Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ... Unser Haushund: Eine Spitzmaus im Wolfspelz? - Wolf-Ekkehard ...
164zwischen den Hunderassen bestätigen die Aussage Trumlers – und selbst das"Rauschen" auf der DNA-Ebene mit ihrer Vielzahl an SNPS und CNVs fügt sichdem Degenerationsthema ein.Und zu Dawkins wiederhole ich with some supplementary remarks andinferences sein Statement wie folgt: "Bear in mind this order of evolutionary change[from Wolf to Chihuahua due to a series of genetic and anatomical dysfunctions], andthen extrapolate backwards twenty thousand times as far into the past. It becomesrather easy to accept that evolution” [and now the correct inference] from a fish intoa human has never happened at all. And all the parallel losses offunctions/deterioration of integration on the genetical and anatomical levels in thefox domestication experiment reinforce this conclusion."Aber ist es denn wirklich so, dass durch die großen Zahlen an Duplikationenüberhaupt keine positiven Veränderungen für den betroffenen Organismus aufallen oder zumindest mehreren Ebenen (siehe oben) hervorgerufen werdenkönnen?" – wird man an dieser Stelle vielleicht einwenden.Sehen wir uns dazu einige als positiv betrachtete Duplikationen etwas näher an.Zunächst bei Bakterien. Erst kürzlich (September 2012) wurde das Paper von Z.D. Blount, J. E. Barrick, C. J. Davidson und R. E. Lenski: Genomic analysis of akey innovation in an experimental Escherichia coli population als bedeutenderBeitrag zum Verständnis von evolutionary novelties u. a. durch Genduplikationengefeiert (Nature 489: 513-518, 27 September 2012 288 ). Hier das Abstract derAutoren:"Evolutionary novelties have been important in the history of life, but their origins are usually difficult toexamine in detail. We previously described the evolution of a novel trait, aerobic citrate utilization(Cit(+)), in an experimental population of Escherichia coli. Here we analyse genome sequences toinvestigate the history and genetic basis of this trait. At least three distinct clades coexisted for more than10,000 generations before its emergence. The Cit(+) trait originated in one clade by a tandemduplication that captured an aerobically expressed promoter for the expression of a previously silentcitrate transporter. The clades varied in their propensity to evolve this novel trait, although genotypesable to do so existed in all three clades, implying that multiple potentiating mutations arose during thepopulation's history. Our findings illustrate the importance of promoter capture and altered gene regulationin mediating the exaptation events that often underlie evolutionary innovations."Michael J. Behe hat am 13. November 2012 zu dieser "evolutionarenInnovation" durch Genduplikationen, promoter capture and altered generegulation einen sehr gut durchdachten Kommentar unter dem Titel Rose-ColouredGlasses, Lenski, Citrate, and Biologos verfasst, aus dem ich im Folgenden einigeHauptpunkte zitieren möchte (zu weiteren Fragen vgl. man den Originalbeitrag). 289"….the Lenski lab observed a mutant strain in their experiments that could metabolize citrate in thepresence of oxygen, which unmutated E. coli cannot do. (Blount et al. 2008) (Importantly, however, thebacterium can metabolize citrate in the absence of oxygen.) This allowed the mutated bacterium tooutcompete its relatives, because the growth medium contained a lot of citrate, as well as oxygen. It wasan intriguing result, and was touted as a major innovation, but at the time Lenski's lab was unable to trackdown at the DNA level the exact mutations that caused the change.Now they have. In a recent publication in Nature (Blount et al. 2012) they report the multiple mutations288 http://www.ncbi.nlm.nih.gov/pubmed/22992527289 Siehe http://www.evolutionnews.org/2012/11/rose-colored_gl066361.html
165that confer and increase the ability to transport citrate in an atmosphere containing oxygen. They divide themutations conceptually into three categories: 1) potentiation; 2) actualization; and 3) refinement. "Actualization"is the name they give to the mutation that first confers a weak ability to transport citrate into the laboratory E.coli. (It turns out that the bacterium is lacking only a protein to transport citrate into the cell in the presence ofoxygen; all other enzymes needed to further metabolize citrate are already present.) The gene for the citratetransporter, citT, that works in the absence of oxygen is directly upstream from the genes for two other proteinsthat have promoters that are active in the presence of oxygen. A duplication of a