very successfully used

to manage such cases [4], but such therapy has severe

complications apart from the cost, which cannot be borne

by average people in developing countries. Hence, there

is a need for evaluating common medicines singly or in

combination in PNH cases.

PNH is an uncommon disorder; hence, not many large

series on treatment options for such patients are available.

Standard management like packed red cell transfusion, iron

replacement where indicated, and relevant management

for bleeding and thrombotic episodes is applicable to

PNH patients along with specific therapy. In this study, 32

well-characterized PNH patients are described as to their

outcomes with cyclosporine, steroids, and danazol therapy

singly or in various combinations.

Patients


Thirty-two patients (19 males and 13 females) aged

between 14 and 60 years (median age: 35 years) were

recruited for the study over a 4-year period and were

followed for at least 1.5 years from the time of diagnosis.

The diagnosis of PNH was made on the basis of paroxysmal

nocturnal hemoglobinuria, pancytopenia, unusual

thrombotic jaundice, anemia, and splenomegaly coupled

with low leukocyte alkaline phosphatase score, and the

diagnosis was confirmed with positive Ham’s test results and

the presence of more than 10% red cells and/or neutrophils

from peripheral blood showing negative staining for both

CD55 and CD59 monoclonal antibodies. The test was

done on a Becton Dickinson FACSCalibur flow cytometer

with antibodies supplied by the same company (Becton

Dickinson, USA).

The study was sanctioned by the institutional ethics

committee (IEC) of the hospital and informed consent from

the patients was taken as is mandatory for sanctioning of

studies by the IEC.

Investigations

The patients were tested for complete blood counts,

reticulocyte count, bone marrow aspirate for morphology

and iron stain, cytogenetic study, and routine biochemistry.

Urinary hemosiderin staining was done in addition to Ham’s

test and flow cytometry tests to confirm the diagnosis. Other

imaging studies were done as per requirements of individual

cases.

Criteria of Response

Complete response was defined as an increase in

hemoglobin to >110 g/L without red cell support, absolute

neutrophil count above 1.5x10 9 /L, platelet count above

100x10 9 /L, and no requirement for blood product support

or any infection. Partial response was defined as freedom

from red cell support but platelet and neutrophil counts that

had not normalized.

Therapy

Supportive management was given to patients in the form

of packed red cell transfusion whenever hemoglobin fell

below 70 g/L. Bleeding episodes were treated with random

donor platelet infusions whenever required. Responses to

therapy were assessed every 3 months and patients who did

not respond at the end of 3 months were deemed as nonresponders

to that therapy.

367




If the patient had bone marrow aplasia as a part of

PNH then the patient was started on cyclosporine at 6 mg/

kg daily per os (PO), and in the event of non-response or

partial response at the end of 3 months, danazol at 100 mg

twice daily PO was added. Oral danazol was titrated up to

400 mg/day if required. Four patients with aplastic marrow

who presented with renal insufficiency (serum creatinine of

>170 µmol/L) were treated only with danazol. PNH patients

who did not have marrow hypoplasia were treated with oral

prednisolone at 1 mg/kg PO along with danazol at 100 mg

twice daily, which was slowly increased to 400 mg/day if

there was no response. After response was achieved, oral

corticosteroids were tapered to a level of 7.5-10 mg PO daily

over a course of 6-8 weeks.

If the patient had a prior thrombotic episode and there was

no response with either prednisolone and cyclosporine, the

patient was warned about the risk of danazol in precipitating

thrombosis. If the platelet count was greater than 50x10 9 /L,

the patient was started on thromboprophylaxis with lowdose

warfarin to maintain an international normalized ratio

(INR) of 1.5-2.0 along with danazol at the lowest possible

dose.

The patients had imaging and other studies done as per

the requirements of their individual cases. In addition, all

patients received a combination of oral iron and folic acid in

addition to immunosuppressive and danazol therapy.

Results

The clinical presentations of the 32 patients are given in

Table 1. Twelve patients presented with marrow hypoplasia

and they received either danazol or immunosuppressive

therapy, or immunosuppressive therapy and danazol.

Twenty patients did not have any marrow hypoplasia and

they were started with a combination of corticosteroids and

danazol orally. The details of these patients are presented in

Table 2.

During the course of follow-up, 5 patients died (16%).

One died due to massive gastrointestinal bleeding, 2 due to

stroke, 1 due to cerebral venous thrombosis, and 1 due to

intraventricular (cardiac) thrombosis. Out of 32 patients,

13 (40%) had complete response and 12 had (38%)

partial response, while 2 patients, i.e. 1 receiving only

danazol and 1 receiving danazol and prednisolone, did not

respond. Hence, 25/32 (78%) patients with PNH had some

response to therapy. There were 4/13 complete responses

in hypoplastic PNH (33%) cases compared to 9/20 (45%)

in PNH cases without marrow hypoplasia. This difference

was statistically significant (chi-square test, p<0.01). Twelve

Table 1. Clinical feature at presentation of 32 PNH patients.

Parameter Total PNH with hypoplastic

marrow

368

PNH with non-hypoplastic

marrow

Number of patients 32 13 19

Age (years) 14-60 14-48 22-60

Male:female 5:3 2:1 3:1

Symptoms <1 year before diagnosis 22 9 13

Anemia (Hb<70 g/L) 32 13 19

Bleeding 14 10 4

Jaundice 18 4 14

Hemoglobinuria 18 5 13

Thrombosis 9 4 5

Pancytopenia 22 12 10

Median Hb (g/L) – 5.1 6.1

Median ANC (µL) – 1000 1400

Median platelet count (10 9 /L) – 40.000 56.000

>2% reticulocyte count 22 7 15

Renal failure 4 4

Abnormal karyotype 0 0 0

Positive urine hemosiderinuria 28 8 20

Negative marrow iron 22 8 14




Table 2. Response of PNH patients to different therapeutic modalities (N=32).

Treatment Response Partial response No response Death

Cyclosporine only (1) 1 0 0 0

Danazol only (4) 1 2 1 0

Cyclosporine + danazol (7) 2 4 0 1

Prednisolone + danazol (20) 9 6 1 4

Total (32) 13 12 2 5

out of 32 patients (38%) needed interruption of treatment

because of danazol-induced derangement of liver function

(10/24) or cyclosporine-induced renal dysfunction (2/8).

This interruption was temporary and did not prevent

continuation of therapy. Nine patients had evidence of

stroke at presentation.

Four patients with hypoplastic marrow had prior

thrombosis, and all of them had low platelet counts and did

not respond to cyclosporine therapy alone; hence, danazol

was added to this group’s treatment without anticoagulation

and none of these patients had developed thrombosis upon

follow-up. Five patients in the non-aplastic group had

thrombosis at presentation and none of them developed

any future thrombotic complications. These patients were

on low-dose warfarin with a target INR of 1.5-2.0 as their

platelet counts were above 30x10 9 /L .

Discussion

In the present study, 32 patients with confirmed PNH

were treated with various combinations of prednisolone,

danazol, and cyclosporine. Cyclosporine was used in those

patients who had marrow hypoplasia with PNH. Danazol was

added to cyclosporine after 3 months if the cyclosporine was

ineffective. One out of 8 patients responded to cyclosporine

only and 1/4 had complete response to danazol only,

while in 2/7 a complete response was seen when danazol

was added to cyclosporine. Hence, in hypoplastic PNH

either cyclosporine or danazol alone is less effective (12%

and 25% response, respectively) than the combination of

cyclosporine and danazol (30% response). In other groups

in which danazol and oral corticosteroids were used, there

were better complete response rates (9/20, 45%; chi-square

test, p<0.05), but death was significantly increased in this

group: 4/20 (20%) as compared to 1/12 (8%). All of the

deaths were due to thrombohemorrhagic complications.

There are no randomized trials demonstrating the efficacy

of oral steroids in decreasing hemolysis in PNH, but they

are still used in the treatment of acute episodes due to their

immediate effects. However, continued use of high dosages of

corticosteroids is associated with substantial side effects and

hence the International PNH Interest Group recommends its

use in pulse doses for controlling acute attacks of hemolysis

[5]. It appears that steroids inhibit the activation of

complements by an alternate pathway to prevent hemolysis

[6]. In a prior study, the effect of danazol for PNH efficacy

was shown in 4/5 cases of classical PNH refractory to other

conventional treatments [7]. This result is similar to our

results in 4 patients for whom only danazol was used. How

danazol works in PNH is not clearly known, but resistance

to osmotic lysis is likely to be one of the mechanisms for

its activity [7]. Cyclosporine has been used as a treatment

modality for hypoplastic anemia in association with other

immunosuppressive drugs like anti-thymocytic globulin [8].

Our rationale for giving cyclosporine to our PNH patients

along with danazol seems to be fully justified based on the

results showing complete or partial response in 7/7 (100%)

patients receiving this combination. However, danazol was

important in this group because cyclosporine alone, when

used without danazol, was useful only in 1/8 patients. The

present study shows that hypoplastic PNH is best treated by

a combination of cyclosporine with danazol. We could not

use anti-thymocytic globulin or anti-lymphocytic globulin

for our patients with severely aplastic marrow because of

financial constraints, and due to the same reason we could

not use eculizumab, which is even more costly than antithymocytic

globulin and anti-lymphocytic globulin.

As a majority of our patients received danazol and 4

of them died due to thrombotic complications while on

danazol, it may well be argued whether danazol could have

precipitated these thrombotic complications. PNH in its

natural course generally has a high rate of venous thrombosis,

reported to be as high as 39% [9]. Compared to that, our

figure was modest: 4/32 died of thrombotic complication

(12%) and 9/32 (28%) had thrombosis at presentation.

With such a high background rate of thrombosis, it does not

appear that danazol increased the rate significantly.

Eculizumab is a useful medicine for PNH as it not

only reduces hemolysis but also reduces the frequency

of thrombosis, proving conclusively the role of activated

complement components in the pathogenesis of thrombosis

in this condition [4]. However, we were not able to use it

because of its cost; this is also the case with recombinant

erythropoietin, which has been used by some authors in

combination with corticosteroids [6]. Eculizumab has its

own serious side effects in the form of intense hemolysis

369




if the medicine is stopped suddenly, or bacterial meningitis

due to blockade of complement component C5a [4,5]. In

the present study, danazol, which was used in 31/32 patients

alone or in combination with cyclosporine or prednisolone,

led to 13 complete remissions and 12 partial remissions

(82% response) with freedom from red cell infusion. Hence,

danazol appears to be a useful medicine for the treatment

of PNH in developing countries where financial constraints

preclude the use of eculizumab.





included.

References

1. Brodsky RA. Paroxysmal nocturnal hemoglobinuria. In:

Hoffman R, Benz EJ, Shattil SJ, Furie B, Cohen HJ, Siberstein

LE, McGlave P (eds). Hematology: Basic Principles

and Practice, 4th ed. Philadelphia, Elsevier Churchill

Livingstone, 2005.

2. Parker C, Omine M, Richards S, Nishimura J, Bessler M,

Ware R, Hillmen P, Luzzatto L, Young N, Kinoshita T, Rosse

W, Socié G; International PNH Interest Group. Diagnosis

and management of paroxysmal nocturnal hemoglobinuria.

Blood 2005;106:3699-3709

3. Saraya AK, Saxena R, Dhot PS, Rattan A. Metronidazole:

a potential therapeutic agent in paroxysmal nocturnal

hemoglobinuria. Am J Hematol 1994;47:150-151.

4. Hillmen P, Young NS, Schubert J, Brodsky RA, Socié G,

Muus P, Röth A, Szer J, Elebute MO, Nakamura R, Browne P,

Risitano AM, Hill A, Schrezenmeier H, Fu CL, Maciejewski

J, Rollins SA, Mojcik CF, Rother RP, Luzzatto L. The

complement inhibitor eculizumab in paroxysmal nocturnal

hemoglobinuria. N Engl J Med 2006; 355:1233-1243.

5. Hill A, Stephen J, Hillmen P. Recent developments in the

understanding and management of paroxysmal nocturnal

haemoglobinuria. Br J Haematol 2007;137:181-192.

6. Bourantas K. High-dose recombinant human erythropoietin

and low dose corticosteroids for treatment of anemia in

paroxysmal nocturnal hemoglobinuria. Acta Haematol

1994;91:62-65.

7. Harrington WJ Sr, Kolodny L, Horstman LL, Jy W, Ahn YS.

Danazol for paroxysmal nocturnal hemoglobinuria. Am J

Hematol 1997;54:149-154.

8. Marsh JC, Ball SE, Darbyshire P, Gordon-Smith EC, Keidan

AJ, Martin A, McCann SR, Mercieca J, Oscier D, Roques AW,

Yin JA; British Committee for Standards in Haematology.

Guidelines for the diagnosis and management of acquired

aplastic anaemia. Br J Haematol 2003;123:782-801.

9. Hillmen P, Lewis SM, Bessler M, Luzzato L, Dacie JV. Natural

history of paroxysmal nocturnal haemoglobinuria. N Engl J

Med 1995;333:1253-1258.

370

Research Article

DOI: 10.4274/Tjh.2012.0142

An Experimental Study of Radiation Effect on Normal

Tissue: Analysis of HIF-1α, VEGF, eIF2, TIA-1, and TSP-1

Expression

Radyasyonun Normal Doku Üzerine Etkisiyle Alakalı Deneysel

Bir Çalışma: HIF-1 alfa, VEGF, eIF2, TIA-1 ve TSP-1

Ekspresyonlarının Analizi

Caner Aktaş1, Cengiz Kurtman2, M. Kemal Özbilgin3, İbrahim Tek4, Selami Koçak Toprak5

1 Bülent Ecevit University School of Medicine, Department of Radiation Oncology, Zonguldak, Turkey

2 Ankara University School of Medicine, Department of Radiation Oncology, Ankara, Turkey

3 Celal Bayar University School of Medicine, Department of Histology and Embryology, Manisa, Turkey

4 Medicana International Hospital, Department of Medical Oncology, Ankara, Turkey

5 Başkent University School of Medicine, Department of Hematology, Ankara, Turkey

Abstract:

Objective: This study investigated whether or not the stress and hypoxia, which are the effects of radiation on normal

vascular endothelium, leading to the release of HIF-1α, VEGF, eIF2, TIA-1, and TSP-1 were related and the possibility of them

stimulating angiogenesis.

Materials and Methods: Twenty-four male Swiss Albino mice were separated into 4 groups. The first group was the

control group (Group 1), and the second, third, and fourth groups were euthanized after 24 h (Group 2), 48 h (Group 3),

and 7 days (Group 4), respectively. A single-fractioned 10 Gy of ionizing radiation was applied to all mice’s pelvic zone with

Co-60. Bladders were removed completely from the pelvic region. Immunohistochemistry and light microscopy were used to

investigate whether there would be an increase or not in the angiogenesis pathway by using the HIF-1α, VEGF, eIF2, TIA-1,

and TSP-1 antibodies.

Results: The HIF-1α antibody showed strong staining in Group 3, while the staining intensity was less in other groups. VEGF

showed weak staining in Groups 1 and 4, while moderate staining in Group 2 and strong staining in Group 3 was observed.

eIF2 showed strong staining in Groups 1 and 4. Groups 2 and 3 were stained weakly. In the present study, staining with TSP-1

was very strong in the samples belonging to Group 1, while other groups showed very weak staining.

Conclusion: When normal tissue was exposed to radiation, the positively effective factors (HIF-1, VEGF, eIF2, and TIA-

1) on the angiogenesis pathway were increased while the negative factor (TSP-1) was decreased. Radiation may initiate

physiological angiogenesis in the normal tissue and accelerate healing in the damaged normal tissue.

Key Words: Angiogenesis, Radiation, Cancer and normal tissue, Vascular endothelium, HIF-1α, VEGF, eIF2, TIA-1, TSP-1

Address for Correspondence: Selami Koçak TOPRAK, M.D.,

Başkent University School of Medicine, Department of Hematology, Ankara, Turkey

GSM: +90 532 656 02 06 E-mail: sktoprak@yahoo.com

Received/Geliş tarihi : October 3, 2012

Accepted/Kabul tarihi : February18, 2013

371


Aktaş C, et al: Radiation Effect on Normal Tissue

Özet:

Amaç: Çalışmada, radyasyonun normal vasküler endotelde oluşturduğu stres ve hipoksiye bağlı olarak HIF-1α, VEGF,

eIF2, TIA-1 ve TSP-1 ekspresyonu ile bunların aralarında ilişki olup olmadığı ve bu ekspresyonlar neticesinde anjiojenezin

uyarılabileceği hipotezi araştırılmıştır.

Gereç ve Yöntemler: Bu amaç ile 24 adet erkek Swiss albino fare, kontrol grubu (1. Grup) ve sırasıyla 24 saat (2. Grup),

48 saat (3. Grup) ve 7. Günde (4. Grup) ötanazi uygulanmak üzere 4 gruba ayrıldı. Co-60 cihazı ile pelvis bölgesine tek

fraksiyonda 10 Gy iyonize radyasyon uygulandı. İmmünhistokimyasal metod ve ışık mikroskobu yöntemi ile HIF-1α, VEGF,

eIF2, TIA-1 ve TSP-1 antikorları kullanılarak mesane damar endotelinde anjiojenez yolunda yer alan faktörlerin ekspresyonları

değerlendirildi.

Bulgular: Çalışmamızda iyonize radyasyon ile mesane damar endotelinde HIF-1α antikoru ile 3. grupta kuvvetli boyanma

izlenirken diğer grupların boyanma şiddeti daha az idi. VEGF incelendiğinde, 1. ve 4. grupta zayıf boyanma izlenirken, 2. grupta

orta derecede, 3.grupta ise kuvvetli boyanma izlendi. eIF2, 1. ve 4. grupta kuvvetli boyanma göstermiş, 2. ve 3. grupta ise zayıf

boyanmıştı. TIA-1 ile yapılan değerlendirmede ise 1. grupta zayıf boyanma özellikleri gözlenirken, 2. ve 4. grup orta derecede, 3.

grupta ise oldukça kuvvetli boyanma izlendi. Çalışmamızda TSP-1 ile boyanma 1. grup örneklerde oldukça kuvvetli gözlenirken,

diğer gruplarda boyanma özellikleri oldukça zayıf izlendi.

Sonuç: Radyasyon uygulaması ile normal dokuda anjiojenez yolundaki pozitif etkili faktörlerin (HIF-1α, VEGF, eIF2, TIA-

1) arttığı görülürken, negatif etkili faktörün (TSP-1) düştüğü belirlendi. Bu sonuç ile radyasyona yanıt olarak normal dokuda

fizyolojik anjiojenezin başlatılarak doku iyileşmesinin hızlandırılmaya çalışıldığı düşünülmüştür.

Anahtar Sözcükler: Anjiojenez, Radyasyon, Kanser ve normal doku, Vasküler Endotel, HIF-1α, VEGF, eIF2, TIA-1, TSP-1

372

Introduction

Treatments with radiotherapy targeting tumor cells and

tissues can lead to potentially lethal and sublethal damage

in vascular and perivascular structures, normal tissues, and

cells. Tumor cells with good vasculature are more sensitive

to radiation, while tumoral structures with poor oxygenation

are more resistant to radiation [1]. The response of the

normal vascular endothelium and tumor vasculature to

radiation treatment is important.

Radiation treatment leads to direct cell death by

developing fractures in the double-helical DNA structure,

while the development of reactive oxygen species (ROS)

is another reason for cell death [2]. ROS and the nuclear

factor kappa B and interleukin-8, together with the factors

that act on angiogenesis, can start the production of vascular

endothelial growth factor (VEGF) in an independent

pathway with the hypoxia-inducible factor (HIF) [3,4].

With the ionizing, oxidative, and reductive effects of

radiation, factors like HIF, the endogenous mitogenic VEGF,

the eukaryotic initiation factor 2 (eIF2) that determines the

response of the cell towards stress, and T-cell intracytoplasmic

antigen-1 (TIA-1) can be released [5]. Thrombospondin-1

(TSP-1) is the endogenous antiangiogenic factor, which

can inhibit these factors that can be released as a response

to stress [6]. It is known that factors other than TSP-1 are

released during angiogenesis.

The aim of this study is immunohistochemical

determination of VEGF, which can be released with the

increase of HIF-1a, being the positive factor that can start

physiological angiogenesis as a response to the stress that

develops in normal vascular endothelium as a result of

radiation and hypoxic states; TIA-1, which determines

apoptosis; levels of endogenously released TSP-1, which can

inhibit angiogenesis; and eIF2, which is known to determine

stress granules. Furthermore, by exposing normal vascular

endothelium to ionizing radiation, the relation between

negatively influencing TSP-1 and the positive factors HIF-

1, VEGF, eIF2, and TIA-1 of angiogenesis pathways is

investigated. The present study tries to determine the varying

conditions of HIF-1a, VEGF, eIF2, TIA-1, and TSP-1, all of

which play a role on angiogenesis signaling pathways, and

their interrelations by the immunohistochemical method at

24 h, 48 h, and 7 days.


A total of 24 healthy, male, adult Swiss Albino mice,

weighing 30-40 g, were obtained from the Gazi University

Experimental Animal Laboratory and used as subjects. The

subjects were isolated from stress and noise and fed with

water and food ad libitum at 25 °C in a cycle of 12 h of

dark and 12 h of light before being included in the study.

Care of the subjects was performed at the Gazi University

Experimental Animal Laboratory throughout the study.

The subjects were divided into 4 groups, the first being the

control group and each containing 6 mice. Except for the 6

subjects in the control group, mice were exposed to ionizing

radiation at their pelvic region on the same day with the Co-

60, 780-C device present in the Department of Radiation

Oncology of Gazi University School of Medicine, applied to

a region with 5 a 23 cm dimensions with a source-to-surface

distance of 80 cm for 10.7 min with a 1000 cGy dose for

Dmax in a single fraction. For obtaining sedation before the

procedure, intramuscular ketamine injection at a dose of 45-

50 mg/kg was performed. In the field, 5 mice were fixed at

the prone position.



The 6 mice in Group 1 (control) were not exposed to

any radiation. Euthanasia by the method of cardiac puncture

blood collection on the first day was performed, following

sedation with 45-50 mg/kg intramuscular ketamine

injection. After euthanasia, the pelvic region was dissected

and the bladder was completely removed.

The 6 mice in Groups 2, 3, and 4 were sedated with 45-

50 mg/kg intramuscular ketamine injection 24, 48, and 168

h after their pelvic region was exposed to a single fraction

of 1000 cGy ionizing radiation, respectively, and euthanasia

by cardiac puncture blood collection was performed. After

euthanasia, the pelvic region was dissected and the bladder

was completely removed.

All samples were first washed in a solution containing

10% formol and then placed in screw-cap sampling

containers containing 10% formol, with separate boxes used

for every animal.

The tissue samples taken after the procedure were

embedded into paraffin following the routine light

microscopy paraffin tissue method at the Department

of Histology and Embryology of Celal Bayar University

School of Medicine. Slides of 5 µm were evaluated with the

indirect immunohistochemistry method by using HIF-1α

(monoclonal antihuman/mouse HIF-1α antibody, cat. no.

ab463; Abcam, Cambridge, MA, USA), VEGF (antimouse

VEGF antibody; Santa Cruz Biotechnology, Santa Cruz, CA,

USA ), TIA-1 (cat. no. ab40693; Abcam), eIF2 (anti-eIF2α

antibody, sc-11386; Santa Cruz Biotechnology), and TSP-1

(anti-thrombospondin-1 antibody, cat. no. ab79450; Abcam)

primary antibodies.

In the control and experimental groups, the vascular

endothelial cells of the bladder tissue were compared with

the immunohistochemical method. The effect of ionizing

radiation at 24 h, 48 h, and 7 days on HIF-1α, VEGF, eIF2,

TIA-1, and TSP-1 levels that play their role in angiogenesis

signaling pathways was evaluated and scored under light

microscope in accordance with groups for every parameter.

The intensity of staining was evaluated for every

preparation as 1 (weak), 2 (medium), or 3 (strong). The

number of stained cells in every field was determined as a

percentage and, finally, the histochemical score (H score) of

each subject was obtained.

The study protocol was approved by the local ethics

committee for animal experimentation.


Analyses of data were performed with SPSS 15.0 for

Windows. As the variables used in the study were in

accordance with normal distribution, the Shapiro–Wilk test

was used, and as the P-values in the test were significant

at >0.05, it was concluded that the data were distributed

normally.

During intergroup comparisons of variables, one-way

analysis of variance (ANOVA) was used as the number of

subgroups exceeded 2. The variance analysis test revealed

that the difference between groups was significant. Paired

comparisons of groups that were found to be significant with

the ANOVA test were performed and the paired comparison

of groups with homogeneous variance (equal variance)

was made with the Tukey test, while the Tamhane test was

used for the comparison of nonhomogeneous groups. The

confidence level was accepted as 95% in the performed

statistical evaluations.

Results

When the hematoxylin-eosin–stained preparations of

bladder samples were investigated with the histochemical

technique, the bladder lumen in Group 1 (control) was

covered with folded and transitional epithelium and the

epithelial thickness was in general 5 or 6 layers. The lamina

propria under the epithelium consisted of collagen fibers.

These collagen fibers were distributed irregularly. Various

blood vessels and additional fibroblasts, which are connective

tissue cells, were observed within the lamina propria. Under

the lamina propria, longitudinal muscle fibers were observed

at the inner and outer layers, while circular fibers were seen in

the middle. Bladder tissue samples of the experimental groups

also revealed transitional epithelium coverage and underlining

lamina propria. Slight edema was especially observed in

Groups 2 and 3, different from Group 1 (Figure 1).

When the tissue samples were investigated with the

histochemical technique, it was seen that Groups 4 and 1

were very weakly stained, while Group 2 showed medium

immunoreactivity in preparations stained with the VEGF

antibody. VEGF immunoreactivity was shown by a high

level of staining in Group 3 (Figure 2).

Variance homogeneity test results for the VEGF variable

showed that the intergroup variance was homogeneous

(P=0.099; P>0.05) and the Tukey test was performed.

According to the VEGF Tukey honestly significant difference

Figure 1. Hematoxylin-eosin staining properties of the

bladder in Group 1 (a), Group 2 (b), Group 3 (c), and

Group 4 (d). Ep = epithelium, LP = lamina propria.

373



multiple comparison test, there was a statistically significant

difference between the control group and Groups 2 and 3

(P = 0.009 and 0.000). However, there was no statistically

significant difference between Group 4 and the control group

(P = 0.386). Groups 2 and 3 were significantly different from

the other groups (P = 0.009, 0.000, and 0.000). Although

there was no statistically significant difference between

Group 4 and the control group, Group 4 was significantly

different from Groups 2 and 3 (P=0.386, 0.000, and 0.000).

The eIF2 antibody staining of Groups 1 and 4 revealed

very strong staining at vessel walls. In Groups 2 and 3,

however, the staining was medium and showed almost

similar properties (Figure 3).

According to the eIF2 Tamhane multiple comparison

test, the difference between Group 1 and Groups 2 and 3

was statistically significant (P = 0.000 and 0.001). There was

no statistically significant difference between Group 4 and

Figure 2. Staining properties of the bladder with VEGF

antibody in Group 1 (a), Group 2 (b), Group 3 (c), and

Group 4 (d). Ep = epithelium, LP = lamina propria.

the control group (P = 0.989). Groups 2 and 3 significantly

differed from the control group and Group 4 (P=0.002 and

0.001). When Group 4 was examined, the difference from

Groups 2 and 3 was statistically significant (P=0.002 and

0.006).

Staining with the HIF-1α antibody was strong in Group

3, while the degree of staining in other groups was very little

(Figure 4).

According to the HIF-1 Tukey honestly significant

difference multiple comparison test, although the control

group was statistically significantly different from Group

3 (P=0.000), no statistical difference could be revealed

between the control group and Groups 2 and 4 (P=0.253

and 0.960). Group 2 was significantly different from Group

3 (P = 0.005), but no statistically significant difference could

be determined for Groups 1 and 4 (P=0.253 and 0.1). Group

3 was statistically different from other groups (P=0.000,

0.005, and 0.000). Group 4 was significantly different from

Group 3 (P=0.000). Group 4 was not significantly different

from the control group and Group 2 (P=0.960 and 0.1).

When tissue samples stained with the TIA-1 antibody

were examined, Group 3 showed strong staining while

Groups 2 and 4 had medium staining. Samples of the control

group were weakly stained (Figure 5).

According to the TIA-1 Tamhane multiple comparison

test, the control group was significantly different from

Groups 2, 3, and 4 (P=0.000, 0.000, and 0.013). Group 2

was significantly different from Group 3 and the control

group (P=0.003 and 0.014). There was no significant

difference between Groups 2 and 4 (P=0.809). Group 3

was significantly different from the other groups (P=0.000,

0.014, and 0.000). Group 4 was statistically significantly

different from Group 3 and the control group (P=0.013 and

0.000). However, the difference between Groups 4 and 2 did

not reach statistical significance (P=0.809).

Figure 3. eIF2 staining properties of the bladder in Group

1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep =

epithelium, LP = lamina propria.

374

Figure 4. HIF-1 staining properties of the bladder in Group





Staining with TSP-1 was strong in the control group,

while staining properties in other groups were seen at low

levels (Figure 6).

According to the TSP-1 Tamhane multiple comparison

test, the control group was statistically significantly different

from the other groups (P=0.000, 0.000, and 0.000).

Figure 5. TIA-1 staining properties of the bladder in Group



Figure 6. TSP-1 staining properties of the bladder in Group



Table 1. Staining properties of all groups.

G1 G2 G3 G4

VEGF + ++ ++++ +

eIF2 ++++ ++ ++ ++++

HIF-1α + ++ ++++ +

TIA-1 + ++ ++++ ++

TSP-1 ++++ + + +

G: Group. Weak (+), medium (++), and strong (++++) staining.

Although Group 2 was statistically significantly different

from the control group (P=0.000), no significant difference

could be revealed between Groups 3 and 4 (P=0.998 and

0.533). Group 3 was statistically significantly different

from the control group (P=0.000). However, Group 3 was

not statistically significantly different from Groups 2 and

4 (P=0.998 and 0.169). Although Group 4 was statistically

significantly different from the control group (P=0.000), no

significant difference could be revealed between Groups 2

and 3 (P=0.553 and 0.169).

The staining properties of all groups are given in Table 1.

Discussion

The sensitivity of tumor cells to radiation is important

in treatment. However, the interest in the radiotherapeutic

response for nontumor cell targets has been increasing.

Ischemic and hypoxic stress is the most important

condition for pathological and physiological angiogenesis

[7]. Vascular endothelial cells have been observed to be

the critical determinant in both the normal and tumoral

tissue. In primary targets, the degree of radiation damage

in the endothelial cells can significantly affect the treatment

response [8]. Depending on tumor vasculature, phenotype,

and microenvironment, it is different for normal tissue

vasculature. The most important molecular difference of

tumoral endothelial cells is their close relation with tumorrelated

cytokines [7,9,10]. VEGF and similar proteins

released by the tumoral and normal tissues can send signals

developing angiogenesis response by attaching to the

tyrosine kinase receptor of the endothelial cell. Thus, the

radiation resistance of tumoral endothelial cells can depend

on tumor-related cytokines. Selective tumor vasculature

targeting these cytokines can increase sensitivity to radiation

[7,8,10].

It is suggested that the major determinant of

radiotherapeutic response is tumor vasculature [11]. This

relation shows that in addition to radiotherapy leading

to direct cell death, the damage it causes to the vessels

supplying the tumor leads to secondary cell death. As tumors

need their vessels to survive, a small amount of damage in

these vessels can lead to larger amounts of tumoral death.

It is reported that tumors sensitive to radiotherapy have

good vasculature, while tumors with little vasculature are

more resistant to radiation [11]. In a study reported by

Gorski et al., the way in which tumor vasculature affects

radiotherapeutic response was evaluated, and it was stressed

that radiotherapy increased VEGF release while VEGF was

responsible for the resistance of endothelial cells to radiation

[12]. This study showed that the tumor actively protects its

vasculature from radiation damage. In certain other studies,

similar results were obtained on the role of the combination

of antiangiogenic agents and radiotherapy in improving

endothelial cell sensitivity to radiation [13,14,16].

It is known that HIF-1α is activated in the event of hypoxia

in normal tissues and solid tumors. Many studies have

shown that, during hypoxia, HIF-1α is the main regulator of

physiologic and pathologic angiogenesis signaling pathways.

Normal tissue studies performed with radiation showed

375



that as a result of HIF-1 increase, levels of VEGF, which is

a positive influencing factor of the angiogenesis pathway,

are also increased [17]. When the organism is exposed to

factors like stressing radiation, heat, hypoxia, ischemia, and

infection, stress granules that contain approximately half

mRNA are activated. These granules change cell metabolism

in the recovery of stress-related damage. eIF2 and TIA-1

act in change and adaptation. While formation of granules

decreases eIF2 levels by eIF2 phosphorylation, TIA-1 levels

are increased under the influence of stressing factors. TSP-

1, which acts as an inhibitor endogenously on angiogenesis

signaling pathways, is found at certain levels in normal

tissue [18]. Higher levels of HIF-1 and VEGF, which increase

with stressing factors in normal tissue studies, lead to TSP-

1 down-regulation, while decreased VEGF leads to TSP-1

up-regulation. This is explained by the VEGF-mediated

negative feedback mechanism.

Following exposure to radiation, VEGF, which acts on

the angiogenesis signaling pathways, was increased. In the

present study, all immunohistochemical evaluations revealed

that VEGF staining was weak in Groups 1 (control) and

4 (euthanasia on day 7), medium in Group 2 (euthanasia

after 24 h), and strong in Group 3 (euthanasia after 48

h). These findings show that at the vessel endothelium of

tissues exposed to radiation, VEGF levels are increased

slightly in vascular endothelial cells exposed to stress 24

h after radiation and strongly at 48 h. This increase was

thought to be related to the strong increase of HIF-1α at

48 h. In the study by Rabbani et al., VEGF levels increased

with the increase in HIF-1α [17]. The release of VEGF is an

important process in angiogenesis signaling pathways and

ionizing radiation increases VEGF release by increasing HIF-

1α [12,17]. However, we determined that levels of HIF-1α

and VEGF had regressed to control group levels at day 7. We

administered a single fraction of 10 Gy of ionizing radiation.

This may be the reason for the regression observed in HIF-

1α and VEGF levels back to the control group levels at day

7. Imaizumi et al. in 2010 performed an animal study on

normal tissues and revealed results similar to ours [19]. They

exposed healthy mice to 1 fraction of 8 Gy, 15 Gy, and 20

Gy total body irradiation and observed that the VEGF levels

of aortic endothelial cells decreased in comparison to the

control group after 5 days. They concluded that high doses

of ionizing radiation stopped endothelial cell proliferation,

migration, and budding. It was indicated that in the tumoral

environment, endothelial cells are not silent; they continue

to multiply and are related to the microenvironment.

However, it was also stated that, with radiation exposure,

de novo angiogenesis was blocked, but the recurrence in

irradiated areas being more resistant than the recurrence

in nonirradiated areas could be because of the radiationrelated

inhibition of de novo angiogenesis. Our results are

in accordance with this study. In our study, we observed that

following radiation exposure, HIF-1α and VEGF, which are

the positive influencing factors of the angiogenesis pathway,

were increased immunohistochemically at 48 h and had

regressed to the control group levels on day 7. In the study

by Imaizumi et al., HIF-1 levels influenced by the hypoxic

stress that could depend on radiation were not measured.

376

In our study, after a single fraction of 10 Gy of radiation

exposure, the increase in HIF-1α and VEGF at 48 h was

determined immunohistochemically. Similarly, in the study

by Rabbani et al., VEGF levels increased following the

increase in HIF-1 levels [17]. This shows that after normal

tissue radiation exposure, the positive influencing factors

(HIF-1, VEGF) of the angiogenesis pathway are increased.

VEGF increases the radiation resistance of the endothelial

cells. Dicker et al. stated that the negative influence of this

response can be eliminated with antiangiogenic medications

and in their study performed on normal animals, along with

radiation exposure, they used Cox-2 inhibitors that have a

positive influence on the VEGF level of the angiogenesis

pathway and succeeded in increasing apoptosis while

inhibiting proliferation and migration [20].

It was reported that HIF-1 levels were regulated by the

oxygen concentration, and following radiation treatment,

tumor oxygenation changes with HIF-1 up-regulation

[7,21]. Radiotherapy-induced HIF-1 activation is also related

to reoxygenation [21]. In our study, among preparations

stained with the HIF-1α antibody, Group 3 showed strong

staining, while the degree of staining in other groups was

significantly less. HIF-1α levels reaching their highest at 48 h

showed that the hypoxic state, which depends on radiation,

can be regulated with the increase in HIF-1α. Nevertheless,

it is not correct to relate this condition to apoptosis. In

tumoral tissues, the apoptosis in endothelial cells peaks at

4-8 h following radiation and the vascular damage typically

starts after 48 h. However, the rate of endothelial cells

entering apoptosis is between 0% and 8% following clinical

doses of radiotherapy [13]. Li et al. performed a radiationrelated

apoptosis study on the vascular endothelial cells

of nontumoral tongue tissue in rats and observed that the

rates of apoptosis on days 5, 8, 14, 21, and 28 were 78.3%,

89.3%, 83.5%, 69.3%, and 47.3%, respectively [22]. Their

findings support the finding that apoptosis does not happen

at the same time in tumoral and nontumoral environments.

Although apoptosis is stimulated by radiation in general,

the main death mechanism may not be apoptosis in many

cell types [23]. In our study, a single fraction of 10 Gy of

radiation was given and the staining in HIF-1α was strong

at 48 h; if fractioned radiation were used, different results

could be obtained.

