Identifizierung und Charakterisierung von neuen Genen für die ...
Identifizierung und Charakterisierung von neuen Genen für die ... Identifizierung und Charakterisierung von neuen Genen für die ...
- 68 - Für die einzelnen Domänen bestehen folgende Homologien zu bekannten Proteinen: Quelle: ProDom http://prodes.toulouse.inra.fr/ Dom0: Spezifisch für TRIM46, keine Homologie in NCBI-Datenbank außer zu TRIM46 anderer Spezies. Dom1: RING-Domäne. Homologie zu TRIM9. Dom2: RING-Domäne. Spezifisch für TRIM46, keine Homologie in NCBI-Datenbank außer zu TRIM46 anderer Spezies. Dom3: B-Box 1. Homologie zu TRIM36 und TRIM9. Dom4: B-Box 2: Homologie zur ganzen TRIM-Familie = stärkste konservierte Domäne der Familie. Dom5: Spezifisch für TRIM46, keine Homologie in NCBI-Datenbank außer zu TRIM46 anderer Spezies. Dom6: Coiled-Coil-Domäne. Homolog zu TRIM18 (MID1), TRIM36. Dom7a: Fibronectin-Typ III – FN3 -Domäne. Homolog zu TRIM36 und TRIM9. Dom7b: Spezifisch für TRIM46-Isoform1, keine Homologie in NCBI-Datenbank außer zu TRIM46 anderer Spezies. Dom8: SPRY –Domäne. Homolog zu TRIM36. Dom9: SPRY –Domäne. Homolog zu TRIM36. Funktionelle Annotation der Domänen von TRIM46: NCBI-Protein-Blast sowie SMART-EMBL ( http://smart.embl-heidelberg.de ) erkennen die Domänen von TRIM-Isoform1 und –Isoform2 analog: Für die einzelnen Motive gibt es folgende zusammengefasste Hintergrundinformationen in den Datenbanken von NCBI und Smart-EMBL, die hier zitiert werden sollen: RING: “RAD18, RING-finger-containing E3 ubiquitin ligase [Signal transduction mechanisms]”. “E3 ubiquitin-protein ligase activity is intrinsic to the RING domain of c-Cbl and is likely to be a general function of this domain; Various RING fingers exhibit binding activity towards E2 ubiquitinconjugating enzymes (Ubc' s)”. “Quality control of intracellular proteins is essential for cellular homeostasis. Molecular chaperones recognise and contribute to the refolding of misfolded or unfolded proteins, whereas the ubiquitinproteasome system mediates the degradation of such abnormal proteins. Ubiquitin-protein ligases (E3s) determine the substrate specificity for ubiquitylation and have been classified into HECT, U-box and RING-finger families.” “The RING-finger is a specialised type of Zn-finger of 40 to 60 residues that binds two atoms of zinc, and is probably involved in mediating protein-protein interactions.”
- 69 - Bei TRIM46 allerdings schien die RING-BBC1-BBC2-CC-Struktur alleine nicht auszureichen, um Protein-Protein-Interaktionen zu vermitteln, da mit Isoform 1 (cDNA4) im Yeast-Two-Hybrid-Screen keine Protein-Partner gefunden wurden, wohl aber für Isoform 2 (cDNA12, siehe ab Seite 75). “There are two different variants, the C3HC4-type and a C3H2C3-type, which is clearly related despite the different cysteine/histidine pattern. The latter type is sometimes referred to as 'RING-H2 finger'.” “Several 3D-structures for RING-fingers are known. The 3D structure of the zinc ligation system is unique to the RING domain and is referred to as the 'cross-brace' motif. The spacing of the cysteines in such a domain is C-x(2)-C-x(9 to 39)-C-x(1 to 3)-H-x(2 to 3)- C-x(2)-C-x(4 to 48)-C-x(2)-C. Metal ligand pairs one and three co-ordinate to bind one zinc ion, whilst pairs two and four bind the second, as illustrated”. “Note that in the older literature, some RING-fingers are denoted as LIM-domains. The LIM-domain Znfinger is a fundamentally different family, albeit with similar Cys-spacing”. “Diseases involved in mutations with the RING-Domain”: “Zellweger syndrome (Peroxisome Biogenesis Factor 10; PEX10, lethal diseases that are characterized by neuronal, hepatic, and renal abnormalities and severe mental retardation), Adrenoleukodystrophy neonatal, Breast cancer-1 (Breast Cancer 1 Gene; BRCA1); Ovarian cancer; Breast-ovarian cancer; Papillary serous carcinoma of the peritoneum, Prostate cancer.” BBox: “The B-box zinc finger is an around 40 amino acids domain. One or two copies of this motif are generally associated with a ring finger and a coiled coil motif to form the so-called tripartite motif. It is found essentially in transcription factors, ribonucleoproteins and protooncoproteins, but no function is clearly assigned to this domain. It has been shown to be essential but not sufficient to localize the PML protein in a punctate pattern in interphase nuclei . Among the 7 possible ligands for the zinc atom contained in a B-box, only 4 are used and bind one zinc atom in a Cys2-His2 tetrahedral arrangement. The NMR analysis reveals that the B-box structure comprises two beta-strands, two helical turns and three extended loop regions different from any other zinc binding motif.” “Diseases involved in mutations with the BBox-Domain”: “Familial Mediterranean fever (Pyrin / Marenostrin) is an autosomal recessive disorder characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. Amyloidosis with renal failure is a complication and may develop without overt crises”. BBC BBox-C-terminal: “Coiled coil region C-terminal to (some) B-Box domains. It is found in transcription intermediary factor 1-alpha, which associates with DNA-bound estrogen receptors; ring finger protein, a putative transcriptional regulator; and the GTP-binding protein Ard-1.”
