Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ... Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
232single (usually linear) lesion to widespread and systematized involvement. They may be present at birth or develop early duringchildhood. Ref.58Defects in FGFR3 are a cause of Muenke syndrome (MNKS) [MIM:602849]; also known as Muenke non-syndromic coronalcraniosynostosis. MNKS is a condition characterized by premature closure of coronal suture of skull during development (coronalcraniosynostosis), which affects the shape of the head and face. It may be uni- or bilateral. When bilateral, it is characterized by a skullwith a small antero-posterior diameter (brachycephaly), often with a decrease in the depth of the orbits and hypoplasia of themaxillae. Unilateral closure of the coronal sutures leads to flattening of the orbit on the involved side (plagiocephaly). The intellect isnormal. In addition to coronal craniosynostosis some affected individuals show skeletal abnormalities of hands and feet, sensorineuralhearing loss, mental retardation and respiratory insufficiency. Ref.39 Ref.47 Ref.51Defects in FGFR3 are a cause of keratosis seborrheic (KERSEB) [MIM:182000]. A common benign skin tumor. Seborrheickeratoses usually begin with the appearance of one or more sharply defined, light brown, flat macules. The lesions may be sparse ornumerous. As they initially grow, they develop a velvety to finely verrucous surface, followed by an uneven warty surface withmultiple plugged follicles and a dull or lackluster appearance. Ref.56Defects in FGFR3 may be a cause of testicular germ cell tumor (TGCT) [MIM:273300]. A common solid malignancy in males.Germ cell tumors of the testis constitute 95% of all testicular neoplasms. Ref.62."Unter http://www.uniprot.org/uniprot/P22607#section_comments findet der daran interessierteLeser viele weitere Daten und Kommentare samt References (und zur Zeit 115papers in http://rcgdb.bioinf.uni-sb.de/MutomeWeb/PublicationList?gene=2261) zu FGFR3 beimMenschen (u. a. zu Themen wie Tissue specificity, Subcellular location, Domain,Post-translational modification und Ontologies). Aufschlussreich für unsereFragestellung ist auch die Liste der Natural variants mit Folgen. MalaCards (TheHuman Malady Compendium) führt zur Zeit (7. 1. 2013) 138 maladies auf(http://www.malacards.org/search/by_symbol/FGFR3).Die RCGDB-Site 422 hat zur Frage der Verteilung der Mutationen in FGFR3folgende Abbildung bereitgestellt:Wenn wir zunächst einmal die silent mutations (germline und somatic)unberücksichtigt lassen, so fällt der Kontrast zwischen den relativ wenigen in derAbb. aufgeführten germline missense mutations und den vielen somatic missense,deletion, insertion und nonsense mutations auf.Mögliche Gründe: Zum einen scheinen in der Abbildung (gemäß den zuvoraufgeführten defects mit Quellenangaben und den Abbildungen unten) noch nicht allegermline mutations berücksichtigt worden zu sein (einige sind vielleicht auch nochnicht sequenziert) und zum anderen – und das ist ein ganz entscheidender Punkt –422 RCGDB, The Roche Cancer Genome: http://rcgdb.bioinf.uni-sb.de/MutomeWeb/ (23. 12. 2012)
233werden die meisten somatic mutations (die ohnehin schon als solche, wennunrepariert und/oder ohne medizinische Behandlung, oft genug mit lebensbedrohlichenKonsequenzen verbunden sind) als germline mutations letal sein, d. h. die Entwicklungdes Embryos oder in seltenen Fällen auch des Fetus 423 wird frühzeitig abgebrochen(Definition zur embryonic lethal mutation: "A heritable or somatic mutation in a genomicDNA sequence that causes the death of a eukaryotic organism at the embryonic stage ofdevelopment. Embryonic lethal mutants result in phenotypes that do not allow life to besustained" 424 ) – falls überhaupt eine Entwicklung eingeleitet wird.Zu den silent mutations seien folgende Punkte erwähnt:"Silent mutations are mutations that do not result in a change to the amino acid sequence of a protein, unless thechanged amino acid is sufficiently similar to the original. They may occur in a region that does not code for a protein,or they may occur within a codon in a manner that does not alter the final amino acid sequence. The phrase silentmutation is often used interchangeably with the phrase synonymous mutation; however, synonymous mutations are asubcategory of the former, occurring only within exons (and necessarily exactly preserving the amino acid sequenceof the protein)." 