The RNA granules that emerge in mammalian cells

exposed to heat, oxidation, radiation, and hypoxia are called

stress granules. As a response to stress, the mammalian cell

mRNA changes its cell metabolism for repairing stress-related

damage. During this change and adaptation, RNA-binding

TIA-1 also plays a role in the relation between eIF2 and stress

granules [7,24,25,26]. When stress occurs once in the cell, the

granules are depolarized. Kedersha and Anderson defined this

in 2002 [26]. Stress granules can emerge in tissues exposed

to stress a few hours before apoptosis. Stress granules can

regulate protein translation in neurons during ischemia. Stress

granules do not develop in environments in vitro because

response to stress can only emerge in the microenvironment

in vivo [7,26]. In our study, the eIF2 antibody showed strong

immunohistochemical staining in the control group and



Group 4, while weak staining was observed in Groups 2 and

3. Following irradiation of bladder vessel endothelium, the

eIF2 level was lower than that of the control group at 24 h,

then showed the tendency to increase at 48 h and reached the

level of the control group on day 7. Stress granules can emerge

in 15-30 min after the organism is exposed to stress. The eIF2

level decreases following its phosphorylation. The decrease in

eIF2 levels in Group 2 confirms this. In tissues exposed to

stress, stress granules emerge a few hours before apoptosis.

During this change and adaptation, RNA-binding TIA-1 plays

a role in the relation between eIF2 and stress granules [7].

The increasing tendency of eIF2 levels at 48 h and on day 7

can indicate the start of apoptosis and/or the cells’ recovery

from stress [7,24,25,26]. This is supported in the study of Li

et al. They determined apoptosis on day 5 [22]. eIF2 staining

could have increased at 48 h and on day 7 because of apoptosis

and/or the cells’ recovery from stress. However, in our study,

apoptosis could not be determined; only the factors that

increase and decrease before apoptosis were histochemically

observed. Our method was not convenient for determining

apoptosis.

In our study, the immunohistochemical evaluation

performed with the TIA-1 antibody revealed that the control

group was weakly stained, while Groups 2 and 4 showed

medium staining and Group 3 was very strongly stained. This

showed that no stressing factor existed in the control group,

while in Groups 2 and 3, TIA-1 levels started to increase

depending on stressing factors and reached a maximum in

Group 3.

TSP-1 is our only variable with a negative influence

on angiogenesis signaling pathways. Ischemic or hypoxic

stress is the most important condition for pathological or

physiological angiogenesis [8]. Although many factors

positively control the pathological and physiological

pathways of angiogenesis, the most important endogenous

regulator in down-regulation is TSP-1. TSP-1 prevents

formation of vessel lumen [18,27]. In our study,

immunohistochemical staining with the TSP-1 antibody

revealed that the control group was very strongly stained,

while staining in the other groups was very weak. However,

the mean TSP-1 level at day 7 showed the tendency to

increase when compared to the mean levels at 24 and 48

h. This can be explained as follows: in our study, at the

angiogenesis pathway that was the result of radiation-related

hypoxia, the positive influencing factor HIF-1α, which is

stressing, showed strong staining in Group 3 while staining

weakly in Group 4. eIF2, which is the determinant of stress

granules, showed weak staining in Groups 2 and 3, while

getting close to control group levels in Group 4. Under the

influence of the stressing factor, TIA-1 showed medium

staining in Group 2 and strong staining in Group 3, while

regressing to the control group levels in Group 4. VEGF

showed strong staining in Group 3. Increased levels of

positive influencing factors can explain TSP-1, which acts as

an endogenous inhibitor at the angiogenesis pathway, being

weakly stained in Groups 2 and 3, while the slight increase

in staining in Group 4 can be explained as the decrease in

positively influencing factors of the angiogenesis pathway

leading to the increased immunohistochemical staining of

TSP-1. At the endothelial cells of the irradiated vessel, the

hypoxic stress can lead to the release of HIF-1 or indirect

HIF-1 increase by the increase in ROS, and VEGF release

[7]. The positively influencing factors (HIF-1α, VEGF, eIF2,

and TIA-1) of the angiogenesis pathway could be stimulated

and this might have decreased TSP-1, which is acting as

an endogenous angiogenesis inhibitor. Mean HIF-1α and

VEGF levels increased at 24 and 48 h because of stressing

factors and decreased after 7 days, and this can explain the

TSP-1 levels reaching the control group levels after 7 days.

Suzuma et al. reported that increased VEGF leads to TSP-

1 down-regulation, while decreased VEGF leads to TSP-1

up-regulation. This can be explained by a VEGF-mediated

negative feedback mechanism [28].

Conclusion

Serum levels of angiogenic cytokines decrease after

radiotherapy in patients with hematologic malignancy

and become undetectable in patients with complete

remission [29]. However, by exposing normal tissue to

radiation, we determined that the positively influencing

factors of the angiogenesis pathway increased, while the

negatively influencing factor decreased. Radiation can

start physiological angiogenesis in normal tissues and can

accelerate the healing of damaged normal tissue. The normal

and tumoral tissues respond to radiation differently. In the

future, molecular studies designed with fractioned doses

and diagnostic angiogenesis studies will lead to a better

understanding of this subject.

Conflicts of Interest Statement

None of the authors of this work have any conflicts of

interest, including specific financial interests, relationships,

and/or affiliations, relevant to the subject matter or materials

included.

References

1. Vaupel P, Mayer A. Hypoxia in cancer: significance and

impact on clinical outcome. Cancer Metastasis Rev

2007;26:225-239.

2. Bucci B, Misiti S, Cannizzaro A, Marchese R, Raza GH,

Miceli R, Stigliano A, Amendola D, Monti O, Biancolella M,

Amati F, Novelli G, Vecchione A, Brunetti E, De Paula U.

Fractionated ionizing radiation exposure induces apoptosis

through caspase-3 activation and reactive oxygen species

generation. Anticancer Res 2006;26:4549-4557.

3. Végran F, Boidot R, Michiels C, Sonveaux P, Feron O.

Lactate influx through the endothelial cell monocarboxylate

transporter MCT1 supports an NF-κB/IL-8 pathway that

drives tumor angiogenesis. Cancer Res 2011;71:2550-2560.

377



4. North S, Moenner M, Bikfalvi A. Recent developments in

the regulation of the angiogenic switch by cellular stress

factors in tumors. Cancer Lett 2005;218:1-14.

5. Anderson P, Kedersha N. Visibly stressed: the role of eIF2,

TIA-1, and stress granules in protein translation. Cell Stress

Chaperones 2002;7:213-221.

6. Taraboletti G, Rusnati M, Ragona L, Colombo G. Targeting

tumor angiogenesis with TSP-1-based compounds: rational

design of antiangiogenic mimetics of endogenous inhibitors.

Oncotarget 2010;1:662-673.

7. Moeller BJ, Cao Y, Li CY, Dewhirst MW. Radiation activates

HIF-1 to regulate vascular radiosensitivity in tumors: role

of reoxygenation, free radicals, and stress granules. Cancer

Cell 2004;5:429-441.

8. Gondhowiardjo S. Apoptosis, angiogenesis and radiation

treatment. Acta Med Indones 2004;36:100-108.

9. Dvorak HF. Rous-Whipple Award Lecture. How tumors make

bad blood vessels and stroma. Am J Pathol 2003;162:1747-

1757.

10. Moeller BJ, Dewhirst MW. Raising the bar: how HIF-1 helps

determine tumor radiosensitivity. Cell Cycle 2004;3:1107-

1110.

11. Garcia-Barros M, Paris F, Cordon-Cardo C, Lyden D, Rafii

S, Haimovitz-Friedman A, Fuks Z, Kolesnick R. Tumor

response to radiotherapy regulated by endothelial cell

apoptosis. Science 2003;300:1155-1159.

12. Gorski DH, Beckett MA, Jaskowiak NT, Calvin DP, Mauceri

HJ, Salloum RM, Seetharam S, Koons A, Hari DM, Kufe DW,

Weichselbaum RR. Blockage of the vascular endothelial

growth factor stress response increases the antitumor effects

of ionizing radiation. Cancer Res 1999;59:3374-3378.

13. Geng L, Donnelly E, McMahon G, Lin PC, Sierra-Rivera E,

Oshinka H, Hallahan DE. Inhibition of vascular endothelial

growth factor receptor signaling leads to reversal of tumor

resistance to radiotherapy. Cancer Res 2001;61:2413-2419.

14. Hess C, Vuong V, Hegyi I, Riesterer O, Wood J, Fabbro D,

Glanzmann C, Bodis S, Pruschy M. Effect of VEGF receptor

inhibitor PTK787/ZK222584 [correction of ZK222548]

combined with ionizing radiation on endothelial cells and

tumour growth. Br J Cancer 2001;85:2010-2016.

15. Kozin SV, Boucher Y, Hicklin DJ, Bohlen P, Jain RK, Suit

HD. Vascular endothelial growth factor receptor-2-blocking

antibody potentiates radiation-induced long-term control of

human tumor xenografts. Cancer Res 2001;61:39-44.

16. Lund EL, Bastholm L, Kristjansen PE. Therapeutic synergy

of TNP-470 and ionizing radiation: effects on tumor growth,

vessel morphology, and angiogenesis in human glioblastoma

multiforme xenografts. Clin Cancer Res 2000;6:971-978.

17. Rabbani ZN, Mi J, Zhang Y, Delong M, Jackson IL,

Fleckenstein K, Salahuddin FK, Zhang X, Clary B, Anscher

MS, Vujaskovic Z. Hypoxia inducible factor 1α signaling in

fractionated radiation-induced lung injury: role of oxidative

stress and tissue hypoxia. Radiat Res 2010;173:165-174.

18. Mizukami Y, Kohgo Y, Chung DC. Hypoxia inducible

factor-1 independent pathways in tumor angiogenesis. Clin

Cancer Res 2007;13:5670-5674.

19. Imaizumi N, Monnier Y, Hegi M, Mirimanoff RO, Rüegg

C. Radiotherapy suppresses angiogenesis in mice through

TGF-βRI/ALK5-dependent inhibition of endothelial cell

sprouting. PLoS One 2010;5:11084.

20. Dicker AP, Williams TL, Grant DS. Targeting angiogenic

processes by combination rofecoxib and ionizing radiation.

Am J Clin Oncol 2001;24:438-442.

21. Bussink J, Kaanders JH, Rijken PF, Raleigh JA, Van der Kogel

AJ. Changes in blood perfusion and hypoxia after irradiation

of a human squamous cell carcinoma xenograft tumor line.

Radiat Res 2000;153:398-404.

22. Li CY, Hong Y, Tao XA, Xia J, Cheng B. The correlation

between the severity of radiotherapy-induced glossitis and

endothelial cell injury in local tissues in a rat model. Med

Oral Patol Oral Cir Bucal 2011;16:711-715.

23. Abend M. Reasons to reconsider the significance of apoptosis

for cancer therapy. Int J Radiat Biol 2003;79:927-941.

24. Sparmann A, Bar-Sagi D. Ras-induced interleukin-8

expression plays a critical role in tumor growth and

angiogenesis. Cancer Cell 2004;6:447-458.

25. Xu L, Pathak PS, Fukumura D. Hypoxia-induced

activation of p38 mitogen-activated protein kinase

and phosphatidylinositol 3’-kinase signaling pathways

contributes to expression of interleukin 8 in human ovarian

carcinoma cells. Clin Cancer Res 2004;10:701-707.

26. Kedersha N, Anderson P. Stress granules: sites of mRNA

triage that regulate mRNA stability and translatability.

Biochem Soc Trans 2002;30:963-969.

27. Suri C, McClain J, Thurston G, McDonald DM, Zhou

H, Oldmixon EH, Sato TN, Yancopoulos GD. Increased

vascularization in mice overexpressing angiopoietin-1.

Science 1998;282:468-471.

28. Suzuma K, Takagi H, Otani A, Oh H, Honda Y. Expression

of thrombospondin-1 in ischemia-induced retinal

neovascularization. Am J Pathol 1999;154:343-354.

29. Ria R, Cirulli T, Giannini T, Bambace S, Serio G, Portaluri M,

Ribatti D, Vacca A, Dammacco F. Serum levels of angiogenic

cytokines decrease after radiotherapy in non-Hodgkin

lymphomas. Clin Exp Med 2008;8:141-145.

378

Research Article

DOI: 10.4274/Tjh.2012.0205

Arterial Stiffness and Pulse Wave Reflection in Young

Adult Heterozygous Sickle Cell Carriers

Genç Erişkin Heterozigot Orak Hücre Taşıyıcılarında Arteryel

Sertlik ve Nabız Dalga Yansıması

Tünzale Bayramoğlu 1 , Oğuz Akkuş 1 , Kamil Nas 2 , Miklós Illyes 3 , Ferenc Molnar 4 , Emel Gürkan 5 ,

M. Bayram Bashırov 6 , Şerafettin Demir 7 , Gamze Akkuş 5 , Esmeray Acartürk 1

1Çukurova University, Faculty of Medicine, Department of Cardiology, Adana, Turkey

2Szent János Hospital Department of Radiology, Budapest, Hungary

3Heart Institute Faculty of Medicine, University of Pécs, Pécs, Hungary

4Department of Hydrodynamic Systems, Budapest University of Technology and Economics, Budapest, Hungary

5Çukurova University, Faculty of Medicine, Department of Internal Medicine, Hematology, Adana, Turkey

6Çukurova University, Faculty of Medicine, Adana, Turkey

7Adana State Hospital, Department of Cardiology, Adana, Turkey

Abstract:

Objective: Pulse wave velocity (PWV) and aortic augmentation index (AI) are indicators of arterial stiffness. Pulse wave

reflection and arterial stiffness are related to cardiovascular events and sickle cell disease. However, the effect of these

parameters on the heterozygous sickle cell trait (HbAS) is unknown. The aim of this study is to evaluate the arterial stiffness

and wave reflection in young adult heterozygous sickle cell carriers.

Materials and Methods: We enrolled 40 volunteers (20 HbAS cases, 20 hemoglobin AA [HbAA] cases) aged between 18

and 40 years. AI and PWV values were measured by arteriography.

Results: Aortic blood pressure, aortic AI, and brachial AI values were significantly higher in HbAS cases compared to the

control group (HbAA) (p=0.033, 0.011, and 0.011, respectively). A statistically significant positive correlation was found

between aortic pulse wave velocity and mean arterial pressure, age, aortic AI, brachial AI, weight, and low-density lipoprotein

levels (p=0.000, 0.017, 0.000, 0.000, 0.034, and 0.05, respectively) in the whole study population. Aortic AI and age were

also significantly correlated (p=0.026). In addition, a positive correlation between aortic PWV and systolic blood pressure and

a positive correlation between aortic AI and mean arterial pressure (p=0.027 and 0.009, respectively) were found in HbAS

individuals. Our study reveals that mean arterial pressure and heart rate are independent determinants for the aortic AI. Mean

arterial pressure and age are independent determinants for aortic PWV.

Conclusion: Arterial stiffness measurement is an easy, cheap, and reliable method in the early diagnosis of cardiovascular

disease in heterozygous sickle cell carriers. These results may depend on the amount of hemoglobin S in red blood cells.

Further studies are required to investigate the blood pressure changes and its effects on arterial stiffness in order to explain

the vascular aging mechanism in the HbAS trait population.

Key Words: Sickle cell, Arterial stiffness, Pulse wave velocity, Quality of life

Address for Correspondence: Oğuz AKKUŞ, MD,

Çukurova University Faculty of Medicine, Department of Cardiology Yüreğir Street, Adana, Turkey

GSM: +90 532 668 58 70 E-mail: oakkusfb@gmail.com



379


Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

Özet:

Amaç: Nabız dalga hızı ve aort artırma indeksi arteryel sertliğin belirleyicileridir. Nabız dalga yansıması ve arteryel sertlik

kardiyovasküler olaylar ve orak hücre hastalığı ile ilişkilidir. Ancak bu belirteçlerin heterozigot orak hücre taşıyıcılarına

(HbAS) olan etkisi bilinmemektedir. Çalışmanın amacı genç erişkin heterozigot orak hücre taşıyıcılarında arteryel sertlik ve

dalga yansımasını değerlendirmektir.

Gereç ve Yöntemler: Çalışmaya 18-40 yaşlar arası 40 gönüllü (20 Hemoglobin AS, 20 Hemoglobin AA) dahil edildi.

Arttırma indeksi ve nabız dalga hızı arteriyografi ile ölçüldü.

Bulgular: Orak hücre taşıyıcılarında aort kan basıncı, aort artırma indeksi, brakiyal artırma indeksi değerleri kontrol grubuna

(HbAA) göre anlamlı yüksek saptandı (p=0,033, 0.011, 0,011). Tüm çalışma popülasyonunda aort nabız dalga hızı, ortalama

arter basıncı, yaş, aort artırma indeksi, brakiyal arttırma indeksi, kilo ve düşük yoğunluklu lipoprotein arasında istatistiksel

pozitif anlamlı korelasyon saptandı (p=0,000, 0,017, 0,000, 0,000, 0,034, 0,05). Aort artırma indeksi ve yaş arasında anlamlı

korelasyon bulundu (p=0,026). Orak hücre taşıyıcılarında aort nabız dalga hızı ve sistolik kan basıncı ile aort arttırma indeksi

ve ortalama arter basıncı arasında anlamlı pozitif korelasyonlar saptandı (p=0,027, 0,009). Çalışmamızda ortalama arter basıncı

ve kalp hızının aort artırma indeksi için, ortalama arter basıncı ve yaşın ise aort nabız dalga hızı için en önemli bağımsız

belirleyiciler olduğu görüldü.

Sonuç: Arteryel sertlik ölçümü HbAS taşıyıcılarında erken kardiyovasküler hastalık tanısı için kolay, ucuz ve uygun bir

yöntemdir. Bu sonuçlar kırmızı kan hücrelerindeki hemoglobin S miktarına bağlı olabilir. Heterozigot orak hücre taşıyıcılarında,

vasküler yaşlanma mekanizmasını açıklayabilmek için kan basıncı değişimlerinin arter sertliği üzerine olan etkilerini inceleyen

daha çok çalışmaya ihtiyaç vardır.

Anahtar Sözcükler: Orak hücre, Arteriyel sertlik, Nabız dalga hızı, Yaşam kalitesi

Introduction

Sickle cell disease (SCD) affects many systems as it

is a chronic and hemolytic autosomal recessive disease.

Atherosclerosis is a common finding in patients with

sickle cell anemia [1]. Moreover, the most common cause

of morbidity and mortality in these patients are ischemic

complications [2]. As a consequence of atherosclerosis,

arterial stiffness increases. Arterial stiffness causes a faster

reflection of the forward pulse wave from bifurcation points

in peripheral vessels. As a result of the new waveform,

systolic blood pressure (SBP) increases, diastolic blood

pressure (DBP) decreases, cardiac workload increases,

and coronary perfusion falls. The role of arterial stiffness

and wave reflection has been established in many studies

[3,4]. In addition, the relationship between SCD and pulse

wave reflection causing stroke has been demonstrated

[5]. These vascular complications develop as a result of

microvascular occlusion by dense and rigid sickle cells [6].

Inversely, due to lower blood pressure in the homozygous

sickle cell form (HbSS), aortic pulse wave velocity (PWV)

was found to be lower than in the healthy hemoglobin AA

genotype (HbAA) group [7]. Pulse wave velocity (PWV) is

a susceptible diagnostic element, and it is also involved in

risk stratification for subclinical organ damage [8]. Based on

previous studies, if the change of wave reflection and arterial

stiffness are related to cardiovascular events, there is a need

for more investigations within sickle cell populations. In

this study we investigated the relationship between carriers

of heterozygous sickle cell (HbAS) and arterial stiffness

parameters.

Patients


Twenty individuals with HbAS (16 women and 4 men,

mean age of 28.65±6.50 years) and 20 healthy participants

with HbAA as a control group (16 women and 4 men,

mean age of 31.10±5.86 years) were included in the study.

Diagnosis was made by hemoglobin electrophoresis and

family screening in both groups. Atrial fibrillation and/or

flutter, chronic renal failure, mild or severe valvular heart

disease, and other chronic diseases were the exclusion

criteria. Our local ethics committee approved the study and

written informed consent was obtained from all participants.

Physical Examination

Blood pressures were measured with the aid of a mercury

sphygmomanometer after subjects rested for at least 15 min

and had not consumed caffeinated beverages or tobacco

in the last 12 h. We recorded heart rate by counting the

number of heart beats in 1 min. Circulatory and cardiac

examinations were performed. Skin pallor, cold extremities,

peripheral cyanosis, cardiac cachexia, cardiac murmurs,

increased apex beat, and third and fourth heart sounds were

noted as pathological findings on physical examination.

Laboratory Examination

A 12-lead electrocardiogram was recorded on admission.

Fasting venous blood samples were taken after 12 h of fasting.

Complete blood count, thyroid function tests, fasting blood

glucose, blood urea, creatinine, sodium, potassium, total

cholesterol, low-density lipoprotein cholesterol (LDL-C),

and hemoglobin electrophoresis were checked for all

participants.

380

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers Turk J Hematol 2013;30:379-386

Echocardiographic Examination

All echocardiographic measurements were obtained

from the patients at rest. Standard echocardiographic

examination and pulsed-wave Doppler and tissue Doppler

imaging were performed on an ACUSON SequoiaTM

ultrasound machine (Siemens Medical Solutions, USA)

with a 2.5- or 3.5-MHz phased-array transducer. The mean

of all recordings from 3 consecutive cycles was used for

measurements. M-mode measurements of left ventricular

end-diastolic and end-systolic dimensions and volumes,

ventricular septal and posterior wall thicknesses, and left

atrial end diastolic dimensions were calculated in accordance

with the recommendations of the American Society of

Echocardiography [9]. Left ventricular mass was calculated

by use of the Penn formula (1.04 × [(SVd + IVSd + ADd)³

– (SVd)³] – 13.6). Left ventricular ejection fraction was

calculated by use of the modified Simpson technique. Left

ventricular diastolic function was evaluated in the apical

4-chamber view by means of pulsed-wave and tissue Doppler

imaging. The pulsed-wave Doppler imaging was performed

in order to measure transmitral flow values, including the

peak early diastolic filling velocity (E), the peak late diastolic

filling velocity (A), the early diastolic/late diastolic filling

velocity (E/A) ratio, the E-wave deceleration time, and the

isovolumic relaxation time. The tissue Doppler imaging was

performed in order to measure systolic myocardial velocity

(Sm), peak early diastolic myocardial velocity (Em), and

peak late diastolic myocardial velocity (Am). The Em/Am

ratio was calculated at the end of expiration.

Pulse Waveform Analysis

Assessment of arterial stiffness was performed

noninvasively with the commercially available Arteriograph

(TensioMed, Budapest, Hungary) [10]. We measured the

participants’ oscillometric pulse waves and the distance

between the jugulum and symphysis (which is the same as

by the invasive method for the distance between the aortic

root and the aortic bifurcation), and the PWV was calculated.

Pulse waves were recorded at suprasystolic pressure. The

oscillation signs were identified from a cuff inflated to at

least >35 mmHg above the systolic blood pressure. In this

state there is complete brachial artery occlusion and it

functions as a membrane before the cuff. Pulse waves hit

the membrane and oscillometric waves were measured by

the device, and we could see the waveforms on the monitor.

The augmentation index (AI) was defined as the ratio of the

difference between the second (P2, appearing because of the

reflection of the first pulse wave) and first systolic peaks (P1,

induced by the heart systole) to pulse pressure (PP), and it

was expressed as a percentage of the ratio (AI = [P2 – P1] /

PP × 100). SBP, DBP, PP, central aortic pressure (AP), heart

rate, and other hemodynamic parameters were expressed

as return time (RT, measured in seconds), and diastolic

reflection area (DRA), systolic area index (SAI %), and

diastolic area index (DAI %) were measured noninvasively

with the TensioMed Arteriograph. DRA reflects the quality

of the coronary arterial diastolic filling, while SAI and DAI

are the areas of the systolic and diastolic portions under the

pulse wave curve of a complete cardiac cycle, respectively.

Hence, coronary perfusion is better when DAI and DRA

values are higher. Furthermore, RT is the PWV time from

the aortic root until the bifurcation and return, and so this

value gets smaller as the aortic wall gets stiffer.


Statistical analysis was performed using SPSS 13.0.

Categorical measures were summarized as number and

percentage; numerical measures were summarized as mean

and standard deviation (or, wherever necessary, median

and minimum-maximum). The chi-square test was used

to compare categorical measurements between the groups.

The quantitative measurements of independent groups

were compared by either t-test or Mann–Whitney U test for

parametric and non-parametric data, respectively. Univariate

analysis was used to determine the correlations between

PWV and AI, SBP, heart rate, weight, height, fasting plasma

glucose, serum urea, creatinine, LDL-C, total cholesterol,

and Hb. Stepwise multiple regression analysis was used

to determine whether HbAS, age, weight, mean arterial

pressure (MAP), heart rate, Hb, and the value of total

cholesterol were independent predictors of PWV and AI.

The mutual relationship of PWV and AI with blood pressure

and heart rate was determined by covariance analysis. In

correlation analysis, p≤0.01 was considered significant. In

other analyses, we treated p≤0.05 as significant.

Results

Table 1 shows the clinical, laboratory, and hemodynamic

characteristics of the study population. Age, weight, and

height were similar between groups. Aortic pressure,

sodium, potassium, LDL-C, total cholesterol, mean

corpuscular volume, mean corpuscular hemoglobin, and

red cell distribution width were significantly different

between groups. In terms of arterial stiffness parameters,

only aortic AI and brachial AI were significantly higher in

HbAS individuals (p=0.011). Considering the whole study

population, positive correlations were found between PWV

and mean arterial pressure, age, weight, aortic AI, brachial

AI, and LDL-C (Figure 1). Table 2 shows the relationship

between statistically significant variables in the whole study

population. Furthermore, aortic AI increased with age and

decreased with higher heart rate (p≤0.05).

Positive correlations were found between PWV and AI

and SBP, MAP, age, and weight in HbAS individuals (Figure

2). PWV increased with higher values of SBP, MAP, age,

and weight (p=0.000, p=0.002, p=0.016, and p=0.027,

respectively). Aortic AI and MAP were also found to have

a positive correlation (p=0.009). A negative correlation

was found between aortic AI and serum potassium levels

381



Table 1. Clinical, laboratory and hemodynamic characteristics of HbAS and HbAA participants.

Variable

HbAS

(N=20),

mean±SD (min/max)

HbAA

(N=20),

mean±SD (min/max)

Age 31.10±5.86 (19/38) 28.65±6.50 (19/38) NS

Weight (kg) 67.1±12 (49/98) 65.15±10.5 (45/82) NS

Height (cm) 164.8±6.8 (155/177) 167.75±7.79 (155/179) NS

SBP (mmHg) 123.8±14.5 (108/160) 117.9±10.3 (80/160) NS

DBP (mmHg) 72.25±9.63 (56/95) 70.05±6.26 (60/80) NS

Heart rate (beats/min) 75.50±9.30 (56/95) 74.9±15.6 (55/114) NS

MAP (mmHg) 89.35±9.86 (76/114) 85.95±6.88 (76/98) NS

PP (mmHg) 51.60±12.8 (37/88) 47.9±8.40 (33/64) NS

AP (mmHg) 95.64±23.2 (62/151) 80.15±7.31 (69/95) 0.033

PWV (m/s) 7.80±1.49 (5.8/10.6) 7.15±0.7 (5.9/8.1) NS

Aortic AI (%) 22.62±15.05 (-3.2/51.8) 10.67±8.4 (-0.2/28.3) 0.011

Brachial AI (%) -29.66±29.73 (-80.6/28) -53.27±16.65 (-74.4/-18.5) 0.011

RT (ms) 143.1±25.9 (99/180) 152.0±16.5 (124/187) NS

SAI (%) 47.64±9.19 (37/74.4) 46.40±5.74 (36.6/57.3) NS

DAI (%) 52.29±9.13 (25.5/62.9) 53.6±5.74 (42.6/63.3) NS

DRA 57.85±16.7 (35.6/89.4) 63.48±16.84 (35.2/115.1) NS

Fasting blood glucose (g/dL) 84.65±13.44 (61/114) 85.7±12.9 (58/100) NS

Blood urea (mg/dL) 12.3±2.99 (8/16.4) 12.05±2.36 (9/17.6) NS

Creatinine (mg/dL) 0.71±0.12 (0.46/0.88) 0.76±0.22 (0.08/1.09) NS

Sodium (mmol/L) 141.15±2.48 (136/148) 142.6±1.19 (141/144) 0.009

Potassium (mmol/L) 5.06±0.8 (4/6.7) 4.52±0.31 (4/5.3) 0.038

LDL-C (mg/dL) 98.0±24.2 (40/130) 80.90±27.45 (45/132) 0.033

Total cholesterol (mg/dL) 167.1±27.99 (88/200) 146.0±32.9 (104/209) 0.035

Hb (g/dL) 13.15±1.187 (11.6/15.9) 13.8±1.49 (11.7/16.5) NS

Hct (%) 37.9±2.95 (34.7/45.7) 39.5±4.27 (33.4/46.4) NS

MCV (fL) 79.0±4.29 (72.2/86.3) 86.06±3.52 (81/92.8) <0.001

MCH (pg) 27.7±1.73 (25/30.7) 30.05±1.43 (27.6/33) <0.001

MCHC (%) 34.75±0.66 (33.7/36) 34.92±0.94 (33.5/36.4) NS

Platelet count (x10 9 /L) 247.0±49.9 (150/336) 224.4±45.98 (145/316) NS

RDW (%) 14.43±1.66 (12.7/18.8) 13.7±1.66 (12.3/18.4) 0.035

LVMI (g/m 2 ) 100.78±19.8 (64/137) 91.21±22.09 (63/136) NS

PABs (mmHg) 24.50±2.76 (20/30) 24.0±2.05 (20/25) NS

EF (%) 65.35±3.89 (59/72) 66.95±4.47 (60/74) NS

SBP = systolic blood pressure; DBP = diastolic blood pressure; MAP = mean arterial pressure; PP = pulse pressure; AP = central aortic pressure; PWV = aortic pulse wave

velocity; AI = augmentation index; RT = return time; SAI = systolic area index; DAI = diastolic area index; DRA = diastolic reflection area; LDL-C = low-density lipoprotein

cholesterol; Hb = hemoglobin; Hct =hematocrit; MCV = mean corpuscular volume; MCH = mean corpuscular hemoglobin; MCHC = mean corpuscular hemoglobin concentration;

RDW = red cell distribution width; LVMI = left ventricular mass index; PABs = systolic pulmonary artery pressure; EF = ejection fraction; NS = not significant.

p

382



(p=0.007). In contrast to aortic AI, considering all groups

there was no correlation between PWV and heart rate. Serum

potassium level was higher in HbAS carriers. This may have

been due to more hemolysis while the blood samples of

carriers were being held in the in vitro hypoxic environment.

There was no statistically significant association between

PWV and serum potassium concentration in sickle cell

carriers. However, in the group of HbAA participants with

Figure 1. Correlations between pulse wave velocity (PWV)

and mean arterial pressure (MAP), age, weight, aortic

augmentation index (AI-aortic), brachial augmentation

index (AI-brachial), and low-density lipoprotein cholesterol

(LDL-C) in the whole study population.

Figure 2. Correlations between pulse wave velocity (PWV)

and aortic augmentation index (AI-aortic) and brachial

augmentation index (AI-brachial), systolic blood pressure

(SBP), mean arterial pressure (MAP), age, weight, and

potassium in HbAS individuals.

Table 2. The relationships among statistically significant variables in the whole study population.

Groups Variables Correlation value p Significance

level

HbAS and HbAA (n=40)

PWV-MAP

PWV-Age

PWV-Weight

PWV-Aortic AI

PWV-Brachial AI

PWV-LDL-C

Aortic AI-Age

r 2 =0.436

r 2 =0.16

r 2 =0.129

r 2 =0.459

r 2 =0.462

r 2 =0.112

r 2 =0.146

0.000

0.017

0.034

0.000

0.000

0.05

0.026

Hb = hemoglobin; PWV = aortic pulse wave velocity; MAP = mean arterial pressure; AI = augmentation index; LDL-C = low-density lipoprotein cholesterol.

Table 3. The relationships among statistically significant variables in HbAS and HbAA participants.

p<0.01

p<0.05

p<0.05

p<0.01

p<0.01

p<0.05

p<0.05

Groups Variables Correlation value p Significance

level

HbAS (n=20)

PWV-Aortic AI

PWV-Brachial AI

PWV-SBP

PWV-Weight

PWV-Age

PWV-MAP

Aortic AI-MAP

Aortic AI-potassium

r 2 =0.603

r 2 =0.601

r 2 =0.286

r 2 =0.285

r 2 =0.332

r 2 =0.496

r 2 =0.397

r 2 =(-0.392)

0.000

0.000

0.027

0.027

0.016

0.002

0.009

0.007

p<0.01

p<0.01

p<0.05

p<0.05

p<0.05

p<0.01

p<0.01

p<0.05

HbAA (n=20) PWV-potassium r 2 =0.267 0.028 p<0.05

Hb = hemoglobin; PWV = aortic pulse wave velocity; AI = augmentation index; SBP = systolic blood pressure; MAP = mean arterial pressure;

LDL-C=low-density lipoprotein cholesterol.

383



Table 4. Predictors of aortic pulse wave velocity.

Variable β SE t p

MAP

(mmHg)

Table 5. Predictors of aortic augmentation index.

Variable β SE t p

MAP

(mmHg)

Heart rate

(beats/min)

Stepwise multiple regression analysis; n=40.

Model r 2 =0.397; F=9.203.

Model p<0.005.

β: regression coefficient.

0.586 0.023 3.517 0.003

Age 0.404 0.040 2.429 0.029

Stepwise multiple regression analysis; n=40.

Model r 2 =0.496; F=14.739.

Model p<0.005.

β: regression coefficient.

0.716 0.272 3.847 0.002

-0.423 0.309 - 2.272 0.041

high potassium levels, PWV was found to be increased

(p=0.028). Table 3 shows the separate relationships between

statistically significant variables and HbAS and HbAA by

multivariate analysis.

After performing multiple stepwise regression

analysis, we established that PWV and aortic AI were both

independently positively associated with MAP (p=0.003

and 0.002, respectively). At the same time, PWV was also

positively associated with age (p=0.029). The aortic AI

was independently negatively associated with heart rate

(p=0.041). Multiple stepwise regression analysis results are

shown in Tables 4 and 5.

Discussion

Cardiovascular effects of pulse reflection and arterial

stiffness have been demonstrated. The effect of vascular

aging on prognosis has been proven in publications about

many diseases. Major determinants of these detrimental

results were pulse pressure [11], AI [12], and PWV [13].

PWV is an indicator of subclinical organ damage at values

higher than 12 m/s [8]. Sickle cell anemia is a hereditary

disorder causing abnormal hemoglobin synthesis. Sickle cell

patients (HbSS) are often admitted to the hospital because

of the painful symptoms, and this process is associated

with shortened life expectancy [2]. However, HbAS is a

benign disorder with a standard life-span outside of cases

of vigorous exercise or in military pilots [14,15]. There are

many comprehensive studies related to the hemodynamic

changes as a complication of the disease [16,17]. Some of

these studies were associated with arterial stiffness and wave

reflection [5,7,18].

Rees et al. [19] measured blood concentrations of nitric

oxide in patients with SCD. Nitric oxide causes hypotension

due to vasodilatation. Concentrations were higher than in

the healthy control group. They also identified similar values

during painful-crisis and steady-state SCD, but higher values

than in hemoglobin E/beta-thalassemic form. HbSS patients

experienced painful/hemolytic crises more often than

heterozygous patients (HbAS). Lemogoum et al. [7] examined

HbSS patients to investigate the connection between lower

blood pressure and arterial stiffness. They excluded patients

who experienced painful/hemolytic crises. SBP, DBP, and MAP

were significantly lower in HbSS patients. Pulse pressure is

found to be increasing as arterial stiffness worsens. Benetos

et al. [11] determined the value of pulse pressure to predict

cardiovascular outcomes. In our study, central aortic pressure

was higher in the HbAS group (p=0.033). SBP, DBP, MAP,

and pulse pressures were also higher in the HbAS group, but

these results were not statistically significant. Aortic PWV

was similar between HbAA and HbAS participants. Aortic and

brachial AI values were significantly higher in the HbAS group

(p=0.011). In the current study, blood pressure values were

similar between groups, except for central aortic pressure. AI

values were found to be higher in HbAS carriers. PWV was not

significantly different between groups in our study, in contrast

to patients with HbSS according to the findings of Lemogoum

et al. [7]. In light of these results, the lower blood pressure

can explain the reduced PWV in homozygous (HbSS) patients

and the positive association between arterial stiffness and

blood pressure. However, blood pressure and wave reflection

changes may be affected by factors other than nitric oxide in

homozygous and heterozygous forms of disease.

The influence of age-dependent vascular damage and

the effect of arterial stiffness are well established [20]. There

was no significant difference between groups in terms of

mean age in this study. There was a positive association

between PWV with age in the entire study population and

among HbAS carriers (p=0.017 and 0.016, respectively).

Demirci et al. [21] suggested that worsening arterial stiffness

was the most related variable to higher MAP values. In

stepwise multiple regression analysis we obtained a positive

correlation between PWV and MAP (p=0.003). PWV was

increased by higher MAP. Cypien et al. [22] examined MAP

and arterial stiffness in women and, after multiple regression

analysis, MAP was found to be associated with AI (p<0.001).

For each 10% increase in AI, the risk of mortality related to

coronary events was increased by 28% [23]. In our study,

the most determinative predictors of arterial stiffness were

aortic AI and brachial AI according to univariate analysis.

These values were higher in HbAS patients. According to

stepwise multiple regression analysis, there was a positive

correlation between aortic AI and MAP (p=0.002). Bahl

et al. [24] identified higher heart rates in patients with

384



low hemoglobin levels (below 7 mg/dL). Nevertheless,

there was no significant heart rate change in patients with

HbSS, except for extreme cases (painful/hemolytic crisis)

[25]. Our heterozygous patients had similar hemoglobin

and hematocrit levels as those in the HbAA group. Mean

corpuscular volume and mean corpuscular hemoglobin

were lower in patients with HbAS (p<0.001). As a result,

heart rate (beats/min) values were not distinct between

groups. Wilkinson et al. [26] assessed the effects of changes

in heart rate on wave reflection and arterial stiffness. AI was

significantly decreased with higher heart rate and was much

more sensitive to the effect of heart rate in their study. Our

results were compatible with their findings, as the aortic AI

was inversely related to heart rate (p=0.041).

