Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ... Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
176Mit intelligentem Design (ID) liegt die These nahe, dass der Mensch vonvornherein – zumindest schwerpunktmäßig – für eine bestimmte Ernährungsformauch entsprechend genetisch und physiologisch ausgerüstet wurde. Oben wurdeschon erwähnt, dass viele Daten für eine ursprünglich vegetarische Ernährung desHomo sapiens sprechen und wir können Perry et al. zumindest in ihrer Thesefolgen, dass stärkereiche Pflanzenkost einen bedeutenden Anteil daran hatte 306 .Ihre Deutung der positiven Selektion potentieller AMY1-Genamplifikationen istunter dem ID-Ansatz jedoch nicht mehr (und notwendigerweise) die einzigeOption (und das traf nicht einmal unter strikt evolutionstheoretischenVoraussetzungen zu). Vielmehr ist anzunehmen, dass der Mensch von vornhereinmit der optimalen AMY1-Genzahl ausgerüstet gewesen ist, um seineStärkeverdauung bestens zu gewährleisten, – von den vielen anderen obenaufgeführten physiologischen und damit auch gesundheitlichen Vorteilen einmalganz abgesehen.Aber ist gibt vielleicht noch eine dritte Option. Es wurde schon hervorgehoben,dass die Variation der Quantität und die enzymatische Aktivität der Amylasen auchvon zahlreichen Umweltfaktoren abhängig ist. Genannt wurden: (1) individualhydration status, (2) psychosocial stress level, (3) short-term dietary habits, (4)circadian rhythms, und zum Punkt (2) noch etwas deutlicher:"In addition to its function in the context of nutrition, sAA has also turned out to be useful formonitoring sympathetic nervous system activity. Recent studies on humans have found a relationshipbetween intra-individual changes in sAA activity and physical and psychological stress.”Darüber hinaus wurde in einer neuen Studie (18 November Issue of Nature 2012)zu den somatischen CNVs Folgendes festegestellt (gemäß Yale News, ebenfals 18.11. 2012 307 ): Skin cells reveal DNA's genetic mosaic):"We found that humans are made up of a mosaic of cells with different genomes,” said lead author Dr.Flora Vaccarino, the Harris Professor of Child Psychiatry at the Yale Child Study Center. "We saw that 30percent of skin cells harbor copy number variations (CNV), which are segments of DNA that aredeleted or duplicated. Previously it was assumed that these variations only occurred in cases of disease,such as cancer. The mosaic that we've seen in the skin could also be found in the blood, in the brain, and inother parts of the human body.”The longstanding belief has been that our cells have the same DNA sequence and this blueprint governsthe body's functions. The Yale team's research challenges this dogma. Some scientists have hypothesizedthat during development, when DNA is copied from mother to daughter cells, there could be deletions,duplications and changes in the sequence of the DNA, and an entire group of genes could be affected. Thispremise has been incredibly difficult to test, but Vaccarino and colleagues have done so in this new study.The team used whole genome sequencing to study induced pluripotent stem cells lines (iPS), which arestem cells developed from a mature-differentiated cell. The team grew cells taken from the inner upperarms of two families. The team spent two years characterizing these iPS cell lines and comparing them tothe original skin cells.While observing that the genome of iPS cells closely resembles the genome of skin cells from which theyoriginated, the team could identify several deletions or duplications involving thousands of base pairsof DNA. The team then performed additional experiments to understand the origin of those differences, andshowed that at least half of them pre-existed in small fractions of skin cells. These differences wererevealed in iPS cells because each iPS line is derived from one, or very few, skin cells. Vaccarino said theseiPS lines could act as a magnifying glass to see the mosaic of genomic differences in the body's cells."In the skin, this mosaicism is extensive and at least 30 percent of skin cells harbor different deletion306 Wir erinnern uns: "… it is hypothesized that starch rich plant underground storage organs (USOs) were a critical food resource for earlyhominins. Changes in USO consumption may even have facilitated the initial emergence and spread of Homo erectus out of Africa.” -307 http://news.yale.edu/2012/11/18/skin-cells-reveal-dna-s-genetic-mosaic Siehe auch http://med.stanford.edu/ism/2012/november/urban.htmlund http://www.evolutionnews.org/2012/11/your_genome_whi066601.html (Zugriffe am 24. 11. 2012.)
