Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ... Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
168solution, however, blood glucose and insulin concentrations did not differ between the groups. Theseobservations are interpreted to suggest that HA individuals may be better adapted to ingest starches,whereas LA individuals may be at greater risk for insulin resistance and diabetes if chronicallyingesting starch-rich diets.” 296Und noch einmal zur Frage nach der Kopienzahl von AMY1 generell: "This geneis typically present as two diploid copies in chimpanzees. Humans average over6 copies and may have as many as 15. This is thought to be an adaptation to ahigh-starch diet that improves the ability to digest starchy foods.” 297Aber auch Umweltfaktoren sollten bei dieser Frage nicht übersehen werden (mit Santos et al.2012 wurden schon hydration status, psychosocial stress level, and short-term dietary habitskurz erwähnt). Ebenso heben Mandel et al. 2010 einige wesentliche Punkte hervor, um dann zurgenetischen Frage überzugehen (Literaturhinweise und Abbildungen dazu in der im Internet direktabrufbaren Originalarbeit) 298 :"Salivary amylase is the most abundant protein in human saliva, accounting for 40 to 50% of salivaryprotein, and has the capacity to rapidly alter the physical properties of starch within the oral cavity. Thequantity and enzymatic activity of salivary amylase, however, show significant variation amongindividuals. This is due to a number of environmental factors, including stress levels, and circadianrhythms. In addition, there is evidence that salivary amylase expression is upregulated by a diet high instarch.Ähnlich bemerken Perry et al. 2007 zu ihrer Abbildung 1 (AMY1 copy number variation andsalivary amylase protein expression.) (p. 8 Author manuscript von 2008):"A considerable amount of variation in AMY1 protein level is not explained by copy number (R2 =0.351), which may reflect other genetic influences on AMY1 expression such as regulatory region singlenucleotide polymorphisms (SNPs) or nongenetic factors that may include individual hydration status,stress level, and short-term dietary habits.”Weitere Punkte (ausführlich) zum Einfluss von Umweltfaktoren zur Amylase-Produktionspeziell bei Bonobos siehe Behringer et al. (2012): Stress affects salivary alpha-Amylase activityin bonobos. Physiology and Behavior 105: 476-482. Aus dem Abstract p. 476:"Salivary alpha-Amylase (sAA) is a starch digesting enzyme. In addition to its function in the context ofnutrition, sAA has also turned out to be useful for monitoring sympathetic nervous system activity. Recentstudies on humans have found a relationship between intra-individual changes in sAA activity andphysical and psychological stress.” […] sAA activity [in bonobos] was significantly higher in samplescollected at times when subjects had been exposed to stressors (judged by changes in behavioral patternsand cortisol levels) than in samples collected at other times.”Mandel et al. (2010) fahren im Anschluss an das obige Zitat aus ihrer Arbeit jetztzur genetischen Frage wie folgt fort:"Genetically, salivary amylase levels are influenced by individual copy number variation (CNVs) of theAMY1 gene on chromosome 1p21, which codes for salivary amylase. The AMY1 gene is one of the mostvariable CNV loci in the human genome, with a reported range of anywhere from 2 to 15 diploid copies.Importantly, oral salivary amylase concentrations positively correlate with the number of copies of theAMY1 gene.Genetic variation in AMY1 appears to have evolved independently in diverse populations across theglobe.[…] AMY1 Gene Copy Number and Salivary AmylaseDNA samples were collected from 62 subjects and analyzed by qPCR to determine gene copy number.Values were standardized to a human DNA sample with a known AMY1 gene copy number verified by296 Mandel AL, Breslin PA.(2012): High endogenous salivary amylase activity is associated with improved glycemic homeostasis followingstarch ingestion in adults. J Nutr. 142:853-858.297 http://en.wikipedia.org/wiki/Copy-number_variation (Zugriff am 21. 11. 2012)298 Abigail L. Mandel, Catherine Peyrot des Gachons, Kimberly L. Plank, Suzanne Alarcon and Paul A. S. Breslin (2010): Individual Differencesin AMY1 Gene Copy Number, Salivary α-Amylase Levels, and the Perception of Oral Starch.http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0013352
169Fiber FISH. The median number of AMY1 gene copies was four (mean = 4.4±2), with a range of 1 to11 (Table S2 in File S1). Salivary amylase amount/ml and gene copy number were significantly correlated(r = 0.50; P
- Seite 118 und 119: 118pleiotropically linked to genes
- Seite 120 und 121: 120Selbst unter der Voraussetzung d
- Seite 122 und 123: 122kommen flugunfähige Arten vor.