Pannier et al. [27] examined the simultaneous PWV

measurements of the aorta, brachial, and femoral arteries

in 305 patients and unequivocally proved that only the

PWV measurements of the aorta had a predictive value. We

measured PWV only from the aorta.

Noninvasive measurement of arterial stiffness is a

valuable method. Arteriography results have a considerably

tight relationship with cardiac catheterization measurements

[10]. Nevertheless, a study comparing other devices that

can measure PWV showed that similar PWV values were

obtained using the SphygmoCor (8.1±1.1 m/s) or the

Arteriograph (8.6±1.3 m/s). However, for the Complior

method, values were significantly different (10.1±1.7 m/s)

because the recorded travel distance for PWV was higher

than the others [28].

Our study revealed that MAP and heart rate were

independent determinants for the aortic AI. MAP and age

were also independent determinants for aortic pulse wave

velocity. The most important independent predictors of

arterial stiffness were MAP and age.

Conclusion

Sickle cell disease (HbSS) is associated with shortened life

expectancy, although the sickle cell trait (HbAS) is a benign

carrier condition and is not associated with shortened life

expectancy in ordinary people. HbAS patients have a better

life quality with fewer complaints than HbSS patients, but still

at levels lower than among the normal healthy population.

Unpredictable cardiovascular collapse and death may occur

in the HbAS population during or after vigorous exercise.

Therefore, measurement of arterial stiffness might help

achieve a better understanding of complications associated

with sickle cell carriers. Arterial stiffness measurement is an

easy, cheap, and reliable method in the early diagnosis of

cardiovascular disease in heterozygous sickle cell carriers.

These results may depend on the amount of S hemoglobin

in red blood cells. Further studies are required to investigate

blood pressure changes and their effects on arterial stiffness

in order to explain the vascular aging mechanism in patients

with sickle cell disorder.





included.

References

1. Elsharawy MA, Moghazy KM, Shawarby MA. Atherosclerosis

in sickle cell disease - a review. Int J Angiol 2009;18:62-66.

2. Platt OS, Brambilla DJ, Rosse WF, Milner PF, Castro O,

Steinberg MH, Klug PP. Mortality in sickle cell disease. Life

expectancy and risk factors for early death. N Engl J Med

1994;330:1639-1644.

3. Laurent S, Boutouyrie P, Asmar R, Gautier I, Laloux B, Guize

L, Ducimetiere P, Benetos A. Aortic stiffness is an independent

predictor of all-cause and cardiovascular mortality in

hypertensive patients. Hypertension 2001;37:1236-1241.

4. Cruickshank K, Riste L, Anderson SG, Wright JS, Dunn G,

Gosling RG. Aortic pulse wave velocity and its relationship to

mortality in diabetes and glucose intolerance: an integrated

index of vascular function? Circulation 2002;106:2085-

2090.

5. Belizna C, Loufrani L, Ghali A, Lahary A, Primard E, Louvel

JP, Henrion D, Lévesque H, Ifrah N. Arterial stiffness and

stroke in sickle cell disease. Stroke 2012;43:1129-1130.

6. Francis RB Jr, Johnson CS. Vascular occlusion in sickle cell

disease: current concepts and unanswered questions. Blood

1991;77:1405-1414.

7. Lemogoum D, Van Bortel L, Najem B, Dzudie A, Teutcha

C, Madu E, Leeman M, Degaute JP, van de Borne P. Arterial

stiffness and wave reflections in patients with sickle cell

disease. Hypertension 2004;44:924-929.

8. Mancia G, De Backer G, Dominiczak A, Cifkova R, Fagard R,

Germano G, Grassi G, Heagerty AM, Kjeldsen SE, Laurent

S, Narkiewicz K, Ruilope L, Rynkiewicz A, Schmieder RE,

Boudier HA, Zanchetti A, Vahanian A, Camm J, De Caterina

R, Dean V, Dickstein K, Filippatos G, Funck-Brentano

C, Hellemans I, Kristensen SD, McGregor K, Sechtem U,

Silber S, Tendera M, Widimsky P, Zamorano JL, Erdine S,

Kiowski W, Agabiti-Rosei E, Ambrosioni E, Lindholm LH,

Viigimaa M, Adamopoulos S, Agabiti-Rosei E, Ambrosioni

E, Bertomeu V, Clement D, Erdine S, Farsang C, Gaita

D, Lip G, Mallion JM, Manolis AJ, Nilsson PM, O’Brien

E, Ponikowski P, Redon J, Ruschitzka F, Tamargo J, van

Zwieten P, Waeber B, Williams B; Management of Arterial

Hypertension of the European Society of Hypertension;

European Society of Cardiology. 2007 Guidelines for the

Management of Arterial Hypertension: The Task Force for

the Management of Arterial Hypertension of the European

Society of Hypertension (ESH) and of the European Society

of Cardiology (ESC). Eur Heart J 2007;25:1105-1187.

385



9. Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R,

Feigenbaum H, Gutgesell H, Reichek N, Sahn D, Schnittger I

et al. Recommendations for quantitation of the left ventricle

by two-dimensional echocardiography. American Society of

Echocardiography Committee on Standards, Subcommittee

on Quantitation of Two-Dimensional Echocardiograms. J

Am Soc Echocardiogr 1989;2:358-367.

10. Horváth IG, Németh A, Lenkey Z, Alessandri N, Tufano

F, Kis P, Gaszner B, Cziráki A. Invasive validation of a

new oscillometric device (Arteriograph) for measuring

augmentation index, central blood pressure and aortic pulse

wave velocity. J Hypertens 2010;28:2068-2075.

11. Benetos A, Safar M, Rudnichi A, Smulyan H, Richard JL,

Ducimetieère P, Guize L. Pulse pressure: a predictor of longterm

cardiovascular mortality in a French male population.

Hypertension 1997;30:1410-1415.

12. Weber T, Auer J, O’Rourke MF. Arterial stiffness, wave

reflections, and the risk of coronary artery disease.

Circulation 2004;109:184-189.

13. Choi CU, Park EB, Suh SY, Kim JW, Kim EJ, Rha SW, Seo HS,

Oh DJ, Park CG. Impact of aortic stiffness on cardiovascular

disease in patients with chest pain. Assessment with direct

intra-arterial measurement. Am J Hypertens 2007;20:1163-

1169.

14. Harris KM, Haas TS, Eichner ER, Maron BJ. Sickle cell trait

associated with sudden death in competitive athletes. Am J

Cardiol 2012;110:1185-1188.

15. Mitchell BL. Sickle cell trait and sudden death--bringing it

home. J Natl Med Assoc 2007;99:300-305.

16. Zorca S, Freeman L, Hildesheim M, Allen D, Remaley

AT, Taylor JG, Kato GJ. Lipid levels in sickle-cell disease

associated with haemolytic severity, vascular dysfunction

and pulmonary hypertension. Br J Haematol 2010;149:436-

445.

17. Pegelow CH, Colangelo L, Steinberg M, Wright EC, Smith

J, Phillips G, Vichinsky E. Natural history of blood pressure

in sickle cell disease: risks for stroke and death associated

with relative hypertension in sickle cell anemia. Am J Med

1997;102:171-177.

18. Aessopos A, Farmakis D, Tsironi M, Diamanti-Kandarakis

E, Matzourani M, Fragodimiri C, Hatziliami A, Karagiorga

M. Endothelial function and arterial stiffness in sicklethalassemia

patients. Atherosclerosis 2007;191:427-432.

19. Rees DC, Cervi P, Grimwade D, O’Driscoll A, Hamilton M,

Parker NE, Porter JB. The metabolites of nitric oxide in

sickle-cell disease. Br J Haematol 1995;91:834-837.

20. Laurent S, Cockcroft J, Van Bortel L, Boutouyrie P, Giannattasio

C, Hayoz D, Pannier B, Vlachopoulos C, Wilkinson I, Struijker-

Boudier H; European Network for Non-invasive Investigation

of Large Arteries. Expert consensus document on arterial

stiffness: methodological issues and clinical applications. Eur

Heart J 2006;27:2588-2605.

21. Demirci MS, Gungor O, Kircelli F, Carrero JJ, Tatar E, Demirci

C, Kayikcioglu M, Asci G, Toz H, Ozkahya M, Ok E. Impact

of mean arterial pressure on progression of arterial stiffness

in peritoneal dialysis patients under strict volume control

strategy. Clin Nephrol 2012;77:105-113.

22. Cypiene A, Dadoniene J, Rugiene R, Ryliškyte L, Kovaite M,

Petrulioniene Z, Venalis A, Laucevieius A. The influence of

mean blood pressure on arterial stiffening and endothelial

dysfunction in women with rheumatoid arthritis and

systemic lupus erythematosus. Medicina (Kaunas)

2010;46:522-530.

23. Chirinos JA, Zambrano JP, Chakko S, Veerani A, Schob

A, Willens HJ, Perez G, Mendez AJ. Aortic pressure

augmentation predicts adverse cardiovascular events

in patients with established coronary artery disease.

Hypertension 2005;45:980-985.

24. Bahl VK, Malhotra OP, Kumar D. Non-invasive assessment

of systolic and diastolic left ventricular function in patients

with chronic severe anemia: a combined M-mode, twodimensional

and Doppler echocardiographic study. Am

Heart J 1992;124:1516-1523.

25. Covitz W, Espeland M, Gallagher D, Hellenbrand W, Leff S,

Talner N. The heart in sickle cell anemia. The Cooperative

Study of Sickle Cell Disease (CSSCD). Chest 1995;108;1214-

1219.

26. Wilkinson IB, Mohammad NH, Tyrrell S, Hall IR, Webb

DJ, Paul VE, Levy T, Cockcroft JR. Heart rate dependency

of pulse pressure amplification and arterial stiffness. Am J

Hypertens 2002;15:24-30.

27. Pannier B, Guérin AP, Marchais SJ, Safar ME, London GM.

Stiffness of capacitive and conduit arteries: prognostic

significance for end-stage renal disease patients.

Hypertension 2005;45:592-596.

28. Rajzer MW, Wojciechowska W, Klocek M, Palka I,

Brzozowska-Kiszka M, Kawecka-Jaszcz K. Comparison of

aortic pulse wave velocity measured by three techniques:

Complior, SphygmoCor and Arteriograph. J Hypertens

2008;26:2001-2007.

386

Research Article

DOI: 10.4274/Tjh.2012.0135

Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi

Patients with Chronic Myeloid Leukemia in the Chronic

Phase: Single-Center Study

İmatinib Mesilatın Kronik Faz Kronik Myeloid Lösemi Tanılı

200 Iraklı Hastada Güvenirliğinin Değerlendirilmesi: Tek

Merkezli Çalışma

Bassam Francis Matti1, Alaadin Sahham Naji1, Alaa Fadhil Alwan2

1Baghdad Teaching Hospital, Clinical Hematology Department, Baghdad, Iraq

2National Center of Hematology, Clinical Hematology Department, Baghdad, Iraq

Abstract:

Objective: Imatinib mesylate, a tyrosine kinase inhibitor, is presently the drug of choice for chronic myeloid leukemia

(CML). During therapy, a few patients may develop hematological and non-hematological adverse effects.

Materials and Methods: The aim of this study was to evaluate the safety of imatinib therapy in patients with CML. Between

December 2007 and October 2009 two hundred patients with CML in chronic phase were included in the study. Written informed

consent was obtained from all patients prior to the start of the study. Imatinib was started at 400 mg orally daily. Patients were

monitored carefully for any adverse effects. Complete blood count, liver, and renal function tests were done once in 2 weeks

during the first month and on a monthly basis during follow-up. Toxicities that encountered were graded as per the National

Cancer Institute common toxicity criteria version 2. Both hematologic and non-hematologic toxicities were managed with short

interruptions of treatment and supportive measures, but the daily dose of imatinib was not reduced below 300 mg/day.

Results: Two hundred CML patients in chronic phase were included in this study; the male:female ratio was 0.7:1 with mean

age 39.06±13.21 years (ranged from 15-81 years). The study showed that the commonest hematological side effects were grade

2 anemia (12.5%) followed by leukopenia (8%) and thrombocytopenia (4%), while the most common non-hematological adverse

effects were superficial edema and weight gain (51.5%), followed by musculoskeletal pain (35.5%), then gastro-intestinal

symptoms (vomiting, diarrhea) (19%). Fluid retention was the commonest side effect, which responded to low-dose diuretics.

The drug was safe and well tolerated. There were no deaths due to toxicity.

Conclusion: Imatinib mesylate a well-tolerated drug, and all undesirable effects could be ameliorated easily. The most

common hematological and non-hematological side effects were anemia and fluid retention, respectively.

Key Words: Safety, Imatinib, Chronic myeloid leukemia

Address for Correspondence: Alaa Fadhil ALWAN , M.D.,

National Center of Hematology, Clinical Hematology Department, Baghdad, Iraq

Phone: +9647702743114 E-mail: ala_sh73@yahoo.com

Received/Geliş tarihi : September 18, 2012

Accepted/Kabul tarihi : January 16, 2013

387


Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with

Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

Özet:

Amaç: Bir tirozin kinaz inhibitörü olan imatinib mesilat, günümüz kronik miyeloid lösemi (KML) itedavisinde ilk seçenek

ilaçtır. Tedavi sırasında az sayıda hastada hematolojik ve non-hematolojik yan etkiler gelişebilir.

Gereç ve Yöntemler: Bu çalışmanın amacı KML hastalarında imatinib tedavisinin güvenirliğini değerlendirmektir. Aralık

2007-Ekim 2009 arasında kronik faz KML tanılı 200 hasta çalışmaya alındı. Çalışmanın başlamasından önce tüm hastalardan

yazılı onam alındı. İmatinib oral yoldan günde 400 mg başlandı. Hastalar yan etkiler yönünden dikkatle izlendi. Tam kan

sayımı, karaciğer ve böbrek fonksiyon testleri ilk ay içinde iki haftada bir, sonrasındaki takipte ise ayda bir yapıldı. İzlenen

toksisiteler ulusal kanser enstitüsü toksisite kriterleri 2. versiyona göre derecelendirdi. Hematolojik ve non-hematolojik

toksisiteler tedavinin kısa süre kesilmesi ve destek önlemleri ile yönetildi, ancak imatinibin günlük dozu 300 mg’ın altına

inilmedi.

Bulgular: Çalışmaya 200 hasta dahil edildi. Erkek/kadın oranı 0,7:1, ortanca yaş 39,06 (15-81) idi. Çalışmada en sık rastlanan

hematolojik yan etkiler grade 2 anemi (%12,5), lökopeni (%8) ve trombositopeni (%4) iken, en sık görülen non-hematolojik

toksisiteleri yüzeyel ödem ve kilo alma (%51,5) takiben kas-iskelet ağrısı (%35,5) ve sonrasında gastrointestinal semptomlar

(kusma, ishal-%19) olarak bulundu. En sık görülen yan etki düşük doz diüretiklere yanıt veren sıvı retansiyonuydu. İlaç güvenilir

bulundu ve iyi tolere edildi. Toksisiteye bağlı ölüm izlenmedi.

Sonuç: İmatinib mesilat iyi tolere edilen bir ilaçtır ve tüm yan etkiler kolay yönetilebilir. En sık gözlenen hematolojik yan

etki anemi, non-hematolojik yan etki ise sıvı retansiyonuydur.

Anahtar Sözcükler: Güvenilirlik, İmatinib, Kronik miyeloid lösemi

Introduction

Chronic myeloid leukemia (CML) arises as the result of

a mutation in a pluripotent stem cell and is characterized

by progressive granulocytosis, marrow hypercellularity, and

splenomegaly [1,2,3]. CML accounts for about 20% of newly

diagnosed cases of leukemia in adults [2,4]. The diagnostic

hallmark is the Philadelphia chromosome [5], which is

present in all dividing cells of hematopoietic lineage, as

well as in B and T cells in some patients, but is absent in all

other cells. The essential role of BCR-ABL tyrosine kinase

activity for cellular transformation provides the rationale for

targeting this function therapeutically [6].

Imatinib selectively inhibits the proliferation and induces

apoptosis in BCR-ABL–positive cell lines as well as fresh

leukemic cells from patients with Philadelphia chromosomepositive

CML and Philadelphia chromosome-positive acute

lymphoblastic leukemia [7,8]. Growth inhibition of the

CML cell line K562 occurred at micromolar concentrations

and was associated with inhibition of BCR-ABL tyrosine

kinase activity [9]. In addition to that, imatinib inhibits the

receptor tyrosine kinases for platelet-derived growth factors

(PDGFs), stem cell factor (SCF), and c-kit and inhibit PDGF

receptor and SCF-mediated cellular events [10].

The prospective International Randomized Imatinib

Study (IRIS) showed clear superiority for imatinib when

compared to interferon and low-dose cytarabine as standard

therapy for CML. After a median follow-up of 19 months,

the estimated rate of major cytogenetic response was 87.1%

in the imatinib group and 34.7% in the interferon group.

In regard to the molecular responses to imatinib mesylate,

among 1106 patients from the IRIS study, 370 patients in

complete cytogenetic response (CCR) were monitored by

real-time quantitative polymerase chain reaction. Those

who achieved a 3-log reduction from the initial BCR-ABL/

BCR ratio after 12 months of therapy had a progression-free

survival of 100% in 14 months, compared to 95% for those

who had not achieved a 3-log reduction but were in CCR

and 85% for those who had not achieved CCR at 12 months

(p<0.001) [11].

Imatinib mesylate is a well-tolerated agent. In phase

II trials with this drug, grade 3 to 4 hematologic toxicity

was seen in 34% of chronic phase, 58% of accelerated

phase, and 63% of blastic phase patients. Non-hematologic

toxicity most commonly included nausea (58%-71%), fluid

retention (56%-71%), muscle cramps (37%-50%), diarrhea

(37%-53%), and skin rash (39%-43%) [12]. However, these

adverse events were mostly mild and only rarely resulted in

permanent discontinuation of therapy [13-15].

The updated 5-year IRIS study results showed that the

rate of toxicity with first-line imatinib declined with time

with; most of them being of grade 1 (mild) or 2 (moderate)

in severity, generally able to be managed and tending to

be most frequent in the first year of treatment. Imatinib

discontinuation due to drug-related adverse effects was

less than 4%. Grade 3 or 4 non-hematologic toxicities

include fatigue, depression, myalgia, arthralgia, and nausea.

Hematologic grade 3-4 toxicities within the first 2 years were

388




reported to be neutropenia, thrombocytopenia, anemia,

and elevated liver enzymes at 3.7%, 1.5%, 1.8%, and 0.4%,

respectively [16]. The aim of the present study was to

evaluate the safety of imatinib mesylate in CML patients.


The study was conducted from December 2007 through

October 2009; during this period, 200 patients with CML

in the chronic phase treated with imatinib mesylate were

evaluated at the National Center of Hematology by history,

clinical examination, and laboratory tests.

Eligibility criteria included age of 15 years and older,

Eastern Cooperative Oncology Group (ECOG) performance

status of 0 to 2, adequate hepatic and renal functions, no prior

imatinib therapy, and absence of pregnancy. Chronic myeloid

leukemia in the chronic phase was defined as less than 10%

blasts and less than 20% basophils in the peripheral blood

and bone marrow, and a platelet count of more than 100 x

10 9 /L but less than 1000 x 10 9 /L. The study was approved

by the institutional ethics committee. Written informed

consent was obtained from all patients prior to the start of the

study. Therapy was initiated with imatinib at 400 mg orally

daily and patients were monitored carefully for any adverse

effects. Complete blood count and blood film, liver function

tests, renal function tests, and coagulation parameters

were recorded once in 2 weeks during the first month and

monthly thereafter. Toxicities encountered were graded as

per the National Cancer Institute’s common toxicity criteria,

version 2. Both hematologic and non-hematologic toxicities

were managed with short interruptions of treatment and

supportive measures, but the daily dose of imatinib was not

reduced below 300 mg/day.

Regarding assessment of imatinib toxicity on the

gastrointestinal tract, we assessed whether there was any

nausea, vomiting, stomatitis, or diarrhea in patients who

received imatinib.

Any fever with or without infection in CML patients

was evaluated by identifying any elevation in temperature

at the time of registration and recording any history of fever,

whether it was related to any infection or not.

Dermatological abnormalities during the period of

imatinib intake including any skin rash or itching, along

with hair loss and color changes, were evaluated by direct

examination.

Neurological evaluation was done only by clinical

neurological assessment with notification of any dysesthesia

or paresthesia.

For all patients, baseline weight was recorded and then

weight measurements were done monthly after imatinib

therapy began to determine any weight change.

The statistical analysis was performed using SPSS 17.0

(SPSS Inc., Chicago, IL, USA). Differences between groups

were evaluated by using Student’s t-test this statement

should be omitted. P<0.05 was regarded as significant.

Results

In this study, 200 patients with CML in the chronic phase

were included; 112 patients were female while 88 patients

were male with a male-to-female ratio of 0.7:1. Age ranged

from 15 to 81 years with a mean age of 39.06 ± 13.21 years;

other pretreatment characteristics are shown in Table 1.

Table 2 shows the hematologic and non-hematologic side

effects, while Table 3 shows the distribution of side effects

according to sex.

Discussion

Imatinib has been generally well tolerated, with grade

3 or 4 toxicities being uncommon. The most common side

effects of imatinib were usually of grade 1 or 2.

The most common side effects encountered in this study

were non-hematologic, with all grades of superficial edema

(51.5%), followed by bone pain (35.5%) and then nausea

(32.5%).

Imatinib has the potential to induce severe and prolonged

myelosuppression, particularly in patients with minimal

residual normal hematopoiesis. However, over time, some

patients can achieve recovery of normal hematopoiesis and

Table 1. Pretreatment characteristics of 200 patients

with CML.

Variables

Sex, no. (%)

Male

Female

Mean age, years

min-max (years)

ECOG at diagnosis, no. (%)

0-1

1-2

Splenomegaly, no. (%)

0-4 cm

1-9 cm

≥10 cm

Results

88 (44)

112 (56)

39.06 ± 13.21

15-81

134 (67)

66 (33)

12 (6)

114 (57)

74 (37)

Hepatomegaly, no. (%) 42 (21)

Peripheral blood median, (min-max)

Hemoglobin level, g/L

Leukocyte count, 10 9 /L

Platelet count, 10 9 /L

Basophils, %

Blasts in peripheral blood, %

Blasts in bone marrow, %

104 (58-127)

191 (43-814)

331.5 (132-992)

4 (3-13)

5 (1-9)

3 (2-7)

389




a major cytogenetic response despite having experienced

recurrent grade 3 neutropenia and thrombocytopenia and

frequent dose interruptions [17,18].

Hematologic adverse effects included anemia, which was

documented in 14% of CML cases, most of them of grade

1 or 2. It was found more frequently in females than in

males (P = 0.0001); this may be due to the fact that the basal

hemoglobin level is lower in females or that they are more

sensitive to the myelosuppressive effect of imatinib than

males. Grade 3-4 hematologic toxicity was registered only in

4.5%. Regarding the percentage of all grades, leukopenia and

thrombocytopenia in this study were found at 10% and 4%,

respectively, while grade 3-4 neutropenia was documented

in 1%. Of all CML patients studied, 13.5% complained of

hemorrhagic manifestations, all within the first few weeks

of initiation of treatment. This may be due to concomitant

platelet dysfunction, which is in agreement with the study

by Druker et al., in which hemorrhage was experienced in

18.9% of patients. However, this study did not find that use

of NSAIDs or other concomitant treatment significantly

increased the risk of bleeding in CML patients [19].

Breccia et al. found that grade 3-4 hematologic toxicities

were experienced in 24% of chronic phase CML patients; of

these, 7% experienced toxicity of grades 3-4 in early chronic

phase patients, with a negative influence on cytogenetic

response [17].

Edema and fluid retention occurred in 51.5% of cases,

manifested clinically by periorbital edema, leg edema, and

Table 2. Distribution of the common toxicity effects according to grade. Significant results are given in bold.

Type of toxicity Grade 0 Grades 1 and 2 Grades 3 and 4 All grades

No. % No. % No. % %

Anemia 172 86 25 12.5 3 1.5 14%

Leukopenia 180 90 16 8 4 2 10%

Neutropenia 188 89 10 5 2 1 6%

Thrombocytopenia 192 96 8 4 0 0 4%

Hemorrhage 173 86.5 21 10.5 6 3 13.5%

Infection 163 81.5 34 17 3 1.5 18.5%

Fever 153 76.5 47 23.5 0 0 23.5%

Nausea 135 67.5 65 32.5 0 0 32.5%

Vomiting 173 86.5 27 13.5 0 0 13.5%

Stomatitis 162 81 35 17.5 3 1.5 19%

Diarrhea 157 78.5 43 21.5 0 0 21.5%

Skin rash 150 75 50 25 0 0 25%

Creatinine 195 97.5 5 2.5 0 0 2.5%

Proteinuria 178 89 22 11 0 0 11%

Hematuria 189 94.5 11 5.5 0 0 5.5%

Bilirubin 195 97.5 5 2.5 0 0 2.5%

AST/ALT 198 99 2 1 0 0 1%

Paresthesia 170 85 30 15 0 0 15%

Edema 97 48.5 52 26 51 25.5 51.5%

Bone pain 129 64.5 71 35.5 0 0 35.5%

Weight gain 145 72.5 55 27.5 0 0 27.5%

Hair loss 186 93% 14 7 0 0 7%

Hair discoloration 181 90.5% 19 9.5 0 0 9.5%

390




Table 3. Difference in adverse effects between males and females on imatinib therapy. Significant results are given in bold.

Type of toxicity Males (88) Females (112) P-value

All grades No. % No. %

Anemia 8 9.09 20 17.85 0.001

Leukopenia 9 10.22 11 9.82 0.154

Neutropenia 9 10.22 13 11.6 0.618

Thrombocytopenia 2 2.2 2 1.7 0.110

Hemorrhage 8 9.09 19 17 0.460

Infection 9 10.22 28 25 0.038

Fever 15 17.04 32 28.57 0.155

Nausea 25 28.4 40 35.7 0.126

Vomiting 11 12.5 16 14.28 0.858

Stomatitis 12 13.6 26 23.21 0.212

Diarrhea 17 19.31 26 23.21 0.495

Skin rash 16 18.18 34 30.35 0.138

Creatinine 3 3.4 2 1.78 0.465

Proteinuria 11 12.5 11 9.82 0.686

Hematuria 4 4.54 7 6.25 0.600

Bilirubin 1 1.13 4 3.57 0.496

AST/ALT 0 0 2 1.78 0.452

Paresthesia 8 9.09 22 19.6 0.001

Edema 35 39.7 68 60.7 0.011

Bone pain 26 29.5 45 40.1 0.001

Hair loss 3 3.4 11 9.82 0.005

Color changes 3 3.4 16 14.28 0.12

Weight gain 30 34 25 22.3 0.42

P value from T test

generalized edema, which was significantly more common

in female patients than in males (P<0.011). No ascites or

anasarca cases were documented in this study; in addition,

neither pleural nor pericardial effusions were registered

in this study, similar to the findings of Breccia et al. [17].

Hensley et al. reported that the non-hematologic main

adverse effects with imatinib included fatigue, edema,

nausea, diarrhea, muscle cramps, and rash [18]; Druker et

al. found similar results regarding fluid retention and edema

at 53.2% [19], but severe periorbital edema was occasionally

observed and was postulated to be an effect of plateletderived

growth factor receptor and KIT expressed by dermal

dendrocytes [19,20].

Regarding bone pain, this study found that it was

experienced by 35.5% of patients, which is similar to the

rates reported by other studies [19,21].

Paresthesia was found in 15%, which was not proven

by electromyography or nerve conduction study; this was

highly significant in females (P<0.001), which may be due

to hypophosphatemia, hypocalcemia, and hypomagnesemia

caused either by the imatinib or NSAIDs. Low incidence of

severe infections (grades 3 and 4) was noticed in 1.5% of

patients with chronic phase CML, more significantly so in

females. Typically patients with chronic phase CML do not

suffer from an increase in bacterial or fungal infections until

the advanced state of blastic crisis [21].

Regarding all gastrointestinal side effects (nausea,

vomiting, stomatitis, and diarrhea), they were seen in 86% of

patients, but they were more likely to be of grade 1 or 2 and

did not force the patients to stop using the drug, except for

stomatitis of grades 3 and 4, which occurred just in 1.5% of

cases. Nausea due to direct irritant effect of the drug on the

391




gastric mucosa was experienced by 32.5% of patients, which

was not significantly different between males and females.

Less frequently, vomiting was encountered in 13.5%, while

stomatitis was of grades 1 and 2 in most occasions, associated

with neutropenia, and was registered in 17.5% of patients,

mainly in females.

Druker et al. stated that nausea and vomiting was

experienced by 42.5% and 14.7%, respectively [19]; however,

these side effects could be reduced by taking imatinib with

food, dividing the dose, or using antiemetic medications

[21].

Elevation of the total serum bilirubin and other liver

enzymes (ALT and AST) occurred in 2.5% and 1% of cases,

respectively. This elevation occurred mostly in those patients

with long durations of imatinib therapy rather than those

with less than 1 year of treatment. The cause of this increase

in bilirubin may the drug interaction that metabolized in the

liver due to drugs like acetaminophen, or, in one patient,

antituberculosis medication [22].

Hepatotoxicity is uncommon, occurring in

approximately 3% of patients, usually within 6 months

of the onset of imatinib use. Acute liver failure has been

described [22]. Other causes of liver dysfunction should

be excluded, including viral studies and examination of

serum ferritin level, α1-anti-trypsin level, and concurrent

use of hepatotoxic drugs such as acetaminophen. Imatinib

is metabolized by the CYP3A4/5 P-450 enzyme system.

Thus, caution needs to be taken when using drugs that are

metabolized by the liver [22].

Grade 1 and 2 elevations of creatinine were noticed in

2.5% of cases, while proteinuria and hematuria were seen in

11% and 5.5% of cases, respectively. This may be related to

the direct effect of the drug on the kidneys, or to underlying

kidney diseases caused by diabetes or chronic uncontrolled

hypertension. It was not significantly related to the use of

other medications.

During this study, discoloration of patients’ hair occurred

in 9.5% of cases, in which the hair color changed from white

to a dark color, while hair loss occurred in only 7% of CML

patients. Hair depigmentation and hypopigmentation of the

skin, probably related to the inhibition of the KIT receptor

tyrosine kinase by imatinib, were reported in a French

study, in which 133 patients with CML were treated with

imatinib mesylate. Among these 133 patients, 5 men and 4

women (median age, 63.4 years; range, 53 to 75) with gray

hair before treatment had progressive repigmentation of the

hair (on the head in 8 patients and on the body and head

in 1) during treatment. The median time between the end

of interferon-alpha therapy and the start of treatment with

imatinib mesylate was 5.7 months (range, 0.5 to 42). Hair

repigmentation occurred after a median of 5 months (range,

2 to 14) of treatment with imatinib mesylate. How imatinib

mesylate might induce hair repigmentation is a mystery

[23]. Functional assays show inhibition of the DDR1

gene by imatinib mesylate, a potent inhibitor of BCR-ABL

tyrosine kinase and c-kit tyrosine kinase. Interestingly, the

use of imatinib can lead to vitiligo-like lesions, possibly due

to inhibition of tyrosinase activity through the c-kit pathway

blockade. The DDR1 gene is located between the HLA-E

and HLA-C genes at chromosomal region 6p21, previously

linked to vitiligo susceptibility in a Chinese population. In

another study, imatinib has been proposed as a therapy for

vitiligo because of its effects on the DDR1 gene [24,25].

Out of 200 patients in this study, weight gain was more

significantly common among males than females (34%

versus 22%); this was mostly because of fluid retention,

which was statistically not significant. However, it is clear

that fluid retention alone cannot account for the progressive

increases in weight seen in some patients, as increased

appetite has been reported by some patients while taking

imatinib, which abates with discontinuation of treatment

for any reason. Another aspect of weight gain has been

observed with return of a normal appetite following the

discontinuation of interferon-alpha treatment. Patients

prone to weight problems need to be cautioned about the

association of imatinib with weight gain [26].

In conclusion, imatinib mesylate is a well-tolerated drug,

in our study and all undesirable effects were easy to manage.

The most common hematologic side effect was anemia.

Regarding the non-hematologic side effects, edema, bone

pain, and nausea were the most commonly encountered

conditions.





included.

References

1. Faderl S, Talpaz M, Estrov Z, O’Brien S, Kurzrock R,

Kantarjian HM. The biology of chronic myeloid leukemia.

N Engl J Med 1999;341:164-172.

2. Sawyers CL. Chronic myeloid leukemia. N Engl J Med

1999;340:1330-1340.

3. Sawyers CL, Druker B. Tyrosine kinase inhibitors in chronic

myeloid leukemia. Cancer J Sci Am 1999;5:63-69.

4. Faderl S, Talpaz M, Estrov Z, Kantarjian HM. Chronic

myelogenous leukemia: biology and therapy. Ann Intern

Med 1999;131:207-219.

5. Nowell PC, Hungerford DA. A minute chromosome

in human chronic granulocytic leukemia. Science

1960;132:1497-1500.

6. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine

kinase activity and transformation potency of bcr-abl

oncogene products. Science 1990;247:1079-1082.

392


Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study Turk J Hematol 2013;30:387-393

7. Anafi M, Gazit A, Gilon C, Ben Neriah Y, Levitzki A. Selective

interactions of transforming and normal abl proteins with

ATP, tyrosine-copolymer substrates, and tyrphostins. J Biol

Chem 1992;267:4518-4523.

8. Anafi M, Gazit A, Zehavi A, Ben Neriah Y, Levitzki A.

Tyrphostin-induced inhibition of p210bcr-abl tyrosine

kinase activity induces K562 to differentiate. Blood

1993;82:3524-3529.

9. Kaur G, Gazit A, Levitzki A, Stowe E, Cooney DA, Sausville

EA. Tyrphostin induced growth inhibition: correlation with

effect on p210 bcr-abl autokinase activity in K562 chronic

myelogenous leukemia. Anticancer Drugs 1994;5:213-222.

10. Brunstein CG, McGlave PB. The biology and treatment of

chronic myelogenous leukemia. Oncology 2001;15:23-31.

11. Hughes TP, Kaeda J, Branford S. Frequency of major

molecular responses to imatinib or alpha-interferon plus

cytarabine in newly diagnosed chronic myeloid leukemia.

N Engl J Med 2004;349:1423-1432.

12. Deininger MWN, O’Brien SG, Ford JM. Practical

management of patients with chronic myeloid leukemia

receiving imatinib. J Clin Oncol 2003;21:1-11.

13. Kantarjian H, Sawyers C, Hochhaus A, Guilhot F, Schiffer

G, Gambacorti-Passerini C, Niederwieser D. Hematologic

and cytogenetic responses to imatinib mesylate in chronic

myelogenous leukemia. N Engl J Med 2002;346:645-652.

14. Talpaz M, Silver RT, Druker BJ. Imatinib induces durable

hematologic and cytogenetic responses in patients with

accelerated phase chronic myeloid leukemia: results of a

phase 2 study. Blood 2002;99:1928-1937.

15. Druker BJ, Sawyers CL, Kantarjian H. Activity of a specific

inhibitor of the BCR-ABL tyrosine kinase in the blast crisis

of chronic myeloid leukemia and acute lymphoblastic

leukemia with the Philadelphia chromosome. N Engl J Med

2001;344:1038-1042.

16. Druker BJ, Guilhot F, O’Brien S, Larson RA, on behalf of the

IRIS. Long-term benefits of imatinib (IM) for patients newly

diagnosed with chronic myelogenous leukemia in chronic

phase (CML-CP): the 5-year update from the IRIS study. J

Clin Oncol 2006;24:338.

17. Breccia M, Stefanizzi C, Cannella L, Latagliata R, Frustaci

AM, Carmosino I, Santopietro M, Alimena G. Differences

in hematological and non-hematological toxicity during

treatment with imatinib in patients with early and late

chronic phase chronic myeloid leukemia. Leuk Lymphoma

2008;49:2328-2832.

18. Hensley ML, Ford JM. Imatinib treatment: specific issues

related to safety, fertility, and pregnancy. Semin Hematol

2003;40:21-25.

19. Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford

JM, Lydon NB, Kantarjian H, Capdeville R, Ohno-Jones S,

Sawyers CL. Efficacy and safety of a specific inhibitor of the

bcr-abl tyrosine kinase in chronic myeloid leukemia. N Engl

J Med 2001;344:1031-1037.

20. Esmaeli B, Prieto VG, Butler CE, Kim SK, Ahmadi MA,

Kantarjian HM, Talpaz M. Severe periorbital edema

secondary to STI571 (Gleevec). Cancer 2002;95:881-887.

21. Reichard KK, Larson RS, Rabinowitz I. Chronic myeloid

leukemia. In: Green JP, Foerster J, Rodgers GM, Paraskevas

F, Glader B, Arber DA, Means RT Jr, editors. Wintrobe’s

Clinical Hematology. 12th ed. Philadelphia: Lippincott

Williams and Wilkins; 2009. pp. 2006-2030.

22. Cross TJ, Bagot C, Portmann B, Wendon J, Gillett D. Imatinib

mesylate as a cause of acute liver failure. Am J Hematol

2006;83:189-192.

23. Etienne G, Cony-Makhoul P, Mahon FX. Imatinib mesylate

and gray hair. N Engl J Med 2002;347:446.

24. Legros L, Cassuto JP, Ortonne JP. Imatinib mesilate (Glivec):

a systemic depigmenting agent for extensive vitiligo? Br J

Dermatol 2005;153:691-692.

25. Silva de Castro C, Machado do Nascimento L, Walker G,

Werneck RI, Nogoceke E, Mira M. Genetic variants of the

DDR1 gene are associated with vitiligo in two independent

Brazilian population samples. J Invest Dermatol

2010;130:1813-1818.

26. Atallah E, Durand JB, Kantarjian H, Cortes J. Congestive

heart failure is a rare event in patients receiving imatinib

therapy. Blood 2007;110:1233-1237.