177or duplication of DNA, each found in a small percentage of cells,” said Vaccarino. "The observation ofsomatic mosaicism has far-reaching consequences for genetic analyses, which currently use only bloodsamples. When we look at the blood DNA, it's not exactly reflecting the DNA of other tissues such as thebrain. There could be mutations that we're missing.”Und ein paar Punkte aus dem Abstract des Originalartikels von Abyzov et al. (2012) 308 :"We find that, on average, an iPSC line manifests two copy number variants (CNVs) not apparent in thefibroblasts from which the iPSC was derived. Using PCR and digital droplet PCR, we show that at least50% of those CNVs are present as low-frequency somatic genomic variants in parental fibroblasts (that is,the fibroblasts from which each corresponding human iPSC line is derived), and are manifested in iPSClines owing to their clonal origin. Hence, reprogramming does not necessarily lead to de novo CNVs iniPSCs, because most of the line-manifested CNVs reflect somatic mosaicism in the human skin. […]Overall, we estimate that approximately 30% of the fibroblast cells have somatic CNVs in theirgenomes, suggesting widespread somatic mosaicism in the human body. Our study paves the way tounderstanding the fundamental question of the extent to which cells of the human body normally acquirestructural alterations in their DNA post-zygotically.”Im Falle der Endopolypoidie ist nicht einfach der Zufall für die Verdoppelungganzer Chromosomensätze (natürlich deutlich zu unterscheiden von den CNVs)zuständig, sondern vielmehr Regulationsmechanismen, die solcheVerdopplungen punktgenau steuern. "Beim Menschen kommt Polyploidiephysiologisch in einigen Geweben vor, namentlich in den Zellen derHerzmuskulatur, der Samenblase, des Hypophysenvorderlappens und inEpithelzellen der Leber. Diese Polyploidie entsteht durch Endomitose." 309Wenn nun die Variation der Quantität und der enzymatische Aktivität derAmylasen bei Lebewesen wie Menschen und Bonobos deutlich auch von derUmwelt abhängig sind (wie erwähnt von Faktoren wie (1) individual hydration status, (2) psychosocialstress level, (3) short-term dietary habits, (4) circadian rhythms) sowie vom Alter und Geschlechtund überdies die soeben erwähnte Endopolyploidie nicht dem Zufall überrlassenbleibt und wenn wir zudem die ebenfalls über den Zufall hinausgehendeEpigenetik-Frage miteinbeziehen (siehe oben), dann erhebt sich vielleicht dieFrage – übertragen auf bestimmte Gene des Genoms selbst – , ob und falls ja,inwieweit auch einzelne Copy Number Variations (CNVs) in Anpassung anbestimmte Aufgaben und Umweltsituationen gezielt und gesteuert ablaufenkönnten. 310308 Alexej Abyzov, Jessica Mariani, Dean Palejev, Ying Zhang, Michael Seamus Haney, Livia Tomasini, Anthony F. Ferrandino, Lior A.Rosenberg Belmaker, Anna Szekely, Michael Wilson, Arif Kocabas, Nathaniel E. Calixto, Elena L. Grigorenko, Anita Huttner, KatarzynaChawarska, Sherman Weissman, Alexander Eckehart Urban, Mark Gerstein, and Flora M. Vaccarino (2012): Somatic copy number mosaicism inhuman skin revealed by induced pluripotent stem cells. Nature: http://www.nature.com/nature/journal/vaop/ncurrent/pdf/nature11629.pdf.Weitere Punkte in der Supplementary Dissussion: http://www.nature.com/nature/journal/vaop/ncurrent/extref/nature11629-s1.pdf309 "Bei der Endopolyploidie sind nur einige Gewebe oder Zellen eines Organismus polyploid. Beispiele hierfür sind die Brennhaare derBrennnessel oder die Megakaryozyten des Menschen. Diese polyploiden Zellen entstehen durch Endomitose oder Endoreduplikation. In beidenFällen werden die Chromosomen verdoppelt ohne dass der Zellkern sich anschließend teilt. Sie wird auch als somatische Polyploidie bezeichnet,da sie auf somatische Zellen beschränkt ist und die Keimbahn nicht betrifft. Sie betrifft Zellen mit hohen Stoffwechselleistungen. SpezielleFormen sind die Riesenchromosomen."310 Spätestens seit den 1980er Jahren ist bekannt, dass die Gene nicht like pearls on a string aufgereiht sind (begann in der 60er Jahren). Dillonfasst seine umfangreichen Untersuchumngen zur Existenz und zu den Aktivitäten des "supramolekularen Mechanismus" 1983, pp. 444-446 wiefolgt zusammen (in diesem Kapitel http://www.weloennig.de/AesIV3.Lam.html auch zahlreiche weitere Punkte):In summary, those cellular processes that seem to require the presence of an organized and programmed genetical mechanism outside the genomeproper include the following that have been noted in the second and third volumes of this trilogy:(1) Governing transcription by selecting those genes to be transcribed at a given stage of development or period in circadian or other biorhythmicfunctions; this activity may include supression of one member of a homologous chromosome pair, as the X chromosome of vertebrates.(2) In many cases preparing the genome for transcription by selecting among multiple like genelets and combining them to others to makepregenes and those into genes.(3) Regulating the processing of the precursorial transcripts.(4) Guiding translation of the mature transcriptive products.