- Seite 17 und 18: - 17 - reguliert die Etablierung de
- Seite 19 und 20: - 19 - Neben dem Hippocampus ist di
- Seite 21 und 22: - 21 - Abbildung 17: Das Semaphorin
- Seite 23 und 24: - 23 - Arterien verkleinern sich im
- Seite 25 und 26: - 25 - Abbildung 26: In frühen Sta
- Seite 27 und 28: - 27 - Abbildung 29: Klassifizierun
- Seite 29 und 30: Die TRIM-Proteine treten mit andere
- Seite 31 und 32: - 31 - • TRIM18: alias MID1. Asso
- Seite 33 und 34: Die Hybridisierungen wurden zweifac
- Seite 35 und 36: Zahl der Gene 25 20 15 10 5 0 - 35
- Seite 37 und 38: - 37 - Vorhersage neuer Marker-Gene
- Seite 39 und 40: - 39 - 90 IMAGp998I113134 Hippocamp
- Seite 41 und 42: E 14 - 41 - A B C Abbildung 41: In-
- Seite 43 und 44: E18 E14 Klon 149 - unbekanntes Gen
- Seite 45 und 46: - 45 - Die 3376 bp lange cDNA-Seque
- Seite 47 und 48: E 18 - 47 - M CGL M CGL M CGL A B C
- Seite 49 und 50: E18 E16 E14 - 49 - Positivkontrolle
- Seite 51 und 52: - 51 - Die Sequenz des IMAGE-Klons
- Seite 53 und 54: - 53 - Bestimmung von Splicevariant
- Seite 55 und 56: - 55 - ATGGGACTCTCATCTCACCAGCTGCATA
- Seite 57 und 58: - 57 - Übersicht der 8 Splicevaria
- Seite 59 und 60: Abbildung 53: 1 - 100 bp Marker 2 -
- Seite 61 und 62: - 61 - Haupt-Splicevariante 2 (enth
- Seite 63 und 64: - 63 - Auf der Seite davor sind Sta
- Seite 65 und 66: - 65 - In Übereinstimmung mit der
- Seite 67: - 67 - Die ProDom-Protein-Datenbank
- Seite 71 und 72: - 71 - “Neural Cell Adhesion Mole
- Seite 73 und 74: - 73 - Abbildung 57: Übersicht der
- Seite 75 und 76: - 75 - Suche nach Protein-Interakti
- Seite 77 und 78: - 77 - Die Abweichungen auf Baseneb
- Seite 79 und 80: Y13, Y57 Y18, Y65 Y23 Y153 Y159 Y16
- Seite 81 und 82: - 81 - Verifikation der Protein-Int
- Seite 83 und 84: - 83 - Resultate der GST-Pulldown-E
- Seite 85 und 86: - 85 - λ-Phagen-PCR-Screen Um die
- Seite 87 und 88: Pvu I (2416) Ampicillin Pvu I (4438
- Seite 89 und 90: Acc 65I (26) SmaI (22) ApaI (18) Kp
- Seite 91 und 92: - 91 - Verdaus von 5441 bp in zwei
- Seite 93 und 94: - 93 - Morula-Aggregation von ES-Ze
- Seite 95 und 96: - 95 - 2. Virtueller Northern für
- Seite 97 und 98: ISH - 97 - Abbildung 73: Die Abbild
- Seite 99 und 100: Abbildung 75: In der rechten Abbild
- Seite 101 und 102: cv ia da Abbildung 78: In diesem ho
- Seite 103 und 104: - 103 - Abbildung 82: E12ct Embryo
- Seite 105 und 106: ca na ok ct lca lca lca ct ct co ct
- Seite 107 und 108: le Il caa ia pe Il ila ao caa cav i
- Seite 109 und 110: 3 4 5 6 ia 7 8 9 10 11 12 13 1 2 ao
- Seite 111 und 112: tt Il ma de - 111 - Abbildung 94: I
- Seite 113 und 114: - 113 - TRIM46 im Whole-Mount-Gehir
- Seite 115 und 116: Abbildung 101: Adultes Gehirn von T
- Seite 117 und 118: Cgl Cgl TN GCl HI AMY AMY Pir Abbil
- 69 -<br />
Bei TRIM46 allerdings schien <strong>die</strong> RING-BBC1-BBC2-CC-Struktur alleine nicht auszureichen, um<br />
Protein-Protein-Interaktionen zu vermitteln, da mit Isoform 1 (cDNA4) im Yeast-Two-Hybrid-Screen<br />