segment of this regionserendipitously placed the citT gene next to one of these promoters, so the citT gene could then beexpressed in the presence of oxygen. Gene duplication is a type of mutation that is known to be fairly common,so this result, although requiring a great deal of careful research to pin down, is unsurprising.Over time the mutant got better at utilizing citrate, which the authors called "refinement." Further workshowed this was due to multiple duplications of the mutant gene region, up to 3-9 copies. Again, geneduplication is a fairly common process, so again it is unsurprising. In another experiment Lenski and coworkersshowed that increasing the concentration of the citrate transporter gene was sufficient in itself toaccount for the greater ability of E. coli to grow on citrate. No other mutations were needed.A more mysterious part of the whole process is what the group called "potentiation." It turns out that theoriginal E. coli they began with decades ago could not benefit from the gene duplication that broughttogether a citT gene with an oxygen-tolerant promoter. Before it could benefit, a preliminary mutationhad to occur in the bacterium somewhere other than the region containing the citrate-metabolismgenes. Exactly what that mutation was, Lenski and coworkers were not able to determine. However, theyexamined the bacterium for mutations that may contribute to potentiation, and speculated that "A mutationin arcB, which encodes a histidine kinase, is noteworthy because disabling that gene upregulates thetricarboxylic acid cycle." (They tried, but were unable to test this hypothesis.) In other words, the"potentiation" may involve degradation of an unrelated gene.D. h. auch in den Untersuchungen des Lenski-Labors mit Billionen von Bakterienüber mehr als 50.000 Generationen konnten keine (durch Zufallsmutationenentstandenen) neuen funktionalen DNA-Sequenzen (Gene) für die Bildung völligneuer Proteine nachgewiesen werden – wie viel geringer ist dann erst dieAussicht, dass sich durch diesen Mechanimus völlig neue Gene im Zuge derKurzzeit-Domestikation des Grauen Wolfs gebildet hätten!Abschließend stellt Behe in seinem Beitrag fest:"In my own view, in retrospect, the most surprising aspect of the oxygen-tolerant citT mutation was that itproved so difficult to achieve. If, before Lenski's work was done, someone had sketched for me a cartoon ofthe original duplication that produced the metabolic change, I would have assumed that would be sufficient-- that a single step could achieve it. The fact that it was considerably more difficult than that goes toshow that even skeptics like myself overestimate the power of the Darwinian mechanism."Aber immerhin: Durch diese Genduplikationen ist eine metabolische Veränderung(metabolic change) für ein neues environment induziert worden 290 . Das zeigt, dasseine Anpassung an veränderte Umweltbedingungen durch diesen (Zufalls-)Mechanismus möglich zu sein scheint (siehe Einschränkung in der Fußnote) – wennauch erst durch den Einsatz gewaltiger Zahlen von Individuen und Generationen 291 ,die bei Säugetieren sowie bei der Domestikation des Grauen Wolfs [“a few wolves gaveup their freedom in exchange for our garbage”] in wenigen tausend Jahren gar nichtgegeben sind und damit für diese entfällt.Unter der bisher unbewiesenen Voraussetzung, dass vielleicht einige wenigeCNVs mit Genduplikationen beim Hund (und zwar CNVs, die beim Grauen Wolf290 - Eine Umwelt zwar, die – soweit ich das bisher verstehen kann –, so in der Natur so überhaupt nicht existiert und durch einen Prozessüber mehrere Stufen, der ohne die ganz gezielt eingesetzte menschliche Hilfe nie zustande gekommen wäre. Mit anderen Worten: So theyprepared E. coli for a totally artificial environment in which the bacteria will never occur and - even if these surroundings existed in the wild -would never survive inasmuch as several steps with billions of bacteria over thousands of generation would be necessary to cope with that strangehabitat/milieu which would consist of extraordinary amounts of citrate and oxygen. (Auf die Frage "Is their any natural environment where theability to transport citrate in an atmosphere containing oxygen would be useful for E. coli?” Antwortete mir Michael J. Behe am 20. 11. 2012: "Ifthere is such an environment, I haven't heard of it and Lenski hasn't mentioned it. He has taken pains in his papers to say that the inability to usecitrate in the presence of oxygen is a species-defining trait for E. coli.”)291 Insbesondere auch die Zahl der Generationen extrapoliert für die letzten 3 Milliarden Jahre.