425Oder ganz kurz: "silent mutation, an alteration in a DNA sequence that does not resultin an amino acid change in a polypeptide. (Mosby's Medical Dictionary, 8th edition. ©2009, Elsevier.) 426In Ausnahmefällen können jedoch nach Chamary und Hurst selbst noch solche silentmutations die Gesundheit beeinträchtigen. Die Autoren bemerken in ihrem Beitrag (2009): Howtrivial DNA changes can hurt health (preview):"Biologists long thought they understood how genetic mutations cause disease. But recent work has revealed animportant twist in the tale and uncovered surprising – even counterintuitive – ways that alterations in DNA can makepeople sick. The classic view assumed that what are termed "silent” mutations were inconsequential to health, becausesuch changes in DNA would not alter the composition of the proteins encoded by genes. Proteins function in virtuallyevery process carried out by cells, from catalyzing biochemical reactions to recognizing foreign invaders. Hence, thethinking went, if a protein's makeup ends up being correct, any small glitches in the process leading to its constructioncould not do a body harm.Yet detective work occasionally traced a disorder to a silent mutation, even though researchers presumed that itcould not possibly be the culprit. Similar mysteries popped up in studies of genome evolution, where patterns ofchanges in the DNA of various species indicated that many silent mutations were preserved over time – a sign that theywere useful to the organisms possessing them. In many species, these changes seemed to help cells make proteins moreefficiently, but not in people." 427Da meines Wissens noch kaum etwas oder gar nichts zu solchen Ausnahmefällen für dasFGFR3 Gen bekannt ist, wollen wir die silent mutations nach dem gegenwärtigen Wissensstandhier weiter vernachlässigen.Die entscheidende Frage zur Entstehung der Genkaskaden und Gennetzwerke (Zufalloder Design?) ist also zunächst: Wie hoch ist der Prozentsatz der für die Gesundheit desMenschen und weiterer Spezies noch einigermaßen tolerierbaren Aminosäurerest-Substitutionen des FGFR3 Proteins (einzeln und kombiniert)? Und genau welcheSubstitutionen sind nachweislich tragbar? Im Folgenden konzentrieren wir uns dabeizumeist auf den Menschen, da hier bisher die meisten und gründlichstenUntersuchungen vorliegen.423 "Lethal fetal abnormalities are uncommen;” A C G Breeze, C C Lees, A Kumar, H H Missfelder-Lobos, and E M Murdoch (2007): Palliativecare for prenatally diagnosed lethal fetal abnormality. Archives of Disease in Childhood: Fetal & Neonatal 92:F56-F58.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675307/424 http://bioportal.bioontology.org/ontologies/47638/?p=terms&conceptid=Embryonic_Lethal_Mutation_Abnormality (26.12.2012)425 http://en.wikipedia.org/wiki/Mutation (26. 12. 2012)426 http://medical-dictionary.thefreedictionary.com/silent+mutation (26. 12. 2012; dort eine gnze Serie weiterer kurzer präziser Definitionen derverschiedenen Klassen von Mutationen)427 http://www.scientificamerican.com/article.cfm?id=the-price-of-silent-mutations (26. 12. 2012; Die Aussage "In many species, these changesseemed to help cells make proteins more efficiently, but not in people” erscheint widersprüchlich. Es wäre genauer zu untersuchen, ob inunterschiedlichen Spezies tatsächlich solche silent mutations völlig unterschiedlich effektiv die Proteinsynthese beeinflussen. "Preserved overtime" ist jedenfalls keine ausreichende Begründung. Der Verlust der Fähigkeit zur Vitamin C (Ascorbinsäure-)Synthese bei mehrerenOrganismen ist auch "preserved over time" – aber dennoch keine positive Mutation.