keine Protein-Partner gef<strong>und</strong>en wurden, wohl aber <strong>für</strong> Isoform 2 (cDNA12, siehe ab Seite 75).<br />
“There are two different variants, the C3HC4-type and a C3H2C3-type, which is clearly related despite<br />
the different cysteine/histidine pattern. The latter type is sometimes referred to as 'RING-H2 finger'.”<br />
“Several 3D-structures for RING-fingers are<br />
known. The 3D structure of the zinc ligation<br />
system is unique to the RING domain and is<br />
referred to as the 'cross-brace' motif. The<br />
spacing of the cysteines in such a domain is<br />
C-x(2)-C-x(9 to 39)-C-x(1 to 3)-H-x(2 to 3)-<br />
C-x(2)-C-x(4 to 48)-C-x(2)-C. Metal ligand<br />
pairs one and three co-ordinate to bind one<br />
zinc ion, whilst pairs two and four bind the<br />
second, as illustrated”.<br />
“Note that in the older literature, some RING-fingers are denoted as LIM-domains. The LIM-domain Znfinger<br />
is a f<strong>und</strong>amentally different family, albeit with similar Cys-spacing”.<br />
“Diseases involved in mutations with the RING-Domain”:<br />
“Zellweger syndrome (Peroxisome Biogenesis Factor 10; PEX10, lethal diseases that are characterized by<br />
neuronal, hepatic, and renal abnormalities and severe mental retardation), Adrenoleukodystrophy<br />
neonatal, Breast cancer-1 (Breast Cancer 1 Gene; BRCA1); Ovarian cancer; Breast-ovarian cancer;<br />
Papillary serous carcinoma of the peritoneum, Prostate cancer.”<br />
BBox:<br />
“The B-box zinc finger is an aro<strong>und</strong> 40 amino acids domain. One or two copies of this motif are<br />
generally associated with a ring finger and a coiled coil motif to form the so-called tripartite motif. It<br />
is fo<strong>und</strong> essentially in transcription factors, ribonucleoproteins and protooncoproteins, but no<br />
function is clearly assigned to this domain. It has been shown to be essential but not sufficient to<br />
localize the PML protein in a punctate pattern in interphase nuclei . Among the 7 possible ligands for the<br />
zinc atom contained in a B-box, only 4 are used and bind one zinc atom in a Cys2-His2 tetrahedral<br />
arrangement. The NMR analysis reveals that the B-box structure comprises two beta-strands, two helical<br />
turns and three extended loop regions different from any other zinc binding motif.”<br />
“Diseases involved in mutations with the BBox-Domain”:<br />
“Familial Mediterranean fever (Pyrin / Marenostrin) is an autosomal recessive disorder characterized by<br />
recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by<br />
pain. Amyloidosis with renal failure is a complication and may develop without overt crises”.<br />
BBC BBox-C-terminal:<br />
“Coiled coil region C-terminal to (some) B-Box domains.<br />
It is fo<strong>und</strong> in transcription intermediary factor 1-alpha, which associates with DNA-bo<strong>und</strong> estrogen<br />
receptors; ring finger protein, a putative transcriptional regulator; and the GTP-binding protein Ard-1.”