393

Research Article

DOI: 10.4274/Tjh.2012.0086

Hematological Parameters in Severe Complicated

Plasmodium falciparum Malaria among Adults in Aden

Ciddi Komplike Falciparum Sıtmalı Aden Yetişkinlerinde

Hematolojik Parametreler

Sawsan Bakhubaira

Aden University, Faculty of Medicine and Health Sciences, Department of Hematology Oncology, Aden, Yemen

Abstract:

Objective: To study some hematological parameters in adult patients with complicated severe malaria and their relations

to clinical outcome.

Materials and Methods: This was a prospective study, including 77 patients from Aden Governorate with complicated

severe malaria over the course of 2 years (2010-2011).

Results: The common form of severe malaria in Aden was cerebral malaria (25.9%), followed by renal failure (18.2%), severe

anemia (16.9%), and hepatitis (14.3%), with a case fatality rate of 7.8%. Hemoglobin concentration was significantly different

among the various complications of severe malaria, while platelet and white blood cell counts did not show such differences.

The mean age was older among patients that died. Hematological parameters did not significantly differ among dead or surviving

patients. Thrombocytopenia was seen in 42.9% of patients and 18.2% of these had platelet counts of <50.0x10 9 /L. However,

none of them developed bleeding.

Conclusion: This study concluded that hematological changes are common complications encountered in severe malaria,

but they are not related to the clinical outcome.

Key Words: Complicated, Severe, Malaria, Thrombocytopenia

Özet:

Amaç: Komplike ağır sıtmalı hastalarda bazı hematolojik parametrelerin klinik sonuç ile ilişkisinin incelenmesi.

Gereç ve Yöntemler: Aden vilayetinde iki yıllık sürede (2010-2012) tanı alan 77 komplike ağır sıtma hastasını içine alan

prospektif bir çalışma yapıldı.

Bulgular: Ağır sıtmanın çeşitli komplikasyonlarında hemoglobin konsantrasyonları önemli ölçüde farklı idi, bununla birlikte

trombosit ve lökosit sayıları bu farklılığı göstermedi. Yaş ortalaması ölen hastalar arasında büyüktü.

Hematolojik parametreler, ölen ya da hayatta kalan hastalar arasında önemli derecede farklı değildi. Trombositopeni oranı

%42,9 idi ve bunların %18,2’sinde sayı 50,0 x10 9 /L’den küçüktü. Ancak hiçbirinde kanama gelişmedi.

Sonuç: Bu çalışma ile, hematolojik değişikliklerin ağır sıtmada sık karşılaşılan komplikasyonlar olduğu fakat klinik sonuç

ile ilişkili olmadığı sonucuna varılmıştır.

Anahtar Kelimeler: Komplike, Ciddi, Sıtma, Trombositopeni

Address for Correspondence: Sawsan BAKHUBAİRA, M.D,

Aden University, Faculty of Medicine and Health Sciences, Department of Hematology Oncology, Aden, Yemen

Phone: 00967777929010 E-mail: bakhubaira@gmail.com

Received/Geliş tarihi : October 16, 2011

Accepted/Kabul tarihi : May 16, 2013

394

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden


Introduction

Malaria is an important cause of death and illness,

especially in tropical countries [1]. The most severe forms

of and deaths from malaria are caused by Plasmodium

falciparum, with other species rarely producing serious

complications, debilitating relapses, and even death [2].

Major complications of severe malaria can develop rapidly

and progress to death within hours or days [3]. These include

cerebral malaria, pulmonary edema, acute renal failure,

severe anemia, and/or bleeding. Acidosis and hypoglycemia

are the most common metabolic complications [1,2,3,4].

The World Health Organization (WHO) established

criteria for severe malaria that assisted clinical and

epidemiological studies. This project was begun in 1990

[4] and was then revised in 2000 to include other clinical

manifestations and laboratory values that portend a poor

prognosis based on clinical experience in semi-immune

patients [3].

In Yemen, malaria remains a significant health problem,

with Plasmodium falciparum as the predominant species

that is responsible for 90% of malaria cases [5]. Different

studies were conducted on severe malaria, such as that of

Al-Taiar et al. [6] on pediatric patients, which showed severe

malaria constituting 17% of pediatric hospital admissions.

In the same study, the main presentation of severe malaria

was respiratory distress (40%), followed by severe anemia

(37%) and cerebral malaria (8%). Another study conducted

by Al-Mekhlafi et al. [7] reported that severe malaria puts a

high burden on health services in Yemen, and they found a

high prevalence of severe malaria among children younger

than 5 years old.

The previous studies on severe malaria in Yemen did

not focus on the hematological parameters of complicated

severe malaria in adults; therefore, this study was conducted

to evaluate the main hematological parameters in adult

patients with complicated severe malaria in Aden, where a

large central referral hospital and a branch of the National

Center of Public Health Laboratories (NCPHL) are present.


This was a prospective study that included 77 patients

from Aden Governorate with complicated severe malaria

admitted to Al-Gamhouria Modern General Hospital

(Aden, Yemen) and treated at the NCPHL in Aden during 2

years (2010-2011). Patients were selected according to the

following criteria: adult Yemeni patients with severe malaria

(aged 18 years or more), confirmed to have Plasmodium

falciparum malaria parasites in the peripheral blood or bone

marrow, and presenting with severe malaria as according

to the WHO definition [3]. Severe malaria patients were

followed within the hospital until death or discharge (not

including discharge against medical advice).

Exclusion criteria included severe malaria patients of <18

years of age, severe malaria patients who were not residents

of Aden (because they usually refuse to stay in the hospital

after initial improvement), and severe malaria patients who

absconded or were discharged against medical advice.

The hematological data were collected from the

NCPHL in Aden. The clinical data were obtained directly

from patients or relatives as well as from physicians in the

intensive care unit of the internal medical department of

the hospital, where complicated severe malaria patients are

admitted.

In the NCPHL, malaria is diagnosed by thick and thin

blood films. These films were stained with Giemsa for the

detection and characterization of Plasmodium falciparum

malaria and the parasite load was determined for each film.

Diagnosis of severe malaria was established according to

the WHO criteria published in 2000 [3]:

- Severe anemia was defined as normocytic normochromic

anemia with hematocrit of <15% or hemoglobin of <5 g/

dL in the presence of parasitemia at >1000/µL. In the

case of microcytic/hypochromic anemia, iron deficiency,

thalassemia, and hemoglobinopathy were ruled out.

- Cerebral malaria was defined as unrousable coma not

attributable to any other cause, with a Glasgow Coma Scale

score of ≤9, or coma that persisted for at least 30 minutes

after a generalized convulsion.

- Renal failure was defined as urine output of <400 mL/24

h and serum creatinine of >3.0 mg/dL despite adequate

volume repletion.

- Circulatory collapse (algid malaria) was defined as

systolic blood pressure of <70 mmHg with cold, clammy

skin or a core-skin temperature difference of >10 °C.

- Black-water fever was defined as the passage of dark red,

brown, or black urine secondary to massive intravascular

hemolysis and resulting hemoglobinuria.

- Hepatitis was defined as the presence of clinically

detected jaundice with serum bilirubin concentration of >3

mg/dL and ultrasonographic evidence of enlarged, inflamed

liver with elevated liver enzymes.

- Hypoglycemia was defined as plasma glucose level of

<40 mg/dL.

- Prostration and weakness was defined as a patient

who could not sit or walk with no obvious neurological

explanations.


The collected data were analyzed with SPSS 18.

Quantitative variables were presented as mean values,

standard deviations, and ranges. Results were tested by

the Mann–Whitney or Student t-test with a 95% level

of significance and p≤0.05 was considered statistically

significant.

395



Ethical Considerations

This study was approved by the ethics committee of the

hospital as well as by the ethics committee of the NCPHL

in Aden. During data collection from patients or relatives,

verbal consent was obtained, and names and personal data

were completely secured and transferred to codes to keep

patients’ identities private.

Results

A total of 88 patients were diagnosed with complicated

severe malaria, and 11 of these were excluded due to leaving

the hospital early against medical advice. The remaining 77

patients were followed until discharge with medical advice

or death.

The most common form of complicated severe malaria

among the studied 77 patients in Aden was cerebral malaria

(25.9%), followed by renal failure, severe anemia, and

hepatitis at 18.2%, 16.9%, and 14.3%, respectively (Table 1).

The mean hemoglobin concentration showed a highly

significant statistical difference in relation to the type of

complications in severe malaria (p=0.00001); it was lowest

in those with severe anemia (3.5 g/dL), increasing to 8.2 g/

dL in cases of renal failure, to 9 and 9.1 g/dL respectively

in hepatitis cases and in prostrated patients, and up to 11.4

and 11.6 g/dL in cerebral malaria and algid malaria patients,

respectively (Table 1).

Platelet and white blood cell (WBC) counts did not

show significant statistical differences in relation to the type

of complications in severe malaria (p=0.052 and p=0.095,

respectively) (Table 1).

The studied patients were followed until complete

improvement and discharge, while 6 of them died,

representing a case fatality rate of 7.8% (Figure 1). The

mean age of deceased patients with severe malaria was

statistically significantly older than the mean age of those

who survived after severe malaria: 45.2 years versus 29.3

years, respectively (p=0.015). However, the mean values of

the studied hematological parameters (hemoglobin, platelet,

and WBC counts) were not significantly different among

those who died or survived after severe complicated malaria

(Table 2).

Thirty-three patients from the studied 77 with severe

complicated malaria had thrombocytopenia (platelet count

of <150x10 9 /L) at variable degrees; this rate represents 42.9%

of all severe complicated malaria cases in this study. However,

none of them developed bleeding. In these patients, the

Table 1. Studied hematological parameters by type of complications in severe malaria.

Complications

(n=77)

Hemoglobin

concentration (g/dL)

Platelet count

(x10 9 /L)

WBC count

(x10 9 /L)

n % Mean±SD Range Mean±SD Range Mean±SD Range

Cerebral malaria 20 25.9 11.4±1.7 9.2-13.8 143.5±52.8 40-373 5.8±4.6 1.0-19.0

Renal failure 14 18.2 8.2±2.6 5.7-11.4 152.4±80.6 20-350 4.3±2.1 1.3-9.0

Severe anemia 13 16.9 3.5±1.2 2.0-4.8 197.4±63.9 90-296 2.8±0.2 1.0-5.5

Hepatitis 11 14.3 9.0±3.3 5.8-13.8 200.7±135.4 20-482 5.6±2.5 2.0-9.9

Algid malaria 8 10.4 11.6±2.6 7.2-13.9 232.0±108.5 60-396 3.5±0.8 1.0-6.2

Hypoglycemia 5 6.5 10.4±1.1 9.0-12.0 120.7±85.4 76-291 5.5±2.8 2.6-8.8

Prostration and

weakness

3 3.9 9.1±1.7 7.8-11.3 89.4±35.2 60-130 6.2±1.4 1.5-9.8

Black-water fever 3 3.9 10.8±2.4 8.1-13.2 133.0±13.2 122-147 4.0±1.4 2.3-8.1

Mann–Whitney test (p-value) 0.00001 0.052 0.095

p≤0.05 is statistically significant. SD: standard deviation; WBC: white blood cell.

396



count was repeated by manual method. They were classified

into 3 grades: grade 1 thrombocytopenia with counts of

<150 to 75x10 9 /L, grade 2 thrombocytopenia with counts of

<75 to 50x10 9 /L, and grade 3 thrombocytopenia with counts

of <50x10 9 /L. The studied cases of thrombocytopenia were

classified as 57.6% in grade 1, 24.2% in grade 2, and 18.2%

in grade 3 (Table 3).

Three of the 6 deceased patients had grade 1

thrombocytopenia, 2 had grade 2, and 1 had grade 3 (Table

3). Five out of the 6 deceased patients in this study (83.3%)

had cerebral malaria, while the sixth patient (16.7%) had

renal failure (Table 4).

Discussion

This study demonstrated some hematological parameters

in complicated severe malaria due to Plasmodium falciparum,

which is the most common type of malaria infection in

Yemen, accounting for 90% of malaria cases [5].

Cerebral malaria was the most common complication in

severe malaria in adults, representing a quarter of the studied

cases (25.9%). Several hypotheses have been proposed to

explain the pathophysiology of cerebral malaria, but none

have been completely satisfactory. Moreover, there is no

association of cerebral malaria with altered hematological

parameters [1]. This is similar to the findings of this study

Table 2. Age and studied hematological parameters of deceased versus surviving patients with complicated severe

malaria.

Hematological

parameters

Alive (n=71)

Died (n=6)

Mean±SD Range Mean±SD Range

p*

Age (years) 29.3±14.5 18-70 45.2±21.1 19-80 0.015

Hemoglobin concentration (g/dL) 10.1±2.8 3.2-13.9 9.3±2.4 2.0-12.2 0.312

Platelet count (x10 9 /L) 131.9±85.8 40-373 140.5±67.1 48-335 0.812

WBC count (x10 9 /L) 4.2±2.7 1.0-19.0 3.4±1.4 1.0-9.9 0.477

*: p-values were calculated by t-test. SD: standard deviation; WBC: white blood cell.

Table 3. Grades of thrombocytopenia associated with complicated severe malaria in adult patients in Aden.

Thrombocytopenia

Grade

(x10 9 /L)

n % Minimum Maximum

Number of deceased

patients

Grade 1 <150.0-75.0 19 57.6 75.0 149.3 3

Grade 2 <75.0-50.0 8 24.2 50.0 74.6 2

Grade 3 <50.0 6 18.2 24.3 49.2 1

Total 33 100.0 24.3 149.3 6

397



(Table 1), whereby mean hemoglobin, WBC, and platelet

counts were not affected in cerebral malaria patients.

Hemoglobin concentration showed lowest mean values

reaching 3.5 g/dL in the studied patients with severe

anemia. Plasmodium falciparum malaria is one of the most

common causes of anemia. The other Plasmodium species

rarely cause anemia because only select red cell populations

(reticulocytes in the case of P. vivax and P. ovale and older

cells in P. malariae) are invaded. Multiple mechanisms

cause anemia in severe malaria, the most important being

hemolysis of infected and uninfected red blood cells (RBCs),

splenic sequestration of RBCs, dyserythropoiesis, and bone

marrow suppression; such factors can culminate in the

chronically low hemoglobin values observed in patients

residing in holoendemic regions [8,9].

Studies found that anemia is also correlated with the

severity of malaria infection [10]. In this study, the mean

WBC count did not show a deviation from the normal

reference range in all types of complicated severe malaria.

This is similar to the results reported by Bashawri et al. [11]

Table 4. Causes of mortality in 6 adult patients with

complicated severe malaria in Aden.

Cause of death n %

Cardiopulmonary arrest with cerebral

malaria

Cardiopulmonary arrest with renal

failure

5 83.3

1 16.7

Total 6 100.0

in Saudi Arabia. However, other studies showed that during

severe P. falciparum infection there are changes in leukocyte

proliferation and function.

Thrombocytopenia was detected in 42.9% of the studied

patients with complicated severe malaria. This is a common

hematological alteration in malaria, which may be a result

of peripheral platelet destruction and consumption. Studies

showed that immune complexes generated by malarial

antigens lead to sequestration of the injured platelets by

macrophages in the spleen [12]. The present finding of

thrombocytopenia is similar to that that reported by Banzal

et al. [13] in Saudi Arabia (50.4%).

In this study, thrombocytopenia was graded to look for

the percentage of lower platelet counts; 18.2% of the studied

patients showed a count of <50.0x10 9 /L. In a study by Khan

et al. [14], a quarter (26.8%) of the cases of P. falciparum

malaria showed grade 3 thrombocytopenia with a count of

<50.0x10 9 /L. However, none of our patients bled, and all

of them recovered from thrombocytopenia quickly during

treatment.

In regard to mortality associated with complicated

severe malaria, neurological manifestations were the major

determinant of morbidity and mortality in severe malaria

cases in adults. All 6 of the deceased patients in this study

suffered cardiopulmonary arrest and died. Postmortem

autopsy is not a routine in Yemen; it is only done in legal

cases. Five out of the 6 deceased patients in this study

(83.3%) had cerebral malaria and the sixth (16.7%) had

renal failure. However, hematological findings were not

seriously deteriorated in the studied patients with cerebral

malaria. This finding is similar to that reported by Mengistu

and Diro in Ethiopia [15], as well as to the findings of Giha

Table 5. Sex, age, and studied hematological parameters in patients with cerebral malaria.

Hematological parameters

Patients with cerebral malaria (n=20)

Mean±SD

Range

Sex of patient: Male 18 (90.0%)

Female 2 (10.0%)

Age (years) 31.6±17.0 18-80

Hemoglobin concentration (g/dL) 11.4±1.7 9.2-13.8

Platelet count (x10 9 /L) 143.5±52.8 40-373

WBC count (x10 9 /L) 5.8±4.6 1.0-19.0

Sex of patients expressed as number and percentage. SD: standard deviation; WBC: white blood cell.

398



et al. [16] in Sudan, who reported mean hemoglobin levels

to be higher in patients who died of severe malaria than in

the survivors.

Conclusion

This study concluded that hematological changes are

common complications encountered in any patient with

severe malaria. Hemoglobin concentration is associated with

significant changes in relation to the type of complications of

severe malaria; however, it is not associated with the clinical

outcome after severe malaria. The total WBC count cannot

be used as a predictor for severity. Thrombocytopenia can

implicate complications, but it is usually asymptomatic and

platelet transfusions are generally not required because

patients recover quickly. It is recommended that physicians

should rely on the clinical presentation and complaints

of patients with severe malaria and not hurry to conduct

transfusion of blood or blood components based on the

findings of hematological parameters alone (Table 5).





included.

References

1. Trampuz A, Jereb M, Muzlovic I, Prabhu RM. Clinical

review: severe malaria. Crit Care 2003;7:315-323.

2. Svenson JE, MacLean JD, Gyorkos TW, Keystone J.

Imported malaria. Clinical presentation and examination

of symptomatic travelers. Arch Intern Med 1995;155:861-

868.

3. [No authors listed.] Severe falciparum malaria. World Health

Organization, Communicable Diseases Cluster. Trans R Soc

Trop Med Hyg 2000;94(Suppl. 1):1-90.

4. [No authors listed.] Severe and complicated malaria. World

Health Organization, Division of Control of Tropical Diseases.

Trans R Soc Trop Med Hyg 1990;84(Suppl. 2):1-65.

5. Al-Mekhlafi AM, Mahdy MA, Azazy AA, Fong MY. Molecular

epidemiology of Plasmodium species prevalent in Yemen

based on 18 s rRNA. Parasit Vectors 2010;3:110.

6. Al-Taiar A, Jaffar S, Assabri A, Al-Habori M, Azazy A, Al-

Mahdi N, Ameen K, Greenwood BM, Whitty CJ. Severe

malaria in children in Yemen: two site observational study.

BMJ 2006;333:827-832.

7. Al-Mekhlafi AM, Mahdy MA, Azazy AA, Fong MY. Clinical

situation of endemic malaria in Yemen. Trop Biomed

2010;27:551-558.

8. Buffet PA, Safeukui I, Milon G, Mercereau-Puijalon O, David

PH. Retention of erythrocytes in the spleen: a doubleedged

process in human malaria. Curr Opin Hematol

2009;16:157-164.

9. Perkins DJ, Were T, Davenport GC, Kempaiah P, Hittner JB,

Ong’echa JM. Severe malarial anemia: innate immunity and

pathogenesis. Int J Biol Sci 2011;7:1427-1442.

10. Das BS, Nanda NK, Rath PK, Satapathy RN, Das DB. Anemia in

acute Plasmodium falciparum malaria in children from Orissa

State, India. Ann Trop Med Parasitol 1999;93:109-118.

11. Bashawri LAM, Mandil AA, Bahnassy AA, Ahmed

MA. Malaria: hematological aspects. Ann Saudi Med

2002;22:372-377.

12. Looareesuwan S, Davis JG, Allen DL, Lee SH, Bunnag D,

White NJ. Thrombocytopenia in malaria. Southeast Asian J

Trop Med Public Health 1992;23:44-50.

13. Banzal S, Ayoola EA, El-Sammani EE. The clinical pattern

and complications of severe malaria in the Gizan Region of

Saudi Arabia. Ann Saudi Med 1999;19:378-380.

14. Khan SJ, Abbass Y, Marwat MA. Thrombocytopenia as an

indicator of malaria in adult population. Malaria Res Treat

2012;2012:405981. doi: 10.1155/2012/405981. Epub

2012 Jul 2.

15. Mengistu G, Diro E. Treatment outcome of severe malaria

in adults with emphasis on neurological manifestations at

Gondar University Hospital, north west Ethiopia. Ethiop J

Health Dev 2006;20:106-111.

16. Giha HA, Elghazali G, A-Elgadir TM, A-Elbasit IE, Eltahir

EM, Baraka OZ, Khier MM, Adam I, Troye-Blomberg

M, Theander TG, Elbashir MI. Clinical pattern of severe

Plasmodium falciparum malaria in Sudan in an area

characterized by seasonal and unstable malaria transmission.

Transact Royal Soc Trop Med Hyg 2005;99:243-251.

399

Case Report

DOI: 10.4274/Tjh.2012.0180

Co-expression of t(15;17) and t(8;21) in a Case of Acute

Promyelocytic Leukemia: Review of the Literature

Akut Promiyelositik Lösemili Bir Hastada t(15;17) ve t(8;21)

Birlikteliği: Literatürün Gözden Geçirilmesi

Burak Uz, Eylem Eliaçık, Ayse Işık, Salih Aksu, Yahya Büyükaşık, İbrahim C. Haznedaroğlu, Hakan Göker,

Nilgün Sayınalp, Osman İ. Özcebe

Hacettepe University Medical School, Department of Internal Medicine, Division of Hematology, Ankara, Turkey

Abstract:

Additional chromosomal abnormalities in acute myelogenous leukemia have been identified as one of the most important

prognostic factors. Favorable chromosomal changes such as t(8;21), inv(16), and t(15;17) are associated with higher rates of

complete remission and event-free survival. Translocation (15;17) characterizes acute promyelocytic leukemia (APL) (French-

American-British class M3) in almost all patients. Secondary chromosomal abnormalities are also present in approximately

23%-29% of patients with newly diagnosed APL. The prognostic implications of t(8;21) and other secondary cytogenetic

aberrations in APL are reviewed here. We present a 47-year-old woman diagnosed with APL whose initial cytogenetic analysis

included both t(8;21) and t(15;17). The initial induction chemotherapy included 3 days of idarubicin (12 mg/m2/day) and

daily all-trans retinoic acid (ATRA; 45 mg/m2/day). At the sixth week of treatment, a control bone marrow biopsy was found

to be normocellular, t(15;17) bcr3 and t(8;21) were negative, and t(15;17) bcr1 fusion transcripts were reduced from 5007

(1.78525699%) copies per 1 µg RNA to 40 (0.00062020%) with real-time quantitative polymerase chain reaction. Consolidation

with 4 days of idarubicin (5 mg/m2/day), ATRA (45 mg/m2/day for 15 days), and cytarabine (1 g/m2/day for 4 days) was then

started. However, the patient became pancytopenic and had neutropenic fever after consolidation treatment. Unfortunately,

she died 3 months after the time of APL diagnosis, due to acute respiratory distress syndrome-like respiratory problems and

multiorgan dysfunction requiring respiratory support and hemodialysis.

Key Words: Additional chromosomal abnormalities, Acute promyelocytic leukemia

Özet:

Akut miyeloid lösemide ek kromozomal anomaliler en önemli prognostik faktörlerden biri olarak belirlenmiştir. Translokasyon

t(8;21), inv(16), ve t(15;17) gibi olumlu kromozomal değişiklikler daha yüksek tam remisyon ve olaysız sağkalım ile ilişkilidir.

Translokasyon (15;17) neredeyse tüm hastalarda akut promiyelositik lösemiyi (APL) tanımlamaktadır (Fransız-Amerikan-

İngiliz [FAB] sınıf M3). Yeni tanı alan APL hastalarının yaklaşık %23-29’unda ikincil kromozomal anomaliler de bulunmaktadır.

Bu olgu vesilesiyle APL’de t(8;21) ve diğer ikincil sitogenetik aberasyonların prognostik etkileri gözden geçirilmiştir. APL

tanısı konan 47 yaşındaki kadın hastanın tanı anındaki sitogenetik analizinde t(8;21) ve t(15;17) birlikteliği saptandı.

Başlangıç indüksiyon kemoterapisi 3 gün idarubisin (12 mg/m2/gün), ve günlük all-trans retinoik asit (ATRA) (45 mg/m2/gün)

içermekteydi. Tedavinin 6. haftasında yapılan kontrol kemik iliği biyopsisi normoselülerdi. t(15;17) bcr3 ve t(8;21) negatifti,

ve gerçek zamanlı kantitatif polimeraz zincir reaksiyonu (RQ-PCR) ile tespit edilen t(15;17) bcr1 füzyon transkriptleri 5007

(1,78525699 %) kopya/1 µg RNA’dan 40 (0,00062020 %)’a düşmüştü. Bunun üzerine 4 gün idarubisin (5 mg/m2/gün), 15

gün ATRA (45 mg/m2/gün), ve 4 gün sitarabin (1 g/m2/gün) içeren konsolidasyon tedavisi başlandı. Konsolidasyon tedavisi

sonrasında hastada pansitopeni ve nötropenik ateş tablosu gelişti. APL tanısından 3 ay sonra, solunum desteği ve hemodiyaliz

gerektiren çoklu organ fonksiyon bozukluğu ve ARDS-benzeri solunum problemleri nedeniyle hasta kaybedildi.

Anahtar Kelimeler: Ek kromozomal anomaliler, Akut promiyelositik lösemi

Address for Correspondence: Burak UZ, M.D.,

Hacettepe University Medical School, Department of Internal Medicine, Division of Hematology, Ankara, Turkey

Phone: +90 312 305 15 43 E-mail: burakuz78@gmail.com

Received/Geliş tarihi : November 22, 2012


400

Uz B, et al: Co-expression of t(15;17) and (8;21) in APL


Introduction

Acute promyelocytic leukemia (APL) accounts for

approximately 10%-15% of acute myelogenous leukemia

(AML) cases and is a very specific subtype with regard to

morphologic, clinical, and prognostic features [1]. Although

APL has the highest frequency of hemorrhagic morbidity

and mortality among all subtypes of AML, most patients

with t(15;17) will respond to a combination treatment with

all trans-retinoic acid (ATRA), cytarabine (Ara-C), and

anthracycline-based chemotherapy [1,2].

Balanced chromosome rearrangements are detected in

approximately 25%-30% of adults with de novo AML [3-

5] and have attracted a great deal of attention because of

specific translocations and inversions associated with the

prognosis of the patients harboring them. t(15;17) is known

to be found in almost all APL patients [1]. Chromosomal

abnormalities accompanying t(15;17) are reported in 23%-

39% of APL cases [2,6,7,8,9,10]. Additional chromosome

rearrangements including t(8;21) and t(15;17) are rarely

seen in APL patients [11,12]. However, the clinical impact

of these secondary anomalies has not been clearly elucidated

yet.

Herein, we present an APL patient who had both t(15;17)

and t(8;21) at the time of diagnosis. Diagnosis of APL in this

patient was based on karyotyping, immunophenotyping,

and molecular studies of bone marrow cells. The treatment

and clinical course of the patient is summarized. Informed

consent was obtained.

Case Report

In February 2012, a 47-year-old woman was admitted

to the General Surgery Department of our institution with

a 3-week history of fever, anal pain, and rectal discharge.

Her initial blood count showed pancytopenia as follows: Hb,

55 g/L (normal range: 117-155), WBC: 1.6 x 10 9 /L (normal

range: 4.1-11.2) with 0.2 x 10 9 /L absolute count (10.4%) of

neutrophils, and platelets, 56 x 10 9 /L (normal range: 159-

388). Peripheral blood smear revealed 1% neutrophils, 11%

lymphocytes, 88% lymphomononuclear cells, poikilocytosis,

anisocytosis, and schistocytes. Besides a mild increase in

fasting blood glucose (6.56 mmol/L; normal range: 3.9-

6.1), all biochemical parameters were within normal limits.

Abdominal magnetic resonance imaging (MRI) revealed

a lesion consistent with abscess formation (1.8 x 1.3 cm)

adjacent to the right of the anal canal, which was hyperintense

in T2A-weighted images and demonstrated peripheral

involvement after the administration of intravenous contrast

medium. A lateral internal sphincterotomy was performed

in March 2012. After the operation she had continuous fever

and leukocytosis (21.8 x 10 9 /L) with 19.6 x 10 9 /L absolute

count (89.9%) of neutrophils. Her platelet count decreased

to 11 x 10 9 /L. Despite replacement with platelet suspensions,

she had retinal bleeding. Coagulation parameters revealed a

increased prothrombin time (2.22 international normalized

ratio; normal range: 0.86-1.20), D-dimer level (>20 mg/

mL; normal range: 0-0.48), and thrombin time (27.2 s;

normal range: 16.6-22.5). Fibrinogen level was found to be

low (1.4 µmol/L; normal range: 6.4-11.9). Activated partial

thromboplastin time was normal. The patient was referred

to the hematology division. Her physical examination

revealed fever (38.3 °C), generalized petechiae, and bilateral

complete loss of pupillary light reflex. She did not have a

chronic disease or history of drug usage. She had been

pancytopenic since December 2011, and a bone marrow

biopsy performed at another center was found to be

normocellular (50%), with no finding of dysplasia. The bone

marrow biopsy was repeated to reveal a marked increase in

cellularity, with a grade I-II/III increase in reticulin network.

Intermediate- to large-sized immature cells with large

cytoplasm and irregularly shaped nuclei including light

chromatin and 2-3 little nucleoli were seen. The immature

cells were CD34-negative. Immature cells were accepted

as Faggot cells including Auer rods with May-Grünwald

Giemsa staining. Bone marrow aspiration revealed 20%

blasts and 20% promyelocytes. Thus, the patient’s diagnosis

was APL. Spinal lumbosacral MRI showed diffuse bone

marrow signal alterations and contrast medium involvement

of all vertebrae and iliac bones. A suspicious compression at

the L5 level was also reported, but the patient did not have

any neurologic deficits.

Flow cytometric analysis of bone marrow samples

identified the presence of an abnormal population of

CD13(+)/CD33(+)/CD45(+)/MPO(+)/DR(-)/Tdt(-) cells.

Analysis of 25 metaphases showed clonal abnormalities.

The karyotype was interpreted as 46,XX,t(8;21)(q22;q22)

[1]/46,XX,t(15;17)(q22;q21)[5]/46,XX[24]. Additional

fluorescence in situ hybridization (FISH) studies for the PML

locus at 15q22 and RARα locus at 17q21 were carried out.

Analysis of 100 interphase nuclei showed a hybridization

pattern consistent with PML/RARα fusion in 36 (36%)

nuclei (nuc ish(PMLx3)(RARAlfax3)(PML conRARAlfax1)

[36/100]). In addition, real-time quantitative (RQ)

polymerase chain reaction (PCR) analysis with t(15;17) bcr1

transcript revealed 5007 copies (1.78525699%) of fusion

transcripts per 1 µg RNA and 305 copies (0.1082556554%)

of fusion transcripts per 1 µg RNA with t(15;17) bcr3

transcript. FLT3 ITD and D835 mutations were studied from

peripheral blood with the PCR and restriction fragment

length polymorphism (PCR-RFLP) method, and both were

negative.

Induction chemotherapy consisting of 3 days of

idarubicin (12 mg/m 2 /day) and daily ATRA (45 mg/m 2 /day)

was initiated. After the induction therapy, the pancytopenic

state improved (Hb: 10 9 g/L, WBC: 3.6 x 10 9 /L with 2.1

x 10 9 /L absolute count (59.0%) of neutrophils, platelets:

239 x 10 9 /L), and the hemostasis tests returned to normal

limits except a mild increase in D-dimer (2.02 mg/mL)

401



and fibrinogen levels (15.6 µmol/L). At the sixth week of

treatment, a control bone marrow biopsy was found to

be normocellular. In addition, t(15;17) bcr3 and t(8;21)

were negative, and t(15;17) bcr1 fusion transcripts were

reduced from 5007 (1.78525699%) copies per 1 µg RNA

to 40 (0.00062020%). Consolidation treatment including

4 days of idarubicin (5 mg/m 2 /day), ATRA (45 mg/m 2 /day

for 15 days), and cytarabine (1 g/m 2 /day for 4 days) was

then started. After consolidation therapy, the patient became

pancytopenic and had neutropenic fever. She was transferred

to the intensive care unit because of acute respiratory

distress syndrome-like respiratory problems and multiorgan

dysfunction requiring hemodialysis and respiratory support.

Despite appropriate antibiotic treatment, multiple red blood

cell and platelet transfusions, and inotropic agents, the

patient expired 3 monts after the time of APL diagnosis.

402

Discussion

In the APL-93 trial, the incidence of chromosomal

abnormalities in addition to t(15;17) was 26%, and trisomy

8 was the most frequent secondary change (46% of the

cases with secondary changes) [2]. Additional chromosome

rearrangements including t(8;21) and t(15;17) are rarely

seen in APL patients treated initially with ATRA plus

chemotherapy [11,13,14,15]. Two case studies reported a

coexistence of t(8;21) and t(15;17) chromosomal anomalies

in their patients at the time of diagnosis, and they concluded

that t(8;21) may have been the first event to originate

from an early leukemic clone, while t(15;17) was acquired

later in the course of the disease [11,13]. Charrin et al.

detected 2 clones at the initial phase of an AML including

46,XX,t(15;17) and 46,XX,t(8;21),t(15;17). Relapse

occurred after 12 months of complete remission with

typical APL syndrome when t(15;17) alone was the most

predominant [11]. Movafagh et al. [16] reported a female

patient in whom 2 French-American-British (FAB)-specific

chromosome aberrations evolved from a single leukemic

clone and co-expressed t(15;17) and t(8;21). Recently, in a

case of APL-M3v in which complete remission was achieved

soon after a course of ATRA plus chemotherapy, a novel

t(8;21) chromosomal aberration was detected from 3 to

18 months after initial treatment. Intermittent detection of

t(8;21) during periods without ATRA therapy may reflect

the antitumor effect of ATRA on M2 leukemic cells and 2

independently growing aberrant stem cell clones in this

patient. The authors also suggested that the proportion of

M2 leukemic cells at the time of diagnosis should be below

the sensitivity level of the nested PCR detection limit, and,

after chemotherapy, alteration of bone marrow cell kinetics

should trigger t(8;21) via complex mechanisms [12].

The prognostic impacts of additional cytogenetic

abnormalities in APL patients have been analyzed in a

number of studies, and conflicting results were obtained

[2,6,7,8,9,10]. Grimwade et al. evaluated 1612 AML

patients and found that these cytogenetic changes did not

alter the prognosis of patients with favorable karyotypic

anomalies such as t(15;17). Trisomy 21 was categorized in

the intermediate risk group, while monosomies 5 and 7 had

no effects on response rates and overall survival [10]. In

the largest study by de Botton et al. [2], patients with only

t(15;17) and patients with t(15;17) plus other chromosomal

abnormalities were compared. In accordance with the

findings of Grimwade et al. [10], additional cytogenetic

changes in patients with t(15;17) had no impact on complete

remission rate, event-free survival, relapse and overall

survival at 2 years. Calabrese et al. suggested that complex

chromosome translocations were secondary changes that

occurred after standard t(8;21) and t(15;17), thus clarifying

the hierarchy of the cytogenetic events [17].

Today, ATRA in combination with conventional

chemotherapy increases the efficacy of ATRA dramatically

and improves the long-term survival of APL patients to 75%

[18]. In non-APL AML, the effects of ATRA are less clear.

However, there has been a long-standing interest in the

clinical use of ATRA for the treatment of AML subtypes other

than APL. ATRA has growth inhibitory effects in non-M3

leukemic cells through cytotoxicity and apoptosis [19].

ATRA’s inhibitory roles in non-APL leukemic cells including

the HL-60 cell line [20], ovarian carcinoma, neuroblastoma,

and germ cell tumors [21] were also reported. Based on

these promising scientific data, Schlenk et al. evaluated

ATRA in combination with intensive chemotherapy in non-

APL elderly AML patients. They suggested that patients with

the genotype mutant NPM1 without FLT3 ITD who had

been randomized to the ATRA arm had a significantly better

relapse-free and overall survival compared to patients with

the same genotype who had not been randomized to the

ATRA arm. They considered that ATRA may exert its effect

by down-regulation or by posttranslational modification

of the antiapoptotic protein bcl-2 [22]. Four cases of AML

that were initially misdiagnosed as APL based on FAB

classification were successfully treated with ATRA alone.

Three of these patients achieved complete response (CR),

but all of them relapsed early. Their diagnoses were changed

to t(8;21) AML based on karyotype analysis. One of the 3

patients who achieved CR had a decrement of the AML1-

ETO fusion gene from 92% to 0% after 10 days of ATRA

treatment. However, prior use of arsenic trioxide in the same

patient did not alter the AML1-ETO fusion gene in the bone

marrow cells according to FISH analysis. Interestingly, one

patient who had a temporary response (without CR) with

ATRA achieved CR after a combined treatment including

daunorubicin and cytarabine. The presence of both AML1-

ETO and PML-RARα fusion genes were detected by RT-PCR

in this patient [23]. The authors suggested that AML1-

ETO and PML-RARα recruit a multiprotein complex

containing histone deacetylases (HDACs) on crucial myeloid

differentiation via several co-repressors, which leads to a cell

differentiation block [24]. In addition, oligomerization and



formation of high-molecular-weight complexes by AML1-

ETO and PML-RARα play a critical role in the aberrant

recruitment of HDAC activity [25].