- Seite 182 und 183: 182Worauf der Staffordshire Bull Te
- Seite 184 und 185: 184einmal das Paper von Fernando Cr
- Seite 186 und 187: 186AMY2B copy numbers.”Dazu passt
- Seite 188 und 189: 188auch wiederholt innerhalb unters
- Seite 190 und 191: 190Dieser Punkt scheint mir für di
- Seite 192 und 193: 192Zur Frage Human Similarity werde
- Seite 194 und 195: 194Es wird wohl niemand die geringf
- Seite 196 und 197: 196untersuchten relativ kleinen Anz
- Seite 198 und 199: 198421 ATCCAGATCTACCTCTCTATTCTGTCCC
- Seite 200 und 201: 2001861 GAAGAGGAGGAAGCTATGAAGCTGAAG
- Seite 202 und 203: 202mosquitoes, termites and gnats.
- Seite 204 und 205: 204Der Umbau in MGAM und SGLT1 betr
- Seite 206 und 207: 206breed by authorities, although t
- Seite 208 und 209: 208Diese positive Korrelation schei
- Seite 210 und 211: 210kann in doppelter Weise experime
- Seite 212 und 213: 212Und wie steht es mit den Füchse
- Seite 214 und 215: 214Arten, etwa aus der Gattung Pygo
- Seite 216 und 217: 21616. Hypertrophien und Hyperplasi
- Seite 218 und 219: 218Inwiefern sind nun alle diese Be
- Seite 220 und 221: 220Selektion arbeitenden Neodarwini
- Seite 222 und 223: 222Simon Conway Morris geht nach Hi
- Seite 224 und 225: 224"Mutations, in summary, tend to
- Seite 226 und 227: 226Aktivierung über Stress, UV-Lic
- Seite 228 und 229: 228Überdies: "It is hypothesized t
- Seite 230 und 231: 230ersten Hinweise auf eventuelle F
- Seite 234 und 235: 234Nach dem derzeitigen Wissensstan
- Seite 236 und 237: 236updated 10/31/2012) 34 Beispiele
- Seite 238 und 239: 238TGTATGCAGGCATCCTCAGCTACGGGGTGGGC
- Seite 240 und 241: 240Für die Proteine der isoforms 1
- Seite 242 und 243: 242Wenn hingegen rund ein Viertel a
- Seite 244 und 245: 244FRS2, fibroblast growth factor r
- Seite 246 und 247: 246zusätzlicher funktional-spezifi
- Seite 248 und 249: 24819. Gesetz der rekurrenten Varia
- Seite 250 und 251: 250Karakulschafe beschrieb. […] B
- Seite 252 und 253: 252Die Gründe, warum es sich nur u
- Seite 254 und 255: 25421. Beispiel aus dem Pflanzenrei
- Seite 256 und 257: 256Dogs. 473 In diesem Falle wirkt
- Seite 258 und 259: 258Wiederum Variation durch Verlust
- Seite 260 und 261: 260Das oben zitierte Wort von Eberh
- Seite 262 und 263: 262Ergebnisse der Mutationszüchtun
- Seite 264 und 265: 264Oben: Schlussbemerkungen zum Vor
- Seite 266 und 267: 26622. Stammbäume und Grundtypen (
- Seite 268 und 269: 268erscheinen - zu den dünnen durc
- Seite 270 und 271: 270between the earliest progenitors
- Seite 272 und 273: 272In der deutschsprachigen Wikiped
- Seite 274 und 275: 274Wenn Cimolestes nicht zu den Pla
- Seite 276 und 277: 276than once (in fact, it is also p
- Seite 278 und 279: 278Wiederholen und vergleichen wir
- Seite 280 und 281: 280Auffassungen dazu, samt dem ehrl
233werden die meisten somatic mutations (die ohnehin schon als solche, wennunrepariert und/oder ohne medizinische Behandlung, oft genug mit lebensbedrohlichenKonsequenzen verbunden sind) als germline mutations letal sein, d. h. die Entwicklungdes Embryos oder in seltenen Fällen auch des Fetus 423 wird frühzeitig abgebrochen(Definition zur embryonic lethal mutation: "A heritable or somatic mutation in a genomicDNA sequence that causes the death of a eukaryotic organism at the embryonic stage ofdevelopment. Embryonic lethal mutants result in phenotypes that do not allow life to besustained" 424 ) – falls überhaupt eine Entwicklung eingeleitet wird.Zu den silent mutations seien folgende Punkte erwähnt:"Silent mutations are mutations that do not result in a change to the amino acid sequence of a protein, unless thechanged amino acid is sufficiently s<strong>im</strong>ilar to the original. They may occur in a region that does not code for a protein,or they may occur within a codon in a manner that does not alter the final amino acid sequence. The phrase silentmutation is often used interchangeably with the phrase synonymous mutation; however, synonymous mutations are asubcategory of the former, occurring only within exons (and necessarily exactly preserving the amino acid sequenceof the protein)." 