Identifizierung und Charakterisierung von neuen Genen für die ...

Weitere Magazine

Empfehlungen

Info

- 194 - Stone, J. S., J. L. Shang, et al. (2003). "Expression of Prox1 defines regions of the avian otocyst that give rise to sensory or neural cells." J Comp Neurol 460(4): 487-502. Stoykova, A. and P. Gruss (1994). "Roles of Pax-genes in developing and adult brain as suggested by expression patterns." J Neurosci 14(3 Pt 2): 1395-412. Streit, A., A. J. Berliner, et al. (2000). "Initiation of neural induction by FGF signalling before gastrulation." Nature 406(6791): 74-8. Tanahashi, H. and T. Tabira (2000). "Alzheimer's disease-associated presenilin 2 interacts with DRAL, an LIM-domain protein." Hum Mol Genet 9(15): 2281-9. Theil, T., S. Aydin, et al. (2002). "Wnt and Bmp signalling cooperatively regulate graded Emx2 expression in the dorsal telencephalon." Development 129(13): 3045-54. Thomas, K. R. and M. R. Capecchi (1987). "Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells." Cell 51(3): 503-12. Tole, S., G. Goudreau, et al. (2000). "Emx2 is required for growth of the hippocampus but not for hippocampal field specification." J Neurosci 20(7): 2618-25. Tso, J. Y., D. J. Van Den Berg, et al. (1986). "Structure of the gene for Xenopus transcription factor TFIIIA." Nucleic Acids Res 14(5): 2187-200. van der Laan, R., E. J. Uringa, et al. (2004). "Ubiquitin ligase Rad18Sc localizes to the XY body and to other chromosomal regions that are unpaired and transcriptionally silenced during male meiotic prophase." J Cell Sci 117(Pt 21): 5023-33. Velculescu, V. E., L. Zhang, et al. (1995). "Serial analysis of gene expression." Science 270(5235): 484-7. Von Ohlen, T. and J. E. Hooper (1997). "Hedgehog signaling regulates transcription through Gli/Ci binding sites in the wingless enhancer." Mech Dev 68(1-2): 149-56. Walsh, E. S. M. a. C. A. (2001). "Mechanisms of cerebral cortical patterning in mice and humans." Nature Neuroscience 4: 1199-1206. Weber, A., P. Imisch, et al. (2004). "Coamplification of DDX1 correlates with an improved survival probability in children with MYCN-amplified human neuroblastoma." J Clin Oncol 22(13): 2681- 90. Welham, S. J., P. R. Riley, et al. (2005). "Maternal <strong>die</strong>t programs embryonic kidney gene expression." Physiol Genomics 22(1): 48-56. Wilson, K. (1999). The MIT Encyclopedia of The Cognitive Sciences. Cambridge, Massachusetts. Witter, M. P., G. W. Van Hoesen, et al. (1989). "Topographical organization of the entorhinal projection to the dentate gyrus of the monkey." J Neurosci 9(1): 216-28. Yang, D. C., X. Jiang, et al. (2002). "Antisense ferritin oligonucleotides inhibit growth and induce apoptosis in human breast carcinoma cells." Anticancer Res 22(3): 1513-24. Zhang, L., R. S. Maul, et al. (2004). "Expression pattern of the novel gene EG-1 in cancer." Clin Cancer Res 10(10): 3504-8. Zinovieva, R. D., M. K. Duncan, et al. (1996). "Structure and chromosomal localization of the human homeobox gene Prox 1." Genomics 35(3): 517-22.