- Seite 126 und 127: 126Nachtsheim und Stengel pp. 55 un
- Seite 128 und 129: 128oben erwähnten Vererbung des AG
- Seite 130 und 131: 130Buchbesprechung von Meg Daley Ol
- Seite 132 und 133: 132"However, two independent studie
- Seite 134 und 135: 134Regulation überhaupt erst ermö
- Seite 136 und 137: ig eyes, and floppy ears.136Copping
- Seite 138 und 139: 138cranial development the position
- Seite 140 und 141: 140könnte. Denn eine genaue anatom
- Seite 142 und 143: 142Haare (Hund 246 ): "[…] By 30
- Seite 144 und 145: 144Zu den Letzteren: "Die Augenfarb
- Seite 146 und 147: 146repräsentiert - zumal es sich a
- Seite 148 und 149: 148geschlechtsreif gewordener Prima
- Seite 150 und 151: 150"So beschreibt beispielsweise ei
- Seite 152 und 153: 152Oder: "A DNA sequence, 1000 nucl
- Seite 154 und 155: 154Und im Jahre 1983 begründete Ki
- Seite 156 und 157: 156"Several specific loci have now
- Seite 158 und 159: 158● Tourette-Syndrome 283 : Fern
- Seite 160 und 161: 160D. h. der wesentliche Teil der "
- Seite 162 und 163: 162prior SD experiments [17]. […]
- Seite 164 und 165: 164zwischen den Hunderassen bestät
- Seite 166 und 167: 166nicht nachgewiesen werden könne
- Seite 168 und 169: 168solution, however, blood glucose
- Seite 170 und 171: 170shown to be significantly higher
- Seite 172 und 173: 172word, but rather as an explanato
- Seite 174 und 175: 174Herr Dr. G. von unserem Institut
- Seite 178 und 179: 178Dafür dürfte auch die stark un
- Seite 180 und 181: 180(2007, p. 4) zu einem weniger ho
- Seite 182 und 183: 182Worauf der Staffordshire Bull Te
- Seite 184 und 185: 184einmal das Paper von Fernando Cr
- Seite 186 und 187: 186AMY2B copy numbers.”Dazu passt
- Seite 188 und 189: 188auch wiederholt innerhalb unters
- Seite 190 und 191: 190Dieser Punkt scheint mir für di
- Seite 192 und 193: 192Zur Frage Human Similarity werde
- Seite 194 und 195: 194Es wird wohl niemand die geringf
- Seite 196 und 197: 196untersuchten relativ kleinen Anz
- Seite 198 und 199: 198421 ATCCAGATCTACCTCTCTATTCTGTCCC
- Seite 200 und 201: 2001861 GAAGAGGAGGAAGCTATGAAGCTGAAG
- Seite 202 und 203: 202mosquitoes, termites and gnats.
- Seite 204 und 205: 204Der Umbau in MGAM und SGLT1 betr
- Seite 206 und 207: 206breed by authorities, although t
- Seite 208 und 209: 208Diese positive Korrelation schei
- Seite 210 und 211: 210kann in doppelter Weise experime
- Seite 212 und 213: 212Und wie steht es mit den Füchse
- Seite 214 und 215: 214Arten, etwa aus der Gattung Pygo
- Seite 216 und 217: 21616. Hypertrophien und Hyperplasi
- Seite 218 und 219: 218Inwiefern sind nun alle diese Be
- Seite 220 und 221: 220Selektion arbeitenden Neodarwini
- Seite 222 und 223: 222Simon Conway Morris geht nach Hi
- Seite 224 und 225: 224"Mutations, in summary, tend to
177or duplication of DNA, each found in a small percentage of cells,” said Vaccarino. "The observation ofsomatic mosaicism has far-reaching consequences for genetic analyses, which currently use only bloodsamples. When we look at the blood DNA, it's not exactly reflecting the DNA of other tissues such as thebrain. There could be mutations that we're missing.”Und ein paar Punkte aus dem Abstract des Originalartikels von Abyzov et al. (2012) 308 :"We find that, on average, an iPSC line manifests two copy number variants (CNVs) not apparent in thefibroblasts from which the iPSC was derived. Using PCR and digital droplet PCR, we show that at least50% of those CNVs are present as low-frequency somatic genomic variants in parental fibroblasts (that is,the fibroblasts from which each corresponding human iPSC line is derived), and are manifested in iPSClines owing to their clonal origin. Hence, reprogramming does not necessarily lead to de novo CNVs iniPSCs, because most of the line-manifested CNVs reflect somatic mosaicism in the human skin. […]Overall, we est<strong>im</strong>ate that approx<strong>im</strong>ately 30% of the fibroblast cells have somatic CNVs in theirgenomes, suggesting widespread somatic