425Oder ganz kurz: "silent mutation, an alteration in a DNA sequence that does not resultin an amino acid change in a polypeptide. (Mosby's Medical Dictionary, 8th edition. ©2009, Elsevier.) 426In Ausnahmefällen können jedoch nach Chamary und Hurst selbst noch solche silentmutations die Gesundheit beeinträchtigen. Die Autoren bemerken in ihrem Beitrag (2009): Howtrivial DNA changes can hurt health (preview):"Biologists long thought they understood how genetic mutations cause disease. But recent work has revealed an<strong>im</strong>portant twist in the tale and uncovered surprising – even counterintuitive – ways that alterations in DNA can makepeople sick. The classic view assumed that what are termed "silent” mutations were inconsequential to health, becausesuch changes in DNA would not alter the composition of the proteins encoded by genes. Proteins function in virtuallyevery process carried out by cells, from catalyzing biochemical reactions to recognizing foreign invaders. Hence, thethinking went, if a protein's makeup ends up being correct, any small glitches in the process leading to its constructioncould not do a body harm.Yet detective work occasionally traced a disorder to a silent mutation, even though researchers presumed that itcould not possibly be the culprit. S<strong>im</strong>ilar mysteries popped up in studies of genome evolution, where patterns ofchanges in the DNA of various species indicated that many silent mutations were preserved over t<strong>im</strong>e – a sign that theywere useful to the organisms possessing them. In many species, these changes seemed to help cells make proteins moreefficiently, but not in people." 427Da meines Wissens noch kaum etwas oder gar nichts zu solchen Ausnahmefällen für dasFGFR3 Gen bekannt ist, wollen wir die silent mutations nach dem gegenwärtigen Wissensstandhier weiter vernachlässigen.Die entscheidende Frage zur Entstehung der Genkaskaden und Gennetzwerke (Zufalloder Design?) ist also zunächst: Wie hoch ist der Prozentsatz der für die Gesundheit desMenschen und weiterer Spezies noch einigermaßen tolerierbaren Aminosäurerest-Substitutionen des FGFR3 Proteins (einzeln und kombiniert)? Und genau welcheSubstitutionen sind nachweislich tragbar? Im Folgenden konzentrieren wir uns dabeizumeist auf den Menschen, da hier bisher die meisten und gründlichstenUntersuchungen vorliegen.423 "Lethal fetal abnormalities are uncommen;” A C G Breeze, C C Lees, A Kumar, H H Missfelder-Lobos, and E M Murdoch (2007): Palliativecare for prenatally diagnosed lethal fetal abnormality. Archives of Disease in Childhood: Fetal & Neonatal 92:F56-F58.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675307/424 http://bioportal.bioontology.org/ontologies/47638/?p=terms&conceptid=Embryonic_Lethal_Mutation_Abnormality (26.12.2012)425 http://en.wikipedia.org/wiki/Mutation (26. 12. 2012)426 http://medical-dictionary.thefreedictionary.com/silent+mutation (26. 12. 2012; dort eine gnze Serie weiterer kurzer präziser Definitionen derverschiedenen Klassen von Mutationen)427 http://www.scientificamerican.com/article.cfm?id=the-price-of-silent-mutations (26. 12. 2012; Die Aussage "In many species, these changesseemed to help cells make proteins more efficiently, but not in people” erscheint widersprüchlich. Es wäre genauer zu untersuchen, ob inunterschiedlichen Spezies tatsächlich solche silent mutations völlig unterschiedlich effektiv die Proteinsynthese beeinflussen. "Preserved overt<strong>im</strong>e" ist jedenfalls keine ausreichende Begründung. Der Verlust der Fähigkeit zur Vitamin C (Ascorbinsäure-)Synthese bei mehrerenOrganismen ist auch "preserved over t<strong>im</strong>e" – aber dennoch keine positive Mutation.
Change language