Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ... Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
262Ergebnisse der Mutationszüchtung: "….due to the fact that: (a) "many programmes failed ... to produce anythinguseful”, (b) "almost all mutants distinguish themselves by negative selection values”, (c) "all kinds of mutations are evenmore frequently lethal and more strongly diminishing vitality and fertility in animals”, (d) the overall results "have beenrather meager in relation to the efforts expended”, (e) "in spite of an enormous financial expenditure... [mutation breeding]widely proved to be a failure”, (f) "the objective of practical plant breeding ... could not be realized” neither by "macromutations”nor by "micro-mutations”, (g) none of the modifying measures applied could help fulfilling "the ultimate hopeof obtaining more of the 'better' mutants”, - the overall result was that these strong anticipations concerning a revolutionin plant breeding, accompanied by an intense euphoria especially among geneticists and agronomical scientists after theSecond World War, ended up in a worldwide failure and breakdown of mutation breeding as an autonomousbranch of breeding research in the 1980s at the latest in most Western countries.” Details unter:http://www.weloennig.de/Loennig-Long-Version-of-Law-of-Recurrent-Variation.pdf. Die oben wiedergegebenen Abbildungen lassenvielleicht ahnen, warum die Mutationszüchtung bei Zierpflanzen etwas mehr Erfolg hatte als bei den Nutzpflanzen.
263Lebende Fossilien: Beim Studium der unterschiedlichsten Organismen stößt man immer wieder aufeine von der Evolutionstheorie völlig unerwarteten Konstanz der Formen in Zeit und Raum: Das trifftsowohl auf die hier mutationsgenetisch untersuchte 'Lampinion-Pflanze' (Physalis mit ca. 28 Mill. Jahren)als auch auf die Langhalsgiraffe (mit mindestens 12 Mill. Jahren) zu. Zur Evolutions-Problematik denlebenden Fossilien generell vgl. weiter den Beitrag http://www.weloennig.de/mendel20.htm. LebendeFossilien selbst bei den karnivoren Pflanzen siehe http://www.weloennig.de/Utricularia2010.pdf , pp. 68-70,speziell die ergänzende ausführliche Fußnote mit den Zitaten nach Mayr, Stanley, Gould, Simpson,Eldredge, Prothero und Kemp zum paläontologisch abrupten Auftreten und der Konstanz der Formengenerell pp. 68/69. Siehe auch die Dokumentation unter http://www.weloennig.de/AesIV5.SysDis.html.
- Seite 212 und 213: 212Und wie steht es mit den Füchse
- Seite 214 und 215: 214Arten, etwa aus der Gattung Pygo
- Seite 216 und 217: 21616. Hypertrophien und Hyperplasi
- Seite 218 und 219: 218Inwiefern sind nun alle diese Be
- Seite 220 und 221: 220Selektion arbeitenden Neodarwini
- Seite 222 und 223: 222Simon Conway Morris geht nach Hi
- Seite 224 und 225: 224"Mutations, in summary, tend to
- Seite 226 und 227: 226Aktivierung über Stress, UV-Lic
- Seite 228 und 229: 228Überdies: "It is hypothesized t
- Seite 230 und 231: 230ersten Hinweise auf eventuelle F
- Seite 232 und 233: 232single (usually linear) lesion t
- Seite 234 und 235: 234Nach dem derzeitigen Wissensstan
- Seite 236 und 237: 236updated 10/31/2012) 34 Beispiele
- Seite 238 und 239: 238TGTATGCAGGCATCCTCAGCTACGGGGTGGGC
- Seite 240 und 241: 240Für die Proteine der isoforms 1
- Seite 242 und 243: 242Wenn hingegen rund ein Viertel a
- Seite 244 und 245: 244FRS2, fibroblast growth factor r
- Seite 246 und 247: 246zusätzlicher funktional-spezifi
- Seite 248 und 249: 24819. Gesetz der rekurrenten Varia
- Seite 250 und 251: 250Karakulschafe beschrieb. […] B
- Seite 252 und 253: 252Die Gründe, warum es sich nur u
- Seite 254 und 255: 25421. Beispiel aus dem Pflanzenrei
- Seite 256 und 257: 256Dogs. 473 In diesem Falle wirkt
- Seite 258 und 259: 258Wiederum Variation durch Verlust
- Seite 260 und 261: 260Das oben zitierte Wort von Eberh
- Seite 264 und 265: 264Oben: Schlussbemerkungen zum Vor
- Seite 266 und 267: 26622. Stammbäume und Grundtypen (
- Seite 268 und 269: 268erscheinen - zu den dünnen durc
- Seite 270 und 271: 270between the earliest progenitors
- Seite 272 und 273: 272In der deutschsprachigen Wikiped
- Seite 274 und 275: 274Wenn Cimolestes nicht zu den Pla
- Seite 276 und 277: 276than once (in fact, it is also p
- Seite 278 und 279: 278Wiederholen und vergleichen wir
- Seite 280 und 281: 280Auffassungen dazu, samt dem ehrl
- Seite 282 und 283: 282unter ganz ähnlichen Bedingunge
- Seite 284 und 285: 284shape of the brain (Weidenreich,
- Seite 286 und 287: 286Die schon oben zitierte Aussage
- Seite 288 und 289: vor 536288und wird auf alle nur mö
- Seite 290 und 291: 290Als "medical Definition of PRIMI
- Seite 292 und 293: 292M1 (Unterkiefer) (kein "true pai
- Seite 294 und 295: 294Jahre früher auf als der angeno
- Seite 296 und 297: 296Man fragt sich jedoch, wie es m
- Seite 298 und 299: 298im Sinne des Gradualismus als re
- Seite 300 und 301: were mistaken for natural laws.”
- Seite 302 und 303: 3025(4):346-359 (2003). This study
- Seite 304 und 305: 304Zurück zur Frage der Entstehung
- Seite 306 und 307: 306Die Autoren behaupten sodann, da
- Seite 308 und 309: 308Oben lasen wir noch nach Wang un
- Seite 310 und 311: 310Nigel E. A. Crompton hat zur Gru
262Ergebnisse der Mutationszüchtung: "….due to the fact that: (a) "many programmes failed ... to produce anythinguseful”, (b) "almost all mutants distinguish themselves by negative selection values”, (c) "all kinds of mutations are evenmore frequently lethal and more strongly d<strong>im</strong>inishing vitality and fertility in an<strong>im</strong>als”, (d) the overall results "have beenrather meager in relation to the efforts expended”, (e) "in spite of an enormous financial expenditure... [mutation breeding]widely proved to be a failure”, (f) "the objective of practical plant breeding ... could not be realized” neither by "macromutations”nor by "micro-mutations”, (g) none of the modifying measures applied could help fulfilling "the ult<strong>im</strong>ate hopeof obtaining more of the 'better' mutants”, - the overall result was that these strong anticipations concerning a revolutionin plant breeding, accompanied by an intense euphoria especially among geneticists and agronomical scientists after theSecond World War, ended up in a worldwide failure and breakdown of mutation breeding as an autonomousbranch of breeding research in the 1980s at the latest in most Western countries.” Details unter:http://www.weloennig.de/Loennig-Long-Version-of-Law-of-Recurrent-Variation.pdf. Die oben wiedergegebenen Abbildungen lassenvielleicht ahnen, warum die Mutationszüchtung bei Zierpflanzen etwas mehr Erfolg hatte als bei den Nutzpflanzen.
Change language