- Seite 114 und 115: 114although it recurs in some lines
- Seite 116 und 117: 116were observed outside the limits
- Seite 118 und 119: 118pleiotropically linked to genes
- Seite 120 und 121: 120Selbst unter der Voraussetzung d
- Seite 122 und 123: 122kommen flugunfähige Arten vor.
- Seite 124 und 125: 124Die morphological and physiologi
- Seite 126 und 127: 126Nachtsheim und Stengel pp. 55 un
- Seite 128 und 129: 128oben erwähnten Vererbung des AG
- Seite 130 und 131: 130Buchbesprechung von Meg Daley Ol
- Seite 132 und 133: 132"However, two independent studie
- Seite 134 und 135: 134Regulation überhaupt erst ermö
- Seite 136 und 137: ig eyes, and floppy ears.136Copping
- Seite 138 und 139: 138cranial development the position
- Seite 140 und 141: 140könnte. Denn eine genaue anatom
- Seite 142 und 143: 142Haare (Hund 246 ): "[…] By 30
- Seite 144 und 145: 144Zu den Letzteren: "Die Augenfarb
- Seite 146 und 147: 146repräsentiert - zumal es sich a
- Seite 148 und 149: 148geschlechtsreif gewordener Prima
- Seite 150 und 151: 150"So beschreibt beispielsweise ei
- Seite 152 und 153: 152Oder: "A DNA sequence, 1000 nucl
- Seite 154 und 155: 154Und im Jahre 1983 begründete Ki
- Seite 156 und 157: 156"Several specific loci have now
- Seite 158 und 159: 158● Tourette-Syndrome 283 : Fern
- Seite 160 und 161: 160D. h. der wesentliche Teil der "
- Seite 162 und 163: 162prior SD experiments [17]. […]
- Seite 166 und 167: 166nicht nachgewiesen werden könne
- Seite 168 und 169: 168solution, however, blood glucose
- Seite 170 und 171: 170shown to be significantly higher
- Seite 172 und 173: 172word, but rather as an explanato
- Seite 174 und 175: 174Herr Dr. G. von unserem Institut
- Seite 176 und 177: 176Mit intelligentem Design (ID) li
- Seite 178 und 179: 178Dafür dürfte auch die stark un
- Seite 180 und 181: 180(2007, p. 4) zu einem weniger ho
- Seite 182 und 183: 182Worauf der Staffordshire Bull Te
- Seite 184 und 185: 184einmal das Paper von Fernando Cr
- Seite 186 und 187: 186AMY2B copy numbers.”Dazu passt
- Seite 188 und 189: 188auch wiederholt innerhalb unters
- Seite 190 und 191: 190Dieser Punkt scheint mir für di
- Seite 192 und 193: 192Zur Frage Human Similarity werde
- Seite 194 und 195: 194Es wird wohl niemand die geringf
- Seite 196 und 197: 196untersuchten relativ kleinen Anz
- Seite 198 und 199: 198421 ATCCAGATCTACCTCTCTATTCTGTCCC
- Seite 200 und 201: 2001861 GAAGAGGAGGAAGCTATGAAGCTGAAG
- Seite 202 und 203: 202mosquitoes, termites and gnats.