- Seite 124 und 125: 124Die morphological and physiologi
- Seite 126 und 127: 126Nachtsheim und Stengel pp. 55 un
- Seite 128 und 129: 128oben erwähnten Vererbung des AG
- Seite 130 und 131: 130Buchbesprechung von Meg Daley Ol
- Seite 132 und 133: 132"However, two independent studie
- Seite 134 und 135: 134Regulation überhaupt erst ermö
- Seite 136 und 137: ig eyes, and floppy ears.136Copping
- Seite 138 und 139: 138cranial development the position
- Seite 140 und 141: 140könnte. Denn eine genaue anatom
- Seite 142 und 143: 142Haare (Hund 246 ): "[…] By 30
- Seite 144 und 145: 144Zu den Letzteren: "Die Augenfarb
- Seite 146 und 147: 146repräsentiert - zumal es sich a
- Seite 148 und 149: 148geschlechtsreif gewordener Prima
- Seite 150 und 151: 150"So beschreibt beispielsweise ei
- Seite 152 und 153: 152Oder: "A DNA sequence, 1000 nucl
- Seite 154 und 155: 154Und im Jahre 1983 begründete Ki
- Seite 156 und 157: 156"Several specific loci have now
- Seite 158 und 159: 158● Tourette-Syndrome 283 : Fern
- Seite 160 und 161: 160D. h. der wesentliche Teil der "
- Seite 162 und 163: 162prior SD experiments [17]. […]
- Seite 164 und 165: 164zwischen den Hunderassen bestät
- Seite 166 und 167: 166nicht nachgewiesen werden könne
- Seite 170 und 171: 170shown to be significantly higher
- Seite 172 und 173: 172word, but rather as an explanato
- Seite 174 und 175: 174Herr Dr. G. von unserem Institut
- Seite 176 und 177: 176Mit intelligentem Design (ID) li
- Seite 178 und 179: 178Dafür dürfte auch die stark un
- Seite 180 und 181: 180(2007, p. 4) zu einem weniger ho
- Seite 182 und 183: 182Worauf der Staffordshire Bull Te
- Seite 184 und 185: 184einmal das Paper von Fernando Cr
- Seite 186 und 187: 186AMY2B copy numbers.”Dazu passt
- Seite 188 und 189: 188auch wiederholt innerhalb unters
- Seite 190 und 191: 190Dieser Punkt scheint mir für di
- Seite 192 und 193: 192Zur Frage Human Similarity werde
- Seite 194 und 195: 194Es wird wohl niemand die geringf
- Seite 196 und 197: 196untersuchten relativ kleinen Anz
- Seite 198 und 199: 198421 ATCCAGATCTACCTCTCTATTCTGTCCC
- Seite 200 und 201: 2001861 GAAGAGGAGGAAGCTATGAAGCTGAAG
- Seite 202 und 203: 202mosquitoes, termites and gnats.
- Seite 204 und 205: 204Der Umbau in MGAM und SGLT1 betr
- Seite 206 und 207: 206breed by authorities, although t
- Seite 208 und 209: 208Diese positive Korrelation schei
- Seite 210 und 211: 210kann in doppelter Weise experime
- Seite 212 und 213: 212Und wie steht es mit den Füchse
- Seite 214 und 215: 214Arten, etwa aus der Gattung Pygo
- Seite 216 und 217: 21616. Hypertrophien und Hyperplasi
169Fiber FISH. The median number of AMY1 gene copies was four (mean = 4.4±2), with a range of 1 to11 (Table S2 in File S1). Salivary amylase amount/ml and gene copy number were significantly correlated(r = 0.50; P