Our case showed the typical APL morphology and coexpression

of t(8;21) and t(15;17), which was detected by

conventional cytogenetic analysis. RQ-PCR technology has

recently reached a level of sensitivity, accuracy, and practical

ease that supports its use as a routine bioinstrumentation

for gene level measurement [26]. However, in our patient,

t(8;21) was determined by cytogenetic analysis, but not

by RQ-PCR. FLT3 ITD and D835 mutations were both

negative. Classic AIDA induction chemotherapy [27,28]

was administered to the patient. She went into remission

after induction chemotherapy. t(15;17) bcr3 and t(8;21)

became negative, and t(15;17) bcr1 fusion transcripts were

reduced from 5007 (1.78525699%) copies per 1 µg RNA

to 40 (0.00062020%) according to RQ-PCR. Consolidation

treatment including 4 days of idarubicin (5 mg/m 2 /day),

ATRA (45 mg/m 2 /day for 15 days), and cytarabine (1 g/m 2 /

day for 4 days) was then started.

Co-expression of t(8;21) and t(15;17) is rarely seen in

APL patients. The role of chromosome translocations other

than t(15;17) in APL is still unclear. The current literature

data support the concept that patients harboring t(15;17)

with any other additional chromosomal abnormality a

similarly favorable prognosis as patients with t(15;17)

alone. Combined use of conventional cytogenetics, FISH

[29], and PCR should increase the detection of additional

chromosomal abnormalities either in diagnosis or in the

treatment period of APL. Combination therapy with ATRA,

Ara-C, and anthracycline should be an appropriate choice to

improve the prognosis in these patients. Further studies are

required to clarify the clinical features and prognosis with

complex translocations.





included.

References

1. Saydam G. [Acute promyelocytic leukemia]. Turkiye Klinikleri

J Med Sci 2007;3:42-49.

2. de Botton S, Chevret S, Sanz M, Dombret H, Thomas X,

Guerci A, Fey M, Rayon C, Huguet F, Sotto JJ, Gardin C, Cony

Makhoul P, Travade P, Solary E, Fegueux N, Bordessoule D,

San Miguel J, Link H, Desablens B, Stamatoullas A, Deconinck

E, Geiser K, Hess U, Maloisel F, Castaigne S, Preudhomme

C, Chomienne C, Degos L, Fenaux P; European APL

Group. Additional chromosomal abnormalities in patients

with acute promyelocytic leukaemia (APL) do not confer

poor prognosis: results of APL 93 trial. Br J Haematol

2000;111:801-806.

3. Byrd JC, Mrózek K, Dodge RK, Carroll AJ, Edwards CG,

Arthur DC, Pettenati MJ, Patil SR, Rao KW, Watson MS,

Koduru PR, Moore JO, Stone RM, Mayer RJ, Feldman EJ,

Davey FR, Schiffer CA, Larson RA, Bloomfield CD; Cancer

and Leukemia Group B (CALGB 8461). Pretreatment

cytogenetic abnormalities are predictive of induction

success, cumulative incidence of relapse, and overall survival

in adult patients with de novo acute myeloid leukemia:

results from Cancer and Leukemia Group B (CALGB 8461).

Blood 2002;15;100:4325-4336.

4. Slovak ML, Kopecky KJ, Cassileth PA, Harrington DH, Theil

KS, Mohamed A, Paietta E, Willman CL, Head DR, Rowe

JM, Forman SJ, Appelbaum FR. Karyotypic analysis predicts

outcome of preremission and postremission therapy in

adult acute myeloid leukemia: a Southwest Oncology

Group/Eastern Cooperative Oncology Group study. Blood

2000;96:4075-4083.

5. Grimwade D, Walker H, Harrison G, Oliver F, Chatters

S, Harrison CJ, Wheatley K, Burnett AK, Goldstone AH;

Medical Research Council Adult Leukemia Working Party.

The predictive value of hierarchical cytogenetic classification

in older adults with acute myeloid leukemia (AML): analysis

of 1065 patients entered into the United Kingdom Medical

Research Council AML11 trial. Blood 2001;98:1312-1320.

6. Schoch C, Haase D, Haferlach T, Freund M, Link H,

Lengfelder E, Löffler H, Büchner T, Fonatsch C. Incidence

and implication of additional chromosome aberrations

in acute promyelocytic leukaemia with translocation

t(15;17)(q22;q21): a report on 50 patients. Br J Haematol

1996;94:493-500.

7. Slack JL, Arthur DC, Lawrence D, Mrózek K, Mayer RJ, Davey

FR, Tantravahi R, Pettenati MJ, Bigner S, Carroll AJ, Rao KW,

Schiffer CA, Bloomfield CD. Secondary cytogenetic changes

in acute promyelocytic leukemia—Prognostic importance

in patients treated with chemotherapy alone and association

with the intron 3 breakpoint of the PML gene: a Cancer and

Leukemia Group B study. J Clin Oncol 1997;15:1786-1795.

8. Hiorns LR, Swansbury GJ, Mehta J, Min T, Dainton MG,

Treleaven J, Powles RL, Catovsky D. Additional chromosome

abnormalities confer worse prognosis in acute promyelocytic

leukaemia. Br J Haematol 1997;96:314-321.

9. Pantic M, Novak A, Marisavljevic D, Djordjevic V, Elezovic I,

Vidovic A, Colovic M. Additional chromosome aberrations

in acute promyelocytic leukemia: characteristics and

prognostic influence. Med Oncol 2000;17:307-313.

10. Grimwade D, Walker H, Oliver F, Wheatley K, Harrison C,

Harrison G, Rees J, Hann I, Stevens R, Burnett A, Goldstone

A. The importance of diagnostic cytogenetics on outcome in

AML: analysis of 1,612 patients entered into the MRC AML

10 trial. Blood 1998;92:2322-2333.

11. Charrin C, Ritouet D, Campos L, Devaux Y, Archimbaud

E, Fraisse J, Fiere D, Germain D. Association of t(15;17)

and t(8;21) in the initial phase of an acute promyelocytic

leukemia. Cancer Genet Cytogenet 1992;58:177-180.

403



12. Neto WK, Serpa M, Sanabani SS, Bueno PT, Velloso ED,

Dorlhiac-Llacer PE, Bendit I. Early detection of t(8;21)

chromosomal translocations during treatment of PML-

RARA positive acute promyelocytic leukemia: a case study.

Clin Med Insights Oncol 2010;4:163-170.

13. Bonomi R, Giordano H, del Pilar Moreno M, Bodega

E, Landoni AI, Gallagher R, del Rosario Uriarte M.

Simultaneous PML/RARα and AML1/ETO expression with

t(15;17) at onset and relapse with only t(8;21) in an acute

promyelocytic leukemia patient. Cancer Genet Cytogenet

2000;123:41-43.

14. Varella-Garcia M, Brizard F, Roche J, Flandrin G, Drabkin H,

Brizard A. AMl1/ETO and PMl/RARA rearrangements in a

case of AML-M2 acute myeloblastic leukemia with t(15;17).

Leuk Lymphoma 1999;33:403-406.

15. Xu L, Zhao WL, Xiong SM, Su XY, Zhao M, Wang C, Gao

YR, Niu C, Cao Q, Gu BW, Zhu YM, Gu J, Hu J, Yan H, Shen

ZX, Chen Z, Chen SJ. Molecular cytogenetic characterization

and clinical relevance of additional, complex and/or

variant chromosome abnormalities in acute promyelocytic

leukemia. Leukemia 2001;15:1359-1368.

16. Movafagh A, Varma N, Varma S. Co-expression of two

FAB-specific chromosome changes, t(15;17) and t(8;21),

in a case of acute promyelocytic leukemia. Ann Hematol

1996;72:375-377.

17. Calabrese G, Min T, Stuppia L, Powles R, Swansbury JG,

Morizio E, Peila R, Donti E, Fioritoni G, Palka G. Complex

chromosome translocations of standard t(8;21) and

t(15;17) arise from a two-step mechanism as evidenced by

fluorescence in situ hybridization analysis. Cancer Genet

Cytogenet 1996;91:40-45.

18. Degos L, Wang ZY. All trans-retinoic acid in acute

promyelocytic leukemia. Oncogene 2001;20:7140-7145.

19. Lehmann S, Bengtzen S, Broberg U, Paul C. Effects of retinoids

on cell toxicity and apoptosis in leukemic blast cells from

patients with non-M3 AML. Leuk Res 2000;24:19-25.

20. Petrie K, Zelent A, Waxman S. Differentiation therapy of

acute myeloid leukemia: past, present and future. Curr

Opin Hematol 2009;16:84-91.

21. Miller WH Jr. The emerging role of retinoids and retinoic

acid metabolism blocking agents in the treatment of cancer.

Cancer 1998;83:1471-1482.

22. Schlenk RF, Döhner K, Kneba M, Götze K, Hartmann F, Del

Valle F, Kirchen H, Koller E, Fischer JT, Bullinger L, Habdank

M, Späth D, Groner S, Krebs B, Kayser S, Corbacioglu A,

Anhalt A, Benner A, Fröhling S, Döhner H; German-Austrian

AML Study Group (AMLSG). Gene mutations and response

to treatment with all-trans retinoic acid in elderly patients

with acute myeloid leukemia. Results from the AMLSG Trial

AML HD98B. Haematologica 2009;94:54-60.

23. Qian SX, Li JY, Hong M, Qiu HR, Fan L, Xu W. Acute

myeloid leukemia in four patients with t(8;21) treated with

all-trans retinoic acid as a single agent. Leuk Lymphoma

2008;49:998-1001.

24. Lutterbach B, Westendorf JJ, Linggi B, Patten A, Moniwa M,

Davie JR, Huynh KD, Bardwell VJ, Lavinsky RM, Rosenfeld

MG, Glass C, Seto E, Hiebert SW. ETO, a target of t(8;21)

in acute leukemia, interacts with the N-CoR and mSin3 corepressors.

Mol Cell Biol 1998;18:7176-7184.

25. Lin RJ, Evans RM. Acquisition of oncogenic potential by

RAR chimeras in acute promyelocytic leukemia through

formation of homodimers. Mol Cell 2000;5:821-830.

26. Savlı H, Hatırnaz Ö. [Quantitative real time-polymerase

chain reaction and gene expression analysis in haematology:

a review]. Turkiye Klinikleri J Med Sci 2004;24:653-660.

27. Sanz MA, Martín G, Rayón C, Esteve J, González M, Díaz-

Mediavilla J, Bolufer P, Barragán E, Terol MJ, González

JD, Colomer D, Chillón C, Rivas C, Gómez T, Ribera JM,

Bornstein R, Román J, Calasanz MJ, Arias J, Alvarez C, Ramos

F, Debén G. A modified AIDA protocol with anthracyclinebased

consolidation results in high antileukemic efficacy

and reduced toxicity in newly diagnosed PML/RARαpositive

acute promyelocytic leukemia. PETHEMA Group.

Blood 1999;94:3015-3021.

28. Sanz MA, Montesinos P, Rayón C, Holowiecka A, de la Serna

J, Milone G, de Lisa E, Brunet S, Rubio V, Ribera JM, Rivas

C, Krsnik I, Bergua J, González J, Díaz-Mediavilla J, Rojas

R, Manso F, Ossenkoppele G, González JD, Lowenberg B;

PETHEMA and HOVON Groups. Risk-adapted treatment

of acute promyelocytic leukemia based on all-trans

retinoic acid and anthracycline with addition of cytarabine

in consolidation therapy for high-risk patients: further

improvements in treatment outcome. Blood 2010;115:5137-

5146.

29. Ogur G, Fen T, Sucak G, Heimann P, Cankuş G, Haznedar R.

Impact of fluorescence in situ hybridization in the detection

of cryptic fusion transcript PML/RARA and a complex

t(5;15;17) in a case of acute promyelocytic leukemia. Turk J

Haematol 2000;17:207-212.

404

Case Report

DOI: 10.4274/Tjh.2012.0172

Primary Adrenal Lymphoma with Secondary Central

Nervous System Involvement: A Case Report and Review

of the Literature

İkincil Merkezi Sinir Sistemi Tutulumu Olan Primer Adrenal

Lenfoma: Olgu Sunumu ve Derleme

Kübra Aydın¹, Kerem Okutur¹, Mustafa Bozkurt¹, Özlem Aydın 3 , Esat Namal¹, Akın Öztürk¹, Kezban Nur Pilancı¹,

Reyhan Diz Küçükkaya², Osman Gökhan Demir¹

1İstanbul Bilim University Division of Medical Oncology, Department of Internal Medicine, İstanbul, Turkey

2İstanbul Bilim University Division of Hematology, Department of Internal Medicine, İstanbul, Turkey

3Acıbadem University School of Medicine, Department of Pathology, İstanbul, Turkey

Abstract:

Approximately 10%-20% of all systemic lymphomas have central nervous system (CNS) involvement, which has been correlated

to a worsened prognosis. It is well known that secondary involvement of the adrenal glands may occur in up to 25% of patients

during the course of diffuse lymphoma. Primary adrenal lymphoma (PAL), however, is a different entity, and it is defined as

the presence of adrenal lymphoma without evidence of either nodal involvement or leukemia. It has been shown that this

occurrence is rarely accompanied by extranodal involvement, such as in the CNS. PAL exhibits a tendency for CNS relapse and

this possibility should be examined even before symptoms are present. Herein we present a patient with PAL and secondary

CNS involvement.

Key Words: Primary adrenal lymphoma, Central nervous system involvement

Özet:

Tüm sistemik lenfomaların yaklaşık %10-20’sinde merkezi sinir sistemi (MSS) tutulumu mevcuttur ve bunun kötü prognozla

ilişkili olduğu görülmüştür. Yaygın lenfoma hastalık seyrinde hastaların %25’inde ikincil adrenal bez tutulumu olduğu iyi

bilinmektedir. Fakat primer adrenal lenfoma (PAL) farklı bir kavramdır ve ne lösemi ne de lenf bezi tutulumu olmadan adrenal

lenfoma görülmesi olarak tanımlanmıştır. Bu duruma nadiren MSS gibi lenf bezi dışı tutulumların eşlik ettiği görülmüştür.

Sonuç olarak PAL MSS’de nüks etme eğilimi göstermektedir ve bu belirti vermeden önce araştılmalıdır. Burada ikincil MSS

tutulumu olan bir PAL olgusu sunmaktayız.

Anahtar Sözcükler: Primer adrenal lenfoma, Merkezi sinir sistemi tutulumu

Introduction

Central nervous system (CNS) involvement is found in

about 10%-20% of all systemic lymphomas, and it is generally

correlated with a worsened prognosis [1]. Secondary

involvement of the CNS in non-Hodgkin lymphoma may be

shown in several different ways, and rapid control of CNS

involvement in this scenario is deemed to be necessary to

prevent neurologic morbidity and to preserve/enhance the

quality of life. Lymphoma cells seem to enter the CNS via

hematogenous spread or direct extension from adjacent bone

metastases, or through centripetal growth along neurovascular

Address for Correspondence: Kübra AYDIN, M.D.,

Department of Internal Medicine, Division of Medical Oncology, İstanbul Bilim University, Istanbul, Turkey

GSM: +90 505 527 11 78 E-mail: drkubra@yahoo.com

Received/Geliş tarihi : November 11, 2012


405


Aydın K, et al: PAL with CNS Involvement

bundles. It has also been hypothesized that known lymphoma

cells have a potential to spread from retroperitoneal lymph

nodes or patient’s bone marrow to the leptomeninges via the

intervertebral venous plexus [2].

Several series of autopsies have shown that up to 25% of

patients with non-Hodgkin lymphoma have adrenal gland

involvement, and this is usually associated with advanced

disease [3]. However, in contrast, primary adrenal lymphoma

(PAL) is a different entity, defined as the presence of adrenal

lymphoma without evidence of nodal involvement or leukemia.

In addition, this has been found to be rarely accompanied by

extranodal involvement. This is considered to be an enigma,

however, because a normal adrenal gland in humans has been

shown to be devoid of any lymphoid or hematopoietic tissue.

Possible explanations for the occurrence of PAL include either

preexisting autoimmune adrenalitis with lymphocyte infiltration

or hematopoietic rest tissue in the adrenals, although this is not

conclusively proven to exist due to the rarity of the disease [4].

In this article we report a rare case of PAL with secondary

CNS involvement and review the literature.

Case Report

A 75-year-old male was admitted to our neurology clinic

with a chief complaint of dullness for a duration of 2 months.

The patient had a history of diabetes mellitus and Parkinson’s

disease. A brain MRI was obtained and revealed a paramedian

subcortical mass measuring 30 mm x 25 mm x 25 mm,

located on the superior and middle frontal gyrus of the left

brain hemisphere. Moreover, this lesion was accompanied by

diffuse perilesional vasogenic edema. Due to the mass and

edema effects, there was compression noted on the anterior

horn of the left lateral ventricle. Additionally, a similar mass

was detected measuring 2.5 cm in diameter located at the

right frontal periventricular. After diagnosis, the patient

underwent surgical intervention and an excisional biopsy was

performed. The histopathological examination of the specimen

revealed a CD20+ large B cell lymphoma (Figures 1A and 1B).

Subsequently, the patient was referred to our medical oncology

outpatient clinic. Physical examination at the outpatient

admission showed no pathological findings correlated to vital

signs and systems. The patient’s blood pressure was 120/70

mmHg, while the respiratory rate was 18/min, pulse rate

was 67/min, and body temperature was 37.0 °C. There was

no lymphadenopathy or organomegaly noted. Laboratory

tests revealed a normal complete blood count; however, the

erythrocyte sedimentation rate was found to be 45 mm/h.

Additionally, β2-microglobulin and other laboratory values were

found to be within normal limits. The patient’s baseline lactate

dehydrogenase (LDH) level was within the normal levels. HIV

test results were negative, while the International Prognostic

Index score was calculated to be 4 (high risk). Chest computed

tomography (CT) imaging was reviewed and determined to

be normal, without any evidence of hilar lymphadenopathy or

pulmonary lesions. An abdominal CT scan revealed bilateral

adrenal mass. The left adrenal mass was measured as 30 mm x

33 mm, whereas the right adrenal mass was 32 mm x 53 mm

in diameter. PET/CT scanning revealed a fluorodeoxyglucose

(FDG) uptake focus only in the adrenal glands, and the brain

was without pathologic glycolytic activity, as were all other

regions of the body (Figures 2A and 2B). A CT-guided fine

needle aspiration biopsy was obtained from both adrenal

masses, and this scan revealed a CD20+ large B cell lymphoma

similar in presentation to the patient’s brain pathology (Figure

1C). Bone marrow biopsy was normal, having no lymphoma

infiltration. Thus, the diagnosis for this patient was reported

to be stage IV diffuse large B cell PAL with secondary CNS

involvement. Unfortunately, because of generalized seizures

and status epilepticus, the patient was transferred to the

intensive care unit (ICU). Antiepileptic and antiedema drugs

were administered. Along the course, gram-negative septicemia

occurred, and suitable antibiotics for coverage were included

in the patient’s treatment. A new cranial CT was performed

and suggested a rapid, progressive cranial mass (Figure 2C).

Whole-brain radiotherapy was then initiated. Several days after

initiation of radiotherapy, the patient improved, and he was

subsequently transferred to a regular nursing floor. Wholebrain

radiotherapy was completed, and then the patient was

discharged from the hospital. Six weeks later, a repeat cranial

MRI showed tumor regression. Afterwards, the patient was

started on chemotherapy utilizing R-COP (rituximab 375 mg/

m 2 , cyclophosphamide 750 mg/m 2 , vincristine 1.4 mg/m 2 ,

prednisone 100 mg/m 2 ). We did not administer adriamycin

due to the patient’s age, his general health status, his history of

sepsis, and an increased risk of further infection. Unfortunately,

2-3 days after the completion of the third cycle of chemotherapy,

the patient had a focal epileptic seizure. Repeat cranial MRI

revealed a progressive left cranial mass, which at this time

crossed the corpus callosum and was in the left side of the

brain hemisphere. The patient was then readmitted to the ICU.

Because of his age and history of whole-brain radiotherapy, a

high dose of methotrexate could not be given. The patient died

at the end of a 6 months of follow-up period due to disease

progression. Informed consent was obtained.

1A 1B 1C

Figure 1: The histopathological examination of the specimen

showed a.

CD20(+) large B cell lymphoma

2A 2B 2C

Figure 2: The images of PET-CT and Cranial MR.

406



Discussion

Primary CNS lymphomas (PCNSLs) make up approximately

1% of intracranial neoplasms and only about 1% of extranodal

non-Hodgkin lymphomas. These lymphomas are mostly

present in individuals over 60 years of age, and this seems to

be related to a reduction of immunologic vigilance, particularly

T lymphocytes. PCNSL has a tendency to remain within the

CNS and there is low incidence of systemic spread from these

neoplasms [5]. In the case presented, we initially expected the

outcome to be PCNSL; however, FDG uptake was detected in

the bilateral adrenal glands in PET/CT, and the subsequent

biopsy revealed a different diagnosis.

Bilateral adrenal masses are found to exist in about 10%-

15% of the adrenal “incidentaloma” cases, likely to be diagnosed

as metastatic disease (mostly from lung or breast), congenital

adrenal hyperplasia, lymphoma, infection, hemorrhage,

adrenocorticotropic hormone-dependent Cushing’s syndrome,

and lastly, pheochromocytoma [6]. There are 2 types of adrenal

involvement in lymphoma: PAL, which is defined as a disease

originating from and confined to the adrenal glands solely, and

non-Hodgkin lymphoma with adrenal involvement [7]. PAL

is extremely rare; only about 100 cases have been previously

reported in the literature [8]. PAL usually does not have disease

found elsewhere, but if it is present, it is more likely extranodal

in nature. Sites for extranodal involvement for PAL are the CNS

and the gastrointestinal tract, as well as other endocrine organs

[9]. In our case, CNS involvement was present. Mantzios et al.

reviewed a total of 100 cases that had been previously reported

in the literature over the past 4 decades [8]. According to their

findings, PAL shows a predilection for older males with a maleto-female

ratio of 2:1. The mean age at presentation with PAL

was 65 years of age. These findings were similar in our case. As

in our case, more than two-thirds of patients had a significant

bilateral enlargement of the adrenal glands. The prognosis of

PAL is poor. More than 90% of patients died within 1 year

of diagnosis. Overall survival time in our case from time of

diagnosis was roughly 6 months. Recently, Kim et al. published

a study investigating prognostic factors in primary diffuse large

B cell lymphoma (DLBCL) of the adrenal gland. Contrary

to prior reports, their data suggested that outcomes of PAL

are encouraging when a regimen of R-CHOP is utilized and

that achieving complete response after R-CHOP therapy is

predictive of survival [10].

Similarly, 5 cases of PAL with CNS involvement have been

reported in the literature [10,11,12,13,14]. Table 1 summarizes

the features of these reported cases. All of the patients reported

were males older than the age of 50 (median age: 65), and

bilateral involvement was noted in all. In one case, a high-

Table 1. Cases of primary adrenal lymphoma with central nervous system involvement.

Case no. 1 2 3 4 5 6 (present

case)

Reference year/

2008/China 2005/France 2002/Korea 2001/Israel 2004/Greece 2013/Turkey

country

Age/sex 74/M 51/M 61/M 60/M 80/M 75/M

Presenting

symptoms

Anorexia, nausea,

vomiting, weight

loss, fatigue,

pigmentation

Generalized

seizure

Abdominal pain

Weight loss,

weakness, abdominal pain

Fever, fatigue,

nausea, emesis, and

constipation

Dullness,

generalized

seizure

Site Bilateral Bilateral Bilateral Bilateral Bilateral Bilateral

Size

R5.9 L7.7 R5 L4 R5.8 L5.8 R6 L4 R9 L10 R3.3 L5.3

(max. cm)

Diagnosis US, CT, PET, CT, biopsy CT, MRI, PET, CT, Ga67 scan,

CT, biopsy

CT, PET, biopsy

biopsy

biopsy

biopsy

Pathology DLBCL DLBCL DLBCL DLBCL Burkitt/

DLBCL

Burkitt-like

lymphoma

Treatment CHOP MVBP, MTX(it)

ACVBP

CEOP, WBRT CHOP, WBRT, high-dose

MTX

CNOP+R

WBRT,

R-COP

Site of CNS Not defined Cerebral, Frontal lobe, Parietal lobe Leptomeninges Frontal lobe

epidural basal ganglia,

cerebellum

Prognosis 6 months 16 months 6 months 14 months 2 months 6 months

Abbreviations: WBRT, Whole brain radiotherapy; DLBCL, Diffuse large B cell lymphoma;R, Right adrenal gland; L, Left adrenal gland; CHOP, Cyclophosphamide,

doxorubicin, oncovin, prednisone; MVBP, Methotrexate, etoposide, BCNU, prednisone; ACVBP, Adriamycin, cyclophosphamide, vindesine, bleomycin, prednisone;

CEOP, Cytoxan, epirubicin, vincristine, prednisolone; CNOP+R, Cyclophosphamide, mitoxantrone, vincristine, prednisolone + rituximab.

407



grade atypical Burkitt/Burkitt-like lymphoma histology was

found, while all others were cases of DLBCL. Only one patient

presented initially with brain symptoms comparable to those

of our case. Patients in the study had recurrence in the brain

after systemic chemotherapy regimen. Survival was noted to be

a median time of 6 months from initial diagnosis.

Some patients are at an increased risk for developing CNS

relapse, especially if involvement of specific extranodal sites

(bone marrow, epidural, testes, paranasal sinuses, kidneys,

adrenal glands, liver, and breast) is noted, or if there are 2 or

more extranodal sites with elevated LDH. Lumbar puncture

should be performed for initial evaluation in all suspected

patients. Although optimal management of these patients is

still under investigation, intrathecal methotrexate (MTX) has

historically been the most common used regimen. It has been

suggested that systemic intravenous MTX at a dose of 3500 mg/

m 2 followed by leucovorin rescue should be adopted for CNS

prophylaxis in high-risk patients and that intrathecal therapy

be considered only for those patients who are not able to

tolerate systemic therapy [15,16].

For patients with presentation of parenchymal CNS

involvement, systemic methotrexate (3-3, 5 g/m 2 ) should

be incorporated into the treatment regimen. Systemic MTX

with leucovorin rescue has been safely incorporated into

R-CHOP-21, with MTX administrated on day 15 of the 21-

day cycle. Systemic MTX is the optimal treatment for isolated

CNS relapse that involves the brain parenchyma, and longterm

survival is possible in some patients. These patients do

not appear to benefit from intrathecal treatment, and only

symptomatic benefit is noted from radiation treatment [17].

More case studies and data on the treatments performed are

necessary to develop a better picture of diagnostic procedures

and treatment regimens that have maximum efficacy.



including specific financial interests, relationships, and/ or

affiliations relevant to the subject matter or materials included.

References

1. Hollender A, Kvaloy S, Lote K, Nome O, Holte H. Prognostic

factors in 140 adult patients with non-Hodgkin’s lymphoma

with systemic central nervous system (CNS) involvement. A

single centre analysis. Eur J Cancer 2000;36:1762-1768.

2. Levitt LJ, Dawson DM, Rosenthal DS, Moloney WC. CNS

involvement in the non-Hodgkin’s lymphomas. Cancer

1980;45:545-552.

3. Kita M, Mandala E, Saratzis A, Ventzi L, Venizelos I,

Keryttopoulos P, Efstathiadou Z, Garyfallos A, Avrimides A.

Primary adrenal lymphoma presenting as Addison’s disease.

Case report and review of the literature. Exp Clin Endocrinol

Diabetes 2008;116:363-365.

4. Reddy SV, Prabhudesai S, Gnanasekaran B. Origin of primary

adrenal lymphoma and predisposing factors for primary

adrenal insufficiency in primary adrenal lymphoma. Indian J

Endocrinol Metab 2011;15:350-351.

5. Ferreri AJ, Reni M. Primary central nervous system lymphoma.

Crit Rev Oncol Hematol 2007;63:257-268.

6. Wang J, Sun NC, Renslo R, Chuang CC, Tabbarah HJ, Barajas

L, French SW. Clinically silent primary adrenal lymphoma:

a case report and review of the literature. Am J Hematol

1998;58:130-136.

7. Kunavisarut T, Nitiyanant W, Muangsomboon S, Tongdee

T, Siritanratkul N. Non-Hodgkin lymphoma with adrenal

insufficiency: a case report and literature review. J Med Assoc

Thai 2009;92:687-690.

8. Mantzios G, Tsirigotis P, Veliou F, Boutsikakis I, Petraki

L, Kolovos J, Papageorgiou S, Robos Y. Primary adrenal

lymphoma presenting as Addison’s disease: case report and

review of literature. Ann Hematol 2004;83:460-463.

9. Salvatore JR, Ross RS. Primary bilateral adrenal lymphoma.

Leuk Lymphoma 1999;34:111-117.

10. Kim YR, Kim JS, Min YH, Hyunyoon D, Shin HJ, Mun YC, Park

Y, Do YR, Jeong SH, Park JS, Oh SY, Lee S, Park EK, Jang JS, Lee

WS, Lee HW, Eom H, Ahn JS, Jeong JH, Baek SK, Kim SJ, Kim

WS, Suh C. Prognostic factors in primary diffuse large B-cell

lymphoma of adrenal gland treated with rituximab-CHOP

chemotherapy from the Consortium for Improving Survival of

Lymphoma (CISL). J Hematol Oncol 2012;5:49-57.

11. Wang J, Sun H, Bai R, Gao S, Li Y. F-FDG PET/CT images in

primary adrenal lymphoma. Eur J Radiol Extra 2008;68:83-

87.

12. Mermershtain W, Liel Y, Zirkin HJ, Lupu L, Lantsberg S,

Cohen Y. Primary bilateral adrenal lymphoma relapsing as a

solid cerebral mass after complete clinical remission. Am J Clin

Oncol 2001;24:583-585.

13. Vélayoudom FL, Cardot-Bauters C, Decouvelaere AV, Vlaeminck

V, Bauters F, Wémeau JL. Non-Hodgkin’s lymphoma involving

the adrenal glands and the central nervous system (CNS): a

particular evolution after chemotherapy. Ann Endocrinol

(Paris) 2005;66:527-531.

14. Hahn JS, Choi HS, Suh C, Lee WJ. A case of primary bilateral

adrenal lymphoma (PAL) with central nervous system (CNS)

involvement. Yonsei Med J 2002;43:385-390.

15. Armitage JO. How I treat patients with diffuse large B-cell

lymphoma. Blood 2007;1:29-36.

16. Abramson JS, Hellmann M, Barnes JA, Hammerman P,

Toomey C, Takvorian T, Muzikansky A, Hochberg EP.

Intravenous methotrexate as central nervous system (CNS)

prophylaxis is associated with a low risk of CNS recurrence in

high-risk patients with diffuse large B-cell lymphoma. Cancer

2010;116:4283-4290.

17. van Besien K, Ha CS, Murphy S, McLaughlin P, Rodriguez

A, Amin K, Forman A, Romaguera J, Hagemeister F, Younes

A, Bachier C, Sarris A, Sobocinski KS, Cox JD, Cabanillas

F. Risk factors, treatment, and outcome central nervous

system recurrence in adults with intermediate-grade and

immunoblastic lymphoma. Blood 1998;91:1178-1184.

408

Case Report

DOI: 10.4274/Tjh.2012.0072

Primary Bone Lymphoplasmacytic Lymphoma Presenting

with Spinal Cord Compression: A Case Report

Spinal Kord Basısı ile Ortaya Çıkan Lenfoplazmasitik

Primer Kemik Lenfoması: Olgu Sunumu

Yang Lei, Liu Zi, Su Long, Li Pei, Li Wei

Jilin University, Department of Hematology and Oncology, Changchun, China

Abstract:

Primary bone lymphoma is a rare disease, and the main pathological type is diffuse large B-cell lymphoma. The occurrence of

follicular, marginal zone and lymphoplasmacytic lymphomas is rare. Vertebras are also sites that can be affected, and spinal

cord compression is reported in 14% of patients with vertebral involvement. However, there is no report on primary vertebral

lymphoplasmacytic lymphoma with spinal cord compression. The present report presents one case of primary vertebral

lymphoplasmacytic lymphoma with spinal cord compression and increased serum and urine λ light chain, without an elevated

heavy chain of immunoglobulin.

Key Words: Primary bone lymphoma, Lymphoplasmacytic lymphoma, Spinal cord compression

Özet:

Primer kemik lenfoması nadir bir hastalık olup, en sık patolojik tipi difüz büyük B hücreli lenfomadır. Folliküler, marjinal

lenfoma ya da lenfoplazmasitik lenfoma alt tipleri nadirdir. Vertebra tutulan bölgelerden biridir ve spinal kord basısı vertebral

tutulumu olan hastaların %14’ünde bildirilmiştir. Bununla birlikte, spinal kord basısı ile başvuran bir primer vertebra

lenfoplazmasitik lenfoma daha önce rapor edilmemiştir. Bu yazıda spinal kord kompresyonuna neden olmuş primer vertebra

lenfoplazmasitik lenfoması olan ve serum, idrar λ hafif zincir miktarı artmış ancak immünglobulin ağır zinciri normal bulunan

bir olgu sunulmuştur.

Anahtar Sözcükler: Primer kemik lenfoması, Lenfoplazmasitik lenfoma, Spinal kord basısı

Introduction

Primary bone lymphoma (PBL) is defined as lymphoma

localized to the bone without evidence of involvement of

lymph nodes or other tissues at presentation. It one of the

rarest primary bone malignancies, accounting for less than

5% of all primary bone tumors [1]. PBL constitutes less

than 1-2% of all malignant lymphomas in adults [2]. Most

PBLs are primary bone diffuse large B-cell type lymphomas

with a rare occurrence of follicular, marginal zone and

lymphoplasmacytic types [3]. The long bones are primarily

affected and the femur is the most commonly involved

location as a single site [2,4]. The common signs and

symptoms are local bone pain with or without soft tissue

swelling and pathological fracture. Spinal cord compression

is reported in 14% of patients with vertebral involvement

but the presence of B symptoms is relatively uncommon

Address for Correspondence: Yang LEİ, M.D.,

Jilin University, Department of Hematology and Oncology, Changchun, China

Phone: 86-0431-88782051 E-mail: allan54@126.com

Received/Geliş tarihi : June 7, 2012

Accepted/Kabul tarihi : September 27, 2012

409


Lei Y, et al: Primary Bone Lymphoplasmacytic Lymphoma Presenting with Spinal Cord Compression: A Case Report

[2,5]. PBL has a better prognosis following radiotherapy

and chemotherapy than many other malignant tumors,

and therefore early identification allows for appropriate

treatments [2,6]. In this report, the authors present a 61-yearold

patient with a primary vertebra lymphoplasmacytic

lymphoma presenting with spinal cord compression.

410

Case Report

A 61-year-old woman presented to the emergency

department with a 3-month history of progressive chest

and back pain, 1-month history of numbness and weakness

of the lower extremities, and paraplegia for 1 day. Initially,

the patient had a paroxysmal pain of the chest and lower

back, which spread progressively to the bilateral scapula,

oxter, and praecordia. Two months later, she felt numbness

in her left lower extremity. After 1 week, she felt weakness

in the lower extremities and had difficulty in walking. In

three months, the symptoms worsened and hypoesthesia

appeared. She became paraplegic the day before admission to

hospital. The history revealed no cardiac, bowel, or bladder

problems and her pain was not associated with motor or

sensory neurological deficits at presentation. On physical

examination she had no superficial lymphadenopathy or

hepatosplenomegaly. The superficial hypoesthesia was

located below the bilateral papilla plane. Tenderness and pain

in percussion were positive at the level of vertebra T1-T3, in

addition to a mild pain at the level of vertebra L4. Muscular

force was normal for upper limbs, and the forces of hip,

knee, and ankle joints were Grade III for both extending and

flexing. Patellar reflex was strengthened and Achilles tendon

reflex was normal. Computerized tomography (CT) scan

showed a space-occupying lesion located in and outside the

left canalis spinalis and foramen intervertebral levels T1-T3,

accompanied with the destruction of the second vertebra.

Serum calcium, albumin, and lactate dehydrogenase

were within normal range. β2-microglobulin was slightly

increased (2.57 mg/L; normal range is 0.7-1.8 mg/L). Blood

and urine immunofixation were positive for λ chain. Serumfree

lambda light chain was 175.3 mg/L (normal range is

6.72-22.81 mg/L), and κ chain was 10.6 mg/L (normal range

is 5.81-21.04 mg/L). The 24-h urine λ chain was 949.2 mg

(normal range is <7.8 mg). Serum IgG was normal, but a

slight decrease was seen for IgA and IgM, at 0.616 g/L

(normal range is 0.7-4.0 g/L) and 0.192 g/L (normal range

is 0.4-2.3 g/L), respectively. The erythrocyte sedimentation

rate was 21 mm/h (normal range is 0-20 mm/L for females),

and the International Prognostic Index score was 4. Bone

marrow examinations with both smear and biopsy were

normal. Informed consent was obtained from the patient.

On 30 September 2010, the patient received

decompressive laminectomy, and the excision material

was evaluated by hematoxylin-eosin (H&E) staining and

immunohistochemistry. The results revealed diffuse tumor

cell proliferation, which infiltrated and damaged the adjacent

bone and soft tissues. The middle-sized tumor cells showed

plasma cell features that were characterized by abundant

cytoplasm and asymmetrical nuclei. The chromatin was

granulated and Russell bodies could be observed. No

plasmablasts could be found. The morphology suggested a

proliferative disease of plasma cells (Figures 1A-1D). The

immunohistochemical staining result was CD20 (+) (Figure

2A), CD138 (±) (Figure 2B), CD56 (+) (Figure 2C), CD79a

(+) (Figure 2D), CD38 (+), Lambda (+), NUM-1 (+), Ki-67

(some +), PAX5 (weakly positive), Bcl-2 (+/-), CyclinD1 (-),

CD21 (-), CD5 (-), CD3 (-), CK-P (-), CD43 (-), CD23 (-),

CD10 (-), Bcl-6 (-), MPO (-), Kappa (-), EMA (-), and EBER

(-). The pathological diagnosis was lymphoplasmacytic

lymphoma.

Positron emission tomography (PET)-CT was utilized to

stage and determine the disease focus. The results revealed

that the second vertebra had hypermetabolism accompanied

Figure 1: The hematoxylin-eosin (H&E) stained laminectomy

material revealed middle-sized tumor cells with plasma cell

features that were characterized by abundant cytoplasm

and asymmetrical nuclei. The morphology suggested a

proliferative disease of plasma cells.