mosaicism in the human body. Our study paves the way tounderstanding the fundamental question of the extent to which cells of the human body normally acquirestructural alterations in their DNA post-zygotically.”Im Falle der Endopolypoidie ist nicht einfach der Zufall für die Verdoppelungganzer Chromosomensätze (natürlich deutlich zu unterscheiden von den CNVs)zuständig, sondern vielmehr Regulationsmechanismen, die solcheVerdopplungen punktgenau steuern. "Be<strong>im</strong> Menschen kommt Polyploidiephysiologisch in einigen Geweben vor, namentlich in den Zellen derHerzmuskulatur, der Samenblase, des Hypophysenvorderlappens und inEpithelzellen der Leber. Diese Polyploidie entsteht durch Endomitose." 309Wenn nun die Variation der Quantität und der enzymatische Aktivität derAmylasen bei Lebewesen wie Menschen und Bonobos deutlich auch von derUmwelt abhängig sind (wie erwähnt von Faktoren wie (1) individual hydration status, (2) psychosocialstress level, (3) short-term dietary habits, (4) circadian rhythms) sowie vom Alter und Geschlechtund überdies die soeben erwähnte Endopolyploidie nicht dem Zufall überrlassenbleibt und wenn wir zudem die ebenfalls über den Zufall hinausgehendeEpigenetik-Frage miteinbeziehen (siehe oben), dann erhebt sich vielleicht dieFrage – übertragen auf best<strong>im</strong>mte Gene des Genoms selbst – , ob und falls ja,inwieweit auch einzelne Copy Number Variations (CNVs) in Anpassung anbest<strong>im</strong>mte Aufgaben und Umweltsituationen gezielt und gesteuert ablaufenkönnten. 310308 Alexej Abyzov, Jessica Mariani, Dean Palejev, Ying Zhang, Michael Seamus Haney, Livia Tomasini, Anthony F. Ferrandino, Lior A.Rosenberg Belmaker, Anna Szekely, Michael Wilson, Arif Kocabas, Nathaniel E. Calixto, Elena L. Grigorenko, Anita Huttner, KatarzynaChawarska, Sherman Weissman, Alexander Eckehart Urban, Mark Gerstein, and Flora M. Vaccarino (2012): Somatic copy number mosaicism inhuman skin revealed by induced pluripotent stem cells. Nature: http://www.nature.com/nature/journal/vaop/ncurrent/pdf/nature11629.pdf.Weitere Punkte in der Supplementary Dissussion: http://www.nature.com/nature/journal/vaop/ncurrent/extref/nature11629-s1.pdf309 "Bei der Endopolyploidie sind nur einige Gewebe oder Zellen eines Organismus polyploid. Beispiele hierfür sind die Brennhaare derBrennnessel oder die Megakaryozyten des Menschen. Diese polyploiden Zellen entstehen durch Endomitose oder Endoreduplikation. In beidenFällen werden die Chromosomen verdoppelt ohne dass der Zellkern sich anschließend teilt. Sie wird auch als somatische Polyploidie bezeichnet,da sie auf somatische Zellen beschränkt ist und die Ke<strong>im</strong>bahn nicht betrifft. Sie betrifft Zellen mit hohen Stoffwechselleistungen. SpezielleFormen sind die Riesenchromosomen."310 Spätestens seit den 1980er Jahren ist bekannt, dass die Gene nicht like pearls on a string aufgereiht sind (begann in der 60er Jahren). Dillonfasst seine umfangreichen Untersuchumngen zur Existenz und zu den Aktivitäten des "supramolekularen Mechanismus" 1983, pp. 444-446 wiefolgt zusammen (in diesem Kapitel http://www.weloennig.de/AesIV3.Lam.html auch zahlreiche weitere Punkte):In summary, those cellular processes that seem to require the presence of an organized and programmed genetical mechanism outside the genomeproper include the following that have been noted in the second and third volumes of this trilogy:(1) Governing transcription by selecting those genes to be transcribed at a given stage of development or period in circadian or other biorhythmicfunctions; this activity may include supression of one member of a homologous chromosome pair, as the X chromosome of vertebrates.(2) In many cases preparing the genome for transcription by selecting among multiple like genelets and combining them to others to makepregenes and those into genes.(3) Regulating the processing of the precursorial transcripts.(4) Guiding translation of the mature transcriptive products.
Change language