Publikationen: - 195 - • Yuh-Shin Chang*, Kamal Chowdhury*, Joachim Glaubitz*, Friederike Kirsch*, Victoria Moreno*, Sven Mühlfriedel*, Kay Nieselt-Struwe*, Anastassia Stoykova*, Ahmet Ucar and Peter Gruss (*gleichberechtigte Beiträge, Liste in alphabetischer Reihenfolge): “Large microarray screen for genes with regionalized expression in the developing mouse cerebral cortex”, MPINews, April 2002. • Joachim Glaubitz: “Common pathways in development of vascular and central nervous system: role of a new TRIM gene.”, MPINews, October 2005. • Joachim Glaubitz : “Freier Wille”, Spektrum der Wissenschaft, August 2005, S.7. • Joachim Glaubitz, Kamal Chowdhury, Anastassia Stoykova, Peter Gruss: “Identification of new marker genes for cerebral cortex development by DNA microarray screening and verification with in-situ-hybridizations”, in Vorbereitung zur Veröffentlichung im Journal Mechanisms of Development. • Joachim Glaubitz, Kamal Chowdhury, Anastassia Stoykova, Peter Gruss: ”TRIM46 is specifically expressed in the embryonic and adult central nervous system, the endothel of developing arteries, and several other endothelia”, in Vorbereitung zur Veröffentlichung. • Joachim Glaubitz, Gunnar Dietz, Monika Labes, Nicolaj Kloecker, Regina Ort-Winkelbauer, Mathias Baehr: „Upregulation of Rat Six1 Gene After Optic Nerve Axotomy to Resemble Regeneration Programms of Primitive Organisms”, in Vorbereitung zur Veröffentlichung im Journal Molecular Brain Research.
Seite 1 und 2:
Identifizierung und Charakterisieru
Seite 3 und 4:
Diese Arbeit wurde am Max-Planck-In
Seite 5 und 6:
- 5 - Lunge........................
Seite 7 und 8:
- 7 - Abkürzungen, Begriffsklärun
Seite 9 und 10:
- 9 - Einleitung Ziel dieser Arbeit
Seite 11 und 12:
- 11 - Gehirnentwicklung und Genese
Seite 13 und 14:
- 13 - bleibt im rostralen und late
Seite 15 und 16:
- 15 - Die thalamischen Innervation
Seite 17 und 18:
- 17 - reguliert die Etablierung de
Seite 19 und 20:
- 19 - Neben dem Hippocampus ist di
Seite 21 und 22:
- 21 - Abbildung 17: Das Semaphorin
Seite 23 und 24:
- 23 - Arterien verkleinern sich im
Seite 25 und 26:
- 25 - Abbildung 26: In frühen Sta
Seite 27 und 28:
- 27 - Abbildung 29: Klassifizierun
Seite 29 und 30:
Die TRIM-Proteine treten mit andere
Seite 31 und 32:
- 31 - • TRIM18: alias MID1. Asso
Seite 33 und 34:
Die Hybridisierungen wurden zweifac
Seite 35 und 36:
Zahl der Gene 25 20 15 10 5 0 - 35
Seite 37 und 38:
- 37 - Vorhersage neuer Marker-Gene
Seite 39 und 40:
- 39 - 90 IMAGp998I113134 Hippocamp
Seite 41 und 42:
E 14 - 41 - A B C Abbildung 41: In-
Seite 43 und 44:
E18 E14 Klon 149 - unbekanntes Gen
Seite 45 und 46:
- 45 - Die 3376 bp lange cDNA-Seque
Seite 47 und 48:
E 18 - 47 - M CGL M CGL M CGL A B C
Seite 49 und 50:
E18 E16 E14 - 49 - Positivkontrolle
Seite 51 und 52:
- 51 - Die Sequenz des IMAGE-Klons
Seite 53 und 54:
- 53 - Bestimmung von Splicevariant
Seite 55 und 56:
- 55 - ATGGGACTCTCATCTCACCAGCTGCATA
Seite 57 und 58:
- 57 - Übersicht der 8 Splicevaria
Seite 59 und 60:
Abbildung 53: 1 - 100 bp Marker 2 -
Seite 61 und 62:
- 61 - Haupt-Splicevariante 2 (enth
Seite 63 und 64:
- 63 - Auf der Seite davor sind Sta
Seite 65 und 66:
- 65 - In Übereinstimmung mit der
Seite 67 und 68:
- 67 - Die ProDom-Protein-Datenbank
Seite 69 und 70:
- 69 - Bei TRIM46 allerdings schien
Seite 71 und 72:
- 71 - “Neural Cell Adhesion Mole
Seite 73 und 74:
- 73 - Abbildung 57: Übersicht der
Seite 75 und 76:
- 75 - Suche nach Protein-Interakti
Seite 77 und 78:
- 77 - Die Abweichungen auf Baseneb
Seite 79 und 80:
Y13, Y57 Y18, Y65 Y23 Y153 Y159 Y16
Seite 81 und 82:
- 81 - Verifikation der Protein-Int
Seite 83 und 84:
- 83 - Resultate der GST-Pulldown-E
Seite 85 und 86:
- 85 - λ-Phagen-PCR-Screen Um die
Seite 87 und 88:
Pvu I (2416) Ampicillin Pvu I (4438
Seite 89 und 90:
Acc 65I (26) SmaI (22) ApaI (18) Kp
Seite 91 und 92:
- 91 - Verdaus von 5441 bp in zwei
Seite 93 und 94:
- 93 - Morula-Aggregation von ES-Ze
Seite 95 und 96:
- 95 - 2. Virtueller Northern für
Seite 97 und 98:
ISH - 97 - Abbildung 73: Die Abbild
Seite 99 und 100:
Abbildung 75: In der rechten Abbild
Seite 101 und 102:
cv ia da Abbildung 78: In diesem ho
Seite 103 und 104:
- 103 - Abbildung 82: E12ct Embryo
Seite 105 und 106:
ca na ok ct lca lca lca ct ct co ct
Seite 107 und 108:
le Il caa ia pe Il ila ao caa cav i
Seite 109 und 110:
3 4 5 6 ia 7 8 9 10 11 12 13 1 2 ao
Seite 111 und 112:
tt Il ma de - 111 - Abbildung 94: I
Seite 113 und 114:
- 113 - TRIM46 im Whole-Mount-Gehir
Seite 115 und 116:
Abbildung 101: Adultes Gehirn von T
Seite 117 und 118:
Cgl Cgl TN GCl HI AMY AMY Pir Abbil
Seite 119 und 120:
- 119 - Genaue Lokalisation der TRI
Seite 121 und 122:
- 121 - Zur weiteren Spezifizierung
Seite 123 und 124:
Auge Magen, Duodenum, Pankreas, Dar
Seite 125 und 126:
Niere - 125 - Abbildung 119: (A) Qu
Seite 127 und 128:
Harnblase TRIM46-lacZ gl Prox1 gl T
Seite 129 und 130:
pa Br Abbildung 127: lacZ-Färbung
Seite 131 und 132:
- 131 - lacZ-Färbung in Tumorgeweb
Seite 133 und 134:
Diskussion - 133 - Microarray-Analy
Seite 135 und 136:
- 135 - Publikationen sich damit be
Seite 137 und 138:
- 137 - Klon 103 - Etv5 Das Gen Etv
Seite 139 und 140:
- 139 - Expressionsdaten der ISH re
Seite 141 und 142:
- 141 - Bevor auf die gefundenen In
Seite 143 und 144: - 143 - regulatorische Pfad über d
Seite 145 und 146: - 145 - nachgewiesen. Im Sinne der
Seite 147 und 148: Zusammenfassung - 147 - In dieser A
Seite 149 und 150: Materialien und Methoden Materialie
Seite 151 und 152: SDS-Sammelgel (4%): - 151 - 1,3 ml
Seite 153 und 154: - 153 - Verwendete Plasmide, Marker
Seite 155 und 156: - 155 - Abbildung 146: Expressionsv
Seite 157 und 158: - 157 - >Primer vorwärts zur Besti
Seite 159 und 160: - 159 - AAAAAATGGCTTTCGCTACCTGGAGAG
Seite 161 und 162: Methoden - 161 - Herstellung einer
Seite 163 und 164: - 163 - Das Auftauen erfolgt durch
Seite 165 und 166: Affymetrix-Microarray-Screen - 165
Seite 167 und 168: - 167 - Herstellung der Hybridisier
Seite 169 und 170: DNA-Techniken - 169 - Herstellung e
Seite 171 und 172: - 171 - gemäß den Primern, siehe
Seite 173 und 174: - 173 - PCR Alle PCR-Reaktionen fol
Seite 175 und 176: Agarose-Gelelektrophorese Der aufzu
Seite 177 und 178: - 177 - RNA-Techniken Bei allen Arb
Seite 179 und 180: - 179 - einem entsprechenden Mangel
Seite 181 und 182: - 181 - 8. Das Pellet wurde in 40 m
Seite 183 und 184: tischen Retikulums, aber auch die s
Seite 185 und 186: - 185 - Immunhistochemische Färbun
Seite 187 und 188: - 187 - Protokoll für Cryo-Schnitt
Seite 189 und 190: Anhang - 189 - Literaturverzeichnis
Seite 191 und 192: - 191 - Haase, V. H., J. N. Glickma
Seite 193: - 193 - Myers, M. and M. Forgac (19
Seite 197: Lebenslauf Name: Geburtsdatum: Gebu
Alle anzeigen

Identifizierung und Charakterisierung von neuen Genen für die ...

Sie wollen auch ein ePaper? Erhöhen Sie die Reichweite Ihrer Titel.

Template löschen?

Als Template speichern?