Figure 2: The immunohistochemical staining resulted in

CD20 (+) (Figure 2A), CD138 (±) (Figure 2B), CD56 (+)

(Figure 2C), CD79a (+) (Figure 2D) cells. The pathological

diagnosis was lymphoplasmacytic lymphoma.



Figure 3: PET-CT of the patient revealed FDG uptake at

second thoracic (Figure 3A, C) and fourth lumbar vertabrae

(Figure 3B, D).

with bone destruction, and the standardized uptake value

(SUV) was 3.2 (average: 2.1) (Figure 3A). The fourth

lumbar vertebra was also hypermetabolic accompanied

with bone destruction, and the SUV was 3.0 (Figure 3B),

which suggested infiltration of lymphoma and compression

fracture of the lumbar vertebra. There was no significant

hypermetabolic focus in other sites.

Local radiation therapy was given to the second thoracic

and fourth lumbar vertebras (total: 44 Gy/22 f). The back

pain gradually disappeared and muscle strength and feeling

gradually recovered during the treatment. The patient then

performed functional training for 1 month. Muscular tension

and strength recovered to normal and she could move freely.

Reexamination of the serum and urine immunofixation

showed positivity of the λ chain. The λ chain was 413.1 mg

(decrease of >50%) for 24 h. PET-CT showed significantly

decreased focus in the second thoracic and fourth lumbar

vertebras (Figures 3C and 3D). After that, the patient

received R-CHOP chemotherapy (R: rituximab, 600 mg; C:

cyclophosphamide, 1125 mg; H: epirubicin, 112.5 mg; O:

vindesine, 4 mg; P: prednisone, 100 mg).

Discussion

PBL is a rare presentation of non-Hodgkin’s lymphoma.

It was first described as a distinct clinicopathological entity

in 1939 by Parker and Jackson [7]. The real prevalence

of PBL is unclear because of the considerable difficulty in

distinguishing primary from secondary bone lymphoma [2].

According to Coley’s criteria [8], primary bone lymphoma

should have: 1) a primary focus in a single bone; 2) positive

histological diagnosis; and 3) no evidence of distant

soft tissue or distant lymph node involvement. Regional

lymph node involvement at diagnosis is not considered

as an exclusion criterion [9,10]. Recently, multiple bone

involvement was also recognized as primary bone lymphoma,

as long as the other 2 criteria are met [9]. According to the

WHO classification, lymphoma involving the bone can be

classified in 4 groups: group 1, lymphoma in a single bone

site with or without regional lymph node involvement; group

2, lymphoma in multiple bones, but no visceral or lymph

node involvement; group 3, bone tumor with involvement

of other visceral sites or lymph nodes at multiple sites; and

group 4, lymphoma involving any other site and found by

bone biopsy that was done to rule out possible involvement

[2]. In this case, the patient was considered as having PBL

involving 2 separate sites of the bone based on the result of

accessory examination.

The stage of PBL was established with the Ann Arbor

staging system. Single localized bone lesions were classified

as Stage IE, and in the case of lymph node involvement on

the same side of the diaphragm, patients were considered to

have Stage IIE. If lymph nodes in both sides of the diaphragm

were involved, the case was considered as Stage IIIE. Stage

IVE disease was defined as cases of multiple sites of bone

involvement. Hence, the present patient was evaluated as a

Stage IVE case.

Lymphoplasmacytic lymphoma (LPL) is one of the rare

subtypes accounting for only 1% to 2% of all non-Hodgkin’s

lymphomas. This lymphoma arises from plasma cells, which

are mature B-lymphocytes [11]. It is most often associated

with increased IgM protein produced by the lymphoma

cells and is commonly referred to as Waldenström’s

macroglobulinemia (WM), which is considered an indolent

lymphoma; the disease progresses very slowly and patients

usually live many years after diagnosis. Recently, there

was also a case report of non-secretory immunoglobulin

of LPL [12]. Instead of the signs and symptoms caused

by infiltration and the circulating IgM of WM, such as

lymphadenopathy, hepatosplenomegaly or hyperviscosity,

our patient only presented with increased λ chain and spinal

cord compression. The immunohistochemistry revealed

positive staining for CD20, CD79a, and Lambda of B cell

markers and negative for CD38 and CD138 of plasma cells,

and so this patient was diagnosed with lymphoplasmacytic

lymphoma. It is difficult to rule out plasmacytoma when

the bone is involved, but B cell antigen is negative in these

patients.

Several studies have suggested that combined modality

(chemotherapy and radiotherapy) was the best treatment

for patients with PBL [2,13]. Beal et al. concluded that

PBL patients treated with combination chemotherapy

and irradiation had significantly better survival than

patients treated with a single modality (chemotherapy or

radiotherapy alone), but the 5-year overall survival rate

between the 2 groups was not significantly different [2,14].

Ramadan et al. reported patients with advanced-stage

disease who received chemotherapy plus irradiation with

a poor outcome when compared with those who received

chemotherapy alone (10-year overall survival rates were 25%

and 56%, respectively) [4]. However, this difference must

411



be very cautiously interpreted because the decision to use

radiotherapy was individualized. It is possible that patients

with more biologically aggressive disease were more likely to

receive irradiation, obscuring its impact [3]. Moreover, this

result was derived from PBL of diffuse large-cell lymphoma

[3]. However, there was no available information in this

report about lymphoplasmacytic lymphoma.

After therapeutic and diagnostic surgery, the patient

received radiation therapy for local lesions of the vertebras.

As she was in an advanced stage (Stage IVE), the R-CHOP

regimen was given for the subsequent treatment. She is

currently alive after the treatment and was periodically

reexamined for almost 1 year; there was no sign of disease

progression or relapse.





included.

References

1. Mulligan ME, McRae GA, Murphey MD. Imaging features

of primary lymphoma of bone. AJR Am J Roentgenol

1999;173:1691-1697.

2. Nasiri MR, Varshoee F, Mohtashami S, Raziee HR, Aledavood

A, Ghafarzadeh K, Memar B, Vojdani S, Sarvizadeh M.

Primary bone lymphoma: a clinicopathological retrospective

study of 28 patients in a single institution. J Res Med Sci

2011;16:814-820.

3. Bhagavathi S, Fu K. Primary bone lymphoma. Arch Pathol

Lab Med 2009;133:1868-1871.

4. Ramadan KM, Shenkier T, Sehn LH, Gascoyne RD, Connors

JM. A clinicopathological retrospective study of 131 patients

with primary bone lymphoma: a population-based study

of successively treated cohorts from the British Columbia

Cancer Agency. Ann Oncol 2007;18:129-135.

5. Zinzani PL, Carrillo G, Ascani S, Barbieri E, Tani M, Paulli M,

Stefoni V, Sabattini E, Alinari L, Binazzi R, Tura S, Baccarani

M, Pileri SA. Primary bone lymphoma: experience with 52

patients. Haematologica 2003;88:280-285.

6. Rahmat K, Wastie M, Abdullah B. Primary bone lymphoma:

report of a case with multifocal skeletal involvement.

Biomed Imaging Interv J 2007;3:52.

7. Parker F, Jackson H. Primary reticulum cell sarcoma of bone.

Surg Gynecol Obstet 1939;45-53.

8. Coley BL, Higginbotham NL, Groesbeck HP. Primary

reticulum cell sarcoma of bone; summary of 37 cases.

Radiology 1950;55:641-658.

9. Singh T, Satheesh CT, Lakshmaiah KC, Suresh TM, Babu GK,

Lokanatha D, Jacob LA, Halkud R. Primary bone lymphoma:

a report of two cases and review of the literature. J Cancer

Res Ther 2010;6:296-298.

10. Baiocchi OC, Colleoni GW, Rodrigues CA, Barton D,

Kerbauy FR, Garcia RJ, Segreto RA, Alves AC, Bordin JO.

Importance of combined-modality therapy for primary

bone lymphoma. Leuk Lymphoma 2003;44:1837-1839.

11. Kristinsson SY, Björkholm M, Goldin LR, McMaster ML,

Turesson I, Landgren O. Risk of lymphoproliferative

disorders among first-degree relatives of lymphoplasmacytic

lymphoma/Waldenström macroglobulinemia patients: a

population-based study in Sweden. Blood 2008;112:3052-

3056.

12. Kobayashi K, Yokote T, Hirata Y, Nakayama S, Hiraoka

N, Takayama A, Iwaki K, Akioka T, Takubo T, Tsuji M,

Hanafusa T. Two case reports of non-secretory [correction

of non-secretary]-Ig types of lymphoplasmacytic lymphoma

(LPL). Ann Hematol 2010; 89: 945-947.

13. Qureshi A, Ali A, Riaz N, Pervez S. Primary non-Hodgkin’s

lymphoma of bone: experience of a decade. Indian J Pathol

Microbiol 2010;53:267-270.

14. Beal K, Allen L, Yahalom J. Primary bone lymphoma:

treatment results and prognostic factors with long-term

follow-up of 82 patients. Cancer 2006;106:2652-2656.

412

Case Report

DOI: 10.4274/Tjh.2012.0055

Sweet Syndrome in a Patient with Chronic Lymphocytic

Leukemia/Small Lymphocytic Lymphoma: Curious

Lymphocyte/Neutrophil Fluctuations

KLL’li bir hastada Sweet Sendromu: İlginç Lenfosit/Nötrofil

Dalgalanmaları

Çiğdem Usul Afşar1, Semra Paydaş1, Meral Günaldı1, Berna Bozkurt Duman1, Vehbi Erçolak1, Suzan Zorludemir2,

Arbil Açıkalın2

1Çukurova University Medical Faculty, Department of Medical Oncology, Adana, Turkey

2Çukurova University Medical Faculty, Department of Pathology, Adana, Turkey

Abstract:

Sweet syndrome, also referred to as acute febrile neutrophilic dermatosis, is characterized by tender, red inflammatory nodules

or papules that occur in association with infection, malignancy, connective tissue disease, or following exposure to certain

drugs. Here, we present Sweet syndrome in a case with small lymphocytic lymphoma/chronic lymphocytic leukemia (SLL/CLL)

which is a relatively rare co-occurrence.

Key Words: Chronic lymphocytic leukemia, Fever, Malignancy, Neutrophilic leucocytosis, Steroid, Sweet syndrome

Özet:

Akut febril nötrofilik dermatoz da denilen Sweet sendromu; enfeksiyon, malignite, konnektif doku hastalıkları veya bazı

ilaçlara maruz kalma sonucu ortaya çıkan; kırmızı, hassas inflamatuvar nodüller veya papüllerle karakterizedir. Burada oldukça

nadir bir birliktelik olan küçük lenfositik lenfoma/kronik lenfositik lösemili (SLL/CLL) bir vakada gelişen Sweet sendromunu

sunduk.

Anahtar Sözcükler: Kronik lenfositik lösemi, Ateş, Malignite, Nötrofilik lökositoz, Steroid, Sweet sendromu

Introduction

In 1964 Robert D. Sweet described a new entity called

“acute febrile neutrophilic dermatosis” and he characterized

the features of the disease. Also known as Sweet syndrome

(SS), it is characterized by a sudden onset of symptoms

including fever, neutrophilia, and characteristic skin lesions

[1]. However, this disease is not limited to the skin; other

organs may be involved. There are various types, including

idiopathic, para-inflammatory, drug-induced, pregnancyrelated,

and paraneoplastic disease [2,3,4,5]. Paraneoplastic

disease may be associated with hematological disorders,

mainly myeloproliferative diseases [6]. About 85% of

the cases have hematopoietic neoplasias, and 15% have

solid tumors [3]. Small lymphocytic lymphoma/chronic

Address for Correspondence: Çiğdem Usul AFŞAR, M.D.,

Çukurova University Medical Faculty, Department of Medical Oncology, Adana, Turkey

Phone: +90 322 338 60 60 E-mail: cigdemusul@yahoo.com


Accepted/Kabul tarihi : Sep 03, 2012

413


Afşar, et al: CLL and Sweet Syndrome

lymphocytic leukemia (SLL/CLL) is a relatively rare entity

accompanying SS and a few cases have been reported so far

[7,8].

Case Report

A 58-year-old woman was admitted to our hospital with

fever, nausea, abdominal pain, and oral ulcer. She had a

10-year history of SLL/CLL. Initially, she had been treated

with cyclophosphamide, vincristine, and prednisolone

(CVP). Relapse developed 5 years later and she was then

treated with a regimen of rituximab, fludarabine, and

cyclophosphamide (R-FC). In 2006, when she was in

remission for CLL/SLL, a lung mass was detected and a

hemangioma was diagnosed on biopsy. At that time there

was no evidence of SS and she had no symptoms due to

disease until she presented with fever, large aphthous lesions

on the tongue, and hepatosplenomegaly. Informed consent

was obtained. The patient was not using any drugs or herbal

products. Mouth and skin lesions, fever, and neutrophilic

fluctuations in the patient clinically suggested SS (Figure 1,

Table 1), and a biopsy was taken. Initial complete blood cell

as follows were: white blood cells, 13.9 × 10 9 /L; neutrophils,

7.46 × 10 9 /L, hemoglobin, 9.6 g/dL, and platelets, 16.9 ×

10 9 /L. Bone marrow aspiration showed lymphocytosis. One

week later, neutrophilic leukocytosis occurred, which was

confirmed by peripheral smear, and at that time, the skin

lesions worsened. The pathological examination revealed

inflammatory infiltrate (neutrophils) located in the dermis,

epidermis, and adipose tissue. Microscopically, there was

dense perivascular infiltration of the dermis composed

largely by neutrophils (Figure 2), vasodilatation, endothelial

swelling, and erythrocyte extravasation (Figure 3), with

prominent edema of the upper dermis. Prednisolone was

initiated; the fever disappeared within 12 hours and the

mucosal lesions improved dramatically. However, during

follow-up, purpuric, hemorrhagic, and necrotic painful

skin lesions had developed, and fever had recurred at

the end of the fourth week. Clinically, these lesions also

suggested SS, and a biopsy was obtained. Pulse steroid (1

g daily) was given, but the response was not as good as it

was earlier; skin lesions showed progression, and clinical

symptoms suggested myositis. Computed tomography (CT)

revealed consolidations in the lungs. Due to the difficulty

in excluding an opportunistic infection and underlying

CLL/SLL, piperacillin/tazobactam (4 × 4.5 g), acyclovir

Introduction

Discussion

Sweet syndrome is an interesting entity and most

commonly accompanies myeloid neoplasias. Sweet

syndrome accompanying CLL/SLL is rare, and so far, few

cases have been reported. The pathogenesis of this entity is

not clear yet, but hematopoietic growth factors seem to play

important role in the mechanism of disease; thus increased

use of these cytokines may potentially increase the incidence

of this entity. Among these growth factors, granulocyte

colony-stimulating factor (G-CSF), both endogenous and

exogenous, is the most important factor in the development

of the signs and symptoms of the disease [9]. The clinical

Figure 1: Mouth, skin lesions and neutrophilic fluctuations

in the patient.

Figure 2: Dense perivascular infiltration of the dermis

composed largely by neutrophils.

Table 1. Neutrophil and leucocyte counts week by week.

Week 1 Week 2 Week 3 Week 4 Week 5

Neutrophil count 13x10 9 /L 30x10 9 /L 10x10 9 /L 41x10 9 /L 36x10 9 /L

Leucocyte count 30x10 9 /L 38x10 9 /L 14x10 9 /L 46x10 9 /L 42x10 9 /L

414

Afşar, et al: CLL and Sweet Syndrome


Systemic corticosteroids are the therapeutic gold

standard for SS. After initiation of treatment with systemic

corticosteroids, there is a prompt response consisting of

dramatic improvement of both the dermatosis-related

symptoms and the skin lesions. There was a good response

at first in our patient, but she relapsed quickly after

discontinuation of the steroids.

In conclusion, SS is rare in patients with SLL/CLL. It

should be kept in mind that this syndrome can accompany

malignancies and cannot be managed easily as an idiopathic

form. This report emphasizes the association of SS with SLL/

CLL, and very high neutrophil levels in spite of lymphocyte

infiltration in bone marrow is the other interesting and

important point.





included.

References

Figure 3: Neutrophilic infiltration, vasodilatation, endothelial

swelling and erythrocyte extravasation.

importance of SS with respect to hematologic malignancies

is that it can be the very early sign of an indolent or recurrent

malignancy.

Mucosal involvement of the mouth, appearing as oral or

vaginal ulcers, is uncommon in patients with classical SS.

Mucosal SS suggests an underlying malignancy, an important

point in daily practice. In our patient, oral lesion was the first

sign of SS, and skin lesions developed later. At the beginning,

dramatic response to steroids was observed, with fever and oral

lesion disappearing within 12 hours. Another very interesting

point was that there was neutrophilia in the peripheral blood

while there was lymphocyte infiltration in the bone marrow.

After a short remission with steroids, skin lesions developed.

Concomitant muscle pains suggesting myositis and CT

changes in the lungs were detected, along with more severe

neutrophilia, as high as 50 × 10 9 /L. There was no evidence

of an autoimmune process. At that time, a high dose of

corticosteroid was given; a minimal response was observed

but skin and muscle problems increased. Fever recurred

despite the use of broad-spectrum antibiotics in addition

to the pulse steroid, and her condition deteriorated. At the

end, a complicated clinical picture suggesting thrombotic

thrombocytopenic purpura developed and she died.

1. Sweet RD. An acute febrile neutrophilic dermatosis. Br J

Dermatol 1964;76:349-356.

2. Prevost-Blank PL, Shwayder TA. Sweet’s syndrome

secondary to granulocyte colony-stimulating factor. J Am

Acad Dermatol 1996;35: 995-997.

3. Von den Driesch P. Sweet’s syndrome (acute febrile

neutrophilic dermatosis). J Am Acad Dermatol 1994;31:535-

556.

4. Cohen PR. Sweet’s syndrome – a comprehensive review of

an acute febrile neutrophilic dermatosis. Orphanet J Rare

Dis 2007;2:34.

5. Cohen PR, Kuzrock R. Sweet syndrome and cancer. Clin

Dermatol 1993;11:149-157.

6. Ventura F, Rocha J, Pereira T, Marques H, Pardal F, Brito C.

Sweet syndrome as the presenting symptom of hairy cell

leukemia. Dermatol Online J 2009;15:12.

7. Cholongitas E, Pipili C, Dasenaki M, Kaklamanis L.

Piperacillin/tazobactam-induced Sweet syndrome in a

patient with chronic lymphocytic leukemia and autoimmune

cholangitis. Am J Dermatopathol 2008;30:203-204.

8. Thompson MA, Dyson SW, Faderl S. Sweet’s syndrome in

chronic lymphocytic leukemia associated with neutropenic

fever and granulocyte colony stimulation factor. Am J

Hematol 2006;81:703-705.

9. Paydas S, Sahin B, Zorludemir S. Sweet’s syndrome

accompanying leukaemia: seven cases and review of the

literature. Leuk Res 2000;24:83-86.

415

Letter to the Editor

DOI: 10.4274/Tjh-2013.0156

Lymphoma Associated with Sjögren’s Syndrome

Sjögren Sendromu ile İlişkili Lenfoma

Tuğba Aktan Köşker1, Şükran Erten2, Esra Erden3

1Atatürk Education and Research Hospital, Internal Medicine, Ankara, Turkey

2Atatürk Education and Research Hospital, Department of Rheumatology, Ankara, Turkey

3Ankara University Medical Faculty, Department of Pathology, Ankara, Turkey

To the Editor,

A 50-year-old woman visited the outpatient rheumatology

department presenting with heel spurs and radiating pain

in the legs and the right hip. She had sicca symptoms and

morning stiffness lasting for 15 min.

Her physical examination was normal other than positive

FABERE test of the right hip. Routine biochemical tests and

complete blood count were normal. Serological tests were

positive for anti-nuclear antibodies (+2) with a speckled

pattern, and positive for both anti-SS-A/Ro and anti-SS-B/

La antibodies. The erythrocyte sedimentation rate and

C-reactive protein level were normal. The rheumatoid factor

was 17.4 IU/mL (reference range: 0-14 IU/mL).

The sacroiliac magnetic resonance findings were

compatible with trochanteric bursitis. The results of

Schirmer’s test were <5 mm for both eyes and a minor

salivary gland biopsy showed focal periductal lymphoid

aggregate. With these findings, the present case apparently

met the criteria for the diagnosis of Sjögren’s Syndrome (SS)

[1]. The patient was treated with hydroxychloroquine and

artificial tear drops.

Eighteen months later, the patient was admitted with

painless swelling of the parotid glands. There was generalized

peripheral lymphadenopathy in the neck, axillary, and

inguinal regions.

Excisional biopsies were obtained from the right inguinal

lymph node, which revealed a high-grade, B-cell non-

Hodgkin lymphoma (NHL). The tumor tissue was composed

of atypical round cells with pleomorphic vesicular nuclei

undergoing frequent mitosis and eosinophilic cytoplasm

(Figure 1). Immunohistochemically, neoplastic cells were

positive for CD20, and the Ki-67 proliferation index was

around 70%.

She received 3 cycles of rituximab plus cyclophosphamide,

epirubicin, vincristine, and prednisolone. Because

of cardiotoxicity, she received 5 cycles of rituximab,

cyclophosphamide, and Oncovin.

After 2 months, her symptoms were resolved and her

CT scan revealed a remarkable decrease in the generalized

swelling of the lymph nodes. Five months later, a PET

scan showed no findings consistent with recurrence or

Figure 1: a) Tumor tissue deforming the structure, of lymph

nodes and infiltrating extranodal structures b) Tumor cells

with large pleomorphic nucleus, apparent nucleolus, and

frequent mitosis.

Address for Correspondence: Tuğba AKTAN KÖŞKER, M.D.,

Atatürk Education and Research Hospital, Internal Medicine, Ankara, Turkey

GSM: +90 541 385 40 74 E-mail: tubaaktan@hotmail.com

Received/Geliş tarihi : May 2, 2013


416

Köşker AT, et al: Lymphoma Associated with Sjögren’s Syndrome


involvement of the primary malignancy, and these findings

were consistent with remission.

SS is a common autoimmune disorder characterized by

the degeneration of exocrine glands, clinically presenting as

eye and mouth dryness [2]. Patients with SS have high levels

of immunoglobulin, anti-Ro/SSA, and anti-La/SSB. SS is seen

in all age groups, but it is more common in the fourth and

fifth decades of life [3]. We report a case of NHL associated

with SS presenting with enlargement of the parotid gland

and generalized peripheral lymphadenopathy.

The incidence of NHL in patients with SS has been

reported as 5%. The risk of NHL development in patients

with SS is approximately 40-44 times greater than that in

the general population [2]. Lymphomas that appear during

the course of SS are usually localized extranodal low-grade

B-cell NHL and the major histopathological type is mucosaassociated

lymphoid tissue lymphoma [4].

The clinical and laboratory signs of lymphoma are based

on etiology. The reported extranodal sites are mostly the

salivary glands, followed by the stomach, nasopharynx,

skin, lung, lachrymal gland, liver, and bones. In this disease,

although rare, central nervous system involvement can also

be seen [5].

In conclusion, we encountered a rare case of SS

complicated with NHL. We recommend that patients with

SS be carefully evaluated for occult malignancy and in

particular for NHL.





included.

Key Words: Sjögren’s syndrome, non-Hodgkin lymphoma,

malignancy

References

1. Vitali C, Bombardieri S, Jonsson R, Moutsopoulos HM,

Alexander EL, Carsons SE, Daniels TE, Fox PC, Fox RI,

Kassan SS, Pillemer SR, Talal N, Weisman MH; European

Study Group on Classification Criteria for Sjögren’s

Syndrome. Classification criteria for Sjögren’s syndrome:

a revised version of the European criteria proposed by the

American-European Consensus Group. Ann Rheum Dis

2002;61:554-558.

2. Watanabe Y, Koyama S, Miwa C, Okuda S, Kanai Y, Tetsuka

K, Nokubi M, Dobashi Y, Kawabata Y, Kanda Y, Endo S.

Pulmonary mucosa-associated lymphoid tissue lymphoma

in Sjögren’s syndrome showing only the LIP pattern

radiologically. Intern Med 2012;51:491-495.

3. Soldevilla HF, Molina RM, Navarra SV. Breast lymphoma

in Sjögren’s syndrome complicated by acute monocular

blindness. Int J Rheum Dis 2010;13:164-170.

4. Anaya JM, McGuff HS, Banks PM, Talal N. Clinicopathological

factors relating malignant lymphoma with Sjögren’s

syndrome. Semin Arthritis Rheum 1996;25:337-346.

5. Kinikli G, Erten S, Tanju S, Savas A, Kaygusuz G. Central

nervous system lymphoma in a patient with Sjogren’s

syndrome and autoimmune thyroiditis (Hashimoto’s

thyroiditis). Clin Rheumatol 2007;26:1377-1379.

417


DOI: 10.4274/Tjh-2013.0226

Hepatitis B Vaccine-Associated Atypical Hemolytic

Uremic Syndrome

Hepatit B Aşısı ile İlişkili Atipik Hemolitik Üremik Sendrom

Zekai Avcı1, Cengiz Bayram2, Barış Malbora3

1Ankara Children’s Hematology and Oncology Research Hospital, Department of Hematology, Ankara, Turkey

2 Ankara Pediatric and Pediatric Hematology Oncology Training and Research Hospital, Department of Pediatric Hematology, Ankara, Turkey

3Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey

To the Editor,

Hemolytic uremic syndrome (HUS) is one of the common

causes of acute renal failure in children and is characterized by

microangiopathic hemolytic anemia and thrombocytopenia.

About 5% to 10% of all HUS cases in children are nondiarrheal

HUS (atypical HUS) [1,2]. Many triggering causes

of atypical HUS, such as non-enteric infections, viruses,

drugs, systemic diseases, glomerulopathies, malignancies,

transplantations, and pregnancy, have been identified

[1,2,3,4]. Here we report a patient who developed atypical

HUS after a hepatitis B vaccination.

A 55-day-old female infant was admitted to our hospital

with sudden onset of jaundice and pallor 1 day after the

second dose of recombinant hepatitis B vaccine injection

(containing 10 µg HBsAg/0.5 mL and 0.475 mg aluminum

hydroxide/0.5 mL). There was no history of fever, diarrhea,

or cough. The first dose of hepatitis B vaccine was

administered at birth. She had no health problems in the

neonatal period and was solely breastfed. The family history

was non-contributory.

On physical examination, the patient was in poor general

condition and hypoactive with pale and icteric skin. Body

temperature was 37 °C, pulse rate was 140/min, respiratory

rate was 48/min, and blood pressure was 70/40 mmHg.

There was no hepatosplenomegaly. Laboratory examination

revealed a hemoglobin level of 51 g/L, leukocyte count of

10x10 9 /L, platelet count of 28x10 9 /L, and reticulocyte

level of 3.9%. Anisocytosis, poikilocytosis, polychromasia,

helmet cells, marked schistocytes, and rare platelets were

observed in the peripheral blood smear, compatible with

microangiopathic hemolytic anemia and thrombocytopenia.

Direct and indirect Coombs test results were negative.

Biochemical analyses were as follows: urea 88 mg/dL

(normal range: 5-18), creatinine 1.1 mg/dL (normal: 0.2-

0.4), total bilirubin 13.7 mg/dL (normal: <1.2), direct

bilirubin 2.6 mg/dL (normal: <0.2), uric acid 8.1 mg/

dL (normal: 2.4-6.4), aspartate aminotransferase 96 U/L

(normal: 15-55), lactic dehydrogenase 4641 U/mL (normal:

170-580), and the other serum biochemical tests within

normal limits. Urine microscopy showed numerous red

blood cells. Microscopic examination of stool was normal

and occult blood test results were negative. Her stool culture

and urine culture were also negative. Serum complement

component 3 (C3) and C4 levels were 76.5 mg/dL (normal:

79-752) and 5.89 mg/dL (normal: 16-38), respectively.

Prothrombin time, activated partial thromboplastin time,

and fibrinogen level were within the normal ranges. Renal

ultrasound showed increased echogenicity in both kidneys.

As the patient had acute renal failure, thrombocytopenia,

and microangiopathic hemolytic anemia, she was diagnosed

with HUS. After transfusion of red blood cells, intravenous

fluid therapy was initiated and intravenous furosemide was

administered. Fresh frozen plasma infusion was also started.

Address for Correspondence: Barış MALBORA, M.D.,

Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey

Phone: +90 312 305 60 00 E-mail: barismalbora@gmail.com

Received/Geliş tarihi : July 2, 2013

Accepted/Kabul tarihi : July 19, 2013

418

Avcı Z: Hepatitis B Vaccine-Associated Atypical Hemolytic Uremic Syndrome


On the third day of hospitalization, she had a seizure that

was ended with a single dose of midazolam and did not recur

again. Hemolysis and thrombocytopenia continued until day

8 of hospitalization and the patient required red blood cell

transfusions 5 times during this period. Urea and creatinine

levels progressively rose to 119 mg/dL and 2.2 mg/dL,

respectively. She had no oliguria. Hypertension was treated

with nifedipine and enalapril. On day 9 of hospitalization,

renal function, thrombocytopenia, and hemolysis began

to improve, and plasma therapy was discontinued within

the following 2 days. She no longer needed dialysis. The

patient was discharged in good general condition on day

16 of hospitalization with improved complete blood count,

biochemical tests, and complement levels. Factor H and

factor I levels were normal when measured 3 months after

hospital discharge. At 6 months of age, the patient’s hepatitis

B antibody titer was at the protective level, and thus the

third dose of hepatitis B vaccine was not administered. The

patient completed the immunization schedule except for the

third dose of hepatitis B without further problems. She is

currently 38 months old and has no problems.

Differentiation of HUS into typical HUS and atypical HUS

may become confusing according to prodromal symptoms.

Because infants below 6 months of age are generally

breastfed (pre-weaning period), exposure to Escherichia

coli O157:H7 is less likely in this age group and, therefore,

other causes of HUS should be considered in patients under

6 months of age [4]. Our patient was a 55-day-old infant

with no history of bloody diarrhea or other infection. Her

stool and urine cultures were negative for Escherichia coli

and Shigella. Her clinical presentation was consistent with

the diagnosis of atypical HUS.

Our patient had clinical and laboratory findings of

atypical HUS approximately 1 day after hepatitis B vaccine

injection, and thus we suggest that the hepatitis B vaccine

may play a triggering role for the onset of atypical HUS.

Geerdink et al. [5] first reported a patient who developed

atypical HUS a few days after a hepatitis B vaccination in

their cohort study and they observed a relapse shortly

after combined anti-diphtheria–pertussis–tetanus–polio

vaccination in the same patient. To our knowledge, ours is

the second case of atypical HUS associated with hepatitis B

vaccination. In contrast to the first reported case, we did not

observe a relapse with other vaccinations.

The triggering role of vaccination in the onset or relapse

of atypical HUS has not been defined yet. We suggest that,

compatible with the other adverse effects of vaccination, the

immune-mediated activation of the complementary system

triggers atypical HUS development. Therefore, recent history

of vaccination should be examined, especially in patients

without any other triggering conditions. Further reports are

needed to confirm this hypothesis.

Key Words: Hemolytic uremic syndrome, Hepatitis B

vaccine, Children

Authors’ Contributions

All authors planned and performed the experiments and

wrote the manuscript.

Conflict of Interest Disclosure

There is no potential conflict of interest to disclose.

References

1. Amirlak I, Amirlak B. Haemolytic uraemic syndrome: an

overview. Nephrology (Carlton) 2006;11:213-218.

2. Scheiring J, Rosales A, Zimmerhackl LB. Clinical practice.

Today’s understanding of the haemolytic uraemic syndrome.

Eur J Pediatr 2010;169:7-13

3. Westra D, Wetzels JF, Volokhina EB, van den Heuvel LP,

van de Kar NC. A new era in the diagnosis and treatment

of atypical haemolytic uraemic syndrome. Neth J Med

2012;70:121-129.

4. Ariceta G, Besbas N, Johnson S, Karpman D, Landau D,

Licht C, Loirat C, Pecoraro C, Taylor CM, Van de Kar N,

Vandewalle J, Zimmerhackl LB; European Paediatric Study

Group for HUS. Guideline for the investigation and initial

therapy of diarrhea-negative hemolytic uremic syndrome.

Pediatr Nephrol 2009;24:687-696.

5. Geerdink LM, Westra D, van Wijk JA, Dorresteijn EM, Lilien

MR, Davin JC, Kömhoff M, Van Hoeck K, van der Vlugt

A, van den Heuvel LP, van de Kar NC. Atypical hemolytic

uremic syndrome in children: complement mutations and

clinical characteristics. 2012;27:1283-1291.

419

Letter to Editor

DOI: 10.4274/Tjh.2012.0163

Peripheral Neuropathy in Sézary Syndrome:

Coincidence or a Part of the Syndrome?

Sézary Sendromunda Periferal Nöropati: Tesadüf mü Yoksa

Sendromun Bir Parçası mı?

Yeşim S. Karadağ1, Aydın Gülünay1, Neşe Öztekin1, Fikri Ak1, Saadettin Kılıçkap2

1Ankara Numune Research and Training Hospital, Department of Neurology, Ankara, Turkey

2Hacettepe Cancer Institute, Department of Preventive Oncology, Ankara, Turkey

To the Editor,

A 48-year-old male patient was admitted with the

complaints of diffuse skin dryness, fatigue, and numbness of

the hands. He reported cramps and fasciculation occurring at

nights and weakness of the arms. His physical examination

(AG) revealed a diffuse dryness with widespread squames on

the scalp, trunk, arms, and thighs (Figure 1). Neurological

examination revealed hypoactive deep tendon reflexes in

both lower extremities and hypoesthesia of gloves-socks

type. His white blood cell count was 43,600/mm 3 , 50%-55%

of which comprised eosinophils. Flow cytometry revealed

a Sézary cell count of 3200/µL, a CD4/CD8 ratio greater

than 22.5, and less than 7% T-cells that expressed CD7.

The same clonal amplification was demonstrated by T-cell

receptor gene analysis of skin, blood, and lymph nodes.

Computerized tomography showed axillary and inguinal

lymphadenopathies. The patient was at stage IIA.

Biopsies from skin lesions and lymph nodes were

performed. Immunohistochemical examination was consistent

with SS, showing diffuse CD4 staining. Diagnosis of motor

axonal neuropathy was based on the decrease of compound

muscle action potential amplitudes of right median, peroneal,

and bilateral posterior tibial nerves in a nerve conduction

study. Other etiologies for motor axonal neuropathy such as

diabetes mellitus were excluded. PUVA therapy was used for

his skin lesions. Photopheresis was performed once a month.

After the therapy, his neuropathy improved.

Discussion

Polyneuropathy in patients with cancer may be related

to chemotherapy and is rarely due to direct invasion of the

nerve [6,7]. Neuronal antigens expressed by the tumor

stimulate an immune response characterized by T cells,

antibodies, or both, which attack not only the tumor but

also the neural tissue [8]. Although these scenarios could be

expected in lymphomas, nervous system involvement is not

commonly reported in reviews of SS [1,2].

The co-occurrence of SS and peripheral neuropathy

was first reported in 1978 by Bargman and Coupe [5].

Another case of SS with neurolymphomatosis was reported

by Bezier et al. [3]. In that case, muscle and nerve biopsy

specimens showed neurogenic muscle atrophy and

an axonal neuropathy secondary to an epineurial and

endoneurial infiltration by Sézary cells [3]. Although

extracutaneous spread is not uncommon in advanced stages

of SS, neurological complications are rare and result from

leptomeningeal or central nervous system involvement.

Our patient had axonal peripheral neuropathy without

central nervous system involvement. Neuropathic symptoms

started prior to his medications, which reassured us that the

responsible etiology may have been his primary disease. The

neuropathic symptoms of the patient appeared at the time

of diagnosis and improved after treatment. These findings

support the idea that the neuropathy associates with SS and

may be a consequence of paraneoplastic syndrome.

Address for Correspondence: Saadettin KILIÇKAP M.D.,

Hacettepe Cancer Institute, Department of Preventive Oncology, Ankara, Turkey

Phone: +90 312 306 26 62 E-mail: skilickap@yahoo.com



420

Karadağ YS, et al: Peripheral Neuropathy in Sézary Syndrome Turk J Hematol 2013;30:420-421

References

Figure 1: Widespread squames on the scalp and trunk (A and

B), and a diffuse dryness with widespread squames on the

arms and thighs (C and D).

This case emphasizes the importance of keeping

polyneuropathy in mind while dealing with patients with SS,

although it is difficult to treat, and suggests the possible role

of neurotropism of malignant cells.

Key Words: Sézary syndrome, Mycosis fungoides, Axonal

neuropathy



including specific financial interests, relationships, and/ or

affiliations relevant to the subject matter or materials included.

1. Hwang ST, Janik JE, Jaffe ES, Wilson WH. Mycosis fungoides

and Sézary syndrome. Lancet 2008;371:945-957.

2. Kubica AW, Davis MD, Weaver AL, Killian JM, Pittelkow MR.

Sézary syndrome: a study of 176 patients at Mayo Clinic. J

Am Acad Dermatol 2012;67:1189-1199.

3. Bezier M, Reguiaï Z, Delaby P, Laroche L, Saïd G, Bernard

P, Grange F. Neurolymphomatosis associated with Sézary

syndrome. Arch Dermatol 2009;145:294-296.

4. Atiq OT, DeAngelis LM, Rosenblum M, Portlock CS.

Cutaneous T-cell lymphoma presenting with diffuse

lymphomatous infiltration of the peripheral nerves:

response to combination chemotherapy. Am J Clin Oncol

1992;15:212-215.

5. Bargman H, Coupe RL. Sézary’s syndrome: report of a case

showing peripheral neuropathy and bone marrow fibrosis.

Arch Dermatol 1978;114:1360-1362.

6. England JD, Asbury AK. Peripheral neuropathy. Lancet

2004;363:2151-2161.

7. Viala K, Béhin A, Maisonobe T, Léger JM, Stojkovic T,

Davi F, Leblond V, Bouche P. Neuropathy in lymphoma:

a relationship between the pattern of neuropathy, type of

lymphoma and prognosis? J Neurol Neurosurg Psychiatry

2008;79:778-782.