- Seite 204 und 205: 204Der Umbau in MGAM und SGLT1 betr
- Seite 206 und 207: 206breed by authorities, although t
- Seite 208 und 209: 208Diese positive Korrelation schei
- Seite 210 und 211: 210kann in doppelter Weise experime
- Seite 212 und 213: 212Und wie steht es mit den Füchse
165that confer and increase the ability to transport citrate in an atmosphere containing oxygen. They divide themutations conceptually into three categories: 1) potentiation; 2) actualization; and 3) refinement. "Actualization"is the name they give to the mutation that first confers a weak ability to transport citrate into the laboratory E.coli. (It turns out that the bacterium is lacking only a protein to transport citrate into the cell in the presence ofoxygen; all other enzymes needed to further metabolize citrate are already present.) The gene for the citratetransporter, citT, that works in the absence of oxygen is directly upstream from the genes for two other proteinsthat have promoters that are active in the presence of oxygen. A duplication of a segment of this regionserendipitously placed the citT gene next to one of these promoters, so the citT gene could then beexpressed in the presence of oxygen. Gene duplication is a type of mutation that is known to be fairly common,so this result, although requiring a great deal of careful research to pin down, is unsurprising.Over t<strong>im</strong>e the mutant got better at utilizing citrate, which the authors called "refinement." Further workshowed this was due to multiple duplications of the mutant gene region, up to 3-9 copies. Again, geneduplication is a fairly common process, so again it is unsurprising. In another exper<strong>im</strong>ent Lenski and coworkersshowed that increasing the concentration of the citrate transporter gene was sufficient in itself toaccount for the greater ability of E. coli to grow on citrate. No other mutations were needed.A more mysterious part of the whole process is what the group called "potentiation." It turns out that theoriginal E. coli they began with decades ago could not benefit from the gene duplication that broughttogether a citT gene with an oxygen-tolerant promoter. Before it could benefit, a prel<strong>im</strong>inary mutationhad to occur in the bacterium somewhere other than the region containing the citrate-metabolismgenes. Exactly what that mutation was, Lenski and coworkers were not able to determine. However, theyexamined the bacterium for mutations that may contribute to potentiation, and speculated that "A mutationin arcB, which encodes a histidine kinase, is noteworthy because disabling that gene upregulates thetricarboxylic acid cycle." (They tried, but were unable to test this hypothesis.) In other words, the"potentiation" may involve degradation of an unrelated gene.D. h. auch in den Untersuchungen des Lenski-Labors mit Billionen von Bakterienüber mehr als 50.000 Generationen konnten keine (durch Zufallsmutationenentstandenen) neuen funktionalen DNA-Sequenzen (Gene) für die Bildung völligneuer Proteine nachgewiesen werden – wie viel geringer ist dann erst dieAussicht, dass sich durch diesen Mechan<strong>im</strong>us völlig neue Gene <strong>im</strong> Zuge derKurzzeit-Domestikation des Grauen <strong>Wolf</strong>s gebildet hätten!Abschließend stellt Behe in seinem Beitrag fest:"In my own view, in retrospect, the most surprising aspect of the oxygen-tolerant citT mutation was that itproved so difficult to achieve. If, before Lenski's work was done, someone had sketched for me a cartoon ofthe original duplication that produced the metabolic change, I would have assumed that would be sufficient-- that a single step could achieve it. The fact that it was considerably more difficult than that goes toshow that even skeptics like myself overest<strong>im</strong>ate the power of the Darwinian mechanism."Aber <strong>im</strong>merhin: Durch diese Genduplikationen ist eine metabolische Veränderung(metabolic change) für ein neues environment induziert worden 290 . Das zeigt, dasseine Anpassung an veränderte Umweltbedingungen durch diesen (Zufalls-)Mechanismus möglich zu sein scheint (siehe Einschränkung in der Fußnote) – wennauch erst durch den Einsatz gewaltiger Zahlen von Individuen und Generationen 291 ,die bei Säugetieren sowie bei der Domestikation des Grauen <strong>Wolf</strong>s [“a few wolves gaveup their freedom in exchange for our garbage”] in wenigen tausend Jahren gar nichtgegeben sind und damit für diese entfällt.Unter der bisher unbewiesenen Voraussetzung, dass vielleicht einige wenigeCNVs mit Genduplikationen be<strong>im</strong> Hund (und zwar CNVs, die be<strong>im</strong> Grauen <strong>Wolf</strong>290 - <strong>Eine</strong> Umwelt zwar, die – soweit ich das bisher verstehen kann –, so in der Natur so überhaupt nicht existiert und durch einen Prozessüber mehrere Stufen, der ohne die ganz gezielt eingesetzte menschliche Hilfe nie zustande gekommen wäre. Mit anderen Worten: So theyprepared E. coli for a totally artificial environment in which the bacteria will never occur and - even if these surroundings existed in the wild -would never survive inasmuch as several steps with billions of bacteria over thousands of generation would be necessary to cope with that strangehabitat/milieu which would consist of extraordinary amounts of citrate and oxygen. (Auf die Frage "Is their any natural environment where theability to transport citrate in an atmosphere containing oxygen would be useful for E. coli?” Antwortete mir Michael J. Behe am 20. 11. 2012: "Ifthere is such an environment, I haven't heard of it and Lenski hasn't mentioned it. He has taken pains in his papers to say that the inability to usecitrate in the presence of oxygen is a species-defining trait for E. coli.”)291 Insbesondere auch die Zahl der Generationen extrapoliert für die letzten 3 Milliarden Jahre.