8. Rudnicki, SA, Dalmau J. Paraneoplastic syndromes of the

peripheral nerves. Curr Opin Neurol 2005;18:598-603.

421


DOI: 10.4274/TJH.2013.0030

Rituximab and Fludarabine or Cyclophosphamide

Combination Treatment for Older Waldenström

Macroglobulinemia Patients

İleri Yaştaki Waldenström Makroglobulinemi Hastalarında

Rituksimab’ın Fludarabin veya Siklofosfamid ile

Kombinasyon Tedavisi

XiaoWei Xu, Chun Wang, YaMin Wang, LiLi Zhou, HaiTao Bai

Department of Hematology, Shanghai First People’s Hospital, Shanghai, Jiao Tong University, Shanghai, China

Waldenström macroglobulinemia (WM) is a rare and

incurable B cell malignancy. Most WM cells express CD20,

which enables the use of anti-CD20 monoclonal antibody

rituximab-based strategies. Rituximab has been evaluated in

WM for about 10 years as a single agent with major response

rates of 30% to 40%, whereas the combination of rituximab

with chemotherapy has resulted in response rates of 70% to

90% [1,2,3].

However, the extent to which achievement of complete

response (CR) confers clinical benefit is still debatable.

As such, we administered rituximab (375 mg/m 2 , day

0) combined with fludarabine (40 mg, days 1-3) or

cyclophosphamide (200 mg, days 1-2) in WM patients naive

to rituximab and report herein the toxicities and effects of

these combinations. A total of 4 elderly patients (ages older

than 80) were identified with WM diagnoses from 2007 to

2012 in our department.

According to recommendations for assessing response

from the Third International Workshop on WM, 2 of 4

(50%) patients achieved complete response, 2 (50%) had

major or minor response, and the overall response rate was

100% at the end of the treatment [4].

The individual changes in serum IgM, IgM paraprotein,

and hemoglobin levels for all patients are shown in Figure 1.

Hematologic toxicity was one of the major side effects

of this regimen. Neutropenia and thrombocytopenia were

found in 2 patients at the end of the treatment. Pulmonary

infection was observed in one patient.

With a median follow-up of 27 months, all 4 patients

died. Two patients with sustainable CR died of pulmonary

infection or heart failure, respectively, after follow-up

for 11 and 36 months. One patient who achieved a major

response duration of 34 months died of duodenal squamous

adenocarcinoma. The last patient with minor response had

progression of disease in 2 months and died of WM after 10

months of follow-up.

Gruson et al. assigned a rituximab and fludarabine

combination in a treatment cycle that was repeated every

month for 6 months. Five patients aged 52-85 years with

Figure 1: Individual changes in A) IgM, B) IgM paraprotein,

and C) HB serum levels.

Address for Correspondence: Chun WANG, M.D.,

Department of Hematology, Shanghai First People’s Hospital, Shanghai, Jiao Tong University, Shanghai, China

Phdne : +00-86-21-63240090-3101 E-mail: xuxiaowei1616@126.com

Received/Geliş tarihi : March 1, 2013


422

Xu WX, et al: Rituximab and Fludarabine or Cyclophosphamide Combination Treatment for

Older Waldenström Macroglobulinemia Patients


IgM achieved overall and complete response at 80% and

40%, respectively [5]. Several analyses have identified age

as a major adverse factor [6]. Our results showed that 2

patients with sustainable CR were older than 80 years old

and had high-risk International Prognostic Scoring System

for WM scores. Therefore, with this combination regimen,

age is no longer a major risk factor.

In a study by Dimopoulos et al., which combined

rituximab and fludarabine or cyclophosphamide in 11

patients with WM, combination treatment was used

monthly for 4 cycles. The partial response rate was only 55%

and no patients achieved complete response [7]. The 4-cycle

combination therapy was thus not enough for WM patients

and 5-6 cycles were necessary.

In conclusion, rituximab in association with fludarabine

or cyclophosphamide is well tolerated and effective for

elderly WM patients.

Key Words: Monoclonal IgM protein, rituximab,

Waldenström macroglobulinaemia


The authors have declared no conflicts of interest.

References

1. Dimopoulos MA, Panayiotidis P, Moulopoulos LA, Sfikakis

P, Dalakas M. Waldenström’s macroglobulinemia: clinical

features, complications, and management. J Clin Oncol

2000;18:214-216.

2. Treon SP, Gertz MA, Dimopoulos M, Anagnostopoulos A,

Blade J, Branagan AR, Garcia-Sanz R, Johnson S, Kimby E,

Leblond V, Fermand JP, Maloney DG, Merlini G, Morel P,

Morra E, Nichols G, Ocio EM, Owen R, Stone MJ. Update on

treatment recommendations from the Third International

Workshop on Waldenström’s macroglobulinemia. Blood

2006;107:3442-3446.

3. Dimopoulos MA, Zervas C, Zomas A, Kiamouris C,

Viniou NA, Grigoraki V, Karkantaris C, Mitsouli C,

Gika D, Christakis J, Anagnostopoulos N. Treatment of

Waldenström’s macroglobulinemia with rituximab. J Clin

Oncol 2002;20:2327-2333.

4. Kimby E, Treon SP, Anagnostopoulos A, Dimopoulos M,

Garcia-Sanz R, Gertz MA, Johnson S, LeBlond V, Fermand JP,

Maloney DG, Merlini G, Morel P, Morra E, Nichols G, Ocio

EM, Owen R, Stone M, Bladé J. Update on recommendations

for assessing response from the Third International

Workshop on Waldenström’s macroglobulinemia. Clin

Lymphoma Myeloma 2006;6:380-383.

5. Morel P, Duhamel A, Gobbi P, Dimopoulos MA, Dhodapkar

MV, McCoy J, Crowley J, Ocio EM, Garcia-Sanz R,

Treon SP, Leblond V, Kyle RA, Barlogie B, Merlini G.

International prognostic scoring system for Waldenstrom

macroglobulinemia. Blood. 2009,113:4163-4170.

6. Gruson B, Ghomari K, Beaumont M, Garidi R, Just A, Merle

P, Merlusca L, Marolleau JP, Royer B. Long-term response to

rituximab and fludarabine combination in IgM anti-myelinassociated

glycoprotein neuropathy. J Peripher Nerv Syst

2011;16:180-185.

7. Dimopoulos MA, Hamilos G, Efstathiou E, Siapkaras

I, Matsouka C, Gika D, Grigoraki V, Papadimitriou

C, Mitsibounas D, Anagnostopoulos N. Treatment of

Waldenström’s macroglobulinemia with the combination

of fludarabine and cyclophosphamide. Leuk Lymphoma

2003;44:993-996.

423


DOI: 10.4274/Tjh.2013.0154

Carbamazepine and Hematological Malignancies

Karbamazepin ve Hematolojik Maligniteler

İrfan Yavaşoğlu1, Gökhan Sargın2, Aslı Demirbulat2

1Adnan Menderes University Medical Faculty, Division of Hematology, Aydın, Turkey

2Adnan Menderes University Medical Faculty, Department of Internal Medicine, Aydın, Turkey

To the Editor,

The letter entitled “Carbamazepine and Multiple

Myeloma: Possible Interaction”, written by Günaldı et al. [1]

and published in one of the recent issues of your journal,

was quite interesting. We would like to emphasize some

points about that letter.

In the reported case, the patient’s serum globulin level

was 5.44 g/dL, and serum protein electrophoresis (Figure

1 of the cited letter) showed that the M-peak was closest

to the beta-fraction. Thus, it becomes important to know

the level of light chains and IgA as heavy chains. The

serum protein electrophoresis should also be evaluated for

biclonal gammopathy due to its pattern shown in Figure 1.

Interleukin-6 (IL-6) is the main growth factor for multiple

myeloma (MM) and studies of epileptic patients showed

elevated levels of IL-6 after carbamazepine therapy [2].

We have no information about the level of IL-6 in the case

reported by Günaldı et al.

The specific abnormalities such as t(4;14), t(14;16),

and deletion (del) 17p detected by fluorescence in situ

hybridization (FISH) analysis were reported as high-risk

MM [3]. Tricot et al. [4] reported that partial or complete

deletions of chromosome 13 were associated with poor

prognosis in MM. Chromosome 13 deletions detected only

by FISH independently in the absence of other abnormalities

do not carry significantly higher risk, whereas t(11;14)

does not predict superior outcome [5]. It is interesting to

see cytogenetic abnormalities del17p-t(4;14)-del13 and

t(11;14) in same patient. However, the consensus is that

the data are not yet adequate to suggest routine use of these

FISH markers to predict prognosis [5].

The number of people who had suffered from side

effects due to carbamazepine was reported as 14,705. Ten

of them (0.07%) had MM [6]. Drug-related (although

rarely from carbamazepine) hypogammaglobulinemia is a

well-known condition. 9-Acridine carboxaldehyde is one

of the carbamazepine metabolites generating activated

neutrophils, and presumably monocytes. This metabolite

increases lymphocyte proliferations at lower concentrations

and decreases them at higher concentrations. The

relationship between hypogammaglobulinemia and

carbamazepine is thus clearer [7]. There have also been

reports of agranulocytosis, leucopenia, pure erythrocyte

aplasia, and thrombocytopenia after carbamazepine

[8]. Additionally, phenytoin is considered a possible

carcinogenic for humans and was reported as a carcinogenic

drug in animals [9].

A diagnosis of epilepsy in the same year as a cancer

diagnosis carried an increased risk for leukemia, pancreatic

cancer, non-Hodgkin’s lymphoma, acute myeloid leukemia,

and Hodgkin’s disease, but not for chronic lymphatic

leukemia or MM. The issue of cancer incidence in people

with epilepsy remains an open question [9,10]. In

conclusion, the answer is still unknown as to whether the

drugs for epilepsy or epilepsy itself causes MM.

Key Words: Carbamazepine, Hematological malignancies,

Multiple myeloma

References

1. Günaldı M, Paydaş S, Afşar ÇU, Duman BB, Erçolak V,

Haksöyler V. Carbamazepine and multiple myeloma:

possible interaction. Turk J Hematol 2013;30:83-84.

Address for Correspondence: Gökhan SARGIN, M.D.,

Adnan Menderes University Medical Faculty, Department of Internal Medicine, Aydın, Turke

GSM: +90 553 424 10 97 E-mail: gokhan_sargin@hotmail.com



424

Yavaşoğlu İ; Carbamazepine and Hematological Malignancies

Turk J Hematol 2013;30:4324-425

2. Verrotti A, Basciani F, Trotta D, Greco R, Morgese G, Chiarelli

F. Effect of anticonvulsant drugs on interleukins-1, -2 and

-6 and monocyte chemoattractant protein-1. Clin Exp Med

2001;1:133-136.

3. Avet-Loiseau H. Role of genetics in prognostication in

myeloma. Best Pract Res Clin Haematol 2007;20:625-635.

4. Tricot G, Barlogie B, Jagannath S, Bracy D, Mattox S, Vesole

DH, Naucke S, Sawyer JR. Poor prognosis in multiple

myeloma is associated only with partial or complete

deletions of chromosome 13 or abnormalities involving

11q and not with other karyotype abnormalities. Blood

1995;86:4250-4256.

5. Munshi NC, Anderson KC, Bergsagel PL, Shaughnessy J,

Palumbo A, Durie B, Fonseca R, Stewart AK, Harousseau

JL, Dimopoulos M, Jagannath S, Hajek R, Sezer O, Kyle R,

Sonneveld P, Cavo M, Rajkumar SV, San Miguel J, Crowley

J, Avet-Loiseau H; International Myeloma Workshop

Consensus Panel 2. Consensus recommendations for

risk stratification in multiple myeloma: report of the

International Myeloma Workshop Consensus Panel 2.

Blood 2011;117:4696-4700.

6. eHealthMe.com. From FDA Reports: Carbamazepine and

Myeloma – Multiple. © 2013. Available at http://www.

ehealthme.com/ds/carbamazepine/myeloma+-+multiple.

7. Furst SM, Uetrecht JP. The effect of carbamazepine and its

reactive metabolite, 9-acridine carboxaldehyde, on immune

cell function in vitro. Int J Immunopharmacol 1995;17:445-

452.

8. Flanagan RJ, Dunk L. Haematological toxicity of drugs used

in psychiatry. Hum Psychopharmacol 2008;23:27-41.

9. Singh G, Driever PH, Sander JW. Cancer risk in people with

epilepsy: the role of antiepileptic drugs. Brain 2005;128:7-

17.

10. Adelow C, Ahlbom A, Feychting M, Johnsson F,

Schwartzbaum J, Tomson T. Epilepsy as a risk factor for

cancer. J Neurol Neurosurg Psychiatry 2006;77:784-786.

425


DOI: 10.4274/Tjh.2013.0022

H1N1 Infection-Related Hemophagocytic

Lymphohistiocytosis in a Child

H1N1 Enfeksiyonu ile İlişkili Hemofagositik Lenfohistiositoz

Saptanan Bir Çocuk Hasta

Fatih Demircioğlu1, Elif Kazancı2, Dildar Bahar Genç2, Hakan Erdoğan2,

Sevil Bilir Göksügür1, Mervan Bekdaş1

1Medical Faculty, Abant İzzet Baysal University, Department of Pediatrics, Bolu, Turkey

2Dörtçelik Children’s Hospital, Department of Pediatrics, Bursa, Turkey

To the editor,

Hemophagocytic lymphohistiocytosis (HLH) is a clinical

condition characterized by macrophage and activated

histiocyte proliferation, leading to uncontrolled phagocytosis

of hematopoietic precursor cells. The clinical presentation is

characterized by fever, pancytopenia, hepatosplenomegaly,

and hemophagocytosis in the reticuloendothelial system. In

addition to the primary form of the disorder, secondary HLH

has been associated with a variety of infections, malignancy,

and autoimmune disease [1]. Virus-associated HLH is a

well-recognized clinical condition. Most cases are related to

Epstein-Barr virus (EBV), cytomegalovirus (CMV), human

herpes virus 6, and human herpes virus 8 infections [2].

H1N1 influenza-associated HLH has been reported in children

extremely rarely [3,4]. We present here a successfully treated

case of severe H1N1 influenza-related HLH.

A 4-year-old boy was admitted to our hospital with a

5-day history of fever, malaise, myalgia, cough, respiratory

distress, oliguria, and diffuse petechial eruption. On

physical examination he was found febrile, pale, and

dehydrated. His vital signs included a temperature of 38.7

°C, heart rate of 154 beats per minute, respiratory rate of

42 breaths per minute, blood pressure of 79/56 mmHg, and

capillary refill time of >2 s. He had 6-cm hepatomegaly and

9-cm splenomegaly below the costal margin. The rest of the

physical examination was normal.

Laboratory examination demonstrated hemoglobin of 9.2

g/dL, white blood cell count of 3000/mm 3 (24% neutrophils,

62% lymphocytes, and 14% monocytes), and platelet count

of 56,000/mm 3 . In the peripheral smear investigation, toxic

granulation was observed. Biochemical evaluation revealed

that blood urea nitrogen was 118 mg/dL, creatinine 1.6 mg/

dL, sodium 124 mmol/L, potassium 2.92 mmol/L, C-reactive

protein 18.5 mg/dL (N: 0.0-1.0 mg/dL), fibrinogen 120

mg/dL, and ferritin 875 ng/mL. Serum triglycerides were

increased to 268 mg/dL but cholesterol levels were in the

normal range. The serum aspartate aminotransferase,

alanine aminotransferase, and lactate dehydrogenase levels

were elevated at 208, 72, and 893 U/L, respectively. Serologic

markers for EBV; CMV; parvovirus B19; toxoplasmosis;

hepatitis A, B, and C viruses; human immunodeficiency

virus, salmonella; and Brucella agglutinins were all negative.

Results of the urine analysis were in the normal range. Chest

radiograph demonstrated infiltrates in both lung fields and

bilateral pleural effusions.

Intravenous fluid replacement and meropenem and

dopamine infusion were started. On the second day

of hospital admission, H1N1 influenza was identified

from nasopharyngeal swabs by specific PCR, and then

oseltamivir (6 mg/kg in 2 daily doses, per os) was added to

the treatment. HLH was suspected because of the patient’s

persistent fever, severe pancytopenia, hyperferritinemia,

hypertriglyceridemia, hepatosplenomegaly, and

Address for Correspondence: Fatih DEMİRCİOĞLU, M.D.,

Medical Faculty, Abant İzzet Baysal University, Department of Pediatrics, Bolu, Turkey

E-mail: fatih_demircioglu@yahoo.com

Received/Geliş tarihi : January 23, 2013

Accepted/Kabul tarihi : February 4, 2013

426

Demircioğlu F, et al: H1N1 Infection-Related Hemophagocytic Lymphohistiocytosis in a Child


Figure 1: Bone marrow smear shows histiocytes with

hemophagocytosis (A and B).

hypofibrinogenemia. A bone marrow aspiration was

performed and the results revealed typical hemophagocytosis

(Figure 1). Therefore, intravenous immunoglobulin (IVIG)

was added to the treatment due to the diagnosis of H1N1-

associated HLH. Renal functions returned to normal on

the second day of treatment. The patient’s respiratory

function gradually recovered on day 4. On the third day

of oseltamivir and meropenem therapy, the patient became

afebrile, and oseltamivir and meropenem therapies were

stopped after 5 days and 10 days of treatment, respectively.

On the 10th day of admission, physical examination and

laboratory evaluation were found normal. He was discharged

on day 14. In the first year of follow-up, hematologic and

biochemical values were normal, except for moderate

splenomegaly and hyperferritinemia (ferritin level was 725

ng/mL). Immunodeficiency, infection, malignancy, and other

splenomegaly-related conditions were excluded. Informed


Discussion

The H1N1 virus was first observed in March 2009 in

Mexico and then spread rapidly throughout the world. Cases

of H1N1 have generally been mild, with patients recovering

fully within 1 week [5]. Hematological manifestation of

H1N1 has commonly been observed with leucopenia,

neutropenia, and idiopathic thrombocytopenic purpura.

Rarely, HLH has been observed [6].

HLH represents a severe hyperinflammatory condition

with the major symptoms of prolonged fever, peripheral

cytopenia affecting at least 2 lineages, hepatosplenomegaly,

hypertriglyceridemia and/or hypofibrinogenemia,

hyperferritinemia, decreased or absent natural killer cell

activity, and high soluble interleukin 2 receptor serum

levels and hemophagocytosis by activated macrophages.

Five of these 8 criteria should be fulfilled to confirm

diagnosis [1,2]. Our patient had prolonged fever,

pancytopenia, hepatosplenomegaly, hyperferritinemia,

hypofibrinogenemia, and hemophagocytosis at bone

marrow aspiration and was diagnosed with HLH according

to the criteria of HLH 2004 [1,2].

Our patient had prolonged fever, fatigue, myalgia,

pneumonia, and prerenal insufficiency and diagnosed

H1N1 influenza. The first reported case of H1N1 influenza

virus-related HLH was in a 17-year-old female patient who

completely recovered with steroid and oseltamivir treatment

[3]. Following this case report, 23 more patients were reported

of various ages between 2 months and 61 years old. In most of the

cases, pancytopenia, hepatosplenomegaly, hyperferritinemia,

hypofibrinogenemia, and hemophagocytosis at bone marrow

aspiration were detected [3,4,7,8,9,10,11,12]. Oseltamivir and

systemic steroid was the most commonly preferred treatment

option. We diagnosed our patient with H1N1 virus-associated

HLH. Besides oseltamivir, we also add IVIG to the treatment.

On the third day of oseltamivir and second day of IVIG therapy,

the patient became afebrile; oseltamivir therapy was stopped

after 5 days of treatment.

HLH has high mortality rates if early diagnosis and

treatment are delayed. In previously reported cases, only 5

out of 23 patients survived. In our case, treatment was started

at the second day of hospitalization and a good response

was achieved. In the first year of follow-up, hematologic and

biochemical values remained normal, except for moderate

splenomegaly and hyperferritinemia. To et al. reported

prolonged viral load clearance and cytokine activation in

H1N1 swine influenza virus infection [13]. We did not

detect any obvious cause of splenomegaly in our patient.

The splenomegaly and hyperferritinemia in our case may

therefore be associated with prolonged inflammatory process

and decreased viral load clearance. We report a very rare case

of H1N1-related HLH in childhood, which was diagnosed

early and successfully treated. If it is diagnosed late, H1N1-

associated HLH has very high mortality rates, but early

diagnosis and treatment have favorable outcomes. It may also

cause prolonged viral load clearance and cytokine response.

Key Words: Children, Hemophagocytic lymphohistiocytosis,

Swine-origin influenza





included.

References

1. Janka GE. Familial and acquired hemophagocytic

lymphohistiocytosis. Annu Rev Med 2012;63:233-246.

2. Rouphael NG, Talati NJ, Vaughan C, Cunningham K, Moreira

R, Gould C. Infections associated with haemophagocytic

syndrome. Lancet Infect Dis 2007;7:814-822.

3. Zheng Y, Yang Y, Zhao W, Wang H. Novel swine-origin

influenza A (H1N1) virus-associated hemophagocytic

syndrome--a first case report. Am J Trop Med Hyg

2010;82:743-745.

427


Demircioğlu F, et al: H1N1 Infection-Related Hemophagocytic Lymphohistiocytosis in a Child

4. Ozdemir H, Çiftçi E, Ince EU, Ertem M, Ince E, Doğru U.

Hemophagocytic lymphohistiocytosis associated with 2009

pandemic influenza A (H1N1) virus infection. J Pediatr

Hematol Oncol 2011;33:135-137.

5. Novel Swine-Origin Influenza A (H1N1) Virus Investigation

Team, Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom

S, Garten RJ, Gubareva LV, Xu X, Bridges CB, Uyeki TM.

Emergence of a novel swine-origin influenza A (H1N1)

virus in humans. N Engl J Med 2009;360:2605-2615.

6. Unal S, Gökçe M, Aytaç-Elmas S, Karabulut E, Altan I,

Ozkaya-Parlakay A, Kara A, Ceyhan M, Cengiz AB, Tuncer

M, Cetin M, Gümrük F. Hematological consequences

of pandemic influenza H1N1 infection: a single center

experience. Turk J Pediatr 2010;52:570-575.

7. Willekens C, Cornelius A, Guerry MJ, Wacrenier A, Fourrier

F. Fulminant hemophagocytic lymphohistiocytosis induced

by pandemic A (H1N1) influenza: a case report. J Med Case

Rep 2011;5:280.

8. Katsumi A, Nishida T, Murata M, Terakura S, Shimada K,

Saito S, Kobayashi M, Kodaira A, Shibata S, Oda I, Yagi T,

Kiyoi H, Matsushita T, Kojima T, Naoe T. Virus-associated

hemophagocytic syndrome caused by pandemic swine-origin

influenza A (H1N1) in a patient after unrelated bone marrow

transplantation. J Clin Exp Hematop 2011;51:63-65.

9. Asai N, Ohkuni Y, Matsunuma R, Iwama K, Otsuka Y,

Kawamura Y, Motojima S, Kaneko N. A case of novel swine

influenza A (H1N1) pneumonia complicated with virusassociated

hemophagocytic syndrome. J Infect Chemother

2012;18:771-774.

10. Ur Rehman J, Wali G, Sayes NM, Maulawi A, Aslam

M, Khalid I. Novel influenza A (H1N1) virus-induced

hemophagocytosis: first case reported in Saudi Arabia. Ann

Saudi Med 2012;32:86-89.

11. Beutel G, Wiesner O, Eder M, Hafer C, Schneider AS,

Kielstein JT, Kühn C, Heim A, Ganzenmüller T, Kreipe HH,

Haverich A, Tecklenburg A, Ganser A, Welte T, Hoeper

MM. Virus-associated hemophagocytic syndrome as a

major contributor to death in patients with 2009 influenza

A (H1N1) infection. Crit Care 2011;15:80.

12. Harms PW, Schmidt LA, Smith LB, Newton DW, Pletneva

MA, Walters LL, Tomlins SA, Fisher-Hubbard A, Napolitano

LM, Park PK, Blaivas M, Fantone J, Myers JL, Jentzen JM.

Autopsy findings in eight patients with fatal H1N1 influenza.

Am J Clin Pathol 2010;134:27-35.

13. To KK, Hung IF, Li IW, Lee KL, Koo CK, Yan WW, Liu R,

Ho KY, Chu KH, Watt CL, Luk WK, Lai KY, Chow FL, Mok

T, Buckley T, Chan JF, Wong SS, Zheng B, Chen H, Lau CC,

Tse H, Cheng VC, Chan KH, Yuen KY. Delayed clearance of

viral load and marked cytokine activation in severe cases of

pandemic H1N1 2009 influenza virus infection. Clin Infect

Dis 2010;50:850-859.

428


DOI: 10.4274/Tjh.2013.0127

Antiphospholipid Antibodies and Systemic Scleroderma

Antifosfolipid Antikorları ve Sistemik Skleroderma

Muhammed Mubarak1, Hamid Nasri2

1Sindh Institute of Urology and Transplantation (SIUT), Karachi, Pakistan

2Isfahan University of Medical Sciences, Department of Nephrology, Division of Nephropathology, Isfahan, Iran

Dear Editor:

We read with great interest the article by Touré and

colleagues published in a recent issue of your journal, entitled

“Antiphospholipid Antibodies and Systemic Scleroderma”.

In this study, they investigated 40 patients with systemic

scleroderma (SSc) for the presence of antiphospholipid

antibodies (aPLs). Overall, they found aPLs in 23 (57.5%)

patients. The most frequently encountered antibody was IgG

anti-β2 glycoprotein I (GP I) (37.5% of the patients), followed

by anticardiolipins (17.5%) and lupus anticoagulants (5%).

No statistically significant association of positive aPL tests

to any of the scleroderma complications was observed. They

suggested that patients affected by SSc be followed in order to

monitor vascular complications following the confirmation

of the presence of antiphospholipid syndrome (APS) [1].

We would like to remind readers of a few points about APS

nephropathy (APSN) and rheumatologic disease. Although

high proportions of patients showing association of SSc and

aPLs were described by Touré et al., more attention and

support is needed to find the co-existence of APSN with

systemic lupus erythematosus and SSc in routine evaluation

of these patients [2,3,4]. Thus, the main question to bear in

mind is: what do nephrologists or rheumatologists need to

know about APS and APSN?

APS is being increasingly recognized as an important

cause of renal damage due to thrombosis at any location

within the renal vasculature [5]. The term “APSN” refers

to the various renal pathologies caused by vascular lesions

in the glomeruli, arterioles, and/or interlobular arteries

in patients with aPLs [5,6,7]. From the nephrology point

of view, this small-vessel, vaso-occlusive nephropathy

may present with hypertension, acute and/or chronic

renal failure, and often a low-grade proteinuria clinically

[8,9,10]. It is also necessary to increase the awareness of the

morphologic features of this disease among pathologists and

nephrologists from developing countries for its early and

accurate diagnosis and appropriate management. It is clear

that the diagnosis of APSN can only be made based on renal

biopsy. None of the patients in the study under discussion

showed renal manifestations or complications, and neither

did they undergo renal biopsy [11,12].

There were additionally some errors in the study. The

authors did not classify the disease. The timing of antibody

testing was also not provided. It is not clear how many of

the patients were diagnosed with APS. Laboratory criteria

alone are not enough to definitively diagnose this condition.

The titer of antibodies was not given. This may be one of

the factors underlying the lack of association of the aPLs

with complications of SSc. There was also no information

about SSc serologies such as anti-Sc70. An age of 41 years is

given as both the median and mean value in different places.

The frequency of anti-β2 GP I is given as 50% in the results

section, but it is 37.5% as given in Table 2. Hypochromic skin

macula is described as present in 100% of cases in the results

section, while in Table 1, it is 94.7%. The percentage value of

pulmonary hypertension in Table 1 is also wrong; it should

be 12.5%. The values for complications/manifestations in

Tables 1 and 3 do not match. In the discussion section, the

study period is given as 8 months rather than 18 months.

Address for Correspondence: Hamid NASRI, M.D.,

Isfahan University of Medical Sciences, Department of Nephrology, Division of Nephropathology, Isfahan, Iran

E-mail: hamidnasri@med.mui.ac.ir


Accepted/Kabul tarihi : April 30, 2013

429

Mubarak M, et al: RE: Antiphospholipid Antibodies and Systemic Scleroderma


Declaration of Conflicting Interests

The authors declare no conflicts of interest with respect

to the authorship and/or publication of this article.

References

1. Touré AO, Ly F, Sall A, Diatta A, Gadji M, Seck M, Faye B,

Dieye T, Diop S. Antiphospholipid antibodies and systemic

scleroderma. Turk J Hematol 2013;30:32-36.

2. Nasri H. Hypertension and renal failure with right arm

pulse weakness in a 65 years old man. J Nephropathol

2012;1:130-133.

3. Mubarak M. Catastrophic antiphospholipid syndrome

presenting with sudden renal failure: the lesson lies in

vascular lesions. J Nephropathol 2013;2:135-138.

4. Mardani S, Nasri H. Catastrophic antiphospholipid

syndrome presenting with sudden renal failure and past

history of long-lasting psychosis and hypertension in a

woman. J Nephropathol 2013;2:110-113.

5. Kronbichler A, Mayer G. Renal involvement in autoimmune

connective tissue diseases. BMC Med 2013;11:95.

6. Serrano F. Antiphospholipid syndrome: a complex disease. J

Nephropathol 2013;2:73-74.

7. Sinico RA, Cavazzana I, Nuzzo M, Vianelli M, Napodano

P, Scaini P, Tincani A. Renal involvement in primary

antiphospholipid syndrome: retrospective analysis of 160

patients. Clin J Am Soc Nephrol 2010;5:1211-1217.

8. Ardalan MR, Vahedi A. Antiphospholipid syndrome: a

disease of protean face. J Nephropathol 2013;2:81-84.

9. Nishimura M, Nii T, Trimova G, Miura S, Umezawa K,

Ushiyama A, Kubota T. The NF-κB specific inhibitor

DHMEQ prevents thrombus formation in a mouse model of

antiphospholipid syndrome. J Nephropathol 2013;2:114-

121.

10. Biggioggero M, Meroni PL. The geoepidemiology of the

antiphospholipid antibody syndrome. Autoimmun Rev

2010;9:299-304. doi: 10.1016/j.autrev.2009.11.013. Epub

2009 Nov 25.

11. Nasri H. Antiphospholipid syndrome-associated

nephropathy: Current concepts . J Ren Inj Prev 2013; 2: 1-2.

doi:10.12861/jrip.2013.01

12. Baradaran A. Antiphospholipid syndrome-associated

nephropathy; a nephropathy needs classification. J

Nephropharmacol. 2012;1:7-9.

Reply,

* I don’t know what you mean about the timing of the

study. We led our study during 18 months.

* For anti-beta2 GPI, we tested for IG M and IG G and

we found these following results: 50% of patients had

either G or M, 37,5% had IGM and the same proportion

Ig G. Of course some patients had both.

* For table 1, I made a mistake with hypochromic

maculae, wich was the main reason of counsulting: all

patients (100%) have had this abnormalities. The rate of

pulmonary hypertension is also 12.5%.

* For table 3 : the good version is this one

Raynaud’s phenomenon APL + (26) and APL - (13)

Pulmonary hypertension APL + (4) and APL - (1)

Acrosclerosis APL + (22) and APL - (6)

I am really sorry for all these disturbances and thank

you again.

Best regards

Dr Awa O Touré

430


DOI: 10.4274/TJH-2013.0150

The Relationship between Survival and Multidrug

Resistance Protein 1

Multi Drug Rezistans Protein 1 ile Survi Arasındaki İlişki

Kadir Öztürk, Yusuf Emrah Eyi, Yakup Aksoy

Hakkari Military Hospital, Department of İnternal Medicine, Hakkari, Turkey

Hakkari Military Hospital, Department of Emergency Medicine, Hakkari, Turkey

Hakkari Military Hospital, Department of Ophthalmology, Hakkari, Turkey

To the Editor,

We read with great enthusiasm the recently published

article entitled “The Frequency and Clinical Relevance of

Multidrug Resistance Protein Expression in Patients with

Lymphoma” by Gündüz and colleagues [1]. In that very welldesigned

study, they tried to evaluate the relationships between

levels of multidrug resistance protein 1 (MDR1), multidrug

resistance-associated protein (MRP), and lung resistancerelated

protein (LRP) and median survival in patients with

non-Hodgkin lymphoma (NHL), Hodgkin lymphoma (HL),

and reactive lymphadenopathy (LAP). They concluded that

MDR1, MRP, and LRP expression did not influence overall

survival in NHL and HL patients.

The authors reported that the age difference between

patient groups was not significant; the mean age was

53.2±17.5 years in the NHL patients (group 1) and 37.6±13.7

years in the HL patients (group 3), and p<0.05 was accepted as

statistically significant. Although there were both statistically

and clinically significant differences between the groups

in age, the authors reported that there was no significant

difference in age between the groups. In previous studies,

it was reported that MDR1, MRP, and LRP expression levels

were correlated with age [2]. In addition, in the study under

present discussion, it was declared that the average survival

time of patients with HL (49.50±4.69 months) was longer

than that of patients with reactive LAP (42.46±5.85 months).

Although the authors reported that survival of patients with

HL was longer than that of the patients with reactive LAP, HL

has higher mortality than in a healthy population despite all

advances in treatment [3].

In the study, it was indicated that there was not a

relationship between MDR1, MRP, and LRP expression

and lactate dehydrogenase, albumin, beta-2 microglobulin,

C-reactive protein, or erythrocyte sedimentation rate.

However, the authors did not mention any numerical or

statistical values in regard to these results.

We thank the authors for their contribution.

References

1. Gündüz E, Dinçer M, Yıldız G, Bal C, Gülbaş Z. The

frequency and clinical relevance of multidrug resistance

protein expression in patients with lymphoma. Turk J

Hematol 2012;29:120-125.

2. Schaich M, Soucek S, Thiede C, Ehninger G, Illmer T; SHG

AML96 Study Group. MDR1 and MRP1 gene expression

are independent predictors for treatment outcome in adult

acute myeloid leukaemia. Br J Haematol 2005;128:324-

332.

3. National Cancer Institute. Hodgkin Lymphoma-SEER Stat

Fact Sheets. Bethesda, NCI, n.d. Available at http://seer.

cancer.gov/statfacts/html/hodg.html; accessed 26 August

2012.

Address for Correspondence: Yusuf EYİ, M.D.,

Hakkari Military Hospital, Department of Emergency Medicine, Hakkari, Turkey

GSM: +90 532 582 28 02 E-mail: dremraheyi@hotmail.com



431

Öztürk K, et al: The Relationship between Survival and Multidrug Resistance Protein 1


Reply,

The mean ages for patient groups were 53.2 +/- 17.5

in non Hodgkin lymphoma (NHL) patients (group 1),

41.7 +/- 15.1 in non malignant patients and 37.6 +/-

13.7 in Hodgkin lymphoma (HL) patients (group 3).

The difference was statistically significant between NHL

and HL groups but there was no statistically significant

difference between lymphoma patients and non

malignant group. Unfortunately it was written as only

“NHL patients were older than HL patients (p<0.05),

the difference was not significant” with missing words.

The difference was not significant sentence should be

written as “the difference was not significant between

lymphoma patients and non malignant group”.

Although Schaich et al reported a correlation between

age and MDR1, MRP and LRP expressions in acute

myeloid leukemia patients we didn’t investigate such a

relation ship. It can be analyzed in further studies.

Survival of our patients with HL was 49.5+/-4.69

months. This was 42.46+/-5.85 months for NHL group.

Survival was shorter than HL group for NHL patients

but was not different between lymphoma groups and

non malignant group. The survival is for not only

reactive lymphadenopathy (LAP) but all malignant

group although we mentioned as reactive LAP in our

article. Non malignant group consisted of reactive

LAP, granulomatous inflammation, dermatopathic LAP,

benign mixed tumour and Kikuchi’s disease. These

subgroups and the small number of patients in HL

group might have effected our results.

In the study MDR1, MRP and LRP expressions were

not related with lactate dehydrogenase, albümin, beta

2 microglobulin, C reactive protein or erythrocyte

sedimentation rate. The numerical and statistical values

are not given because we didn’t want to confuse with

many numbers and can be shared if requested.

Zafer Gülbaş

432

Images in Hematology

DOI: 10.4274/Tjh.2012.0207

Primary Mesenteric

Follicular Lymphoma

Associated with Mesenteric

Migration of Intrauterine

Device

Intrauterin Aracın Mezenterik

Migrasyonu ile Birlikte Primer

Mezenterik Foliküler Lenfoma

A 39-year-old woman received an intrauterine device

(IUD) placement 6 years ago, and lower abdominal pain

occurred intermittently 1 year after the placement. Every

attack lasted for a few days and was relieved spontaneously.

Pain occurred again 2 days before admission, with nausea,

vomiting, and constipation. Physical examination revealed

a mass in the left lower abdomen with localized tenderness.

Abdominal computed tomography showed that a mass, 5.9

× 4.0 cm in size, was adjacent to the aorta abdominalis and

below the umbilicus. A 2-cm circinate foreign body was

observed close to the mass (Figure 1). Exploratory laparotomy

showed that a metallic IUD was on the mesenterium, while

the uterine was intact, and the mesenterium, 130 cm distal

to the Treitz ligament until 40 cm proximal to the ileocecum,

was occupied by purple nodules, which coalesced into a

large mass (Figure 2). Diseased mesenterium and relevant

intact small bowel were resected successfully. Postoperative

pathologic study showed abnormal crowding of follicles

and many large centroblasts with nucleoli adjacent to

the nuclear membrane with admixed cleaved cells, in

accordance with Grade III follicular lymphoma (Figure

3). Immunohistochemistry results were positive for CD20,

CD21, mum-1, Bcl-2, and Bcl-6 and weakly positive for

CD10, with a Ki-67 index of 60%. Further bone marrow

smear and biopsy had negative results. She was treated with

6 cycles of combined chemotherapy after surgery, and no

relapse was observed at the 1-year follow-up. Informed


Figure 1: Abdominal CT reveals a mass of 5.9 x 4.0 cm in

size adjacent to the aorta abdominalis under the umbilicus,

to the right of which a dissociative circinate foreign body of

2 cm in diameter is observed (arrow).

Xue-Feng Sun1, Jun Feng2, Wei Liu3

1Peking Union Medical College Hospital, Department of

Respiratory Medicine, Beijing, China

2Peking Union Medical College Hospital, Department of

Hematology, Beijing, China

3Peking Union Medical College Hospital, Department of General

Surgery, Beijing, China

Address for Correspondence: Wei LIU, M.D.,

Peking Union Medical College Hospital, Department of General Surgery, Beijing, China

E-mail: liu_wei_95@sina.com


Accepted/Kabul tarihi : March 15, 2013

Figure 2: During laparotomy, a metallic IUD was noticed on

the mesenterium. The mesenterium to the left of the IUD

is occupied by purple nodules coalescing into a large mass.

Some nodules were ruptured, and brown mucus was seen

flowing out.

433

Sun FX, et al: Follicular Lymphoma with Migrated IUD


Figure 3: Ostoperative pathologic study showed abnormal

crowding of follicles and many large centroblasts with

nucleoli adjacent to the nuclear membrane with admixed

cleaved cells, in accordance with Grade III follicular

lymphoma (hematoxylin and eosin, 100x).

IUDs become embedded in the uterine wall or even

perforated into the peritoneal cavity only in very rare cases.

It has been reported that perforation of the uterus occurs

in 0.87 of 1000 insertions [1]. Follicular lymphoma is an

indolent lymphoma and accounts for about 10% of non-

Hodgkin lymphomas in China. Although the presence of

primary follicular lymphoma of the gastrointestinal tract

is relatively commonly seen, primary mesenteric follicular

lymphoma is extremely rare.

It is usually considered that IUDs are unrelated to

malignancy, and might even act as a protective cofactor in

cervical carcinogenesis [2], but there are no studies about

the safety of migrated IUDs. In this case, mesenteric follicular

lymphoma followed IUD placement and migration, and they

were adjacent in space, which brought about the postulation

that there was some unusual association between the

formation of follicular lymphoma and the migrated IUD.

This might be explained by the fact that the pathogenesis of

lymphoma is associated with inflammation [3].

Key Words: Mesenteric follicular lymphoma,

Intrauterine device


The authors declare that they have no conflicts of interest

that could be perceived as having influenced the impartiality

of the materials presented.

Funding

The present study received no grant from a funding

agency in the public, commercial, or for-profit sectors.

References

1. Markovitch O, Klein Z, Gidoni Y, Holzinger M, Beyth Y.

Extrauterine mislocated IUD: is surgical removal mandatory?

Contraception 2002;66:105-108.

2. Castellsagué X, Díaz M, Vaccarella S, de Sanjosé S, Muñoz N,

Herrero R, Franceschi S, Meijer CJ, Bosch FX. Intrauterine

device use, cervical infection with human papillomavirus,

and risk of cervical cancer: a pooled analysis of 26

epidemiological studies. Lancet Oncol 2011;12:1023-1031.

3. Rosenquist R. Introduction: The role of inflammation,

autoimmune disease and infectious agents in development

of leukaemia and lymphoma. J Intern Med 2008;264:512-

513.

434

Images in Hematology

DOI: 10.4274/Tjh.2012.0115

Interstitial Pneumonitis

in a Patient with Chronic

Myeloid Leukemia

Kronik Miyeloid Lösemi Hastasında

Gelişen İnterstisyel Pnömoni

Figure 1: Chest X-ray showed bilateral interstitial

infiltrates (A). Thoracic CT revealed patchy parenchymal

consolidations in both apical lungs, bilateral superior

segments of the lower lobes, and the posterior regions of

both lungs (B).

Ahmet Emre Eşkazan1, Ayşe Salihoğlu2,

Serdar Erturan3, Teoman Soysal2

1İstanbul University Cerrahpaşa Faculty of Medicine, Department

of Internal Medicine, Division of Hematology, İstanbul, Turkey

2İstanbul University Cerrahpaşa Faculty of Medicine, Department

of Chest Disease, İstanbul, Turkey

Address for Correspondence: Teoman SOYSAL, M.D.,

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine,

Division of Hematology, İstanbul, Turkey

Phone: +90 212 589 79 34 E-mail: soysal12@istanbul.edu.tr

Received/Geliş tarihi : August 24, 2012

Accepted/Kabul tarihi : December 14, 2012

A 43-year-old otherwise healthy male patient was

admitted to our hematology clinic with leukocytosis in April

2008. Philadelphia-positive chronic phase chronic myeloid

leukemia (CML) was the diagnosis. Imatinib mesylate (IM)

at 400 mg/day was initiated in May 2008. He tolerated the

therapy quite well; only a mild skin rash developed, which

was easily controlled with antihistamines. He was admitted

with dry cough and shortness of breath, unresponsive to

moxifloxacin therapy, in February 2010, after 20 months of

IM treatment. He had a 15-pack-year history of smoking,

which he had quit 2 years ago. He was afebrile and there

were crackles on auscultation in both lungs. His chest

X-ray showed bilateral interstitial infiltrates (Image 1A),

and thoracic computed tomography (CT) revealed patchy

parenchymal consolidations in both apical lungs, bilateral

superior segments of the lower lobes, and the posterior

regions of both lungs (Image 1B). Pulmonary function tests

showed a restrictive ventilatory defect. No elevations of the

acute phase reactants were detected, and the IgE blood level

was within the normal limits. Fiberoptic bronchoscopy

revealed normal airways, and bronchoalveolar lavage showed

no abnormalities with the transbronchial fine needle biopsy

showing nonspecific interstitial inflammation. The diagnosis

was nonspecific interstitial pneumonitis and the possible

cause was thought to be IM. Imatinib was discontinued

and methylprednisolone (80 mg/day) was initiated. Under

the corticosteroid therapy, his symptoms and radiological

findings were resolved.

Imatinib is indicated in the first-line treatment of CML. It

is generally well tolerated, but mild adverse events including

edema, nausea, diarrhea, abdominal pain, muscle cramps,

and skin rash can be seen. Pulmonary complications such as

dyspnea and cough are usually due to the pulmonary edema

and pleural effusion that are seen in approximately 7%-14%

of the patients receiving IM [1,2]. Interstitial pneumonitis

during imatinib therapy is a rare entity [3]. While receiving

IM and between days 10 and 337 of treatment, interstitial

pneumonitis cases are documented [1]. The pathogenesis

of the interstitial pulmonary disease during IM includes the

direct toxic effects of the inflammatory and immune system

cells resulting in parenchymal lung injury and fibrosis

[4]. Our patient had tolerated IM well until month 20 of

treatment, when a serious pulmonary complication occurred.

Interstitial pneumonitis can be reversible when diagnosed

early and treated quickly; thus, pulmonary symptoms in

patients receiving IM should be closely monitored and

possible pulmonary toxicity should always be kept in mind.

Informed consent was obtained.

435


Eşkazan EA, et al: Interstitial Pneumonitis in a CML Patient

Key words: CML, imatinib, interstitial pneumonitis





included.

References

1. Yokoyama T, Miyazawa K, Kurakawa E, Nagate A,

Shimamoto T, Iwaya K, Akata S, Aoshima M, Serizawa

H, Ohyashiki K. Interstitial pneumonia induced by

imatinib mesylate: pathologic study demonstrates alveolar

destruction and fibrosis with eosinophilic infiltration.

Leukemia 2004;18:645-646.

2. Rajda J, Phatak PD. Reversible drug-induced interstitial

pneumonitis following imatinib mesylate therapy. Am J

Hematol 2005;79:80-81.

3. Isshiki I, Yamaguchi K, Okamoto S. Interstitial pneumonitis

during imatinib therapy. Br J Haematol 2004;125:420.

4. Robibaro B, Kropfmueller A, Prokop M, Haber P, Gisslinger

H. Imatinib, cytokines and interstitial lung disease in

a patient with primary myelofibrosis. Ann Hematol

2010;89:829-831.

436

30 th Volume Index / 30. Cilt Dizini

SUBJECT INDEX - KONU DİZİNİ

March 2013 - December 2013

Mart 2013 - Aralık 2013

Acute Leukemia

Children / Çocuk, 58

Epstein-Barr virus / Epstein-Barr virus, 58

Leukemia / Lösemi, 58

Lymphoproliferative disorder / Lenfoproliferatif hastalık, 58

Rituximab / Rituximab, 58

Myeloid leukemia / Miyeloid lösemi, 129

NPM1 mutation / NPM1 mutasyonu, 129

Acute myeloid leukemia / Akut miyeloid yösemi, 137

Angiogenesis / Anjiyogenez, 137

Gene expression / Gen ekspresyonu, 137

VEGF-A, VEGF-C / VEGF-A, VEGF-C, 137

Acute promyelocytic leukemia / Akut promyelositik lösemi, 157

Locked nucleic acid / Locked nükleik asit, 157

microRNA / mikroRNA, 157

miR-92a / miR-92a, 157

Acute leukemia / Akut lösemi, 263

Chemotherapeutics / Kemoterapötikler, 263

TRAIL / TRAIL, 263

Cardiotoxicity / Kardiyotoksisite, 290

Chemotherapy / Kemoterapi, 290

Childhood / Çocukluk çağı, 290

Endocrinology / Endokrinoloji, 290

Late effects / Geç etki, 290


Acute myeloid leukemia / Akut miyeloid lösemi, 300

Neuropilin-1 / Neuropilin-1, 300

Acute promyelocytic leukemia / Akut promiyelositik lösemi, 400

Additional chromosomal abnormalities /

Ek kromozomal anomaliler, 400

Anemia

Iron deficiency anemia / Demir eksikliği anemisi, 145

Treatment / Tedavi, 145

Ferrous sulfate / Ferröz sülfat, 145

Zinc sulfate / Çinko sülfat, 145

Reticulocyte hemoglobin content / Retikülosit hemoglobin

içeriği, 153

Diagnosis / Tanı, 153


Autoimmun hemolytic anemia / Otoimmün hemolitik anemi, 194

Megadose methylprednisolone / Megadoz metilprednizolon, 194

Obesity / Obezite, 293

Bleeding Disorders

Oral surgery / Ağız cerrahisi, 19

Hemophilia / Hemogli, 19

Hemostasis / Hemostaz, 19

Ankaferd blood stopper / Ankaferd blood stopper, 19

Platelet aggregation defects /

Trombosit agregasyon bozuklukları, 168

Von Willebrand disease / Von Willebrand hastalığı, 168

Menorrhagia / Menoraji, 168

Bleeding disorder / Pıhtılaşma bozukluğu, 168

Bone Marrow

Lymphocyte / Lenfosit, 1

Stem cell physiology / Kök hücre fizyolojisi, 1

Immunity / Bağışıklık, 1

Hematopoetic stem cells / Hematopoetik kök hücreler, 1

Blood cells / Kan hücreleri, 1

Monocyte / Monosit, 256

Mesenchymal stromal cell / Mezenkimal stromal hücre, 256

Bone marrow transplantation / Kemik iliği nakli, 256

İmmunsupresion / İmmünspresyon, 256

Blood Smear

May-Grünwald-Giemsa stain /

May-Grunwald-Giemsa boyaması, 53

Blood smear / Çevre kan yayması, 53

Polymorphonuclear neutrophils / Parçalı nötrogl , 53

Gender / Cinsiyet, 53

Nuclear appendages / Çekirdek ilave uzantısı, 53

Chanarin-Dorfman syndrome

Chanarin-Dorfman syndrome /

Chanarin Dorfman Sendromu, 72

Ichthyosis / İktiyoz, 72

Child / Çocuk, 72

Acute myeloblastic leukemia / Akut miyeloblastik lösemi, 230

Pseudo Chediak-Higashi anomaly / Yalancı Chediak Higashi

Subject Index - Konu Dizini

Anomalisi, 230

Child / Çocuk, 230

Chronic Leukemia

Imatinib / Imatinib, 247

Chronic myeloid leukemia / Kronik myeloid lösemi,

247,352,359,387

Tyrosine kinase inhibitor / Tirozin kinaz inhibitörü, 247

Dasatinib / Dasatinib, 247

Nilotinib / Nilotinib, 247

Bosutinib / Bosutinib, 247

Ponatinib / Ponatinib, 247


Insulin resistance / İnsülin direnci, 300

Anemia / Anemi, 300

Inflammation / İnflamasyon, 300

CML / KML, 359

Accelerated phase HOXA9 gene / Akselere faz HOXA9 geni, 359

BCR-ABL expression / BCR-ABL ekspresyonu, 359

Safety / Güvenilirlik, 387

Imatinib / İmatinib, 387

BCR-ABL / ABL ratio / BCR-ABL / ABL oranı, 359

Endothelial Protein C Receptor

sEPCR / sEPCR, 37

EPCR / EPCR, 37

A3 / A3, 37

Pediatric stroke / Pediatrik inme, 37

Essential Thrombocythemia

Leg ulcers / Bacak ülserleri, 184

Hydroxyurea / Hidroksiüre, 184

Essential thrombocythemia / Esansiyel trombositemia, 184

Interferon / İnterferon, 184

Factor VIII Inhibitors

Hemarthrosis / Hemartroz, 76

Acquired hemophilia / Edinsel hemogli, 76

FVIII inhibitors / Faktör VIII inhibitörleri, 76

Postpartum inhibitors / Doğum sonrası inhibitörler, 76

Granulocytic Sarcoma

Monocytic differentiation / Monositik Farklılaşma, 82

Granulocytic sarcoma / Granülositik sarkom, 82

Skin / Deri, 82

Hematological Malignancies

Molecular genetics / Moleküler genetik, 122

Hematologic malignancies / Hematolojik maligniteler, 122


Microarray / Mikroarray , 122

Hemophilia



Hemophilia / Hemofili, 19


Hydrops

α-Thalassemia / α-talasemi, 63

Hydrops fetalis / Hidrops fetalis, 63

Nonimmune / Nonimmün, 63

Iron


Treatment / Tedavi, 145

Ferrous sulfate / Ferröz sülfat, 145

Zinc sulfate / Çinko sülfat, 145


Reticulocyte hemoglobin content /

Retikülosit hemoglobin içeriği, 153


Iron / Demir, 307

Omeprazole / Omeprazol, 307

PPI / PPI, 307

Proton pump inhibitors / Proton pompa inhibitörleri, 307

Anemia / Anemi, 307


Insulin resistance / İnsülin direnci, 293

Anemia / Anemi, 293

Inflammation / İnflamasyon, 293

Langerhans Cell Sarcoma

Langerhans / Langerhans, 198

Sarcoma / Sarkom, 198

Axillary / Aksiller, 198

Lymph node / Lenf nodu, 198

Differential diagnosis / Ayırıcı tanı, 198

Lymphoma


Human herpes virus-8 / Human herpes virüs-8, 67

Human immunodegciency virus (HIV) /

Human immunodeficiency virus (HIV), 67

Pleural effusion / Plevral efüzyon, 67

Primary effusion lymphoma / Primer efüzyon lenfoması, 67

Renal lymphoma / Renal lenfoma, 191

Central nervous system involvement /

Santral sinir sistemi tutulumu, 191

Children / Çocuklar, 191

Diffuse large B-cell lymphoma /

Diffüz büyük B hücreli lenfoma, 275

p53 / p53, 275

Bcl-2 / Bcl-2, 275

Ki67 / Ki67, 275

Prognosis / Prognoz, 275

Primary adrenal lymphoma / Primer adrenal lenfoma, 405

Central nervous system involvement /

Merkezi sinir sistemi tutulumu, 405


Primary bone lymphoma / Primer kemik lenfoması, 409

Lymphoplasmacytic lymphoma / Lenfoplazmasitik lenfoma, 409

Spinal cord compression / Spinal kord basısı, 409

Sjögren’s syndrome / Sjogren sendromu, 416

Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 416

Malignancy / Habis, 416

Mesenchymal Stem Cells

Mesenchymal stem cells / Mezenkimal kök hücreler, 116

Differentiation / Diferansiyasyon, 116

Cardiomyocyte / Kardiyomiyosit, 116

Myocyte / Miyosit, 116

Mezenchimal stromal cell / Mezenkimal stromal hücre, 256

Bone marrow transplantation / Kemik iliği nakli, 256

İmmunsupresion / İmmünspresyon, 256

Multiple Myeloma

Multiple myeloma / Multipl miyelom, 84

Carbamazepine / Karbamazepin, 84

Epilepsy / Epilepsi, 84

Multiple myeloma / Multipl miyelom, 234

Quality of life / Yaşam kalitesi, 234

Supportive care / Destekleyici tedavi, 234

Myeloproliferative Disorders

MPL W515L / K mutations / MPL W515L / K mutasyonları, 8

JAK-2 V617F mutation / JAK-2 V617F mutasyonu, 8

Myeloproliferative neoplasms / Miyeloproliferatif neoplazmlar, 8

Essential thrombocythemia / Esansiyel trombositemi, 8

Primary myelofibrosis / Primer miyelofibroz, 8

Myeloproliferative neoplasm / Miyeloproliferatif neoplazi, 13

SOCS1 / SOCS1, 13

SOCS3 / SOCS3, 13

Secondary erythrocytosis/thrombocythemia /

Sekonder eritrositoz/trombositemi, 13

Renal transplantation / Böbrek nakli, 315

Lymphoproliferative disorder / Lenfoproliferatif hastalık, 315

Burkitt lymphoma / Burkitt lenfoma, 315

Mutation

MPL W515L/K mutations / MPL W515L/K mutasyonları, 8

JAK-2 V617F mutation / JAK-2 V617F mutasyonu, 8

Myeloproliferative neoplasms / Miyeloproliferatif neoplazmlar, 8

Essential thrombocythemia / Esansiyel trombositemi, 8

Primary myelofibrosis / Primer miyelofibroz, 8

Methylation

Myeloproliferative neoplasm / Miyeloproliferatif neoplazi, 13

SOCS1 / SOCS1, 13

SOCS3 / SOCS3, 13

Secondary erythrocytosis-thrombocythemia /

Sekonder eritrositoz-trombositemi, 13

Myeloperoxidase Deficiency

Leucocyte function disorders / Lökosit fonksiyon bozuklukları,

232

Myeloperoxidase / Miyeloperoksidaz, 232

Neutrophil / Nötrofil, 232

Polycythemia Vera

Physiopathology / Fizyopatoloji, 102

Etiologic factors / Etyolojik faktörler, 102


Polycythemia vera / Polistemia vera, 102

Stem Cell Transplantation

DVT / DVT, 188

Non-myeloablative allogeneic stem cell transplantation /

Miyeloablatif olmayan allojeneik kök hücre nakli, 188

Incidence / İnsidans, 188

Allogeneic hematopoietic stem cell transplantation (allo

HSCT) / Allojenik hematopoietik kök hücre nakli, 204

Hepatotoxicity / Hepatotoksisite, 204

Encephalitozoon intestinalis / Encephalitozoon intestinalis, 204

Albendazole / Albendazol, 204

Haploidentical stem cell transplantation / Haploidentik kök

hücre nakli, 342

HLA / HLA, 342

GVHD / Gratf versus host hastalığı (GVHH), 342

Sickle Cell

Sickle cell disease / Orak hücreli anemi, 25

Nutritional status / Beslenme durumu, 25

Endocrine system diseases / Endokrin sistem hastalıkları, 25

Children / Çocuklar, 25

Sickle cell / Orak hücre, 379

Arterial stiffness / Arteriyel sertlik, 379

Pulse wave velocity / Nabız dalga hızı, 379

Quality of life / Yaşam kalitesi, 379

Treatment



Hemophilia / Hemofili, 19




Bone healing / Kemik iyileşmesi, 177

Bone histomorphometry / Kemik histomorfometri, 177

Chronic myeloid leukemia / Kronik myeloid lösemi, 247

Tyrosine kinase inhibitor / Tirozin kinaz inhibitörü, 247

Imatinib / Imatinib, 247

Nilotinib / Nilotinib, 247

Dasatinib / Dasatinib, 247

Bosutinib / Bosutinib, 247

Ponatinib / Ponatinib, 247

Thrombosis / Tromboz, 325

Neonate / Yenidoğan, 325

Tissue plasminogen activator / Doku plazminojen aktivatörü, 325

Preterm / Prematüre, 325

Cyclosporine / Siklosporin, 366


Danazol / Danazol, 366

Hemoglobinuria / Hemoglobinüri, 366

Paroxysmal / Paroksismal, 366

Immunosuppression / İmmunosupresyon, 366

Prednisolone / Prednizolon, 366

Safety / Güvenilirlik, 387

Imatinib / İmatinib, 387

Chronic myeloid leukemia / Kronik miyeloid lösemi, 387

Thalassemia

α-Thalassemia / α-talasemi, 63

Hydrops fetalis / Hidrops fetalis, 63

Nonimmune / Nonimmün, 63

Thalassemia / Talasemi, 91

Prevention / Önlem, 91

Campaign / Kampanya, 91

Childhood / Çocukluk çağı, 283

Regional left ventricular cardiac function /

Bölgesel sol ventriküler kardiyak fonksiyonlar, 283

Strain / Strain, 283

Strain rate imaging / Strain hız görüntüleme, 283

Thalassemia / Talasemi, 283

Transfusion

Replacement blood donors / Replasman kan bağışçısı, 163

Hepatitis-B / Hepatit-B, 163

Hepatitis-C / Hepatit-C, 163

HIV / HIV, 163

Thrombosis

DVT / DVT, 188

Non-myeloablative allogeneic stem cell transplantation /

Miyeloablatif olmayan allojeneik kök hücre nakli, 188

Incidence / İnsidans, 188

Eosinophilia / Eozinofili, 311

Hypereosinophilic syndrome / Hipereozinofilik sendrom, 311


Intestinal obstruction / Intestinal tıkanıklık, 311

Venous thrombosis / Venöz tromboz, 48

Blood platelet disorders / Kan trombosit bozuklukları, 48

Platelet aggregation / Trombosit agregasyonu, 48

Platelet function tests / Trombosit fonksiyon testleri, 48


Neonate / Yenidoğan, 325

Tissue plasminogen activator /

Doku plazminojen aktivatörü, 325

Preterm / Prematüre, 325

Viral Infection


Human herpes virus-8 / Human herpes virüs-8, 67

Human immunodeficiency virus (HIV) /

Human immunodeficiency virus (HIV), 67

Pleural effusion / Plevral efüzyon, 67

Primary effusion lymphoma / Primer efüzyon lenfoması, 67

von Willebrand Disease

von Willebrand disease / von Willebrand hastalığı, 40

Prevalence / Prevalans, 40

PFA-100 / PFA-100, 40

Sensitivity / Sensitivite, 40

Specificity / Spesifite, 40

DDAVP / TR, 214

Preeclampsia / Preeklampsi, 214

Pregnancy / Hamilelik, 214

Deficiency / Eksiklik, 214

Platelet / Platelet, 214

Other

Hematologists / Hematologlar, 269

Fertility preservation / Fertilite prezervasyonu, 269

Attitude / Tutum, 269

Complicated / Komplike, 287

Severe / Ciddi, 287

Malaria / Sıtma, 287

Thrombocytopenia / Trombositopeni, 287

Angiogenesis / Njiojenez, 371

Radiation / Radyasyon, 371

Cancer and normal tissue / Kanser ve normal doku, 371

Vascular endothelium / Vasküler endotel, 371

HIF-1a / HIF-1a, 371

VEGF / VEGF, 371

eIF2 / eIF2, 371

TIA-1 / TIA-1, 371

TSP-1 / TSP-1, 371

Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 413

Sweet syndrome / Sweet sendromu, 413

Malignancy / Malignite, 413

Neutrophilic leucocytosis / Nötrofilik lökositoz, 413

Steroid / Steroid, 413

Fever / Ateş, 413

Hemolytic uremic syndrome / Hemolitik üremik sendrom, 418

Hepatitis B vaccine / Hepatit B aşısı, 418

Children / Çocuk, 426, 439

Sézary syndrome / Sézary sendromu, 420

Mycosis fungoides / Mukozis fungoides, 420

Axonal neuropathy / Aksonal nöropati, 420

Hemophagocytic lymphohistiocytosis / Hemofagositik, 426

Swine-origin influenza / Domuz gribi, 426

30 th Volume Idex / 30. Cilt Dizini

AUTHOR INDEX - YAZAR DİZİNİ

March 2013 - December 2013

Mart 2013 - Aralık 2013

A. Uğur Ural, 256

Abdullah Hacıhanifioğlu, 122

Abdülsamet Erden, 100

Abibatou Sall, 32

Adem Güler, 325

Affaf Adda, 53

Afife Karabıyık, 37

Ahmet Baran, 191

Ahmet Durmuş, 209

Ahmet Emin Kürekçi, 325

Ahmet Emre Eşkazan, 98,211,351,435

Ahmet Gözen, 336

Ahmet İrdem, 283

Ajda Ersoy Güneş, 234

Akın Öztürk, 405

Akif Selim Yavuz, 351

Alaa Fadhil Alwan, 387

Alaadin Sahham Naji, 387

Alassane Diatta, 32

Alev Akyol Erikçi, 48

Ali Bay, 283

Ali Koşar, 67

Ali Seçkin Yalçın, 283

Ali Sengül, 256

Ali T. Taher, 184

Ali Ünal, 204,341

Ali Zahit Bolaman, 269

Aliakbar Movasaghpoor, 137

Alireza Hamidian Jahromi, 214

Amjad Baig, 163

Anal Galip Köse, 72

Anupama Chawla, 307

Arbil Açıkalın, 315, 413

Aslı Demirbulat, 424

Asmae Quessar, 340

Aungkura Supokawej, 115

Awa Oumar Touré, 32

Ayça Dilruba Aslanger, 223

Aydın Gülünay, 420

Aylin Orgen Çallı, 198,275

Aynur Akbulut, 223

Aysel Pekel, 256

Ayşe Işık, 328, 400

Ayşe Salihoğlu, 351,435

Ayşe Yüzbaşıoğlu, 72

Bahar Dirican, 256

Bahar Taşdelen, 25

Bahriye Payzin, 198,275

Balahan Makay, 72

Barış Malbora, 144,230,418

Bassam Francis Matti, 387

Baysal Karaca, 331

Berna Atabay, 58

Berna Bozkurt Duman, 83,221,413

Betül Bolat Küçükzeybek, 275

Betül Tavil, 336

Bilgül Mete, 321

Blaise Faye, 32

Burak Uz, 351,400

Burhan Ferhanoğlu, 351

Bülent Eser, 204

Bülent Zülfikar, 25

Cahit Babür, 88

Can Öztürk, 58

Caner Aktaş, 371

Catherine Messina, 307

Cem Ar, 351

Cengiz Bayram, 418

Cengiz Beyan, 13

Cengiz Kurtman, 371

Ceyhun Dizdarer, 40

Christoph Klein, 232

Chun Wang, 422

Ciğdem Usul Afşar, 83,413

Cumhur İbrahim Başsorgun, 177

Deepak Bansal, 85

Deniz Sünnetçi, 122

Deniz Torun, 13

Derya Güleç, 331

Dildar Bahar Genç, 426

Dilek Dilli, 63

Dingming Wan, 263

Doaa El Ghannam, 129

Dökmeci Özden, 72

Duran Canatan, 91

Duygu Yavuz, 122

Ebru Kızılkılıç, 216

Ece Böber, 290

Edmund Fui Min Chin, 76

Ekrem Ünal, 232

Elif Kazancı, 426

Elmas Uzer, 341

Elvin Akdağ, 256

Emel Gürkan, 315,351,379

Emin Kansu, 188

Emine Zengin, 168

Author Index - Yazar Dizini

Emre Tekgündüz, 48

Engin Keltikli, 351

Engin Özçivici, 1

Erdem Akbal, 209

Eren Gündüz, 157

Erman Öztürk, 48

Erol Ayyıldız, 219

Esat Namal, 405

Esmeray Acartürk, 379

Esra Arun Özer, 58

Esra Atıcı, 67

Esra Erden, 416

Evren Özdemir, 188

Eylem Eliaçık, 328,400

Fahri Güneş, 209

Fahri Şahin, 234,351

Farah Jijina, 366

Faruk Özkul, 209

Fatih Demircioğlu, 426

Fatih Kurnaz, 204

Fatih Şap, 40

Fatimata Ly, 32

Ferenc Molnar, 379

Ferhat Özden, 98

Ferit Avcu, 256

Fezan Şahin Mutlu, 157

Figen Atalay, 216

Fikri Ak, 420

Fikri Başlamışlı, 315

Fuat Emre Canpolat, 325

Gamze Akkuş, 379

Giray Bozkaya, 331

Gökhan Sargın, 424

Göksel Leblebisatan, 283

Gül Tokgöz, 223

Gülersu İrken, 290

Gülhis Deda, 37

Gülsan Türköz Sucak, 81

Gülsüm Ak, 25

Gülsüm Emel Pamuk, 351

Güray Saydam, 234,351

Gürhan Kadıköylü, 269

Hadjer Beliali, 53

HaiTao Bai, 422

Hakan Akgün, 333

Hakan Erdoğan, 426

Hakan Göker, 328,400

Hakan Savlı, 122

Hakkı Oğuz Kazancıoğlu, 25

Haldun Öniz, 58

Hale Ören, 290

Hanan M. Mahmoud, 300

Handan Haydaroğlu Şahin, 351

Hasan Abbas Zaheer, 163

Hasan Mücahit Özbaş, 351

Hasan Onur Şimşek, 177

Hassiba Lazreg, 53

Hatice Eke Güngör, 232

Hava üsküdar Teke, 100

Henriette Wa Berenschot, 194

Hilal İlbars, 111

Hilmi Apak, 91

Hilmi Atay, 351

Homaun Sadeghi Bazargani, 137

Howyda Shaaban, 129

Hui Sun, 263

Hülya Şıvgın, 204

Hüseyin Toman, 209

İbrahim C. Haznedaroğlu,

247,328,351,400

İbrahim Tek, 371

İkbal Bozkaya, 144

İlgen Şaşmaz, 91

İlker İnanç Balkan, 321

İlknur Sivrikoz Ak,

İnan Anaforoğlu, 209

İnanç Elif Gürer, 177

İnci Alacacıoğlu, 198

İpek Yönal, 351

İrfan Yavaşoğlu, 269,424

Jamal Uddin, 163

Jan Jacques Michiels, 102

Jie Ma, 263

Jihane Abou Rahal, 184

Joseph E. Maakaron, 184

Julie Sawalle Belohradsky, 232

Jun Feng, 433

Kaan Kavaklı, 40

Kadir Acar, 81

Kadir Öztürk, 333,431

Kadir Öztürk, 431

Kadir Serkan Yalçın, 67

Kamil Nas, 379

Kanay Yararbaş, 223

Kanjaksha Ghosh, 336

Kemal Erdinç, 325

Kerem Okutur, 405

Kezban Nur Pilancı, 405

Kiraz Mızrak, 219

Kübra Aydın, 405

Kuneerat Nartprayut, 115

Lale Olcay, 88,336

Leylagül Kaynar, 204

Li Geng, 311

Li Pei, 409

Li Wei, 409

LiLi Zhou, 422

Ling Sun, 263

Liu Zi, 409

M. Bayram Bashırov, 379

M. Kemal Özbilgin, 371

M. Yavuz Köker, 341

Macoura Gadji, 32

Magda Zidan, 129

Mahmut Yaşar Çeliker, 307

Manal A.shams Eldin El Telbany,

300

Manisha Madkaikar, 371

Maya Gupta, 366

Mehmet Aşık, 209

Mehmet Sönmez, 351

Mehmet Turgut, 351

Mehran Karimi, 214

Mehtap Evran, 221

Melda Cömert, 234,351

Melek Akar, 63

Melek Ergin, 315

Meliha Nalçacı, 8

Meltem Bay, 219

Meltem Gülşan, 144

Meltem Olga Akay, 157,351

Meral Günaldı, 83,413


Meral Türker, 58

Meriç Kaymak Cihan, 88

Mert Küçük, 269

Mervan Bekdaş, 426

Merve Pamukcuoğlu, 81

Meryem Qachouh, 340

Mesut Akyol, 13

Methichit Chayosumrit, 115

Miklós Illyes, 379

Mila Tempel, 307

Mine Gültürk, 351

Mohamed Amine Bekadja, 53

Mohamed Brahimi, 53

Mohammad Kazemi, 157

Mohammad Reza Aliparasti, 137

Mohammadreza Sharifi, 157

Moneer M. Manar, 359

Mouna Lamchahab, 340

Moussa Seck, 32

Muhterem Bahçe, 13

Murat Beyzadeoğlu, 256

Murat Törüner, 219

Mustafa Balal, 315

Mustafa Bozkurt, 405

Mustafa Çakar, 333

Mustafa Çetin, 204

Mustafa Karagülle, 157

Mustafa Kır, 290

Mustafa Nuri Yenere, 351

Mustafa Pehlivan, 351

Mustafa Şenol Tüzüm, 177

Mutea A. Iskander, 300

Muzaffer Demir, 48,351

Mükerrem Safalı, 256

Naci Çine, 122

Nalan Akyürek, 81

Namik Özbek, 144,230

Nazan Sarper, 91,168

Neelam Varma, 85

Nejat Akar, 37,233

Neslihan Erçetin, 25

Neşe Öztekin, 420

Neşe Saltoğlu, 321

Nilgün Sayınalp, 328,400

Nilüfer Bayraktar, 144

Nilüfer Üzülmez, 122

Nur Arslan, 72

Nur Soyer, 331

Nuriye Uzuncan, 331

Nükhet Tüzüner, 98,351

Oğuz Akkuş, 379

Onur Çakır, 25

Onur Kırkızlar, 48,351

Oral Nevruz, 13,256

Orçun Dabak, 325

Orhan Gürsel, 325

Osman Başpınar, 283

Osman Gökhan Demir, 405

Osman İ. Özcebe, 400

Osman İlhan, 219,351

Osman Özcebe, 328

Ömer Doğru, 191

Özlem Şahin Balçık, 67

Özlem Tüfekçi, 290

Pakize Karakaya, 290

Pakpoom Kheolamai, 115

Pınar Gençpınar, 72

Ping Chong Bee, 76

Prateek Bhatia, 85

Qing Li, 311

Qiutang Zhang, 263

R. Simin Ada, 216

Rasoul Salehi, 157

Reşat Özaras, 321

Reyhan Bayrak, 67

Reyhan Diz- Küçükkaya, 8,405

Reza Khalili Dizaji, 137

Rim S. Ishak, 184

S. Jayaranee, 76

Saadettin Kılıçkap, 420

Sadi Bener, 198,275

Sadia Sultan, 163

Said Benchekroun, 340

Saime Paydaş, 315

Sakine Türkmen, 223

Salih Aksu, 328,400

Salih Kozan, 13

Saliou Diop, 32

Samer Ghosn, 184

Samim Özen, 25

Sawsan Bakhubaira, 394

Seçil Arslansoyu Çamlar, 72

Seda Eren, 122

Selami Koçak Toprak, 219,338,371

Selami Koçak Toprak, 219

Selda Kahraman, 351

Selin Berk, 98

Selma Ünal, 25

Sema Aylan Gelen, 168

Semra Paydaş, 83,221,315,351,413

Serap Emre, 72

Serdar Erturan, 435

Serdar Şıvgın, 204

Serdar Ümit Sarıcı, 325

Serhan Küpeli, 191

Seval Akpınar, 48,351

Seven Uludokumacı, 321

Sevgi Gözdaşoğlu, 96

Sevil Bilir Göksügür, 426

Shengmei Chen, 263

Shohreh Almasi, 137

Shreekant Bharti, 85

Sibel Bilgili, 331

Sibel Erdamar, 98

Sibel Kınık, 336

Sirikul Manochantr, 115

Sonay Güven Karataş, 67

Soufi Osmani, 53

Soumaya Anoun, 340

Stefan O. Ciurea, 342

Su Long, 409

Suar Çakı Kılıç, 168

Suat Ali Doğan, 341

Surapol Issaragrisil, 115

Suzan Zorludemir, 413

Süleyman Yazar, 204

Sümer Sütçüoğlu, 58

Syed Mohammad Irfan, 163

Şebnem Yılmaz, 290

Şefik Güran, 13

Şeniz Öngören, 351

Şerafettin Demir, 379


Şinasi Özsoylu,

93,94,95,194,225,226,227,228

Şükran Erten, 416

Tandakha Dieye, 32

Tao Li, 263

Tao Sui, 311

Tarif H. Sallam, 300

Tay Za Kyaw, 76

Tayfun İde, 256

Teoman Soysal, 98,211,321,435

Timuçin Baykul, 177

Timur Selçuk Akpınar, 8

Tuğba Aktan Köşker, 416

Tuğba Doğruluk Paksoy, 275

Tülay Kavaklı, 40

Tünzale Bayramoğlu, 379

Türkan Patıroğlu, 232

Uğur Dilmen, 63

Ulaş D. Bayraktar, 342

Ümit Akyıldız, 67

Vehbi Erçolak, 83,413

Veysel Haksöyler, 83

Veysel Sabri Hançer, 8

Wei Liu, 433

XiaoWei Xu, 422

Xinnv Xu, 311

Xue-Feng Sun, 433

Yahya Büyükaşık, 328,400

Yakup Aksoy, 333,431

YaMin Wang, 422

Yanfang Liu, 263

Yang Lei, 409

Yaowalak U-pratya, 115

Yasin Yıldırım, 219

Yelda Morgül, 198

Yeşim Aydınok, 91

Yeşim S. Karadağ, 420

Yıldız Aydın, 420

Yousof Gheisari, 157

Yuming Li, 311

Yurdanur Kılınç, 91

Yusuf Emrah Eyi, 333,431

Zafer Başlar, 351

Zaher K. Otrock, 184

Zekai Avcı, 144,230,418

Zeynep İlkay, 122

Zeynep Karakaş, 91

Zhongxing Jiang, 263

Zohreh Sanaat, 137

2013-4

Erfolgreiche ePaper selbst erstellen

Template löschen?

Als Template speichern?